Drug Delivery Systems for Tissue Engineering Applications

Joo Reina Maia e Silva April 27th 2011

A Thesis presented to Faculdade de Cincias e Tecnologia da Universidade de Coimbra to obtain the degree of Doctor in Chemical Engineering in the Speciality of Chemical Processes

ii

I gratefully acknowledge the nancial support provided by Instituto de Investigao Interdisciplinar III/BIO/20/2005

Advisor Prof. Dr. Maria Helena Gil Referees Prof. Dr. Miguel Gama Prof. Dr. Pedro L. Granja Prof. Dr. Hermnio C. Sousa Prof. Dr. Lino Ferreira Prof. Dr. Margarida Figueiredo

In the beggining there was nothing. Then even that exploded ...
(Unknow author)

Para a Soa, pela pacincia Para os meus pais, pelo apoio de sempre

Agradecimentos
Gostaria de agradecer Professora Helena Gil por me ter aceite, novamente, como seu aluno. Estes anos ao seu lado foram muito enriquecedores e animados. Queria tambm reconhecer o seu contributo para o meu amadurecimento cientco e pessoal. O seu incentivo, para que eu terminasse o trabalho e ultrapassasse as minhas crises existenciais durante este perodo, foi extremamente importante. Quero deixar uma palavra de agradecimento a todos os colegas e amigos com que me cruzei ao longe destes anos. No s dentro da Universidade de Coimbra, mas tambm nas vrias instituies por onde fui passando. Felizmente, so bastantes. Espero que me perdoem no vos nomear aqui a todos. A vossa ajuda foi fundamental em todos os planos, no s no quotidiano laboratorial mas tambm fora dele, essencial para a manuteno da sanidade mental! Gostaria de agradecer aos amigos Andrade Ramos e Jorge Coelho pela leitura crtica da tese e comunidade de utilizadores Lyx, mas em especial ao Uwe Sthr, pela ajuda na elaborao tipogrca do manuscrito. Um sincero obrigado Ann Daugherty e ao Tom Patapo pela ajuda na cedncia de VEGF pela Genentech, Inc. Mas acima de tudo, ao Lino Ferreira, por me ter acolhido no seu grupo e pela nova oportunidade que me deu de colaborarmos, sem dvida, determinante para levar este projecto a bom porto.

vii

Abstract
The concept of controlled drug delivery arose in the mid-sixties, quickly leading to the rst commercial devices composed of poly(ethylene-co-vinyl acetate). Since then, the eld has suered a tremendous evolution. As the knowledge on cell biology, physiology and materials sciences increased, better approaches were developed. Today we stand on the nanometric level of controlled delivery devices. These approaches rely on highlyinnovative materials, with increasing biological accuracy, having has an ultimate goal the achievement of personalised medicine. Impaired-angiogenesis associated pathologies, such as ischemic heart disease, chronic wounds or stroke, have a high-burden on society. Pro-angiogenic therapies aim at recovering vascularised impaired tissues. Among other approaches, the use of specic growth factors, like vascular endothelial growth factor (VEGF), is one of the most attempted approaches found on the literature. However, the results in clinical trials, using bolus delivery of VEGF, did not meet the desired therapeutic ecacy. Part of this failure was attributed to suboptimal delivery strategies, allied to the short half-life and fast clearance rates of the growth factor. Cardiovascular diseases and wound healing are huge ummet medical needs which would benet tremendously of successful delivery strategies for VEGF. We have previously synthesised and characterised oxidised dextran (dexOx) hydrogels (Maia et al. Polymer 2005;46:9604-9614). We have used this system as a benchmark and continued its characterisation in an attempt to improve it for the desired drug delivery approaches. A deeper analysis of oxidised dextran was performed, focused on the oxidation degree eect and its direct inuence on the microscopic and macroscopic characteristics of the material. As a result, we observed how the oxidation degree strongly interferes with the viscosity of dexOx aqueous solutions and how the thermal degradation proles, of the dierent samples, reect the damage that low and mild oxidations could originate, on the polymeric backbone. DexOx cross-linked with adipic acid dihydrazide hydrogels were further characterised

ix

having in mind the future incorporation of a therapeutic biomolecule and the integration in more complex systems. Dierent geometries were approached, like microgels, of which we present some early studies. The natural reactivity of oxidised dextran toward N-nucleophiles render this vehicle appropriate for an eortless and straightforward conjugation with a proteinaceous growth factor, conferring protection and extending the protein half-life by inhibiting fast cellular consumption. VEGF is able to maintain its bioactivity, however the conjugation to dexOx, severely hinders the interaction with VEGF receptors and antibodies, delaying the VEGF consumption. The hydrogels release prole of VEGF was studied and observed to be quite dierent from other systems described on the literature. The initial burst release could be ne tuned from one to forty ve percent of the total initial drug. Fibrin hydrogels were shown, elsewhere, to be appropriate carriers of endothelial cells. They improved the survival and proliferation of such cells. Therefore, a novel hybrid construct was designed. The dexOx hydrogels were entrapped inside the brin hydrogels. The combination of both platforms in a hybrid matrix supported the attachment of vascular cells and allowed their migration, organisation and proliferation, supported by a possible gradient created by the controlled delivery of VEGF. This novel construct geometry opens interesting perspectives for pro-angiogenic therapies. Finally, we have explored the delivery of small hydrophobic therapeutics. The ultimate frontier in drug delivery is the cells cytoplasm and the dierent cellular organelles. The ability to reach this target allows the manipulation and control of cell fate, highly relevant on the context of stem cells. Retinoic acid (RA) is a hydrophobic molecule which has tremendous potential in cancer prevention and is a regulator of stem cells dierentiation. RA acts upon nuclear receptors, therefore, the intracellular delivery is demanded for a successful application. We addressed this issue, by recurring to polyelectrolytebased nanoparticles, composed by polyethylenimine and dextran sulfate. The balance between the dierent components was shown to aect the RA loading capacity and the nanoparticles size. This system allowed the delivery of a signicant amount of RA to the subventricular zone neuronal stem cells cytoplasm and dierentiate this cells into the neuronal lineage more signicantly than blank nanoparticles or by RA released outside the cells. We antecipate that such system could be delivered through the nasal cavity, straight to the brain, opening new perspectives on the treatment of neurodegenerative diseases.

Resumo
O conceito de libertao controlada de frmacos nasceu nos anos sessenta, o que seria traduzido rapidamente em produtos comerciais compostos por dispositivos com base em poli(etileno-co-vinil acetato). Desde essa altura, o campo evoluiu substancialmente. medida que os conhecimentos de biologia celular, siologia e cincia dos materiais foram crescendo, abordagens mais ecazes foram sendo criadas. Hoje em dia, os dispositivos de libertao controlada de entidades teraputicas ou mesmo clulas, atingiram a escala nanomtrica. Estas abordagens apresentam elevada preciso biolgica, o que nos levar, eventualmente, a uma medicina mais personalisada. Determinadas patologias so caracterizadas por vascularizao deciente, aps o momento do insulto. Exemplos como o enfarte do miocrdio, feridas crnicas ou acidentes vasculares cerebrais tem um elevado peso na sociedade. A angiognese teraputica tem como objectivo a recuperao de tecidos lesionados com uma vascularizao deciente. Entre outras abordagens, o uso de factores de crescimento especcos, como o factor de crescimento do endotlio vascular (VEGF), uma das abordagens mais frequentes encontradas na literatura e abordada em ensaios clnicos. No entanto, os resultados em ensaios clnicos, utilizando apenas VEGF, no atingiu a eccia teraputica pretendida. Parte deste falhano foi atribudo a uma entrega deciente do factor bioactivo aos tecidos comprometidos, aliado ao tempo de semi-vida curto e rpida ltrao por parte do organismo. A cura de feridas cutneas e doenas cardiovasculares so necessidades mdicas que beneciariam muito com estratgias ecientes de entrega e libertao de VEGF. Recentemente, o nosso grupo descreveu a sntese e caracterizao de hidrogeis de dextrano oxidado (dexOx) (Maia et al. Synthesis and characterization of new injectable and degradable dextran-based hydrogels Polymer 2005;46:9604-9614). Este sistema foi usado como referncia padro e durante este estudo foi feito um esforo de realizar uma caracterizao mais exaustiva de modo a melhor-lo. Uma anlise mais profunda do dextrano oxidado foi feita, focada na inuncia do grau de oxidao nas caractersticas

xi

microscpicas e macroscpicas do material. O grau de oxidao tambm foi estudado no contexto de um transporte eciente de factores bioactivos, bem como na sntese de microgeis e hidrogeis aps reticulao com cido adpico dihidrazida. A questo de libertao de VEGF foi abordada, usando o dextrano oxidado como transportador. A reactividade natural do dextrano oxidado para N-nuclelos torna este vector bastante apropriado para uma conjugao simples e directa, conferindo proteco e aumentando o tempo de semi-vida, por inibio do rpido consumo celular. O perl de libertao do VEGF observado bastante diferente de outros sistemas descritos na literatura. A libertao inicial pode ser moldada para ocorrer entre um a quarenta e cinco por cento da totalidade da protena inicial. O VEGF capaz de preservar a sua bioactividade, no entanto a conjugao ao dextrano oxidado, limita severamente a interaco com os receptores celulares e anticorpos especcos, retardando o seu consumo a nvel celular. Hidrogis de brina foram identicados, num outro trabalho, como sendo transportadores ecazes de clulas endoteliais. Foi mostrado que melhoravam a sobrevivncia e proliferao dessas mesmas clulas. Nesse contexto, os hidrogis de dexOx foram incorporados dentro dos hidrogis de brina. A combinao de ambas as plataformas, numa matriz hibrda, suportou a adeso das clulas endoteliais e permitiu a sua migrao, organizao e proliferao, apoiada num possvel gradiente criado pela libertao de VEGF do hidrogel de dexOx. Esta nova geometria abre perspectivas interessantes para novas terapias pro-angiognicas. Por ltimo, foi explorada a libertao controlada de agentes teraputicos de baixo peso molecular e hidrofbicos. A ltima fronteira em libertao de drogas o ambiente citoplasmtico e os diferentes organelos celulares. A capacidade de atingir este espao permite a manipulao e controlo do destino celular, altamente relevante no contexto de clulas estaminais. O cido retinico uma molcula hidrofbica com um potencial tremendo na preveno do cancro e como regulador da diferenciao de clulas estaminais. O cido retinico actua sobre receptores localizados no ncleo celular, nascendo a necessidade de entrega citoplasmtica para uma aplicao bem sucedida. Este problema foi abordado, recorrendo a nanoparticulas baseadas em polielectrlitos (polietilenimina e dextrano sulfato). O balano entre os diferentes componentes afecta a capacidade de transportar cido retinico bem como o tamanho nal das nanopartculas. Este sistema permitiu a entrega de uma quantidade signicativa de cido retinico no citoplasma de clulas estaminais neuronais da regio subventricular promovendo a diferenciao em

xii

clulas da linhagem neuronal, ao contrrio de nanopartculas vazias ou de cido retinico libertado fora das clulas. Antevemos que este sistema possa ser entregue ao crebro atravs da cavidade nasal, surgindo como uma nova oportunidade no tratamento de diversas doenas neuro-degenerativas.

xiii

Thesis Outline
The research project Polysaccharide hydrogels for vascular tissue engineering applications, which was presented and accepted by Instituto de Investigao Interdisciplinar, had as main goal, the development of (...) a new hydrogel formulation to be studied as a scaold for vascular tissue growth, and that could also improve implantable-devices acceptance by the organism. This project was designed on the shoulders of an earlier work, which characterised the synthesis of oxidised dextran (dexOx) hydrogels crosslinked with a dihydrazide (Maia et al. Polymer 2005;46:9604-9614). This work was set as our benchmark. Throughout the period of research, the main goals were slightly shifted in other directions. The polymeric-based materials were still on the main core of the technologies approached, however, the focus of research was oriented, towards drug delivery. To achieve this goal, a material transfer agreement for vascular endothelial growth factor, was arranged. Later on, the possibility of developing and characterising nanoparticles, opened the door for the intracellular delivery of retinoic acid, to neuronal stem cells. Several months were applied in developing dierent polysaccharide-based formulations. After several failed strategies, the research focused on further characterising that previously studied system. The adipic acid dihydrazide (AAD) cross-linked dexOx system presented many of the characteristics which we were trying to achieve. An injectable and initiator-free hydrogel, of aqueous base and which could carry therapeutic molecules. Therefore, it was decided to continue the characterisation of said system and advance to the aimed goal of vascular therapies. The general hypothesis was that an injectable hydrogel system, able to carry specic therapeutic entities, would improve the therapeutic ecacy and benet the recovery of the injured tissue. Such carrier could be applied in a high number of clinical settings. The development of such work represents a collaboration between traditional disciplines as diverse as polymer chemistry and polymer physics to drug delivery and cellular/molecular biology. It is impossible to address tissue engineering and drug delivery from only one

xv

prism, without having to face the challenges arising on other research elds. From the biomaterials perspective, a thorough structural characterisation of dexOx was performed. On chapter 1 we review the background of oxidised dextran on the biomedical eld, in order to contextualise the experimental issues approached. The oxidation degree, which deeply aects the macroscopic and microscopic properties of the oxidised dextrans, was thoroughly analysed by several techniques (chapter 4 and chapter 5), but especially, bidimensional NMR, which unveiled interesting reactivity trends of the dierent aldehydes on oxidised dextran (chapter 4). The consequences of the oxidation degree on the design of hydrogels and microgels is presented on chapter 5 and chapter 6, respectively. The chapter 5 results were oriented towards an injectable ocular application, due to the context of the collaboration that was established during that period. Though, the ocular delivery is out of the specic context of this thesis, the technical needs of such application, regarding the hydrogels properties, are quite similar. This work work will be presented without modications from the published version. Pro-angiogenic therapies are reviewed on chapter 2. The relevance of VEGF as a therapeutic molecule is addressed and the challenges faced on the controlled delivery are also overviewed. A glimpse over the use of vascular progenitor cells or stem cells on proangiogenic therapies is also addressed on this chapter. We have explored the delivery of VEGF, on the context of this dexOx-based hydrogel system but also as simple drug conjugate to dexOx and the implications that it could have on the VEGF denaturation and bioactivity (chapter 7). The conjugation to dexOx protects VEGF, without denaturating, extending its half-life by inhibiting fast cellular consumption. This system presented an interesting release prole, which could be advantageous on a wound healing clinical context. However, a new hybrid hydrogel construct is proposed, where the controlled delivery of VEGF apparently guides the migration and proliferation of endothelial cells inside a brin hydrogel. New opportunities in drug delivery by nanoparticles arose due to our last collaboration. The impact of nanoparticulate delivery systems is addressed on chapter 3 and some insights on the challenges of nanoparticles design is addressed as well as the most innovative approaches. The intracellular delivery of retinoic acid was approached with a polyelectrolyte nanoparticle system and the potential in dierentiating neural stem cells was assessed and described on chapter 8. We show that our NP formulation is very eective in loading RA, a small molecule with low aqueous solubility, and to release RA at concentrations higher than its solubility limit. Importantly, our results show that the

xvi

intracellular internalisation of RA positive nanoparticles contribute for neurogenesis and therefore highlighting the importance of drug spatial positioning and concentration in terms of stem cell dierentiation. The experimental section chapters were all prepared in the form of independent publishable manuscripts. The author apologizes for the redundancy of some sections.

Published Work
Chapter 4 was published in the journal Polymer. Joo Maia, Jorge FJ Coelho, Rui A Carvalho, Pedro N Simes, Maria H Gil. Insight on the periodate oxidation of dextran and its structural vicissitudes. Polymer 2010; doi:10.1016/j.polymer.2010.11.058 Chapter 5 was published in the journal Acta Biomaterialia. Joo Maia, Maximiano P Ribeiro, Carla Ventura, Rui A Carvalho, Ilidio J Correia, Maria H Gil. Ocular injectable formulation assessment for oxidized dextran-based hydrogels. Acta Biomaterialia 2009;5(6):1948-1955; doi:10.1016/j.actbio.2009.02.008 Chapter 8 was published in the journal ACS Nano. Joo Maia, Tiago Santos, Sezin Aday, Fabienne Agasse, Lusa Cortes, Joo O. Malva, Liliana Bernardino, Lino Ferreira. Controlling the neuronal dierentiation of stem cells by the intracellular delivery of retinoic acid-loaded nanoparticles. ACS Nano 2010; doi: 10.1021/nn101724r.

xvii

Contents
Agradecimentos Abstract Resumo Thesis Outline List of Symbols and Acronyms List of Figures List of Tables vii ix xi xv xxv xxxi xxxiii

I. Introduction
1. Oxidised Dextran 1.1. Dextran in Biomedical Industry . . . . . . . . . . . . . . . . . . . . . . 1.2. Dextran Oxidation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1.2.1. Oxidation Degree . . . . . . . . . . . . . . . . . . . . . . . . . 1.2.2. DexOx Reactivity . . . . . . . . . . . . . . . . . . . . . . . . . 1.2.3. Oxidation Consequences . . . . . . . . . . . . . . . . . . . . . 1.2.3.1. Physico-Chemical . . . . . . . . . . . . . . . . . . . . 1.2.3.2. Biological . . . . . . . . . . . . . . . . . . . . . . . . 1.3. DexOx Applications . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1.3.1. DexOx-Drug Conjugation . . . . . . . . . . . . . . . . . . . . . 1.3.1.1. Small Molecules . . . . . . . . . . . . . . . . . . . . .

1
3 3 4 6 7 8 8 8 9 9 9

1.3.1.2. Proteins . . . . . . . . . . . . . . . . . . . . . . . . . 10 1.3.1.3. Immunoconjugates . . . . . . . . . . . . . . . . . . . . 12

xix

1.3.1.4. Gene-Delivery . . . . . . . . . . . . . . . . . . . . . . 13 1.3.2. Hydrogels . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17 1.3.3. Particles . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19 1.3.4. Surfaces . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19 1.4. Conclusion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 24 2. Pro-Angiogenic Therapies 25

2.1. VEGF in Health and Disease . . . . . . . . . . . . . . . . . . . . . . . . 25 2.2. VEGF Biology . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26 2.3. Therapeutic Angiogenesis . . . . . . . . . . . . . . . . . . . . . . . . . 29 2.3.1. Polymeric Matrices-Based Strategies . . . . . . . . . . . . . . . 31 2.3.1.1. Diusion Controlled . . . . . . . . . . . . . . . . . . . 31 2.3.1.2. Covalent Immobilisation . . . . . . . . . . . . . . . . . 32 2.3.1.3. Composite Constructs . . . . . . . . . . . . . . . . . . 32 2.3.1.4. Multiple Release . . . . . . . . . . . . . . . . . . . . . 33 2.3.1.5. Stimuli-Sensing . . . . . . . . . . . . . . . . . . . . . 35 2.3.2. Cell-Based Therapies . . . . . . . . . . . . . . . . . . . . . . . 37 2.4. Conclusion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 39 3. Nanotechnology: Novel Delivery Frontiers 41

3.1. NanoBiotechnology . . . . . . . . . . . . . . . . . . . . . . . . . . . . 41 3.2. Nanoparticle Design . . . . . . . . . . . . . . . . . . . . . . . . . . . . 43 3.2.1. Synthesis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 43 3.2.2. Stimulus Sensitivity . . . . . . . . . . . . . . . . . . . . . . . . 45 3.2.3. Targeting . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 46 3.3. Nano Delivery . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 47 3.3.1. Proteins . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 47 3.3.2. Small Drugs . . . . . . . . . . . . . . . . . . . . . . . . . . . . 48 3.3.3. Intracellular Targeting . . . . . . . . . . . . . . . . . . . . . . . 49 3.4. Nano Tissue Engineering . . . . . . . . . . . . . . . . . . . . . . . . . . 50 3.5. Conclusions. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 52

II. Results and Conclusions

4. Insight on the Periodate Oxidation of Dextran

53
55

xx

4.1. Abstract . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 55 4.2. Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 55 4.3. Material and Methods . . . . . . . . . . . . . . . . . . . . . . . . . . . 57 4.3.1. Materials . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 57 4.3.2. Dextran Oxidation . . . . . . . . . . . . . . . . . . . . . . . . 57 4.3.3. Nuclear Magnetic Resonance . . . . . . . . . . . . . . . . . . . 57 4.3.4. DexOxs Solubility and Solutions Viscosity . . . . . . . . . . . . 58 4.3.5. Size Exclusion Chromatography . . . . . . . . . . . . . . . . . . 58 4.3.6. Dynamic Mechanical Thermal Analysis . . . . . . . . . . . . . . 59 4.3.7. Thermogravimetric Analysis . . . . . . . . . . . . . . . . . . . . 59 4.4. Results and Discussion . . . . . . . . . . . . . . . . . . . . . . . . . . . 59 4.4.1. DexOx Characterisation . . . . . . . . . . . . . . . . . . . . . . 59 4.4.2. Bidimensional Nuclear Magnetic Resonance . . . . . . . . . . . 60 4.4.3. Macroscopic Consequences of the Oxidation . . . . . . . . . . . 64 4.4.4. Thermal Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . 66 4.5. Conclusion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 70 5. Oxidised Dextran-Based Hydrogels 73

5.1. Abstract . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 73 5.2. Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 73 5.3. Materials and Methods . . . . . . . . . . . . . . . . . . . . . . . . . . 75 5.3.1. Materials . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 75 5.3.2. Dextran Oxidation . . . . . . . . . . . . . . . . . . . . . . . . . 76 5.3.3. Nuclear Magnetic Resonance and Size Exclusion Chromatography 76 5.3.4. DexOxs Solutions Viscosity . . . . . . . . . . . . . . . . . . . . 77 5.3.5. Hydrogel Preparation and Characterisation . . . . . . . . . . . . 77 5.3.6. Dynamic Swelling Experiments . . . . . . . . . . . . . . . . . . 77 5.3.7. Rheological Analysis . . . . . . . . . . . . . . . . . . . . . . . . 78 5.3.8. Cell Source and Growth . . . . . . . . . . . . . . . . . . . . . . 78 5.3.9. Cell Culture and In Vitro Cytotoxicity Studies . . . . . . . . . . . 78 5.4. Results and Discussion . . . . . . . . . . . . . . . . . . . . . . . . . . 79 5.4.1. DexOx Characterisation . . . . . . . . . . . . . . . . . . . . . . 79 5.4.2. DexOx Solutions Viscosity . . . . . . . . . . . . . . . . . . . . . 80 5.4.3. Hydrogels Characterisation . . . . . . . . . . . . . . . . . . . . . 82 5.4.4. Assessment of Cytotoxic Potential . . . . . . . . . . . . . . . . . 85

xxi

5.5. Conclusions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 87 6. Dextran-Based Microgels 89

6.1. Abstract . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 89 6.2. Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 89 6.3. Materials and Methods . . . . . . . . . . . . . . . . . . . . . . . . . . 91 6.3.1. Materials . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 91 6.3.2. Preparation of Microspheres . . . . . . . . . . . . . . . . . . . . 91 6.3.3. Scanning Electron Microscopy and Particle Sizing Analysis . . . . 92 6.4. Results and Discussion . . . . . . . . . . . . . . . . . . . . . . . . . . . 92 6.5. Conclusion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 94 7. Pro-angiogenic Hybrid Hydrogels 97

7.1. Abstract . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 97 7.2. Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 97 7.3. Materials and Methods . . . . . . . . . . . . . . . . . . . . . . . . . . 99 7.3.1. Materials . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 99 7.3.2. Dextran Oxidation and Characterisation . . . . . . . . . . . . . . 99 7.3.3. VEGF Labelling . . . . . . . . . . . . . . . . . . . . . . . . . . 100 7.3.4. Characterisation of VEGF Conjugates by Gel Electrophoresis . . . 100 7.3.5. Characterisation of VEGF Conjugates by Circular Dichroism . . . 101 7.3.6. Evaluation of VEGF Conjugates Bioactivity . . . . . . . . . . . . 101 7.3.7. Release of VEGF from DexOx Hydrogels . . . . . . . . . . . . . 102 7.3.8. Hybrid Hydrogels of DexOx and Fibrin . . . . . . . . . . . . . . 102 7.3.9. Viability of Encapsulated Endothelial Cells . . . . . . . . . . . . 103 7.3.10. Quantitative Real time Reverse-Transcription Polymerase Chain Reaction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 103 7.3.11. Statistical Analysis . . . . . . . . . . . . . . . . . . . . . . . . 104 7.4. Results and Discussion . . . . . . . . . . . . . . . . . . . . . . . . . . . 104 7.4.1. VEGF Conjugation to DexOx . . . . . . . . . . . . . . . . . . . 104 7.4.2. Structure Stabilisation of VEGF 7.4.3. Intracellular Ca
2+

. . . . . . . . . . . . . . . . . 106

Uptake in Endothelial Cells . . . . . . . . . . . 108 . . . . . . . . . . . . 112

7.4.4. Phosphorylation of Akt and ERK in Endothelial Cells . . . . . . . 110 7.4.5. VEGF Controlled Release from Hydrogels 7.4.6. Endothelial Cells Encapsulation in Hybrid Hydrogels Containing VEGF . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 114

xxii

7.5. Conclusion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 117 8. Retinoic Acid-Loaded Nanoparticles 8.1. Abstract . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8.2. Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8.3. Materials and Methods . . . . . . . . . . . . . . . . . . . . . . . . . 8.3.1. Materials . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8.3.2. Fluorescent Labeling of PEI . . . . . . . . . . . . . . . . . . . 8.3.3. Preparation of Nanoparticles . . . . . . . . . . . . . . . . . . . 8.3.4. Characterisation of the Nanoparticles . . . . . . . . . . . . . . 8.3.5. Determination of Weight Ratio of Cationic to Anionic Polymer in Nanoparticles . . . . . . . . . . . . . . . . . . . . . . . . . . . 8.3.6. Loading Eciency of RA in Nanoparticles . . . . . . . . . . . . 8.3.7. RA Release from Nanoparticles . . . . . . . . . . . . . . . . . 8.3.8. In vitro Degradation of Polymeric Nanoparticles . . . . . . . . 8.3.9. SVZ Cell Cultures and Experimental Treatments. . . . . . . . 8.3.10. Single Cell Calcium Imaging . . . . . . . . . . . . . . . . . . . 8.3.11. Internalisation Studies . . . . . . . . . . . . . . . . . . . . . . 8.3.12. Western Blots . . . . . . . . . . . . . . . . . . . . . . . . . . 8.3.13. Immunocytochemistry . . . . . . . . . . . . . . . . . . . . . . 8.3.14. TUNEL Assay . . . . . . . . . . . . . . . . . . . . . . . . . . 8.3.15. Propidium Iodide Incorporation . . . . . . . . . . . . . . . . . 8.3.16. Statistical Analysis . . . . . . . . . . . . . . . . . . . . . . . 8.4. Results and Discussion . . . . . . . . . . . . . . . . . . . . . . . . . . 8.4.1. High-Loading Capacity and Positive-Net Charge Nanoparticles . 8.4.2. Nanoparticles Internalisation in SVZ Cells . . . . . . . . . . . . 8.4.3. RA+ NPs Promote Neuro-Dierentiation . . . . . . . . . . . . 8.5. Conclusion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 119 . 119 . 119 . 120 . 121 . 121 . 121 . 122 . . . . . . . . . . . . . . . . . 122 123 123 123 124 124 125 126 126 127 128 128 128 130 133 137 140

III. Final Remarks

9. General Conclusions Bibliography

143
145 149

xxiii

List of Symbols and Acronyms

1

H-NMR

Proton nuclear magnetic resonance spectroscopy Adipic acid dihydrazide Protein Kinase B, Multifunctional serine-threonine protein kinase Angiopoietin Aminopropyldimethylethoxy silane Aminopropyltriethoxy silane Bovine serum albumine Carboxyethyl chitosan Carboxymethyl cellulose Correlation spectroscopy Drug delivery devices Oxidised dextran Dimethyl sulfoxide Dynamic mechanical thermal analysis Deoxyribonucleic acid Dextran sulphate Dierential thermogravimetric Embryoid bodies

AAD Akt Ang APDES APTES BSA CEC CMC COSY DDD dexOx DMSO DMTA DNA DS DTG EBs

xxv

ECM EGF EPC ERK EtC FGF FITC Flk1 Flt1 HA HCl HEMA hESC HGF hGH HMQC HPMA HPMC HUVEC IC50 IKVAV IL-8

Extracellular matrix Epidermal Growth Factor Endothelial progenitor cells Extracellular signal-regulated protein kinase Ethyl carbazate Fibroblast growth factor Fluorescein isothiocyanate Fetal liver kinase 1; Same as KDR and VEGFR-2 fms-related tyrosine kinase 1; Same as VEGFR1 Hyaluronic acid Hydrochloric acid Hydroxyethyl methacryate Human embryonic stem cells Hepatocyte growth factor Human growth hormone Heteronuclear multiquantum coherence NMR spectroscopy N-(2-hydroxypropyl)methacrylamide Hydroxypropylmethyl cellulose Human umbilical vein endothelial cells Half maximal inhibitory concentration laminin-based peptide Interleukin 8

xxvi

KDR KGF mab MAPK MC MCP1 MMA MPEG NP NR1 NRP OD pab PDGF PEG PEGDA PEI PI3K PLA PLGA PlGF qRT-PCR

Kinase insert domain receptor; Same as Flk1 and VEGFR-2 Keratinocyte growth factor Monoclonal antibody Mitogen-activated protein kinase Methyl cellulose Monocyte chemotactic protein 1 Methyl methacrylate Methyl polyethylene glycol Nanoparticles NMDA receptor subunit type 1 Neuropilin Oxidation degree Polyclonal antibody Platelet-derived growth factor Polyethylene glycol Polyethylene glycol diacrylate Polyethylenimine Phosphatidylinositol 3-kinase Polylactic acid Poly(lactic-co-glycolic) acid Placental growth factor Quantitative real time reverse-transcription polymerase chain reaction

xxvii

RA RAR RARE RGD SEC SMC sms SVZ tBC TG TGF TNBS TNF UCB VEGF VEGFR1 VEGFR2 VPF vWF

Retinoic acid Retinoic acid receptor DNA sequence called retinoic acid-response element Arg-Gly-Asp peptide, used as a recognition epitope on cell adhesion Size exclusion chromatography Smooth muscle cells Somatostatin Subventricular zone - Neurogenic niche of stem cells tert-butyl carbazate Thermogravimetric Transforming Growth Factor Trinitronenzenosulfonic acid Tumour necrosis factor Umbilical cord blood Vascular endothelial growth factor VEGF receptor 1; Same as Flt1 VEGF receptor 2; Same as Flk1 and KDR Vascular permeability factor Von Willebrand factor

xxviii

List of Figures
1.1. Single and double oxidation of dextran by the metaperiodate ion . . . . 1.2. Oxidised dextran reactivity . . . . . . . . . . . . . . . . . . . . . . . . 1.3. Schematic example of oxidised dextran conjugates to small drugs and proteins. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1.4. Examples of oxidised dextran based hydrogels and microparticles . . . . 1.5. Surface coating of biomedical devices by dexOx . . . . . . . . . . . . . 2.1. Schematic organisation of the VEGF gene and most common VEGF isoforms. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.2. The role of the dierent VEGF receptors. . . . . . . . . . . . . . . . . 2.3. VEGF pathways. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.4. 1-integrin is required for clustering and continued internalisation of VEGF-R2 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.5. Schematic example of dierent VEGF immobilisation approaches and impact on release prole. . . . . . . . . . . . . . . . . . . . . . . . . . . 2.6. Postnatal stem and progenitor cells. . . . . . . . . . . . . . . . . . . . 3.1. 3.2. 3.3. 3.4. 3.5. Publication counts for nanobiotechnology on the ISI WoK database. Dierent designs in nanoparticles assembly. . . . . . . . . . . . . . Dierent aspects of nanoparticles composition . . . . . . . . . . . Cellular internalisation pathways of NP . . . . . . . . . . . . . . . Nanoparticles suprastructures. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5 7

. 11 . 18 . 20

. 27 . 28 . 29 . 30 . 34 . 38 . . . . . 42 45 46 49 51 56 60 61 63 66

4.1. Dextrans -1,6 glucose residue possible periodate oxidations. . . . . . . 4.2. Possible hemiacetal structures and tBC reactions for the dierent oxidised residues. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.3. Bidimensional NMR spectra of dexOx reacted with tBC. . . . . . . . . . 4.4. NMR spectra acquired at alkaline pH . . . . . . . . . . . . . . . . . . . 4.5. Dissolution time and viscosity proles according to the oxidation degree.

xxix

4.6. DMTA thermoanalytical curves for the dierent oxidised samples. . . . . 68 4.7. TGA thermoanalytical curves for the dierent oxidised dextrans. . . . . . 69 5.1. Oxidised dextran crossliking by adipic acid dihydrazide. . . . . . . . . . . 81 5.2. Viscosity proles of dexOx solutions dependency of oxidation degree and concentration. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 82 5.3. Swelling index prole of dexOx based hydrogels. . . . . . . . . . . . . . 84 5.4. Endothelial cells seeded on top of dexOx-based hydrogels. . . . . . . . . 86 5.5. Metabolic activity, assessed by MTS, of endothelial cells seeded on top of dexOx-based hydrogels. . . . . . . . . . . . . . . . . . . . . . . . . . 87 6.1. Oxidised dextran and adipic acid dihydrazide reversible cross-linking reaction 90 6.2. Freeze-dried microparticles morphology with varying concentrations of AAD and the eect of Tween 60. . . . . . . . . . . . . . . . . . . . . . 93 6.3. Dierential volume percentage for microgels synthesized with dierent oxidised dextrans. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 94 7.1. Conjugation of oxidised dextran to VEGF followed by SDS-PAGE . . . . 105 7.2. Circular Dichroism spectra of VEGF and D25-VEGF conjugates. . . . . . 107 7.3. VEGF dose-dependent Ca2+ uptake. . . . . . . . . . . . . . . . . . . . . 108 7.4. Intracellular Ca2+ uptake as determined by Fura-2-loaded ECs. . . . . . . 109 7.5. Phosphorylation pathways expression by VEGF and the dexOx conjugates. 111 7.6. DexOx based hydrogels swelling and VEGF release followed by ELISA and radioactivity. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 113 7.7. Hybrid hydrogels uorescent images and cellular viability . . . . . . . . . 115 7.8. Contrast phase images from endothelial cells encapsulated in the brin section of the hybrid hydrogels. . . . . . . . . . . . . . . . . . . . . . . 115 7.9. Genetic proling of endothelial cells after six days. . . . . . . . . . . . . 116 8.1. Physico-chemical properties of the nanoparticles. . . . . . . . . . . . . . 129 8.2. Diameter and release prole of RA+ -NPs . . . . . . . . . . . . . . . . . 132 8.3. UV spectral scan of RA . . . . . . . . . . . . . . . . . . . . . . . . . . 133 8.4. Cellular nanoparticle uptake. . . . . . . . . . . . . . . . . . . . . . . . . 134 8.5. Scheme of the SVZ cell cultures experimental protocols . . . . . . . . . 135 8.6. Cell viability after RA+/ -NPs uptake. . . . . . . . . . . . . . . . . . . 136 8.7. Proliferation of SVZ cells . . . . . . . . . . . . . . . . . . . . . . . . . 136 8.8. RA+ -NPs have a proneurogenic eect. . . . . . . . . . . . . . . . . . . 138

xxx

8.9. RA+ -NPs induce dierentiation of SVZ cells into functionally neurons. . . 140

xxxi

List of Tables
1.1. Price comparison for dierent clinical grade polysaccharides . . . . . . . 4 1.2. DexOx-based drug delivery strategies . . . . . . . . . . . . . . . . . . . 14 1.4. DexOx-based applications involving 3D matrices or surface coatings. . . . 20 2.1. VEGF delivery from polymeric matrices. . . . . . . . . . . . . . . . . . . 35 4.1. Macroscopic characteristics of native dextran and the several oxidised samples. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 65 4.2. Glass transition temperatures obtained from the DMTA curves and characteristic quantities. . . . . . . . . . . . . . . . . . . . . . . . . . . . . 70 5.1. Oxidation degree estimation and Mw of several oxidised dextrans. . . . . 80 5.2. Gelation periods estimated for each dexOx with dierent AAD concentrations. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 83 7.1. Primer sequences used for rtPCR. . . . . . . . . . . . . . . . . . . . . . 104 7.2. Estimation of rhVEGF secondary structure percentage from circular dichroism. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 107 8.1. Physico-chemical characteristics of DS/PEI nanoparticles either with or without RA. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 131

xxxiii

List of Tables

xxxv

Part I. Introduction

1. Oxidised Dextran
Dextran is not the sexiest of the biomedical polymers out there. It is linear, neutral and cheap. Nevertheless, it is an interesting substracte for chemical modications and throughout the last decades, has been a reliable resource with broad applications in the biomedical industry.

1.1. Dextran in Biomedical Industry

Since the late nineteen forties, when dextran from Leuconostoc mesenteroids (strain B-512; US clinical standard [1]) was accepted as a plasma volume expander (i.e. plasma substitute) that the biomedical industry is using this polysaccharide [1, 2, 3]. From the economical perspective, concerning the biomedical industry, when comparing dextran to other polysaccharides of biomedical interest, such as hyaluronic acid, chitosan or alginate, dextran is competitively priced (Tab. 1.1). The dextran from this strain was chosen based on the high percentage (>95%) of -1,6 linkages, more relevant to the initial application, due to the slower hydrolysis by body enzymes, compared to the -1,4 linkage (e.g. glycogen). The high density of hydroxyl groups present in dextran, allows dierent kinds of chemical modications [4]. Such approaches aim at using dextran from drug conjugation [5] to particles or hydrogels synthesis [6], easily adding value to the starting material and broadening the potential applications. Among the chemical modications described in the literature, one nds dierent degrees of complexity. They can involve organic solvents, hazardous monomers and troublesome procedures which may counter-balance the added value of such approaches. The dextran periodate oxidation is a simple, straightforward chemical modication, which yields a highly versatile biomaterial with reproducible qualities. Oxidized dextran has mild cytotoxicity, which can be mitigated [7], but still has brought value to most therapeutic applications studied so far. Most importantly, it has entered the

Chapter 1

Oxidised Dextran

clinical trials stage before, demonstrating oxidised dextran (dexOx) as a valid low-cost biomaterial option [8]. Table 1.1.: Price comparison for dierent clinical grade polysaccharides. Whenever possible the bulk price was presented, which obviously lowers the /gram. There is no conict of interests between the authors and the mentioned companies.
Material Dextran Chitosan Hyaluronan Hyaluronan Alginates Price range /gram 0.5 0.85 ~ 45 ~ 45 ~100 ~ 45 Grade Ultrapure; clinical Ph. Eur.3 Ph. Eur.3 Medical grade Ph. Eur.3 Companies scanned Pharmacosmos1 ; Polydex1 Novamatrix2 Novamatrix2 Lifecore1 Novamatrix2

1 - Through cotation; 2 - Through companys website; 3 - European Pharmacopoeia

1.2. Dextran Oxidation

The dextran oxidation by periodate ion is a catalysis-free aqueous reaction which yields a puried product with a simple dialysis step, followed by freeze-drying. Initially described by Malaprade in 1928 [9], this method was used for the characterisation and elucidation of the polysaccharide structure, through the complete oxidation and consequent analysis of the degradation products [10, 11, 12, 13]. Dextrans glucose residue, has vicinal diols (on -1,6 residues), presenting two dierent oxidisable bonds, within the same residue. The oxidation of any of those bonds yields an aldehyde on C3 , which is also susceptible to periodate oxidation due to the neighbouring hydroxyl on C2 or C4 , eventually leading to a double oxidation of that same residue (Fig. 1.1A). This process can be observed by the pH decrease, due to the release of the C3 as formic acid [14]. As clearly explained by Tiziani [15], in the rst oxidation step, one of the I-O bonds of the periodate ion, attacks one of the two hydroxyl groups of the vicinal diol; the second step is the formation of the planar cyclic ester as part of an octahedral intermediate, the rate of which, must depend on the acidity of the oxygen of the OH groups and their relative positions. Regarding the rst oxidation step, this oxidative attack, on aqueous environment, is sensitive to the carbon bond. The cleavage of the C3 -C4 bond was described to be favoured 7.5-fold compared to the C2 -C3 bond. However, the second oxidation step was reported to have similar kinetics [16].

1.2 Dextran Oxidation

Figure 1.1.: (A) Single and double oxidation of dextran by the metaperiodate ion; (B) hemiacetal structure proposed by Ishak and Painter [16]; (C) aldo-enol tautomerism proposed by Drobchenko [17, 18].

