You are on page 1of 25

Genes to Proteins: An Introduction

The DNA inherited by an organism specifies the traits that organism possesses and can express. The information content of DNA is in the form of specific sequences of nucleotides organized into units called genes. The information stored in genes is retrieved through the function of specific molecules which decode them and use the decoded messages to synthesize proteins. Expressed traits are the result of proteins and the activity of proteins; proteins are the link between genotype and phenotype.

Relating Genotype Phenotype to Mendels Pea Plants


Height character in pea plant: Tall trait dominant to Dwarf trait. Alleles: T (tall), t (dwarf). T/t locus specifies protein used for growth hormone synthesis:

Genotypes
T T Gene product (protein)

Hormone Synthesis pathway


Precursor compound T= enzyme Growth Hormone Tall plant

t= mutant allele; nonGene functional protein product Precursor No Growth (protein) compound Hormone Dwarf plant

Genotypes

Protein Function

Phenotypes

Beadle & Tatum Experiments

Created mutants in arginine (an amino acid) pathway in Neurospora (a fungus) by irradiating cells (spores) with UV light: in order to grow, the mutants required the addition of different intermediates in the arginine synthesis pathway:

Arg-1 mutants
Can grow if given ornithine or citrulline; lack enzyme A

Arg-2 mutants
Can grow if only given citrulline; lack enzyme B

Arg-3 mutants
Can grow if only given arginine lack enzyme C

Found that one gene mutation was responsible for one enzyme being defective; enzymes are proteins thus, this lead to the: 1 gene - 1 protein (polypeptide) hypothesis

WHAT ARE PROTEINS ?


Amino acids are the H O chemical units that comprise proteins; H - N - C - C - OH proteins are H R polymers of amino R group: 20 different acids side, or functional groups,
Link amino acids together to form a protein (polypeptide):
Amino acid #1

Shaded region: chemical structure common to all amino acids.

Amino acid #2 Amino acid #3

among amino acids.


Amino acid #4

H - N - C - C- N -C - C - N - C - C -N - C - C - OH H R Carboxy H R H R Amino H R
terminus

H O

H O

H O

H O

terminus

PROTEIN STRUCTURE OVERVIEW


pp=polypeptide

The primary structure of a protein is determined by inherited genetic information (i.e., the DNA sequence of genes.
Single polypeptide = gene product

Primary

Secondary: Hbonding within pp backbone

Four Levels of Protein Structure

Tertiary: interaction among R groups in pp chain Quarternary: multiple pp chains

The Central Dogma: DNARNA Protein


DNA

DNA

Replication: Make an RNA DNA copy of a DNA duplicates template; called mRNA.
DNA

RNA

Transcription: The mRNA has a sequence mRNA complimentary to mRNA synthesis the DNA template Read the mRNA sequence and convert to a Translation: Polypeptide Protein sequence Ribosome synthesis
Protein

Protein

Differences Between DNA & RNA


NH2

DNA
O
HO O=PO H H O H

N N N

RNA
O O=PHO O
H O H

NH2 N N N N

AMP

H O OH OH H dAMP O P ODeoxyadenosine O-

monophosphate (deoxyribonucleotide)

H OH H O OH O P OAdenosine monophosphate O-

(ribonucleotide)

DNA
Double stranded helix Very stable A:T, G:C Deoxyribose sugar

RNA
Single stranded, forms secondary structures, unstable Uracil, rather than thymine: A:U, G:C Ribose sugar

TRANSCRIPTION

RNA Orientation of strands

DNA template 3 RNA polymerase copies 1 DNA strand (template) to make a single-stranded RNA molecule; makes an RNA chain in the 5 to 3 direction (like DNA polymerase) but it does not require an initial primer (unlike DNA polymerase)

Steps of Transcription
Initiation - Unwind DNA - DNA promoter sequence upstream of transcription start site Elongation Termination End of RNA polymerase transcription reads the DNA template 3 to 5 and makes the RNA chain 5 to 3 Both DNA strands possess genes, thus mRNAs can be transcribed from both templates. 5

DNA 5

promoter

Gene Z 3

3 mRNA 5

3 Gene A

mRNA 3 5
promoter

**Key: 5 to 3 transcript made from 3 to 5 DNA template

How is the mRNA Transcript Deciphered ?


There are sequences of 4 nucleotide bases that comprise the transcript and 20 amino acids, what is the genetic code? (Watson & Crick had to determine whether 1, 2, or 3 bases code for each amino acid)
codons start stop mRNA: 5 A A C U U G A U G C C C U U U G G A.U G A 3

The Genetic Code: sets of 3 ribonucleotides called codons, each coding for a specific amino acid Start codon, AUG, aligns the reading frame, Stop codon signals end of translation; this codon does not code for an amino acid.

The Genetic Code


The genetic code represents the mRNA transcript codons Specifies the codon:amino acid pairings The code is redundant; multiple codons per amino acid

RNA Molecules Types & Their Roles


Transcription: mRNA
(messenger) an RNA copy of a DNA template that is the template for protein synthesis

Translation (protein synthesis): tRNA


(transfer) an RNA that acts as an adaptor between the mRNA & the protein by binding an amino acid and separately interacting with the mRNA RNA molecules that are part of the ribosome and serve as the site for translation

rRNA
(ribosomal)

**rRNA genes & tRNA genes in DNA are transcribed to form these RNA molecules.

Transfer RNAs serve as the adaptor molecules that


translate the nucleic acid language into an amino acid language (called translation of the mRNA) tRNAs chemically linked to a specific amino acid (charged tRNA)
Specific amino acyl tRNA synthetases catalyze charging reaction

Has three base anticodon complimentary to the mRNA codon; allows recognition and binding of tRNA to mRNA.

