You are on page 1of 4

Journal of Microbiological Methods 75 (2008) 365–368

Contents lists available at ScienceDirect

Journal of Microbiological Methods
j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / j m i c m e t h

Note

Simultaneous detection of six human diarrheal pathogens by using DNA microarray combined with tyramide signal amplification
Dazhi Jin 1, Hongjuan Qi, Suhong Chen, Ting Zeng, Qiqi Liu, Shengqi Wang ⁎
Beijing Institute of Radiation Medicine, No. 27 Taiping road, Beijing, China

A R T I C L E

I N F O

A B S T R A C T
Multiplex PCR and DNA microarray were combined with tyramide signal amplification (TSA) to develop a reliable method suitable for simultaneous detection of six species of human diarrheal pathogens (Yersinia enterocolitica, Shigella spp, Salmonella typhi, Brucella spp, Vibrio cholera and Escherichia coli O157:H7). Meanwhile, our method could distinguish V. cholera serotype O1 from O139, and O157:H7 from O157: nonH7. This assay conferred a specificity of 100% for target pathogens. The limit of detection was 103 °CFU/mL approximately. The results of 98.6% (357/362) clinical specimens and 100% (5/5) mocked double-blind samples were the same to that from conventional assay. Consequently this assay is sensitive and a specific tool suitable for diagnostic detection and surveillance of multiple human pathogens. © 2008 Published by Elsevier B.V.

Article history: Received 21 December 2007 Received in revised form 18 June 2008 Accepted 20 June 2008 Available online 2 July 2008 Keywords: Human diarrheal pathogens Detection DNA microarray Tyramide signal amplification

Diarrhea and enteritis are two major intestinal diseases in clinic, and often lead to clinical complications, such as septicemia, encephalitis and meningitis, etc (Evan, 1998; Fratamico et al., 2005). Recent statistical reports from the Ministry of Health People Public of China have shown that a large portion of incidents related to diarrhea and food poisoning are mainly caused by six species of aforementioned pathogens (Ministry of Health P.R. China, 2006.). Obviously, infection and epidemic of pathogenic bacteria still remains as one of the major threats to human health, and therefore is a severe hygienic problem worldwide so far. Conventional microbiological methods are often limited by the length of time and trivial steps required to complete the assay (Kong et al., 2002). The enzyme-linked immunological protocols (Luk, 1994) and molecular biological assays based on DNA probing (Mooney et al., 1995) or PCR amplification (Gonza'lez et al., 2003; Osorio et al., 2000; Kong et al., 2002; Brasher et al., 1998)had overcome the problems associated with culture-based assays due to their specificity, sensitivity and rapidity. To date, DNA microarray combined with multiplex PCR has been applied widely to detect and identify various genera or species of pathogenic microorganisms (Call et al., 2001; Gonza'lez et al., 2004; Del et al., 2002; Chizhikov et al., 2002; Jin et al., 2006). In this study, we described an assay of the coupled multiplex PCRmicroarray, which employed nine primer sets to detect six species or genus of pathogenic diarrheal microorganisms using a TSA-Cy3 reporting system.

⁎ Corresponding author. Beijing Institute of Radiation Medicine, No. 27 Taiping road, Beijing 100850, China. Tel./fax: +86 10 66932211. E-mail addresses: dazhijin_y@hotmail.com (D. Jin), sqwang@nic.bmi.ac.cn (S. Wang). 1 The author's current institute is Zhejiang Provincial Center for Disease Control and Prevention, Hangzhou, China. Tel./fax: +86 571 87115285. 0167-7012/$ – see front matter © 2008 Published by Elsevier B.V. doi:10.1016/j.mimet.2008.06.020