When the oxidation is held in dimethyl sulfoxide (DMSO), a non-selective, single oxidation was described to occur. The second oxidation inhibition was explained by a protective intra-residual hemiacetal formation [19], which does not allow further oxidation on the same residue. This phenomenon, was also considered to occur in aqueous environment, but was suggested that it is not stable enough to prevent complete dextran oxidation [16]. The hemiacetals, as well as hemialdals, should be responsible for the spectroscopic disappearance [14] of the aldehyde moiety. These structures exist in equilibrium, allowing the aldehydes to be reactive towards their natural counterparts (proposed hemiacetal structure for the doubly oxidised residue depicted on Fig. 1.1 B [16]). Another set of studies focused on the spectral characteristics of the mildly oxidised dextrans at dierent pH conditions, suggested alternative structures to hemiacetals. The UV analysis, disclosed the presence of bands, indicating that the hemiacetals might exist in a restricted pH window, between 4.0 and 5.2. Below pH 4, the bands were attributed to aldehydes and above pH 5.2, to enols and enolate ions. The authors propose a pH-dependent aldo-enol tautomerism (Fig. 1.1 C) [17]. The 1 H-NMR analysis of

Chapter 1

Oxidised Dextran

dexOx at dierent pHs revealed the appearance of new peaks (7.5 9.5 ppm), which disappeared after treatment with a borohydride salt, therefore being attributed to the aldo-enol transition populations and hemiacetals [18, 20, 21]. However, when the dexOx oxidation reaction is followed by 1 H-NMR a putative aldehyde at ~9.7 ppm is observed. At that moment, the pH is close to 2.5, but the following spectra failed to capture the aldehydes again [14].

1.2.1. Oxidation Degree

The control over the modication extension is of utmost importance on the nal macroscopic and microscopic properties of mildly oxidised dextran. The aldehyde groups generated can be easily titrated and quantied either by colorimetry or by potentiometry. The most common methods described in the literature, involve the titration with carbazates [14, 22] and its indirect quantication of the excess with trinitrobenzenosulfonic acid (TNBS). The dinitrosalycilic acid method, developed for estimating sugars in urine [23], can also be approached to oxidised dextran and assess the reducing strength, hence, the oxidation degree (OD) [24]. Another common method uses potentiometric titration to quantify the released equivalents of HCl, after hydroxylamine hydrochloride reaction with the aldehydes [25]. Interestingly, the less used colorimetric method with oxidised dextran is the method developed by Hugo Schi [26]. The complex between aldehydes and fuchsin can be quantied by its absorption at 556 nm, and to the best of our knowledge it was used once involving oxidised dextran [27]. As the dextran structure is very homogenous, the 1 H-NMR spectrum is well resolved, when compared to other polysaccharides. The carbazone formed, after titration with slight excess of tert-butyl carbazate (tBC) (taking into account two aldehydes per residue), yields a new non-exchangeable proton, visible on D2 O, around 7.3 ppm [14]. The ratio between this peak integral and the anomeric peak, correlated well with the data from the TNBS assay, validating this 1 H-NMR approach. Intuitively, the reaction stoichiometry is expected to have two aldehydes per oxidised residue, hence, yielding two carbazones per oxidised residue. However, the visualisation of a single correlation on the HMQC [14] suggests otherwise, because only one population of aldehydes appears of being attacked [14]. Therefore, the oxidation degree determination could be masked by this phenomenon, which we will try to clarify on chapter 4.

1.2 Dextran Oxidation

1.2.2. DexOx Reactivity

The attractiveness of aldehyde-activated dextran is inherently connected with the propensity of this chemical group to react promptly with N-nucleophiles, forming a stable covalent link, yet, reversible. Amines are ubiquitous throughout a broad variety of small therapeutic molecules and a regular presence in proteins, especially through the aminoacid lysine. Hydrazides can be incorporated easily on several compounds [28], empowering the target molecule with dexOx reactivity. The outcome from the reaction between dexOx and amines results in an imine (widely known has Schi base; Fig. 1.2 A) whereas the reaction with hydrazides results in a hydrazone (Fig. 1.2C). Hydrazones are more stable and resistant to hydrolysis than imines, which results from the delocalisation of the -electrons [29]. Theoretically, imines on single oxidised residues, formed on C3 , can undergo an Amadori rearrangement (Fig. 1.2B) forming stable ketoamines [30, 31]. The imine bond is susceptible of reduction, leading to a non-hydrolizable bond. The preferred approach is performed by reductive amination, through sodium borohydride or sodium cyanoborohydride. The reaction yields an irreversible amine covalent bond. Cyanoborohydride is more selective, because it does not reduce aldehyde bonds as borohydride does [32] and can limit the number of reduced bonds between dexOx and the target molecule [33]. Another option is pyridine borane which has slightly greater reducing strength than sodium cyanoborohydride [34].

Figure 1.2.: (A) DexOx conjugation to amines with consequent formation of imines and (B) the possibility of an Amadori rearrangement on C3 ; (C) reaction with hydrazides and consequent hydrazone formation.

Chapter 1

Oxidised Dextran

1.2.3. Oxidation Consequences

1.2.3.1. Physico-Chemical The periodate oxidation, promotes dextran degradation and consequent Mw decrease. This eect can be observed by size exclusion chromatography [14, 35]. The dexOx presents longer retention times and increased polydispersity. Usually, the polymers Mw trend, directly inuences the resistance to ow, due to the hydrodynamic radio. Therefore, the oxidation related decrease of the Mw , should yield less viscous solutions. However, as we will demonstrate on chapter 5, the concentration increase, results in a reverse eect, attributed to the interchain cross-linking, articially, increasing the Mw and consequently the viscosity .

1.2.3.2. Biological From the biomedical device perspective, the excessive oxidation could bring poor qualities concerning the macro-monomer handling. However, a high reactive molecule could be useful for high loading eciency hence, high payload. The biological impact of the dextran oxidation degree has been reported across several aspects. Concerning the release of therapeutic agents on target tissues, where the release is dextranasedependent, the oxidation degree was reported to confer resistance to enzymatic hydrolysis and consequent drug release [36]. Some works have described dexOx to be toxic and inhibit cell growth of dierent cell lines. It has been suggested to be directly associated with the concentration of aldehyde groups. The mouse leukaemic monocyte macrophage cell line was shown to be sensitive to the aldehyde concentration (IC50 3 mol/mL of aldehydes), though mitigated after reaction with ethanolamine [7]. The evaluation of cytotoxicity by specic assays also gave indications of possible dexOx toxicity towards keratinocytes, endothelial cell and broblasts, though it could be related to interference of dexOx with the mentioned techniques [37]. Nevertheless, the cross-linked dexOx, in the form of hydrogels, has been reported several times as cytocompatible [37, 38, 39] as well as in this work, with endothelial cells from rabbit cornea (chapter 5).

1.3 DexOx Applications

1.3. DexOx Applications

The rise of pharmaceutical and biotech industries brought to the market an impressive portfolio of new drugs of dierent natures for all sorts of unmet medical needs. The eld of drug delivery aims at delivering any drug at the right time in a safe and reproducible manner to a specic target in a given concentration level. However, issues such as low stability in vivo, short half-life and immunogenicity limitations are common. Among several approaches to overcome these issues, the polymer conjugation has been one of the preferred methods and has seen some products entering the market [5]. Polymeric conjugation allows the increase of the hydrodynamic volume, decreasing the excretion rate, hence, prolonging the plasma half-life and increasing the bioavailability. This eect is remarkable when dealing with hydrophobic drugs, due to the deliverance of a higher payload. It can also confer protection against the host immune system by shielding the therapeutic protein [5]. The industry gold standard is a process known as PEGylation, characterised by the grafting of polyethylene glycol (PEG) [40]. Most of the available polymer-drug conjugates on the market, present this FDA approved polymer. Currently, on clinical trials, one can also nd N-(2-hydroxypropyl)methacrylamide (HPMA) copolymer and polyglutamate to serve such purpose [5].

1.3.1. DexOx-Drug Conjugation

The characteristics of dexOx have been explored under the perspective of drug conjugation. Several studies, regarding the use of dexOx as the polymeric conjugate, will be presented, focusing on the nature of the therapeutic entity and complexity of the system. 1.3.1.1. Small Molecules Many antibiotics and anticancer agents suer from hydrophobicity, which can be overcome through conjugation to water-soluble polymers. The most straightforward strategy is by direct conjugation to the ubiquitous chemical group, the amine group. Doxorubicin will be used as an example of small drug delivery conjugated to dexOx, due to the high number of studies found on the literature. Doxorubicin (a member of the anthracycline ring antibiotics) has been used in the treatment of solid tumours and leukemias. However, due to the clinical limitation of potentially developing dose-related cardiotoxicity, it has been coupled to dexOx through its amine group (Fig. 1.3A), which can decrease

Chapter 1

Oxidised Dextran

the sub-acute toxicity compared to the free drug [41]. The retention prole on dierent tissues of the dexOx - Doxorubicin amine conjugate, was demonstrated to increase the systemic circulation and decrease the total body clearance of the drug. Higher liver accumulation of the conjugate but decreased cardiac accumulation, was described, which improved the issue of doxorubicin associated cardiactoxicity [42]. This and other set of studies (Tab. 1.2) demonstrate dexOx to be able to overcome some of the most chronic issues in small pharmaceuticals delivery. The lack of a N-nucleophile is not impairment for dexOx conjugation, though it makes the process straightforward and highly ecient. It enables the delivery of hydrophobic drug in higher percentages and generally, increases the plasma circulation half-life, reducing systemic toxicity and increasing therapeutic ecacy. 1.3.1.2. Proteins Proteins, when compared to the small drugs, have higher degrees of complexity. The proteins native conformation denes its identity and the proteins preservation is of utmost importance for the activity maintenance. Generally, proteins are sensitive to temperature, organic solvents and mechanical stress, which can promote protein denaturation and lead to stability/activity lost. The exposed lysines (Fig. 1.3B) will determine the extension of the interaction with dexOx [33]. This interaction will depend not only on the ratio between aldehydes and amines but also on the molecular weight dierence between the polysaccharide and the protein. Three dierent enzymes were conjugated with dexOxs with variable Mw and were successful in preserving enzymes activities and stabilities, on the presence of organic and air interfaces [43]. On the case of multimeric enzymes, the stability and activity, the quaternary structure of bovine catalase [44] or L-asparaginase [45], was also preserved by dexOx conjugation. The last examples demonstrate the protein stabilising potential of dexOx. However, most examples were performed under reductive amination conditions, which irreversibly bind the protein-dexOx conjugate. The proteins bioactivity can be partially/totally impaired by steric hindrance of the active site. DexOx has reached a phase III clinical trial1 as a conjugate to somatostatin (sms). Somatostatin-receptors positive tumours can be targeted by sms which triggers cytostatic and cytotoxic eects. However, natural sms has a short in vivo half-life due to
1

Personal communication from Anders Holmerg During 2010 sms-D70 will enter a registration phase (in Mexico) and will hopefully be given "orphan drug status".

10

1.3 DexOx Applications enzymatic degradation. The conjugation to a mildly oxidised dextran, recurring to reductive amination, was able to achieve ~27 hours of plasma residency in mice [46] and was still able to maintain the same degree of anity with every receptor [47]. The phase I clinical trial assessment of plasma concentrations and tolerability, showed the conjugate to be well tolerated but the limiting dose was not established. However, no responses were found [8]. Though, the concept of increasing the plasma half-life of a small protein was demonstrated, a few issues related with the conjugate nature, were not addressed. The authors estimated a ratio of four sms per dexOx chain. This high ratio might have helped retaining the conjugate activity, because the sms active site has a lysine, likely reacting with the aldehydes.

Figure 1.3.: Schematic example of oxidised dextran conjugated to (A) small molecules (doxorubicin); (B) proteins; (C) antibodies, used in immunoconjugation. Aldehyde highlighted with red circle A more detailed study, involving the human growth hormone (hGH) - dexOx conjugate, successfully yielded a pro-drug formulation with sustained release. The release was dependent on the imine bond, while the reduced imine failed to release any hGH. The conjugate was shown to be stable at 4 C for up to 10 days and that could be stored frozen (-70 C) without activity loss. This evidence broadens the thermo-stability window conferred by dexOx. The release kinetics of hGH from dexOx is correlated with the dextran oxidation degree and directly aects the half-life of the conjugate. The in

11

Chapter 1

Oxidised Dextran

vivo studies conrmed the increased circulation period, at higher dose, for two days, when compared to the bolus injection [48]. The authors established a strong correlation between the oxidation degree and the extent of complex formation, which they believe is favoured by the higher percentage of doubly oxidised residues, compared to the singly oxidised residues, which are suggested to be under hemiacetals. DexOx appears to be an interesting alternative to PEG, the industry gold standard for protein pharmacokinetics modulation. The simple mix reaction yields a reversible conjugate, which can be reduced to a stable and irreversible amine in one simple step. The half-life of such conjugates is dependent on the nature of that bond, but most important is the stability and environmental protection conferred by dexOx, enhancing the delivery to target sites, with reduced systemic toxicity. Other examples of protein dexOx conjugates can be found on Tab. 1.2. 1.3.1.3. Immunoconjugates The linearity of dextrans chain and the wide range of molecular weights available, associated to the multiple functionalities brought by periodate oxidation, allows the multiple conjugation of dierent chemical entities. As described earlier, small pharmaceuticals, are devoid of tissue specicity, leading to systemic toxicity. However, the simultaneous conjugation with an antibody (immunoconjugate), can increase the therapeutic ecacy on the target tissue (Fig. 1.3C). To overcome the toxicity of the chemotherapeutic agents, and to improve their tissue selectivity, antibodies directed against the tumour cells can be used. Daunomycin (similar to doxorubicin) was the chosen anticancer agent. The tumours were injected intraperitoneally, so as the immunoconjugates. But the intravenous route was found to yield better results for the immunoconjugates and has being important on the therapy success. However, the immunoconjugates still failed to achieve better results than the drug dexOx conjugate alone, in two experimental murine tumour systems [49]. On other study by the same authors, they achieved improved results with the immunoconjugate, this time with the monoclonal antibody (mab) against rat -fetoprotein. Under the experimental conditions used, the immunoconjugate was more ecient impairing the growth of -fetoprotein-producing tumour cells, than daunomycin alone or conjugated to dexOx [50, 51]. Indeed, this system was successful in decreasing, hepatoma cells transplanted intraperitoneally, in rats. When administered intravenous, the immunoconjugate achieved better results, than through the intraperitoneal route. The success was

12

1.3 DexOx Applications attributed to the lower toxicity of the daunomycin on the conjugated form and the higher specicity of the antibodies [52]. These last set of examples, render dexOx as an interesting choice to increase the eciency of pro-drugs. The nal setup has extended plasma residency periods, reduced systemic toxicity, improved the target specicity and increased therapeutic activity.

1.3.1.4. Gene-Delivery Gene therapy expectations, as the next medicine revolution, have had their downturns. The promising viral gene therapy, still with the highest transfection eciencies of all the available techniques, suered major setbacks, in a pioneering treatment for severe combined immunodeciency diseases [53]. Therefore, while viral gene therapy is being improved, other less pathogenic and immunogenic non-viral approaches have been explored. A comprehensive review on this subject can be found elsewhere [54]. Within the context of polyplexes (DNA/polymer complexes), polyethylenimine (PEI) has been considered the gold standard in gene delivery, because of its excellent transfection efciencies [55, 56]. The dexOx-based strategy grafted oligoamines to the dexOx chain, capable of complexing genetic material. The inuence of dextran molecular weight, the oxidation degree extension, several oligoamines and the transfection eciencies of the obtained polyplexes were screened [57, 58]. Despite most of the combinations, yield stable polyplexes, only a few were active in transfecting cells. The tetramine, spermine, conjugated to dexOx, was identied as the best transfection vector [57, 59]. Histopathological assessment revealed mild toxicity in the muscle and no abnormal nding in liver or lung, as well as no systemic toxicity was observed [60]. Certain conditionings may increase the transfection yield, not only formulation-wise but as well environmentally related. Mesenchymal stem cells, cultured on 3D scaolds (collagen reinforced with polyglycolic acid) were more susceptible to transfection than when cultured on normal surfaces. The 3D environment provides higher surface area for cell attachment, spreading and proliferation, strongly aecting and increasing these cell events, periods when cell are more susceptible to transfection [61]. Interestingly, the same polycations, were identied as being eective in eliminating the pathological conformation of the cellular prion protein, responsible for self-propagating the refolding of the normal prion protein and developing into neurodegenerative diseases, known as spongiform encephalopathies [62].

13

Chapter 1

Oxidised Dextran

Table 1.2.: DexOx-based drug delivery strategies, overviewing the conjugation method, strategy followed and dexOx characteristics.

Active factor

Conjugation Kind

Therapeutic Application Scope Anti-viral; Hepatitis B; Increase circulation Antiarrhythmic agent; Prodrug Antifungal agent; Assessment of conjugate stability and activity Antifungal agent; Injectable hydrogel Antifungal agent; Stable water-soluble conjugate Chrons disease; Sustained and targeted delivery Anticancer agent; Increase solubility and targeting Anticancer; Attack cell surface sialic acid Cancer chemotherapy; Nanoparticles with antitumor ecacy Anti-tumor specic delivery; DexOx as the core of polypropylene amine dendrimers. Chemoembolisation; Gelatin microparticles Non-steroidal anti-inammatory drug; DexOx/Cholic acid hydrazide micelles. Self aggregating particles Anti-inammatory; Improve in vivo ecacy; DexOx grafted with -Cyclodextrin. (NaBH4)

Mw 1 (kDa) 32 - 42

OD2 (%) (200)

Ref.

Acyclovir

Imine Imine / Amine (NaBH3 CN) Amine (NaBH4 ) Imine Imine / Amine (NaBH4 ) Amine (pyridineborane) Hydrazide spacer

[63]

Procainamide

43

33 - 90

[64]

Amphotericin B Amphotericin B Nystatin 5-aminosalicylic acid Asulacrine / Ellipticine Cationic dextran Doxorubicin

40 100 - 200 9 - 74

1.5 - 52 33 75 5 - 50

[7] [65] [66]

6 - 500

12 93

[36]

40

~18

[28]

Amine (NaBH3 CN) Amine (NaBH4 ) Hydrogen bonds; to tertiary amines (NaBH4 ) Physical entrapment Hydrophobic

70

(57)

[67]

10

n.a.

[68]

DoxorubicinHCl

60

(100)

[69]

Pingyangmycin

40

78.8

[70]

Indomethacin

interaction with cholic acid Inclusion complexes in -Cyclodextrins

40

29.2; 46.5

[71]

Naproxen

70

(~76)

[72]

14

1.3 DexOx Applications

Therapeutic Application Scope Solid tumours; oxidised sulfopropyl dextran microspheres Anticancer; Systemic accumulation prole Tuberculose; Sephadex drug reservoir Study carbohydrate mediated interactions Antianemic; Iron repository Mw 1 (kDa) Sephadex 10; 70; 500 Sephadex OD2 (%) n.a.

Active factor

Conjugation Kind

Ref.

Mitomycin C

Imine Amine (NaBH4 ) Imine and hydrazone Hydrazone Complexation in alkaline solution Cysteine grafting

[73, 74]

Doxorubicin Kanamycin, Isonyazide Oligosaccharides

n.a.

[42]

n.a.

[75]

500

50

[76]

Iron (III)

n.a.

26 - 43

[77]

Rhenium-188

(NaBH3 CN). Gluconate as transchelator Complexation

Contrast agent; Nuclear oncology; Improve contrast agent availability

70

(22)

[78]

99m Tc

through cysteamine grafting (NaBH4 )

Contrast agent; Nuclear oncology; Improve contrast agent availability Controlled release system; Enhance osmotic activity Anti-tumour agent; Increase therapeutic ecacy Interfacial protection; Activity preservation Activity preservation; Stabilisation of multimeric proteins Activity preservation; Stabilisation of multimeric proteins Protein stabilisation. Detect protein-protein interactions

60 - 90

~6

[27]

Histidine Aminoguanidine; Agmatine

Amine (NaBH4 )

40

~ 100

[79]

Amine (NaBH3 CN)

70 6; 20; 150; 1000 6

(59)

[80]

Glucose oxidase

Amine (NaBH4 )

(100)

[43, 81]

Catalase

Amine (NaBH4 )

20; 100

[44]

L-asparaginase

Amine (NaBH4 )

20

(100)

[45]

Several proteins

Amine (NaBH4 )

1.5; 6; 20

(100)

[82]

15

Chapter 1
Therapeutic Application Scope Thermal stabilisation; Enzyme activity preservation Mw 1 (kDa) 10; 40;

Oxidised Dextran
OD2 (%)

Active factor Pullulanase, Amylase, Cellobiase

Conjugation Kind

Ref.

Amine (NaBH4 ; NaBH3 CN) Amine (NaBH4 ;

70; 500; 2000

(100)

[83, 24]

Cellobiase

NaBH3 CN; (CH3 )2 NBH3 ) Amine

Stabilisation and rigidication of the protein 3D structure

70

(100)

[33]

Lipase B

(NaBH4 ; NaBH3 CN) Amine (NaBH3 CN)

Improve thermal stability activity

40, 250

(>100)

[84]

Somatosatin receptor positive tumours; Improve circulation time, maintain activity Increase therapeutic ecacy; Sustained release, reduce high-dosing Blood substitution; Plasma expander/oxygen delivery Blood substitution; Plasma expander/oxygen delivery Blood clotting; Increase plasma residency Tumour targeting; Reduce immunogenicity Tumour targeting; Reduce immunogenicity Solid tumours; Immunoconjugate 1 - 100 6, 31, 50, 64 (56) 70 - 75 (25)

Somatostatin

[46, 8, 47]

Growth Hormone Hemoglobin Hemoglobin; deoxyhemoglobin Factor IX; Protein C mabT101

Imine

[48]

Imine

200- 275

[85]

Imine / Amine (NaBH3 CN/NaBH4 )

10 40

n.a.

[86, 87, 31, 88]

Imine

10

n.a.

[89]

Amine (NaBH3 CN)

(190)

[90]

Fab fragments mabT1010; Doxorubicin nucleotide analogue; anti-IgM Daunomycin; 2 = antibodies

Amine (NaBH3 CN)

(190)

[91]

Amine (NaBH3 CN)

n.m.

n.a.

[92]

Amine (NaBH3 CN)

B leukemia cells; Immunoconjugate

10, 40, 50 10, 40, 50

n.a.

[93]

Amine (NaBH4 )

Solid tumours; Immunoconjugate

n.a.

[49]

16

1.3 DexOx Applications

Therapeutic Application Scope Solid tumours; Immunoconjugate Mw 1 (kDa) 10 OD2 (%) n.a.

Active factor Daunomycin; mab/pab Adriamycin (Doxorubicin); mab

Conjugation Kind

Ref. [50, 52, 51]

Amine (NaBH4 )

Amine (NaBH4 )

Tumour targeting; Immunoconjugate

40

25

[94]

Radiotherapy of EGF receptors

99m Tc;

EGF

Amine (NaBH3 CN)

expressing tumours; Immunoconjugate-like

10

(46)

[95]

99m Tc;

anticytokeratin mab

99m Tc-dextran

Radio imaging Immunoconjugate

complex; Imine

10

n.a.

[96]

p-Nitroaniline

Amine (NaBH4 )

nonlinear optical chromophores Increase thermo and photostability

150

~7

[97]

1 - Native dextran molecular weight; 2 - When the real OD was not determined, the theoretical OD is mentioned in brackets; n.a. not applicable; n.m. not mentioned

1.3.2. Hydrogels
The hydrophilic nature and reactivity of oxidised dextran has been exploited on the synthesis of hydrogels (Fig. 1.4A), either has the main backbone or has a cross-linker. The existing aldehydes, oer complementary reactivity towards amines, hydrazides and hydroxyl (on acidic media) groups, avoiding the need for chemical initiators or other adjuvants. Other initiator-free cross-linking methods, include the pairs thiol/acrylate [98] or hydroxyl/isocyanate [99], however, the latter has to be prepared on an aprotic solvent, because of the prompt reaction of water towards the isocyanate group. A very comprehensive review on cross-linking methods of hydrogels can be found elsewhere [100, 101], as well as a more specic review on biodegradable dextran hydrogels [6]. Gelatine was one of the rst materials, cross-linked by dexOx, to yield a hydrogel [30]. As a protein, it contains lysines, responsible for the cross-linking. This initial study, identied a set of conditions, related to dexOx, responsible for the decrease in gelation time, such as the increase of the oxidation degree and the increase of the dextran Mw .

17

Chapter 1

Oxidised Dextran

The OD increase presents higher concentration of reactive species, speeding up the reaction and reducing gelation time. The onset of reaction can also be controlled by the media pH, ionic strength and temperature [30, 102]. This formulation was evaluated as a hydrogel lm, for the controlled release of several proteins (BSA and EGF). The protein molecular weight and the lysine content inuenced their release proles. As this system is susceptible to interact with proteins, it retained BSA much easier (68 kDa; 60 Lys residues) than EGF (6 kDa; 2 Lys residues) [103]. This system proved to have an acceptable biocompatibility, after direct comparison with commercially available wound dressing materials, after in vitro cytotoxic evaluation and by in vivo subcutaneous implantation in mice [37]. The chitosan derivative, carboxyethyl chitosan (CEC) which, contrary to the native chitosan, is readily soluble in non-acidic aqueous media, yields versatile hydrogels [104]. The hydrogels of dexOx and CEC have fast gelation rates (30 600 seconds), depending on the polymers concentration, feed ratio and mixing temperature and could be modulated to closely match the mechanical properties of the tissue of interest. The growth factors free hydrogel, promoted adhesion and growth of encapsulated mouse broblasts. It also accelerated wound healing on a mice full-thickness transcutaneous wound model [105]. Our research group has approached the dexOx cross-linking with adipic acid dihydrazide (AAD). That formulation yields hydrogels with tuneable gelation rates, mechanical properties, porosity, swelling ratios and dissolution proles. The feed concentration of dexOx or AAD as well as the dexOx OD, control the hydrogels characteristics [14], further characterised on chapter 5. Other compatible crosslinkers (such as PEI) were also approached (Fig. 1.4A), but without complete characterisation.

Figure 1.4.: (A) DexOx-based hydrogels cross-linked with nanoparticles of PEI (unpublished data); (B) SEM imaging of dexOx-based microparticles, cross-linked with AAD and prepared in an all-water emulsion as described in chapter 6.

18

1.3 DexOx Applications

1.3.3. Particles
The use of dexOx on other congurations such as particles (Fig. 1.4B) can be useful on drug delivery and could have advantages, over prodrugs or hydrogels matrices, yielding higher therapeutic ecacy. Particles have higher surface to volume ratios, than hydrogels, allowing higher control over the drug release. Like the hydrogels, the dexOx particles, can be prepared by cross-linking with N-nucleophile polymers, such as chitosan [68] or gelatine [70, 106]. As with the several strategies described on the design of prodrugs, dexOx is susceptible of modication, broadening the strategies on the production of particles. The grafting of moieties that promote self-aggregation and stabilisation of the particles, is commonly used with polymeric biomaterials and some examples can be found with dexOx as the core polymer. Methyl polyethylene glycol (MPEG) was grafted to dexOx, sterically stabilising the nanoparticles, allowing the aldehydes to bind BSA [107]. A micro emulsion method was used to prepare nanoparticles of chitosan and a dexOx-doxorubicin reduced conjugate, which yielded monodispersed particles with ~100 nm of diameter [68]. Other interesting approach for doxorubicin, used dexOx as the dendrimeric core [69]. The several aldehyde moieties were reacted with polypropylene amine, which was subsequently reduced with sodium borohydride. A more detailed review on nanoparticles will be presented on chapter 3.

1.3.4. Surfaces
Biomedical devices require surface biocompatibility as they will be in contact with physiological environment. Therefore, the inertness of dextran render it appropriate for surface coating strategies. Silicon is a widespread material in biomedical devices, which can be further modied. The silanisation, for example, with aminopropyldimethylethoxy silane (APDES) [108] or aminopropyltriethoxy silane (APTES) [109, 110, 111, 112], can be used as an intermediary step for the consequent coating of the aminated surfaces. By reductive amination, dexOx can be reverted to a dextran-like inert state, limiting cell adhesion and spreading [109]. However, after a second periodate oxidation and grafting of specic peptides, such as RGD [111], it is possible to redirect the dexOx coating to any kind of specic surface bioactivity, by the proper grafting of specic biomolecules. Indeed, the grafting of the laminin-based peptide, IKVAV, promoted substantial neural cell adhesion and reduced broblast and glial cell adhesion. This kind of approach could lead to the development of guiding surfaces for the neurite outgrowth [112]. But it

19

Chapter 1

Oxidised Dextran

could also be used to minimise the eects of glial scar tissue on neural recordings in deep brain electrodes. On another work, dexOx was used to bridge a polylysine surface and laminin/TGF-1 (transforming growth factor). The grafted TGF-1 was successful in avoiding the glial scar through decrease of the astrocytes proliferation on the electrodes (Fig. 1.5) [113].

Figure 1.5.: Surface coating of biomedical devices by dexOx, bridging laminin/TGF-1. Adapted with permission from reference [113], artwork by Matthew Kruback. A nal and dierent example, where the coated surface was not aminated, came from the gecko-inspired surface based on poly(glycerol sebacate acrylate), which was spin-coated with dexOx. It increased the interfacial adhesion on biological tissues [114], through the exposed amine groups of the target tissue, skin. Table 1.4.: DexOx-based applications involving 3D matrices or surface coatings.

Application

Application / Drug No

Scope & Strategy Thorough characterisation; Gelatine XL; Imine Thermal and rheological properties; Gelatine XL; Imine In vitro release study; In vitro and in vivo biocompatibility; Gelatine XL; Imine

Mw 1 (kDa) 10 - 500

OD2 (%) 5 - 70

Ref [30, 102] [115] [37, 103]

Hydrogel

Hydrogel

No

70

5 20

Hydrogel

EGF; BSA

70

5 20

20

1.3 DexOx Applications

Application / Drug Mw 1 (kDa) OD2 (%)

Application

Scope & Strategy Characterisation and comparison to brin

Ref

Hydrogel

Tissue adhesive

glue; Ethylenediamine modied gelatine XL; Imine

200

15 - 70

[116]

3D vascular Hydrogel tissue engineering Hydrogel Support in vitro growth Enhanced wound healing None

EC growth on 2D; SMC growth on 3D; Gelatine XL; Imine; IPN with glycidyl methacrylate General characterisation; Gelatine, chitosan or BSA as XL; Amine (NaBH4 ) Mechanical; physico-chemical; biological characterisation; N-carboxyethylchitosan XL; Imine Gelation rate; Succinyl-chitosan XL; Imine Chemical, biological and biomechanical

400 500

14 (9)

[117]

40

n.a.

[118]

Hydrogel

76

5, 15, 25 16 - 82

[104, 105] [119]

Hydrogel

60 90

Hydrogel

Bone glue

characterisation; Modied chitosan XL; Imine

15 20

40

[120]

Corneal Hydrogel incisions and tissue adhesive

[121, Biological and functional characterisation; 8-arm PEG amineXL; Imine 10 50 122, 123, 124, 39] Physico-chemical, mechanical and blood coagulation characterisation; Polyallylamine, Chitosan or Glycol chitosan XL; Imine Self-gelling hydrogel; Carboxymethylcellulose hydrazide XL Self-gelling hydrogel; Carboxymethylcellulose hydrazide XL Protease detection by degradation rate; Protease-sensitive peptides XL Improve therapeutic ecacy ( 100 nm); Chitosan XL; Amine (NaBH4 ) 100 200 100 200

Hydrogel

Hemorrhage sealant

36 - 88

[125]

Hydrogel

Amphotericin B Prevent

5 75

[65]

Hydrogel

peritoneal adhesions

70

n.a.

[38]

Hydrogel

Clinical diagnostics Doxorubicin

2000

107

[126]

Nanoparticles

10

n.a.

[68]

21

Chapter 1
Application / Drug Pingyangmycin AIDS related Microspheres pneumonia; TAPP-Br Nanospheres Proteins delivery; HSA Mw 1 (kDa) 40

Oxidised Dextran
OD2 (%) 78.8

Application

Scope & Strategy Synthesis, characterisation & in vitro release ( 50 - 200 m); Gelatine XL Synthesis, characterisation & in vitro release ( 80 - 120 m); Gelatine XL Synthesis and characterisation; ( < 200 nm); MPEG modied dexOx; Albumin XL Self-aggregating particles. Synthesis,

Ref

Microparticles

[70]

70

81.7

[106]

70

47

[107]

Micromicelles

Indomethacin

characterisation & in vitro release ( 500 nm); DexOx-grafted cholic acid High-load delivery, drug stability and

40

46

[71]

Microparticles

Mitomtcin C

reduced toxicity ( 100 m); Oxidised sulfopropyl dextran

Sephadex

n.a.

[127, 73, 74]

Magnetic nanoparticles

Delivery of biomolecules

Synthesis and ( 8 nm); Iron-dextran conjugated particles, activated by oxidation Synthesis, biological characterisation, drug

40

48

[128]

Dendrimers

Doxorubicin

release and selective cell-uptake; Polypropylene imine-grafted dexOx (NaBH4 ) with encapsulated drug

60

(100)

[69]

NP coating

Protein stabilisation Possible

Prevent GOX inactivation, immobilized on magnetic nanoparticles; DexOx coating (NaBH4 ) Modication of aminated matrices; Aminated matrices; Enzacryl AA/AH Prevent protein fouling; Functionalised silicon with APDES; dexOx coating (NaBH3 CN) Control surface reactivity by oxidation extension; Functionalised silicon with APTES; dexOx coating (NaBH3 CN) 110 20 - 50 [110] 10 6 100 [108] (6 20) 20 (180) [81]

Surface

immobilisation of proteins Biocompatible

10, 40

[129]

Surface

non-fouling surfaces Control

Surface

interactions at tissue/material interface

22

1.3 DexOx Applications

Application / Drug Control cell Surface adhesion; RGD; IKVAV) Mw 1 (kDa) OD2 (%)

Application

Scope & Strategy Limit and promote specic cell adhesions and growth; Functionalised silicon with APTES; dexOx coating (NaBH4 ) Decrease astrocyte adhesion and

Ref [109,

40, 70

(50)

111, 112]

Surface

TGF-1

proliferation; Functionalised silicon with APTES, or poly-L-Lysine; dexOx coating (NaBH4 )

40

(20)

[113]

Surface

Biomedical devices coating

Gas-plasma n-heptylamine deposition; dexOx coating of aminated surface (NaBH3 CN) Increase detection sensitivity; Aminated surface (APTES) dexOx dipped (NaBH3 CN) Improve carbohydrate-mediated molecular interactions; Hydrazide-linked monosaccharides to dexOx Improve performance as hydrophilic spacer; Aminated Agarose support; (NaBH4 ) Particles coated with dexOx for the

9, 74, 515, 2000

17 100

[130]

Surface

Immunochemical microarrays

20

[131]

Surface

Oligosaccharide probes Rennin & Protein A

500

(50)

[76]

Surface

6; 20

(50)

[132]

Surface

Lysozyme

immobilisation of lysozyme; Amino-Silicate carrier

35, 170 2000

(200)

[133]

Improve ELISA Surface hapten immuno detection

dexOx acts as long spacer, permitting easy hapten recognition; DexOx bridging hapten and BSA for immobilisation Topography and dexOx reactivity (tissue 20 20 [134]

Surface

Gecko-inspired tissue adhesive

amines) provide adhesiveness; poly(glycerol sebacate acrylate) surface, coated with dexOx, hemiacetal bonding

70

14

[114]

1 - Dextran native molecular weight; 2 - Real oxidation when estimated or theoretical oxidation in brackets; XL - crosslinker; n.a. - not available

23

Chapter 1

Oxidised Dextran

1.4. Conclusion
Since the approval of dextran as a plasma expander, over 60 years ago, this polysaccharide has seen many dierent uses in pharmaceutical sciences. The mild oxidation of dextran, by the periodate ion, yields a very reactive macro-monomer towards N-nucleophiles compounds. It does an interesting job in increasing the solubility, half-life and therapeutic ecacy of small pharmaceuticals. Concerning proteins, dexOx preserves the stability and activity across a wide range of temperatures, providing sustainable release in vivo, as long as the imine bond is not reduced. In fact, dexOx has entered the clinical stage, as a carrier of somatostatin, opening the door for other suitable formulations to be commercialised, with the advantage of having a very competitive price compared to other biomedical relevant polysaccharides. The properties of oxidised dextran have also been used on series of dierent approaches for the design of hydrogels, particles and is an interesting option in surface coating. However, the consequences of mild periodate oxidation are not fully understood. The periodate oxidation leads to dextran degradation which has strong consequences on the macro-monomers characteristics aecting the solutions viscosity and aecting injectability. The assessment of the real OD after periodate oxidation is vital for the design of drugconjugate formulations, hydrogels or other approaches, therefore, the questions raised about the amount of aldehydes reacting is extremely important. Some of these issues will be approached on chapter 4 and chapter 5.

24

2. Pro-Angiogenic Therapies
Impaired-angiogenesis associated pathologies, such as ischemic heart disease (leading cause of death worldwide in 20041 ), wound healing or stroke, have a high-burden on society. Regenerative medicine is getting closer to oer some solutions, however, the regeneration of vascular tissues via polymeric-based strategies is yet to see successful outcomes [135]. Dierent approaches can be found on the literature, which include the delivery of one or more specic growth factors [136], the incorporation of bio-mimetic motifs on the polymeric structure [137] or the delivery of specic cells [138, 139]. Usually, the design strategy of polymeric matrices contemplates, not only the nal application, but as well the specic growth factors or cell type which are being delivered. In this section, the VEGF biology, VEGF-delivery-based approaches, as well as cell-based strategies, on pro-angiogenic therapies, will be overviewed.

2.1. VEGF in Health and Disease

Angiogenesis is the phenomenon by which de novo blood vessels are formed. It is observed during embryogenesis, constituting the rst organ in the embryo. In the adult stage, when dysregulated, the newly formed blood vessels contribute to numerous malignant disorders, such as tumours and some non-tumoural pathologies, like age-related macular degeneration [140]. The existence of angiogenic factors was initially postulated on the basis of the strong neovascular response induced by transplanted tumours [141]. Many molecules have been implicated as positive regulators of angiogenesis, including acidic or basic broblast growth factor (FGF), TGF and , hepatocyte growth factor (HGF), tumour necrosis factor (TNF-), angiogenin, interleukin 8 (IL-8) and angiopoietins [142]. Over the past 20 years most of the research has been devoted to the research and understanding of the biology of the vascular endothelial growth factor (VEGF). VEGF is a heparin-binding growth factor specic for vascular endothelial cells
1

World Health Organisation. The Global Burden of Disease - 2004 update

25

Chapter 2

Pro-Angiogenic Therapies

that is able to induce angiogenesis in vivo, described for the rst time in 1983 [143] and fully characterised and sequenced in 1989 [144]. A very comprehensive historic perspective of the quest for angiogenesis and its most important players can be found elsewhere [145]. The identication of clear targets on the development of angiogenesis, such as VEGF, allowed the design and development of new therapies. Such anti-angiogenic therapies address pathologies where the dysregulated blood vessel formation could be hindered, preventing pathology development and hopefully leading to cure. The predominant role of VEGF in angiogenesis led to the development of anti-angiogenic agents targeting soluble VEGF (e.g. Avastin - humanised variant of an anti-VEGF antibody), arresting angiogenesis and stoping the blood ow to nourish the growing tumour [146]. VEGF has been related to vascular permeability events in acute/chronic inammation, cancer and wound healing. Indeed, it was formerly called vascular permeability factor (VPF), exactly because of its propensity in inducing vascular permeability and leakage. The use of VEGF, in clinical settings, where a pro-angiogenic response is necessary, has also been addressed. Unfortunately, clinical trials testing the pro-angiogenic potential of VEGF alone, have not had the expected results [147, 148]. Part of this failure is attributable to suboptimal delivery strategies. Stimulating the growth of durable and functional vessels is a more formidable challenge than previously anticipated. Recent advances in therapeutic neo-vascularisation, applied to ischemic disease states, focus on better delivery of growth factors or combination of several angiogenic entities, addressing better mimicking of natural healing processes. These strategies can involve multi-growth factor delivery in dierent spatio-temporal windows and encapsulation of cells in bioresponsive polymeric matrices. This review will briey overview VEGFs biology and role in the complex and coordinate process of angiogenesis. The main focus will be on the most recent and relevant studies dealing with the VEGF delivery on a therapeutic setting and new perspectives on cellbased therapies.

