EKSPRESI HETEROLOGUS GEN INTERFERON ALFA 2 MANUSIA: ISOLASI, KLONING, DAN SEKUENSING

YEMIMA SURYANI

JURUSAN KIMIA FAKULTAS MATEMATIKA DAN ILMU PENGETAHUAN ALAM INSTITUT PERTANIAN BOGOR BOGOR

2001

RINGKASAN
YEMIMA SURYANI. Ekspresi Heterologus Gen Interferon Alfa 2 Manusia: Isolasi, Kloning, dan Sekuensing Gen Interferon Alfa Manusia (Heterologous Expression of Interferon Alpha 2 Gene: Isolation, Cloning, and Sequencing). Dibimbing oleh SULlSTlYANI, I MADE ARTIKA, dan HERAWATISUDOYO. Interferon alfa 2 manusia (Hu-IFNo:.2) merupakan zat antivirus dan antitumor yang Lelah diakui penggunaannya untuk mengobati berbagai penyakit keganasan dan penyakit akibat virus. Penggunaannya di Indonesia masih terbatas karena harga obar ini di luar jangkauan kernampuan masyarakat. Penelitian ini bertujuan mengisolasi gen Hu-IFNu2 yang pada akhirnya akan diekspresikan untuk tujuan produksi protein IFNo:.2 dalam skala industri, Penelitian diawali dengan studi bioinformatika untuk menentukan urutan nukleotida gen Hu-IFNo:.2 dan daerah sekitarnya. Data yang diperoleh digunakan sebagai landasan dalam merancang sepasang primer yang digunakan untuk mengisolasi gen tersebut dari DNA genom manusia dengan teknik peR (Polymerase Chain Reaction). Dari proses ini diperoleh fragmen DNA berukuran 797 ph yang merupakan kandidat gen Hu-IFNo:.2• Fragmen DNA disisipkan ke dalam vektor pGEM®-T, dilanjutkan dengan transformasi ke dalam sel E. coli. Dari sepuluh koloni transforrnan yang plasmidnya diisolasi dan ukuran insert-ivy» diperiksa dengan teknik peR, ternyata sernbilan koloni memiliki ukuran insert yang sesuai (1.047 pb). Urutan nukleotida kandidat gen Hu-IFNu2 tersebut diperiksa menggunakan Big Dye Terminator Cycle Sequencing Ready Reaction Kit (ABI) serta dianalisis menggunakan Automatic DNA Sequencer AB! Prism 377. Hasil analisis menunjukkan bahwa bcnar gen yang diisolasi rnerupakan gen Hu-IFNo:.2• Gcn ini siap untuk disubklon ke dalam suatu vekror ckspresi untuk mcnghasilkan protein 1FNcx2.

THE SHEPHeRD's PSALM

The Lord is my shepherd; I shall not want. He maketh me to lie down in green pastures: He leadeth me beside the still waters. He restoreth my soul: he leadeth me in the paths of righthousness for his name's sake. Yea, though I walk through the valley of the shadow of death, I will fear no evil: For thou art with me; thy rod and thy staff they comfort me. Thou preparest a table before me in the presence of mine enemies: thou antoinest my head with oil; my cup runneth over. Surely goodness and mercy shall follow me all the days of my life: and I will dwell in the house of the Lord forever.
\

Psalm 23

EKSPRESI HETEROLOGUS GEN INTERFERON ALFA 2 MANUSIA: ISOLASI. KLONING. DAN SEKUENSING YEMIMA SURYANI Skripsi sebagai salah satu syarat untuk mernperoleh Sarjana Sains pada Program Studi Kimia gelar JURUSAN KIMIA FAKULTAS MATEMATIKA DAN ILMU PENGETAHUAN ALAM INSTITUT PERTANIAN BOGOR BOGOR 2001 .

: Ekspresi Heterologus Gen Interferon Alfa 2 Manusia: Isolasi. M. dan Sekuensing Nama : Yernima Suryani NIM : 001497047 Judul Menyetujui.1 Made Artika. Ph. 11'. AUG 2001 .D Pernbimbing II Pernbimbing III Tanggal lulus: I 7. Kloning. Ph.D.Sc..

Selarna mengikuti perkuliahan penulis pernah menjadi asisten mata kuliah Kimia Dasar I pada tahun ajaran 1999/2000. Pada tahun 1997 penulis lulus dari SMU Kristen I Jakarta dan pad a tahun yang sama penulis masuk IPB pada Fakultas MIPA Program Studi Kimia melalui jalur Undangan Seleksi Masuk IPB (USMI). . Jakarta. dan Biokimia I pada tahun ajaran 200012001. Jakarta dan pada tahun 2001 penulis melaksanakan penelitian di Lembaga Biologi Molekul Eijkman.RIWAYATHIDUP Penulis dilahirkan di Jakarta pada tanggal 16 April 1979 sebagai anak tunggal dari pasangan Adi Suryono dan Jusijanti. Pad a tahun 2000 penulis melaksanakan praktik lap~ngan di Badan Tennga Nuklir Nasional Pasar Jumat. Kimia Dasar II pada tahun ajaran 1999/2000.

Sc.App. Penelitian seluruhnya didanai oleh Lembaga Biologi Molekul Eijkman.. Ph.D. Ph. sehingga karya ilmiah ini bisa diselesaikan dengan baik. mengizinkan M.. antara lain Prof. Eno. Kak Helena. dan seluruh star Lembaga Eijkrnan alas bantuan dan sarannya. Benny. Oge.PRAKATA Puji dan syukur penulis panjatkan ke hadirat Bapa yang Maim Kasih atas segala karunia-Nya. mama. dan Rahel untuk scgala doa.D selaku Direktur Lembaga Eijkman yang telah penulis rnelakukan penelitian. Yadi. Penelitian ini yang berjudul Ekspresi Heterologus Gen dilaksanakan lIll Interferon Alfa 2 Manusia: Isolasi. dan sernua ternan angkatan 34 alas segala dukungan dan persahabatannya.. M. kasih. Kristi. If.D. dr.S.Sc. Ph. Debby.D. Dodi.D selaku pembimbing yang ban yak memberi saran dan M. Sulistiyani. Sangkot Marzuki. dan dukungannya. Semoga karya ilmiah ini dapat bcrmanfaat. Kloning.. Selain itu penults juga mcngucapkan tcrima kasih kepada Eva. Jakarta. Puji. dan drh. Terima kasih penulis ucapkan kepada berbagai pihak yang Lelah membantu penyelesaian karya ilmiah ini. bimbingan yang berharga bagi penulis. I Made Artika M. Jakarta. Ph. Iskandar. Herawati Sudoyo. Ungkapan terirna kasih juga disampaikan kcpada papa. dan Sekuensing Gen Inteferon Alfa 2 Manusia dad bulan Februari sampai Mei 2001 di Lembaga Biologi Molekul Eijkman. Juli 200 I Yemima Suryani . Di samping itu ungkapan terima kasih ini juga diberikan kepada Kak Anna.

......... Amplifikasi Gen Interferon Alfa 2 Manusia............................... Sekuensing............. .. . ............................................ ................ Isolasi DNA Genom........................ ............. HASIL DAN PEMBAHASAN Isolasi DNA Genom: Kadar dan Keruurnian DNA.......................... Ligasi Produk peR dengan Vektor pGEM®-T............................................ ................ BAHAN DAN METODE Bahan 3 4 6 7 Peralatan Garis Besar Kcgiatan......................................... .... LAMPI RAN ......... Saran..... Sekuensing.............. ......................................................................... Halaman ~ viii VIII \............................................................... DAFTAR PUSTAKA.... ................................................. ................................................................ Pemurnian Produk peR " ................................. Deteksi Prod uk peR dengan Elektroforesis Gel Agarosa. DAFTAR LAMPIRAN....... DAFTAR GAMBAR.................. KESIMPULAN DAN SARAN Kesimpulan..DAFTARISI DAFfAR TABEL..... 2 .............................. Pengukuran Kadar dan Kemurnian DNA......... SeJeksi dan Isolasi Plasmid Rekombinan........................................................ 9 9 9 10 10 10 II I1 12 14 16 17 17 17 20 ............. ... ....................... coli......111 ................................................................ Kloning............................ ..... ...................................... ............................. Transforrnasi ke daIam SeI E....... 3 PolymeraseChainReactioll........... Studi Bioinformatika.... Sekuensing Hasil Kloning................................................................... .. PENDAHULUAN TINJAUAN PUSTAKA Interferon Struktur dan Keragaman Gen Interferon Manusia....... ................................... ..... Kloning................. ... 7 I) 8 8 9 PolymeraseChainReaction................................ Interferon Alfa 2..................................... ............................................................

. DAFTAR LAMPIRAN Halaman 20 21 22 23 24 I................. 2............... L 3................. Ciri-ciri urnum gen IFN manusia........ Program PCR untuk konfirmasi ukuran 9 I! II insert plasmid rckombinan................................................ Elektroforegram hasil perunutan sekuens gcn IFNa2dengan primer IF-2... 5............................. 3...... Daerah pertemuan antara vektor pGEM®-T dengan salah satu ujung insert 14......................... 4. Daftar primer yang digunakan.................... Program peR untuk sekuensing... 7......... Hasil amplifikasi DNA sampel dengan primer IF-2 dan IR-2 pada 3 suhu annealing ..........2 dan IFNaz c ..................... .... b.... . Hasil PCR sepuluh koloni 13............. 2..... 9......... 13 15 16 16 17 II.... Tahapan teknik kloning....... dan X-gal 12.............................. Diagram alir metode penelitian IFNA 2............ Perbandingan sekuens sampel dengan sekuens standar 1FNa2 IFNo:...... ... 5... Stratcgi amplifikasi gen 1FNa2........... Konsrruksi plasmid pGEM®-T......... 8....... Contoh pernisahun fragmcn-Iragmcn DNA clan sckuensnya................................ DAFTAR GAMBAR Halaman 4 4 5 7 I........... Klasifikasi interferon. Cawan petri berisi medium LB yang mengandung ampisiIin.. 12 10......... a... 4.... IPTG.... Perbandingan sebagian sekuens IFN~ dengan sebagian sekuens IFNa yang lain... ................. Perhitungan kadar dan kemurnian DNA. ...........DAFTAR TABEL Halarnan 2 2 I...................................................... 8 6...... Hasil konfirrnasi sekuens sampel dengan standar Y 11834........................................ Program PCR untuk amplifikasi gcn IFNA 2.... Tahapan reaksi pad a teknik Polymerase Chain ReactiOIl..........................................

25 26 .....6........ Urutan nukleotida gen Hu-1FNa2 dan asam amino yang disandinya..... 7........... Sekuens keseluruhan IFNa2 hasil isolasi.........