Strains of bacteria used in this study are listed in Table 1. A total of 92 strains of bacteria from 18 genera or species were obtained from National Institute for the Control of Pharmaceutical and Biological Products of China. The local strains of Vibrio cholera O1 (569B), V. cholera Ogawa, V. cholera O139 and Escherichia coli O157: H7, and some intestinal bacteria strains were provided by Zhejiang Provincial Center for Disease Prevention and Control, China. All these selected strains were cultured for 24–36 h according to the conventional method as described (Evan, 1998; Miliotis, 2003). 362 clinical specimens (anus swabs) were provided by Zhejiang provincial Center for Disease Prevention and Control, China. The pathogens that isolated from clinical specimens were identified by the conventional method and the appropriate API test system (bioMerieux SA, Lyon, France) respectively. Meanwhile, 5 mocked double-blind samples containing Yersinia enterocolitica, Brucella and mixed pathogens were prepared. Genomic DNA of bacteria was extracted by centrifugation, lysate buffer (Triton x-100, NP40) as previously described (Jin et al., 2006). All the primer pairs and probes were designed from the specific genes of target pathogens. The corresponding loci chosen were: ail, ipaH, vipR, BCSP, ctxA, LPSgt, rfbE, fliC, and 16S rDNA was used as an internal control. Eight PCR primer sets and eight internal probes were designed using the Primer 5.0 program (PE Biosystems, Foster City, CA). The reverse primers were labeled with biotin group. All the oligonucleotide probes were attached to an amino-modified group at the 3′ end to allow covalent bonding to the aldehyde-coated glass slide. An additional polyethleneglycol spacer was linked to 3′ end of in front of an amino group. Based on the previous study (Jin et al., 2006), we chose a region on 16S rDNA gene as the internal control. DNA microarray was designed to have 10 probes surrounding six columns and five rows included 1 internal control and 1 negative

51335. 1. The location spots (complementary sequence of 16S-R) surrounded the array were used to identify the position of each target probe. 49103 63301. and the slide was washed with PBS-T (0. The name of gene was corresponding to target pathogen. 16028 M045. solution B (0. 1:1000 diluted TSACy3 (in 1 × PBS plus 1% BSA) was incubated in each well for 30 min at 37 °C. The typical hybridization results of six species of human pathogenic microorganism and non-target bacteria from pure bacterial cultures. All the experiments were done in triple. 26111. 11511 10719. The chamber was submerged in a 50 °C water bath. control. (8) Escherichia coli O157:non-H7. 50035 50760. 9068 44752.05% Tween 20) 1 min for three times. 20506. Other components were as above. (3) Brucella spp. 882364.63509 64201 64203 64711. 50096. The different ratio of forward to reverse (labeled with biotin) primer of each set was optimized following a value of 1:1. (4) Shigella spp. We interrogated the difference of two labeling methods. 43859. CB569. and 72 °C for 5 min. (1) non-target bacteria. Fluorescent measurements of DNA microarray was generated by scanning the slide on the GenePix 4000B scanner (Axon. 52217. which was placed in a humidified chamber. 52302 23456. Bio-Rad.27661 49027. 20511 16025.0 mM MgCl2 and 500 nM each primer. DNA microarray was evaluated for sensitivity using a series of 10-fold dilution (106 cfu/ml to 101 cfu/ml) from pure culture. Finally. E. 50017. The fluorescent signals were quantified using GenePix5. 52211. TW00186 54003. 6539 14028. 13C08 403. 26113. (5) Salmonella typhi. (2) Yersinia enterocolitica. 25840 23447. 0. 