2.2. VEGF Biology

Vascular endothelial growth factor is a homodimeric glycoprotein with a variable Mw . The VEGF family includes VEGF121 , VEGF165 (usually referred solely as VEGF), VEGF189 , VEGF206 (among other isoforms) and a structurally related molecule, placental growth

26

2.2 VEGF Biology factor (PlGF). This gene family has a unique role in controlling growth and dierentiation of multiple components of the vascular system. Lymphatic angiogenesis, for instances, is regulated by VEGF189 and VEGF206 [149, 150]. The VEGF gene is split among eight exons and the dierent isoforms arise from alternative exon splicing events [151, 152]. The shortest isoform, with 121 amino-acids is an acidic protein with no anity towards heparin (low extracellular matrix anity) and is freely diusible. The 165-amino-acids isoform (38 kDa) has some heparin anity and is the most similar to the native VEGF (45 kDa). The other isoforms (189 and 206) are highly basic and are completely arrested by the extracellular matrix (ECM) [153]. The ECM bound isoforms have plasmin cleavable sites which allow to reestablish the soluble VEGF pool upon ECM remodelation and degradation by growing vascular vessels (Fig. 2.1) [154]. This plasmin-cleavable VEGF

Figure 2.1.: Schematic organisation of the VEGF gene and most common VEGF isoforms, result of alternative splicing events. Adapted from [155]. fragment, has no anity towards heparin, compared to VEGF165 [153]. This isoform is not so strongly bound to the ECM as the heavier isoforms, existing on an equilibrium with a soluble form, showing optimal characteristics of bioavailability and biological potency. The dierent isoforms with dierential anity towards the ECM allow the creation of a VEGF gradient able to guide new vessel growth, having impact on development and patterning of the vascular system [155]. There are several cell receptors which are responsible for mediating VEGF activity [142] (Fig. 2.2). The VEGF receptor 1 (VEGFR1 or Flt1) binds preferentially to VEGF165 and VEGF121 but also to PlGF. The signalling properties seem to evolve throughout the development stage, but it was also proposed that it could lure VEGF from any mitogenic activity by preventing from binding to other receptors [156]. This down-regulation is

27

Chapter 2

Pro-Angiogenic Therapies

Figure 2.2.: The role of the dierent VEGF receptors. Based on reference [142] accompanied by a soluble spliced variant of VEGFR1 (sVEGFR1 ). The major mediator of the angiogenic enhancing eects is VEGF receptor 2 (VEGFR2 , Flk1 or KDR). Upon VEGF binding, VEGFR2 dimerises and propagates its signalling through several phosphorylation cascades, resulting in mitogenic, chemotactic and prosurvival responses (Fig. 2.3) [157, 158, 159]. Other interesting receptors are Neuropilins (NRP 1 and 2) which are also implicated in neuronal guidance. Neuropilin dimerises with VEGFR2 upon VEGF165 binding, mediating chemotaxis. The interesting similarities between the vascular and neuronal networks throughout the body and the shared processes are reviewed elsewhere [160]. VEGF is known to activate most of the signalling pathways in endothelial cells and guiding cell fate (Fig. 2.3). It plays an important role in non-pathological conditions, as autocrine VEGF is necessary for in vivo cell survival and consequently, for the homeostasis of blood vessels in the adult [161]. After subjecting endothelial cells to serum starvation, it was observed that VEGF acts as an important survival factor. Promotes survival activity through, phosphatidylinositol 3-kinase (PI3K)/Akt signal transduction pathway, preventing apoptosis induced by serum starvation [157]. It was also shown to have neuroprotective activity, by increasing the VEGFR2 expression, stimulating the activation of the PI3K/Akt and ERK-1/2 pathway [162]. The VEGF binding to VEGFR2 leads to receptor dimerisation, internalisation through

28

2.3 Therapeutic Angiogenesis

Figure 2.3.: VEGF pathways taken from http://david.abcc.ncifcrf.gov/. endocytosis and consequent signal transduction. The VEGF matrix immobilisation, impairs this event, but leads to prolonged activation kinetics of VEGFR2 which recurs to 1integrin dimerisation for signal transduction. This phenomena leads to dierent VEGFR2 phosphorylation patterns and enhancement of the p38/MAPK (Mitogen-activated protein kinase) cascade [163], leading to actin reorganisation and inducing cell migration (Fig. 2.4). The thorough knowledge of VEGFs biology is of utmost importance on the design of delivery strategies. VEGF is a very potent mitogen, with half-lifes below 30 minutes [164] and the fast consumption leads to low therapeutic ecacy, claiming for better delivery eciency [147, 148].

2.3. Therapeutic Angiogenesis

Several unmet medical needs strive for normal vascular perfusion. Pro-vascularisation therapies are expected to bring benet on the healing response, by the organism. Pathologies like peripheral vascular disease, ischemic heart disease, wound healing, as well as cell and tissue transplants, could be addressed by such therapies [135]. In the complexity of the angiogenic process, VEGF is one of the most important players. It induces activation, promotes the migration and guides the proliferation of endothelial cells on the sprouting of new vessels. However, the sprout and proliferation of endothelial cells is not enough to yield mature vessels. Smooth muscle cells (SMCs), are also essential on the development of mature vessels. These cells will accommodate and

29

Chapter 2

Pro-Angiogenic Therapies

Figure 2.4.: 1-integrin is required for clustering and continued internalisation of VEGFR2 . Adapted from [163]. stabilise the new vessels, forming new extracellular matrix and inhibiting the new sprouts regression [165]. Approaches, such as the dual delivery of VEGF and SMC specic growth factors, with distinct release proles, can lead to the formation of mature vasculature as compared to either of the growth factors delivered alone or simultaneously [166, 136]. Parallel to this research, the last decade has seen the rise of improved pro-angiogenic cellbased therapies, due to the identication of new cell populations from dierent sources, with high therapeutic potential. The identication of endothelial progenitor cells (EPC), among peripheral blood mononuclear cells, which migrate/proliferate to neovascularisation sites and dierentiate into endothelial cells in situ, oppened new lines of research [167]. This event has been observed to be induced by angiogenic factors, including VEGF [168]. The therapeutic potential of EPCs was rst assessed in a mice hindlimb ischemia model, where exogenously administered EPCs improved neovascularisation and enhanced functional recovery [169]. It is highly relevant to be aware of the pathological settings and the diseases biology, upon delineating strategies for regenerative medicine approaches in order to mimic physiological signalling and achieve biologic functionality. Some of the most relevant approaches involving VEGF polymeric delivery systems will be addressed, as well as recent

30

2.3 Therapeutic Angiogenesis achievements in cell-based approaches, in the context of therapeutic angiogenesis.

2.3.1. Polymeric Matrices-Based Strategies

The tissue regeneration/engineering strategies usually fall into three categories, conduction, induction and transplantation of cells. Conductive strategies design implantable biomaterials that can provide structural support for ingrowth of the desired healthy host cells. Inductive strategies, include growth factors within the polymeric matrices, to enhance cellular ingrowth events, promoting better tissue regeneration. The transplantation of cells, together with the constructs, expects their participation on the tissue regeneration process [170]. Most of the strategies to be reviewed shortly, fall within the latter two categories. A key challenge in engineering functional tissues is the limited capacity of oxygen and nutrients transport into the tissue, which is conned to the maximum diusion distance of oxygen and nutrients 100 m [171, 172]. The use of VEGF within the scaolds has been seen as a key factor in promoting angiogenesis and initiate the vascularisation process. The rationale is to mimic key aspects by which the ECM controls the bioavailability and signalling activity of VEGF in the body. 2.3.1.1. Diusion Controlled The incorporation of VEGF in polymeric matrices leads to a diusion-dependent release, controlled by the hydrogels micro-viscosity, unless the matrix has some kind of anity with the growth factor. Several cellulose derivatives, with or without ionic charge, have been assessed for the topical delivery of VEGF. More than viscosity or micro-viscosity of the hydrogels, the release can be controlled by the interactions of VEGF with the polymeric chain. Possible structural similarities between carboxymethyl cellulose (CMC) and heparin have been observed to retard the release of VEGF, when compared to hydrypropyl cellulose (HPMC) or methyl cellulose (MC) [173]. More complex hydrogels, prepared by UV-cross-linking in the presence of polyethylene glycol diacrylate (PEGDA) and allyl isocyanate-grafted dextran, having VEGF mixed with the feeding solutions, were studied. Dextran was further modied with amine, carboxilic and methacrylate moieties to increase the hydrogel potential. The dierent functionalities were able to modulate the VEGF release. The aminated matrices showed

31

Chapter 2

Pro-Angiogenic Therapies

a 20% burst release, compared to all the other ones, where VEGF remained mostly entrapped within the scaold [174]. However, none of this strategies relies on a strong interaction of VEGF with the matrix and the release mechanism is mainly diusional. 2.3.1.2. Covalent Immobilisation Providing a sustained release by simple diusion usually leads to non-controlled burst releases and high VEGF concentrations on the implantation loci which could promote vessels malformation. The rationale, behind VEGF immobilisation is related with the induction of cell growth, mimicking the ECM-immobilised VEGF isoforms. The immobilisation can be based on reversible or irreversible covalent bonds, regulating VEGF release or not. An uncommon approach immobilised VEGF by recurring to glycosilated species of VEGF. The carbohydrate moiety was periodate-oxidised and further covalently linked to a hydrazide modied PLGA surface by the reversible hydrazone. VEGF was also bound by carbodiimide chemistry to the PLGA surface. The immobilisation was mediated by dihydrazide spacers of dierent lengths, which modulated the amount of immobilised protein as well as its accessibility to soluble specic antibodies and receptors, stressing the importance of the non-random immobilisation of VEGF [175]. A more traditional approach, used carbodiimide chemistry to immobilize VEGF. Collagen is a widely used material in tissue engineering-based applications due to their growth support of several cell types. Immobilised VEGF on porous collagen scaolds, maintained biological activity and promoted the inltration and proliferation of endothelial cells in the 3D scaold. The system was able to promote human umbilical vein endothelial cells (HUVEC) penetration and proliferation at deeper distances within the hydrogel compared to when only soluble VEGF was present [176]. 2.3.1.3. Composite Constructs The assembly of scaolds with materials of dierent nature, composites, is a common approach. In nature, the bone tissue, is an example of a composite material, where a complex mix of inorganic versus organic materials is found, deeply irrigated by blood vessels. Commercially available bone grafts, usually do not contemplate a strategy for the graft vascularisation throughout the regeneration process.

32

2.3 Therapeutic Angiogenesis To overcome this issue, VEGF was entrapped in alginate microspheres, easily prepared by dropping an alginate solution on a Ca2+ solution. To control the initial burst release, the microspheres were later encapsulated in several combinations of alginate, chitosan or chitosan/polylactic acid (PLA) scaolds. The former construct presented the most interesting release results, with low burst release and sustained release of VEGF ( 50%) during 4 weeks, leaving good indications for bone grafting [177]. The use of calcium phosphate bone cements is commonly used for replacement of autologous bone grafts. The physical adsorption of VEGF to an unmodied bone cement or to the same material modied with collagen or O-phospho-L-serine was performed. The composites achieved a good binding capacity to VEGF, though with moderate initial burst releases. However, the VEGF biological ecacy was higher for the O-phospho-Lserine modied cements, compared to the blank samples [178]. The further modication of the same cements with heparin, was able to improve and reduce the initial burst release of VEGF. Furthermore, the presence of heparin, not only had a higher impact on VEGFs biological activity, as even favoured good endothelial cells adhesion and proliferation [179]. 2.3.1.4. Multiple Release The angiogenesis process, relies on several timely events, from the sprouting moment up to the maturation stage. The breakthrough study, mentioned earlier [166] was performed with PLGA scaolds. VEGF was mixed with the polymer and platelet-derived growth factor (PDGF) was entrapped within PLGA microspheres. This approach temporally controls the release of both growth factors. On an initial stage, occurs a rapid release of VEGF, followed by the slower release of PDGF, triggering dierent events and promoting a better maturation of the induced angiogenesis. Hyaluronic acid (HA) was thiolated and further cross-linked by PEGDA, as a matrix for the dual release of VEGF and keratinocyte growth factor (KGF) [180]. Animals receiving hydrogel implants with both GFs developed more mature micro-vessels networks than in any of the other study conditions, even in the absence of HA, demonstrating the relevance of the polymeric matrix. A similar approach used HA-thiolated, but also thiolated gelatine and heparin, cross-linked with PEGDA. Heparin was included to delay the GF release, based on their natural interaction. Indeed, the concentration of heparin, modulated the VEGF/bFGF release, extending the angiogenic response over a period of weeks and providing better micro-vessel formation [181]. The same approach, involving

33

Chapter 2

Pro-Angiogenic Therapies

HA, gelatine and heparin, studied the loading of VEGF in combination with a second GF, like angiopoetin 1 (Ang-1), KGF or PDGF to promote neo-vessel maturation. The inclusion of heparin, showed a growth factor specic eect, promoting higher microvessel maturity for the VEGF/PDGF combination, followed by KGF, but inhibiting for the pair VEGF/Ang-1 [182]. The multiple delivery commonly addresses several growth factors for dierent cell lineages. However, certain cellular pathways, if down-regulated, could enhance neoangiogenesis. In that sense, injectable alginate matrices were used to release DATP (secretase inhibitor; inhibition of the Notch signalling pathway may enhance regional neovascularisation [183]) and VEGF promoted increased cell migration and sprout formation and induced faster recovery of blood ow on an ischemic hindlimb model [184].

Figure 2.5.: Schematic example of dierent VEGF immobilisation approaches and impact on release prole. Coloured arrows on the timeline indicate the triggering release stimulus on the respective system.

34

2.3 Therapeutic Angiogenesis 2.3.1.5. Stimuli-Sensing A research trend in the last few years has been based on taking advantage of the host tissue feed-back, for releasing growth factors on-demand. Some ambitious approaches, involve the production of VEGF variants, with bioactive amino-acid sequences. Hubbells group has been developing several strategies, involving brin as the biomaterial and modulating material responses to the wound environment. A modied version of VEGF (VEGF-TG), which cross-links to brinogen by the transglutaminating activity of factor XIII during brin polymerisation, but also has a proteolytic sensitive sequence, is released by the brinolytic activity of the wound environment. This form of VEGF active release showed to have superior results compared to passively released VEGF [185, 186, 187]. Simpler approaches, took advantage of the dimeric nature of VEGF to cross-link a lowmolecular-weigh-heparin-modied star PEG. The formed hydrogel is sensitive to immobilised VEGF-receptors, promoting the erosion of the matrix and releasing VEGF [188]. However, VEGF can be chemically bound to plain PEG diacrylate hydrogels, engineered with protease sensitive peptides and adhesion peptides (RGD) to induce new vasculature growth inside the implant. The success of this approach was due to a cell-demanded vascularisation [137]. The necessity of overcoming the bolus delivery of VEGF, providing an eective and controlled spatio-temporal presentation to the target tissues, has seen many dierent strategies arise. We have mentioned approaches that simply conne VEGF in polymeric microspheres or matrices to the promotion of VEGF binding through chemical or physical means to the scaold. The sketch on Fig. 2.5 resumes the most common ways of VEGF incorporation. Classical release proles for the dierent situation are pictured, for better visualisation of the impact of each of those strategies. Table 2.1.: VEGF delivery from polymeric matrices.VEGF delivery from polymeric matrices. Other signicant literature on the past years (2006).

Delivery strategy

VEGF integration; Concentration

Remarks

Ref.

Bioactive PEGDA hydrogel with RGD and collagenase sensitive peptides

PEGylated and matrix immobilised

Promoted HUVEC motility and matrix remodeling

[189]

35

Chapter 2
Delivery strategy VEGF integration; Concentration Chitosan hydrogels coated with collagen IV EDC-immobilised on collagen 0.22 ng/mm2

Pro-Angiogenic Therapies
Remarks Ref.

Flk1+ progenitor cells adhere and dierentiate into EC; without VEGF occurs dierentiation into SMC

[190]

Collagen hydrogels

EDC-immobilised on collagen

Scaolds with immobilised VEGF and Ang1 promoted better EC inltration

[191]

Collagen matrices

immobilised through PEG crosslinker; 10 ng/gel

Enhanced angiogenic potential

[192]

Collagen matrices; heparinized PLA scaolds created by supercritical technology Oxidised alginate crosslinked with Ca2+

Mixed; 10 ng/gel Supercritical encapsulation 1.7g/0.13g PLA Mixed; 250 ng/mL

Dierential release Promoted signicant bone regeneration Long term in vivo therapeutic benet

[193] [194]

[195]

Oxidised alginate crosslinked with Ca2+

Mixed; 3 - 10 g/gel

Signicance of temporal gradients

[196]

Alginate sulphate/alginate scaolds

Binding anity to alginate sulphate; Also loaded with PDGF-BB and TGF-1;

Release controlled by dierential binding anity; improved maturation of vasculature in implanted rats Zn2+ /Ca2+ balance controls diusional release Improved survival of encapsulated ECs and SMCs recruitment

[197]

Alginate/HPMC microparticles

Entrapped upon microparticles preparation

[198]

Fibrin/collagen hydrogels

Dual delivery of VEGF and MCP1

[136]

Scaolds from particulate PLG and PLA microspheres PLGA microspheres loaded into ionic crosslinked alginate gels Fibrin matrix + heparin coated PLGA nanoparticles

Mixed; 3g / pellet

125 I-VEGF

[199]

Entrapped in microspheres

Injectable system with sustained delivery of VEGF

[200]

Simply dissolved in the brin matrix or conjugated to the NPs

Release dependent on diusion or heparin anity

[201]

36

2.3 Therapeutic Angiogenesis

Delivery strategy VEGF integration; Concentration HEMA-MMA hydrogels VEGF-secreting encapsulated broblasts Polyelectrolyte nanoparticles from dextran sulphate and chitosan/PEI/poly-L-lysine PGA matrices with PLGA microspheres Entrapped in PLGA microspheres Anity to dextran sulphate Promoted higher local angiogenesis in vivo High encapsulation eciency; extended release and bioactivity preservation Sustained VEGF release and improved EC proliferation and cappilary density [204] [203] [202] Remarks Ref.

2.3.2. Cell-Based Therapies

The potential of cell-based therapies in the treatment of ischemic diseases, is reected by the 322 studies retrieved at ClinicalTrials.gov2 . Most cells in adult organisms are composed of dierentiated cells. However, each tissue has its own set of quiescent stem cells or progenitor cells, which can be activated under certain environmental stimuli, participating on the tissue regeneration if an insult is identied. One of the rst studies, used endothelial progenitor cells, derived from the bone marrow, which can be isolated from the peripheral blood and expanded ex-vivo. This cell population was administered systemically to enhance neovascularisation and was observed to increase the chance of a healing response [169]. As these type of cells are not abundant, umbilical cord blood (UCB) has become a popular source of EPCs and other cell types (Fig. 2.6), to be used on therapeutic vascularisation [205]. Indeed, several studies have demonstrated that the transplantation of EPCs or vascular cells, increases signicantly the vascularisation of ischemic tissues in animal models of hindlimb ischemia [206, 139, 207], myocardial ischemia [208, 209, 210] and diabetic chronic wounds [138]. Material-based approaches for the delivery of cells have also been proposed. An in vivo vascular progenitor cells depot was used to promote repopulation of the damaged tissue and participate in neovascularisation [139]. Polymeric hydrogels can be manipulated to oer an ECM-like microenvironment by the incorporation of biological cues, in other words, biomimicking the scaold, for the best spatio-temporal presentation of information and improved therapeutic outcome. In this study, Silva et al [139] designed alginate
2

Search terms cell therapy ischemia on the November 28th of 2010. http://clinicaltrials.gov

37

Chapter 2

Pro-Angiogenic Therapies

Figure 2.6.: Postnatal stem and progenitor cells from the variou tissues. EPCs highlighted in gray. Adapted from [167]. macroporous scaolds doped with RGD cues, to present cell adhesion ligands, and VEGF to maintain cell viability and induce cell migration out of the scaold. Endothelial progenitors isolated from human cord blood to treat ischemic muscle tissue were used on this approach and this system was demonstrated to dramatically improve vascularisation and perfusion of ischemic murine hindlimb musculature, and prevented toe and foot necrosis. These results suggest that an eective endothelial progenitor cell utilisation, highly depends on the mode of delivery and control over cell fate after transplantation. The bioactive scaolds can also be used for enhancement of vascular dierentiation of progenitor vascular cells or stem cells. Vascular progenitor cells, isolated from human embryonic stem cell aggregates (embryoid bodies), can be directed to endothelial-like cells after exposure to VEGF [211]. Embryoid bodies (EBs) are aggregates of human embryonic stem cells (hESC), frequently used to simulate embryonic stages in vitro. However, the heterogenous size and spontaneous dierentiation into the several germ

38

2.4 Conclusion layers of the embryo, turns it dicult to control their dierentiation [212]. An ingenious way of controlling such dierentiation was achieved by mixing growth-factor-releasing microparticles with the EBs [213]. This system uses biodegradable and biocompatible components and allows for the control of several variables in cell dierentiation, such as, concentration, spatial localisation and combinatorial release of growth factors. Hydrogel platforms have also been studied, for the controlled dierentiation of hESC. Hyaluronic acid hydrogels were able to maintain the self-renewal state of the hESC, for a long term period, in the presence of conditioned medium from mouse embryonic broblasts. Differentiation could be induced by supplying the appropriate soluble growth factors [214]. The immobilisation of EBs in agarose hydrogels with covalently linked VEGF was able to guide the aggregates into blood progenitor cells. The induction by immobilised VEGF was more ecient in guiding hESCs dierentiation than soluble VEGF [215]. The authors believe that this system would be suitable for an up-scale and consequent collection of large numbers of dierentiated cells. However, other strategies have demonstrated that the use of EBs may not be the most ecient. The enhancement of vascular dierentiation of hEBSs was also achieved by encapsulating them in bioactive RGD-functionalised dextran-based hydrogels. The growth factor, VEGF, was microencapsulated in PLGA microparticles, further entrapped inside the hydrogels. The 3D scaold promotes the stem cell dierentiation into vascular lineages, more than the 2D systems. After removing the cells from these networks and promoting further vascular dierentiation, they contained higher fraction of vascular cells than the spontaneously dierentiating EBs. This approach increased the vascular dierentiation of human embryonic stem cells when compared to embryoid bodies [216].

2.4. Conclusion
The vascular endothelial growth factor is a major regulator of physiological and pathological angiogenesis, acting upon most of the metabolic pathways in endothelial cells. The use of VEGF in therapeutic approaches relied mostly on the bolus injection, but failed to restore compromised tissue functions. The implementation of new delivery strategies, such as polymeric systems, to overcome the limitations of the bolus delivery and supply VEGF in a localised and sustained way to the target site, is giving new expectations for the utilisation of this growth factor. The use of such systems allow for dierent sorts of controlled release, which could mimic the complex and sophisticated endogenous VEGF delivery, which uses dierent isoforms with variable anity towards the ECM and specic

39

Chapter 2

Pro-Angiogenic Therapies

proteases cleavable sites. Several reviewed strategies successfully mimicked this VEGF interplay with the endogenous environment, enabling control over spatial and temporal release. The release in the context of other growth factors and their spatio-temporal presentation will need better ne tuning. The upgrade of these systems with the integration of cells is also a challenge which could bring highly eective therapeutic benets. Recent studies suggest a dierent approach for endothelial progenitor cell-based therapies that may be applicable in the treatment of ischemic diseases and more broadly in regenerative medicine. Strategies involving bioactive materials for the delivery of vascular progenitor cell populations, which could provide a microenvironment to enhance cell survival, and the sustained release and repopulation of the surrounding tissue by outbound migrating cells.

40

3. Nanotechnology: Novel Delivery Frontiers

Nanotechnology usually refers to any man-made structure with dimensions below the 100 nanometers, in at least one dimension, however, this range is usually broader, reaching the 500 nanometers. Among the myriad of possible applications, drug delivery, in a biomedical setting, is growing substantially. This chapter will briey contextualise the challenges of designing and preparing nanoparticles for accurate and ecient drug delivery.

3.1. NanoBiotechnology
Nanobiotechnology, is a eld located at an intersection between chemical, physical, engineering and biological sciences. The research of nanotechnologies integrated with the biomedical sciences has seen a rapid growth in the new millennium (Fig. 3.1) and is approaching the 20-years gestation period (generic interval for transition of science discovery into commercial applications) after which innovative technologies will be translated into biomedical applications [217]. Nanotechnologies, such has nanoparticles (NP) have been around for some time [218]. However, new technologies are achieving great expression, such as quantum dots [219, 220], nanotubes [221] or nanowires [222]. This new area of nanobiotechnology is generating new applications from molecular imaging to anticancer therapies with new tools that are reaching new frontiers within cells and opening new biomedical perspectives [223]. Drug delivery issues, such as poor drug ecacy, low drug bioavailability or systemic toxicity are the main barriers to overcome. In the last decade, the integration with new and alternative nanotechnologies for the improvement of drug delivery, has seen a huge

41

Chapter 3

Nanotechnology: Novel Delivery Frontiers

rise in research. Some of the technologies reviewed earlier, involving polymeric-based materials can be adapted with new processing techniques, bringing the approach to the nano level. The advantages of nanoparticulate drug delivery systems are their small size, which allows them to pass through many biological barriers and the high density of therapeutic drug that can be encapsulated, dispersed or dissolved, within the carrier [224]. Nanoparticulate systems can improve the physicochemical properties by optimising solubility, diusivity, biodistribution, release characteristics and immunogenicity, targeting specic tissues without major systemic toxicity [225]. Depending on the composing materials and the preparation strategy, surface functionalities can be incorporated at the nanoparticle surface, facilitating the protection of the nanoparticles in the organism, but also the targeting to specic cells or tissues.

An overview on the design of polymeric-based nanoparticles will be made, focusing on the assembly strategies regarding synthesis, response to external stimulus and surface reactivity. It will be followed by a brief overview about nanodelivery of VEGF and retinoic acid, as bioactive representatives of proteins and small drugs, respectively, and the last delivery frontier, the cellular organelles. For last, a brief overlook about the use of nanostructures as building blocks in tissue engineering applications will be given.

Figure 3.1.: Publication counts from Thompson ISI Web of Knowledge (www.isiknowledge.com; Search performed on the 29th November 2010). Searches under topic for nano* (black; left axis), nano*+bio* (red; right axis).

42

3.2 Nanoparticle Design

3.2. Nanoparticle Design

Nanoparticles can be dened as solid colloidal particles containing or not an active substance. Traditional techniques, such as emulsication evaporation, solvent displacement, salting-out and emulsication diusion are somewhat outdated. These approaches involve high volumes of organic solvents or oils and often, toxic chemical cross-linking agents, impairing the use of many pharmaceutical drugs [226], potential downstream toxicity, but also the possibility of reaching smaller sizes. Newer techniques rely on less severe approaches through usage of carefully chosen starting materials more appropriate for less aggressive synthesis strategies. Polymers, either of synthetic or natural origin, provide great exibility on the design of nanoparticles. Not only due to their native physicochemical properties but as well through the variety of possible modications yielding new functionalities. The polymers chemistry drive the processing reaction and the nal outcome can yield nanocapsules [227], nanogels [228], dendrimers [69], nanocoacervates [203] or other structures as depicted on Fig. 3.2. Nanoparticles design should also take in account that they will necessarily interact with the physiological environment by binding to serum proteins, which can be dictated by the surface chemistry necessarily inuenced by the polymeric constituents [229]. This phenomena will interfere with the bioavailability and biodistribution of the NP being reected on the therapeutic ecacy [230]. Indeed, what the cells see is a mix of physiological proteins adsorbed to the NP surface. Likely, this protein layer confers the NP its identity, rather than the NP surface itself [231].

3.2.1. Synthesis
Most of the approaches used on the nano-assembly of such structures can be divided into two main categories of chemical and physical nature. Chemical nature Chemicalwise, one of the most popular functionalisation of polymers, recurs to vinyl monomers for posterior radical or photo-polimerization [232]. Other approaches involve the mixture of polymers with cross-reactive chemical moieties, which promptly react selectively establishing a covalent bond. Common examples are Michael-type additions,

43

Chapter 3

Nanotechnology: Novel Delivery Frontiers

where the previously mentioned vinyl functionalisation can be used to react with thiolmodied substrates [233] or the previously mentioned reversible Schi bases by the combination of aldehydes and amines [104, 234]. These sort of reactions can be termed click chemistry, referring to the facile, ecient, selective and versatile chemical reaction which leads to a single reaction product [235], however, it is the copper (I) catalysed azide-alkyne cycloaddition that has almost exclusively adopted this terminology [236]. Physical nature The spontaneous formation of physical nanostructures relies on weak secondary forces such as Van der Waals mediated stereo-complexes formation [237], hydrophobic [71], ionic interactions [238], or hydrogen bonding between water soluble polymer chains [239]. The most interesting approaches involve self-assembly of nanoparticles, characterised as the spontaneous formation of higher order structures from simpler building blocks, driven thermodynamically [240]. The self-aggregation of the nanoparticles constituents can simply rely on the physical properties of the polymers or appropriate moieties can be grafted to promote the self-assembly of the system. A simple example are nanoparticles formed via coacervation by recurring to oppositely charged polyelectrolytes. In nature, the class of polysaccharides exhibits dierently charged molecules which can be used for this purpose. Chitosan has been preferred as the polycation in several applications and complexed with polyanions such as carrageenan [241], dextran sulphate [203] and heparin or hyaluronan [242]. The variation of the mass ratios of the polyelectrolytes regulates the charge density of the nal nanoparticles, which can be used to achieve higher uploads of drug. On one series of works, polyethylenimine (PEI) was complexed to dextran sulphate in dierent mass ratios, customised according to the cargo properties. The system was custom designed to accommodate DNA [238], insulin [243] or amphotericin B [244]. Neutral and water-soluble polymers, like dextran or pullulan, can be modied with hydrophobic moieties, leading to nanoparticles formation by self-aggregation of the hydrophobic moieties, like in cholesterol-grafted pullulan [245], cholic acid-grafted to oxidised dextran [71] or by chemical conjugation of hydrophobic 5-cholanic acid to hyaluronic acid [246]. A second level on the design strategy of NP, deals with conferring specic characteristics, which will improve the NP performance for the desired application. Examples of such strategies are resumed on Fig. 3.3.

44

3.2 Nanoparticle Design

Figure 3.2.: Dierent designs in nanoparticles assembly.

3.2.2. Stimulus Sensitivity

Assembling nanoparticles that are sensitive to one or more external stimulus and that could trigger a reaction, like swelling or degradation, has many applications in biomedical sciences. Such characteristics allow the carrier to deliver or not the cargo after reaching the target site. The sensitivity to pH is one of the most studied. Nanoparticles of dextran grafted with polyacrylic acid were designed to swell upon pH elevation [247] which could possibly release an entrapped cargo by diusion. Degradation can be achieved by incorporation of acid-sensitive monomers in the NPs [248]. NPs that could support external stimulus, other than the environmental stimulus, oer the possibility of external guidance or actuation by the operator. Magnetic nanoparticles could be guided through

45

Chapter 3

Nanotechnology: Novel Delivery Frontiers

Figure 3.3.: Dierent aspects of nanoparticles composition, commonly addressed for improved performances and increased versatility. the body up to the desired target place. Dierent polymers, like dextran, chitosan or polyacrylic acid, can be activated with Fe3+ for the preparation of magnetic NPs, and present low cytotoxicity and good biocompatibility [249]. The cross-linking of Nisopropyl acrylamide monomer with PEG-diacrylates originates NP which are temperature sensitive [250].

3.2.3. Targeting
The tissue targeting specicity of the nanoparticles can be increased by introducing specic ligands, able to recognise particular cell surface entities (Fig. 3.3). An obvious choice, are antibodies due to their high specicity. The chemical conjugation to nanoparticles is straightforward and drastically increases the tissue specicity [251]. Nonchemical coatings of NP with ligands, employing electrostatic interactions, for example, can avoid the change of the biophysical properties of the nanoparticles [252], produced by chemical grafting of ligands. The use of specic ligands on NP surfaces, has found applications other than target questing. Some tissues, like cartilage, lack vasculature, limiting the bioavailability of drugs. By controlling the nanoparticles size (< 40 nm), it is possible to achieve high yields of nanoparticles penetration within the cartilage, furthermore, the incorporation of a targeting peptide, prevents the nanoparticles from

46

3.3 Nano Delivery leaving the tissue providing an intra-tissue releasing system [253].

3.3. Nano Delivery

An interesting review on drug delivery devices was written recently by Alan Homan [254] contextualising the evolution from the macro era of drug delivery devices (DDD), with zero-order release, to the nano era of targeted and site-controlled drug delivery systems, which will eventually lead to personalised medicine. The ideas described earlier (sec. 1.3), concerning polymer-drug conjugates, can also be considered nano-delivery. However, next we will present some studies using nanoparticles, for the delivery of proteins and small pharmaceuticals and the implications and potential that such strategies enclose.

3.3.1. Proteins
Proteins with therapeutic interest, like antibodies or growth factors, display a short half-life in circulation, usually of several minutes [164, 255, 256]. They undergo rapid degradation in vivo and the systemic or local delivery will result in low availability. The high doses usually applied, may lead to systemic toxicity due to the non-specic distribution. The use of nanoparticulate systems can help improve the therapeutic action, since they can help penetrate deeper into tissues, through the epithelial lining. The nanoparticles will be responsible for the physicochemical properties of the system. Among the described studies in the literature, nanoparticulate systems for growth factor delivery include lipossomes, polymers, micelles, dendrimers among other material combinations [225]. Focusing on VEGF, it has been formulated in PLGA [257, 199, 204], PLGA/PEG [258] or alginate [259, 198] particles to control its release on a localised area, however, such formulations yield particles in the micrometer range. Therefore, PLGA nanoparticles with sizes below 200 nm, negative zeta-potentials and heparinfunctionalisation [260], appear to be interesting carriers for VEGF. Indeed, the incorporation in commercial brin hydrogels, enhanced the therapeutic ecacy in a rabbit ischemic hind-limb model, when compared to soluble VEGF [201]. A polyelectrolyte complex, where dextran sulphate is the polyanion and the polycation role was performed by chitosan, PEI or poly-L-lysine was adapted for the loading of VEGF [203]. The dextran sulphate structural similarities to heparin were used to promote a higher loading

47

Chapter 3

Nanotechnology: Novel Delivery Frontiers

eciency, through electrostatic complexation. In the presence of the polications, selfassembly occurs through coacervation of oppositely charged polyelectrolytes. Negatively charged nanoparticles, with sizes below the 300 nm were obtained. The formulation was successful in protecting VEGFs bioactivity, sustaining its release and showed improved ecacy in inducing endothelial cells proliferation [203]. A less traditional approach used lecithin (from soy bean) to create anionic nanolipids, with a lipid core and an outer surface that binds electrostatically to the positive VEGF. Pluronics F127 was used to confer a shell to the complex. The manipulation of the components mass ratios allows control over size, zeta-potential and the VEGF release prole [261].

3.3.2. Small Drugs

As stressed earlier (sec. 1.3.1.1), the systemic delivery of small drugs leads to issues such as lack of activity towards the target tissue and toxicity on other tissues were the drugs can accumulate during the process of clearance from the organism. As with pro-drugs, nanoparticles can increase the concentration of small pharmaceuticals and improve the delivery ecacy. Retinoic acid, is a small lipophilic derivative of Vitamin A [262], which has a tremendous therapeutic potential in cancer prevention [263] and could be used to control the dierentiation of stem cells. All-trans retinoic acid is a water-insoluble molecule (0.21 M [264]) which can see its water solubility increased by the simple complexation with certain polymers like polyaminoacids [265] or PEI [266], which in the presence of the dispersing agent poloxamer 188, forms nanoparticles. Poly(ethylene oxide)-b-poly(L-lysine) also complexes with RA forming core-shell type micelles where retinoic acid forms the hydrophobic core [267]. The natural polycation chitosan is also suitable for RA delivery. Low molecular weight water soluble chitosan was able to form complexes with RA, achieving loading eciencies above 90% and nanoparticles sizes below 200 nm [268]. The grafting of methoxy poly(ethylene glycol) to chitosan allows the delivery of RA in the form of nanoparticles [269] or micelles [270] with diameters of 100 and 100 - 500 nm, respectively. These systems are able to increase substantially the concentration of RA presented to the cells, however, the RA actions are transmitted through the RA receptors, which are located on the cell nucleus [263]. When delivering molecules with intracellular targets, it is rather important, that the nanoparticles overcome the tissues and cellular barriers and deliver the payload on the cells cytoplasm. The release outside the cell, might not bring any action.

48

3.3 Nano Delivery

3.3.3. Intracellular Targeting

Many therapeutic agents have specic intracellular molecular targets, which are located in the cytoplasm, nucleus, mitochondria or other cell organelles. The targeting of any of these intracellular destination, implicates a higher degree of complexity on the design of the nanomaterials. Several barriers must be taken into account, in order to reach the site of action, where the payload has to be delivered. The eciency of drugcarriers for cytosolic delivery is limited mainly by their interaction with cell membranes and the endosomal release of therapeutics [271]. The ability of nanoscale materials to

Figure 3.4.: Cellular internalisation pathways of NP. (A) Diusion, usually on endocytosis-inhibiting conditions; (B) Phagocytosis; (C) Macropinocytosis; (D) Clatrin-dependent endocytosis; (E) Receptor-mediated endocytosis. Adapted from [272]. autonomously escape from endosomal compartments can be used to deliver cargo that can alter cell metabolism and function and regulate signalling pathways. Hydrophobicfunctionalised silica NPs were able to carry specic protein, which were shown to interfere with cellular pathways [273]. The cellular internalization can follow several pathways, such as receptor-mediated endocytosis, non-specic endocytosis and internalization under endocytosis-inhibiting conditions (Fig. 3.4) [272, 274]. The receptor-mediated endocytosis is probably the most attractive and ecient method for the specic uptake of nanocarriers, which can be designed to incorporate a given complementary cell-surface

49

Chapter 3

Nanotechnology: Novel Delivery Frontiers

receptor, enabling an increase of up to 1000-fold [274]. The nanoparticles uptake in endosomes (mild pHs; 5 - 6.5) goes through a maturation process up to late endosomes that could later fuse with other endosomes and lysosomes (even more acidic pHs), experiencing degradation conditions [274]. Escaping this barrier, avoids degradation or exocytosis, releasing the therapeutic agent within the cytosol and enabling its actuation [272]. The awareness of the endosomal pathway as lead research towards pH-sensitive carriers, which could rapidly release their payload, facilitating its delivery into the cytoplasm. Polymeric cations, are ecient transfection agents without recurring to cell-targeting or membrane-disrupting agents, being PEI a gold-standard of polyplexes [56, 55]. The high concentration of primary and secondary amines turns PEI into a proton-sponge at virtually any pH. On the endosomal context, it possibly buers that small compartment, protecting the carrier from degradation, eventually promoting swelling and rupture [56].

3.4. Nano Tissue Engineering

Biological tissues are often observed as small repeating units assembled over several scales. Therefore, the ability to synthesise and control materials on the nano scale opens new frontiers in tissue engineering. Designing nanomaterials as building blocks may lead to suprastructures that can be obtained by several processing techniques or just by selfassembly of the building blocks. These structures can be used to host and/or deliver cells in several contexts, just as some of the 3D structures described earlier, though, oering new control variables as well as improved macroscopic qualities. As reviewed recently by Wan et al. 2010 [275], nanomaterials can be divided in several classes, with chemical and physical properties which enable them to be processed or function in dierent contexts of tissue engineering. Commonly used nanomaterials found in the literature enclose peptide amphiphiles, self-assembled peptides, nanoparticles, carbon nanotubes, electrospun bres or layer-by-layer structures. Our focus will fall on strategies describing the preparation of nanoparticles which are able to yield suprastructures. As illustrated on Fig. 3.2 and Fig. 3.3, the limit for nanoparticles decoration is imagination. If properly designed, ingenious suprastructures can be originated, taking advantage of the dierent properties of the several components, which can be prepared either by self-assembly or by external stimuli. Materials with several hierarchical structures may present improved networks. Polymeric gels, for example, can be made in several sizes.

50

3.4 Nano Tissue Engineering

Figure 3.5.: Nanoparticles suprastructures. (A) Polymer gel nanoparticle network; (B) Nanoparticle-cross-linked hydrogels; (C) Self-assembly by external stimuli. Bulk hydrogels are easy to handle, but have a slow response to external stimuli, while nanogels act much quicker, due to the higher ratio of the surface area versus volume. However, co-nanoparticle networks can retain the properties of each polymer nanoparticle, resulting that such network could perform several tasks on a given application (Fig. 3.5A) [276]. Other example is the polystyrene nanoparticles which were used as cross-linkers of polyacrylamide to synthesise hydrogels. The hydrophobic character of the nanoparticles deeply inuenced the swelling behaviour, conferring excellent elasticity and predictable swelling properties, appropriate for several human tissues (Fig. 3.5B) [277]. The rationale is that the physical properties of the nanoparticles core are transmitted to the upper hierarchical level, while the surface is grafted with reactive pendant groups, enabling the cross-reactivity. Gold-cross-linked pNIPAAm hydrogels display remarkably dierent bulk properties of equilibrium swelling and thermo-responsive phase transition when compared to the gold-free hydrogels [278]. Other example is the nanostructured hyaluronic acid hydrogel, prepared by cross-linking thiol-grafted hyaluronan with acrylated nanogels, via Michael addition. The nanogels are sensitive to hydrolysis, propagating such property to the bulk hydrogel. Gelation occurs at physiological conditions and can be used as a cell delivery scaold or other biological agents (Fig. 3.5B) [279]. Physical interactions are more appropriate for the self-assembly of the suprastructures.

51

Chapter 3

Nanotechnology: Novel Delivery Frontiers

Usually, an external stimuli sets the trigger for the sol-gel transition. The amphiphilic macromer constituted by PEG-PPG-PEG, self-assembles into micelles subsequently polymerised into nanogels. These nanogels, when concentrated, form macroscopic physical gels upon heating (Fig. 3.5C) [280]. Fancier approaches used NPs covered with only a few photoactive ligands, which formed metastable crystals that can be assembled and disassembled on demand by using light of dierent wavelengths. For higher surface concentrations, self-assembly is irreversible, and the NPs organise into permanently cross-linked structures including robust supracrystals and plastic spherical aggregates [281].