. Zat-zat imun tersebut diharapkan akan rnengobati tepa! pada sasaran dan sesedikit mungkin menimbulkan efek sarnping. menghambat proliferasi sel-sel vertebrata. sehingga sumber daya manusia Indonesia yang menggeluti bidang ini masih terbatas. Manfaat yang diperoleh dari penelitian ini adalah tersedianya gen 1FNu2 dalam vektor pGEM6'-T yang siap untuk dipindahkan (disubklon) ke dalam suatu vektor ekspresi. Hasil-hasil penelitian menunjukkan bahwa IFNu2 efektif untuk rnereduksi tumor dan mengobati berbagai macarn jenis penyakit yang diinduksi oleh virus. IFN tidak langsung menyerang virus . Keberhasilan procluksi 1FNuz akan mendukung terciptanya swasembada obat antivirus dan antitumor di Indonesia. 1994). Interferon alfa 2 (IFNu2) merupakan salah satu jcnis protein yang disintesis oleh sistem kekebalan tubuh apabila tubuh terserang virus dan tumor. kloning gen tersebut. Ketiga fungsi ini berkaitan erat satu sama lain karena dalam rnenjalankan tugasnya. Daya tahan tubuh yang lemah mengakibatkan tubuh mudah terserang penyakit. Mereka berfungsi untuk menghambat replikasi virus yang masuk ke dalam sel. J 996. 1990). Swasembada 1FNu2 di' Indonesia selama ini belum diusahakan karen a terdapat beberapa kendala utama.PENDAHULUAN Akhir-akhir ini semakin banyak manusia yang terserang penyakit tumor dan penyakit yang diinduksi oleh virus.z ini adalah penghambatan replikasi virus dan penghancuran sel yang terserang virus atau tumor. Tahapan penelitian yang dilakukan secara garis besar melipuri isolasi DNA genom rnanusia dari darah vena. Dcngan demikian diharapkan jumlah penderita penyakit tumor dan penyakit yang disebabkan oleh virus di Indonesia akan berkurang. Teknik pengobatan yang digunakan secara luas saat ini belum menunjukkan hasil yang cukup memuaskan karena tingkat kesembuhan penderita penyakit tersebut masih relatif rendah. para peneliti di negara-negara maju mengembangkan suatu teknik pengobatan menggunakan zat-zat irnun (kekebalan) yang diproduksi oJeh tubuh manusia secara alami pada kondisi tertentu. antara lain adalah keterbatasan teknologi. TINJAUAN PUSTAKA Interferon Interferon (lFN) dipublikasikan pertama kali oleh Isaacs dan Lindenmann pada tahun 1957 dan dinamai oleh mereka berdasarkan kemampuan senyawa tersebut untuk mengganggu replikasi dari berbagai macarn : virus. (995). Adapun tujuan penelitian ini adalah untuk mengisolasi gen IFNu2 dan menyimpannya dalam vektor pGEM. Akibatnya sampai saat ini IFNO'. dan biaya. terutama untuk penyakit tumor ganas (kanker). Pengiriman dan pemasaran IFNu2 dari luar negeri ke Indonesia memerlukan biaya yang sangat mahal. amplifikasi gen IFNo:z dari DNA genom manusia dengan teknik peR (Polymerase Chain Reaction).IFNu2 di Indonesia. Selain itu biaya yang diperlukan juga cukup mahal. 1FNu2 telah diakui oleh U. dan mengatur respon kekebalan (Stites et al.. dan konfirrnasi sekuensnya dcngan teknik sekucnsing. Efek yang ditimbulkan oleh IFNO'. Salah satu zat irnun yang telah banyak dimanfaatkan di negara-negara maju adalah interferon alfa 2 manusia (Millar et al. Selanjutnya 1FNu2 hasil ekspresi dapat dimanfaatkan secara luas untuk mengobati penyakit tumor dan penyakit akibat virus. 1994). Jalan keluar yang dapat ditempuh untuk mengatasi rnasalah tersebut adalab swasembada .z belum dimanfaatkan secara luas di Indonesia. padahal kebutuhan akan 1FNu2 sernakin meningkat seiring dengan meningkatnya jumlah penderita penyakit tumor dan penyakit yang diinduksi oleh VIruS. AgarwaJa & Kirkwood.!i)-T. Sejak dua dekade terakhir. Penelitian ini rnerupakan tahap awal dari serangkaian peneiitian tentang IFNcxz yang bertujuan untuk rnemproduksi 1FNu2 dengan teknik DNA rekombinasi melalui ekspresi gen 1FNu2 dalam suatu vektor ekspresi. sumber daya manusia.S. Pada dasarnya IFN merupakan sekelompok protein dan glikoprotein yang diproduksi oleh sel mamalia dalam rangka merespon sejumlah penginduksi (Sattayasai. Teknologi DNA rekornbinasi yang diperlukan untuk produksi IFNu2 baru dimanfaatkan di Indonesia dalam beberapa tahun terakhir. Food and Drug Administration sebagai salah satu obat antitumor dan antivirus pada bulan Juni 1986 dan telah banyak diproduksi oleh negara-negara maju (Gutterman.

yairu IFNo:.. yaitu tahan terhadap kondisi asarn dan keduanya menggunakan reseptor yang sama. 1985 Antara tahun 1979 dan 1982. Akibatnya penggolongan pada Tabel 1 yang awalnya hanya didasarkan pada kriteria serologis. TabeI 2. dan IFNy. sekucns DNA manusia yang menyandi kode genetik untuk pernbentukan IFNo:. Ciri-ciri umum gen IFN manusia Panjung Tipe Jumluh 11111"011 IFN CI mature Protein (au) Gell > 13 Panjang peptida Sinyal (aa) Leuik o 0 3 165. 198 I). IlJli:'i terdapat Pada genom manusia paling scdikit I.. Tabel Tire IFN CI. dan 6 pseudogcn dengan homologi Sel yang memproduksi Leukosit (kemungkinan Komponen mukrofng) p y Ll mfoblnstoid Sel pad a jaringan padat Stimulus Sel T (dibantu oleh makrofug) anligenik Surnber . Enam buah pseudogen tersebut kadangkadang tidak digolongkan ke dalam gen IFNa. IFNP. Struktur dan Keragaman Gen Interferon Manusla Gen IFN dari beberapa spesies hewan (manusia. coli. melainkan menyerang sel inang yang terinfeksi virus sedernikian rupa. Terdapat tiga jenis lFN. tetapi struktur umum gen IFN~ mirip dengan IFNa. IFNa.. IFNro sering dikaitkan dengan IFNa. I.Dijkmans & Silli!IU. hanya sekitar 45 %. berkelorupok dalam kromosorn 9 dan tidak memiliki intron (Dijkrnans & Billiau. tikus. 1994).. Gen ini mcnyandi 187 asam amino dengan 21 asarn amino pertamanya merupakan peptida sinyal. sehingga digolongkan sebagai IFN tipe. Beberapa karakteristik gen IFN manusia (Hu-IFN) dan protein yang dihasilknnnya disajikan pada Tabcl 2. Sel-sel tumor lebih sensitif terhadap IFN dibandingkan dengan sel-sel normal karena kemungkinan besar IFN merupakan tumor supressor yang potensial.2 yang rnenginfeksi sel-sel tubuh. Homologi gen IFN~ dengan gen IFNa. IFN juga memiliki efek antitumor. sehingga sel-sel tersebut tidak dapat lagi ditempati oleh virus tersebut. kernudian dinyatakan keabsahannya oleh data asam nukleat penyusun masing-rnasing tipe IFN. Gen IFNy hanya merniliki sedikit kerniripan dengan gen IFNo:. dan sapi) Lelah diklon dan dianalisis.. Tipe-tipe IFN yang dapat menginduksi efek antivirus dan antitumor pad a sel-sel vertebrata disajikan pada Tabel I. coli. . sedangkan IFNy berbeda dengan kedua tipc IFN yang lain karena tidak tahan terhadap kondisi as am dan menggunakan rcscptor yang bcrhcda. I985). letapi digolongkan ke dalam kelornpok tersendiri yang disebut sebagai IFNw. Hal ini mencerrninkan kemampuan IFN untuk mengatur ekspresi gengen yang spesifik dan aktivitas metaboIik pacta sel-sel sasaran. IFN~. sehingga gen IFN tersebut dapat diekspresikan di dalam E. Sampai saat ini hanya satu gen IFN~ manusia yang diternukan. dan IFN~. schinggu digolongkan ke dalam IFN tipc II. Gen IFNo:. gen ini juga tidak memiliki intron dan terletak dalarn kromosorn 9. SeIain efek antivirus.. Gen IFNy terletak pada kromosom 12 dan merniliki 3 intron dalam . tetapi hanya gen IFN manusia yang paling banyak diketahui saat ini. Produk gen ini adalah polipeptida dengan 188 atau 189 asarn amino dengan 23 asam amino pertarnanya merupakan peptida sinyaJ yang bersifat hidrofobik. atau disebut pseudogen karena susunannya menyerupai IFNa dan diproduksi oleh Ieukosit (Stites et al. Klasifikasi Penginduksi Virus Virus interferon (IFN) 13 gcn IFNa. sekuens nukleotidanya 85-95% (Lawn et al. 1982). dan IFN~ sifatnya mirip.166 166 146 D 21 20 Krouuisom \) ~ 'Y Kromusosu <) Kromusum 12 Sumbcr: Dijkmans & BilliutI. dan IFNy diperoleh dengan teknik kloning. Sarna seperti gen IFNa. Teknik kloning tersebut dilakukan dengan cam rnemasukkan gen IFN ke dalam plasmid E. Peptida sinyal ini akan dilepaskan pada saat protein ini ditransportasikan keluar sci rnenghasilkan INFiX yang terdiri dari 165 atau 166 asam amino. Beberapa gen IFN juga dimasukkan ke dalam vektor yang memungkinkan ekspresi gen tersebut di dalam sel rnamalia atau di dalam sel ragi (Gray et al.

Dcnaturasi dilakukan pada suhu 9095°C. yaitu pernbukaan rantai DNA utas ganda. sedangkan IFNu2 a tidak ditemui pada populasi ini. dan 1FNa2 e. Basa nitogen dari nukleotida ke-137 pada IFNu2 a diisi oleh adenin (A). Mullis pada tahun 1983. (1994). Teknik ini diternukan oleh Kary B. Polymerase Chain Reaction Teknik Polymerase Chai/l Reaction (PCR) merupakan salah satu teknik utama yang digunakan pada penelitian ini. Tahap-tahap pada teknik PCR disajikan pada Gambar !. Hasil penelitian tersebut mendukung hasil penelitian Kaluz et al. Hasil penelitian menunjukkan bahwa 1FNa2 im berperan dalam pengobatan beberapa penyakit. DNA polimerase yang digunakan berasal dari E. tidak rnenggunakan enzim ligase dan primer RNA (Watson et al. Basa nitrogen dari nukleotida ke-170 pad a 1FNa2 a dan 1FNa2 b diisi oleh adenin (A). Suhu ini merupakan suhu optimum untuk kerja enzim Taq DNA polimerase.. kemudian menaikkan dan rnenurunkan suhu campuran secara berulang selarna beberapa jam sampai diperoleh jumlah sekuens DNA yang diinginkan. Ketiga tahap tersebut dilakukan berulang kali dalam mesin PCR. Selanjutnya subu rcaksi diturunkan untuk penernpelan primer oligonukleotida pada sekuens yang komplementer pada molekul DNA cetakan. dan enzim terrnostabil Taq DNA polirnerase dalam larutan bufer yang sesuai. (1995). dan penyembuhan pasien setelah operasi melanoma (Kirkwood et al. annealing. yaitu 1FNu2 a. antara lain myeloma (Mandelli. chronic myeloid leukimia (Talpaz et al. Penggunaan teknik PCR ini dalam bidang biologi rnolekuler sernakin meluas. Oleh karena itu enzim tersebut . 1991).000 manusia sehat menunjukkan bahwa gen 1FNa2 b merupakan sub varian yang paling banyak terdapat pada DNA genom sarnpel tersebut. 1FNu2 merupakan protein yang terdiri dari 189 asam amino dengan 23 asam amino pertamanya merupakan peptida sinyal. Sekuens ketiga subvarian tersebut san gal mirip. follicular lymphoma (Solal-Ccligny et al. Teknik yang menciptakan terobosan baru di bidang genetika ini merupakan suatu leknik arnplifikasi sejurnlah kecil sekuens DNA ill vitro secara sensitif dan spesifik. coli. Tahap terakhir dari satu siklus PCR adalah tahap ekstensi yang dilakukan pada suhu 72°C. Suhu annealing untuk setiap sekuens DNA sifatnya spesifik dan mcrupakan penentu utama keberhasilan suatu reaksi PCR. bergantung kepada jumlah DNA yang diinginkan. 1992). (1995) menggunakan sampeJ darah dari 28. 1996). Penyebabnya adalah kesederhanaan teknik tersebut dan tingginya tingkat kesuksesan amplifikasi sekuens DNA yang diperoleh (Saiki.. 1FNa2 b. Gewert et al. Tahap ini disebut annealing. yaitu bahwa IFNaz mengandung tiga buah subvarian (IFNu2 a. penernpelan primer. Secara ringkas. Pada awal ditemukannya teknik PCR. 1FNu2 tcrdiri alas tiga buah subvarian. 200 I). I %).. 1998). sedangkan pad a 1FNa2 e diisi oleh guanin (0). 1989). DNA polimerase ini bersifat sangat sensitif terhadap panas dan rusak pada suhu denaturasi utas ganda DNA. 1FNu2 e diternui pada sejumlah keeil sarnpel « 0. dan ckstcnsi.3 dacrah penyandi protein.. 1FNa2 b. pada umumnya antara 25 sampai 40 siklus. Satu siklus pad a teknik PCR terdiri dari tiga tahap. Gen ini menyandi protein dengan 166 asam amino dengan 20 asam amino pertamanya merupakan peptida sinyal. Menurut Kaluz et al. Hanya saja pada teknik PCR.. 1990). teknik PCR dilakukan dengan cam mencampurkan sampel DNA dengan primer oligonukleotida. yaitu denaturasi. deoksiribonukieotida trifosfat (dNTP). Pada tahap ekstensi terjadi sintesis DNA yang komplernen dengan DNA cetakan. Interferon Alfa 2 IFNa2 rnerupakan produk salah satu gen IFNu. dan perpanjangan rantai DNA bam oleh DNA polimerase dari arah 5' ke 3'. sedangkan pada IFNu2 b dan 1FNa2 e diisi oleh guanin (G). (1995) meneliti subvarian 1FNa2 dari DNA genom manusia Afrika dan Afro-Caribian. Perbedaan sekuens ketiganya terletak pada nukleotida ke-137 dan nukleotida ke-170. Hasil penelitian yang dilakukan oleh Lee et at. (1994) dan Lee et at. sehingga tcrjadi pcmisahan utas ganda DNA menjadi dua utas tunggal DNA yang merupakan cctakan (template) tempat penempelan primer dan tempat kerja DNA polimerase. 1993). dan 1FNu2 c) dan IFNu2 b merupakan subvarian yang paling banyak ditemui. terapi penderita hepatitis C (Colier et al. Pada dasarnya reaksi PCR mengambil pnnsip replikasi DNA. Kaposi's sarcoma (Borden.