0.13048 52207. 16026. 23213 32219. (7) Vibrio cholera O139. 8759 13428. . then air-dried. A parallel dilution series of Fig.. 2. 1:3. 54005. Shigella spp.5 U Taq DNA polymerase (TaKaRa Biotechology Co. 5412. USA). Through analysis of signal intensity the suitable ratios corresponding to nine primer sets would be confirmed. 23457. Ltd).366 Table 1 Reference strains used in this study Species Salmonella spp Salmonella typhi Salmonella typhimurium Salmonella paratyphi A Salmonella paratyphi B Salmonella paratyphi C Escherichia coli O157:H7 Escherichia coli O157:non-H7 Escherichia coli O55:H7 Escherichia coli O26:H11 Escherichia coli O111:NM Listeria monocytogenes Listeria innocua Listeria seeligeri Listeria grayi Listeria welshimerii Shigella spp Vibrio parahaemolyticus Vibrio cholera Vibrio cholera O139 Vibrio cholera O1 Staphylococcus aureus Proteus spp Bacillus cereus Clostridium botulinum Clostridium perfringens Yersinia enterocolitica Brucella spp Campylobacter jejuni Aeromonas hydrophila Enterococcus faecalis Citrobacter freundii Enterobacter aerogenes D. 20–50 ng of purified genomic DNA. 3. (6) Vibrio cholera non-O139. the slide was washed in solution A (1 × SSC. One way for S. dUTP. 51207. PCR was performed for 35 cycles under the following conditions: 94 °C for 5 min. CA. Ltd). 50115 12176. V. dried at room temperature. coli O157:H7 respectively. typhi: each diluted concentration of genomic DNA of S. PCR products of S.a except particular notes 50001. 32220. USA). 19430.. and the slide was washed according to above step.1 × SSC) in sequence for 1 min. USA). a. 50041. 49345. 72 °C for 30 s. / Journal of Microbiological Methods 75 (2008) 365–368 ATCC accession no.2 × SSC) and washing solution C (0. 32221. 35964.Ogawa 26001. After removed from the hybridization chamber. Jin et al.2% SDS. 50835.6051. TSA-Cy3 and Cy3 end labeling. 23211. 20507. 405. The cutoff value of each probe was calculated through the mean of the spot intensity in order to determine the signals objectively. 23365 33560. 11778. 23458. 43429 10501. PCR reaction was performed in a volume of 50 μL with 1 × PCR buffer (TaKaRa Biotechology Co. The layout of DNA microarray was shown in Fig. Layout of DNA microarray. Subsequently 1:1500 diluted streptavidin-horseradish peroxidase was incubated in each well on the slide for 30 min at 37 °C. 1837 569B. and incubated for 1 h. W933. enterocolitica. 23448. 14028 50073. cholera O139. 5% formamide) without heat denaturation treatment. 23449. 50004. 493/89 5905. 5B 13C07. 29029 20502. 250 μM deoxynucleotide mixture (each of dATP. 32223 CMCC (B) 48016 CMCC (B) 45103 a American Type Culture Collection (ATCC) accession number for positive-control strains. typhi labeled with biotin were diluted by a series of 10-fold dilutions. (10) Escherichia coli O157:H7. 54006. 4 μL PCR products was mixed with 6 μL of hybridization buffer (5 × SSC. 49102. Two following ways were utilized for evaluating sensitivity. and the other way for genomic DNA of target pathogens in pure culture. 19940. We selected genomic DNA from Salmonella typhi.2% SDS). (9) Escherichia coli non-O157:H7. and then transferred to one well on the slide. Hercules. 4 °C forever on the DNA thermal system (icycler. 55 °C for 30 s. EDL 933 S14-91. 50013. 49101.0 software (Axon. 1:5. 52215. Brucella spp. dCTP and dGTP).13565. 7709. Each dilution series was repeated three times. b. 43889. 23450. 29428. 51424. 1-a. 50019. 54007 33090 35967 25401 35897 51081. typhi was diluted with supernatant of stool samples from healthy volunteers. 35654. Y. Each probe was spotted as two. 1:10 and 1:20 respectively. 1:2. 35 cycles of 94 °C for 30 s. 5A. 23459.

