Genes to Proteins: An Introduction

• The DNA inherited by an organism specifies the traits that organism possesses and can express. • The information content of DNA is in the form of specific sequences of nucleotides organized into units called genes. • The information stored in genes is “retrieved” through the function of specific molecules which decode them and use the decoded messages to synthesize proteins. • Expressed traits are the result of proteins and the activity of proteins; proteins are the link between genotype and phenotype.

Relating Genotype Phenotype to Mendel’s Pea Plants
Height character in pea plant: Tall trait dominant to Dwarf trait. Alleles: T (tall), t (dwarf). T/t locus specifies protein used for growth hormone synthesis:

T T Gene product (protein)

Hormone Synthesis pathway
Precursor compound T= enzyme Growth Hormone Tall plant





t= mutant allele; nonGene functional protein product Precursor No Growth (protein) compound Hormone Dwarf plant


Protein Function


lack enzyme B Arg-3 mutants Can grow if only given arginine lack enzyme C Found that one gene mutation was responsible for one enzyme being defective. enzymes are proteins thus. this lead to the: 1 gene .1 protein (polypeptide) hypothesis .Beadle & Tatum Experiments Created mutants in arginine (an amino acid) pathway in Neurospora (a fungus) by irradiating cells (spores) with UV light: in order to grow. the mutants required the addition of different intermediates in the arginine synthesis pathway: Arg-1 mutants Can grow if given ornithine or citrulline. lack enzyme A Arg-2 mutants Can grow if only given citrulline.

Amino acid #4 = = H .OH H R Carboxy H R H R Amino H R terminus = = H O H O H O H O terminus . H .WHAT ARE PROTEINS ? Amino acids are the H O chemical units that comprise proteins.C .C -N .N .C .N . Link amino acids together to form a protein (polypeptide): Amino acid #1 Shaded region: chemical structure common to all amino acids.OH proteins are H R polymers of amino R group: 20 different acids side.C.C .C .N . or functional groups. Amino acid #2 Amino acid #3 = among amino acids.C .C .C .N -C .

.e.PROTEIN STRUCTURE OVERVIEW pp=polypeptide The primary structure of a protein is determined by inherited genetic information (i. the DNA sequence of genes. Single polypeptide = gene product Primary Secondary: Hbonding within pp backbone Four Levels of Protein Structure Tertiary: interaction among R groups in pp chain Quarternary: multiple pp chains .

The Central Dogma: DNA→RNA→ Protein DNA DNA Replication: Make an RNA DNA copy of a DNA duplicates template. DNA RNA Transcription: The mRNA has a sequence mRNA complimentary to mRNA synthesis the DNA template Read the mRNA sequence and convert to a Translation: Polypeptide Protein sequence Ribosome synthesis Protein Protein . called mRNA.

forms secondary structures. G:C Ribose sugar . rather than thymine: A:U. unstable Uracil. G:C Deoxyribose sugar RNA Single stranded.Differences Between DNA & RNA NH2 DNA O HO O=PO H H O H N N N N RNA O O=PHO O H O H NH2 N N N N AMP H O OH OH H dAMP O P ODeoxyadenosine O- monophosphate (deoxyribonucleotide) H OH H O OH O P OAdenosine monophosphate O- (ribonucleotide) DNA Double stranded helix Very stable A:T.

makes an RNA chain in the 5’ to 3’ direction (like DNA polymerase) but it does not require an initial primer (unlike DNA polymerase) 5’ .TRANSCRIPTION RNA Orientation of strands 5’ 3’ DNA template 3’ RNA polymerase copies 1 DNA strand (template) to make a single-stranded RNA molecule.

DNA promoter sequence upstream of transcription start site Elongation Termination End of RNA polymerase transcription reads the DNA template 3’ to 5’ and makes the RNA chain 5’ to 3’ • Both DNA strands possess genes.Unwind DNA . thus mRNA’s can be transcribed from both templates. 5’ DNA 5’ promoter Gene Z 3’ 3’ mRNA 5’ 3’ Gene A mRNA 3’ 5’ promoter **Key: 5’ to 3’ transcript made from 3‘ to 5’ DNA template .Steps of Transcription Initiation .

. AUG.…U G A 3’ • The Genetic Code: sets of 3 ribonucleotides called codons. what is the genetic code? (Watson & Crick had to determine whether 1. this codon does not code for an amino acid. aligns the reading frame. each coding for a specific amino acid • Start codon. or 3 bases “code” for each amino acid) codons start stop mRNA: 5’ A A C U U G A U G C C C U U U G G A…. • Stop codon signals end of translation.How is the mRNA Transcript Deciphered ? • There are sequences of 4 nucleotide bases that comprise the transcript and 20 amino acids. 2.

multiple codons per amino acid .The Genetic Code • The genetic code represents the mRNA transcript codons • Specifies the codon:amino acid pairings • The code is redundant.