antara lain memiliki susunan basa yang acak. yaitu plasmid. memiliki jurnlah purin dan pirirnidin yang seimbang. Pada umumnya panjang primer yang digunakan berkisar antara 20 sarnpai 30 basa. Ligasi adalah pemasukan sekuens DNA yang diinginkan ke dalam suatu vektor. Kloning yang dilakukan pada penelitian ini menggunakan vektor berupa plasmid. . Ligasi menghasilkan produk yang disebut dengan DNA rekombinan. Plasmid adalah DNA utas ganda sirkular yang berukuran dari I sampai 250 kb dan memiliki paling sedikit satu ori (origin of replication). transforrnasi. dan yeast artificial chromosomes (Voet & Voet. yaitu ligasi. 3'~' ~A3' DNAinsert Klon ~ ~ Annealing Gambar 2. maka ia tidak perlu ditambahkan pada setiap siklus. DNA polimerase tersebut dapat tetap aktif sampai suhu 95°C (Saiki et al. transforrnasi adalah pemasukan DNA rekombinan ke dalam suatu sel kornpeten. 1989). Oleh karena kerja Taq DNA polirnerase tidak dipengaruhi oleh suhu denaturasi utas ganda DNA. dan seleksi (Gambar 2). Tahapan teknik kloning. 1988). 1994).. 1989). Selain itu spesifisiras. Teknik kloning merupakan bagian terpenting dari teknologi DNA rekornbinasi (Sambrook et al. Hal Ill! berpeluang mengakibatkan terjadinya kesalahan apabila beberapa sampel diamplifikasi seeara simultan. Ligasi Ligasi adalah pemasukan sekuens DNA yang mengandung gen diinginkan ke dalam DNA genom dari suatu elernen gcnetik yang dapat bereplikasi sendiri (vektor). Tahapan reaksi pada teknik Polymerase Chain Reaction (peR). dan panjang sekuens DNA target yang akan diamplifikasi juga meningkat. memiliki titik leleh yang hampir mendekati satu sama lain. sedangkan seleksi adalah pernilihan sel-sel yang mengandung DNA rekombinan. Adanya ori mengakibatkan plasmid dapat bereplikasi sendiri di dalam sel inangnya dan tidak bergantung pada Gambar I. dan sedikit rnungkin rnerniliki susunan basa yang komplementer (Saiki. Teknik ini meliputi tiga tahap. bakteriofag. Primer oligonukleotida yang digunakan dalam teknik peR hams memenuhi beberapa syarat.4 harus ditambahkan secara manual untuk setiap siklus. sehingga tidak terjadi polipurin atau polipirimidin. Modifikasi ini mengakibatkan penyederhanaan prosedur karena pelaksanaan peR dapat dilakukan secara autornatis. Kloning Klon adalah sekumpulan organisme identik yang berasal dari satu sumber (Alberts et al. hasil.. 1994). Penggunaan DNA polimerase E..coli kemudian digantikan oleh DNA polimerase yang dimurnikan dari bakteri terrnofilik Thermus aquaticus (Taq). sensitivitas.

misalnya ampisilin.5 kromosom utama sel inang tersebut. (1990) rnengemukakan cara transforrnasi rnenggunakan penembakan sel target dengan mikroproyektil berkecepatan tinggi. Plasmid ini pada umumnya mengandung satu atau lebih gen yang menyandi ketahanan (resistensi) terhadap antibiotika. Antibiotika yang ditambahkan ke dalam media LB bergantung pada jenis plasmid yang digunakan. misalnya EcoRI. Seleksi 101 pada umumnya dilakukan dengan menggunakan media LB yang mengandung antibiotika. Metode transformasi yang digunakan pada penelitian ini adalah metode kejut pa~as (heat shocks. . Kedua basa ini dimanfaatkan untuk berkomplemen dengan ujung-ujung sekuens DNA hasil PCR yang selalu memiliki sebuah basa adenin (A) yang menggantung (overhang). Konstruksi vektor pOEM-T. Pada umumnya plasmid yang digunakan mengandung gen yang menyandi ketahanan terhadap ampisilin. Ligasi menggunakan plasmid alami pada umumnya dilakukan dengan memo tong plasmid dan DNA yang akan disisipkan (insert) dengan enzim restriksi yang sarna. (1985) sebagai salah satu met ode transforrnasi yang dapat dilakukan terhadap sel hewan. Cara lain untuk transformasi dilakukan dengan metode elektroporasi. Metode mikroinjeksi yang dilakukan dengan menginjeksikan molekul DNA langsung ke dalarn nukleus sci target menggunakan jarum yang sangat runcing dikemukakan oleh Hammer et al. Boynton et al. Selanjutnya plasmid dan DNA insert dilekatkan dengan enzim ligase. (1988) & Daniell et al. Pada masingmasing ujung plasmid yang terbuka terdapat basa timin (T) yang menggantung (overhang). 1988). Proses ini disebut transformasi. Pada penelitian ini vektor yang digunakan berupa plasmid sintetik yang bernama pGEM®-T. Seleksi Tahap terakhir pada teknik kloning adalah seleksi sel-sel yang mengandung plasmid rekombinan. sedangkan sel-sel yang mengandung plasmid dapat berkernbang biak dengan baik pada media tersebut. sehingga media yang digunakan adalah media LB-ampisilin. dan kloramfenikol. Penggunaan pOEM®-T lebih menguntungkan dibandingkan dengan plasmid yang lain karena plasmid ini bentuknya sirkular terbuka. Plasmid yang lazim digunakan dalam teknik kloning adalah plasmid yang berukuran kurang dari 10 kb dan terdapat dalam jumlah yang cukup banyak di dalam satu sel inang (Brown. Mikroproyektil tersebut pada umumnya terbuat dari logarn tungsten atau emas yang diselubungi oleh produk ligasi dan ditembakkan dari penembak partikel. gcn ketahanan terhadap ampisilin (Amp'). sehingga tidak perlu dipotong dengan enzim restriksi. sehingga sel inang yang mengandung plasmid dapat bertahan dalam lingkungan yang mengandung antibiotika tertentu. Plasmid ini berukuran 3000 pb dan konstruksinya dapat dilihat pada Gambar 3. Teknik ini dikenal dengan teknik biolistik dan saat ini telah banyak diterapkan untuk transformasi produk ligasi ke dalam berbagai jenis sel. dan beberapa situs pemotongan enzim restriksi. Sel-sel yang tidak mengandung plasmid tidak akan dapat berkembang biak pada media Lls-antibiotika. Transformasi Plasmid rekombinan yang dihasilkan dari hasil ligasi selanjutnya dimasukkan ke dalarn sel kompeten (sel yang telah memperoleh perlakuan kimiawi atau perlakuan fisik tertentu yang meningkatkan kemampuan sel tersebut untuk mengambil DNA). Seleksi dengan rnenggunakan media LB- Oambar 3. lalu dikejutpanaskan (heat shock) pada suhu 42()C selama 45 detik. tetrasiklin. Vektor pGEM®-T memiliki dua buah ori. Transforrnasi produk ligasi ke dalam sci kompeten dapat dilakukan dengan cam mencampurkan sci kompeten dengan plasmid DNA dalam larutan kalsium klorida. basa timin (T) yang menggantung (overhang) di tengah-tengah gen laeZ. yaitu transfer DNA melalui Iubang semen tara pada membran sel yang diinduksi oleh pulsa elektrik pendek (Calvin & Hanawalt. 1995). kernudian menggabungkan DNA insert dan plasmid dengan enzim ligase.

Hal ini akan mcnghasilkan sekumpulan fragmen berland a radioaktif yang panjangnya tergantung pada jarak aniara Ietak basa yang dihilangkan dengan ujung molekul yang bcrtand a radioaktif (Maxam & Gilbert. Metode sekuensing yang banyak dilakukan saat ini adalah metode Sanger yang dirnodifikasi untuk memperbaiki sensitivitas dan efektivitas analisisnya. Sekuens DNA dapat dibaca dari hasil pernisahan fragmen-fragmen yang terbentuk pada gel poliakrilamida. dNTP. suatu molekul yang mirip dengan galaktosa dan IPTG (isopropiltiogalaktosida) yang merupakan inducer enzim ~-galaktosidase. 1978). dan enzim DNA polimerase. rnaka gen laeZ akan terekspresikan dan enzim ~-galaktosidase akan dihasilkan. maka gen laeZ tidak akan diekspresikan dan enzim ~-galaktosidase tidak terbentuk. tetapi sel yang mengandung plasmid rekombinan akan mati. Sekucnsing Penentuan sekuens DNA atau RNA yang menyandi pembentukan protein dan RNA dikenal dengan teknik sekuensing. Pad a metode Maxam-Gilbert. 1977). satu jenis ddNTP. Modifikasinya terletak pada penggunaan ddNTP yang bertanda zat fluoresen. Metode seleksi dengan antibiotika kcdua diterapkan pada plasmid yang memiliki minimal 2 gen yang menyandi ketahanan Lcrhadap antibiotika. Masalah yang timbul kemudian adalah memisahkan sel yang mengandung plasmid rekombinan dengan sci yang mengandung plasmid tanpa insert. sehingga berbentuk sirku!ar yang dapat pula masuk ke dalam sel kornpeten. Penempelan ddNTP pada DNA cetakan sama efisiennya dengan penempelan dNTP pada DNA cetakan tersebut. Oleh sebab itu. Selanjutnya ditarnbahkan piperidin yang akan mernutus rantai DNA pada ternpat basa yang dilernahkan ikatannya tersebut. sel yang tidak mengandung plasmid rekombinan akan tetap bertumbuh. Gugus hidroksil 1111 diperlukan untuk penempelan nukleotida berikutnya untuk pernanjangan utas komplcmenter. dan selanjutnya oleh kerja enzim DNA polimerase. DNA yang akan disekuensing dibagi ke dalam empat tabung. Reaksi setiap basa dengan zat warna fluoresen tersebut akan memberikan sinyal fluoresensi yang berbeda. J 977). DNA utas ganda mula-mula didenaturasi menjadi dua buah utas tunggal. Akibatnya akan dihasilkan berbagai fragmen bertanda radioaktif yang berbeda-beda panjangnya (Sanger. Apabila sel yang mengandung plasmid tanpa insert dtumbuhkan pada media tersebut. Metode Maxam-Gilbert didasarkan alas destruksi bas a seeara kimiawi. kemudian DNA tersebut didenaturasi dan dibagi ke dalam cmpat tabung reaksi. Dua buah metode sekuensing DNA dikembangkan pada tahun I970-an. kemudian salah satu utas lunggal DNA ditempeli primer yang bertanda radioaktif. yaitu metode Maxam-Gilbert dan metode Sanger.6 ampisilin dapat membedakan sel-sel yang mengandung plasmid dengan sel-sel yang tidak mengandung plasmid. I995). Penempelan ddNTP pada DNA eetakan mengakibatkan penghentian sintesis utas yang komplementer dengan DNA cetakan. Masing-masing tabung berisi primer bertanda radioaktif'. dapat diarnbil kesimpulan bahwa seleksi menggunakan blue white screening akan mernberikan warn a biru untuk sel yang tidak mengandung plasmid rekombinan dan warna putih untuk sel yang mengandung plasmid rekornbinan (Brown. Enzim ini akan memeeah X-gal dan menghasilkan senyawa yang berwarna biru. Penye!esaian masalah ini dapat dilakukan dengan seleksi plasmid menggunakan aruibiorika kedua atau rnengggunakan blue-white screening. DNA yang akan disekuensing ditandai dengan J2p. sehingga keempat basa terse but . Apabila sel yang mengandung plasmid rekombinan ditumbuhkan pada media tersebut. sedangkan metode Sanger didasarkan alas penghambatan sintesis nukleotida akibat adanya persaingan antara dNTP dengan ddNTP. Pada metode seleksi dengan antiblotika kedua. Pemisahan fragmen-fragmen tersebut dilakukan dengan gel poliakrilamida (Sanger & Coulson. Pada metode Sanger. Masing-masing tabung direaksikan dengan bahan-bahan yang secara spesifik melernahkan ikatan antara satu atau dua dari empat basa yarig terdapat di dalam DNA. Hal ini disebabkan karena ddNTP kehilangan gugus hidroksil pada atom karbon nornor 3 dari komponen gulanya. maka digunakan media yang mengandung X-gal {5-bromo-4-kloro-3-indolil~-D-galaktopiranosida}. yaitu plasmid yang mengalami swaligasi (self-ligated vector). Untuk seleksi menggunakan blue white screening. Metode yang dipilih bergantung pada jenis plasmid yang digunakan. primer diperpanjang dengan dNTP atau ddNTP yang tersedia.