ail: attachment invasion locus. In addition. rfbE: O antigen for O157 serotype. sequence of the forward primer. ail. LPSgt: glycosotransferase. P. fliC: H7 flagellar antigen. The results showed that the intensity of the hybridization signal from each probe was the highest while the ratios of the primer pairs for 16S rDNA. Jin et al. rfbE. R. B: Cy3 end labeling. sequence of the reverse primer. positive signal was obtained from internal control probe in each reaction with bacterial genomic DNA. c F. The hybridization results indicated that high specificity of hybridization signals was obtained from six species of bacteria. ipaH: invasion plasmid antigen H. A: TSA-Cy3 labeling. 1:10. size (bp) 174 Primer sequence(5′-3′) 367 LPSgt U72485 262 Escherichia coli O157:H7 rfbE S83460 125 filC AM228905 162 Yersinia enterocolitica Ail AY004311 116 Shigella spp ipaH DQ448042 234 Salmonella typhi vipR X67785 337 Brucella spp BCSP DQ229169 223 Internal control 16S rDNA U00096 500 CACCCAACATGTTTAACGTTAATG ATCTATCTCTGTAGCCCCTATTAC CATACAGTCCTCATCCAGATGAACAAGAAGTTTCTGCTTTAGGTG CAGATTGTGATATGATAAGAGCGC ATAACAACTGAGATATCAAGCGTC TCGATAAGAAGAGATAAAGATCTGAGTTATCTAAAGATATTTGATTTAATGTTTT AACTATTACTACAGGTGAAGGT TAGCCTATAACGTCATGCCAA AGGCCAAGGATTAGCTGTACATAGGCA GGTGGGATTACTTATCAGGCTAC ATCCACATAAGACTTCGCAGCATC AGATGTAGTATTGAGCGAAACCAAAGCGGCTGCCGCGACATCTTCAATTAC AGGTTCGTTTGCTTATACCCATCAG GCTTAATGCGGAAAGATGGCCCC TTTCTTCTATGGCAGTAATAAGTTTGGTCACGGTGATCTTGA CTCAGTGCCTCTGCGGAGCTTCG GAGAGTTCTGACTTTATCCCG GAAGGCCTTTTCGATAATGATACCGGCGCTCTGCTCTCCC GGTTTCATCATTTCTGGCCTCCG CTCTGCTCCGTCAAGATCTTTTCACC CTTCAATAATGCCAGCAGCTCCAACCCCGAAATAGATA TGGCTCGGTTGCCAATATCAA CGCGCTTGCCTTTCAGGTCTG CTGGCGACGCTTTACCCGGAAACGATCCATA CGCTGGCGGCAGGCCTAACACATGC CGCGGCTGCTGGCACGGAGTTAGCC ACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTAGGGAATATTG a Genetic locus targeted by the described PCR primers and probes: ctxA: toxin sub-unit A. A series of images Fig. LPSgt. ctxA. 1:10. two serotypes were discriminated between V. respectively. while blank control and non-bacterial DNA control showed no signals (Fig.. and BCSP gene were adjusted to be 1:10. typhi as target pathogen to compare the method of TSA-Cy3 labeling with the assay of Cy3 end labeling. 1:5. We chose S. BCSP: 31-kDa cell surface protein. vipR. 1:5 and 1:5. Oligonucleotide probe.D. 2. cholera O1 and O139 as well as E. fliC. The results indicated that the positive signals emerged at the position of internal probe. A series of scanning image obtained from serial dilution of Salmonella typhi PCR products. / Journal of Microbiological Methods 75 (2008) 365–368 Table 2 Genes targeted for multiplex PCR and DNA microarray hybridization Pathogenic microorganism Vibrio cholera O139 Target genea ctxA GenBank accession no. 1:10. 1:10. Furthermore. 2006). No cross-reacted signals were detected for each target pathogen. The cutoff value is a proxy to determine hybridization results. 1-b). Oligonucleotide sequence of primers and probes used in this study are shown in Table 2. and no signals emerged by the negative control probe in any reaction. 1:10. Different ratio of the forward primer vs reverse primer (labeled with biotin) was tested in PCR reaction for each amplicon.b DQ774432 Primer namec ctxA-F ctxA-R ctxA-P LPSgt-F LPSgt-R LPSgt-P rfbE-F rfbE-R rfbE-P filC-F filC-R filC-P ail-F ail-R ail-P ipaH-F ipaH-R ipaH-P vipR-F vipRRvipR-P BCSP-F BCSP-R BCSP-P 16S-F 16S-R 16S-P Frag. A total of 92 strains of bacteria from 18 genera or species were tested by DNA microarray assay established as above. The specificity of primers and probes was confirmed by 92 reference strains from 18 genera or species. b Representative GenBank accession number from which the probe sequence was derived. The average intensity of signals from negative bacteria and blank control plus 2SD was calculated as cutoff value of probe (data not shown). vipR: regulating Vi antigen expression. . ipaH. coli O157: H7 and non H7. PCR products labeled with Cy3 was prepared according to the assay described previously (Jin et al.