3.5. Conclusions.
Improving the half-life of growth factors has been achieved by several nanoparticulate strategies. It is however benecial to understand exactly the release mechanism and degradation involved in each strategy. The winning strategy will nd a balance between the resiliency of nanoparticles to reach the target site, target specicity and the sustained release of the growth factors. This will inevitably lead to more complex systems with targeting cues and environmental/external degradation-sensitive mechanisms. As the knowledge in disease biology increases, the more demanding the nano-scale design of DDD will be. Allan Homan suggested that the evolution of DDD will become more biological and less materials-oriented in character [254]. In fact, the trend in literature is oriented to the seeding of biomaterials with biological cues able of mimicking and permeating those drug delivery vectors in biological systems. This biological accuracy will eventually lead the eld into personalised medicine, where tailor-made DDD will be the ultimate goal. Nanoparticles will likely have a relevant role in bottom-up tissue engineering, providing improved scaolds that can be highly biomimetic and possibly overcome most of the challenges faced in this eld.

52

Part II. Results and Conclusions

4. Insight on the periodate oxidation of dextran and its structural vicissitudes

4.1. Abstract
Periodate oxidised dextran has been widely studied in a broad range of biotechnological applications, regardless of this, usually little attention is paid to the oxidation extension consequences on the properties of the nal modied dextran. Based on a bidimensional NMR analysis, we suggest that the two aldehydes groups, resulting from the periodate oxidation, are not fully reactive with N-nucleophiles, under certain pH conditions. The aldehyde group bonded to C3 appeared to be the only prone to react. The other aldehyde might be arrested in more stable hemiacetal structures. The hemiacetals are also responsible for oxidised dextran cross-linking, interfering in simple processing steps, such as dissolution and solubility, as well as increasing the viscosity of the solutions. The molecular weight variation on the oxidised samples can be followed by dynamic mechanical thermal analysis in consequence of the variation of glass transition temperature with the molecular weight, which was corroborated by the onset temperature of the thermal degradation.

4.2. Introduction
Dextran is a polysaccharide synthesised by a large number of bacteria, when grown on sucrose-containing media [3]. Nowadays, Leuconostoc mesenteroids (strain B-512) [1] is responsible for the majority of the commercially available dextrans. They are characterised by having over 95% of -1,6 linkages and some low degree of branching.

55

Chapter 4

Insight on the Periodate Oxidation of Dextran

From the late nineteen forties, dextrans have attracted attention from the biotechnology world. They were accepted as a plasma volume expander, due to its linear structure, high water solubility, and especially owing to its -1,6 linkage, more relevant to biological applications, in virtue of the slower hydrolysis by body enzymes, compared to the -1,4 linkage (e.g. glycogen) [1, 2]. The dextran oxidation by the periodate ion is a catalysis-free aqueous reaction which yields a puried product with a simple dialysis step. The periodate ion attacks vicinal diols promoting bond breaking. Typically, the -1,6 residues in dextran are attacked between carbons C3 - C4 or C3 - C2 , breaking the C-C bond and yielding aldehyde groups, being able to be further reduced on a second and independent oxidation reaction (Scheme 1) (Fig. 4.1)[282]. Initially, this method was used in the characterisation and elucidation of the polysaccharide structure, through the complete oxidation and consequent analysis of the degradation products [10]. Nowadays, low and mild periodate oxidations are used to confer the dextran chain with aldehyde functionalities, which have as main characteristic the highly reactive nature towards N-nucleophiles, such as amines, hydrazines or carbazates [29].

Figure 4.1.: Dextrans -1,6 glucose residue possible periodate oxidations. Periodate attack at C3 -C4 (A); C3 -C2 (B) and double oxidation (C). Concerning the dexOx application on a biomedical perspective, the accurate assessment of the periodate oxidation consequences in mild oxidation conditions is of utmost importance in predicting the extent of drug loading [65] or the nal physicochemical properties of hydrogels [35]. Due to the highly reactive nature of the formed aldehydes, they are easily attacked by neighbouring hydroxyl groups, leading to the formation of hemiacetals [16]. These hemiacetals are the most consensual resulting structures, even taking into account that some studies restrict these structures to a narrow pH window (4.0 5.2) [17]. Other consequences of the dextran oxidation are the decreased average molecular weight and polydispersity increase [14].

56

4.3 Material and Methods Herein we address the consequences of low and mild dextran oxidation and try to further elucidate the structural nature of dexOx through bidimensional NMR, upon reaction with tert-butyl carbazate. Our data suggest that only one aldehyde per residue might be involved on this reaction, while the second aldehyde could be arrested to a stable hemiacetal structure. We will explore the oxidation inuence on simple manipulation steps, such as aqueous dissolution and the solutions viscosity outcome. Dynamic mechanical thermal analysis (DMTA) data on dexOx are discussed and correlated with the molecular weight trend. The relative thermal stability of dexOx samples was evaluated by thermogravimetric (TG) measurements.

4.3. Material and Methods

4.3.1. Materials
Dextran (from Leuconostoc mesenteroides; Mw 60 kDa, according to Flukas specication), sodium periodate, AAD, tBC, ethyl carbazate (EtC), phosphate buered saline (PBS; pH 7.4), dialysis membranes (MWCO 12 kDa) and NaOD were purchased from Sigma (Sintra, Portugal) and used as received.

4.3.2. Dextran Oxidation

An aqueous solution of dextran (1 g; 12.5% (w/v) ~ pH 5.5) was oxidised with 2 mL of sodium periodate solution with dierent concentrations (33 264 mg/mL) to yield theoretical oxidations from 5 to 40%, at room temperature (The oxidation degree (OD) of dexOx is dened as the number of oxidised residues per 100 glucose residues). The reaction was stopped after 4 hours. The resulting solution was dialysed for 3 days against water and lyophilised (Snidjers Scientic type 2040, Tillburg, Holland). The scale-up of the reaction was done using the same procedure albeit using 30 g of dextran and a calculated amount of periodate to yield a theoretical oxidation of 5, 10, 25 and 40%, referred hereafter as D5, D10, D25 and D40, respectively.

4.3.3. Nuclear Magnetic Resonance

H spectra were acquired on a Varian 600 NMR spectrometer (Palo Alto, CA) using a 3 mm indirect detection NMR probe. 1 H NMR spectra were recorded in D2 O (20-25
1

57

Chapter 4

Insight on the Periodate Oxidation of Dextran

mg in 0.2 mL; pD of c.a. 4.5 or 10.2 after addition of NaOD) using a 90 pulse and a relaxation delay of 30 s. The water signal, used as reference line, was set at 4.75 ppm and was partially suppressed by irradiation during the relaxation delay. A total of 32 scans were acquired for each 1 H NMR spectra. Bidimensional spectra were recorded on the same magnet. 1 H-1 H correlation spectroscopy (COSY) spectra were collected as a 2048 1024 matrix covering a 5 kHz sweep width using (32) scans/increment. Before Fourier transformation, the matrix was zero lled to 4096 4096 and standard sinebell weighting functions were applied in both dimensions. 1 H-13 C heteronuclear multiple quantum coherence (HMQC) spectra were collected as a 2048 1024 matrix covering sweep widths of 5 and 25 kHz in the rst and second dimensions, respectively. Before Fourier transformation, the matrix was zero-lled to 4096 4096 and standard Gaussian weighting functions were applied in both dimensions. The spectra were analysed with iNMR software, version 2.6.4 (www.inmr.net). The oxidation degree (OD) refers to the theoretical value unless otherwise stated.

4.3.4. DexOxs Solubility and Solutions Viscosity

The dierent dexOx and dextran samples were dissolved in PBS (20% w/w). Aliquots of 1 mL were distributed in small glass vials, frozen at -20 C and freeze-dried, in order to obtain a similar freeze-drying cake across every sample. The original dextran processed this way will be referred as D0. To each sample, 0.85 mL of miliQ water was added and the dissolution time was recorded at dierent temperatures (n=3). The reason was to mimic the reconstitution of a pharmaceutical freeze-dried product. The vials were preserved under reduced pressure on a glass desiccator supplied with silica gel. Dextran and dexOx solutions, with concentrations ranging from 10 to 30% w/w, were prepared and tested in a Brookeld Programmable D-II+ Viscometer with a S18 spindle, assisted by DVLoader v1.0 software. The chamber temperature was controlled by an external bath to 25 C. Low viscosity solutions were measured by a Labolan V1-R viscometer with a LCP spindle (low viscosity adapter) and controlled temperature to 25 C.

4.3.5. Size Exclusion Chromatography

Performed in a HPLC system composed by a degasser and a WellChrom Maxi-Star k1000 pump (Knauer), coupled to a LS detector (evaporative light scattering PL-EMD 960) and one column (Polymer Laboratories, aquagel-OH Mixed 8 m). The whole

58

4.4 Results and Discussion system was kept at room temperature and the eluent used was KNO3 (0.001 M; pH 3.9) at a ow rate of 0.4 mL/min. Samples and standards were dissolved in the eluent at 4-6 mg/mL (Fluka Chemie AG, dextran standards from 12 80 kDa).

4.3.6. Dynamic Mechanical Thermal Analysis

The freeze-drying samples obtained above were subjected to dynamical mechanical thermal analysis (DMTA) on a Triton Tritec 2000 analyser. About 50 mg of sample were loaded into metal pockets fabricated from a sheet of stainless steel. The pocket was clamped directly into de DMA using a single cantilever conguration. Temperature scans, from -200 C to +300 C, with a standard heating rate of 2 Cmin1 were performed in a multifrequency mode (1 and 10 Hz) in order to identify the temperature transition peaks.

4.3.7. Thermogravimetric Analysis

The thermal stability of dextran and dexOx samples was studied in a TA Instruments Q500 thermogravimetric analyser (thermobalance sensitivity 0.1 g). The temperature calibration was performed in the range 25-1000 C by measuring the Curie point of nickel standard, using open platinum crucibles, a dry nitrogen purge ow of 100 mLmin1 , and a heating rate of 10 C min1 , the later being the conditions applied throughout the thermoanalytical measurements. At least two runs were performed for each sample (sample weights of ca. 8 mg) in order to check the repeatability of measurements.

4.4. Results and Discussion

4.4.1. DexOx Characterisation
Dextran with a molecular weight of 60 kDa, was oxidised with variable amounts of sodium periodate in order to obtain dierent OD. Usually, the aldehyde group is not observed by FTIR spectroscopy, unless in highly oxidised samples (1730 cm1 ), nor in the NMR spectrum, except during the rst minutes of reaction (~9.7 ppm) [14]. It is widely accepted that the aldehyde groups react with nearby hydroxyl groups, forming hemiacetals or hemialdals [16, 282]. These transitory events could be either intra or

59

Chapter 4

Insight on the Periodate Oxidation of Dextran

inter-residue (Fig. 4.2) and, in certain situations, interfere with the oxidation evolution. The most important aspect arising from this modication is the nal oxidation degree. It denes the dexOxs reactivity on drug conjugation [65] or gelation rate on hydrogel formulations [14, 35]. Concerning the estimation of the oxidation degree, several ways have been used to approach the problem. On extensive oxidations, acid-base titration is useful in assessing the released formic acid and the percentage of doubly oxidised residues [10]. On mild oxidations, colorimetric titrations, such as the hydroxyalamine hydrochloride [25] or the TNBS assay [22], have been used. However, the calculations are usually performed assuming that both aldehydes react with the carbazates. On an earlier study [14], our two-dimensional NMR results led us to suggest that just one of the aldehydes per residue reacts with the carbazates, in agreement with the single correlation observed on the 1 H-13 C HMQC spectrum. Our new results suggest that, under the studied conditions, only one aldehyde per residue is reacting.

4.4.2. Bidimensional Nuclear Magnetic Resonance

The NMR data was collected in D2 O with a measured pD of ~ 4.5, which falls inside the consensual pH window for hemiacetals formation. Therefore, our bidimensional NMR analysis will take into account the most likely hemiacetal populations, based on previously proposed structures found in the literature. These structures will serve as

Figure 4.2.: (A) Single periodate oxidation outcome after periodate ion attack at C3 C4 and (B) C3 -C2 cleavage, followed by possible intra-hemiacetals formation and tBC reaction. (C) Periodate doubly oxidised residue, possible hemiacetals and tBC reactions.

60

4.4 Results and Discussion

Figure 4.3.: (A) COSY (B) HMQC spectra of D25. The peaks assigned with plain numbers refer to correlations arising from the intact residue. The correlations arising from the dierent oxidised residues are represented by: a: C3 -C4 oxidation; b: C3 -C2 oxidation; c: C4 -C2 double oxidation; and d: -1,3 branched oxidised residue.

61

Chapter 4

Insight on the Periodate Oxidation of Dextran

a starting ground for the carbazone peak assignment. The C3 -C4 cleavage (Fig. 4.2A) was described to be 7.5-fold faster than the C3 -C2 cleavage (Fig. 4.2B) [16]. On a mild oxidation, the double oxidised structure (Fig. 4.2C) is likely less representative, as most periodate would be rapidly consumed on single oxidations and such scenario is favored by the starting pH (~ 5) [283]. Furthermore, it is thought that the hemiacetal formation could hinder further oxidation, even of neighboring residues [16]. Therefore, the structures arising from the C3 -C4 oxidation will be treated as more representative, followed by the C3 -C2 oxidation and the double oxidation. The titration of dexOx with carbazates yields a carbazone moiety, evidencing the former aldehydic proton, which helps clarifying the bidimensional spectra. The region around 7.3 ppm (proton axis) and 145 ppm (carbon axis) on the 1 H-13 C-HMQC (Fig. 4.3A inset) unveiled two main peak populations of carbazone protons. A third carbazone peak exists (7.16 ppm), only seen on the COSY (correlation spectroscopy) spectrum (Fig. 4.3B) and is apparently correlated with the -1,3 anomeric proton (see left axis dextrans proton spectrum overlay for the native peaks). Therefore, it seems to exist two main carbazone peaks, out of four possible dierent carbazones (C2 , C4 and two dierent C3 s), though each of them could have dierent environments inuencing the chemical shifts. Analysing the C3 -C4 cleavage (Fig. 4.2A), an intra-hemiacetal structure is likely to occur, after a hydroxyl (C2 ) attack to the C4 aldehyde, forming a stable six sides ring [284], despite several dierent possibilities due to the rotativity of the oxidised residue. The aldehyde on C3 could suer an attack from any hydroxyl (HO-C4 from the downstream residue suggested in the structure). We propose this aldehyde to be the more susceptible of attack by tBC, represented by the most shielded of the protons (Fig. 4.3A 3a; ~ 7.28 ppm) in the 7.3 ppm region. Analysing this peak correlation on the COSY, one can see a correlation with a proton at ~ 4.25 ppm (2a), correlating itself with a carbon (Fig. 4.2A) on the same chemical shift as glucose C2 (~ 71.6 ppm). The same proton (2a) further correlates downeld, with a possible anomeric proton/carbon (1a). Supposing this structure as the most likely and stable after C3 -C4 cleavage, the C4 proton has an anomeric-like environment and possibly could be associated with a correlation with C5 like those proposed aacording to the bidimensional spectra (4a and 5a, respectively). The C3 -C2 cleavage yields an aldehyde on C2 , which has been proposed to form a stable and conformationally plausible 1,4-dioxepane ring after reaction with the OH on C4 from the downstream residue (Fig. 4.2B) [16]. Again, the aldehyde on C3 (3b) would be more prone to react with tBC. Following the other carbazone proton at ~ 7.35 ppm (Fig. 4.3B; 3b), it correlates with a proton at ~ 4.55 ppm (4b), which further correlates with a single

62

4.4 Results and Discussion proton upeld, falling near the glucose residue proton/carbon 5 (5b). There is a strong correlation between an anomeric proton and a proton at ~ 3.65 ppm, which could be an unshielded proton on C2 and also correlates with a carbon in the same chemical shift as glucose C2 . This correlation could likely arise from 1b and 2b, but also 1c and 2c, from the doubly oxidised residue, as the environments are very similar. Regarding the doubly oxidised residue, the hemiacetal structure depicted in Fig. 4.2 was also suggested by Ishak and Painter (1978) [16] to be plausible.

Figure 4.4.: NMR spectra acquired at alkaline pH (10.2). (A) 1 H-NMR of D25 with close up (7.8 - 9.2 ppm); (B) D25 mixed with EtC, close up of the region of interest; (C) COSY overlay of D25 (red contour) with D25 mixed with EtC (black contour). The new correlations arising from the carbazone protons are identied. Therefore, C4 would be more sensitive to a carbazate attack. However, the third major visible correlation in the COSY spectrum, at 7.16 ppm, apparently correlates with the anomeric proton (-1,3), which would be an unlikely chemical shift for a proton on C5 . It would be more reasonable if this correlation arose from the carbazate attack at C2 of the doubly oxidised, but a second correlation would have to be present in the HMQC spectrum (Fig. 4.3B). It is possible that the correlations from the doubly oxidised

63

Chapter 4

Insight on the Periodate Oxidation of Dextran

residue, as well as other minor populations, are masked within the major peaks. The transient nature of the hemiacetals and the similar environments turn the peak assigning task a hard mission, which could have several interpretations. Anyhow, the two main correlations on the COSY spectrum suggest that not every aldehyde is reacting with a carbazate under these pH conditions. At alkaline pH (10.2), some new peaks can be seen in the range of 7.5 to 9.5 ppm for the D25 sample (Fig. 4.4A). These peaks were previously attributed to isomeric enol forms. Such structures are under an aldo-enol equilibrium [18]. Many other peak populations are observed between 4 and 6 ppm, due to the higher resolution (Fig. 4.41A). Though, the addition of EtC, at this pH, did not revert most of the identied new peaks, it presented more correlations on the zone of interest for the carbazone protons (~7.3 ppm; Fig. 4.4 B & C). We have observed before, that dexOx crosslinked with AAD hydrogels dissolved quickly at pH 9 [14], suggesting the sensitivity of the hydrazone bond to alkaline pHs, thus, the likelyhood of a similar behaviour for the carbazone bond also exists. These new correlations, suggest that, every aldehydic carbon is sensitive to a carbazate attack. Under this pH, the aldo-enolic structures are likely more exposed to attack than under the hemiacetal form, establishing a higher number of equilibriums, concomitantly expressed on the COSY spectrum (Fig. 4.4D). The overlay of both COSY spectra shows the appearance of a high number of new correlations after the addition of EtC (Supplementary Figure 1D, black contour), partially reverting the correlations of D25 (red contour). These results identify pH as a strong modulator of dexOx reactivity, which might be interesting to contemplate under certain pH sensitive applications.

4.4.3. Macroscopic Consequences of the Oxidation

The extensive and complete dextran oxidation leads to the destruction of the molecule into characteristic degradation by-products [10]. Low and mild oxidations also degrade dextran, leading to slight molecular weight decrease. The destruction of the glucose residue, yielding aldehydes, could also contribute in altering the dexOx behaviour in solution. The periodate oxidation in non-buered solutions leads to pH decrease, after formic acid release [14], possibly contributing for acid-hydrolysis [285]. This phenomenon can be observed in several ways. The reference technique in the characterisation of polymers is the size exclusion chromatography (SEC), which separates the dierent populations in accordance with the hydrodynamic volume, which can be translated to molecular weight and the polydispersity index (Tab. 4.1). The molecular weight is a

64

4.4 Results and Discussion Table 4.1.: Macroscopic characteristics of native dextran and the several oxidised samples. OD estimated by 1 H-NMR analysis, Mw and PDI calculated by SEC, viscosities at dierent concentrations and time necessary until complete dissolution.
Sample Oxidation degree IO4 a EtCb Dextran D5 5 3.6 0.1 D10 10 8.6 0.2 D25 25 22.2 0.7 D40 40 33.0 0.8
a b

Mw c kDa 60.1 61.2 60.8 60.3 25.4

PDId

1.47 1.59 1.61 2.03 3.05

e f t37C g 20% 5% (mPa.s) (mPa.s) 30.7 2.7 1.00.04h 35.9 2.9 1.30.08 35.1 3.0 1.50.05 26.8 2.7 3.90.65 102.8 2.7 26.60.44

Theoretical OD, calculated as the molar ratio of sodium periodate per initial glucose unit in dextran. Calculated by 1 H-NMR after titration with tert-butyl carbazate/ethyl carbazate, taking into account the ratio between the integral of the peak at 7.3 ppm and the integral of the anomeric proton at 4.9 ppm. Average and standard deviation of 5 independent integrations. c Weight-average molecular weight estimated by SEC. d Polydispersity index corresponding to Mw /Mn . e Viscosities of dextran and oxidised dextrans at 20% w/w. Taken from the slope of the curves Shear Stress = f(Shear Rate) plot. The linear regression was forced to cross the origin as every sample showed a Newtonian behaviour. f Viscosities of dextran and oxidised dextrans at 5 % w/w, at 200 rpm. g Dissolution time taken, at 37 C, in PBS, without agitation.

key property of polymers, dening certain macroscopic characteristics, such as solubility, viscosity and clearance rates in biological systems [2]. Besides 1 H-NMR and SEC, we have gathered results of techniques and empirical evidences, which clearly reect the molecular weight dierences between the several dexOx samples. One direct consequence of the dextran oxidation is the longer dissolution times in aqueous media. This phenomenon is of utmost importance on an o-the-shelf freeze-dried product. The dissolution time periods of the several samples under exactly the same conditions (Fig. 4.5A) but at dierent temperatures, show that D5 and D10 have very close dissolution proles to dextran (D0). However, the D25 and D40 dissolution proles clearly reect the OD increase. The viscosity of a dextran solution is directly related to its concentration and Mw [286, 287]. The molecular weight decreasing due to periodate oxidation should theoretically yield a less viscous solution than the original dextran, for the same concentration conditions. At lower concentrations (5%) the viscosity variation is negligible (Tab. 4.1). However, the reactivity of the oxidised dextran, through inter-hemiacetals formation, has great inuence on the behaviour of the solutions. We observed that the oxidation degree could invert the viscosity trend, depending on the dexOx concentration. Concentrated solutions

65

Chapter 4

Insight on the Periodate Oxidation of Dextran

Figure 4.5.: Dissolution time proles, at dierent temperatures (A) and the shear stress vs. shear rate prole at 20% (w/w) concentration and 25 C (B) for dextran ( ), D5 ( ), D10 ( ), D25 ( ) and D40 ( )

favour the inter-chain hemiacetals formation, resembling a molecular weight increasing, hence the higher resistance to ow. Within the same concentration range (20% w/w), only D25 viscosity falls below the dextran viscosity. On the other hand, D40 has an extremely high resistance to ow, reecting the cross-reactivity (Tab. 4.1 and Fig. 4.5B). We suggest that this eect is due to the interchain hemiacetals formed, inverting what would be the natural viscosity trend and demonstrating how both parameters (OD and Mw) can interfere with the viscosity of a given dexOx solution.

4.4.4. Thermal Analysis

We have extended the study on the inuence of the oxidation extension by analysing the thermoanalytical curves of the dierent oxidised species. The DMTA method is frequently used to evaluate the eects of excipients on polymers glass transition temperature (T g ). In amorphous polymers, a primary relaxation transition may be observed at a characteristic temperature Tg . In this point, the glass-like state (restricted motion of the polymeric chains) changes to a rubber-like state indicating loss in rigidity (i.e. increased relaxation) associated with enhanced polymeric chain mobility. Typically, the glass transition is dened as the temperature(s) at which either a maximum in the mechanical damping parameter (tan ) or loss modulus (G) occurs [288]. The presence of moisture can also be assessed by DMTA, visible in the thermoanalytical curves as characteristic transitions at certain temperatures [289]. In terms of damping, it is

66

4.4 Results and Discussion possible to identify four main transitions for the pristine dextran, approximately at -80 C, 105 C, 235 C and 305 C (Fig. 4.6A */**). The peak at -80C is a secondary relaxation due to absorbed water, which contributes to the formation of a more diuse and stronger H-bond network than observed in a dry sample [289]. The peak at 105 C refers to the water evaporation from dextran. These thermal events show that even after the freeze-drying process some residual water is present. These events have dierent proles on the oxidised samples (not shown), which will not be addressed since this issue is out of the scope of this work. The next peak at ca. 235 C corresponds toT g . At this temperature, the storage modulus decreases rapidly and is frequency dependent on the Tan (Fig. 4.6A inset). This peak reectes an - relaxation from non-frequency dependent events, such as crystalization, melting, curing or thermal degradation [290]. The peak at 305 C reects an overall degradation stage and will be discussed further ahead. It has been reported that the molecular weight of dextrans inuences the Tg due to the decrease of the free volume with the Mw increase [291]. To conrm such inuence, the thermoanalytical data of several dextrans (Mw : 580, 60 and 19.5 kDa; tested as supplied) were analysed. In fact, the T g of the tested dextrans samples decrease directly with the Mw , being the correspondent peak values observed at 237.8, 235.4 and 231.1 C, respectively (Fig. 4.6B). These T g are in agreement with the trend described by Icoz et al[291] for a comparable Mw , despite determined by a dierent technique. The dierent oxidised samples were processed in a similar way to avoid any artifacts that could arise from freezing and freeze-drying and there was an eort to minimize samples moisture. Interestingly, D0 presented a broader peak and shifted to lower temperature (223.6 C) when compared with the original dextran (Fig. 4.6B). The presence of the phosphate salts could interfere with the freezing process of dextran, leading to dierent dextran chain conformation, which is reected by the broader T g peak and the shift to lower temperatures [292]. By freeze-drying a phosphate buered aqueous dextran solution, it can impair the crystallization process of the salts [293] as well as the dextran derivative itself. Nevertheless, the Mw dierence, within the dexOxs samples, is clearly visible on the DMTA curves (Fig. 4.6C and Tab. 4.2) corroborating the SEC and NMR data. It is known that cross-linking agents can also increase the T g [288]. However, the hemiacetals cross-linking eect, observed on the viscosity studies, apparently is not reected on the T g , suggesting that the real molecular weight is dominant on the T g onset. A rst look to the TG curve proles (Fig. 4.7A) allows to identify a quite dramatic change

67

Chapter 4

Insight on the Periodate Oxidation of Dextran

Figure 4.6.: (A) Full thermogram of native dextran marked with the non-frequency dependent transitions (*) and T g identication (inset; **) through frequency dependent transition; (B) T g of the dierent molecular weight dextrans; (C) T g of the dierent oxidised samples. All samples presented with a frequency of 1 Hz, except for dotted line at a frequency of 10 Hz. in going from native dextran to its processed (freeze-dried PBS solution) counterpart, D0. Apart from a shift in the onset temperature of the main mass loss stage towards lower temperatures (by 41 C), a remarkable dierence is observed in the residual mass (at 600 C), which should be ascribed to the salts coming from PBS. The original dextran exhibits a quite familiar behaviour [294, 247, 289, 295], with a rst mass loss stage below ca. 120 C due to the elimination of water, as observed in the DMTA, followed by the overall degradation stage (depolymerization) along the approximate temperature range from 298 to 328 C, in good correspondence with the fourth transition, identied by the DMTA results (Fig. 4.6A). However, the thermal decomposition of oxidised dextran samples should be analysed with reference to thermal decomposition of the sample that reects the inuence of PBS in dextran, D0. In this case, the dierences in the thermoanalytical curves appear to be more subtle.

68

4.4 Results and Discussion

Figure 4.7.: (A) TG and (B) DTG curves of dextran and dexOx samples. (=10 Cmin1 ; dry nitrogen at 100 mLmin1 ).

Both D0 and oxidised dextran samples exhibit a rst mass loss stage, from the ambient temperature to 150 C. The correspondent mass loss rate is somewhat variable among the samples, but the residual mass at 150 C is quite comparable (see Tab. 4.2). This rst weight change is caused by the loss of adsorbed water, and, probably, of some water of crystallization related with the PBS components (phosphates). Above 150 C, the dierences in the response of samples under comparison become more apparent. The complexity of the global thermal decomposition, probably involving several kinetically independent processes as suggested by the TG data and, mainly, by the dierential thermogravimetric (DTG) curves proles (Fig. 4.7B), increases with the degree of the oxidation of the samples. A rst change in the mass loss rate within the approximate temperature range 180-220 C can be observed (Fig. 4.7B inset), being only incipient in the case of the D5 sample, moderate in the D10 one, and rather evident in the remaining oxidised dextran samples (see also Tab. 4.2 for the onset temperatures). This stage is followed by the main decomposition process, whose pattern is also clearly inuenced by the oxidation degree, as revealed by the DTG curve proles. In terms of characteristic quantities, while the onset temperature of the main decomposition stage obeys to a well dened pattern, monotonically decreasing with the increase of the oxidation degree from 247.5 C (D5) to 233.0 C (D40), the undened trend of the peak temperature at the maximum decomposition rate (Tab. 4.2) reects dierences in decomposition pathways. The residual mass at 600 C for the most oxidised sample (D40) suggests a pronounced dierent decomposition course when compared to the remaining oxidised samples.

69

Chapter 4

Insight on the Periodate Oxidation of Dextran

Table 4.2.: Glass transition temperatures obtained from the DMTA curves (see Fig. 4.6) and characteristic quantities (mean and standard deviation) obtained from the TG/DTG curves (see Fig. Fig. 4.7).
Sample Dextran D0 D5 D10 D25 D40
a
b c

Tg (C) 235.5 223.6 211.5 207.9 200.5 190.7

Ton a (C) 298.60.4 257.61.4 195.21.4 247.50.8 198.60.6 241.50.4 190.80.4 234.10.3 179.70.2 233.00.7

Tp b (C) 315.00.2 269.91.7 267.11.6 279.20.2 266.20.2 274.41.8

mc (%) 92.80.2 96.31.1 94.70.2 93.20.3 93.10.4 94.30.3

8.30.4 29.70.2 29.70.2 28.80.0 30.90.3 35.40.0

Ton : extrapolated onset temperatures (TG curve). Tp : peak temperature, corresponding to the maximum decomposition rate (DTG curve). m: residual mass at the temperatures 150 C and 600 C.

4.5. Conclusion
Our bidimensional NMR data suggests that only one aldehyde per residue is responding to the carbazate under mildly acidic conditions. We propose that the two main peak populations (~ 7.3 ppm) arise from carbazates on C3 from single oxidised residues. There are more downeld shifted peaks, but not more than 5.5 ppm, which indicate the nonexistence of more carbazate proton populations. These peaks should arise from protons involved in hemiacetals. The enol forms appear to be more reactive towards carbazates, though more labile and less stable. The periodate oxidation of dextran is a harsh reaction which promotes chain degradation, confers high chemical reactivity to a natively neutral molecule and deeply alters its physicochemical properties. The increasing OD, impairs water solubility, taking longer periods of time to solubilise, and interferes with the resulting viscosity, especially at high polymer concentrations. The solutions viscosity could impair injectability and mixibility of certain formulations. The degree of oxidation is also reected on the glass transition temperature according to DMTA data. Interestingly, the hemiacetals do not seem to aect the thermal properties of the freeze-dried samples. The glass transition temperatures shift is in direct accordance with the molecular weight decrease, but do not give much insight on the structural consequences of the oxidation. On the other hand, the DTG proles, for the diverse samples, are quite interesting. An increase in the thermal decomposition complexity with the increase in the oxidation degree was identied,

70

4.5 Conclusion evidencing the deleterious eect of periodate oxidation on dextrans structure. Low oxidative conditions, up to 10%, do not damage extensively dextrans structure, however milder oxidation conditions, result in extensive disruption of the dextran structure. These set of results may rise awareness for the consequences of periodate oxidation on the nal structural properties of the modied dextran, helping researchers to better guide the design of dexOx-based formulations.

71

5. Ocular Injectable Formulation Assessment for Oxidised Dextran-based Hydrogels

5.1. Abstract
Initiator-free injectable hydrogels are very interesting for drug and/or cell delivery applications, since they can be administered in a minimally invasive way, without recurring to chemical initiators that could be harmful. In the current work, oxidised dextran crosslinked (dexOx) with adipic acid dihydrazide (AAD) hydrogels were further characterised and tuned to produce formulations, having in sight an injectable ocular formulation for the possible treatment of posterior eye diseases. The gelation rate and the hydrogels dissolution prole were shown to be dependent on the balance between the dextran oxidation degree, and both components concentration. On the in vitro studies, rabbit corneal endothelial cells were seeded on the hydrogels, to assess cytotoxicity. Hydrogels prepared with low oxidised dextrans were able to promote cell adhesion and proliferation to conuence in just 24 hours, while higher oxidised samples promoted cell adhesion and proliferation, but without achieving conuence. Cell viability studies were performed using MTS assays to verify the non-cytotoxicity of hydrogels and their degradation byproducts, rendering these formulations attractive for further in vivo studies.

5.2. Introduction
Ocular diseases of the posterior eye segment are the most common cause of visual disorders in industrialised countries [296]. These illnesses include, for example, cataracts, diabetic retinopathy, macular degeneration associated with ageing and retinitis pigmen-

73

Chapter 5

Oxidised Dextran-Based Hydrogels

tosa [296, 297]. The visual disorders cause discomfort, anxiety and fear of losing the vision in patients. Until now, ocular drug market is dominated by drugs, which were conceived to treat illnesses that aect the anterior eye segment, such medicines include: antibiotics, antiinammatory agents or anti-glaucoma drugs, usually as eye drop formulations [296, 298]. These topical applications, in the form of eye drops, are ineective in many cases, due mainly to the drainage system of the eye, which leads to poor ocular bioavailability [299]. New drugs have been developed to reach the posterior eye segment, although, most of them are administered through repeated intravitreal injections. This method is associated with complications such as pain, increased intraocular pressure, retinal detachment and endophtalmitis (which may lead to blindness). New methods of drug delivery, more secure, ecient, comfortable and with prolonged activity are needed, to minimise the number of injections. Currently, there are systems of controlled drug delivery on the market or being tested, such as implants, hydrogels and colloids [296]. Hydrogels are hydrophilic polymer networks, which may absorb up to thousands of times their dry weight in water. Hydrogels may be chemically stable or they may degrade and eventually disintegrate and dissolve. They are called reversible or physical gels when the networks are held together by molecular entanglements, and/or secondary forces including ionic, H-bonding or hydrophobic forces. Hydrogels are called permanent or chemical gels when they are covalently cross-linked networks [300]. Recently, Van Tomme and collaborators compiled the dierent strategies used in producing dextranbased hydrogels, demonstrating dextran as a very versatile starting polymer for hydrogel synthesis [6]. Furthermore, pharmaceuticals and various potential therapeutic agents can easily be incorporated and its release prole controlled. Recently, human embryonic stem-cell encapsulation was also successfully achieved in bioactive hydrogels of dextranacrylate [216]. Dextran is biocompatible and can be degraded through the action of dextranases in various organs in the human body, including liver, spleen, kidney and colon [2]. Dextran oxidation by sodium periodate is an easy and well-known way to functionalise dextran with aldehyde moieties [10]. This chemical functionality has been widely tested to conjugate N-nucleophiles, due to their fast and almost complete reaction [29]. This approach has been tested on the synthesis of pro-drugs [66], as a spacer in enzyme immobilisation [132] or for growth factor controlled release [103]. On the preparation of hydrogels, dierent aminated cross-linkers, like chitosan [104, 105], gelatine [102], 8-arm

74

5.3 Materials and Methods PEG amine [39] or polyhydrazides [28] have been used to yield chemical initiator-free formulations. Recently, we described an injectable formulation composed of oxidised dextran (dexOx) cross-linked with adipic acid dihydrazide (AAD) [14]. The dexOx with 15% oxidation degree (OD) was cross-linked with AAD, forming a gel within 24 minutes, depending on the AAD concentration used. The obtained hydrogels were characterised by their mechanical properties (7 32 kPa), swelling and degradation (9 to 23 days) behaviour under physiologic conditions. In this work, oxidised dextran, with various OD, was studied in order to improve the control of the system properties. The inuence of dextran OD and concentration in the solution viscosity was monitored. We observed that the hydrogel swelling and dissolution could also be controlled by the dextran oxidation degree and that the dissolution prole could be extended for more than 2 months, improving the previous studied formulation. Cell toxicity assays were carried out in 96-well plates with dierent dexOxs hydrogels. Cell viability studies were performed using rabbit corneal endothelial cells, which were seeded on top of the dexOxs hydrogels. The cell adhesion and growth was visualised by optical microscopy and dehydrogenase activity of cells was evaluated by reduction of the MTS reagent.

5.3. Materials and Methods

5.3.1. Materials
Dextran (from Leuconostoc mesenteroides; Mw 60 kDa, according to Flukas specication), sodium periodate, AAD, tBC, EtC, PBS, dialysis tubes (MWCO ~12 kDa), amphotericin B, L-glutamine, Minimum Essential Medium Eagle, penicillin G, streptomycin, and trypsin were purchased from Sigma (Sintra, Portugal). Foetal bovine serum was purchased from Biochrom AG (Berlin, Germany). The 3-[4,5-dimethylthiazol-2-yl]-5-(3carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt (MTS) and electron coupling reagent (phenazine methosulphate; PMS) were purchased from Promega. Tasks and 96 well plates were purchased from Nunc (Denmark).

75

Chapter 5

Oxidised Dextran-Based Hydrogels

5.3.2. Dextran Oxidation

An aqueous solution of dextran (1 g; 12.5%, w/v) was oxidised with 2 mL of sodium periodate solution with dierent concentrations (33 264 mg/mL) to yield theoretical oxidations from 5 to 40%, at room temperature. The reaction was stopped after 4 hours. The resulting solution was dialysed for 3 days against water, using a dialysis tube with a MWCO 12-14 kDa, and then lyophilised (Snidjers Scientic type 2040, Tillburg, Holland). The scale-up of the reaction was done using the same procedure albeit using 30 g of dextran and a calculated amount of periodate to yield a theoretical oxidation of 5, 10, 25 and 40%.

5.3.3. Nuclear Magnetic Resonance and Size Exclusion Chromatography

The OD of dexOx is dened as the number of oxidised residues per 100 glucose residues (OD refers to the theoretical value unless otherwise stated) and quantied by using tBC [22, 301]and EtC. The carbazates react with aldehyde groups to form carbazones in the same way hydrazones are formed in the presence of hydrazides. H spectra were acquired on a Varian 600 NMR spectrometer (Palo Alto, CA) using a 3 mm broadband NMR probe. 1 H NMR spectra were recorded in D2O (20-25 mg in 0.2 mL; pD of ca. 5.0) using a 90 pulse and a relaxation delay of 30 s. The water signal, used as reference line, was set at 4.75 ppm and was partially suppressed by irradiation during the relaxation delay. A total of 32 scans were acquired for each 1 H NMR spectra. The spectra were analysed with iNMR software, version 2.6.4 (www.inmr.net). Size exclusion chromatography (SEC) was performed in a HPLC system composed of a degasser and a WellChrom Maxi-Star k-1000 pump (Knauer), coupled to a LS detector (evaporative light scattering PL-EMD 960) and one column (PL aquagel-OH Mixed 8 m) from Polymer Laboratories. The whole system was kept at room temperature and the eluent used was KNO3 (0.001 M; pH 3.9) at a ow rate of 0.4 mL/min. Samples and standards were dissolved in the eluent at 4-6 mg/mL (Fluka Chemie AG, dextran standards from 12 80 kDa).
1

76

5.3 Materials and Methods

5.3.4. DexOxs Solutions Viscosity

Dextran and dexOxs solutions, with concentrations ranging from 10 to 30% (w/w) in PBS, were prepared and analysed in a Brookeld Programmable D-II+ Viscometer with a S18 spindle, assisted by DVLoader v1.0 software. The chamber temperature was controlled by an external bath to 25 C, and the chamber was loaded with 8 mL of solution.

5.3.5. Hydrogel Preparation and Characterisation

The several oxidised dextrans were dissolved in dierent concentrations; dexOx 5% (D5) and 10% (D10) solutions were used at 30% (w/w) and dexOx 25% (D25) at 20% (w/w), in aqueous solvent (PBS) at 37 C until a liquid solution was obtained and then kept at 5 to 8 C, until further use. Then, 250 L of a given dexOx solution was mixed with 250 L of a given AAD solution on home-made Teon moulds and let to cross-link never less than 2 hours (except for the D5 hydrogels, which were let to cure over night). The AAD concentrations used are calculated based on a given molar percentage of dextran residues. The hydrogels nomenclature is as follows: dexOx 5% + AAD 5% - D5A5; and so forth.

5.3.6. Dynamic Swelling Experiments

DexOx hydrogels, after being prepared and weighted (Wi), were immersed in PBS (ca. 5 mL) in 6-wells cell culture plates, at 37 C. At regular time intervals, they were removed from the aqueous solution, blotted in lter paper, weighted (Wt) and returned to the original well while PBS was replaced. The swelling index (SI) is dened as:

SI = W t/W i

(5.1)

where W t is the weight on a given time point and W i represents the initial hydrogel weight.