IF-2. Contoh hasil pemisahan fragmenfragmen DNA dan sekuensnya.. dengan metode ini. .X174 DNA/Hae III. "'6 "'6 .7 dapat dibedakan. dan etidium bromida.. dan X-gaL Bahan yang digunakan untuk isolasi plasmid adalah Larutan I (Tris-HCl pH 7. sedangkan kolom QlAquick (Qiagen) digunakan untuk pemurnian produk PCR dan plasmid basil isolasi. .. MgCh 50 mM. EDTA 0. etanol 70%. Untuk sekuensing digunakan Automatic DNA Sequencer ABlPrism 377 (Perkin EImer).002 M pH 8. dan ddNTP yang telah diberi senyawa fluoresens). SP6... gel agarosa 1%. . sedangkan bahan yang digunakan untuk PCR adalah bufer PCR (KCI 500 mM. .25%. -.09 M.4). Peralatan lain yang digunakan adalah tabung mikrofuge .. etanol absolut. GIIIIIIlIII> .. bufcr TE... loading buffer (bromfenol biru 0. sctiap sampel hanya perlu direaksikan satu kali (tidak perlu dilakukan pernisahan antara basa yang saru dengan yang lainnya) dan hasilnya dapal dipisahkan dengan baik oleh gel poliakrilamida.N.... isopropanol. Larutan II (0... . akuabides steril. Adapun bahan yang digunakan untuk elektroforesis gel agarosa tersebut adalah agarosa tipe II (Sigma).. Konfirrnasi hasil kloning dilakukan dengan teknik PCR. Gel: G T A . dNTP. bacto yeast extract.. sedangkan bahan yang digunakan untuk tahap transforrnasi dan tahap seleksi adalah sel Ecoli kompeten DH5a. 15% sukrosa). dan LB padat yang tersusun dari bahan yang sama seperti LB cair hanya terdapat penambahan bacto agar... . dan buffer TE (TrisHellO mM pH 8... Bahan yang digunakan untuk sekuensing adalah perangkat pcmurnian QIAquick (Qiagen). Tris-HC! 10 mM pH 8. microwave (Nasional). Bahan yang digunakan untuk tahap ligasi adalah vektor pGEM®-T... TBE. akrilamida 40%.. RNase 5 mg/ml. Contoh hasil pemisahan fragrnen[ragmen DNA dengan gel poliakrilamida dan pernbacaan sekuensnya disajikan pada Gambar 4. larutan TBE (Tris-borat 0. ammonium asetat 5 M. 10 mM EDTA.. TEMED (N. standar DNA q.. dan bufer. Peralatan Peralatan yang digunakan untuk PCR adalah thermocycler peR (GeneAmp® PCR System 9700 Perkin Elmer) dan tabung PCR 50 Ill. -C . Oleh karena itu. enzim ligase.. <IIIIiIIIIII> II n T C G C C T GCGAATGCGTCCACAACGCTACAGGTG GCGAATGCGlCCACAACGCTACAGGT GCGAAlGCGTCCACAACGCTACAGG GCGAAT6CGTCCACAACGCTACAG GCGAATGCGTCCACAACGCTACA GCGAATGCGTCCACAACGCTAC GCGAATGCGTCCACAACGCTA GCGAATGCGTCCACAACGCT GCGAATGCGTCCACAACGC GCGAATGCGTCCACAACG GCGAATGCGTCCACAAC GCGRATGCGTCCACAII GCGRATGC6TCCACII GCGAATGCGTCCAC GCGAATGCGTCCn GCGAATGCGTCC GCGARTGCGTC GCGAATGCGT GCGAATGCG QCGAATGC GCGAAlG GCGAAT Gambar 4. larutan pelisis sel darah merah. dan sepasang primer 40 pmol. etano] absolut. natrium asetat.5. Tris-HCI 100 mM pH 8. ampisilin (100 1l1/IllI).N'N'tetrametilenetilendiamina) dan APS (amonium persulfat) 10%. NaCl.5.. BAHAN DAN METODE Bahan Bahan yang digunakan untuk isolasi DNA adalah sampel darah vena manusia. sedangkan untuk elektroforesis gel agarosa adalah perangkat elektroforesis (Bio Rad). yaitu primer M 13-1' dan M 13-r.2 M NaOH.. Iarutan fcnolkloroforrn (I: 1).. dan kamera UV (Bio Rad Gel Doc 1000). sehingga bahan yang digunakan sama scperti bahan PCR umum hanya primer yang digunakan berbeda.. .. C A T C G C 11 . Spektrofotometer (Ultraspsec IIlPharmacia) digunakan untuk mengukur kadar dan kemurnian DNA.. medium Luria Bertani (LB) cair steril yang terdiri dari bacto tripton. ready mix (AmpIiTaq. loading buffer (50 mg/ml blue dekstran dalam larutan EDT A 25 mM yang rnengandung dimetilforrnamida dengan nisbah 1:5). primer T7.0). Iarutan pelisis sel darah putih.6 dalam asam asctat glasial). Elektroforesis gel agarosa dilakukan untuk memeriksa hasil PCR. Lannan III (3 M Na asetat pH 4. akuabides steril.... sukrosa 40% (w/v)). -G . dan RNase. Teknik kloning dilakukan dalarn tiga tahap.0. dan IR-2.. EDTA I mM)....l. . Taq DNA polimerase 5 unit/p. 1% SDS). etanol 70 %.. dNTP 10 mM.. IPTG.

incubator shaker (New Brunswick Scientific). Tabung berisi sampel selanjutnya disentrifugasi pad a 1. lalu diisolasi dengan reknik miniprep. Inkubasi pada suhu Studi Bioinformatika Studi bioinformatika yang dilakukan pada awa! penelitian bertujuan untuk rnernperoleh sekuens DNA yang mengkode IFNo:2 Studi ini dilakukan melalui penelusuran di internet pada situs Gene Bank National Center for Biotechnology Information (NCB I) dengan alarnat www ncbi. Selanjutnya dua buah plasmid hasil isolasi yang mcnunjukkan ukuran insert yang tepat dianalisis dengan teknik sekuensing agar diketahui urutan nukleotidanya. Hasil studi ini < . Hasil pemurnian disisipkan ke dalam vektor pGEM®.8 (eppendorf). inkubator (Thermolyne). Ukuran insert dalam plasmid hasil isolasi dikonfirmasi kembali menggunakan PCR. penangas air (Forma Scientific). Supernatannya dibuang dan peletnya diberi 1.d larutan pelisis sel darah putih lx. studi bioinformatika tersebut digunakan untuk mensintesis sepasang primer yang diperlukan untuk rnengisolasi sekuens IFNa.2. dan vortex (Thermolyne).250 I. tabung falcon. coli DH5a. lalu dikocok dengan pipet transfer sampai larutannya homogen. Sel-sel tertransformasi till kemudian ditumbuhkan pada media agar LB yang mengandung ampisilin. DNA hasil isolasi ini digunakan sebagai DNA cetakan untuk PCR. dengan mctode kejut panas (heat shackedi. Secara keseluruhan metode penelitian disajikan pada Gambar 5. untuk sintesis sepasang primer untuk sekuens gcn IFNo:z dengan teknik Isolasi DNA ini diawali dengan studi bioinforrnatika yang bertujuan untuk memperoleh DNA manusia yang rnengkode IFNa. Langkah !Ill diulang 2-3 kali sampai supernatannya jernih.500 rpm selama 10 menit. pipet mikro (eppendorf).. Plasmid DNA rekombinan hasil kloning diseleksi. Sebanyak 5 III RNAse (5 mg/ml) ditambahkan ke dalam tabung.T melalui reaksi ligasi. dan X-gal selama semalam. kemudian diinkubasi selama 10 menit pada suhu kamar sambil diaduk beberapa kali.nih. pornpa vakum (BioRad). lalu diaduk beberapa kali.? dari DNA genom dengan teknik PCR. sehingga menghasilkan plasmid rekombinan yang selanjutnya ditransformasikan ke dalam sel bakteri E. sentrifuse (eppendorf ripe 5403. Du Pont). Diagram IFNa. speed vac (Shelby).falcon 50 ml yang berisi IS ml larutan pelisis sel darah merah I x. Hasil sekuens Seleksi Isolasi plasmid rekombinan Gambar 5. Apabila hasil analisis ini menunjukkan fragrnen DNA diinginkan (yang menyandi gen IFNa(2). Garis Besar Kegiatan Pcnelitian digunakan amplifikasi PCR. Sorvall" MC J2V. Darah vena sebanyak 5 lUI dimasukkan ke dalam tabung . DNA genom diisolasi dari darah vena manusia dcngan metode Bohringer Maneheim.nlm.gov.z· alir metode penelitian Isolasi DNA Genom DNA genom diisolasi dari darah vena. IPTG. Selanjutnya produk PCR dipisahkan dengan elektroforesis gel agarosa. maka DNA ini kemudian dimurnikan dari komponen-komponen reaksi PCR dengan menggunakan perangkat QIAquick. dan tipe 54l5C berpendingin.

kemudian dimasukkan ke dalam sumursurnur tempat aplikasi sampel. Prod uk PCR dilarutkan dalam bufer . sedangkan pada siklus terakhir dilakukan pemanjangan waktu ekstensi selama [0 rnenit (Gambar 6). Pasangan primer yang digunakan adalah IF-2 dan IR-2 (Lampi ran 1). Setelah kering. DNA hasil isolasi ini disimpan pada suhu -20°C.5 III Taq DNA polimerase dalam akuabides steri!. 1 )11dNTP lO mM.165 III etanol 70 %.O(} Garnbar 6. Gel agarosa dibuat dengan cara melarutkan 0. Pradenaturasi dilakukan selama 5 menit.5 )11 primer IR-l 40 pmol. lalu sebanyak 2.5 Jll etidium bromida ditarnbahkan ke dalam larutan gel agarosa tersebut. Dalam hal ini dilakukan optirnasi suhu annealing agar dihasilkan produk yang optimum. Metode yang digunakan untuk teknik PCR ini adalah metode Saiki et al. PCR untuk amplifikasi gen yang diperoleh diukur kadar dan kernurniannya bcrdasarkan mctodc Sambrook et al. kemudian gel dibiarkan membeku selama setengah jam atau lebih. Elektroforesis dijalankan pada tegangan 80 V selama 48 rnenit. Visualisasi pita DNA dilakukan dengan lampu UV pada panjang gelombang 300 nm. Supcrnatannya dituang ke tabung baru yang berisi 3850 111 isopropanol dan dikocok sampai DNA-nya terlihat. Jumlah siklus yang digunakan untuk mengarnplifikasi gen 1FNa2 adalah 30 siklus. (1989). Polymerase Chain Reaction (peR) Gen 1FNu2 dikeluarkan dari DNA genom rnanusia dengan teknik Polymerase Chain Reaction (PCR). Sebanyak [0 )11 sampel DNA dicampur dengan 2 )11 loading bufer. (1988).5 )11MgCl2 50 mM. 94°CI 94°C 5:00: 1:00 I I I I I I I I I 54-56°C I.25 g agarosa dalam 25 1111 bufer TBE rnclalui pemanasan dengan oven microwave. Kemurnian larutan DNA dihitung dengan mernbandingkan absorbanss pada panjang gelombang 260 nm dengan absorbanss pada panjang gelornbang 280 nm. Kadar larutan DNA diukur dengan spektrofotomcter pada panjang gelombang 260 Deteksi Produk PCR dengan Elektroforesis Gel Agarosa Prod uk PCR diperiksa dengan tcknik clektroforesis gel agarosa. 4°C selama 15 menit. DNA dilarutkan dalam bufer TE dan diinkubasi pada suhu 37°C selama dua jam. Program 1FNa2. Supernatannya dibuang dan DNA dibilas dengan 4. Tahap denaturasi dilakukan selama 1 menit pada suhu 94°C. annealing. Untuk mengendapkan protein dilakukan penambahan 833 Jll amonium asetat 5 M ke dalam tabung. Setelah beku. gel dimasukkan ke dalam perangkat elektroforesis yang berisi larutan bufer TBE I x . dan 0.S III buffer PCR lax. tahap annealing dilakukan selama I menit Pemurnian produk PCR dilakukan untuk menghilangkan sisa-sisa primer dan pereaksi lain pada proses PCR. Untuk rnembandingkan hasil yang diperoleh digunakan standar DNA ~X174 DNA/Hac III. 0. 1.9 3i'c dilakukan selama 15 menit pada penangas air. Pemurnian Produk peR nm. Satu siklus PCR terdiri dari tiga tahapan. Perbanyakan fragrnen DNA yang mengkode gen 1FNu2 secara in vitro dilakukan dengan menggunakan pasangan primer oligonukleotida sintetik yang membatasi daerah di luar gen tersebut. dan ekstensi. Selanjutnya Iarutan gel dituang ke dalam wadah cetakan gel horizontal dengan sejumlah sumur tcmpat aplikasi sampel. Sentrifugasi dilakukan pada kecepatan 3. Pcngukuran DNA Kadar dan Kemurnian DNA pada suhu 54-56°C. kemudian tabung di-vortcx sarnpai larutan yang terbentuk terlihat seperti susu. 4°C selama 5 menit. Pembuatan campuran reaksi ini semuanya dilakukan dalam keadaan dingin. Hasil visualisasi kemudian direkam dengan menggunakan kamera UV. dan lahar ekstensi dilakukan selama I menit pada 72°C. Komposisi bahan yang diperlukan untuk 50 )11volume reaksi dalam tabung PCR adalah 2 )11sampel DNA. 0.000 rpm.5 JlI primer IF-l 40 pmol. Pemurnian dilakukan dengan menggunakan perangkat QlAquick PCR purification. yaitu denaturasi. Ialu dikeringkan pad a suhu kamar sclama [ jam. Tabung disentrifugasi lagi pada kecepatan 3000 rpm.