.RNA Molecules Types & Their Roles Transcription: mRNA (messenger) an RNA copy of a DNA template that is the template for protein synthesis Translation (protein synthesis): tRNA (transfer) an RNA that acts as an adaptor between the mRNA & the protein by binding an amino acid and separately interacting with the mRNA RNA molecules that are part of the ribosome and serve as the site for translation rRNA (ribosomal) **rRNA genes & tRNA genes in DNA are transcribed to form these RNA molecules.

allows recognition and binding of tRNA to mRNA.• Transfer RNA’s serve as the adaptor molecules that translate the “nucleic acid language” into an “amino acid language” (called translation of the mRNA) – tRNA’s chemically linked to a specific amino acid (“charged tRNA”) • Specific amino acyl tRNA synthetases catalyze charging reaction – Has three base anticodon complimentary to the mRNA codon. Anticodon sequence .

complex separates Termination . AGU. protein released. initiator tRNA (charged) binds Large ribosomal subunit binds: translation can begin AA1 tRNA + amino acid mRNA small ribosome unit Large ribosome unit AA1 Elongation the mRNA is read 5’ to 3’. UGA) is in the ribosome’s A-site a protein called a release factor binds. amino acid chain gets longer and stays attached to a tRNA molecule Once a stop codon (AUU.The Stages of Translation Form Initiation Complex Small ribosome subunit binds mRNA.

The Ribosome Entire complex comprised of Large proteins and 2 subunit rRNA molecules organized as 2 subunits. units associate with each other in the presence of mRNA Small subunit .

. linking amino acids to form a polypeptide.The amino acid from the initial tRNA is transferred and bonded to the amino acid of the newly bound tRNA in the A site. Translation proceeds as an incoming charged tRNA with the appropriate anticodon pairs with the next available codon (A site of ribosome) adjacent to the preceeding tRNA:codon. Peptide bond formation Ribosomes catalyse the formation of peptide bonds.

Relationship of DNA template:mRNA:tRNA DNA 3’ T A C G G C A T A C G A G A A A T T 5’ mRNA 5’ A U G C C G U A U G C U C U U U A A 3’ tRNA 3’ U A C G G C A U A C G A G A A A U U 5’ MET PRO TYR ALA LEU STOP Amino acids • tRNA: – orientation antiparallel to mRNA – Uracil (U) in tRNA pairs with Adenine (A) in mRNA • Note the DNA sequence that was transcribed – Orientation antiparallel to transcript – Adenine (A) in DNA pairs with Uracil (U) in RNA • Use genetic code table to find amino acids .

5’ to 3’ direction .How to determine the outcome of transcription and translation starting from a given DNA sequence Using the DNA sequence on the right what is the 5’ TT ATGCCCGTTCATGCGGCAT 3’ 3’ AATACGGGCAAGTACGCCGTA 5’ outcome of translation using the top strand as the template strand? 5’ TT ATGCCCGTT CAT GCGGCAT 3’ 3’ AAUACGGGCAAGUACGCCGUA 5’ DNA Template RNA copy NOTE: The START codon (AUG) does NOT 5’AUG|CCG|CAU|GAA|CGG|GCA|UAA 3’ have to be the very first three nucleotides in a An mRNA is read by the ribosome in sequence.

5’ AUG CCG CAU GAA CGG GCA UAA 3’ Met Pro His Glu Arg Ala STOP Amino (or N) carboxyl terminus (or C) terminus .

Summary: Central Dogma of Gene Expression • • • • Promoter (DNA) RNA polymerase mRNA (codons) Both DNA strands contain coding information • tRNA (anticodons. synthesize polypeptide . amino acids) • rRNA (ribosomes) • peptide bond formation.

5 µm .Coupling Transcription & Translation Polyribosome formation facilitates rapid protein synthesis RNA polymerase Direction of RNA synthesis Active DNA segment Inactive DNA segment Active DNA segment Ribosomes Polyribosome Direction of protein synthesis mRNA 0.

– Chromosomal mutations: more extensive DNA alteration than point mutations .. somatic) cells. affect single gene • Frameshift mutation: deletion or insertion of base • Silent.e. – Germ line mutations: occur in sex cells. • Types: – Point mutations: single nucleotide base mutation. silent mutations are not detrimental to the cell.Mutations • Mutations are heritable changes in DNA – Somatic mutations: occur in non-sex (i. nonsense. unlike the other mutation types. are not passed on to offspring. missense mutations: base substitution – Silent mutations do not affect protein function. offspring inherit such mutations.

& protein: DNA 3’ T A C G G C A T A C G A G A A A T T 5’ mRNA 5’ A U G C C G U A U G C U C U U U A A 3’ MET PRO TYR Frameshift mutation: insert T ALA LEU STOP DNA 3’T A C G G C T A T A C G A G A A A T T 5’ mRNA 5’A U G C C G A U A U G C U C U U U A A3’ Mutated protein MET PRO ILE CYS SER LEU Amino acid sequence altered past the insertion . transcript.Normal DNA.

T instead of A: DNA 3’ T A C G G C A T T C G A G A A A T T 5’ mRNA 5’ A U G C C G U A A G C U C U U U A A 3’ Mutated protein Should be: MET PRO STOP MET PRO TYR ALA LEU STOP Point mutation: missense type. T instead of A: DNA 3’ T A C G G C T T A C G A G A A A T T 5’ mRNA 5’ A U G C C G A A U G C U C U U U A A 3’ MET PRO ASP Should be: ALA LEU STOP TYR .Point mutation: nonsense type.

specific RNA molecules carry out the transcription and translation of genetic information.e. • DNA stores the information that is “decoded” into an amino acid sequence to make a protein. • RNA is the link between DNA and protein.. (Central Dogma) • Errors in the DNA sequence lead to errors in translation (mutations) . the genotype) is realized as a phenotype (visible traits) by the functions of proteins.Summary • The heritable information of chromosomes is contained in the base sequences of DNA. – Organized into units called genes • This information (i.

Sign up to vote on this title
UsefulNot useful

Master Your Semester with Scribd & The New York Times

Special offer for students: Only $4.99/month.

Master Your Semester with a Special Offer from Scribd & The New York Times

Cancel anytime.