Anticodon sequence

The Stages of Translation


Form Initiation Complex Small ribosome subunit binds mRNA, initiator tRNA (charged) binds Large ribosomal subunit binds: translation can begin

AA1

tRNA + amino acid mRNA small ribosome unit Large ribosome unit

AA1

Elongation

the mRNA is read 5 to 3; amino acid chain gets longer and stays attached to a tRNA molecule Once a stop codon (AUU, AGU, UGA) is in the ribosomes A-site a protein called a release factor binds; protein released, complex separates

Termination

The Ribosome
Entire complex comprised of Large proteins and 2 subunit rRNA molecules organized as 2 subunits; units associate with each other in the presence of mRNA Small
subunit

The amino acid from the initial tRNA is transferred and bonded to the amino acid of the newly bound tRNA in the A site.

Translation proceeds as an incoming charged tRNA with the appropriate anticodon pairs with the next available codon (A site of ribosome) adjacent to the preceeding tRNA:codon.

Peptide bond formation

Ribosomes catalyse the formation of peptide bonds, linking amino acids to form a polypeptide.

Relationship of DNA template:mRNA:tRNA


DNA 3 T A C G G C A T A C G A G A A A T T 5 mRNA 5 A U G C C G U A U G C U C U U U A A 3 tRNA 3 U A C G G C A U A C G A G A A A U U 5 MET PRO TYR ALA LEU STOP Amino acids tRNA:
orientation antiparallel to mRNA Uracil (U) in tRNA pairs with Adenine (A) in mRNA

Note the DNA sequence that was transcribed


Orientation antiparallel to transcript Adenine (A) in DNA pairs with Uracil (U) in RNA

Use genetic code table to find amino acids

How to determine the outcome of transcription and translation starting from a given DNA sequence
Using the DNA sequence on the right what is the 5 TT ATGCCCGTTCATGCGGCAT 3 3 AATACGGGCAAGTACGCCGTA 5 outcome of translation using the top strand as the template strand? 5 TT ATGCCCGTT CAT GCGGCAT 3 3 AAUACGGGCAAGUACGCCGUA 5 DNA Template RNA copy
NOTE:

The START codon (AUG) does NOT 5AUG|CCG|CAU|GAA|CGG|GCA|UAA 3 have to be the very first three nucleotides in a An mRNA is read by the ribosome in sequence. 5 to 3 direction

5 AUG CCG CAU GAA CGG GCA UAA 3 Met Pro His Glu Arg Ala STOP Amino (or N) carboxyl terminus (or C) terminus

Summary: Central Dogma of Gene Expression

Promoter (DNA) RNA polymerase mRNA (codons) Both DNA strands contain coding information

tRNA (anticodons, amino acids) rRNA (ribosomes) peptide bond formation, synthesize polypeptide

Coupling Transcription & Translation


Polyribosome formation facilitates rapid protein synthesis
RNA polymerase Direction of RNA synthesis Active DNA segment

Inactive DNA segment Active DNA segment

Ribosomes Polyribosome Direction of protein synthesis mRNA

0.5 m

Mutations
Mutations are heritable changes in DNA
Somatic mutations: occur in non-sex (i.e., somatic) cells; are not passed on to offspring. Germ line mutations: occur in sex cells; offspring inherit such mutations.

Types:
Point mutations: single nucleotide base mutation; affect single gene
Frameshift mutation: deletion or insertion of base Silent, nonsense, missense mutations: base substitution
Silent mutations do not affect protein function; unlike the other mutation types, silent mutations are not detrimental to the cell.

Chromosomal mutations: more extensive DNA alteration than point mutations

Normal DNA, transcript, & protein: DNA 3 T A C G G C A T A C G A G A A A T T 5 mRNA 5 A U G C C G U A U G C U C U U U A A 3

MET PRO TYR


Frameshift mutation: insert T

ALA LEU STOP

DNA 3T A C G G C T A T A C G A G A A A T T 5 mRNA 5A U G C C G A U A U G C U C U U U A A3
Mutated protein

MET PRO

ILE

CYS SER

LEU

Amino acid sequence altered past the insertion

Point mutation: nonsense type; T instead of A: DNA 3 T A C G G C A T T C G A G A A A T T 5 mRNA 5 A U G C C G U A A G C U C U U U A A 3


Mutated protein Should be:

MET PRO STOP MET PRO TYR ALA LEU STOP

Point mutation: missense type; T instead of A: DNA 3 T A C G G C T T A C G A G A A A T T 5 mRNA 5 A U G C C G A A U G C U C U U U A A 3

MET PRO ASP


Should be:

ALA LEU STOP

TYR

Summary
The heritable information of chromosomes is contained in the base sequences of DNA.
Organized into units called genes

This information (i.e., the genotype) is realized as a phenotype (visible traits) by the functions of proteins. DNA stores the information that is decoded into an amino acid sequence to make a protein. RNA is the link between DNA and protein; specific RNA molecules carry out the transcription and translation of genetic information. (Central Dogma) Errors in the DNA sequence lead to errors in translation (mutations)