5 III primer M 13-r 40 prnol. yaitu debt api. dicampur dengan 800 III media LB cair. Sebagai pembanding.000 rpm selarna satu menit. kemudian dikeringkan dengan speed vac dan disuspensikan kernbali dalam 50 III buffer TE yang mengandung Rnase.000 rpm. Sel dipccahkan dengan mcnambahkan 200 !!l Larutan II. Setelah itu disimpan dalam es selama 5 menit. sehingga produk PCR yang telah dirnurnikan diperoleh pada tabung eppendorf mikrofuge. coli kompeten (DH5a). Peletnya kcmudian disuspensikan dengan sisa supernatannya. Senlrifugasi dilakukan selarna I menit pada kccepatan 14.5 III primer MI3-!. dan X-gal dalam cawan petri sampai rneresap. Lapisan alas dipindahkan ke dalarn tabung eppendorf baru. lalu disentrifugasi pada kecepatan 14. dan 0.000 rpm. digunakan kontrol negatif yang diperlakukan sama seperti sampel. Langkah yang sama juga dilakukan un(uk kontrol negatif. dan penanaman suspensi sel pada media ini dilakukan pada kondisi steril. Pemekatan menumbuhkan Seleksi dan Isolasi Plasmid Rekornbinan Pengujian yang dilakukan untuk memperoleh klon positif (yang rnengandung plasmid rekombinan) diawali dengan mengambil 10 koloni yang dipilih secara acak. Supernatannya dibuang dan kolorn disentrifugasi kembali pada kecepatan 14. Suspensi sel dipekatkan dengan sentrifugasi pada kecepatan 12. I ". Setelah disentrifugasi pada kccepatan 14. I III vektor pGEM®-T. cawan petri ditutup dengan parafilm dan disimpan dalam peudingin (40Q. Sebanyak 1. lalu dikejutpanaskan (heat shocked) dalam penangas air 42°C selama 45 detik. dibiarkan dalam es selama 30 men it. Supcrnatannya kcmudian dibuang dan peletnya disuspcnsikan kernbali dalarn 100 III Larutan I dan diinkubasi dalam es sclama 5 rncnit.000 rpm pada suhu 4°C selama 15 rnenit. supematan diekstraksi dengan larutan fenol-kloroform (I: 1). Campuran reaksi tersebut kemudian diinkubasi sernalam pada suhu 4°C (rnesin PCR). dikocok dan didiamkan pada suhu kamar selama 5 men it.5 ml. kemudian masing-masing koloni ditumbuhkan dalarn media LB cair. Kornposisi bahan dalam satu tabung PCR terdiri dari 21 III ddH20. Plasmid DNA diendapkan dengan penambahan 2 x volume etanol absolut. dan 1 III akuabides steriI daJam tabung eppendorf.000 rpm selama 2 menit dan ± 750 III supernatannya dibuang.75 ml bufer PE. IPTG. suhu 4°C selarna 10 menit. SeJanjutnya ke dalam kolom ditambahkan 0. SeIanjutnya DNA plasmid rekombinan dari kultur diisolasi dengan prosedur lisis basa yang tcrmodifikasi (Sam brook et al. sehingga supernatannya terpisah ke bawah dan dibuang. kecuali tanpa penambahan prod uk PCR (insert). 20 III plasmid hasil isolasi. 1. (1989). lulu diinkubasi lagi dalam es selama 5 menit. 0.· Kolom dipindahkan ke dalam tabung eppendorf mikrofuge 1. Coli koloni sel-sel transform an. Setelah inkubasi. Sebanyak 5 III prod uk ligasi dicampur dengan 50 III sci E. Selanjulnya 150 III Larutan III dirambahkan ke dalam carnpuran dan eampuran diinkubasi lagi dalam cs selama 5 menit.-IdNTP 10 mM.5 !!I MgCI2 50 mM.5 III enzirn Taq DNA polimerase. Plasmid hasil isolasi kernudian diperiksa ukuran insert-eye dengan teknik PCR.10 PB sebanyak 5x voJumenya dan dikocok. lalu Pernasukan plasmid rekombinan ke dalam sel kompeten dilakukan menurut metode Sam brook et al. Ligasi Produk peR dengan Vcktor pGEM®-T Ligasi produk PCR dilakukan menurut metode Sambrook et al.000 rpm. 0. lalu diinkubasi semalam pada suhu 37°C untuk disentrifugasi kembali pada kecepatan 14. 5 III bufer PCR lOx. lalu diinkubasi selama I jam 45 menit dalam incubator shaker pada suhu 37°C pada keeepatan 200 rpm. Pelet yang diperoleh dicuci dengan etanol 70 0/0. 1983).000 rpm selama satu menit. Larutan plasmid rekombinan selanjutnya disimpan pada suhu "20°C. lalu kolom disentrifugasi kembali pada kecepatan 12. 40 pmol.. Suspensi ini disebarkan ke media padat LB yang mengandung arnpisilin.000 rpm selama 3 menit.5 IIII kultur bakteri yang Lelah diinkubasi selama sernalam dalam media LB cair disentrifugasi pada kecepatan 12.000 rpm pada suhu 4°C selama 5 menit. Program peR yang digunakan untuk . lalu dimasukkan ke dalam kolom spin QIAquick dan disentrifugasi selama satu men it pada kecepatan J2. lalu ke dalam kolom ditarnbahkan 20 III bufer EB. I III DNA ligase T4. Transformasi Sel E. (1989) dengan cara mencampurkan 7 III produk PCR dengan I III bufer ligase lOx.

Selanjutnya larutan tersebut dimasukkan ke dalam sumur-sumur gel dan e1ektroforesis dijalankan pada tegangan 1 kV. etanol presipitasi. Konsentrasi gel akrilamida yang digunakan adalah 4%.6 dengan Gambar 8. Hasil PCR dipresipitasi dengan etanol absolut dan I J.11natrium asetat 3 M pH 4. suhu 51°C. Pernisahan fragmen-fragmen DNA dilakukan dengan elektroforesis poliakrilamida (PAGE) (Sanger. Reaksi pertama menggunakan primer SP6. I I I I I Gambar 7. Sebanyak 250 J. Selanjutnya ke dalam campuran tersebut ditambahkan TBE dan akuabides sampai volumenya 50 m!. Selanjutnya dipilih dua klan plasmid rekombinan untuk digunakan pada analisis sekuensing. Prosedur pemurnian plasmid rekombinan sama seperti prosedur pemurnian prod uk PCR. IF-2 untuk reaksi ketiga. perbandingan 10:25: I. Keernpat reaksi tersebut dibedakan dari jenis primer yang digunakan. kemudian dihornogenkan dengan vortex. lalu dipanaskan pada suhu 90 C selama 2 menit dan segera didinginkan dengan es.05 D 60DC I 4:001 00 Sekuensing dilakukan dalam em pat tahap.[[ konfirmasi ukuran insert plasmid rekornbinan disajikan oleh Gambar 7. hanya saja pada tahap awal. Untuk pemisahan dengan .elektroforesis akrilamida. dan IR-2 untuk reaksi keempat) dengan konsentrasi 2 pmol/ul. Campuran tersebut dilarutkan selama 10 menit dan disaring menggunakan filter 0. Purifikasi plasmid rekombinan dilakukan dengan perangkat QIAquick PCi: purification.2 x volume sampel.l1 APS [0% dan 35 J. 3 III ready mix (mengandung AmpliTag ™ dan dNTP yang telah dilabel fluaresens). dan reaksi keempat menggunakan primer IR-2. kemudian disentrifugasi dengan kecepatan 12. daya 50 W. DNA yang diperoleh disirnpan pada suhu _20De. Program PCR untuk sekuensing. dan pernisahan fragmen-fragmen DNA dengan elektroforesis gel poliakrilamida (Sanger. kemudian disentrifugasi pad a kecepatan 12.000 rpm pada suhu 4°C selama 20 menit. reaksi yang kedua menggunakan primer T7. Supernatan dibuang dan peletnya dicuci dengan 250 III etanol 70 %. dan ekstensi dilakukan pada suhu 60°C selama 4 menit.5 g campuran resin. juga ditambahkan larutan NaCI 5 M sebanyak 0. lalu dengan segera campuran tersebut diinjeksikan ke dalarn pelat elektroforesis dengan menggunakan syringe 50 ml dan dibiarkan sampai membeku. 0. selain ditambahkan bufer PB. DNA hasil presipitasi dilarutkan dalam 3 J!l loading buffer. reaksi ketiga menggunakan primer IF-2. . Program PCR yang digunakan untuk sekuensing disajikan pada Gambar 8. annealing dilakukan pada suhu 50°C selama 5 detik. dan daya laser 40 MW selama 7 jam. Denaturasi dilakukan pada suhu 96°C selama 10 detik. yaitu purifikasi plasmid rekombinan. 1978).25 mikron dan pornpa vakum selama 10 menit.11 akuabides. Campuran tersebut diamplifikasi dengan 25 siklus PCR. 1977). 25 rnl akuabides steril. Pelet dikeringkan dengan speed vac selama 7 menit. I III primer (SP6 untuk reaksi pertama T7 untuk reaksi kedua. Program PCR untuk konfirrnasi ukuran insert plasmid rekombinan. PCR sckuensing.11 TEMED ditambahkan ke dalam campuran. dan 5 J. Gel tersebut dibuat dengan mencampurkan 18 g urea.000 rpm pada suhu 4()C selama [0 menit. Pada tahap awal dilakukan pradenaturasi selama 3 menit. Carnpuran itu didiamkan dalam es selama 5 mcnit. PCR sekuensing dilakukan dengan empat macam reaksi. Buffer yang digunakan sebagai jernbatan kanduksi adalah TBE. Campuran reaksi untuk PCR sekuensing adalah I III larutan plasmid rekombinan hasil purifikasi (dari klan positif). 5 ml stok akrilarnida 40%. Hasil Kloning 3:00 l 0: 10 1 1 1 1 1 1 Sekucnsing 50 C 0.

DNA kemudian diendapkan dengan isopropanol.0 dcngan toleransi sebesar 0. dilakukan pemisahan an tara sel-sel darah putih dengan sel-sel darah merah karen a DNA genom manusia hanya terdapat di dalam nukleus sel darah putih. yaitu 840 ng/)ll. maka jumlah DNA cetakan yang digunakan pada tahap peR tidak perlu banyak. Hasil pengukuran menunjukkan bahwa DNA hasil isolasi memiliki kadar yang eukup tinggi (>500 ng/pJ). sedangkan protein dipisahkan dengan pengendapan olch amonium asetat.75. atau 20 ng/)ll oligonukleotida utas tunggal. EDTA bcrfungsi untuk rnengkelat lcgam Mg yang rnerupakan salah satu komponen penting penjaga stabilitas membran sel. Strategi amplifikasi gen 1FNa2. Pad a tahap akhir. maka DNA dicuci dengan ctanol 70% (Moore. 40 ng/)ll DNA utas tunggal. Absorbans sampel pa(ja panjang gelombang 260 nm adalah 0. scdangkan ekor nonpolar SDS berfungsi untuk menarik fosfolipid yang merupakan penyusun utama mernbran sel (Brown.048 menunjukkan jumlah protein pengotor yang terdapat dalam larutan tersebut. Sclanjutnya DNA genom dikeluarkan dari sel darah putih dengan penambahan larutan pelisis sci darah putih.05 (Sambrook et (II. homologi gen Hu-IFNa sangat tinggi. (998). seperti gararn-garam dan molekul-molekul organik keeil. . SampeJ yang mcngandung DNA utas ganda.. Penempelan sepasang primer tersebut pada gen 1FNa2 manusia ditunjukkan oleh Gambar 9. Dua buah pengo tor utama DNA genom adalah RNA dan protein. Nilai kernurnian yang rendah menunjukkan bahwa DNA hasil isolasi lerselubungi oleh protein. sehingga kadar DNA sampel diperoleh dari hasil perkalian antara absorbans pada panjang gel om bang 260 nm dengan faktor pengenceran dan 50 ng/1l1 (Larnpiran 2). 1995). Gen 1FNa2 manusia merupakan salah satu subtipe dari gen IFNa manusia. DNA ini dapat langsung digunakan pada tahap peR karena tidak terlalu rnempcngaruhi cfisiensi proses peR. Apabila kadar DNA sampel cukup tinggi.0.12 HASIL DAN PEMBAHASAN Isolasi DNA Genom: Kadar dan Kemurnian DNA Sebagai tahap awal isolasi DNA genom manusia. DNA dikatakan murni apabila nilai kernurniannya bcrkisar antara 1. DNA genom yang dikeluarkan dari dalarn sel darah putih seIanjutnya dipisahkan dari pengotor. Primer yang digunakan untuk tahap amplifikasi ini adalah primer IF-2 dan IR-2. Teknik peR primer yang 1. Nilai ini menunjukkan jumlah DNA yang terdapat dalam larutan sampel. sehingga larutan tersebut akan masuk ke dalarn sel darah mcrah dan mengakibatkan scl terscbut pecah. yaitu 85-95% (Larnpiran 3). Larutan pelisis sel darah putih mcngandung dua komponcn utarna perusak struktur membran. Dcgradasi RNA dilakukan dcngan penambahan RNase. Kadar DNA dalam sampel diperlukan untuk rnemperkirakan jumlah DNA yang digunakan sebagai DNA cetakan dalam tahap peR. DNA hasil isolasi diukur kadar dan kemurniannya dengan spektrofotorneter pada panjang gelombang 260 nm dan 280 nm (Tabel 3).. yaitu EDTA dan SOS. Pemisahan itu dilakukan dengan penambahan Iarutan pelisis sel darah merah yang diikuti dengan sentrifugasi. Seperti yang telah dikemukakan sebelumnya.8-2. Nilai kemurnian DNA hasil isolasi adalah 1. digunakan Amplifikasi Gen Interferon Alfa 2 Manusia diawali dengan penentuan akan digunakan untuk mengampliflkasi gcn diinginkan. (1989) mengemukakan bahwa I nilai absorbans sebanding dengan 50 ng/)ll DNA utas ganda. 1989). untuk memisahkan DNA dari pengotor-pengotor minor. Peptida sinyal Gen Hu-IFNO:2 Gambar 9. Oleh karena itu untuk mengamplifikasi gen tersebut diperlukan sepasang primer yang sangat spesifik supaya gen yang teramplifikasi adalah gen 1FNa2 dan bukan subtipe IFNa yang lain. Sifat larutan pelisis sel darah merah adalah hipotonis.084. Akibatnya akan tcrjadi penurunan efisiensi amplifikasi DNA pada tahap peR secara drastis. Sambrook et al. Nilai ini diperolch dari perbandingan antara absorbans pada panjang gelombang 260 nm dengan absorbans pada panjang gelombang 280 nm. sedangkan absorbans sampel pada panjang gelombang 280 nm sebesar 0. Karena nilai kcmurnian DNA hasil isolasi mendekati nilai idealnya.