77

Chapter 5

Oxidised Dextran-Based Hydrogels

5.3.7. Rheological Analysis

Rheological experiments were carried out using the parallel plate geometry (20 mm diameter, steel) of a Haake Rheostress RS 1. On the calculation of gelation period, both solutions (190 L each) were mixed on the bottom plate, and the upper plate was positioned at a gap of 1 mm (after gap optimisation). This procedure took around 20 seconds after which the experiment was started at low frequency (0.5 Hz) and stress (0.1 Pa), to avoid interference with the network formation. The gelation rate was followed and the gelation period was considered to be the crossover point between G and G (G=G).

5.3.8. Cell Source and Growth

Corneal endothelial cells from rabbit were obtained as previously described [302]. Subsequently, cells were platted in T-asks of 25 cm3 with Minimum Essential Medium Eagle (MEM) with heat-inactivated foetal bovine serum (FBS, 10% v/v) and growth factors to do primary culture in agreement with the procedures previously described in the literature [303]. T-asks with cells were incubated in a 5% carbon dioxide humidied atmosphere at 37 C. On day 3, the medium was changed and here after every three days. Six days after cells attained conuence. After conuence was obtained, cells were sub-cultivated using 5 min incubation in 0.18% trypsin (1:250) and 5 mM EDTA. The free cells were added to an equal volume of culture medium. Following centrifugation, cells were re-suspended in sucient culture medium and seed in 96 well plates containing the biomaterials.

5.3.9. Cell Culture and In Vitro Cytotoxicity Studies

Two cross-linking degrees of AAD for each dexOx were selected and used on cytocompatibility tests. The oxidised dextran samples and AAD were either dissolved in PBS or in the appropriate cell culture medium, MEM. Each formulation in the form of hydrogel was introduced (n=6), on wells of 96-wells cell culture plates, never exceeding 60 L. The plates were irradiated for 30 minutes with UV, before being seeded with cells. Forth passage endothelial corneal cells were seeded, at a density of 90000 cells per well, into a 96-well plate containing the hydrogels. The plate was incubated at 37 C,

78

5.4 Results and Discussion under a CO2 (5%) humidied atmosphere. After 1, 3 and 7 days, cell viability was assessed through MTS assays. A CellTiter 96 AQueous Assay composed of 3-[4,5dimethylthiazol-2-yl]-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt (MTS) and an electron coupling reagent (phenazine methosulphate; PMS) from Promega were used. 20 l of MTS/PMS were added to each sample and incubated for 4 h at 37 C, under a CO2 (5%) atmosphere. The absorbance of the samples was determined at 492 nm using a Biorad Microplate Reader Benchmark. Wells containing cells in culture medium without biomaterials were used as negative control (K-). Ethanol 96% was added to wells containing both types of cells to have a positive control (K+). The samples were analysed using an Olympus CX41 optical microscope equipped with an Olympus SP-500 UZ digital camera.

5.4. Results and Discussion

5.4.1. DexOx Characterisation
Following previous work [14], we characterised hydrogels made from dexOx with a wider range of oxidation degrees, cross-linked with dierent amounts of AAD. Dextran was oxidised by using sodium periodate at dierent percentages and characterised by 1 HNMR. The oxidation degree was not estimated by the TNBS assay, due to the good correlation of the NMR titration with the colorimetric assay, as shown in previous work [14]. The tert-butyl carbazate titration, however, causes sample precipitation when reacted with high oxidation degree samples, not allowing NMR spectra acquisition (D40, Tab. 5.1). We suggest that this eect is caused by the large tert-butyl moiety and we hypothesised that a less bulky molecule, such as ethyl carbazate, would not cause sample precipitation. In fact, both spectra are similar except for the ethyl protons peak which is sharper and slightly shifted up-eld in comparison to the tert-butyl peak (spectra not shown). The real oxidation degree was calculated by taking into account the ratio between the integral of the peak at 7.3 ppm (arising from the carbazone group formed either with tBC or EtC) and the integral of the anomeric proton at 4.9 ppm. The oxidation degrees obtained with EtC were slightly higher (Tab. 5.1) than that obtained with tBC titration, which may suggest some diculty of tBC to react further due to its bulkier moiety. The dexOx number-average molecular weight (Mn ), estimated by a SEC analysis, showed

79

Chapter 5

Oxidised Dextran-Based Hydrogels

Table 5.1.: Oxidation Degree of several oxidised dextrans calculated by 1 H-NMR analysis after titration with dierent carbazates and molecular weight evolution. Sample Dextran D5 D10 D25 D40
a

NaIO4 a 5 10 25 40

Oxidation degree tBCb 2.5 0.3 7.4 0.9 18.9 0.4 -e

Mnc EtCb 3.6 0.1 8.6 0.2 22.2 0.7 33.0 0.8 40.9 40.8 37.9 29.7 8.3

PDId 1.47 1.59 1.61 2.03 3.05

- Theoretical OD, calculated as the molar ratio of sodium periodate per initial glucose unit in dextran. b - Calculated by 1 H-NMR after titration with tert-butyl carbazate/ethyl carbazate, taking into account the ratio between the integral of the peak at 7.3 ppm and the integral of the anomeric proton at 4.9 ppm. Average and standard deviation of 5 independent integrations. c - Number-average molecular weight estimated by SEC d - Polydispersity index corresponding to Mw/Mn e - Precipitation occurred a clear decrease with increasing oxidation degree, but also an increasing polidispersity index (PDI), reecting the higher range of dexOx molecular weights (Tab. 5.1).

5.4.2. DexOx Solutions Viscosity

On the design of injectable hydrogel formulations, details, like viscosity characterisation, become increasingly important, in order to choose the best syringe geometries and/or needle gauges. Generally, the hydrogel characteristics can be tailored by the feed concentration [104], degree of polymer modication and in other cases, chemical initiators concentration [304]. This particular system involves the mixing of two equal-volume solutions, each of which, with its own reactive species, oxidised dextran residues and the dihydrazide. Thus, the formulations design has to take into account the feed concentration halving, of both solutions, after mixing. Every dexOx sample, at any of the concentrations tested, showed a linear shear stress increase regarding the dierent shear rates, hence, a Newtonian behaviour. For every concentration tested, across the dierent ODs, the obtained viscosities for each dexOx series show a natural trend directly related with the concentration, as can be observed on Fig. 5.2A for dextran and D40. The OD inuence on viscosity seems to have a

80

5.4 Results and Discussion

Figure 5.1.: The reactive aldehyde groups formed upon periodate oxidation are prone to establish inter (A) or intra (B) hemiacetals, when reacting with hydroxyl groups from nearby residues. The addition of AAD (C) promotes the reversible cross-linking with the formation of hydrazones.

higher eect, when the polymer concentration is high, but as the polymer solution is less concentrated, the viscosity tends to decrease and eventually be lower than the reference solution (original dextran). Within the same concentration range, only the D25 viscosity falls below the dextran viscosity, but on the other hand, D40 has an extremely high viscosity reecting the inuence of the high reactivity, due to the high OD (Fig. 5.2B). We suggest that this eect is due to the molecular weight decrease with oxidation, which, below a certain concentration, counter-balances the cross-linking via hemiacetals (Fig. 5.1A), decreasing the solution viscosity (Fig. 5.2A), which could possibly be further enhanced by a dexOx chain coil due to the intra hemiacetal formation (Fig. 5.1B), demonstrating how both parameters (OD and Mw ) can interfere on the viscosity of a given dexOx solution.

81

Chapter 5

Oxidised Dextran-Based Hydrogels

Figure 5.2.: Shear stress versus Shear rate. (A) Dextran with concentrations (w/w) of: - 30%, - 20%, - 15% and - 10%; and D40 with concentrations (w/w) of: - 20%, - 15% and - 10%. (B) All solutions at 20% (w/w) - dextran, - D5, - D10, - D25 and - D40

5.4.3. Hydrogels Characterisation

The hydrogels preparation took into consideration three factors: the dexOx concentration/oxidation degree and the AAD concentration. The rst two are closely related due to the viscosity issues that were discussed above. Therefore, the concentration used was as high as the viscosity would allow it. Solutions of D5 and D10 with 30% concentration allow a good homogenisation, despite the high viscosity, but for D25, we had to use a 20% concentration. The D40 macro-monomer was not studied in deep detail as the others, due to its high reactivity for the concentration range wanted. The D40 with a 20% concentration yields a very viscous solution that reacts promptly with AAD, impairing a good homogenisation. Lower concentrations produce nicer hydrogels, however with less attractive and more unpredictable swelling proles. Yet, the D40 gelation rate data is presented (15% feed concentration), to strengthen the issue on the balance between OD and AAD feed concentration eect on the gelation rate, discussed below. The balance between the available cross-linking points (oxidation degree) and the amount of cross-linker used (AAD feed concentration) clearly aects the gelation rate, as shown on Tab. 5.2, however, not always on the same direction. The gelation periods of D25 and D40 hydrogels decrease with the AAD increase, while for the D5 and D10 hydrogels,

82

5.4 Results and Discussion the gelation periods increase directly with the AAD concentration. When low ODs are present, the excess AAD increases the number of non-valid cross-links, caused by the reaction of a single hydrazide, leaving a dangling end [305], and retarding the hydrogel formation. The polymer feed concentration also aects the gelation periods, as can be observed with the D40 hydrogels, which should be faster than the D25, for the same AAD feed concentrations. Table 5.2.: Gelation periods estimated for each dexOx with dierent AAD concentrations. dexOx D5 D10 D25 D40
a b

Feed Conc. % (w/w) 30 30 20 15

Gelation period (min)a 5% AAD 10% AAD 66.71.4 77.8 5.2 14.9 1.7 16.8 0.5 2.8 0.3 1.6 0.9 3.7 0.4 2.6 0.1

20% AAD -b 18.8 1.3 1.3 0.2 2.3 0.1

The gelation period was considered when G = G ; values are means SD (n=4). Hydrogel not formed.

The dexOx/AAD hydrogels were prepared in Teon moulds and let to cure for at least two hours, except for the D5 hydrogels, which were left overnight, due to the slow curing rate. Equal volumes of dexOx and AAD solutions were added and mixed vigourously with the pipette tip, to achieve a good homogenisation of both solutions. The hydrazide groups in AAD react with the aldehyde groups in oxidised dextrans forming hydrazone bonds, which are hydrolysable, retrieving the same chemical groups (Fig. 5.1C), therefore, making these hydrogels soluble in dierent time frames. The swelling index (Equation 5.1) of the dierent sets of hydrogels showed how the dissolution proles could be controlled, not only by the AAD amount but as well by the dextran OD. By increasing the OD, we can signicantly increase the dissolution time of the hydrogels. This oxidation increase, allows that more AAD can be used as a crosslinking agent, reecting on more lasting hydrogels. By balancing these two variables it is possible to control the dissolution prole of the hydrogels. As shown, low oxidation degrees do not allow long dissolution times. However, it is perfectly possible to control the dissolution prole with the AAD concentration, within a range of 5 days (Inset in Fig. 5.3). Rising up the oxidation, hydrogels more resistant to dissolution are obtained. The D25 hydrogels have very interesting proles (Fig. 5.3).

83

Chapter 5

Oxidised Dextran-Based Hydrogels

The dissolution time could be extended up to 70 days. Furthermore, one can observe an interesting plateau, with 20% AAD, resembling a saddle, approximately from the 2nd until the 50th day of immersion on phosphate buer. Within this period the hydrogels maintained their size and shape without abrupt swelling variations. This prole seems to be interesting for the proposed application, as it will not swell above the injected volume and takes few weeks to dissolve. Just before the hydrogel collapses and dissolve, a maximum swelling peak is observed. We hypothesise this peak to be a fracture point, reached when the osmotic force equals the polymeric matrix force, which weakens through time, due to the AAD diusion out of the hydrogel.

Figure 5.3.: Swelling index prole of dexOx+AAD hydrogels. D25 with feed concentration of 20% and D10 and D5 with feed concentration of 30%. Main plot: - D25A5; - D25A10; - D25A20; Inset: - D10A5; -D10A10; - D10A20; - D5A5; - D5A10.

The water content of the vitreous humour is around 98%, mainly composed of collagen, hyaluronic acid [306] and hyalocytes of Balazs, which take care of removing cellular debris and reprocessing the hyaluronic acid [307]. Since the dexOx hydrogels are soluble in water and electrolyte solutions we think that the vitreous humour will naturally contribute to the dissolution of the hydrogel and help the hydrogel elimination. The by products of the designed hydrogel are its same initial components. oxidised dextran and AAD. Both by-products should be excreted, to the aqueous humour, by the anterior route. This elimination is probably faster than through the blood-retina barrier to the systemic circulation [296], despite that dextrans, up to 150 kDa, are diusible through the sclera [308].

84

5.4 Results and Discussion

5.4.4. Assessment of Cytotoxic Potential

The characteristics of these formulations render them suitable as a drug carrier to the posterior part of the eye, due to its injectable character, the controlled gelation rate or the dissolution prole shown. Formulations composed partially by dexOx have been tested for their biocompatibility. Recently, Bhatia and co-workers [39], seeded 3T3 broblast cells on top of oxidised dextran (20% 50% OD) cross-linked with 8-arm PEG amine and showed that their formulation, was non-toxic and could lead to cell conuence after 24 hours of growth. This suggests, that the cross-linked oxidised dextran can promote better cell adhesion than dextran itself [109], despite showing some toxicity when present, alone, in cell culture with mesothelial cells [38]. In the present work, endothelial cells from rabbit cornea were chosen based on the need to assess the oxidised dextran AAD cross-linked hydrogels cytotoxicity for the proposed application. To assess the cytotoxicity of these materials, several combinations of hydrogels involving the dierent dexOxs and AAD concentrations, were prepared. The 96-well cell culture plates were covered with 60 L of hydrogels or just controls and the cells were seeded on top, after an over-night curing period. The materials used were not only dissolved in PBS but also on the appropriate cell culture media. Occasionally, the initial dexOx feed concentration had to be slightly decreased, due to the high viscosity, probably due to medium proteins, that cross-link with the oxidised dextran through the existing amine groups. After cell seeding on top of the hydrogels, each well was visualised in optical microscope, to observe whether there was any cell adhesion and/or proliferation. Cells grew in the presence of all hydrogels tested, although cell growth, in the presence of D25 hydrogels, did not achieve conuence during the period of study (Fig. 5.4). Dextran is neutrally charged and we expect dexOx to keep the neutrality, as the periodate oxidation reaction does not yield any charged chemical groups. However, the crosslinking of dexOx with AAD (pKa 2.5) yields hydrazone bonds which were reported to have a pKa in the order of 3 to [309]. Hence, due to the nature of the cross-linking bond, we suggest that the hydrogels zeta potential shifts negatively, allowing cell growth and proliferation. It is well known that the surface chemistry of hydrogels can aect cell adhesion, proliferation and other phenomena. Chen et al [310] work showed how the polymer nature

85

Chapter 5

Oxidised Dextran-Based Hydrogels

Figure 5.4.: Endothelial cells isolated from rabbit cornea seeded in dexOx + AAD hydrogels, dissolved in MEM or PBS, after 72 h. (A) D5A5, PBS; (B) D5A5, MEM; (C) D10A10, PBS; (D) D10A10, MEM; (E) D25A10, PBS; (F) D25A10, MEM; (G) negative control; (H) positive control. Original magnication 100X. and cross-linker concentration can dictate the surface charge density of the gels and strongly inuence the cell behaviour. They have identied a threshold on the surface zeta potential (- 20 mV), below which cell adhere and proliferate. Schneider and collaborators also reported that charge density of the hydrogel can regulate cell attachment either directly in the absence of extra-cellular matrix components, or indirectly through the association of extra-cellular matrix proteins found within the serum associated with charges of the hydrogel surface [311]. The MTS assay is a quick eective method for testing mitochondrial impairment and correlates quite well with cell proliferation. In recent years, it has been frequently used as a preliminary screen for the evaluation of in vitro cytotoxicity of polymeric components. The MTS assays were performed at 1, 3 and 7 days after cells being seeded on top of the hydrogels. Cellular activity did not seem to be aected by the medium used to prepare the hydrogels (MEM or PBS). The results (Fig. 5.5) emphasise that every formulation promoted dehydrogenase activity. In the rst 24 hours, all hydrogels promoted higher enzyme activity than the negative control. By the 3rd day, the activity doubled for most

86

5.5 Conclusions

Figure 5.5.: Cellular activities measured by the MTS assay after 1 day (open bars), 3 days (grey bars) and 7 days (black bars). Endothelial cells from rabbit cornea, seeded onto dexOx+AAD hydrogels. The materials were either dissolved in PBS or MEM. K+: Positive control; K-: Negative control. All error bars represent one standard deviation from six experiments. hydrogels, with a few exceptions, and by the 7th day, the activity maintained the same levels. These results demonstrate the tested formulations as non-cytotoxic.

5.5. Conclusions
On the estimation of the dextran oxidation degree, we have identied ethyl carbazate as a better and more accurate titrant, than tert-butyl carbazate, especially for the higher oxidised samples. The bulkier tBC moiety causes sample precipitation and it also seems to impair good access to the oxidised residues lowering the measured oxidation degree. The viscosity studies revealed how the dextran oxidation degree can limit the concentration used. However, for diluted dexOx solutions, the lower molecular weight, counterbalances the oxidation eect, decreasing the viscosity. The characterised hydrogels have a dual cross-linking control method, which lies on the dextran OD and the amount of AAD used. The OD allows a given percentage of residues to serve as reactive points to molecules such as AAD. The amount of AAD used is crucial in dening the gelation period, mechanical properties and dissolution prole of

87

Chapter 5

Oxidised Dextran-Based Hydrogels

the hydrogels. It should be within the same range of the amount of oxidised residues present in dextran, to avoid forming dangling ends, and not valid mechanical cross-links. On the cytotoxicity assay, the dierent dextran oxidation degrees tested were successful in promoting cell adhesion and growth. However, with the increasing oxidation, the cells took longer to proliferate in the hydrogels. Oddly, the metabolic activity, measured by the MTS assay, showed very high levels of activity for the higher oxidised hydrogels, not corresponding to the cellular proliferation observed. The proposed and studied system aims at providing a sustainable drug delivery device to the posterior part of the eye, which requires a single injection, but does not require further surgery on the removal of the device. The designed formulation is expected to dissolve and be eliminated naturally by the organism.

88

6. Dextran-Based Microgels
6.1. Abstract
The use of micro or nano drug carriers in biomedical applications is an extremely attractive approach, in order to circumvent the commonly associated issues with drug delivery. This chapter reports the use of an all-aqueous methodology to prepare degradable dextran-based microgels of variable sizes by the cross-linking of oxidised dextran with adipic acid dihydrazide. The size and polydispersity of microgels is deeply aected by the concentration of adipic acid dihydrazide as assessed by scanning electron microscopy. The light scattering analysis revealed monodispersed populations with sizes above 100 m and slightly dependent of the dextrans oxidation degree. The continuous phase has a strong inuence on the polydispersity of the microgels.

6.2. Introduction
Microgels, in the same way as hydrogels, are networks prepared from hydrophilic polymeric materials, which are cross-linked in several dierent ways, to avoid dissolution of the polymeric chains into solution [100]. Microgels oer an interesting platform as the basis of a drug delivery system due to their high water content and good biocompatibility. These systems nature allow polymer-based drug conjugation or simply drug entrapment into the network, which couples perfectly with the tuneable microsphere size, surface area/volume ratio and release time-prole [312]. The polysaccharide nature, dictates the processing techniques that can be used in order to achieve a target nal application. However, these natural-origin polymers are quite versatile, and their structure can be modied and tuned with extra functionalities [313], broadening the range of processing techniques able to manipulate the polymers. Oxidised-dextran (dexOx) is easily obtained after periodate oxidation and yields a shorter

89

Chapter 6

Dextran-Based Microgels

dextran chain with aldehyde functionalities [14], which are extremely reactive towards N-nucleophiles [29]. The most common application has been in drug conjugation, which can be called 1D processing, where small molecules [66, 7] but as well proteins [47] have been studied for improved drug delivery. A 2D processing has also been approached, best exemplied by the coating of aminated surfaces [109, 111, 112] and nally, the 3D processing, in structures such as hydrogels, where a dexOx solution can be cross-linked with several dierent substrates [14, 35, 30, 104]. Apart from hydrogels, dexOx has not been involved in many dierent 3D micro-processing. Some of the few existing studies integrate oxidised modied dextrans. Methyl polyethylene glycol (MPEG) modied dextran, for example, that after oxidation, cross-linked with human albumin in a water/acetone mixture to yield nanospheres, with narrow size distribution and under 200 nm diameter [107]. Oxidised sulfopropyl dextran microspheres for the delivery of mitomycin C were also successfully achieved [73, 74]. Another study, used oxidised dextran modied with cholic acid, hydrophobic core, to promote self-aggregation in nanomicelles [71]. However, simple dexOx has only been used as a cross-linker, in the case of gelatine, to prepare microspheres as carriers of pingyangmycin [70] and polyamidine TAPP-Br [106], interestingly, both studies obtained mean diameter sizes shy of 100 m.

Figure 6.1.: Oxidised dextran and adipic acid dihydrazide reversible cross-linking reaction The formulation of oxidised dextran cross-linked with AAD has the potential of being injectable, and it has the capacity to form a hydrogel within a few minutes without requiring the use of a chemical initiator (Fig. 6.1) [14]. The hydrogel eventually dissolves, in variable periods of time, depending on the dextran oxidation degree; the AAD feed concentration or environment conditions, such as pH. Therefore, we intended to adapt the components of this hydrogel formulation, and broaden the range of techniques, able to process this system. An all-water emulsion technique was preferred over other emulsion techniques, specially the organic/aqueous emulsions, where protein aggregation can occur at the aqueous/organic interface [314, 315]. This is an important aspect if a

90

6.3 Materials and Methods protein drug, should be carried by such system. This water/water approach has only been used with formulations involving cross-linking by radical polymerisation [316]. We chose the method described by Henninks group, where an all-aqueous system is used, taking advantage of the polymer-polymer immiscibility due to a thermodynamic constraint. In a ternary system consisting of two water-soluble polymers and water, liquidliquid phase separation can occur. From a thermodynamic point of view, phase separation in these systems occurs when the change in Gibbs free energy is positive [317, 318, 319]. To the best of our knowledge, we will approach this emulsion technique, with a self-gelling and initiator-free system, for the rst time.

6.3. Materials and Methods

6.3.1. Materials
Polyethylene glycol (PEG; 20 kDa) was obtained from Merck Schuchardt. PEG (6 kDa) (Fluka), Polyvinyl Alcohol (PVA; 13 to 23 kDa), Dextran (from Leuconostoc mesenteroids; Mw 60 kDa, according to Flukas specication), sodium periodate, adipic acid dihydrazide (AAD), ethyl carbazate (EtC), phosphate buered saline (PBS), Tween 60, dialysis tubes with a MWCO ~12 kDa were purchased from Sigma Aldrich (Sintra, Portugal). All the reagents were used as received.

6.3.2. Preparation of Microspheres

Dextran with several oxidation degrees were prepared and characterised as described elsewhere [35]. The dexOx samples used, have oxidation degrees of 8.6 0.2 (D10), 22.2 0.7 (D25) and 33.0 0.8 (D40) as calculated by 1 H-NMR using EtC as titrant. Typically, a 25% (w/v) PEG or PVA solution was used as the continuous phase (CP), with AAD in the concentration range of 0.01 to 10 g/mL. The dexOx solution (20% w/v) was used as the discontinuous phase (DP), either with or without Tween 60 (2% dexOx weight). On a rst formulation screening, a capped reaction tube was lled with 10 mL of the CP and 250 L of the DP were added. The system was vortexed at maximum speed allowed for 60 seconds. The system was let to rest for 10 -15 minutes and then centrifuged at 5000 rpm for 5 minutes. The supernatant was discarded and the pellet was washed with PBS three times before being freeze-dried. The upscale was performed

91

Chapter 6

Dextran-Based Microgels

with a 100 mL round-bottom vial with 3 entries. The stirring was provided by a homemade inox stirrer, and a Heidolph rotor (model RZR1). The CP and DP compositions respected the same concentrations and weight ratios as on the initial screen, described above. The microgels were collected on the same way as described before.

6.3.3. Scanning Electron Microscopy and Particle Sizing Analysis

Freeze-dried microparticles, were mounted into an aluminium stud and gold coated by plasma vapour deposition and were recorded by a eld emission scanning electron microscope (JEOL model JSM-5310), at 15.0 20.0 kV. Particle size distribution was performed with a COULTER LS 130 (Coulter Electronics) standard bench.

6.4. Results and Discussion

The mixing reaction of dexOx and AAD solutions is characterised as being fast, depending on the feed concentration of the reactive species [35]. Therefore, the production of microgels had to take this aspect into account on the expectation that it would not perturb signicantly the phase separation. We observed that when AAD was formulated within the discontinuous phase (DP), a better phase separation occurred. After establishing the best system conguration we screened the AAD concentration, oxidised dextran OD and the surfactant presence. Based on the work of Henninks group [317, 318, 319] we prepared a continuous phase (CP) composed of 6 kDa PEG dissolved in PBS to 25% w/w. The DP was composed with dexOx dissolved in PBS (20% w/w) plus AAD. After adding the DP, a turbid solution was formed, suggesting the phasing out of the microgels. With AAD above this concentration range, aggregates could be seen with the naked eye, indicating the formation of macrogels. Within the concentration range chosen, a homogenous turbidity was always observed. The SEM visualisation (Fig. 6.2) of the freeze-dried microgels elucidated the extreme importance of AAD on the microgels size. Not only the microgels sizes decreased directly with the AAD concentration, but the homogeneity in sizes also improved. Because microgels tend to aggregate and form networks, we evaluated the eect of the addition of Tween 60 during their preparation. Previous studies have reported that the addition of a surfactant could avoid this phenomena [248]. According to Fig. 6.2, Tween 60 had little eect in the stabilisation of microparticles. These results suggest

92

6.4 Results and Discussion

Figure 6.2.: Freeze-dried microparticles morphology with varying concentrations of AAD in PEG continuos phase, in the presence or not of Tween 60, as the surfactant. Bar corresponds to 10 m. that the aggregation of the microparticles might be due to the cross-linking of individual microparticles promoted by the adipic acid dihidrazide. Next we evaluated the inuence of oxidation degree of dextran as well as the composition of the two-aqueous system in the size of the microgels. The oxidation degree of dextran appeared to have a slight inuence on the particles sizes. There was a slight shift to larger average sizes with the lowest oxidised dextran (D10), which could be due to the less cross-linking points available (Fig. 6.3A). On the other hand, the highest oxidised

93

Chapter 6

Dextran-Based Microgels

Figure 6.3.: Dierential volume percentage for microgels synthesized with dierent oxidised dextrans in CP with PEG 6 kDa (a); and D40 microgels synthesized in dierent CP (b). Every CP presented 0.01 g/mL of AAD sample (D40) originated other populations with lower diameter sizes. Analysing the continuous phase, apart from PEG 6 kDa, we also tested a higher Mw PEG (20 kDa), but also a dierent synthetic polymer, PVA with ~10 kDa. The results suggest that the Mw increase of PEG, directly aected the microparticles polydispersity. PVA, however, promoted a less polydispersed sample (Fig. 6.3B). The sizes obtained by light scattering were considerably higher than the apparent sizes observed by SEM. We need to take into consideration that a few aspects might have inuenced this dierence. The SEM observed samples were in a freeze-dried state compared to the ones measured by LS, which were re-suspended in water and subjected to sonication. This phenomenon might be ascribed to the physical state of the nanoparticles when characterised by the two techniques: dry state for SEM and hydrated state for light scattering analyses. Similar dierences have been described elsewhere for peptide-coated self-assembled nanoparticles of poly(-amino ester) and DNA [252]. These microgels, should behave similarly with the previously characterised hydrogels therefore, some initial burst swelling is expected. The higher ratio surface/volume of the microgels should promote a faster uptake of water, which leads to the much higher particle sizes when in solution.

6.5. Conclusion
The results obtained, in this work, suggest that it is possible to obtain microgels based on oxidised dextran cross-linked with AAD, using this all-water emulsion system. Compared to other systems, we were able to avoid the use of chemical initiators, which reduce the

94

6.5 Conclusion amount of toxic components. We observed, that the cross-linker concentration, AAD, present on the continuous phase, is responsible for the particles size and homogeneity. As the concentration decreases, so does the particle size. Higher AAD concentrations should lead, not only to larger particles but also to higher microgels aggregation. The oxidation degree, also seems to aect the polydispersity of the microgels, but to a lower extension. The microgels, should behave similarly with the studied hydrogels, having dissolution time proles, dependent on the oxidation degree [35]. The type of polymer used on the continuous phase appears to have a relevant role. Both the polymer nature and the molecular weight were shown to aect the microgels polydispersity. Other excipients (e.g. surfactants) should be screened, to improve the microgels stability upon cryopreservation or freeze-drying. Further studies to evaluate the dissolution prole of this system and the eciency as carrier for small molecules with amine moieties or proteins should be performed.

95

7. Dual Pro-angiogenic Therapy Based on Hybrid Hydrogel Networks

7.1. Abstract
We present a hybrid hydrogel, where a VEGF-loaded matrix was combined with an endothelial cells-loaded brin matrix. Oxidised dextran was used as the basis for the matrix-bearing VEGF. Oxidised dextran conjugates to VEGF, through covalent imine bonds. The oxidation degree eect on VEGFs three-dimensional structure was evaluated by circular dichroism and the bioactivity was assessed by the stimulation eect on some VEGF receptor 2-mediated metabolic pathways. The VEGF release prole from oxidised dextran hydrogels was followed by radioactivity and ELISA. The dexOx hydrogels were entrapped in brin matrices loaded with endothelial cells and an inuence on gene expression and 3D cell organisation was observed which is dependent on the oxidation degree. We envision that these constructs might be benecial for the induction of a rapid pro-angiogenic response in ischemic tissues, as well as matrixes to drive the in situ dierentiation of vascular progenitor cells.

7.2. Introduction
Ischemic diseases such as myocardial infarction, chronic wounds and stroke, are the cause of high morbidity and have an important social impact on the western society. Two major angiogenic therapies are under study to treat patients suering from these diseases. One is based on the delivery of growth factors, such as, VEGF, placenta growth factor (PlGF) or FGF among others [135] and the second one takes advantage of cells,

97

Chapter 7

Pro-angiogenic Hybrid Hydrogels

such as EPCs [167]. In the rst group, VEGF has been extensively examined in the promotion of tissue vascularisation. Unfortunately, the bolus delivery of VEGF in phase II human clinical trials failed to demonstrate signicant benets in the approved end points [148]. The fast plasma clearance (19.1 5.7 mL/min/kg) and short half-life (33.7 13 min) of VEGF [164] are likely in the origin of the poor therapeutic ecacy observed [147, 320, 148, 135]. To overcome this issue, several polymeric matrices have been developed for the ecient delivery of VEGF [170]. The strategies range from simple VEGF diusion out of the gel [173], to delayed release due to VEGF anitybased interactions with the matrix [188] or due to covalent binding [137]. Overall, the spatio-temporal presentation of VEGF is essential for a proper therapeutic actuation [321]. Despite these advances, alternative therapeutic solutions are needed to potentiate the eect of VEGF in ischemic tissues and rapidly form blood vessels. The transplantation of vascular cells could be a potential platform for the quick formation of blood vessels after an ischemic insult. Indeed, several studies have demonstrated that the transplantation of EPCs or vascular cells, derived from umbilical cord blood stem cells, can increase signicantly the vascularisation of ischemic tissues. This was demonstrated in animal models of hindlimb ischemia [169, 206, 139, 207], myocardial ischemia [208, 209, 210] and diabetic chronic wounds [138]. Unfortunately, the survival of these cells is relatively low in the rst days of post-transplantation due to a combination of dierent factors, including oxidative stress or inammation. A three-dimensional scaold able to support the attachment of vascular cells and simultaneously deliver VEGF could be benecial for the development of more potent and rapid pro-angiogenic therapies. The combination of both platforms in a single matrix should meet several design criteria. First, it should support the attachment of vascular cells and allow their migration and organisation. Second, it should allow the delivery of VEGF at appropriate rates and concentrations. Although recent studies have reported the incorporation of pro-survival factors with vascular cells in the same matrix [322], it is dicult to decouple the growth factor delivery component from the cell-matrix component. Herein, we developed a new approach to integrate in the same three-dimensional hydrogel scaold a growth factor delivery system and a substrate able to support cell attachment and remodelation. Both components can be tailored separately to match dierent needs. VEGF was covalently conjugated to oxidised dextran and the immobilisation eciency, VEGF three-dimensional structure and bioactivity were characterised. We show that the oxidation degree of dextran has a tremendous impact on the presentation of VEGF to its natural cellular receptors, as evaluated by the eect on intracellular signaling molecules

98

7.3 Materials and Methods like Ca2+ , ERK and Akt. We further show that the crosslinking of these conjugates with adipic acid dihydrazide yield gels having variable VEGF release kinetics, depending on the OD of dexOx. The incorporation of these VEGF-releasing systems within brin hydrogels containing endothelial cells, showed a pro-survival eect dependent of the OD of the dexOx hydrogels, as observed by contrast phase microscopy and qRT-PCR.

7.3. Materials and Methods

7.3.1. Materials
Adipic acid dihydrazide, EtC, dextran (from Leuconostoc mesenteroides; Mw 60 kDa, according to Flukas specication), NaBH3 CN (Fluka), dialysis tubes (MWCO of 12 kDa), human brinogen, human thrombin, phosphate-buered saline (PBS), Tris-buered saline (TBS), Histopaque-1077 Hybri Max, rhodamine B isothiocyanate (TRITC), serum free medium 199 and Pluronics F127 and oligonucletides used as primers in qPCR were purchased from Sigma. Endothelial growth medium (EGM-2) and human umbilical vein endothelial cells (HUVEC) were purchased from Lonza. Slide-a-lyzer (10 kDa) was acquired from Thermo Scientic. N-Succinimidyl-[2,3-3 H] Propionate (3 HNSP; 1 mCi/mL with specic activity of 80 mCi/mmol) was purchased from Scopus Research. scintillation liquid Ultima Gold XR purchased from Perkin-Elmer. DuoSet ELISA kit from R&D Systems. Fura-2AM was purchased from Molecular Probes. Phosphoprotein assay kit was purchased from Biorad. Taqman Reverse transcription reagents and Power SYBR Green PCR Master Mix were from Applied Biosystems. The RNeasy Mini Kit was purchased from Qiagen. CaCl2 was acquired from Merck. DiI-Ac-LDLwere purchased from Biomedical Technologies. The mini-MACS immunomagnetic separation system was purchased from Miltenyi Biotec. Fetal bovine serum, Trizol reagent, Fibrinogen - Alexa Fluor 488 conjugate and the LIVE/DEAD kit were purchased from Invitrogen.VEGF was a kind gift of Genentech, Inc, South San Francisco, CA. All materials were used as received.

7.3.2. Dextran Oxidation and Characterisation

An aqueous solution of dextran (1 g; 12.5%, w/v) was oxidised with 2 mL of sodium periodate solution with dierent concentrations (33 165 mg/mL) to yield theoretical

99

Chapter 7

Pro-angiogenic Hybrid Hydrogels

oxidations from 5 to 25%, at room temperature. The reaction was stopped after 4 hours. The resulting solution was dialysed for 3 days against water, using a dialysis tube with a MWCO 12 kDa, and then lyophilised (Snidjers Scientic type 2040, Tillburg, Holland). The scale-up of the reaction was done using the same procedure albeit using 30 g of dextran and a calculated amount of periodate to yield a theoretical oxidation of 5, 10 and 25%, referred as D5, D10 and D25, respectively. The real oxidation degree (OD) was quantied by 1 H NMR (Varian 600 NMR spectrometer, Palo Alto, CA) using EtC as a titrant and taking into account the ratio between the integral of the peak at 7.3 ppm and the integral of the anomeric proton at 4.9 ppm. The spectra were analysed with iNMR software, version 2.3.3 (www.inmr.net).

7.3.3. VEGF Labelling

The N-Succinimidyl-[2,3-3 H] Propionate (3 HNSP) solution was transferred to a glass vial with a rubber stopper and the airspace was ushed with N2 , to allow evaporation of the ethyl acetate. A PBS-dialysed solution of VEGF with 2.54 mg/mL was moved to the 3 HNSP vial and stirred magnetically, at room temperature, for 4 hours. The solution was transferred to a slide-a-lyzer cassette (10 kDa) and dialysed against PBS. The resulting absorbance at 276 nm (vegf = 0.37) revealed a 2.13 mg/mL VEGF-3 H solution. The estimated radioactivity is 1.33 0.07 mCi/mmol of VEGF. The samples were mixed with scintillation liquid and the scintillation counts were read on a PerkinElmer Tri-Carb 2900T Liquid Scintillation Analyser.

7.3.4. Characterisation of VEGF Conjugates by Gel Electrophoresis

The SDS-PAGE was performed on a 12.5% polyacrylamide gel and 0.75 mm thick. Approximately 5 - 10 g of protein was loaded into each well, after denaturing for 5 minutes at 95 C. The samples were run at 200 V and later revealed with Comassie Blue. The loaded samples consisted of VEGF or mixtures between VEGF and the several dextrans at 100-fold weight excess of dextran or the dierent dexOxs. In onne case D25VEGF sample was reduced with an VEGF equimolar amount of NaBH3 CN.

100

7.3 Materials and Methods

7.3.5. Characterisation of VEGF Conjugates by Circular Dichroism

Far-UV circular dichroism (CD) spectra were collected using a Olis DSM 20 spectropolarimeter equipped with a Peltier temperature controller. Protein samples (~0.6 mg/mL) were analysed at 37 C in a quartz cuvette with a 0.2 mm path-length. Spectra were collected at resolution of 1 nm with 4 seconds of integration time with a bandwidth of 0.6 mm. To monitor changes in the secondary structure of VEGF bound with dexOx, CD spectra were obtained for VEGF in the presence of a 100-fold weight excess of dextran or the dierent dexOxs. Spectra for VEGF bound with dextrans were background corrected with respect to the same dextran in buer.

7.3.6. Evaluation of VEGF Conjugates Bioactivity

HUVECs (passage 7) or endothelial cells (derived from CD34+ umbilical cord blood cells [138]) were cultured in EGM-2 medium at 37 C and 5% CO2 until sub-conuence was achieved. The cells were tripsinized and plated into an opaque 96-wells plate (Costar) with an initial seeding of 30,000 cells per well. After reaching sub-conuence, they were kept in starvation for 20h in M199. The medium was discarded and the wells were loaded with Fura-2 calcium uorescent indicator by incubation with 5 M of the membrane permeable acetoxymethyl (AM) derivative FURA-2/AM (1 mM in DMSO, Molecular Probes, Invitrogen) and 0.06% (w/v) Pluronic F-127 (Sigma), using basal medium (M199, Sigma) as a vehicle (35 l/well, not supplemented with serum nor antibiotics), for 1 hour at 37 C in 5% CO2 and 90% humidity. Cells were washed twice with sodium salt solution (140 mM NaCl, 5 mM KCl, 1 mM MgCl2 , 10 mM glucose, 10 mM HEPES Na+ pH 7.4) and once again before testing each condition. The reading was performed at 25 C (Spectramax Gemini EM, Molecular Devices, with SoftMax Pro Software), by measuring emission at 510 nm using two alternating excitation wavelengths (340 and 380 nm). Cells were stimulated with 2 L of VEGF, D25-VEGF and D25-VEGF (cyanoborohydride reduced) solutions to yield a 100 ng/mL nal concentration of VEGF and 1000-fold more of D25, when present (n=4). Activation of Akt and extracellular signal-regulated kinase (ERK) in HUVECs (80% conuency, in 6 well plates) was induced by starving the cells for 20 h in serum-free M199 medium (with Earles Salts and Lglutamine; Sigma-Aldrich) [157] and then treating them for 10 minutes, by replacing the medium by fresh M199 containing VEGF or VEGF conjugates. Following treatment, the

101

Chapter 7

Pro-angiogenic Hybrid Hydrogels

plates were immersed on ice and the medium discarded. Then the proteins were isolated from the cells (total protein concentration of 220-300 g/mL) using the Bio-Plex Cell Lysis kit (Bio-Rad) and the levels of Akt and ERK phosphorylation were determined using a Bio-Plex kit (Bio-Rad), according to manufacturers recommendations.

7.3.7. Release of VEGF from DexOx Hydrogels

The D25 was dissolved in aqueous solvent (PBS) to obtain a 20% (w/w) and stored at 4 C if not used immediately. The hydrogels were produced by mixing thoroughly 100 L of D25 and 100 L of AAD, with dierent concentrations. The AAD concentration used was calculated based on a given molar percentage of dextran residues. The hydrogels were let to cure for never less than 2 hours and the swelling was performed in 24-wells cell culture plates immersed in 1 mL of PBS at 37 C. At regular time intervals, the hydrogels were removed from the aqueous solution, blotted in lter paper, weighted (Wt ) and returned to the original well while the buer was replaced. For the in vitro studies, VEGF or VEGF-3 H were added to the D25 solution or the AAD 10% solution, to obtain a 0.2 mg/mL nal concentration, delivering 20 g of VEGF, per hydrogel. The VEGF release study was performed in the same conditions as the swelling study. At regular time intervals, the immersion media was collected and saved and replaced by new media. The released VEGF was quantied either by ELISA or scintillation.