C. Bhunia.7%) were S. which was confirmed experimentally by the assay described here. Aquat. 109–115. Detection of microbial pathogens in shellfish with multiplex PCR. K. M. Microbiol 68. Powell. 337–347. Call. typhi. 55. Furthermore.. cholera O139 should be the etiological agent in this epidemic. A total of 362 clinical specimens were detected by bacteria culture.. 06G120). Biotechniques 17 (6). Flavobacterium psychrophilum.. 4(1. Kapikian. Other two target pathogens were not detected in all clinical specimens. Krug. coli O157:H7 and S.L. 21. Detecting and genotyping Escherichia coli O157:H7 using multiplexed PCR and nucleic acid microarrays. cholera serotype O139 from O1 based on the present of the LPSgt gene. K. D. and 1 negative samples in 5 mocked samples. J. Bhunia. Fratamico. 40.A. International Handbook of Foodborne Pathogens. 5 mocked double-blind samples were detected by using DNA microarray.. Int.Q.F. Lin.Z. Lee. A. Detection and identification of intestinal pathogens in clinical specimens using DNA microarrays.. by multiplex PCR. In: Miliotis. Ivshina. Dis.M. Santos. Probes 20.. E. China.. Org. Osorio. 2006. 2002. J. Osorio. Cell. coli O157:H7 and Shigella spp.... Wang. (Ed... Wu. coli O157:H7 positive and 6(1.J. Toranzo. Statistics of Legal Infectious Disease Broke Out in 2001–2006..6%) specimens identified by DNA microarray were also positive by conventional bacteria culture method. Chumakov. V. (No.R. A..A.. 2006. Kong. M. Guijarro. and Yersinia ruckeri. enterocolitica.W. Barja. Clin. so it was predicable that pathogenic V. the results obtained by the appropriate API test system were the same to that of DNA microarray. 40.W. DNA microarray was able to detect 5 extra positive specimens that were negative with the conventional method. M.S.. Jones. The results showed that there were 4 positive samples including 1 Y.0 software (Fig. J Clin Microbiol 42. S.E.P.K. suggesting DNA microarray was more intact than the conventional culture method assay when clinical specimens contained dead or inactive bacteria. typhi positive by both two detection methods....J. K.Z. 2002. three major fish pathogens.F.. S. which provides a valuable assay for epidemiological investigation and preliminary diagnoses.S. In this report. C. cholera. M. 1998.. www. Wagner.C. D. Evan. 1414–1419. Food Pathogens: Microbiology and Molecular Biology. Marquez. typhi).L. API test system and DNA microarray.). 71–80.. Caister Academic Press.2%) were positive by using DNA microarray. Jin et al. and specifically detect E. Dis. 2 mixed pathogens (E. 101–107. Marcel Dekker. 1038–1040.S. Hoshino.. 67..Y.J. Chandler. Basel. All the clinical specimens were collected from an epidemic of V. J. Aquat. D. J. Law.A. coli O157 and serotype H7 based on the O157-(rfbE) and H7-specific(fliC) gene..moh.. Water Res 36.. The sensitivity of DNA microarray was evaluated based on cutoff values. S. Call. which included S. 10(2. DePaola.Y. Microbiol. Law. Bej. S.R.. C. Rapid detection of six types of bacterial pathogens in marine waters by multiplex PCR.W. These results indicated that the method of TSA-Cy3 labeling was ten times more sensitive than the assay of Cy3 end labeling. Plenum Medical Book Company.D. Romalde. New York. Acknowledgments Grant numbers and sources of support: this work was supported by the Military Medicine and Health Science Foundation of China. D.H. 2003. A. hybridization signals were shown positive for dilution containing as high as 103 cfu/mL of each species of pathogens. P. 2802–2812. Brockman. Norwich. we have established an assay using DNA microarray coupled with multiplex PCR and TSA-Cy3 labeling method for simultaneous identification of six species of human diarrheal pathogenic microorganisms and discriminate V. A PCR enzyme immunoassay for detection of Salmonella typhi. A.S. J. Gonza'lez. Environ. Aquat. cholera O139 by the conventional bacteria culture method. 2). The results showed that 137 (37. 1995. 1 Brucella spp. Powell. Detection of Aeromonas salmonicida in wild Atlantic salmon using a specific DNA probe test. New York. I. Multiplexed PCR assay for ureC and 16S rRNA genes clearly discriminates between both subspecies of Photobacterium damselae.. 1998.. 177–183. S. 2005.. Clabby...D.. Smith. Wen. A. Food Microbiol.8%) were detected positive of V. Luk. R... 37.. In: Evan.gov.368 D.. Org. References Brasher. J. P.. Miliotis. Y. 2004. Jin. C.F.7%) were detected Shigella spp positive. Dis. L. / Journal of Microbiological Methods 75 (2008) 365–368 and data corresponding to each concentration were analyzed using GenePix pro 4. Ministry of Health P. 2001. Development of a PCR based method for the detection of Listonella anguillarum in fish tissues and blood samples. T.A.cn.. 1994. 5177–5180. M. but were positive with the appropriate API test system. R. A. Curr. Y.D. Simultaneous detection of Aeromonas salmonicida. 131–135. However.. Mooney.). Mol. Negative and positive controls were included in parallel with each test to avoid false–positive and false–negative results. Microbiol.. Del. Smith.R.. Detection and genotyping of human group A rotaviruses by oligonucleotide microarray hybridization. (Eds. NY. In: Fratamico. respectively. Bacterial Infections of Humans. (Ed. F. Nielsen. Chen. Appl. 2398–2407..M. D. R. C. It was clear that background of genomic DNA in stool samples did not have an affect to the limit of detection. Gonza'lez. S. Chizhikov.. Org.R.K.1%) were detected E. E.M.. A.J. while 142 (39. 2002. 2000.R...H. L. The results also showed that 357 (98.E. .). F. S. In addition. J.Y.. Simultaneous detection of marine fish pathogens by using multiplex PCR and a DNA microarray. 2003.