sehingga tidak dapat dipastikan apakah pita itu tersusun dari hasil amplifikasi satu macam gen IFNa at au be be rap a gen IFNa.078 pb S72pb 603 pb 797 pb x x Gambar 10. Arnplifikasi gen 1FNu2 dengan primer IF-2 dan IR-2 akan menghasilkan sebuah produk yang berukuran 797 pb. Hal ini ditunjukkan oleh pita yang cukup tebal an tara 603 pb dan 872 pb. N menunjukkan kontrol ncgatif. produk non spesifik yang yang berukuran sekitar 250 pb dan 900 pb (Gambar lOa). dan 56DC. sehingga suhu annealing merupakan penentu utama keberhasilan amplifikasi. intensitas pita prod uk spesifik yang terbentuk paling rendah bila dibandingkan dengan kedua suhu lainnya. Hasil amplifikasi gen-gen yang ukurannya berdekatan dapat berkumpul di satu tempat yang sarna. b. Jumlah produk non spesifik yang terbentuk berkurang (250 pb). produk non spesifik yang berukuran 900 pb sulit dipisahkan dari produk spesifiknya. Suhu ini dianggap optimum karena pada suhu ini hanya terbentuk produk spesifik dan tidak terbentuk produk non spesifik. 55°C. Hasil amplifikasi DNA sarnpel dengan primer IF-2 dan IR-2 pada 3 macam suhu annealing. rnencakup daerah yang terlalu luas. M mcnunjukkan marker atau penanda. tetapi tidak terbentuk produk non spesifik (Gambar 10c). 55°C. M N S c. Perhitungan Tm untuk primer yang Hasil amplifikasi DNA genom hasil isolasi dengan primer IF-2 dan IR-2 ditunjukkan oleh Gambar 10. Oleh karena itu. Dari Gambar 10. dan 56°C (x mcnunjukkan produk non spesifik yang terbentuk. Pada suhu ini.353 pb 1. Gambar lOa.078 pb 872pb 603 pb 1. dan 10c berturutturut rnenunjukkan basil amplifikasi DNA dengan teknik PCR pada suhu 54°C.13 M N S b. tetapi intensitas pita prod uk non spesifik tersebut bertambah. Pada suhu tersebut juga terbentuk dua buah . Penempelan primer IF-2 dan IR-2 pada subtipe IFNa yang lain juga akan menghasilkan produk yang juga berukuran sekitar 797 pb. Selain itu. Untuk suhu 55°C. dan c berturut-turut mcnunjukkan hasil amplifikasi pada suhu annealing 54°C. Penentuan suhu annealing didasarkan atas nilai Tm (melting temperature) primer yang digunakan untuk amplifikasi. Garnbar a. Ketiga gambar tersebut menjelaskan len lang proses optimasi suhu annealing yang digunakan pada tahap PCR. sehingga suhu ini tidak optimum. Pada suhu 56DC intensitas pita produk spesifik yang terbentuk lebih rendah dibandingkan dengan dua suhu yang lain karena penempelan primer pada DNA cetakan semakin sulit (Gambar IOc). dan S menunjukkan sampeI). suhu denaturasi dan suhu ekstensi pada umumnya tetap. Akibatnya produk non spesifik yang dihasilkan dari hasil amplifikasi sulit dibedakan dari produk spesifiknya apabila sekuens gen yang teramplifikasi adalah sesama sekuens gen subtipe IFNa. x 1. Pada tcknik PCR. lOb. suhu ini juga dianggap belum optimum. dapat diamati bahwa penaikan suhu annealing akan mengurangi jumlah produk non spesifik yang terbentuk. intensitas pita produk spesifik maupun non spesifik yang terbentuk adalah maksimum (Gambar lOb). SeJain itu.353 pb 1. M N S a. Hasil optimasi menunjukkan bahwa suhu annealing yang paling optimum untuk amplifikasi gen 1FNu2 adalah 56°C. Hasil amplifikasi sampel pada suhu annealing 54 DC menghasilkan pita prod uk spesifik yang intensitasnya cukup tinggi. pita produk spesifik yang terbentuk terlalu Iebar.

sedangkan nilai Tm IR-2 adalah 49°C. Purifikasi dilakukan densan '" menggunakan kolom silika.14 tersusun oleh ::. maka gen-gen non spesifik akan teramplifikasi. Volume ini sebanding dengan 1. tetapi pad a prakteknya. Semakin rendah suhu annealing. Komponen lain yang menentukan proses amplifikasi sekuens DNA adalah dNTP dan MgCh.04 x 105 molekul DNA Sementara itu jumlah enzim Taq DNA polimerase yang direkomendasikan untuk PCR oleh Lawyer et.\0 6 molekul. pori-pori sel E. Dengan metode kejut panas ini.. Silika dimanfaatkan karena dapat mcngadsorbsi DNA pada konscntrasi garam yang tinggi. sehingga dapat diperoleh DNA yang murni. Sebaliknya suhu annealing yang tinggi akan rnengakibatkan penurunan efisiensi penempelan primer pacta DNA cetakan. Cara transformasi yang ditempuh pada penelitian ini adalah metode kejut panas. Keberhasilan tahap transformasi diperiksa dengan cawan petri berisi medium LB yang mengandung ampisilin. Kloning diawali dengan memasukkan gen hasil amplifikasi ke dalam vektor pGEM®-T (Iigasi). Penambahan ini dilakukan oleh enzim Taq DNA polimerase secara autornatis. letapi bergan~ung ~epad. Bagaimanapun juga. Kedua primer yang digunakan pada penelitian ini tersusun alas ~ 20 basa. jurnlah DNA yang umum digunakan sebagai DNA cetakan pada tahap PCR adalah se ki uar I O'5 . enzim. primer dimer. Selanjutnya plasmid rekombinan tersebut ditransformasikan ke dalam suatu sel E. Oleh karena itu. 20 basa mengacu kepada metode yang dikemukakan oleh Wallace et al. sehingga keduanya dapat sating berkomplemen dan dilekatkan dengan enzim ligase. tidak mengadsorbsi protein. Oleh karena itu jumlah Mg yang tidak tepat akan mengakibatkan timbulnya produk-produk non s~esifik. dan oligonukleotida y~ng panjangnya < 50 pb. garam.al. Selain itu metode ini juga sederhana.a sifat dan kondisi gen yang akan diamplifikasi. sehingga nilai Tm dihitung berdasarkan nearest neighbor method. sehingga volume DNA yang dibutuhkan sebagai cetakan pada tahap PCR adalah 2 ~l. coli akan membuka dalam waktu singkat dan siap untuk menerima plasmid rekornbinan yang akan masuk.f/e copy DNA genom manusia adalah 3 x 10'. Ampisilin digunakan untuk menapis sel yang mengandung plasmid dengan sel yang tidak . Keempat macam dNTP yang digunakan pada tahap PCR harus mempunyai jumlah yang sebanding supaya tidak terjadi kesalahan penernpelan dNTP pada DNA cetakan. sehingga primer hanya akan menernpel pada sekuens gen yang spesifik. Sementara itu vektor pGEM®-T memiliki keistimewaan yang penting. Kloning Gen hasil amplifikasi dengan PCR harus dipurifikasi terlebih dahulu sebelum diklon.5 Unit/IOO ul larutan. keseluruhan kondisi PCR yang digunakan untuk mcngamplifikasi suatu gcn harus dioptimasi. yaitu tidak perlu melalui pernotongan dengan enzim restriksi tertentu karena setiap ujung 3' gen hasil arnplifikasi dengan PCR rnemiliki tambahan bas a adenin (A). suhu annealing harus dioptimasi agar prod uk yang terbentuk hanyalah produk yang diinginkan. Magnesium (~g) merupakan komponen yang berperan pentmg pada keseluruhan tahap PCR. Secara teoritis suhu annealing adalah 5IDoC di bawah Tm kedua primer. maka jumlah produk yang dihasilkan kurang memadai. IPTG. bahkan pada utas DNA yang spesifik sekalipun. Kadar DNA dalam larutan sampel adalah 840 ng/u].68 ug DNA atau 5. Hal ini dilakukan untuk menghilangkan sisa-sisa primer. sedangkan apabila enzirn yang digunakan terlalu sedikit. Metode ini dipilih karen a mernbran sel Ecoli mudah dibuka hanya dengan kejutan panas. Apabila enzim yang digunakan terlalu berlebih. RNA. sernakin tinggi efisiensi penernpelan primer pada DNA cetakan termasuk penempelan pada sekuens gen yang tidak spesifik. Akan tetapi suhu annealing yang terlalu tinggi menyebabkan primer sarna sekali tidak dapat menempel pada utas DNA. sedangkan perhitungan Tm untuk primer yang tersusun oleh ~ 20 basa didasarkan pada metode Breslauer yang dikenal dengan nama nearest neighbor method. jumlah bahan yang digunakan pada tahap PCR tidak mutlak. (1989) berkisar antara 12. Jumlah molekul DNA yang terkandung dalam I ug sil'. coli kompeten. Ligasi dapat dilakukan secara langsung. yaitu 2(A+T) + 4(G+C). Bahan yang digunakan pada tahap PCR jumlahnya tertentu agar menghasilkan produk spesifik yang optimum. dan X-gal. Dari perhitungan tersebut diperoleh nilai Tm IF-2 adalah 5rC. dan pengotor-pengotor lain yang dapat mengganggu proses kloning. Menurut Innis & Gelfand (1990). yaitu mempunyai basa timin (T) yang menggantung (overhang).

Gambar lla menunjukkan cawan petri kontrol negatif. coli. maupun cawan petri sam pel merupakan koloni yang mengandung plasmid karena sel-sel yang tidak mengandung plasmid tidak dapat menghasilkan suatu protein yang dapat merubah arnpisilin menjadi suatu senyawa yang tidak berbahaya bagi E. Kenyataan ini menunjukkan bahwa koloni sel yang berisi plasmid kosong jumlahnya lebih sedikit daripada koloni sel yang berisi plasmid rekombinan. sehingga ukuran produk peR yang diperoleh merupakan penjumlahan ukuran insert dengan jumlah nukleotida dari kedua daerah . dipilih sepuluh buah koloni untuk diperiksa ukuran insert-nya dengan teknik peR. baik cawan petri kontrol negatif.047 pb). b. IPTG. lumlah koloni pada cawan petri kontrol negatif adalah 9 buah. Gambar 12 menunjukkan bahwa sembilan koloni memiliki ukuran insert yang sesuai (1. dan X-gal. mengandung plasmid. maka kedua basa T harus saling berkomplemen. Gambar 11 menunjukkan cawan petri kontrol negatif dan cawan petri sam pel. Komplemen ini tidak stabil. Gambar a menunjukkan kontrol negatif. Masing-masing cawan petri tersebut berisi medium LB yang mengandung ampisilin. setiap ujung 3' vektor pGE~ -T terdapat basa timin (T) yang menggantung. Gambar lIb menunjukkan bahwa koloni yang tumbuh pada cawan petri sampel berwarna putih dan biru. Produk peR yang diperoleh tidak berukuran 797 pb karena peR dilakukan dengan menggunakan sepasang primer (MI3) yang terletak pada vektor pGEM®-T. oleh karenanya koloni sel yang mengandung plasmid kosong cenderung lebih sedikit jumlahnya dibandingkan dengan koloni sel yang mengandung plasmid rekombinan. Gen penyandi protein yang resisten terhadap ampisilin terdapat di dalam plasmid. Gambar II. untuk masuk ke dalam sel hams berswaligasi (selfligated vector). IPTG. sedangkan jumlah koloni pada cawan petri sampel adalah sekitar 150 buah. koloni yang ada seluruhnya berwarna biru. lumlah koloni yang berwama biru lebih sedikit daripada koloni yang berwarna putih (30 : 70). tetapi mungkin terjadi. Pada cawan petri tersebut dapat diamati bahwa selain jumlah koloninya sedikit.15 a. Cawan petri berisi medium LB yang mengandung ampisilin. sedangkan !PTG dan Xgal digunakan untuk membedakan sel yang mengandung plasmid rekornbinan dengan sel yang mengandung plasmid kosong. sedangkan Gambar b menunjukkan sampei. Secara sepintas dapat pula diamati bahwa jumlah koloni pada cawan petri kontrol negatif jauh lebih sedikit dibandingkan dengan jumlah koloni pada cawan petri sampel. Adapun sel pada umumnya akan menerima plasmid yang berbentuk sirkular. Plasmid yang tidak berligasi dengan insert. sedangkan satu koloni memiliki ukuran yang salah (sekitar 500 bp). Kontrol negatif memperoleh perlakuan yang sarna dengan sampel hanya tidak diberi insert. Semua koloni yang tumbuh pada cawan petri. Kedua primer ini berjarak sekitar 125 pb dari daerah insert. dan X-gal. Dari ratusan koloni yang berwarna putih. Hal ini menunjukkan bahwa tidak terjadi kontaminasi pada kontrol negatif karena semua koloni sel yang terbentuk hanya mangandung plasmid kosong. Swaligasi vektor pGEM®-T agak sulit terjadi karena seperti yang sudah disebutkan di atas. Untuk berswaligasi.