7.3.8. Hybrid Hydrogels of DexOx and Fibrin

DexOx hydrogels were prepared on top of the plungers of 1 mL sterile syringes with cut tips and were let to cure for 2 hours. They were later washed with PBS (three times) and let in contact with brinogen solution for 30 minutes. The hydrogels were later covered with mixed brin gel precursor solution to yield a hydrogel. The 10 L dexOx hydrogels were prepared with D5, D10 (30% w/w)chapter 5 and D25 (20% w/w) with 10% crosslinking degree of AAD. When required, VEGF was added to the feed solution of dexOx or AAD, at 20 g/mL, before the preparation of the hydrogels. Endothelial cells (induced from CD34+ UCB isolated cells, as described elsewhere [138]) were delivered in the brin hydrogels as previously described [138]. Fibrin gels were formed by crosslinking of brinogen in the presence of thrombin. The 50 L brin gels contained 10 mg/mL brinogen (in TBS, pH 7.4), 2 U/mL thrombin and 2.5 mM CaCl2 . CD34+ -derived

102

7.3 Materials and Methods ECs (0.35 105 ) were centrifuged, ressuspended in the brin gel precursor solution and transferred to the syringes containing the dexOx hydrogels. Polymerisation was initiated at 37 C and allowed to proceed over 30 minutes. After polymerisation, the cell constructs were removed from the syringes and placed in 96-well plates containing culture medium identical to EGM-2 but without VEGF (unless otherwise stated), for up to 6 days. After 6 days, the live cells were counted and enough hydrogels were saved and stored at 80 C for posterior analysis. DexOx (D25) modied with TRITC and brinogen conjugated with Alexa uor 288 were used to prepare uorescent hydrogels. To 100 L of D25 (20% w/w) was add 1 L of 10 mg/mL of TRITC in DMSO and the nal solution was diluted 100-fold in D25 (20% w/w) solution, before crosslinking with AAD (20%). The Alexa uor conjugated brinogen was resuspended to 20 mg/mL in TBS buer (pH 7.4) and diluted 1000-fold with a plain brinogen solution (20 mg/mL). The hybrid hydrogels were prepared between glass slides for visualisation under the uorescence microscope. A Zeiss Axiovert 200M uorescence inverted microscope with 1.25x and 5x objectives was used. Endothelial cells stained with Hoechst were encapsulated in the brin hydrogel.

7.3.9. Viability of Encapsulated Endothelial Cells

Cell viability was determined using a LIVE/DEAD kit. The gels containing the encapsulated cells were washed in PBS, immersed in a working solution of 2 g/mL calcein AM and 4 g/mL ethidium homodimer-1 in PBS for 30 minutes at 37 C and visualised under a Zeiss Axiovert 200M uorescence inverted microscope. The statistical signicance was determined by using one-way ANOVA followed by Dunnetts post hoc test for comparison with control, with P < 0.05 considered to represent statistical signicance.

7.3.10. Quantitative Real time Reverse-Transcription Polymerase Chain Reaction

Cell constructs were collected at day 6 and stored at 80 C until further use. Cell constructs were disrupted in Trizol reagent in 2 mL tubes containing a 5 mm diameter stainless steel bead (Qiagen), in a TissueLyser II aparatus (Qiagen) for 2 min, at 30 Hz. Total RNA was isolated by using the RNeasy Mini Kit, according to manufacturers instructions. cDNA was synthesized from 1 g total RNA using Taqman Reverse

103

Chapter 7

Pro-angiogenic Hybrid Hydrogels

transcription reagents. Quantitative PCR (qRT-PCR) was performed using Power SYBR Green PCR Master Mix and the detection was carried out in a 7500 Fast Real-Time PCR System (Applied Biosystems). Quantication of target genes was performed relatively to the reference gene (GAPDH): relative expression= 2[(C t sampleCt GADP H)] [323]. The mean minimal cycle threshold values (Ct ) were calculated from four to six independent reactions. The primer sequences can be found on Tab. 7.1. Table 7.1.: Primer sequences used for rtPCR. Target Gene Human GAPDH Human VEGF Human Flk-1 Human MMP2 Human MCP-1 Primer Sequence Forward: AGCCACATCGCTCAGACACC Reverse: GTACTCAGCGCCAGCATCG Forward: AGAAGGAGGAGGGCAGAATC Reverse: ACACAGGATGGCTTGAAGATG Forward: CTGGCATGGTCTTCTGTGAAGCA Reverse: AATACCAGTGGATGTGATGGCGG Forward: CCCAGAAAAGATTGACGC Reverse: CGACAGCATCCAGGTTAT Forward: CCCCAGTCACCTGCTGTTAT Reverse: TGGAATCCTGAACCCACTTC

7.3.11. Statistical Analysis

For the cell viability and the qRT-PCR analysis a paired t test was used. Results were considered signicant when P 0.05. GraphPad Prism 4.0 (San Diego, CA) was used.

7.4. Results and Discussion

7.4.1. VEGF Conjugation to DexOx
The periodate ion attacks vicinal diols in dextran, between carbons C3 - C4 or C3 - C2 , breaking the C - C bond and yielding aldehyde groups. The oxidation degree of dexOx was determined by 1 H-NMR after titration with ethyl carbazate (chapter 5). The dexOx samples, D5, D10 and D25, used in this study, have an OD of 3.6 0.1, 8.6 0.2 and 17.8 1.2, respectively. The dexOx derivatives were then conjugated with VEGF to have a nal mass ratio of 100-fold. The conjugation of VEGF to dexOx is mediated by imine bonds (Schi base) [48]. The reversible imine bond can then be reduced to an amine,

104

7.4 Results and Discussion an irreversible and stable bond, by sodium cyanoborohydride. The presence of VEGF in both dexOx-VEGF conjugates (non-reduced and reduced forms) was characterised by SDS-PAGE (Fig. 7.1A). In this case, the presence of unconjugated VEGF contributes for a band with an electrophoretic mobility at approximately 40 kDa (lane 1), while conjugated VEGF contributes for bands with an electrophoretic mobility above 40 kDa (lanes 2-4), likely depending in the degree of VEGF immobilisation into each polymer chain. Solutions of non-oxidised dextran with VEGF (lane 5) and VEGF reduced with NaCNBH3 (lane 6) were used as controls to demonstrate that the presence of dextran or the reducing activity of NaCNBH3 does not aect the electrophoretic mobility of unconjugated VEGF, respectively.

Figure 7.1.: Conjugation of oxidised dextran to VEGF followed by SDS-PAGE (A). vegf (1); D5-vegf (2); D10-vegf (3); D25-vegf (4); dextran + vegf (5); reduced vegf (6); reduced D25-vegf (7); D25 (8); (B) Schematic representation of dextran oxidation and subsequent immobilization of VEGF. According to Fig. 7.1A the conjugation of VEGF to dexOx without reduction with sodium cyanoborohydride is directly proportional to the OD in dexOx (lanes 2 - 4). The image analysis (ImageJ) revealed an amount of free protein of 32.6 %, 15.5 % and ~ 0 % for the D5, D10 and D25 conjugates, respectively. The presence of free VEGF in D5 and D10 conjugates might be due to two dierent reasons. First, dexOx with low oxidation degree might be unable to immobilise chemically all the VEGF added initially to the polymeric

105

Chapter 7

Pro-angiogenic Hybrid Hydrogels

solution. Second, because dexOx with low oxidation degree immobilises VEGF by a low number of attachment points, the biomolecule might be released overtime due to the instability of imine bonds. The absence of free VEGF in D25 might be due to the slow dissociation of VEGF from dexOx due to multi-point attachment. In line with our results, the conjugation of VEGF into dexOx with high OD (D25) and subsequent reduction with sodium cyanoborohydride yields a conjugate with complete immobilisation of VEGF (lane 7).

7.4.2. Structure Stabilisation of VEGF

We investigated the three-dimensional (3D) structure of VEGF chemically immobilised into dexOx by circular dichroism (CD). Previous studies have shown that in most cases the chemical immobilisation of proteins into dexOx does not aect its native structure and activity [48] even at wide temperature ranges [84]. The CD spectra of either reduced or non-reduced D25-VEGF conjugates showed comparable 3D structural organisation as unconjugated VEGF (Fig. 7.2A). There was a decrease in the intensity of the 204 nm peak, either for the reduced VEGF or reduced D25-VEGF conjugate. As cyanoborohydride does not reduce disulphide bridges (lane 7, Fig. 7.1A) [324], a drastic secondary structure change is not expected. This might be due to dierences in protein concentration. Any potential interference in the 3D VEGF structure was expected to promote shifts in the absorption band of the spectrum. However, the denaturation of VEGF by temperature, did not aect the overal spectrum, except after reaching 90 C, where a peak shift occurred to approximately 200 nm. With the temperature increase, protein precipitation was observed, which was reected on a decrease in intensity (Fig. 7.2B). Other denaturation conditions failed to be observed by CD, due to the high amount of necessary salts, which interfere in the absorption spectrum. Next, we estimated the secondary structure of VEGF chemically immobilised into dexOx by tting the CD data with CONTIN software. The secondary structure percentages were estimated taking in account the number of residues assigned to each structure (helix and -strand) reported in previous studies. One study characterised the fragment corresponding to the KDR-binding domain (95 residues; 2VPF from Protein Data Bank) [325] and other characterised the heparin-binding domain (55 residues; 2VGH from Protein Data Bank) [326] fragment of VEGF). All the other residues were considered to be random coil for a total of 165 residues (Tab. 7.2). According to Tab. 7.2, an increase of 7% on the -helixes and a decrease of 6% on the

106

7.4 Results and Discussion -sheets content were observed on D25-VEGF conjugate as compared to the original VEGF.

Figure 7.2.: (A) Circular Dichroism spectra of VEGF; D25-VEGF; reduced D2-VEGF; reduced VEGF at 25 C. (B) Circular Dichroism spectra of VEGF at increasing temperatures. * Spectrum at 25 C after decreasing temperature from 90 C. However, this result might be aected by the high absorbance observed on the infrared window of the spectrum, likely interfering with our t curve. Interestingly, the reduction of D25-VEGF by cyanoborohydride reverted this shift up to normal percentual values. This could be due to an increase in rigidity of the conjugate, possibly promoted by the Table 7.2.: Estimation of rhVEGF secondary structure percentage from circular dichroism.
Entry VEGF1 VEGF VEGF reduced D25 + VEGF D25 + VEGF reduced -helix (%) 11-12 14 15 21 14 -sheet (%) 37-41 39 36 33 37 Unordered (%) 48-51 47 48 46 49 SDE Ref. PDB; [325, 326]

0.01 0.01 0.01 0.01

1 - Based on crystallography and NMR studies [325, 326]; 2VPF and 2VGH les from the Protein Data Bank. Both estimations considered 165 residues

increasing number of links within the conjugate [33], maintaining the original conforma-

107

Chapter 7

Pro-angiogenic Hybrid Hydrogels

tion. On the other hand, the reversible character of the imine bonds in the non-reduced D25-VEGF conjugate might promote some changes in the 3D VEGF structure, explaining the higher deviations observed for this sample. Overall, the 3D structure of VEGF is substantially not aected by the chemical conjugation to dexOx.

7.4.3. Intracellular Ca2+ Uptake in Endothelial Cells

To assess the bioactivity of VEGF conjugated to dexOx we evaluated its ability to induce an increase in intracellular Ca2+ [327] mediated by the activation of VEGF receptor 2 [142, 328]. Initially, we tested the ability of VEGF conjugates to induce an increase of intracellular Ca2+ in HUVECs. Previous results have shown that free VEGF activates the transient increase in cytosolic calcium in HUVECs through VEGFR2 [329]. This calcium is released initially from intracellular Ca2+ stores and only after is due to extracellular calcium inux [329].

Figure 7.3.: Intracellular Ca2+ uptake as determined by Fura-2-loaded HUVECs. (A) VEGF dose-dependent Ca2+ uptake (blue dots; VEGF concentration in ng/mL). (B) Changes in the concentration of intracellular Ca2+ in the presence of the dierent dexOx-VEGF conjugates (green dots; VEGF at 100 ng/mL). Histamine (100 M) and BSA (1%, w/v) were used to set the limits (100% and 0%, respectively) and normalized the experimental data of Ca2+ uptake (n = 4 8). In this work, HUVECs were cultured in serum-free medium for 20 hours to reduce the inuence of VEGF present in the serum and loaded with a uorescent dye to monitor the intracellular concentration of Ca2+ . As a rst step, cells were activated by dierent

108

7.4 Results and Discussion concentrations of free VEGF to determine a dose response prole (Fig. 7.3A). Histamine and BSA were used to set the range of Ca2+ uptake. The administration of VEGF induces an increase in Ca2+ uptake (rst 5 minutes), followed by a plateau phase where Ca2+ remains constant for the remaining of the experiment. In line with previous studies [327], the levels of cytosolic Ca2+ increased in direct correlation with an increase of VEGF concentration. The VEGF concentration decrease also promoted a rate decrease on Ca2+ uptake.

Figure 7.4.: Intracellular Ca2+ uptake as determined by Fura-2-loaded endothelial cells derived from cord blood stem cells. (A) VEGF dose-dependent Ca2+ uptake (blue dots; VEGF concentration in ng/mL). (B) Intracellular levels of Ca2+ mediated by VEGF conjugates (D25-VEGF, D10-VEGF and D5-VEGF). (C) Intracellular levels of Ca2+ mediated by VEGF cyanoborohydride-reduced conjugates (D25-VEGF, D10VEGF and D5-VEGF). The concentration of VEGF conjugate assessed in these assays corresponds to a concentration of 100 ng/mL of VEGF (n = 4 8).

109

Chapter 7

Pro-angiogenic Hybrid Hydrogels

Next, we evaluated the inductive eect of dierent dexOx-VEGF conjugates in the intracellular concentration of Ca2+ (Fig. 7.3B). For that purpose, HUVECs were stimulated with VEGF conjugates having a concentration of 100 ng/mL VEGF . Interestingly, D25VEGF induces an initial increase of intracellular Ca2+ corresponding to the eect of 25 ng/mL of free VEGF, reaching a plateau after 7-8 minutes with a similar intracellular Ca2+ concentration, as observed for 100 ng/mL of free VEGF. Our results indicate that although D25-VEGF loses approximately 75% of the initial induction eect (taking into account that D25-VEGF has 100 ng/mL of VEGF), the later response is similar to 100 ng/mL VEGF. The D5- and D10-VEGF conjugates have similar Ca2+ activation proles. Both conjugates induce an initial increase of intracellular Ca2+ corresponding to the eect of free VEGF between 50 and 100 ng/mL, reaching the plateau after 7-8 minutes with an intracellular concentration of Ca2+ that is slightly lower than the one observed for 100 ng/mL of free VEGF. The dierences found in the initial intracellular Ca2+ proles between unconjugated and conjugated VEGF might due to the accessibility of VEGF to interact with its receptors. It is likely that only part of the immobilised VEGF in all three conjugates will activate VEGF receptor due to conformational barriers; however, the conjugates could maintain their activation for long time without the complex ligandreceptor being internalised and eliminated by the cell. The same eect was observed with CD34+ -derived endothelial cells. The dexOx conjugation to VEGF, reduced the Ca2+ activation prole and this reduction was dependent on the OD (Fig. 7.4B). The reduction on calcium uptake was not so drastic, as observed earlier for the HUVECs, which might be due to the dierences between both kinds of cells and the density of VEGF receptors at the cell surface ([138]). Again, the higher the OD, the more imines are formed between the dexOx and VEGF, which is more extensive in the case of D25. The reduction of the conjugate, to non-hydrolisable amine bonds, with cyanoborohydride, further reduced this calcium uptake. This eect is more expressive with D25, strongly inhibiting the bioactivity of VEGF (Fig. 7.4B&C). The Ca2+ uptake reduction was less pronunciated with D10 (Fig. 7.4B&C) and D5 (Fig. 7.4B&C), suggesting the higher conjugate lability on these two last conditions.

7.4.4. Phosphorylation of Akt and ERK in Endothelial Cells

To further conrm the activation of endothelial cells by D25-VEGF, the activation of Akt [157] and ERK [330, 331] (downstream eectors of VEGF signaling pathway), were evaluated by protein analysis. In this case, HUVECs were starved for 20 hours in serum-

110

7.4 Results and Discussion free M199 medium and then treated for up to 20 minutes with M199 medium containing VEGF or D25-VEGF conjugate. The levels of phosphorylated and total Akt and ERK proteins were determined using a Bio-Plex kit. A VEGF concentration of 100 ng/mL was used in all experimental groups. VEGF increased Akt phosphorylation as early as 5 minutes and produced a maximal eect at 15 minutes (Fig. 7.5A), declining thereafter. The same samples were evaluated for the activation of ERK1/2 signaling pathway (Fig. 7.5B). The activation of ERK1/2, a mediator in the mitogen-activated protein kinase (MAPK) cascade, may promote cell proliferation [331] or cell survival when cells are cultured under stress conditions [330]. ERK1/2 signaling was highly activated when HUVECs were exposed to VEGF.

Figure 7.5.: Phosphorylation pathways. (A) Akt and Erk expression (phospho/total protein ratio) throughout 20 minutes, after stimulation by VEGF (100 ng/mL) and 20 hours of starvation. Upper dashed lines represente the positive control: EGM-2; and lower dashed lines represent the negative controls: M199. (B) Erk phosphorylation ratio by soluble VEGF, D25-VEGF and D25-VEGF (reduced) at 10 minutes after stimulus, after 20 hours of starvation. All conditons presented VEGF at 100 ng/mL. Free VEGF increased ERK1/2 phosphorylation as early as 5 minutes (rst time point) followed by a decrease on the eect up to 20 minutes. A similar prole has been reported elsewhere for the activation of ERK by free VEGF [331]. As the ERK pathway was the most responsive under the studied conditions, the eect of non-reduced or reduced D25-VEGF conjugate was assessed. Importantly, cells exposed to unconjugated VEGF for 10 min have higher activation than non-reduced or reduced D25-VEGF conjugate (Fig. 7.5C). This is in line with the previous intracellular Ca2+ results. This is likely due

111

Chapter 7

Pro-angiogenic Hybrid Hydrogels

to the fact that VEGF conjugated to DexOx has decreased access to the VEGF receptor due to the physical restrictions exerted by the dextran polymer.

7.4.5. VEGF Controlled Release from Hydrogels

Next, we evaluated the release of VEGF from hydrogels prepared by the cross-linking of dexOx-VEGF with AAD. Considering that the terminal half-life of VEGF, after a 4-hour intravenous steady infusion, is around 30 minutes [164], the dexOx-VEGF-AAD hydrogels may be a valuable sustained delivery system of VEGF. Several formulations have been reported in the last years, for the sustained release of VEGF, based on the physical immobilisation of VEGF such as heparin-based hydrogels [188], dextran sulphate-based nanoparticles [203] and on the chemical immobilisation of VEGF to networks formed by collagen, PLGA and PEG [175, 176, 137, 195]. In this work, VEGF was chemically conjugated to dexOx (100-fold weight excess of dexOx to VEGF) and the remaining aldehyde groups reacted with AAD to form a gel. The gel was formed within minutes [14] depending on the feed concentration of dexOx and/or AAD. Several gel formulations were prepared based in D25-VEGF, dierent concentrations of AAD (10% and 20%), and dierent methodologies (addition of VEGF to the D25 or the AAD solution). Hydrogels with or without VEGF have similar dissolution proles. Hydrogels with low cross-linking density (5% AAD) are dissolved completely before the fourth day and were not further studied. Hydrogels with medium cross-linking density (10%) and containing VEGF have similar dissolution times as hydrogels without VEGF, however presenting a higher swelling prole (Fig. 7.6A). Hydrogels with high cross-linking density (20%) did not dissolve up to over 30 days (Fig. 7.6A). To determine the release of VEGF from hydrogels we used two methodologies: (i) quantication by ELISA and (ii) quantication by tritium (3 H-VEGF). We evaluated the release of VEGF in hydrogels having D25 and dierent cross-linking densities (10 and 20% AAD) and hydrogels where (i) VEGF was rst conjugated with dexOx and then cross-linked with AAD or where (ii) VEGF was added rst to AAD and then crosslinked with dexOx. The formulation where VEGF is conjugated to dexOx before gel preparation promotes higher levels of conjugation than when VEGF is conjugated during the preparation of the gel. ELISA results showed that only a tiny amount (< 4%) of VEGF is released from the gels (Fig. 7.6B). This is likely due to the fact that most of the VEGF released from

112

7.4 Results and Discussion

Figure 7.6.: (A) Swelling of D25 hydrogels crosslinked with 10% AAD, with ( ) and without ( ) VEGF, and D25 hydrogels crosslinked with 20% AAD with VEGF ( ). (B, C, D) Release of VEGF, as quantied by ELISA (B, D) or scintillation (C), from D25 hydrogels crosslinked with 10% AAD, in which VEGF was added in the dexOx solution ( ) or in the AAD ( ) solution, from D25 hydrogels crosslinked with 20% AAD ( ), from D10 hydrogels crosslinked with 10% AAD ( ), and from D5 hydrogels crosslinked with 10% AAD ( ). Results are average SD, n=3.

the gel is still conjugated to dexOx. The presence of dextran attached to VEGF will prevent its interaction with the antibody that recognises VEGF. In line with all this, when VEGF is released from gels where the biomolecule was incorporated in the network during its formation (mixed with AAD), therefore less conjugated to the network, the content of VEGF released is higher (up to 3.5% of the total VEGF incorporated in the network) than in the other experimental groups. When VEGF is rstly conjugated with dexOx and then used for gel preparation, only 0.1% of the total VEGF is released over 30 days (Fig. 7.6B). In a subsequent step, radio-labeled VEGF (3 H-VEGF) was used for the release studies (Fig. 7.6C). In contrast to the ELISA results, a signicant release

113

Chapter 7

Pro-angiogenic Hybrid Hydrogels

of VEGF was observed for all the experimental groups, showing that most of VEGF is conjugated with DexOx. The release of VEGF in gels with medium cross-linking density (10% AAD) peaks at day 5 corresponding to the total dissolution of the gel. The release of VEGF in gels with high cross-linking density (20%) is low (< 2%) for the rst 20 days and increases abruptly afterwards. Next, we evaluated VEGF release from D5 or D10-based hydrogels. In contrast to D25-VEGF hydrogels, D10 and D5-based hydrogels release high concentration of VEGF as assessed by ELISA (Fig. 7.6D). The D5 hydrogels degrade in less than 2 days and release approximately 30% of the initial VEGF over that time while D10-based hydrogels degrade in 4 days and release approximately 7% of the initial VEGF over the same time. The amount of VEGF identied by ELISA, may not account for the total real released drug, but it qualies as the active VEGF, as it was identied by anti-VEGF antibodies. The slow release of the VEGF, plus the protecting eect of the binded dexOx, could help establish a gradient within an optimal concentration range (0 - 10 ng/mL) [321], which could promote endothelial sprouting and a directional growth towards the hydrogel. The fact that dexOx remains conjugated to VEGF, after the release from the hydrogel, means that there is an extended protection which can prolong signicantly the life-time of VEGF.

7.4.6. Endothelial Cells Encapsulation in Hybrid Hydrogels Containing VEGF

The hybrid construct was formed by two components: (i) a hydrogel of dexOx-VEGF crosslinked with AAD and (ii) a brin hydrogel embedding the dexOx-VEGF hydrogel (Fig. 7.7A&B). The dexOx hydrogels containing VEGF (10 L volume) were prepared initially on a syringe plunger, after which a mixed aqueous solution of brinogen and thrombin (50 L in total) was placed on top of the dexOx hydrogel (Fig. 7.7A&B). Umbilical cord blood-derived endothelial cells, previously characterised by Pedroso et al. [138], were immersed in the brin gel precursor solution. These cells have a typical cobblestone morphology, express high levels of EC markers, including CD31, Von Willebrand factor (vWF), CD34 and Flk-1/KDR over time [138]. After the curing of the brin gel, the hybrid constructs were placed in EGM-2 media and incubated at 37 C. The constructs were monitored for six days by contrast microscopy and the cell viability was quantied by a live-dead assay at the 6th day(Fig. 7.7C).

114

7.4 Results and Discussion

Figure 7.7.: Hybrid hydrogels visualisation in a uorescence microscope. (A) Image of the whole hybrid hydrogel. DexOx hydrogel in red (TRITC) and brin hydrogel in green (Alexa 488). Scale bar 2 mm. (B) Image of the hybrid hydrogel dexOx/brin interface with cells stained with Hoechst (blue). Scale bar 200 m. (C) Cellular viability assessed by live/dead assay (P<0.05).

Figure 7.8.: Contrast phase images from endothelial cells encapsulated in the brin section of the hybrid hydrogels. All scale bars are 100 m. D5 hydrogels located within brin gels were completely degraded before the 6th day, while no macroscopic degradation was observed for the remaining hydrogels (D10 and D25). The survival of the ECs was high (> 80%) for all the experimental groups tested (Fig. 7.7). With the exception of gels containing D25, cell survival was higher for constructs with VEGF than without VEGF (P<0.05). These results demonstrate the cell pro-survival eect of VEGF. In addition, images obtained by light microscopy indicate that the release of VEGF within the hybrid gel induce a cord-like organisation

115

Chapter 7

Pro-angiogenic Hybrid Hydrogels

of the endothelial cells (Fig. 7.8). This eect was observed for constructs containing D5 and D10 hydrogels, but not D25 hydrogels. In addition, no visible network formation was observed in constructs containing D5 and D10 hydrogels without VEGF, suggesting that the formation of cord-like structures was mediated by VEGF.

Figure 7.9.: Genetic proling of endothelial cells after six days. The eect of VEGF in the encapsulated endothelial cells was evaluated by qRT-PCR analysis. We analysed the expression of VEGF and Flk-1 (VEGFR2 ), but also the matrix metallo-proteinase 2 (involved in the remodeling of ECM and cell migration and which has been shown to be stimulated by VEGF in vitro [332]) and MCP-1, an endogenous cytokine with chemotactic properties towards SMCs [333] and up-regulated when endothelial cells are exposed to certain conditions [334]. Gene expression in cells encapsulated in constructs with VEGF was normalized by the corresponding gene expression in cells encapsulated in brin hydrogels without VEGF. Interestingly, the expression of matrix metallo-proteinase 2 (MMP-2) was higher for gels that have the ability to release faster VEGF (D5 and D10). The constructs with D25-VEGF have no statistical significant upregulation of MMP-2 gene at day 6, as compared to the control. In addition, constructs that release faster VEGF induced a downregulation in the expression of the VEGF gene. Constructs with D25-VEGF hydrogels, that have no signicant release of VEGF over 6 days, have cells with an upregulation of VEGF and Flk-1 gene. Under these conditions, the cells need to secrete VEGF and to express VEGF receptor for survival. These constructs have cells that express high levels of MCP-1, a chemotactic protein, specic for SMCs, which would benet the survival of the ECs, by the segregation of EC-specic cytokines and growth factors [335].

116

7.5 Conclusion

7.5. Conclusion
We report a novel pro-angiogenic therapy based on a construct able to release VEGF at variable rates and support the attachment and organisation of endothelial cells derived from umbilical cord stem cells. These constructs allow tailoring the properties of the growth factor release system separately from the matrix encapsulating the cells. We show that the degree of oxidation in dexOx is very important to control the release of VEGF. DexOx with high degree of oxidation (D25) tend to form multi-point attachment with VEGF retarding its delivery. By circular dichroism we demonstrate that the 3D structure of VEGF is substantially not aected by the chemical conjugation to dexOx. We also show that the VEGF conjugates induce an increase of intracellular Ca2+ in endothelial cells and the induction prole is dependent on the degree of oxidation of the VEGF conjugate. We conrmed these results also by evaluating the phosphorylation of Akt and ERK proteins. Our results also indicate that dexOx-VEGF hydrogels can release between 1 to 45% of the total initial protein. Yet, most of the protein is released as a conjugate, accompanying hydrogel dissolution. We show that when dexOx-VEGF hydrogels are incorporated in a brin gel containing endothelial cells, the released VEGF (mainly for the low cross-linked hydrogels) can modulate gene expression and threedimensional cell organisation. We envision that these constructs might be benecial for the induction a rapid pro-angiogenic response in ischemic tissues, as well as matrixes to drive the in situ dierentiation of vascular progenitor cells.

117

8. Controlling the neuronal dierentiation of stem cells by the intracellular delivery of retinoic acid-loaded nanoparticles
8.1. Abstract
The manipulation of endogenous stem cell populations from the subventricular zone (SVZ), creates an opportunity to induce neurogenesis and inuence brain regenerative capacities in the adult brain. Herein, we demonstrate the ability of polyelectrolyte nanoparticles to induce neurogenesis exclusively after being internalized by SVZ stem cells. The nanoparticles are not cytotoxic for concentrations equal or below to 10 g/mL. The internalisation process is rapid and nanoparticles escape endosomal fate in few hours. Retinoic acid-loaded nanoparticles increase the number of neuronal nuclear protein (NeuN)-positive neurons and functional neurons responding to depolarisation with KCl and expressing NMDA receptor subunit type 1 (NR1). These nanoparticles oer an opportunity for in vivo delivery of proneurogenic factors and neurodegenerative diseases treatment.

8.2. Introduction
Several biomolecules have the capacity to dierentiate stem cells progeny towards desired lineage-specic precursors [336, 337, 213]. However, the administration of some of these bioactive factors presents a signicant challenge because of their poor water solubility, short half-life, and potentially undesired side eects. One example is retinoic

119

Chapter 8

Retinoic Acid-Loaded Nanoparticles

acid (RA) which interacts with members of the hormone receptor super-family, including the RA receptor (RAR) and the retinoid X receptor (RXR), located in the cell nuclei [262]. These receptors heterodimerise and bind to a DNA sequence called retinoic acidresponse element (RARE), activating gene transcription involved in cell proliferation, dierentiation and apoptosis. Many factors regulate neurogenesis and several studies have demonstrated that RA is able to induce the dierentiation of progenitor cells into neuronal cells [262, 338, 339], suggesting that this molecule is a good candidate for enhancing postinjury neurogenesis. However, RA is rapidly metabolized by cells and has low solubility in aqueous solutions [264]. In addition, the use of this biomolecule in an in vivo setting for the dierentiation of resident stem/progenitor cells remains elusive. Nanoparticles can be an excellent platform to ensure intracellular transport and controlled release of RA [266, 267, 340]. Several nanoparticle formulations have been developed for the release of this molecule [266, 267, 340]. However, until now none of the reported formulations was designed to deliver RA within cells, and particularly for the dierentiation of stem/progenitor cells. Nanoparticles can be internalised via endocytosis, macropinocytosis or phagocytosis, but these processes conne the compounds to closed vesicles (endosomes or phagosomes), where the pH is progressively lowered to 5.5-6.5 [271, 274]. Polycations, such as polyethylenimine, that absorb protons in response to the acidication of endosomes (i.e. cationic polymers with a pK around or slightly below physiological pH) can disrupt these vesicles via the proton sponge eect that promotes the swelling of the endosome in situ [56, 341]. Once the polymeric nanoparticles reach the cytosol, the bioactive molecule may be released by desorption, diusion through the nanoparticle or nanoparticle erosion. Herein, we present a novel strategy to dierentiate the progeny of stem cells into neurons using nanoparticles able to intracellularly release RA. We demonstrate that the internalisation of the RA-loaded nanoparticles has a minimal eect on cell viability and proliferation but a large impact on dierentiation. Importantly, nanoparticle-conditioned medium is unable to promote the dierentiation of stem/progenitor cells indicating that neuronal dierentiation is only mediated by internalisation of the nanoparticles.

8.3. Materials and Methods

Disclaimer: From sec. 8.3.9 onward, the work respecting the biological characterisation of the developed nanoparticulate system, was performed by Tiago Santos under the

120

8.3 Materials and Methods guidance of Joo Malva and Liliana Bernardino with assistance by Fabienne Agasse and Luisa Cortes.

8.3.1. Materials
All-trans retinoic acid, polyethylenimine (PEI, average Mw ~25 kDa by LS, average Mn ~10 kDa by GPC, branched), zinc sulphate heptahydrate (ZnSO4 ), ninhydrin reagent solution, Azure-A, uorescein isothiocyanate (FITC) and tungstic acid were purchased from Sigma-Aldrich. Dextran sulphate (DS, Mw=500 kDa) was purchased from Fluka. Dimethyl sulfoxide (DMSO) and Ethanol (EtOH) were acquired from Merck. All reagents were used without further purication.

8.3.2. Fluorescent Labeling of PEI

PEI (10 g) was dissolved in 90 mL of borate buer (pH 8.5) and a 10-fold molar excess of FITC, dissolved in 2 mL of DMF, was added dropwise and stirred for 1 hour. The solution was transferred to a dialysis membrane with 6 - 8 kDa cut-o and dialyzed against milliQ water. The dialysed solution was freeze-dried for 2 to 3 days, protected from light.

8.3.3. Preparation of Nanoparticles

Nanoparticles with a weight ratio of DS to PEI of 1 were prepared by adding dropwise 0.6 mL of RA (2% w/v, in DMSO)) into 12 mL of PEI (1% w/v, in pH 8.0 borate buer). The formation of complexes between RA-PEI occurred immediately and was allowed to proceed for 30 min with intense magnetic stirring. Then, 12 mL of DS solution (1% w/v) was added dropwise and stirred for another 5 min. Finally, 1.2 mL of ZnSO4 aqueous solution (1 M) was added and stirred for 30 min. Nanoparticles were centrifuged 3 times in 5% mannitol solution at 14,000 g for 20 minutes. Supernatants from each step were collected to determine PEI and DS amounts in nanoparticles. Resulting nanoparticles were frozen and lyophilised for 4 days to obtain a dry powder. Lyophilised nanoparticles were stored at 4C. Similar protocol was adopted for the preparation of nanoparticles with a weight ratio of PEI to DS of 5 and 0.2, by changing the concentration of the polymers accordingly. Blank nanoparticles were prepared using the same procedure in the absence of RA.

121

Chapter 8

Retinoic Acid-Loaded Nanoparticles

8.3.4. Characterisation of the Nanoparticles

The morphology of the nanoparticles was evaluated by transmission electron microscopy (Hitachi SU-70, with a STEM detector at 30 kV) following negative staining with tungstic acid solution (1%, w/v; pH 7.5). Initially, an aliquot of lyophilised NPs (5 mg) was resuspended in PBS (1 mL), centrifuged for 5 minutes at 14,000 g, ressuspended in PBS, centrifuged again, and nally ressuspended in PBS (0.5 mg/mL). Five microliters of both sample and tungstic acid solution (1%, w/v; pH 7.5) were placed on a 300 mesh copper grid with a carbon-coated formvar membrane and dried overnight before examination by TEM. Particle size was determined using light scattering via Zeta PALS Zeta Potential Analyzer and ZetaPlus Particle Sizing Software, v. 2.27 (Brookhaven Instruments Corporation). Nanoparticles suspended in water and sonicated for short times (< 10 min) were used. Typically, all sizing measurements were performed at 25 C, and all data were recorded at 90, with an equilibration time of 5 min and individual run times of 60 s (5 runs per measurement). The average diameters described in this work are number-weighted average diameters. The zeta potential of nanoparticles was determined in a 1 mM KCl pH 6 solution, at 25 C. All data were recorded with at least 6 runs with a relative residual value (measure of data t quality) of 0.03.

8.3.5. Determination of Weight Ratio of Cationic to Anionic Polymer in Nanoparticles

Anionic-to-cationic polymer (DS:PEI) mass ratios in nanoparticles can be determined by subtracting the known amount of PEI and DS in the supernatant of completely centrifuged particles from the initial amount present [244]. The amount of PEI was determined using ninhydrin. Twenty microliters of supernatant from a centrifuged nanoparticle suspension were mixed with 380 mL of an acetic acid solution (0.05% w/v). One milliliter of ninhydrin reagent solution was then added. The mixture was placed into a boiling water bath for 10 min and then cooled to room temperature. Three milliliters of 95 % ethanol were added and mixed. The amount of PEI was then determined spectrophotometrically at 575 nm using a calibration curve from 10 to 30 mg/ml of PEI. The amount of unreacted DS in the supernatant was detected spectrophotometrically at 630 nm using an azure A dye binding method in which 400 mL of supernatant from a centrifuged nanoparticle suspension were mixed with 1.0 mL of azure A (10 mg/mL). Again

122

8.3 Materials and Methods a calibration curve of 1.0 to 3.5 mg/mL of DS was used to determine the concentration of unknown samples.

8.3.6. Loading Eciency of RA in Nanoparticles

In order to determine the amount of RA in loaded nanoparticles, a given amount of nanoparticle powder was dissolved in 1 mL of DMSO:HCl (9:1) solution and the absorption for RA at 350 nm was measured. The RA concentration was obtained from a calibration curve from 0.47-0.0023 mg/mL of RA in DMSO:HCl (9:1) solution. Loading eciency was calculated using the following equation: Loading Ef f iciency = Amount of RA in the nanoparticles 100 Initial amount of RA

8.3.7. RA Release from Nanoparticles

Nanoparticles (2.5 mg) were placed in PBS (0.5 mL) and incubated under mild agitation, at 37 C. At specic intervals of time, the nanoparticle suspension was centrifuged (at 20,000 rpm for 20 min) and 0.4 mL of the release medium removed and replaced by a new one. The reserved supernatant was stored at 5 C until the RA content in release samples was assessed by spectrophotometry at 350 nm. Concentrations of RA were determined by comparison to a standard curve. All analyses were conducted in triplicate.

8.3.8. In vitro Degradation of Polymeric Nanoparticles

Nanoparticles with or without RA were suspended at ~10 mg/mL in 10 mM PBS (pH 7.4) or 0.2 M citrate buer pH 5 or 6 and incubated at 37 C, under mild agitation. In one experimental set, the incubation lasted 7 days, after which, the nanoparticle suspension was centrifuged (20,000 g for 15 min) and the pellets lyophilised for nal mass. On the second experimental set, the incubation lasted for 21 days and at daily intervals, the nanoparticles suspension was centrifuged (20,000 g for 15 min) and 0.4 mL of the release medium removed and replaced by a new one, for RA quantication and particles size measurements. At the nal day, the resulting nanoparticle suspensions were lyophilised for 3 days to obtain a dry powder for mass determination.

123

Chapter 8

Retinoic Acid-Loaded Nanoparticles

8.3.9. SVZ Cell Cultures and Experimental Treatments.

All experiments were performed in accordance with NIH and European (86/609/EEC) guidelines for the care and use of laboratory animals. SVZ cells were prepared from 1-3 day-old C57BL/6 donor mice as described by [342]. Briey, mice were killed by decapitation and the brains were removed and placed in calcium- and magnesium-free HBSS solution (Gibco, Rockville, MD, USA), under sterile conditions. Fragments of SVZ were dissected out of 450 m-thick coronal brain sections using a McIlwain tissue chopper and then SVZ was digested in 0.025% trypsin (Gibco) and 0.265 mM EDTA (Gibco) (10 min, 37 C), following mechanical dissociation with a P1000 pipette. The cell suspension was diluted in serum-free medium (SFM) composed of Dulbeccos modied eagle medium [(DMEM)/F12 + GlutaMAXTM-I)] supplemented with 100 Uml penicillin, 100 gml streptomycin, 1% B27 supplement, 10 ngml epidermal growth factor (EGF) and 10 ngml basic broblast growth factor (FGF)-2 (all from Gibco). Single cells were then plated on uncoated Petri dishes at a density of 3000 cellscm2 and were allowed to develop in an incubator with 5% CO2 and 95% atmospheric air at 37 C. Six-day-old neurospheres were adhered for 48 hours onto 24 well plate poly-D-lysine-coated glass coverslips for all experiments except western blots, which were left adherent onto poly-Dlysine-coated 6 well plates, all in SFM devoid of growth factors. Then, the neurospheres were allowed to develop for 2 or 7 days at 37 C in the presence a broad range of RAreleasing NP concentrations. Cell death assays were done after 2 days of incubation. At the end of the 7 day treatment, Single Cell Calcium Imaging (SCCI) experiments, western blots and immunocytochemistry were performed. (Fig. 8.5). To determine whether the proneurogenic eect of RA was due to its release in the cell medium or the nanoparticles internalized, RA+ -NPs were dissolved in SFM devoid of grow factors and incubated for 7 days at 37 C. Thereafter, the resulting cell medium containing the RA+ -NPs was centrifuged (14,000 rpm, 15 min), nanoparticles were discarded and the supernatant was recovered and used for conditioned medium (CM) on SVZ cells for 7 days, followed by NeuN immunocytochemistry.