Pemakaian kedua primer ini bertujuan untuk melihat apakah insert benar-benar terligasi dengan vektor pGEM®-T. Daerah pertemuan antara vektor pGEM-T dengan salah satu ujung insert (ditunjukkan oleh landa'" ). peR sekuensing dilakukan dengan beberapa primer. (Lampiran 4). TI.047 pb 603 ph 500 pb Garnbar 12. . Sekuensing Dari sernbilan buah koloni yang menunjukkan ukuran insert yang tepat. Adanya sebuah koloni yang berukuran salah menunjukkan bahwa ternyata pada suhu annealing 56°e masih terbentuk produk non spesifik yang berukuran M 2 3 4 sekitar 250 pb. yaitu SP6. yaitu dengan membaca sekuens sambungan antara vektor dengan ujung-ujung insert. Plasmid dari masing-masing koloni diisolasi dengan prosedur lisis basa termodifikasi. T7 dimanfaatkan untuk merunut sekuens insert dari depan. Gambar 13 menunjukkan sebagian elektroferogram hasil sekuensing dengan primer T7. dipilih dua buah koloni untuk disekuensing. oleh karenanya kedua primer terscbut terletak di ujungujung insert. sedangkan SP6 dimanfaatkan untuk merunut sekuens insert dari belakang. SP6 dan T7 tersusun dari oligonukleotida yang terletak pada vektor pGEM®-T (terletak di luar insert). 1-10 =nomor koloni). T7. dan IR-2. Mesin tersebut hanya dapat merunut sekuens suatu gen sampai sekitar 400-500 pb. Oleh karen a itu dimanfaaikanlah primer IF-2 dan IR-2. Keadaan sebaliknya dapat terjadi apabila insert terligasi dengan vektor dalam posisi terbalik. Produk non spesifik tersebut tidak terekam dengan kamera UV karena konsentrasinya sangat rendah « 50 ng). Gambar 13.078 pb 872 pb 1. tetapi ternyata ban yak basa di bagian tengah insert yang tidak dapat terbaca.16 primer ke daerah insert. Koloni yang dipilih adalah koloni 5 dan koloni 8. IF-2. Bagian yang tidak dapat terbaca hanya bagian ujung-ujung insert.353 pb 1. IF-2. dan IR-2 saling meJengkapi. Ujung T (timin) dari vektor langsung disambung oleh insert. 5 6 7 8 10 9 1. Selanjutnya dipurifikasi untuk menghilangkan sisa-sisa bahan yang digunakan dalam isolasi plasmid karen a bahan-bahan tersebut akan rnenimbulkan gangguan pada tahap pernisahan fragmen-fragmen DNA. Primer IF-2 dan IR-2 merupakan primer yang digunakan untuk mengamplifikasi insert. Pada gambar tersebut ditunjukkan bahwa insert teriigasi dengan vektor pGEM®-T. Dengan dernikian keseluruhan sekuens insert dapat dibaca karena perunutan sekuens insert dengan primer SP6. Perunutan sekuens insert perlu dilakukan dengan rnenggunakan kedua primer ini karena kemampuan mesin Automatic DNA Sequencer Abi Prism 377 untuk rnerunut sekuens suatu gen untuk satu reaksi (sebuah primer) terbatas. Perunutan sekuens insert menggunakan kedua primer ini sangat baik. Hasil peR sepuluh kalani (Memarker. Seharusnya penggunaan SP6 dan T7 dapat digunakan untuk membaca keseluruhan sekuens insert.

. Lebih spesifik lagi. Selanjutnya untuk mengetahui subvarian IFNuz dari gen tersebut. Lewis. Hasil sekuensing dikonfirmasi (alignment) dengan standar gen IFNo:z yang terdapat dalam Genllank: dengan kode akses Y1834. M. Kenyataan ini tidak mengherankan karena IFNO:2 b merupakan subvarian yang paling dorninan (Lee et aI. Sekuens keseluruhan gen hasil isolasi dan urutan asarn amino yang disandi oleh gen 1FNu2 disajikan pada Lampiran 6 dan 7. Ganger. Gen . S. Chloroplast transformation in Chlamydomonas with high velocity microprojectiles. Johnson. M. Science 240: 15341538. Shark. Klein & K. B.. M. N.17 Sekuens kedua koloni tersebut ternyata sarna persis dengan standar gen IFNO:2 yang terdapat dalam Genliank dengan kode akses Yl1834 (Lampi ran 5). Sulivan. dan IR-2. Brown. dan IFNo:z c diperoleh dari Genllank masing-masing dengan kode akses S64979. J. Raff. isolasi gen dari DNA genom. D. Hasilnya menunjukkan bahwa gen hasil isolasi merupakan subvarian b dari IFNo:z. New York. yaitu pada tahap amplifikasi sam pel.. ke-3. IFNO:2 b. H. 1988. KESIMPULAN DAN SARAN Kesimpulan Gen yang diisolasi dari DNA genom rnanusia dengan teknik PCR menggunakan primer IF-2 dan IR-2 merupakan gen 1FNu2.. B. Madras. Sekuens gen 1FNu2 a. Oneal. D. T. A. 2:365-371. dan S64991. K. H. dan S64991. Bray. Jakate. W. D. Gretch & D. Borden. 01eh sebab itu pernanfaatan teknik PCR pada penelitian irn sangat menguntungkan. N. Perbandingan sekuens sampel dengan IFNuz a. P. 1988. ternyata gen yang dipero1eh merupakan sub varian b dari IFNo:2. dan IFNO:2 c disajikan pada Gambar 14. Gene regulation and clinical roles for interferons in neoplastic disease. The Oncologist 3: 198-203.e. Daily interferon therapy for hepatitis C virus infection gagaatctctcttttctcctgcttgaaggacagacatg gagaatctctcttttctcctgcttgaaggacagacatg gaaaatctctcttttctcctgcttgaaggacagacatg gagaatctctcmtctcctgcttgaaggacagacgtg 'f 171 'f Gambar 14. Jones. DAFTAR PUSTAKA Alberts. D. Bacteriol. 2001. W. E. M. D. E. & P. Ng. L. Agarwala. IF-2. yaitu adanya basa guanin (G) pada posisi ke-137 dan basa adenin (A) pada posisi ke-170 (Kaluz et al. dan pada tahap sekuensing. R. J. 137 Sampel IFNA 2b IFNA 2a IFNA 2c 1FNa2 tersebut telah berhasil diklon ke dalam vektor pGEM®-T. 1995. Gillham. S. Saran Penelitian pendahuluan ini sebaiknya dilanjutkan dengan ekspresi gen Hu-IFNu2 supaya dapat dihasilkan protein IFNO:2 yang berrnanfaat sebagai obat antitumor dan antivirus. Ed. Hal ini menunjukkan bahwa benar gen yang diisolasi merupakan gen 1FNu2 manusia. M. T. A. yaitu primer SP6. IFNO:2 b. IFNo:z b. Robertson. Roberts & J. Calvin. J. S. Harris. 1995. E. & J. Potential uses of interferon alpha 2 as adjuvan therapy in cancer. Ini dibuktikan oleh ciri khas gen IFNO:2 b yang muncul pada gen sampel. C. Watson. S64994. Jensen. Boynton. S. Gene Cloning An lntroduction. B. 1994). Ann. Perbandingan sekuens sampel dengan sekuens standar IFNo:z a. A. S64994. Hanawalt. Randolph-Anderson. Rosenblate. 1995). D. Hosler. Chapman & Hall. R. Kirkwood. maka dilakukan alignment dengan ketiga macam standar sekuens subvarian IFNO:2 yang ada dalam GenBank dengan kode akses S64979. dan IFNo:2c. 1994. Ed.. S. M. Cotler. kc-3. Kaur. Teknik PCR yang digunakan pada peneiitian ini merupakan teknik yang efektif karena dapat digunakan pada berbagai tahap penelitian. Garland Publishing. 1998. J. Molecular Biology of the Cell. High efficiency transformation of bacterial cell by electroporation. 170:2796-280 l. T7. R. J. K. Konfirmasi diperoleh dari \1asil sekuensing menggunakan empat buah primer. Surg. G. konfirmasi ukuran insert.

1981. A. Characterization and Expression in Echericia coli of the DNA polymerase gene from Thermus aquaticus. H. K. J. Palmiter & R. Maxam. H. 1990. 1996. I. USA 78:5435-5439. Nature 295:503-507. Department of Biochemistry. Di dalam M. San Diego. Barber. W.. Gray. G. Interferon-alpha 2 variants in human genome. Sci. M. Cancer 73:236-240. Sci. Gilbert. M. Nielsen. J. Maintenance treatment with recombinant interferon alpha 2b in patients with myeloma responding to conventional induction chemotherapy. M. Strawderman & M. 38:\01-104. Bell & R. Kabat. J. A. R. J. recipients. A new method for sequencing DNA.. M. I. C. Interferons Their impact in Biology and Medicine: an introduction to the genes of the interferon system. Hammer. coli and monkey cells. John Wiley & Sons. P. K. 1977. Goeddcl. Dijkmans. Gray & D. H. Moore. W. H. Leung. D. & A. E. B. Rexroad. R. and pigs by microinjection. McCandliss. J. Ernstoff. N. Nat!. An introduction to the genes of the interferon system. 1990. Expession of human immune interferon cDNA in E. 1989.. S. V. Kontsek. K. R. T. Myambo. J. L. N.. Production of transgenic rabbits. Seeburg. . Avvisati & S. Vivekananda. Gutterman. D. Interferon Cytokine Res. Pursel. Taylor-Papadimitriou (Penyunting). A. M. Kaluz. Gross. 1981. M. G. F. R. J. 15:403-406.. R. Franke. Canada. Lawn. J. R. 1985. USA 87:88-92. 1994. Clin. 264:6427-6437. 3-12. Australia. R. A cad. I. M.. R. N. M.. Innis. Detection of rare alelic variants of the interferon-alpha 2 gene in human genomic DNA. 15:341349. J. 1. Med. Daniell. 1995. Sharp. W. 322: 14301434. Lawn. Gill. A. 118. 1990. R. 1996. Di dalam 1. Interferon alpha 2b is the predominant Sattayasai. Gelfand. J. Houck. Cooper. D. Lawyer. S. K. 1998. Kirkwood. M. Tesis. E. M. H. E. A cad. C. Optimization of PCR. Ye. Natl. 1994. V. M. him. Fuchsberger & P. Isolation. Ni. Liao & D. Thurs & J. Acta Virol. M. R. Oxford University Press. U. A.. J. V. 1. him. S. J. Crowe. Tucker. Transplantation subvariant detected in human genomic DNAs. A. Natl. Gewert. 14:7-17. Br. USA 74:560-564. Proc. Sninsky. Amadori. S. D. C. Testa. D. M. C. Lewis. Dull. A. in after Proc. Elbert. Bolt. BioI. MandeUi. M. P. Proc. Academic Press. Powles. Innis. Saiki. DNA sequence of a major human leukocyte interferon gene. Brinster. F. L. Lymphocyte recovery and clinical response in multiple myeloma patients receiving interferon alpha 2 beta after injtensive therapy. P. Current Protocol in Molecular Biology: manipulation of DNA. Immunological studies of human interferons a: antibodies with predetermined specificity. Tewari & J. White (Penyunting). 1985. H. sheep. Engl. 1995.. D. Chou. Vojtassak. Gross.18 in liver transplant 71:261-266. S. Gibadulinova. OIlCOI. Proc. Nat!. PCR Protocols A Guide to Methods and Applications. Interferon alpha-2b adjuvant therapy of high-risk resected cutaneous melanoma. Sanford. E. N. Gray. Hussain. Stoffel. Billian. N. Drummond & D. K. Gelfand. A. Nature 315:680-683. D. Transient foreign gene expression chloroplast of culture tobacco cells biolistic delivery of chloroplast vector. USA 91:1198-1205. & T. C. K. Brissette. Gelfand. D. 1990. Sci. H. P. Acad. P. L. 1. G. B. K. N. Monash University. Chem. Acad. & D. A. Yelverton & P. Oxford. interferon Cytokine Res. Lee. Ullrich. D. B. Millar. & W.. Sci. Cytokine therapeutics: lesson from interferon a. Wall.

Norwalk. Watson. Coulson. K. R. G. Med. B. 1977. Recombinant interferon alpha-2b combined with a regimen containing doxorubicin in patient with advanced follicular lymphoma. John Wiley & Sons. Ed. D. Horn. Molecular Cloning A Laboratory Manual. S. J. Gelfand. Solal-Celigny. USA. 1989. E. Lepage & N. J. Coulson. H. Intern. 1978. H. Maniatis.. Interferon-alpha produces sustained cytogenetic responses in chronic mylogenous leukimia. Talpaz. Trujillo & J. Stoffel. ke-2. Wilkowski & M. Ann. Stites. Engl. Sanger. Recombinant DNA. J.. G. Science 239:487-494. S. R. A. M. D. Mullis & H. U. [989. D. Primer directed enzymatic amplification of DNA with a thermostable DNA polymerase. Acad. Fritsch & T. Kc-2 . Brousse. Natl... 87: 107-110. 1991. M. Cold Spring Harbor Laboratory Press. Higuchi. J. Sanger. Appleton & Lange. R. ke-Z. Scharf. Erlich. ke-8. New York. 144:532-538. Proc. Voet. Gutterman. R. Basic and Clinical Immunology. D. 1992. USA 74:54635467. Zoller. Med. Kurzrock. I. Voet. Ed. Ed. P. P. S. J. E. Scientific American Books. Nicklen & A. & J. F & A. Ed. R. Kantarijan. . Stockton Press. PCR Technology Principles & Appplications for DNA Amplification: the design and optimization of the PCR. FEBS Lett. 329:1608-[614. The use of thin acrylamide gels for DNA sequencing.. A. Sci. 1988. R. Gilman. Biochemistry. G. F. 1993. New York. K. Saiki. M. K. Parslow. Sarnbrook. DNA sequencing with chain-terminating inhibitor. T. London. 1994. J. N. Terr & T.19 Saiki. F. 1994.

LAMPlRAN .

. J-. ::g ::g M .:::J .....::l ::r: ::r: C !oJ} 0 c <!) a:: . uu <r.::l d .:l .. U U E-< U 0 0 0 u <C ~ <I' b 0 i'rl c '" v . u -c 0 < u u0 ~ U < -c 0 f-< ~ f-< M M U M u < u .. 0:1 .:: S <C 0.. 10 U e U p. U p..l :... C :.v:.v:. 1::: 'U ~ .......0 p. 1::: ~ '" ........!<: ::l 10 til '0:... :::...:l << U 0 i'rl 0 0 0 E 0 0 < u <C U U E-< In b i'rl r-:. 0:1 ..'" $ c o.. p. 0 ....l .:: 8 0. N N z z E d ~ .. e !oo !oj} .....l C o... .. 0:1 "0 10 .§ .s ~ . ~ .E E ] "0 e ....!<: :::> N N N N ("<') ("<') N N '1" N N N 0 bb <r. ttl ttl :.:l tlJ} ] e ..:l e ] I:: o.. 10 ""' <P c ~ E ro 0 <P c E .......s 0... uuu < << <r. . "0 e ro e E 0 '" p::. ... .5 e '" <!) . ~ i'rl u <C U .I:: ro '0:.l [J') .!<: !l..:::J e B ~ :::. v-i 0 .... d ..!<: ~ "0 "0 ~ U p.. . ~ 0 u <r.. 0 0 0 <r. U< u M M u M <r.:l ] ro ...5 til 0:1 '" . 0... [J') . <C E-< E:5 u < 0 '.. ..... .l d :::. "0 '" A:: ro ·S ·S til 0....... '" p::.. p::.. ~ 0 ::0 '-"' 0.:l e !oj} . <!) bll ttl btl 'V:.. <!) '.. ...!<: o. N ~ ('f) 1. .. <!) < -c 0 U E-< u 0 0 f-< 0 f-< U E-< U U u S i'rl t3 8 f-< U ~ u0 u <r.

75 Sampel 0. Perhitungan kadar dan kemurnian DNA A2so"".! A2BOn". Perhitungan kadar DNA sampel (ng/ill) KadarDNA = A260nm X faktor pengenceran x 50 ng/ill = = 0.084 x 200 x 50 ng/il! 840 ng/u! 2.l) Kemurnian DNA (A26onn.048 200 840 I.084/ 0.084 0.21 Lampiran 2. Kemurnian DNA sampel Kemurnian = A260 nm / A2so nm = 0.048 .) 1. Faktor pengenceran Kadar DNA (ng/p.

.

.... Q) . -E . (c )<{ c<) c<) co c 000 -[ij r... ~q.-00 ><{> <D o 0 as (j) ."<t o o Ql ) )... ) ~ gJ CD ....-. >.

24 Lampiran 5.8) multiple sekuens sampel dengan standar Y11834 (Sequence CLUSTAL SAMPEL STANDAR sequence alignment ------------------CTTTNAATTCCCTTTG-AACATCNACATNGGCCTTGACCTTGGCTCACCCATTTCAACCAGTCTAGCAGCATCTGCAACATCTACAATGGCCTTGACCTTT * * ** ****** *** ************ ** GCTTTACTGGTGGCCCTCCTGGTGCTCAGCTGCAAGTCAAGCTGCTCTGTGGGCTGTGAT GCTTTACTGGTGGCCCTCCTGGTGCTCAGCTGCAAGTCAAGCTGCTCTGTGGGCTGTGAT ************************************************************ SAMPEL STANDAR SAMPEL STANDAR CTGCCTCAAACCCACAGCCTGGGTAGCAGGAGGACCTTGATGCTCCTGGCACAGATGAGG CTGCCTCAAACCCACAGCCTGGGTAGCAGGAGGACCTTGATGCTCCTGGCACAGATGAGG ************************************************************ AGAATCTCTCTTTTCTCCTGCTTGAAGGACAGACATGACTTTGGATTTCCCCAGGAGGAG AGAATCTCTCTTTTCTCCTGCTTGAAGGACAGACATGACTTTGGATTTCCCCAGGAGGAG ************************************************************ TTTGGCAACCAGTTCCAAAAGGCTGAAACCATCCCTGTCCTCCATGAGATGATCCAGCAG TTTGGCAACCAGTTCCAAAAGGCTGAAACCATCCCTGTCCTCCATGAGATGATCCAGCAG ************************************************************ SAMPEL STANDAR SAMPEL STANDAR SAMPEL STANDAR ATCTTCAATCTCTTCAGCACAAAGGACTCATCTGCTGCTTGGGATGAGACCCTCCTAGAC ATCTTCAATCTCTTCAGCACAAAGGACTCATCTGCTGCTTGGGATGAGACCCTCCTAGAC ************************************************************ AAATTCTACACTGAACTCTACCAGCAGCTGAATGACCTGGAAGCCTGTGTGATACAGGGG AAATTCTACACTGAACTCTACCAGCAGCTGAATGACCTGGAAGCCTGTGTGATACAGGGG ************************************************************ GTGGGGGTGACAGAGACTCCCCTGATGAAGGAGGACTTCATTCTGGCTGTGAAGGAAATA GTGGGGGTGACAGAGACTCCCCTGATGAAGGAGGACTCCATTCTGGCTGTGA-GGAAATA ************************************* ************** ******* CTTCCAAAGAATCACTCTCTATCTGAAAGAGAAGAAATACAGCCCTTGTGCCTGGGAGGT CTTCCAAAGAATCACTCTCTATCTGAAAGAGAAGAAATACAGCCCTTGTGCCTGGGAGGT ************************************************************ TGTCAGAGCAGAAATCATGAGATCTTTTTCTTTGTCAACAAACTTGCAAGAAAGTTTAAG TGTCAGAGCAGAAATCATGAGATCTTTTTCTTTGTCAACAAACTTGCAAGAAAGTTTAAG ************************************************************ SAMPEL STANDAR SAMPEL STANDAR SAMPEL STANDAR SAMPEL STANDAR SAMPEL STANDAR AAGTAAGGAATGAAAACTGGTTCAACATGGAAATGATTTTCATTGATTCGTATGCCAGCT AAGTAAGGAATGAAAACTGGTTCAACATGGAAATGATTTTCATTGATTCGTATGCCAGCT ************************************************************ CACCTTTTTATAATCTGCCATTTCAAAGACTCATGGTTCTGCTATGACCATGACACGATT CACCTTTTTATGATCTGCCATTTCAAAGACTCATGTTTCTGCTATGACCATGACACGATT *********** *********************** ************************ TAAATCTTTTCAAATGGTTTTANGAGTATTAATCAACCATTGGATTCAGCTCTTAAGGCA TAAATCTTTTCAAATGTTTTTAGGAGTATTAATCAAC-ATTGTATTCAGCTCTTAAGGCA **************** ***** ************** **** ***************** CTAGTCCC----------CTAGTCCCTTACAGAGGAC ******** SAMPEL STANDAR SAMPEL STANDAR SAMPEL STANDAR . Hasil konfirmasi reference) W (1.

I IIII III I II II I IIII I II II I aagcctgtgt cctgatgaag ttccaaagaa gcccttgtgc atctttttct IIII II gatacagggg gtgggggtga cagagactcc 440 gaggactcca ttctggctgt gaggaaatac 480 tcactctcta tctgaaagag aagaaataca 520 ctgggaggtt gtcagagcag aaatcatgag 560 ttgtcaacaa acttgcaaga aagtttaaga 600 640 630 620 610 II III •I II I II aI II II II III I IIII II III I agtaaggaat attgattcgt ttcaaagact aaatcttttc tqttcagctc gaaaactggt atgccagctc catgtttctg aaatgttttt ttaaggcact tcaacatgga acctttttat ctatgaccat aggagtatta agtcccttac aatgattttc 640 gatctgccat 680 gacacgattt 720 atcaacattg 760 agaggac.I ttggatttcc ccaggaggag 240 ggctgaaacc atccctgtcc 280 atcttcaatc tcttcagcac 320 gggatgagac cctcctagac 360 ccagcagctg aatgacctgg 400 Lt30 Lt40 420 .25 Lampiran 6. 40 II I I ggctcaccca ctacaatggc ggtgctcagc ctgcctcaaa tgctcctggc 210 III" III tttcaaccag cttgaccttt tgcaagtcaa cccacagcct acagatgagg III aI .I III II 10 III II II 20 II I 30 IIII II II " IIII I. Sekuens keseluruhan IFNCX:1 hasil isolasi III . 797 .I 410 I I II .I I tctagcagca tctgcaacat 40 gctttactgg tggccctcct 80 gctgctctgt gggctgtgat 120 gggtagcagg aggaccttga 160 agaatctctc ttttctcctg 200 220 230 240 I IIII III II II II 1111111111 cttgaaggac tttggcaacc tccatgagat aaaggactca aaattctaca III agacatgact agttccaaaa gatccagcag tctgctgctt ctgaactcta I III .

26 Lampiran 7.2dan asam amino yang disandinya MALTFALLVALLVLSCK 1 SSC atg gee ttg aee ttt get tta etg gtg gee ete etg gtg etc age tge aag tea age tge SVGCDLPQ THSLGSRRTLML 61 tet gtg ggc tgt gat ctg ect caa aec cae age etg ggt age agg agg ace ttg atg etc LAQMRRJSLFSCLKDR HDFG 121 etg gea eag atg agg aga ate tct ett tte tee tge ttg aag gac aga cat gae ttt gga FPQE 181 EFGNOFQ KAET PVLH ttt eee eag gag gag ttt gge aae eag tte eaa aag get gaa ace ate eet gte ete eat EM I Q Q IF NL FS TKO S S AA W0 241 gag atg ate eag cag ate tte aat etc tte age aca aag gae tea tet get get tgg gat ETLL 0 KFYTELYOOLNDLEA 301 gag aee ete eta gae aaa tte tac aet gaa cte tac eag eag ctg aat gae etg gaa gee CV IOGVGVT ETPLMKE DSIL 361 tgt gtg ata eag ggg gtg ggg gtg aea gag aet eee etg atg aag gag gac tee att etg AVRKYFORI 421 TLYLKE KK YSP get gtg agg aaa tae ttc caa aga ate act etc tat etg aaa gag aag aaa tac age cet CAW 481 EVV RAE 1M RSFSLST NL tgt gee tgg gag gtt gte aga gea gaa ate atg aga tet ttt tet ttg tea aea aac ttg Q 541 ESLRSKE eaa gaa agt tta aga agt aag gaa tga . Urutan nukleotida gen Hu-IFNCt.

Sign up to vote on this title
UsefulNot useful