8.3.10. Single Cell Calcium Imaging

To functionally characterise neuronal dierentiation in SVZ cells, variations of intracellular calcium concentration ([Ca2+ ]i ) following stimulation with 50mM KCl and 100M histamine (Sigma-Aldrich) were analysed. KCl depolarisation causes the increase of [Ca2+ ]i

124

8.3 Materials and Methods in neurons, whereas stimulation with histamine increases [Ca2+ ]i in stem/progenitor cells [343]. SVZ cultures were loaded for 40 minutes at 37 C with 5M Fura-2 AM (Molecular Probes), 0.1% fatty acid-free bovine serum albumin (BSA), and 0.02% pluronic acid F-127, in Krebs buer (132 mM NaCl, 1 mM KCl, 1 mM MgCl2 , 2.5 mM CaCl2 , 10 mM glucose, 10 mM HEPES, pH 7.4). After a 10 minutes post-loading period at room temperature (RT), the coverslip was mounted on RC-20 chamber in a PH3 platform (Warner Instruments) on the stage of an inverted Axiovert 200 uorescence microscope (Carl Zeiss). Cells (approximately 100 cells per eld) were continuously perfused with Krebs and stimulated by applying 100 M histamine or high-potassium Krebs solution (containing 50 mM KCl, isosmotic substitution with NaCl) by the mean of a fast pressurized (95% air, 5% CO2 atmosphere) system (AutoMate Scientic Inc.). [Ca2+ ]i was evaluated by quantifying the ratio of the uorescence emitted at 510 nm following alternate excitation (750 milliseconds) at 340 and 380 nm, using a Lambda DG4 apparatus (Sutter Instrument) and a 510 nm band-pass lter (Carl Zeiss) before uorescence acquisition with a 40x objective and a CoolSNAP digital camera (Roper Scientic). Acquired values were processed using the MetaFluor software (Universal Imaging Corporation). Histamine/KCl values for Fura-2 ratio were calculated to determine the extent of neuronal maturation in cultures. The percentage of cells displaying a neuronal-like prole was calculated on the basis of the histamine (Hist)/KCl ratio.

8.3.11. Internalisation Studies

In order to visualise the cellular uptake of RA+ -NP by SVZ cells we performed a live imaging experiment on a confocal microscope (LSM 510 Meta, Carl Zeiss). 50 g/mL RA+ -NPs were administrated to SVZ neurosphere seeded on glass bottom petri dishs (35 mm, IBIDI, Germany) and incubated at 37 C for 60 min. For imaging, cells were then placed into a special stage (Heating Insert P Lab-Tek and Incubator S, Pecon) at 37 C, 5% CO2 on a confocal laser scanning microscopy (LSM 510 META, Carl Zeiss). This system maintained normal cell culture and allowed multiple regions of interest to be imaged regularly throughout the duration of the experiment. internalisation of NP was followed over a 4 hours period (4 frames 1 ), by detection of FITC bound to the NPs using a 488 nm argon laser (45 mW) for excitation and a 510-550 nm bandpass emission lter, and a 63x objective (Plan-ApoChromat, N.A. 1.4). Dierential interference contrast (DIC) images were simultaneously acquired in order to visualise alterations on cell morphology during the experiment. Finally, Hoechst 33342 (2 g/ml)

125

Chapter 8

Retinoic Acid-Loaded Nanoparticles

(Invitrogen) was added in order to visualise nuclei morphology. Images were acquired using a 405 nm Diode laser (30 mW) and a band-pass emission lter (420-450 nm).

8.3.12. Western Blots

SVZ cells, previously incubated with RA+ -NPs for 7 days in dierentiation conditions, were washed with 0.15 M phosphate-buered saline (PBS) and incubated in a lysis buer [0.15 M NaCl , 0.05 M Tris-Base, 5 mM EGTA, 1% Triton X-100, 0.5% DOC, 0.1% SDS, 10 mM DTT containing a cocktail of proteinase inhibitors (Roche)]. Total protein concentration from the lysates was determined by BCA assay and samples were treated with SDS-PAGE buer [6x concentrated: 350 mM Tris, 10% (w/v) SDS, 30% (v/v) glycerol, 0.6 M DTT, 0.06% (w/v) bromophenol blue], boiled for 5 min at 95 C, and stored at -20 C until use for western blotting. Then, proteins (40 g of total protein) were resolved in 15% SDS polyacrilamide gels and then transferred to PVDF membranes with 0.45 m pore size in the following conditions: 300 mA, 90 min at 4 C in a solution containing 10 mM CAPS and 20% methanol, pH 11) (protocol adapted from Pinheiro et al. (2005) [344]). Membranes were blocked in Tris-buer saline containing 5% low-fat milk and 0.1% Tween 20 (Sigma) for one hour, at RT, and then incubated overnight at 4 C with the primary antibody rabbit monoclonal anti-NR1 (1:100) (CHEMICON International Inc., Billerica, MA, USA) diluted in 1% TBS-Tween and 0.5% low fat milk. After rinsing three times with TBS-T 0.5% low-fat milk, membranes were incubated for 1 h, at RT, with an alkaline phosphatase-linked secondary antibody anti-rabbit IgG 1:20,000 in 1% TBS-T and 0.5% low-fat milk (GE Healthcare, Buckinghamshire, UK). For endogenous control immnunolabelling, primary antibody solution consisted of mouse monoclonal anti-GAPDH (1:10,000) (Millipore, MA, USA). Protein immunoreactive bands were visualised in a Versa-Doc Imaging System (Model 3000, BioRad Laboratories, CA, USA), following incubation of the membrane with ECF reagent (GE Healthcare, Buckinghamshire, UK) for 5 min. Densitometric analysis were performed by using the ImageQuant software.

8.3.13. Immunocytochemistry
Cells were xed with 4% paraformaldehyde (PFA). After washing three times with PBS, unspecic binding was prevented by incubating cells in a 3% BSA and 0.3% Triton X100 solution for 30 min, at RT. Cells were kept overnight at 4 C in a primary antibody

126

8.3 Materials and Methods solution, then washed with PBS the following day, and incubated for 1 h, at RT, with the corresponding secondary antibody. Antibodies were used as listed: mouse monoclonal anti-Tuj1 (Covance, Princeton, NJ, USA) (1:100), mouse monoclonal anti-NeuN (Millipore) (1:100), rabbit polyclonal anti-GFAP (1:100) (Cell Signaling Tech., Beverly, MA, USA) prepared in 0.1% Triton X-100, 0.3% BSA solution; Alexa Fluor 594 goat anti-mouse; Alexa Fluor 488 goat anti-rabbit (both at 1:200 in PBS, from Invitrogen). For nuclear labelling, cell preparations were stained with Hoechst 33342 (2 g/ml) (Invitrogen) in PBS 5 min, at RT, and mounted in Dakocytomation uorescent medium (Dakocytomation Inc., Carpinteria, CA, USA). Fluorescent images were acquired using a confocal microscope (LSM 510 Meta, Carl Zeiss). In order to visualise the NPs internalisation, cells were incubated overnight with the RA-releasing NPs (10 g/mL) and then xed in methanol-acetone 1:1 for 20 min at -20 C. After xation, non-specic binding sites were blocked with 6% BSA (Sigma) in PBS for 1 h. Cells were subsequently incubated with the primary antibody mouse monoclonal anti-FITC (1:100, Sigma) in PBS containing 0.3% BSA (Sigma). Thereafter, coverslips were rinsed in PBS and incubated for 1 h, at RT, with the secondary goat anti-mouse Alexa 594 (1:200, Invitrogen). After rinsing with PBS, cell preparations were incubated with Hoechst 33342 (2 g/ml, Invitrogen) in PBS for 5 min at RT. Finally, the preparations were mounted using Dako Fluorescent Mounting Medium (Dakocytomation). Fluorescent images were acquired using a confocal microscope (LSM 510 Meta, Carl Zeiss).

8.3.14. TUNEL Assay

SVZ cultures were xed with 4% PFA for 30 min, at RT, rinsed in PBS and permeabilised in 0.25% Triton X-100 (Sigma) for 30 min at RT. Thereafter, coverslips were incubated for 20 min in 3% H2 O2 and reacted for terminal transferase (0.25 UL) biotinylated dUTP (6 M) nick-end labelling of fragmented DNA in TdT buer (pH 7.5) (all from Roche, Basel, Switzerland) for 1 h 30 min at 37 C in a humidied chamber. The enzymatic reaction was stopped by 15 min incubation in 300 mM NaCl and 30 mM sodium citrate (both from Sigma) buer. Following an additional rinse in PBS, cultures were incubated for 30 min at RT with the avidin-biotin-peroxidase complex (1:100; Vector Laboratories Inc., Burlingame, CA, USA). Peroxidase activity was revealed by the DAB chromogen (0.025%; Sigma) intensied with 0.08% NiCl2 in 30 mM Tris-HCl (pH 7.6) buer containing 0.003% H2 O2 . The cell preparations were then dehydrated in an

127

Chapter 8

Retinoic Acid-Loaded Nanoparticles

ethanol gradient (70%, 2 min; 80%, 2 min; 90%, 2 min; 95%, 2 min; 100%, 2 min), cleared in xylene (3 min) and mounted using DEPEX mounting medium (Fluka Chemie AG, Buchs, Switzerland). Photomicrographs of TUNEL labelling were recorded using a digital camera (Axiocam HRC, Carl Zeiss) adapted to an Axioskop 2 Plus uorescent microscope (Carl Zeiss).

8.3.15. Propidium Iodide Incorporation

Propidium iodide (PI; 3 g/mL, Sigma) was added 40 min before the end of the 48 h of incubation with RA+ -NPs. Thereafter, cells were xed with 4% PAF for 30 min, rinsed in PBS and stained with Hoechst 33342 (2 g/ml; Invitrogen) in PBS, for 5 min, at RT, and mounted in Dakocytomation uorescent medium (Dakocytomation Inc.). Photomicrographs of PI-uptake labelling were recorded using a digital camera (Axiocam HRC, Carl Zeiss) adapted to an Axioskop 2 Plus uorescent microscope (Carl Zeiss).

8.3.16. Statistical Analysis

Data are expressed as means standard error of mean (SEM). Statistical signicance was determined by using Students t-test or one-way ANOVA followed by Dunnetts post hoc test for comparison with control or Neuman-Keuls for multiple comparison test, with P<0.05 considered to represent statistical signicance. All measurements were performed in the monolayer of cells surrounding the seeded SVZ neurospheres. For SCCI experiments, the percentage of neuronal responding cells (Hist/KCl ratio<0.8) was calculated on the basis of one microscopic eld per coverslip, containing about 100 cells (40 magnication). Percentages of NeuN-, TUNEL-, or PI-positive cells were calculated from cell counts in ve independent microscopic elds in each coverslip with a 40 objective (approximately 200 cells per eld). Because no signicant dierences were found between experiments from dierent SVZ cell cultures, the corresponding data were pooled.

8.4. Results and Discussion

Nanoparticles were prepared by complex coacervation, i.e., through the electrostatic interaction of polyethylenimine (PEI, polycation) and dextran sulphate (DS, polyanion)

128

8.4 Results and Discussion (Fig. 8.1A). Initially, complexes of RA with PEI were formed by the electrostatic interactions of the carboxyl groups of RA with the amine groups of PEI. According to previous studies the maximum loading is obtained for a ratio of amino groups to carboxylic acid groups of about 2:1 [266]. In this work we used a ratio between 4:1 (for the NP formulation DS:PEI with weight ratio of 5.0) and 17:1 (for the NP formulation DS:PEI with weight ratio of 0.2), only considering the primary amines present in PEI. The electrostatic interaction between RA and PEI is conrmed by a shift in the RA peak at 350 nm to near 300 nm, as conrmed by spectrophotometry (Fig. 8.2).

Figure 8.1.: Physico-chemical properties of the nanoparticles. A) Chemical structures of retinoic acid (RA), polyethylenimine (PEI) and dextran sulphate (DS). B) Typical prole obtained by DLS for the formulation RA+ -NPs (0.2). Results are expressed as number-weight average diameter. C) Transmission electron microscopy (TEM) images of RA+ -NPs. Scale bar: 200 nm. D) Mass loss on nanoparticles suspended in buered solutions at pH 5.0, 6.0 and 7.4 for 7 days, at 37 C. Nanoparticles with or without RA were used in these degradation studies. Results are shown as mean SD, n=6. ** and *** denotes statistical signicance P<0.01 and P<0.001, respectively. These complexes formed nanoparticles with 100 to 250 nm in diameter, although they tend to dissociate relatively easy. To stabilize the nanoparticle formulation DS and zinc sulfate were added in successive steps [244]. The electrostatic interaction of DS with PEI previously has been conrmed by Fourier Transform Infrared (FTIR) analysis in PEI/DS

129

Chapter 8

Retinoic Acid-Loaded Nanoparticles

nanoparticles [244] and this physical crosslink may contribute for the stabilization of the NPs. Then, DS and zinc sulphate were added in successive steps to stabilise the formulation [244]. Nanoparticles without zinc sulphate tend to aggregate and form large particles. Mannitol was added to the NP suspension during centrifugation steps and lyophilisation to prevent their aggregation.

8.4.1. High-Loading Capacity and Positive-Net Charge Nanoparticles

Three dierent weight ratios of DS relatively to PEI were selected for our initial screening: 5.0 (large excess of DS), 1.0 (similar weight of both polymers), and 0.2 (large excess of PEI). In each formulation we determined particle size, zeta potential and RA loading eciency. A Brookhaven ZetaPALS analyser was used to evaluate NP zeta potential and size distribution (deionized water). The number-weighting prole of all formulations tested was usually unimodal (>99%) (Fig. 8.1B). The formulation DS:PEI weight ratio of 5 yielded nanoparticles with an average diameter between 40 and 120 nm, and a negative net charge, while the formulation DS:PEI weight ratio of 1 yielded large aggregates of nanoparticles (diameter > 500 nm), with a positive net charge (Tab. 8.1). This is in line with other results previously reported, indicating that an excess of one of the NP components is needed to act as a colloidal protective agent and preventing the coalescence of the NPs [244]. Nanoparticles prepared from the formulation DS:PEI weight ratio of 0.2 had an average diameter between 80 and 90 nm; however, presenting a signicantly higher RA loading eciency (48 versus 2%) and positive net charge (15 versus 2 mV) than the other formulations tested. The high loading eciency is explained by the high content of PEI able to interact with RA. Based on the loading capacity and net charge results, nanoparticles obtained from the formulation 0.2 were selected for subsequent experiments. The morphology of these nanoparticles was then characterised by transmission electron microscopy (TEM). TEM micrographs (Fig. 8.1C) show a similar range of sizes as observed by DLS. The dissolution prole of nanoparticles is aected by pH. The dissolution of the nanoparticles (~10 mg/mL) was evaluated at pH 7.4, 6.0 and 5.0, under agitation, at 37 C. This pH range is typically found at the cytoplasm and intracellular organelles [274]. After 7 days, the suspensions were centrifuged, lyophilised and nally weighed. Interestingly, the disassembly of RA-containing nanoparticles (RA+ -NPs) was lower than blank nanoparticles (RA -NPs) (Fig. 8.1D).

130

8.4 Results and Discussion

Formulation Ratioa w/w 0.311 0.557 n.a. n.a. 0.078 0.503

Charge ratiob

c %

d mV

Emulsione nm

RVf

NPg nm

RVf

Table 8.1.: Physico-chemical characteristics of DS/PEI nanoparticles either with or without RA.

This might reect dierences in the cross-linking of both preparations. RA might act as a cross-linker agent, where the carboxyl group interacts electrostatically with the amine
RA payloadi g/mg 2.21.2 18.69.2 0.40.2 2.51.5 48.315.9 86.128.4 LEh %

DS/PEI 5 7.1 1 -34.73.0 43.4 0.074 74 DS/PEI+RA 5 7.4 6.2 -42.68.1 115 0.283 67 j DS/PEI 1 1.4 n.a. n.a. 541 0.510i n.a. j DS/PEI+RA 1 1.5 7.3 +1.90.5 711 0.228i n.a. DS/PEI 0.2 0.3 22.5 +14.92.8 91 0.044 61 DS/PEI+RA 0.2 0.4 34.12 +15.61.4 80 0.074 224 a The real ratio for the 0.2 and 0.2RA formulations was estimated to be 0.585 and 0.599, respectively. b Charge ratio. (-/+). c Yield (without mannitol) d - Zeta potential e Peak diameter after the emulsion f - Relative variance g Nanoparticles size after freeze-drying and resuspended in aqueous buer h Loading eciency i Amount of RA per mass of nanoparticle (without mannitol) j - Formation of aggregates; values after removing the formed agglomerates.

131

Chapter 8

Retinoic Acid-Loaded Nanoparticles

groups of PEI, and the aromatic group interacts hydrophobically with the aromatic group of another RA molecule. RA+ -NPs showed a mass loss of 15.4 5.9%, 42 3.8% and 54.5 6.3%, at pHs 7.4, 5.0 and 6.0, respectively, over 7 days (Fig. 8.1D). Our results indicate that acidic pH enhanced the degradation of the nanoparticles likely due to the protonation of PEI amine groups (in excess relatively to the sulphate groups in DS) and the concomitant repulsion between positive charges [345].

Figure 8.2.: Diameter and release prole of RA+ -NPs. Diameter variation (A) and release prole (B) of RA+ -NPs suspended in buered solutions at pH 5.0, 6.0 and 7.4 over 21 days, at 37 C. The release of RA from nanoparticles is dependent on the external pH. Polyelectrolyte complexes change their three-dimensional conformation according to the pH, aecting the release of RA. To evaluate this eect, nanoparticles were incubated at pH 7.4, 6.0 or pH 5.0, at 37 C, under agitation. At determined times the nanoparticle suspensions were centrifuged and the supernatant evaluated by spectrophotometry at 350 nm. The nanoparticles diameter was also evaluated at each time point (Fig. 8.2A). At pH 7.4, the initial diameter (~100 nm) is roughly maintained over 15 days, decreasing afterwards to approximately 60 nm. At pH 6.0 and 5.0, higher aggregation was observed for all the time points; however the population with diameters between 100 and 1000 nm (numberweighting average) accounted for most (> 95%) of the nanoparticles in suspension (Fig. 8.2A). Taking into account that RA solubility is approximately 63 ng per mL at physiological

132

8.4 Results and Discussion pH [264], most of RA released at pH 7.4 is complexed with PEI (Fig. 8.2B). Indeed, the complexation of RA to PEI is conrmed by a shift in the RA peak at 350 nm, which is not aected by the subsequent addition of DS (Fig. 8.3). Interestingly, the release of

Figure 8.3.: UV spectral scan of RA, RA conjugated to PEI, RA conjugated to PEI and after addition of DS, and RA conjugated to PEI and after addition of DS and zinc sulphate, according to the methodology described in the Materials and Methods section, the suspension centrifuged and the pellet resuspended in PBS and characterised by spectrophotometry. RA was dissolved in DMSO and diluted in PBS. RA at pH 5.0 or 6.0 is much lower than pH 7.4, over the same period of time. This can be due to the crystallisation of the RA and the aggregation of the nanoparticles at acidic pHs which decreases RA diusion from the nanoparticles [268, 346]. We cannot eliminate the possibility that RA is released by the nanoparticles at higher percentages than the values assessed, and the low values observed by us is because RA precipitates at acidic pHs circumventing its real quantication.

8.4.2. Nanoparticles Internalisation in SVZ Cells

RA+ -NPs could potentially be used to induce neurogenesis and inuence the brain regenerative capacities. In adult mammalian brain, neurogenesis persists in restricted neurogenic niches. These resources play a central role in the generation and integration of new neurons into pre-existing neural circuitry and are crucial for the maintenance of brain integrity and plasticity [347, 348, 349]. The SVZ is the main neurogenic niche of the adult rodent brain [347, 348, 349] and contains a population of neural stem cells that can give rise to neurons, astrocytes, and oligodendrocytes. Therefore, SVZ cells have a huge potential for stem cell-based brain repair strategies. Previous studies have shown

133

Chapter 8

Retinoic Acid-Loaded Nanoparticles

that nanoparticles (typically below 100 nm) formed by PEI (polycation) complexed with DNA (polyanion) can be internalised by adult mammalian brain cells [350, 351, 352]. However, in spite of the importance of SVZ neural stem cells for brain physiology and repair, there is no consistent information concerning nanoparticle uptake and intracellular drug release in SVZ cells. To evaluate the kinetics of nanoparticle uptake by SVZ cells, they were exposed to uorescein isothiocyanate (FITC)-conjugated nanoparticles and their uptake assessed by confocal live cell imaging and immunocytochemistry. One hour after cell treatment, nanoparticles accumulate rapidly in cell cytoplasm (data not shown). This accumulation

Figure 8.4.: Cellular nanoparticle uptake. A) Confocal live imaging of SVZ cells after exposure for 5 h to FITC-labeled RA+ -NPs (50 g/mL). Hoechst-33342 staining (blue) was used to visualise cell nuclei. Crop images show both transmission and FITC channel or FITC channel alone. B) Confocal microscopy photomicrographs of untreated or FITC-labeled RA+ -NPs-treated (10 g/mL) SVZ cells for 18 h, imunostained with anti-FITC antibody and Hoechst-33342. Scale bars are 10 m. becomes even more expressive at 5 h (Fig. 8.4A). This is in line with other studies, showing that PEI-based nanoparticles can escape rapidly endosomal fate due to their buering capacity leading to osmotic swelling and rupture of endosomes [341]. At 18 h after cell treatment, the FITC-conjugated nanoparticles are distributed overall the cell cytoplasm (Fig. 8.4B).

134

8.4 Results and Discussion To determine the cytotoxicity of these nanoparticles, SVZ neurospheres were exposed to RA+ -NPs or RA -NPs for 2 days and cell death, presumably involving apoptosis or necrosis, was then evaluated by terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) and propidium iodide (PI) staining, respectively (Fig. 8.5). No signicant eect on cell apoptosis was observed for all the experimental groups tested with nanoparticle concentrations up to 100 g/mL (Fig. 8.6A).

Figure 8.5.: Scheme of the experimental protocols used for studying the eects of RA+ NPs on SVZ cell cultures. Dashed line: exposure with RA+ -NPs. In contrast, cell necrosis increases signicantly for nanoparticle concentrations of 100 g/mL (~4-fold) (77.3 9.1%; n=4 coverslips; 2938 cells counted; P<0.0001), relatively to the control (17.8 1.3%; n=9 coverslips; 8618 cells counted) (Fig. 8.6B). The toxic eects of 100 g/mL RA+ -NPs was not due to RA since the void formulation RA -NPs was equally toxic at the same concentration (Fig. 8.6B). Based on these results, RA+ -NPs are not cytotoxic for concentrations equal or below to 10 g/mL. Moreover, at these concentrations, the internalisation of the nanoparticles did not aect signicantly the morphology of the cells. Untreated cells or cells treated with RA+ -NPs (1 g/mL) for 7 days were characterised by immunocytochemistry against neuron-specic class III beta-tubulin (Tuj1) and glial brillary acidic protein (GFAP). RA+ -NPs-treated cells present a healthy morphology undistinguishable from untreated cells (Fig. 8.6C). To investigate the eect of RA+ -NPs on cell proliferation, SVZ neurospheres were exposed to a wide range of nanoparticle concentrations (0.001 to 10 g/mL) for 2 days and then exposed to bromodeoxyuridine (BrdU) in the last 4 h of the treatment. BrdU is a synthetic nucleoside that can be incorporated into newly synthesised DNA substituting for thymidine during cell replication. SVZ cells either when grown under proliferative (in serum free medium with growth factors as free oating neurospheres) or dierentiation (after adherence on poly-D-lysine and in absence of growth factors) conditions exposed

135

Chapter 8

Retinoic Acid-Loaded Nanoparticles

Figure 8.6.: Cell viability after RA+/ -NPs uptake. A) Percentage of TUNEL-positive cells in control cultures and in cultures exposed to RA+ -NPs for 2 days. Data are expressed as mean SEM (n=4-8 coverslips). B) Percentage of PI-positive cells in control cultures and in cultures exposed to RA+ -NPs or RA -NPs for 2 days. Data are expressed as mean SEM (n=4-9 coverslips). ***P<0.001 using Dunnets Multiple Comparison Test. C) Representative confocal microscopy photomicrographs showing a typical morphology of Tuj1-positive neurons (red), GFAP-positive glia (green) and Hoechst-33342 staining (blue nuclei) in SVZ cells maintained for 7 days in the absence (control) or in the presence of RA+ -NPs (1 g/mL). Scale bars are 10 m.

to RA+ -NPs had similar proliferation rates as control cells not exposed to nanoparticles (Fig. 8.7).

Figure 8.7.: Proliferation of SVZ cells cultured in (A) dierentiation (after adherence on poly-D-lysine and in absence of growth factors) or (B) proliferative (in serum free medium with growth factors as free oating neurospheres) conditions.

136

8.4 Results and Discussion

8.4.3. RA+ NPs Promote Neuro-Dierentiation

SVZ cell cultures are mixed cultures of immature cells, neurons, astrocytes, oligodendrocytes, neuronal and glial progenitors in dierent stages of dierentiation [353, 354, 355]. In untreated SVZ cultures we detected about 5 to 15% of new neurons (detected by SCCI and NeuN immunocytochemistry; Fig. 8.8), which is in accordance with the percentage of neurons obtained from standard methods of isolating neural stem cells in vitro [355, 343]. To evaluate the eect of RA+ -NPs on neuronal dierentiation of SVZ cells, the cells were cultured in dierentiation conditions for 7 days in media containing the nanoparticles and then immunolabeled for NeuN, a neuronal-specic nuclear protein present on mature neurons [356, 357, 358] (Fig. 8.5). In the presence of RA+ -NPs at concentrations of 0.1 g/mL (19.6 2.3%; n=5 coverslips; 3460 cells counted; P<0.001) and 1 g/mL (19.2 2.2%; n=7 coverslips; 4954 cells counted; P<0.001), a signicant increase in the percentage of NeuN-positive cells was observed relatively to the untreated cells (11.8 0.6%; n=13 coverslips; 7306 cells counted) (Fig. 8.8A). The proneurogenic eect mediated by RA+ -NPs was absent in cell cultures treated with void nanoparticles (RA -NPs), suggesting that this eect was due to the RA and not due to the nanoparticle formulation per se (Fig. 8.8B). Importantly, the neuronal dierentiation eect was absent for high concentrations (> 1 g/mL) of nanoparticles indicating that an optimal concentration window of RA exists to drive the neuronal commitment of SVZ cells. Most in vitro studies, using embryonic stem cells and neural stem cell cultures isolated from the SVZ and hippocampus, suggest that RA exposure stimulates neurogenesis and neuronal maturation [339, 359, 360, 361, 362, 363]. However, the range of RA concentrations used in these studies ranged from 0.1 to 1 M. These concentrations are 100 to 1000 fold higher than the payload of RA from nanoparticles that induces neurogenesis in our studies. Considering the RA payload per mg of NPs, we found that concentrations of RA payload below 4 nM RA (corresponding to 0.1 g/mL nanoparticles) and above 40 nM RA (corresponding to 1 g/mL nanoparticles) did not promote neuronal dierentiation (Fig. 8.8C). This is consistent with the eect of RA in animal studies [364, 365]. The acute administration of RA (0.15 mg/kg) helped to reverse an age-related decit in long-term potentiation amplitude and improved the ability of the mice to perform relational learning tasks [364]. In contrast, the long-term systemic administration (1 mg/kg, for 42 days) of RA in mice leaded to a decrease in both proliferation and neuronal production in the hippocampus, which were accompanied by a signicant reduction in the ability to perform a learning task [365]. In this case, one

137

Chapter 8

Retinoic Acid-Loaded Nanoparticles

of the RA eects was to suppress SVZ neurogenesis [365].

Figure 8.8.: RA+ -NPs have a proneurogenic eect. A) Representative uorescence photomicrographs of NeuN immunostaining (red) in control cultures and cultures exposed to RA+ -NPs (0.1 g/mL) for 7 days. Hoechst 33342 was used for nuclear staining (blue). B) Percentage of NeuN-immunostained neurons in SVZ cultures after being exposed for 7 days to RA+ -NPs, RA -NPs, or conditioned medium (CM) obtained from the resultant supernatant of the centrifugation of nanoparticles suspensions previously left in culture for 7 days. Data are expressed as mean SEM (n=5-15 coverslips). ***P<0.001 using unpaired Students t-test for comparison with SVZ control cultures. C) Percentage of NeuN-immunostained neurons in SVZ cultures after being exposed for 7 days to RA+ -NPs or free-RA (solubilised in DMSO and added to the culture medium at dierent concentrations). Data are expressed as mean SEM (n=5-15 coverslips).

Because the dierentiation process could be either due to RA release in the medium or within the cell, nanoparticles were left in SFM cell medium devoid of growth factors for 7 days, at 37 C, then centrifuged and the resultant supernatant was collected, and used to treat SVZ neurospheres (7 days treatment protocol). Interestingly, no signicant

138

8.4 Results and Discussion proneurogenic eect was observed when the nanoparticle conditioned medium (CM) was added to SVZ cells (Fig. 8.8B). This shows that the dierentiation of SVZ cells was only mediated by the internalisation of the RA+ -NPs and concomitant intracellular release of RA. We speculate that the spatial gradient of RA within the cell is likely the cause of this biological response; however future studies are needed to address completely this issue. We also found that free RA solubilised in medium applying the same treatment protocol as for the NP, has only achieved a proneurogenic eect with a concentration of 10 M (1000 fold higher concentration than RA released from nanoparticles) (148.622.9% percentage relative to control; n=6 coverslips from 3 independent cell cultures) (Fig. 8.8C). As for RA+ -NPs, the neuronal dierentiation eect was absent for higher concentrations of free RA (50 M) (81.3 17.8% percentage relative to control; n=6 coverslips from 3 independent cell cultures). Therefore, RA signaling really depends on an optimal concentration window to drive the neuronal commitment. Importantly, results also stress that neuronal dierentiation induced by RA+ -NPs requires lower RA concentrations as compared with free RA. Therefore, our formulation is advantageous as comparing to the direct incubation with RA. To assess functional neuronal dierentiation, we measured intracellular calcium ([Ca2+ ]i ) variations in single SVZ cells, following KCl depolarization and histamine stimulation [343] (Fig. 8.5). KCl depolarization leads to the massive entry of Ca2+ through voltagedependent calcium channels in dierentiated neurons and is used as a functional marker of neuronal dierentiation [366]. Histamine stimulation increases [Ca2+ ]i in SVZ immature cells but not in neurons or in glial cells [343]. Therefore, mature neurons have low Hist/KCl ratios (below 0.8) [343]. To evaluate [Ca2+ ]i variations, SVZ cells were loaded with the Fura-2AM calcium probe, perfused continuously for 15 min with Krebs solution, and subsequently stimulated for 2 min with 50 mM KCl followed by 2 min stimulation with 100 mM histamine (Fig. 8.9A). In control cultures, most of the cells showed a predominant immature-like prole, characterised by an increase in [Ca2+ ]i in response to histamine but a negligible response to KCl depolarisation. In contrast, SVZ cells treated with RA+ -NPs at concentration of 0.1 g/mL displayed an increase in the [Ca2+ ]i in response to KCl but not to histamine stimulation, indicating their neuronal-like state (Ctrl: 4.8 1.9%, 9 coverslips, 838 cells; 0.1 g/mL: 28.2 5.2%, 8 coverslips, 1117 cells; P<0.001) (Fig. 8.9A). Moreover, these cells were characterised for the expression of NMDA subunit type 1 (NR1) by western blot analysis. Functional NMDA receptors form the molecular basis of synaptic plasticity and depend on the presence of

139

Chapter 8

Retinoic Acid-Loaded Nanoparticles

Figure 8.9.: RA+ -NPs induce dierentiation of SVZ cells into functionally neurons. A) Representative SCCI response proles of 20 cells in a control culture and in a culture treated with RA+ -NPs (0.1 g/mL). Graph shows percentages of neuronal-like responding cells (Hist/KCl below 0.8) in SVZ control cultures and in cultures exposed to RA+ -NPs (0.01 or 0.1 g/mL) for 7 days. Data are expressed as mean SEM (n=6-9 coverslips). ***P<0.001 using Dunnets Multiple Comparison Test. B) Graph depicts the percentages relative to control of NR1 protein expression normalized to GAPDH in cultures exposed to RA+ -NPs (0.1 g/mL) for 7 days. Below the graph, a representative western blot for 120 kDa NR1 and 37 kDa GAPDH expression is shown. The data is expressed as percentage of control SEM (n=5). *P<0.05 using paired Students t-test for comparison with SVZ control cultures. Scale bars are 10 m. the channel-forming NR1 subunit [367]. In line with the previous results, SVZ cultures that presented a neuronal-like prole (treated with 0.1 g/mL of RA+ -NPs) also show a higher expression of NR1 (~150% comparing with control cultures) (Fig. 8.9B).

8.5. Conclusion
We report a novel method to modulate the dierentiation of SVZ cells into neurons involving the use of RA+ -NPs. We show that our NP formulation is very eective in loading RA (86 28 g of RA per mg of NP), a small molecule with low aqueous solubility, and to release RA at concentrations higher than its solubility limit (> 63

140

8.5 Conclusion ng/mL, at physiological pH 7) due to its complexation with PEI. We further show that the RA+ -NPs have approximately 200 nm in diameter, positive net charge, and disassemble preferentially at acidic pHs. These RA+ -NPs can be taken up rapidly by SVZ cells (rst 5 h) under the tested conditions and localise in the overall cell cytoplasm after 18 h. The NPs are not cytotoxic and do not interfere with cell morphology and proliferation for concentrations below 100 g/mL. Importantly, our results show that the intracellular internalisation of RA+ -NPs contribute for neurogenesis and therefore highlighting the importance of drug spatial positioning and concentration in terms of stem cell dierentiation. We anticipate that these nanoparticles might be delivered into the brain via the nasal cavity, as recently demonstrated for the delivery of cells [368]. Thus, nanoparticle-mediated delivery of neurogenic-inductive factors (proteins, DNA, siRNA, mRNA) [369] might provide a new opportunity for the treatment of various neurodegenerative disorders.

141

Part III. Final Remarks

9. General Conclusions
Though oxidised dextran has been tested in many research studies, entered clinical trials and is even being comercially used in biomedical applications1 , the oxidation degree characterisation and the arising structural consequences have not been a priority in many studies. The assumption that all the aldehydes are fully reactive is common throughout the literature. However, our bidimensional NMR data suggests that only one aldehyde per residue is responding to N-nucleophiles, under certain pH conditions. Based on proposed oxidised residues structures, available on the literature, our interpretation suggests that the two main peak populations, observed on the bidimensional spectra, arise from carbazones on C3 , likely, from single oxidised residues. All the other populations might be disguised under these peaks or they may be arrested as hemiacetals, under the studied pH conditions. Anyhow, it seems that the totality of the aldehydes are not reacting, which could impair the correct determination of the OD. However, at more alkaline pHs, where the carbazone/hydrazone bonds are more labile, all sorts of aldehyde populations seem to be reactive. This issue could pose some problems on the prediction of the dexOx behaviour. The dextran periodate oxidation is a harsh reaction which promotes chain degradation but confers high chemical reactivity to a natively neutral molecule, deeply altering its physicochemical properties. We have shown how the water solubility is compromised and how the OD interferes with the resulting viscosity, especially at high concentrations. The solutions viscosity could impair injectability and miscibility of certain formulations, aecting a possible clinical application, due to issues on manipulation. The characterised hydrogels have a dual cross-linking control method, relying on the dextran OD and the amount of AAD used. The OD allows a given percentage of residues to serve as reactive points to cross-linkers such as AAD. The amount of AAD used is crucial in dening the gelation period, mechanical properties and dissolution prole of the hydrogels. It should be within the same range of the amount of oxidised residues
1

www.royerbiomedical.com

145

Chapter 9

General Conclusions

present in dextran, to avoid forming dangling ends and not valid mechanical cross-links. The inclusion of a bioactive factor within such matrix is usually complete and can be fed either on the dexOx solution or the AAD solution, allowing the modulation of the burst release prole. Oxidised dextran, by itself, is an excellent carrier of aminated entities, from small molecules to proteins, extending the small drugs bioavailability and confering proteins increased environmental stability. The conjugation of dexOx to vascular endothelial growth factor yielded a strong conjugate where the OD had a major inuence in capturing VEGF as observed by SDS-PAGE. The entanglement of VEGF by dexOx preserves its quaternary structure, impairing it, however, to react in full extension with specic antibodies or cellular receptors, likely due to a steric constraint. The conjugation to dexOx reduces the VEGF consumption, but it seems to prolong its activity as observed on the prole of the Ca2+ uptake assay. The reversibility of this conjugate may be modulated by controlling the OD, and the reduction of the conjugate, by cyanoborohydride, further inhibits the bioactivity of VEGF. Within the hydrogel context, formulating VEGF with dexOx, allows the conjugate to mature, before the hydrogel preparation, which will reect strongly in the release prole, when compared to VEGF formulated together with AAD. The amounts released within the rst 24 hours range from less than 1% to around 45% of the total initial protein, for VEGF formulated with dexOx and AAD, respectively. Most of the VEGF is released conjugated to dexOx, taking in account the low amount identied by ELISA. Still this hydrogel formulation allows for the smooth control of the burst release prole. DexOx has been described before to have some cytotoxicity, not so evident when it is cross-linked. Indeed, endothelial corneal cells showed an interesting acceptance upon being seeded on top of these hydrogels, adhering and proliferating well, likely due to the arrest of medium proteins. This is a good indication for the use of the hydrogel as a coating for some biomedical devices. Some work was performed on a wound dressing context, using VEGF-loaded dexOx hydrogels. The initial indications were that such application could benet wound closure rate, however, such study was not concluded. Instead, we proposed a new approach, composed of a dexOx and brin hybrid hydrogel. The controlled and sustained release of VEGF, from the brin-entrapped dexOx hydrogel, was successful in promoting endothelial cells organisation, that were encapsulated on the brin hydrogels. This hybrid system allows the manipulation of cells and growth factors in separate environments, though maintaining the communication and consequent interplay

146

General Conclusions through close contact of both systems. We envision that these constructs might be benecial for the induction of a rapid pro-angiogenic response in ischemic tissues, as well as matrixes to drive the in situ dierentiation of vascular progenitor cells. The last section of this thesis exploited the use of nanoparticles as intracellular drug carriers for a small hydrophobic drug. We show that our NP formulation is very eective in loading retinoic acid, a small molecule with low aqueous solubility, and to release RA at concentrations higher than its solubility limit due to its complexation with PEI. The RAloaded NP have approximately 200 nm in diameter, positive net charge, and disassemble preferentially at acidic pHs. These RA+ -NPs can be taken up rapidly by SVZ cells, localise in the overall cell cytoplasm, not showing cytotoxicity and not interfering with the cells morphology and proliferation for concentrations below 100 g/mL. Importantly, our results show that the intracellular internalisation of RA+ -NPs contribute for neurogenesis better than pre-released RA. The same formulation has been described as a VEGF carrier [203], though with dierent polyelectrolyte mass ratios. The use of nanoparticles allows to reach other cellular frontiers. Some unacomplished projects, involved the integration of such nanoparticles with the dexOx hydrogels (Fig. 1.4), which could improve the performance of the developed formulation and open new research opportunities.

Future Work
The studied hydrogel formulation has tremendous potential as a drug carrier in several biomedical settings. However, the delivery of proteins has to be carefully weighted, as their bioactivity could be seriously impaired. We believe that some other strategies that were not fully explored, might yield interesting outcomes. DexOx would be an interesting platform for a nanoparticle cross-linked matrix. Several questions related with the VEGF actuation arose, throughout the study. Does the dexOx binded VEGF promotes similar VEGF-R2 phosphorylation patterns as described for other systems? We were not able to answer completely how the actuation of VEGF is performed in the presence of dexOx. The developed hybrid system is still immature, but has great potential. It could be used with great advantage in in vitro settings, for the promotion of stem cells dierentiation, through the controlled presentation of specic factors. It could also be studied the application in vivo for the delivery of therapeutic molecules and cells at the same time.

147

Chapter 9

General Conclusions

Further studies are required to assess the real ecacy of such system in vivo. Wound healing could be a potential unmet medical need suitable for such VEGF delivery system. This system could also be useful in guiding dierentiation of endothelial precursor cells into mature endothelial cells and have direct application in cardiovascular and other pro-angiogenic therapies. Regarding the RA nanoparticulate delivery system, it would be interesting to assess its potential, after delivery through the nasal cavity, in addressing neurodegenerative disorders.

148

Bibliography
[1] Bixler GH, Hines GE, McGhee RM, Shurter RA. Dextran. Industrial and Engineering Chemistry. 1953;45(4):692705. [2] Mehvar R. Dextrans for targeted and sustained delivery of therapeutic and imaging agents. Journal of Controlled Release. 2000;69(1):125. [3] Sidebotham RL. Dextrans. Advances in Carbohydrate Chemistry and Biochemistry. 1974;30:371444. [4] Heinze T, Liebert T, Heublein B, Hornig S. Functional polymers based on dextran. Advances in Polymer Science. 2006;205:199291. [5] Pasut G, Veronese FM. Polymer-drug conjugation, recent achievements and general strategies. Progress in Polymer Science. 2007;32(8-9):933961. [6] Tomme SRV, Hennink WE. Biodegradable dextran hydrogels for protein delivery applications. Expert Review of Medical Devices. 2007;4(2):147164. [7] Sokolsky-Papkov M, Domb AJ, Golenser J. Impact of aldehyde content on amphotericin B-dextran imine conjugate toxicity. Biomacromolecules. 2006;7(5):1529 1535. [8] Joensuu TK, Nilsson S, Holmberg AR, Mrquez M, Tenhunen M, Saarto T, et al. Phase I trial on sms-D70 somatostatin analogue in advanced prostate and renal cell cancer. Annals Of The New York Academy Of Sciences. 2004;1028:361374. [9] Malaprade L. Action des polyalcools sur lacide periodique: Application analytique. Bulletin de la Socit Chimique de France. 1928;43(4):683. [10] Jeanes A, Wilham CA. Periodate Oxidation of Dextran. Journal of the American Chemical Society. 1950;72(6):26552657. [11] Sloan J, Alexander B, Lohmar R, Wol I, Rist C. Determination of dextran structure by periodate oxidation techniques. Journal of the American Chemical Society. 1954;76(17):44294434.

149

Bibliography [12] Rankin J, Jeanes A. Evaluation of the periodate oxidation method for structural analysis of dextrans. Journal of the American Chemical Society. 1954;76(17):4435 4441. [13] Dimler R, Wol I, Sloan J, Rist C. Interpretation of periodate oxidation data on degraded dextran. Journal of the American Chemical Society. 1955;77(24):6568 6573. [14] Maia J, Ferreira LS, Carvalho R, Ramos M, Gil MH. Synthesis and characterization of new injectable and degradable dextran-based hydrogels. Polymer. 2005;46(23):96049614. [15] Tiziani S, Sussich F, Cesaro A. The kinetics of periodate oxidation of carbohydrates 2. Polymeric substrates. Carbohydrate Research. 2003;338(10):10831095. [16] Ishak MF, Painter T. Kinetic evidence for hemiacetal formation during oxidation of dextran in aqueous periodate. Carbohydrate Research. 1978;64:189197. [17] Drobchenko S, IsaevaIvanova L, Kleiner A, Lomakin A, Kolker A, Noskin V. An investigation of the structure of periodate-oxidised dextran. Carbohydrate Research. 1993;241:189199. [18] Drobchenko S, IsaevaIvanova L, Kleiner A, Eneyskaya E. Aldo-enol transition in periodate-oxidized dextrans. Carbohydrate Research. 1996;280(1):171176. [19] Yu R, Bishop C. Novel oxidations of methyl glycopyranosides by periodic acid in dimethyl sulfoxide. Canadian Journal of Chemistry. 1967;45(19):21952203. [20] Bondarev G, Drobchenko S, Isaeva-Ivanova L. 1H NMR spectra of tautomeric structures of dialdehydedextran. Polymer Science. 1994;36(7):915918. [21] Neishlos AL, Novikova EV, Passet BV, Moskvin AV. IR and NMR Study of the Structure of Dextran Polyaldehyde. Russian Journal of Applied Chemistry. 2004;77(1):128130. [22] Bouhadir K, Hausman D, Mooney DJ. Synthesis of cross-linked poly (aldehyde guluronate) hydrogels. Polymer. 1999;40:35753584. [23] Sumner J, Graham V. Dinitrosalicylic acid: A reagent for the estimation of sugar in normal and diabetic urine. Journal of Biological Chemistry. 1921;47(1):59. [24] Lenders JP, Crichton RR. Thermal stabilization of amylolytic enzymes by covalent coupling to soluble polysaccharides. Biotechnology and Bioengineering. 1984;26(11):13431351.

150

Bibliography [25] Zhao H, Heindel ND. Determination of degree of substitution of formyl groups in polyaldehyde dextran by the hydroxylamine hydrochloride method. Pharmaceutical Research. 1991;8(3):400402. [26] Schi H. Eine neue Reihe organischer Diamine;. Annalen der Chemie und Pharmacie. 1866;140(1):92137. [27] Matsunaga K, Hara K, Imamura T, Fujioka T, Takata J, Karube Y. Technetium labeling of dextran incorporating cysteamine as a ligand. Nuclear Medicine and Biology. 2005;32(3):279285. [28] Heindel ND, Zhao HR, Leiby J, VanDongen JM, Lacey CJ, Lima DA, et al. Hydrazide pharmaceuticals as conjugates to polyaldehyde dextran: syntheses, characterization, and stability. Bioconjugate Chemistry. 1990;1(1):7782. [29] Suvorova O, Iozep A, Passet B. Reactivity of polysaccharide aldehydes toward N-nucleophiles. Russian Journal of Applied Chemistry. 2001;74(6):10161020. [30] Schacht E, Nobels M, Vansteenkiste S, Demeester D, Franssen O, Lemahieu A. Some aspects of the crosslinking of gelatin by dextran dialdehydes. Polymer Gels and Networks. 1993;1(4):213224. [31] Bonneaux F, Dellacherie E. Fixation of various aldehydic dextrans onto human hemoglobin - study of conjugate stability. Journal of Protein Chemistry. 1995;14(1):15. [32] Borch RF, la Mark D Bernstein, Durst HD. The Cyanohydridoborate Anion as a Selective Reducing Agent. Journal of the American Chemical Society. 1971;93(12):28972904. [33] Germain P, Slagmolen T, Crichton RR. Relation between stabilization and rigidication of the three-dimensional structure of an enzyme. Biotechnology and Bioengineering. 1988;33(5):563569. [34] Cabacungan JC, Ahmed AI, Feeney RE. Amine boranes as alternative reducing agents for reductive alkylation of proteins. Analytical Biochemistry. 1982;124(2):272278. [35] Maia J, Ribeiro MP, Ventura C, Carvalho RA, Correia IJ, Gil MH. Ocular injectable formulation assessment for oxidized dextran-based hydrogels. Acta Biomaterialia. 2009;5(6):19481955.

151

Bibliography [36] Ahmad S, Tester RF, Corbett A, Karkalas J. Dextran and 5-aminosalicylic acid (5-ASA) conjugates: synthesis, characterisation and enzymic hydrolysis. Carbohydrate Research. 2006;341(16):26942701. [37] Draye JP, Delaey B, de Voorde AV, Bulcke AVD, Reu BD, Schacht E. In vitro and in vivo biocompatibility of dextran dialdehyde cross-linked gelatin hydrogel lms. Biomaterials. 1998;19(18):16771687. [38] Ito T, Yeo Y, Highley CB, Bellas E, Kohane DS. Dextran-based in situ cross-linked injectable hydrogels to prevent peritoneal adhesions. Biomaterials. 2007;28(23):34183426. [39] Bhatia S, Arthur S, Chenault H, Kodokian G. Interactions of polysaccharidebased tissue adhesives with clinically relevant broblast and macrophage cell lines. Biotechnology Letters. 2007;29:16451649. [40] Harris J, Martin N, Modi M. Pegylation: A Novel Process for Modifying Pharmacokinetics. Clinical Pharmocokinetics. 2001;40(7):539551. [41] Levi-Schaer F, Bernstein A, Meshorer A, Arnon R. Reduced toxicity of daunorubicin by conjugation to dextran. Cancer Treatment Reports. 1982;66(1):107114. [42] Bapat N, Boroujerdi M. Eect of Colloidal Carriers on the Disposition and Tissue Uptake of Doxorubicin: I. Conjugation with Oxidized Dextran Particles. Drug Development and Industrial Pharmacy. 1993;19(20):26512665. [43] Betancor L, Lopez-Gallego F, Hidalgo A, Alonso-Morales N, Fuentes M, Fernandez-Lafuente R, et al. Prevention of interfacial inactivation of enzymes by coating the enzyme surface with dextran-aldehyde. Journal of Biotechnology. 2004;110(2):201207. [44] Betancor L, Hidalgo A, Fernndez-Lorente G, Mateo C, Fernndez-Lafuente R, Guisan JM. Preparation of a stable biocatalyst of bovine liver catalase using immobilization and postimmobilization techniques. Biotechnology Progress. 2003;19(3):763767. [45] Balco VM, Mateo C, Fernndez-Lafuente R, Malcata FX, Guisn JM. Structural and functional stabilization of L-asparaginase via multisubunit immobilization onto highly activated supports. Biotechnology Progress. 2001;17(3):537542. [46] Behe M, Du J, Becker W, Behr T, Angerstein C, Mrquez M, et al. Biodistribution, blood half-life, and receptor binding of a somatostatin-dextran conjugate. Medical Oncology. 2001;18(1):5964.

152

Bibliography [47] Wulbrand U, Feldman M, Pfestro A, Fehman HC, Du J, Hiltunen J, et al. A novel somatostatin conjugate with a high anity to all ve somatostatin receptor subtypes. Cancer. 2002;94:12931297. [48] Battersby J, Clark R, Hancock W, Puchulu-Campanella E, Haggarty N, Poll D, et al. Sustained release of recombinant human growth hormone from dextran via hydrolysis of an imine bond. Journal of Controlled Release. 1996;42(2):143156. [49] Hurwitz E, Maron R, Bernstein A, Wilchek M, Sela M, Arnon R. The eect in vivo of chemotherapeutic drugantibody conjugates in two murine experimental tumor systems. International Journal of Cancer. 1978;21(6):747755. [50] Tsukada Y, Bischof WK, Hibi N, Hirai H, Hurwitz E, Sela M. Eect of a conjugate of daunomycin and antibodies to rat alpha-fetoprotein on the growth of alpha-fetoprotein-producing tumor cells. Proceedings of the National Academy of Sciences. 1982;79(2):621625. [51] Tsukada Y, Hurwitz E, Kashi R, Sela M, Hibi N, Hara A, et al. Eect of a conjugate of daunomycin and puried polyclonal or monoclonal antibodies to rat alpha-fetoprotein on the growth of alpha-fetoprotein-producing tumor cells. Annals Of The New York Academy Of Sciences. 1983;417:262269. [52] Tsukada Y, Hurwitz E, Kashi R, Sela M, Hibi N, Hara A, et al. Chemotherapy by intravenous administration of conjugates of daunomycin with monoclonal and conventional anti-rat alpha-fetoprotein antibodies. Proceedings of the National Academy of Sciences. 1982;79(24):78967899. [53] Check E. A tragic setback. Nature. 2002;420(6912):116118. [54] Wong SY, Pelet JM, Putnam D. Polymer systems for gene delivery-past, present, and future. Progress in Polymer Science. 2007;32(8-9):799837. [55] Vicennati P, Giuliano A, Ortaggi G, Masotti A. Polyethylenimine in medicinal chemistry. Current Medicinal Chemistry. 2008;15(27):28262839. [56] Boussif O, Lezoualch F, Zanta MA, Mergny MD, Scherman D, Demeneix B, et al. A versatile vector for gene and oligonucleotide transfer into cells in culture and in vivo: polyethylenimine. Proceedings of the National Academy of Sciences. 1995;92(16):72977301. [57] Azzam T, Eliyahu H, Shapira L, Linial M, Barenholz Y, Domb AJ. Polysaccharideoligoamine based conjugates for gene delivery. Journal of Medicinal Chemistry. 2002;45(9):18171824.

153

Bibliography [58] Azzam T, Raskin A, Makovitzki A, Brem H, Vierling P, Lineal M, et al. Cationic polysaccharides for gene delivery. Macromolecules. 2002;35(27):99479953. [59] Azzam T, Eliyahu H, Makovitzki A, Domb A. Dextran-spermine conjugate: An ecient vector for gene delivery. Macromolecular Symposia. 2003;195:247261. [60] Eliyahu H, Joseph A, Azzam T, Barenholz Y, Domb AJ. Dextran-spermine-based polyplexesevaluation of transgene expression and of local and systemic toxicity in mice. Biomaterials. 2006;27(8):16361645. [61] Hosseinkhani H, Azzam T, Kobayashi H, Hiraoka Y, Shimokawa H, Domb AJ, et al. Combination of 3D tissue engineered scaold and non-viral gene carrier enhance in vitro DNA expression of mesenchymal stem cells. Biomaterials. 2006;27(23):4269 4278. [62] Yudovin-Farber I, Azzam T, Metzer E, Taraboulos A, Domb AJ. Cationic polysaccharides as antiprion agents. Journal of Medicinal Chemistry. 2005;48(5):1414 1420. [63] Tu J, Zhong S, Li P. Studies on acyclovir-dextran conjugate: Synthesis and pharmacokinetics. Drug Development and Industrial Pharmacy. 2004;30(9):959 965. [64] Schacht E, Ruys L, Vermeersch J, Remon J, Duncan R. Use of Polysaccharides as Drug Carriers, Dextran and Inulin Derivatives of Procainamide. Annals Of The New York Academy Of Sciences. 1985;446:199212. [65] Hudson SP, Langer R, Fink GR, Kohane DS. Injectable in situ cross-linking hydrogels for local antifungal therapy. Biomaterials. 2009;31(6):14441452. [66] Domb A, Linden G, Polacheck I, Benita S. Nystatin-dextran conjugates: Synthesis and characterization. Journal of Polymer Science: Part A: Polymer Science. 1996;34:12291236. [67] Marquez M, Nilsson S, Lennartsson L, Liu Z, Tammela T, Raitanen M, et al. Charge-dependent targeting: Results in six tumor cell lines. Anticancer Research. 2004;24(3A):13471351. [68] Mitra S, Gaur U, Ghosh PC, Maitra AN. Tumour targeted delivery of encapsulated dextran-doxorubicin conjugate using chitosan nanoparticles as carrier. Journal of Controlled Release. 2001;74(1-3):317323.

154

Bibliography [69] Agarwal A, Gupta U, Asthana A, Jain NK. Dextran conjugated dendritic nanoconstructs as potential vectors for anti-cancer agent. Biomaterials. 2009;30(21):3588 3596. [70] Wu H, Zhang Z, Wu D, Zhao H, Yu K, Hou Z. Preparation and drug release characteristics of Pingyangmycin-loaded dextran cross-linked gelatin microspheres for embolization therapy. Journal of Biomedical Materials Research Part B: Applied Biomaterials. 2006;78(1):5662. [71] Yuan X, Li H, Zhu X, Woo H. Self-aggregated nanoparticles composed of periodate-oxidized dextran and cholic acid: preparation, stabilization and in-vitro drug release. Journal of Chemical Technology and Biotechnology. 2006;81(5):746 754. [72] Ramirez H, Valdivia A, Cao R, Fragoso A, et al. Preparation of beta-CyclodextrinDextran Polymers and their Use as Supramolecular Carrier Systems for Naproxen. Polymer Bulletin. 2007;59:597605. [73] Cheung RY, Ying Y, Rauth AM, Marcon N, Wu XY. Biodegradable dextranbased microspheres for delivery of anticancer drug mitomycin C. Biomaterials. 2005;26(26):53755385. [74] Cheung RY, Rauth AM, Ronaldson PT, Bendayan R, Wu XY. In vitro toxicity to breast cancer cells of microsphere-delivered mitomycin C and its combination with doxorubicin. European Journal of Pharmaceutics and Biopharmaceutics. 2006;62(3):321331. [75] Gumargalieva K, Shipunova O, Zaikov G, Jubanov B, Moshkevitch S. Biodegradation of polymer compounds based on cross-linked dextrans. Polymer Degradation and Stability. 1996;51(1):5765. [76] Yoshitani N, Takasaki S. Microscale synthesis of dextran-based multivalent Nlinked oligosaccharide probes. Analytical Biochemistry. 2000;277(1):127134. [77] Sibikina OV, Novikova EV, Iozep AA, Iozep LI, Tikhomirova NG, Kozhevnikova LS. Reaction between dextran polyaldehyde and iron(III). Russian Journal of Applied Chemistry. 2007;80(2):341343. [78] Du J, Marquez M, Hiltunen J, Nilsson S, Holmberg AR. Radiolabeling of dextran with rhenium-188. Applied Radiation and Isotopes. 2000;53(3):443448. [79] Devakumar J, Mookambeswaran V. A novel anity-based controlled release sys-

155

Bibliography tem involving derivatives of dextran with enhanced osmotic activity. Bioconjugate Chemistry. 2007;18(2):477483. [80] Meurling L, Marquez M, Nilsson S, Holmberg AR. Polymer-conjugated guanidine is a potentially useful anti-tumor agent. International Journal of Oncology. 2009;35(2):281285. [81] Betancor L, Fuentes M, Dellamora-Ortiz G, Lopez-Gallego F, Hidalgo A, AlonsoMorales N, et al. Dextran aldehyde coating of glucose oxidase immobilized on magnetic nanoparticles prevents its inactivation by gas bubbles. Journal of Molecular Catalysis B: Enzymatic. 2005;32(3):97101. [82] Fuentes M, Segura R, Abian O, Betancor L, Hidalgo A, Mateo C, et al. Determination of protein-protein interactions through aldehyde-dextran intermolecular cross-linking. Proteomics. 2004;4(9):26022607. [83] Lenders JP, Germain P, Crichton RR. Immobilization of a soluble chemically thermostabilized enzyme. Biotechnology and Bioengineering. 1984;27(5):572578. [84] Siddiqui KS, Cavicchioli R. Improved thermal stability and activity in the coldadapted lipase B from Candida antarctica following chemical modication with oxidized polysaccharides. Extremophiles. 2005;9(6):471476. [85] Tam SC, Blumenstein J, Wong JT. Soluble dextran-hemoglobin complex as a potential blood substitute. Proceedings of the National Academy of Sciences. 1976;73(6):212831. [86] Klett D, Grandgeorge M, Dellacherie E. Fixation of aldehydic dextrans onto human deoxyhemoglobin. Biopolymers. 1992;32(5):517522. [87] Bonneaux F, Dellacherie E, Labrude P, Vigneron C. Hemoglobin-dialdehyde dextran conjugates: Improvement of their oxygen-binding properties with anionic groups. Journal of Protein Chemistry. 1996;15(5):461465. [88] Dellacherie E, Bonneaux F, Labrude P, Vigneron C. Modication of human hemoglobin by covalent association with soluble dextran. Biochimica et Biophysica Acta. 1983;749(1):106114. [89] Zambaux MF, Bonneaux F, Dellacherie E. Covalent xation of soluble derivatized dextrans to model proteins in low-concentration medium: application to factor IX and protein C. Journal of Protein Chemistry. 1998;17(3):27984.

156

Bibliography [90] Fagnani R, Hagan MS, Bartholomew R. Reduction of immunogenicity by covalent modication of murine and rabbit immunoglobulins with oxidized dextrans of low molecular weight. Cancer Research. 1990;50(12):363845. [91] Fagnani R, Halpern S, Hagan M. Altered pharmacokinetic and tumoor-localization properties of Fab fragments of a murine monoclonal anti-CEA antibody by covalent modication with low-molecular weight dextran. Nuclear Medicine Communications. 1995;16(5):362369. [92] Dillman RO, Shawler DL, Johnson DE, Meyer DL, Koziol JA, Frincke JM. Preclinical trials with combinations and conjugates of T101 monoclonal antibody and doxorubicin. Cancer Research. 1986;46(10):488691. [93] Hurwitz E, Kashi R, Arnon R, Wilchek M, Sela M. The covalent linking of two nucleotide analogues to antibodies. Journal of Medicinal Chemistry. 1985;28(1):137 40. [94] Pimm MV, Jones JA, Price MR, Middle JG, Embleton MJ, Baldwin RW. Tumour Localization of Monoclonal Antibody Against a Rat Mammary Carcinoma and Suppression of Tumour Growth with Adriamycin-antibody Conjugates. Cancer Immunology and Immunotherapy. 1982;12(2):125134. [95] Bue P, Mrquez M, Malmstrm PU, Westlin JE, Nilsson S, Holmberg AR. The potential of radiolabeled EGF-dextran conjugates in the treatment of urinary bladder carcinoma. Cancer. 1997;80(12 Sup):23852389. [96] Mrquez M, Westlin JE, Nilsson S, Holmberg AR. 99mTc-dextran-antibody conjugates. Labelling procedures. Acta Oncologica. 1996;35(4):48992. [97] Dobrev I, Karamancheva I. Solvatochromic Determination of Second-order Polarizabilities of Chromophore-functionalized Dextran and Amylose Derivatives. Supramolecular Chemistry. 2002;14(6):491495. [98] Jukes J, van der Aa H, Hiemstra C, van Veen T, Dijkstra P, Zhong Z, et al. A newly developed chemically crosslinked Dex-PEG hydrogel for cartilage tissue engineering. Tissue Engineering Part A. 2010;16(2):564573. [99] Brondsted H, Hovgaard L, Simonsen L. Dextran hydrogels for colon-specic drug delivery. II. Synthesis and characterization. European Journal of Pharmaceutics and Biopharmaceutics. 1996;42(1):8589. [100] Hennink WE, van Nostrum CF. Novel crosslinking methods to design hydrogels. Advanced Drug Delivery Reviews. 2002;54(1):1336.

157

Bibliography [101] Tomme SRV, Storm G, Hennink WE. In situ gelling hydrogels for pharmaceutical and biomedical applications. International Journal of Pharmaceutics. 2008;355(12):118. [102] Schacht E, Bogdanov B, den Bulcke AV, DeRooze N. Hydrogels prepared by crosslinking of gelatin with dextran dialdehyde. Reactive and Functional Polymers. 1997;33(2-3):109116. [103] Draye JP, Delaey B, de Voorde AV, Bulcke AVD, Bogdanov B, Schacht E. In vitro release characteristics of bioactive molecules from dextran dialdehyde cross-linked gelatin hydrogel lms. Biomaterials. 1998;19(1-3):99107. [104] Weng L, Chen X, Chen W. Rheological characterization of in situ crosslinkable hydrogels formulated from oxidized dextran and N-carboxyethyl chitosan. Biomacromolecules. 2007;8(4):11091115. [105] Weng L, Romanov A, Rooney J, Chen W. Non-cytotoxic, in situ gelable hydrogels composed of N-carboxyethyl chitosan and oxidized dextran. Biomaterials. 2008;29(29):39053913. [106] Cortesi R, Esposito E, Osti M, Menegatti E, Squarzoni G, Spencer D, et al. Dextran cross-linked gelatin microspheres as a drug delivery system. European Journal of Pharmaceutics and Biopharmaceutics. 1999;47(2):153160. [107] Lin W, Coombes AG, Garnett MC, Davies MC, Schacht E, Davis SS, et al. Preparation of sterically stabilized human serum albumin nanospheres using a novel Dextranox-MPEG crosslinking agent. Pharmaceutical Research. 1994;11(11):15881592. [108] Martwiset S, Koh AE, Chen W. Nonfouling characteristics of dextran-containing surfaces. Langmuir. 2006;22(19):81928196. [109] Massia SP, Stark J, Letbetter DS. Surface-immobilized dextran limits cell adhesion and spreading. Biomaterials. 2000;21(22):22532261. [110] Miksa D, Irish ER, Chen D, Composto R, Eckmann DM. Dextran functionalized surfaces via reductive amination: morphology, wetting, and adhesion. Biomacromolecules. 2006;7(2):557564. [111] Massia SP, Stark J. Immobilized RGD peptides on surface-grafted dextran promote biospecic cell attachment. Journal of Biomedical Materials Research. 2001;56(3):390399.

158

Bibliography [112] Massia SP, Holecko MM, Ehteshami GR. In vitro assessment of bioactive coatings for neural implant applications. Journal of Macromolecular Science, Part A. 2003;68(1):177186. [113] Klaver CL, Caplan MR. Bioactive surface for neural electrodes: decreasing astrocyte proliferation via transforming growth factor-beta1. Journal of Macromolecular Science, Part A. 2007;81(4):10111016. [114] Mahdavi A, Ferreira LS, Sundback C, Nichol JW, Chan EP, Carter DJD, et al. A biodegradable and biocompatible gecko-inspired tissue adhesive. Proceedings of the National Academy of Sciences. 2008;105(7):23072312. [115] Bogdanov B, Schacht E, Bulcke AVD. Thermal and rheological properties of gelatin-dextran hydrogels. Journal of Thermal Analysis and Calorimetry. 1997;49(2):847856. [116] Mo X, Iwata H, Matsuda S, Ikada Y. Soft tissue adhesive composed of modied gelatin and polysaccharides. Journal of Biomaterial Sciences - Polymer Edition. 2000;11(4):34151. [117] Liu Y, Chan-Park MB. Hydrogel based on interpenetrating polymer networks of dextran and gelatin for vascular tissue engineering. Biomaterials. 2009;30(2):196 207. [118] Ehrenfreund-Kleinman T, Domb A, Golenser J. Polysaccharide scaolds prepared by crosslinking of polysaccharides with chitosan or proteins for cell growth. Journal of Bioactive and Compatible Polymers. 2003;18(5):323338. [119] Liu G, Shi Z, Kuriger T, Hanton L, Simpson J, Moratti S, et al. Synthesis and Characterization of Chitosan/Dextran-Based Hydrogels for Surgical Use. Macromolecular Symposia. 2009;279:151157. [120] Homann B, Volkmer E, Kokott A, Augat P, Ohnmacht M, Sedlmayr N, et al. Characterisation of a new bioadhesive system based on polysaccharides with the potential to be used as bone glue. Journal of Materials Science - Materials in Medicine. 2009;20(10):20012009. [121] Artzi N, Shazly T, Baker AB, Bon A, Edelman ER. Aldehyde-Amine Chemistry Enables Modulated Biosealants with Tissue-Specic Adhesion. Advanced Materials. 2009;21(32-33):33993403. [122] Artzi N, Shazly T, Crespo C, Ramos AB, Chenault HK, Edelman ER. Characteriza-

159

Bibliography tion of Star Adhesive Sealants Based On PEG/Dextran Hydrogels. Macromolecular Bioscience. 2009;9(8):754765. [123] Shazly TM, Artzi N, Boehning F, Edelman ER. Viscoelastic adhesive mechanics of aldehyde-mediated soft tissue sealants. Biomaterials. 2008;29(35):45844591. [124] Bhatia SK, Arthur SD, Chenault HK, Figuly GD, Kodokian GK. Polysaccharidebased tissue adhesives for sealing corneal incisions. Current Eye Research. 2007;32(12):10451050. [125] Peng H, Shek P. Development of in situ-forming hydrogels for hemorrhage control. Journal of Materials Science - Materials in Medicine. 2009;20(8):17531762. [126] Stair JL, Watkinson M, Krause S. Sensor materials for the detection of proteases. Biosensors and Bioelectronics. 2009;24(7):21132118. [127] Cheung RY, Rauth AM, Wu XY. In vivo ecacy and toxicity of intratumorally delivered mitomycin C and its combination with doxorubicin using microsphere formulations. Anticancer Drugs. 2005;16(4):423433. [128] Hong X, Guo W, Yuang H, Li J, Liu Y, Ma L, et al. Periodate oxidation of nanoscaled magnetic dextran composites. Journal of Magnetism and Magnetic Materials. 2004;269(1):95100. [129] Reiner HGRH. HIO-4-oxidized soluble polysaccharides as polyfunctional links for covalent binding of enzymes, 1. Preparation of polysaccharides and matrices for their binding. Die Makromolekulare Chemie. 1981;182(6):16411648. [130] Dai L, StJohn H, Bi J, Zientek P, Chatelier R, Griesser H. Biomedical coatings by the covalent immobilization of polysaccharides onto gas-plasma-activated polymer surfaces. Surface and Interface Analysis. 2000;29(1):4655. [131] Avseenko NV, TYa M, Ataullakhanov FI, Morozov VN. Immobilization of proteins in immunochemical microarrays fabricated by electrospray deposition. Analytical Chemistry. 2001;73(24):60476052. [132] Penzol G, Armisen P, Fernandez-Lafuente R, Rodes L, Guisan J. Use of dextrans as long and hydrophilic spacer arms to improve the performance of immobilized proteins acting on macromolecules. Biotechnology and Bioengineering. 1998;60:518523. [133] Moser I, Dworsky P, Pittner F. Degradation of bacterial cell walls by immobilized lysozyme. Applied Biochemistry and Biotechnology. 1988;19(3):243249.

160

Bibliography [134] Fuentes M, Mateo C, Fernandez-Lafuente R, Guisan J. Aldehyde-dextran-protein conjugates to immobilize amino-haptens: avoiding cross-reactions in the immunodetection. Enzyme and Microbial Technology. 2005;36(4):510513. [135] Phelps EA, Garcia AJ. Update on therapeutic vascularization strategies. Regenerative Medicine. 2009;4(1):6580. [136] Jay SM, Shepherd BR, Andrejecsk JW, Kyriakides TR, Pober JS, Saltzman WM. Dual delivery of VEGF and MCP-1 to support endothelial cell transplantation for therapeutic vascularization. Biomaterials. 2010;31(11):305462. [137] Phelps EA, Landzuri N, Thul PM, Taylor WR, Garca AJ. Bioarticial matrices for therapeutic vascularization. Proceedings of the National Academy of Sciences. 2010;107(8):33238. [138] Pedroso DCS, Tellechea A, Moura L, Fidalgo-Carvalho I, Duarte J, Carvalho E, et al. Improved survival, vascular dierentiation and wound healing potential of stem cells co-cultured with endothelial cells. Accepted for publication in PLoS One. 2010;. [139] Silva EA, Kim ES, Kong HJ, Mooney DJ. Material-based deployment enhances ecacy of endothelial progenitor cells. Proceedings of the National Academy of Sciences. 2008;105(38):1434714352. [140] Carmeliet P. Angiogenesis in health and disease. Nature Medicine. 2003;9(6):653 660. [141] Folkman J, Merler E, Abernathy C, Williams G. Isolation of a tumor factor responsible for angiogenesis. Journal of Experimental Medicine. 1971;133(2):275288. [142] Ferrara N, Gerber HP, LeCouter J. The biology of VEGF and its receptors. Nature Medicine. 2003;9(6):66976. [143] Senger DR, Galli SJ, Dvorak AM, Perruzzi CA, Harvey VS, Dvorak HF. Tumor cells secrete a vascular permeability factor that promotes accumulation of ascites uid. Science. 1983;219(4587):983985. [144] Leung DW, Cachianes G, Kuang WJ, Goeddel DV, Ferrara N. Vascular endothelial growth factor is a secreted angiogenic mitogen. Science. 1989;246(4935):1306 1309. [145] Ferrara N. VEGF and the quest for tumour angiogenesis factors. Nature Reviews Cancer. 2002;2(10):795803.

161

Bibliography [146] Ferrara N, Hillan KJ, Gerber HP, Novotny W. Discovery and development of bevacizumab, an anti-VEGF antibody for treating cancer. Nature Reviews Drug Discovery. 2004;3(5):391400. [147] Hanft JR, Pollak RA, Barbul A, van Gils C, Kwon PS, Gray SM, et al. Phase I trial on the safety of topical rhVEGF on chronic neuropathic diabetic foot ulcers. Journal of Wound Care. 2008;17(1):3037. [148] Henry TD, Annex BH, McKendall GR, Azrin MA, Lopez JJ, Giordano FJ, et al. The VIVA trial: Vascular endothelial growth factor in Ischemia for Vascular Angiogenesis. Circulation. 2003;107(10):13591365. [149] Murukesh N, Dive C, Jayson GC. Biomarkers of angiogenesis and their role in the development of VEGF inhibitors. British Journal of Cancer. 2010;102(1):818. [150] Ferrara N. Vascular Endothelial Growth Factor: Basic Science and Clinical Progress. Endocrine Reviews. 2004;25(4):581611. [151] Tischer E, Mitchell R, Hartman T, Silva M, Gospodarowicz D, Fiddes JC, et al. The human gene for vascular endothelial growth factor. Multiple protein forms are encoded through alternative exon splicing. Journal of Biological Chemistry. 1991;266(18):1194711954. [152] Houck KA, Ferrara N, Winer J, Cachianes G, Li B, Leung DW. The vascular endothelial growth factor family: identication of a fourth molecular species and characterization of alternative splicing of RNA. Molecular Endocrinology. 1991;5(12):18061814. [153] Park JE, Keller GA, Ferrara N. The vascular endothelial growth factor (VEGF) isoforms: dierential deposition into the subepithelial extracellular matrix and bioactivity of extracellular matrix-bound VEGF. Molecular Biology of the Cell. 1993;4(12):131726. [154] Houck KA, Leung DW, Rowland AM, Winer J, Ferrara N. Dual regulation of vascular endothelial growth factor bioavailability by genetic and proteolytic mechanisms. Journal of Biological Chemistry. 1992;267(36):2603126037. [155] Ferrara N. Binding to the extracellular matrix and proteolytic processing: two key mechanisms regulating vascular endothelial growth factor action. Molecular Biology of the Cell. 2010;21(5):68790. [156] Park JE, Chen HH, Winer J, Houck KA, Ferrara N. Placenta growth factor. Potentiation of vascular endothelial growth factor bioactivity, in vitro and in vivo,

162

Bibliography and high anity binding to Flt-1 but not to Flk-1/KDR. Journal of Biological Chemistry. 1994;269(41):2564654. [157] Gerber H, McMurtrey A, Kowalski J, Yan M, Keyt B, Dixit V, et al. Vascular endothelial growth factor regulates endothelial cell survival through the phosphatidylinositol 3 -kinase Akt signal transduction pathway - Requirement for Flk1/KDR activation. Journal of Biological Chemistry. 1998;273(46):3033630343. [158] Waltenberger J, Claesson-Welsh L, Siegbahn A, Shibuya M, Heldin CH. Dierent signal transduction properties of KDR and Flt1, two receptors for vascular endothelial growth factor. Journal of Biological Chemistry. 1994;269(43):2698895. [159] Takahashi T, Ueno H, Shibuya M. VEGF activates protein kinase C-dependent, but Ras-independent Raf-MEK-MAP kinase pathway for DNA synthesis in primary endothelial cells. Oncogene. 1999;18(13):222130. [160] Carmeliet P, Tessier-Lavigne M. Common mechanisms of nerve and blood vessel wiring. Nature. 2005;436(7048):193200. [161] Lee S, Chen TT, Barber CL, Jordan MC, Murdock J, Desai S, et al. Autocrine VEGF signaling is required for vascular homeostasis. Cell. 2007;130(4):691703. [162] Kilic E, Kilic U, Wang Y, Bassetti CL, Marti HH, Hermann DM. The phosphatidylinositol-3 kinase/Akt pathway mediates VEGFs neuroprotective activity and induces blood brain barrier permeability after focal cerebral ischemia. FASEB Journal. 2006;20(8):11857. [163] Chen TT, Luque A, Lee S, Anderson SM, Segura T, Iruela-Arispe ML. Anchorage of VEGF to the extracellular matrix conveys dierential signaling responses to endothelial cells. Journal of Biological Chemistry. 2010;188(4):595609. [164] Eppler SM, Combs DL, Henry TD, Lopez JJ, Ellis SG, Yi JH, et al. A targetmediated model to describe the pharmacokinetics and hemodynamic eects of recombinant human vascular endothelial growth factor in humans. Clinical Pharmacology Therapeutics. 2002;72(1):2032. [165] Carmeliet P. Mechanisms of angiogenesis and arteriogenesis. Nature Medicine. 2000;6(4):389395. [166] Richardson TP, Peters MC, Ennett AB, Mooney DJ. Polymeric system for dual growth factor delivery. Nature Biotechnology. 2001;19(11):102934. [167] Asahara T, Kawamoto A. Endothelial progenitor cells for postnatal vasculogenesis. American Journal of Physiology, Cell Physiology. 2004;287(3):C572C579.

163

Bibliography [168] Asahara T, Takahashi T, Masuda H, Kalka C, Chen D, Iwaguro H, et al. VEGF contributes to postnatal neovascularization by mobilizing bone marrow-derived endothelial progenitor cells. EMBO Journal. 1999;18(14):39643972. [169] Kalka C, Masuda H, Takahashi T, Kalka-Moll WM, Silver M, Kearney M, et al. Transplantation of ex vivo expanded endothelial progenitor cells for therapeutic neovascularization. Proceedings of the National Academy of Sciences. 2000;97(7):34227. [170] Fischbach C, Mooney DJ. Polymeric systems for bioinspired delivery of angiogenic molecules. Advances in Polymer Science. 2006;203:191221. [171] Caspi O, Lesman A, Basevitch Y, Gepstein A, Arbel G, Habib IHM, et al. Tissue engineering of vascularized cardiac muscle from human embryonic stem cells. Circulation Research. 2007;100(2):263272. [172] Morritt AN, Bortolotto SK, Dilley RJ, Han X, Kompa AR, McCombe D, et al. Cardiac tissue engineering in an in vivo vascularized chamber. Circulation. 2007;115(3):35360. [173] Ji JA, Liu J, Shire SJ, Kamerzell TJ, Hong S, Billeci K, et al. Characteristics of rhVEGF Release from Topical Hydrogel Formulations. Pharmaceutical Research. 2010;27(4):64454. [174] Sun G, Shen YI, Ho CC, Kusuma S, Gerecht S. Functional groups aect physical and biological properties of dextran-based hydrogels. Journal of Biomedical Materials Research: Part A. 2009;93(3):108090. [175] Sharon JL, Puleo DA. Immobilization of glycoproteins, such as VEGF, on biodegradable substrates. Acta Biomaterialia. 2008;4(4):101623. [176] Shen YH, Shoichet MS, Radisic M. Vascular endothelial growth factor immobilized in collagen scaold promotes penetration and proliferation of endothelial cells. Acta Biomaterialia. 2008;4(3):47789. [177] la Riva BD, Nowak C, Snchez E, Hernndez A, Schulz-Siegmund M, Pec MK, et al. VEGF-controlled release within a bone defect from alginate/chitosan/PLAH scaolds. European Journal of Pharmaceutics and Biopharmaceutics. 2009;73(1):508. [178] Lode A, Wolf-Brandstetter C, Reinstorf A, Bernhardt A, Knig U, Pompe W, et al. Calcium phosphate bone cements, functionalized with VEGF: release ki-

164

Bibliography netics and biological activity. Journal of Biomedical Materials Research: Part A. 2007;81(2):47483. [179] Lode A, Reinstorf A, Bernhardt A, Wolf-Brandstetter C, Knig U, Gelinsky M. Heparin modication of calcium phosphate bone cements for VEGF functionalization. Journal of Biomedical Materials Research: Part A. 2008;86(3):74959. [180] Peattie RA, Rieke ER, Hewett EM, Fisher RJ, Shu XZ, Prestwich GD. Dual growth factor-induced angiogenesis in vivo using hyaluronan hydrogel implants. Biomaterials. 2006;27(9):186875. [181] Pike DB, Cai S, Pomraning KR, Firpo MA, Fisher RJ, Shu XZ, et al. Heparinregulated release of growth factors in vitro and angiogenic response in vivo to implanted hyaluronan hydrogels containing VEGF and bFGF. Biomaterials. 2006;27(30):524251. [182] Hosack L, Firpo M, Scott J, Prestwich G, Peattie R. Microvascular maturity elicited in tissue treated with cytokine-loaded hyaluronan-based hydrogels. Biomaterials. 2008;29(15):233647. [183] Roca C, Adams RH. Regulation of vascular morphogenesis by Notch signaling. Genes and Development. 2007;21(20):251124. [184] Cao L, Arany P, Wang Y, Mooney DJ. Promoting angiogenesis via manipulation of VEGF responsiveness with notch signaling. Biomaterials. 2009;30(25):40854093. [185] Ehrbar M, Zeisberger SM, Raeber GP, Hubbell J, Schnell C, Zisch AH. The role of actively released brin-conjugated VEGF for VEGF receptor 2 gene activation and the enhancement of angiogenesis. Biomaterials. 2008;29(11):17209. [186] Ehrbar M, Metters AT, Zammaretti P, Hubbell J, Zisch AH. Endothelial cell proliferation and progenitor maturation by brin-bound VEGF variants with differential susceptibilities to local cellular activity. Journal of Controlled Release. 2005;101(1-3):93109. [187] Ehrbar M, Djonov VG, Schnell C, Tschanz SA, Martiny-Baron G, Schenk U, et al. Cell-demanded liberation of VEGF121 from brin implants induces local and controlled blood vessel growth. Circulation Research. 2004;94(8):112432. [188] Yamaguchi N, Zhang L, Chae BS, Palla CS, Furst EM, Kiick KL. Growth factor mediated assembly of cell receptor-responsive hydrogels. Journal of the American Chemical Society. 2007;129(11):30401.

165

Bibliography [189] Leslie-Barbick JE, Moon JJ, West JL. Covalently-Immobilized Vascular Endothelial Growth Factor Promotes Endothelial Cell Tubulogenesis in Poly(ethylene glycol) Diacrylate Hydrogels. Journal of Biomaterial Sciences - Polymer Edition. 2009;20(12):17631779. [190] Chiang CK, Chowdhury MF, Iyer RK, Stanford WL, Radisic M. Engineering surfaces for site-specic vascular dierentiation of mouse embryonic stem cells. Acta Biomaterialia. 2010;6(6):19041916. [191] Chiu L, Radisic M. Scaolds with covalently immobilized VEGF and Angiopoietin1 for vascularization of engineered tissues. Biomaterials. 2010;31(2):226241. [192] Koch S, Yao C, Grieb G, Prvel P, Noah EM, Steens GCM. Enhancing angiogenesis in collagen matrices by covalent incorporation of VEGF. Journal of Materials Science - Materials in Medicine. 2006;17(8):73541. [193] Yao C, Roderfeld M, Rath T, Roeb E, Bernhagen J, Steens G. The impact of proteinase-induced matrix degradation on the release of VEGF from heparinized collagen matrices. Biomaterials. 2006;27(8):160816. [194] Kanczler JM, Ginty PJ, Barry JJA, Clarke NMP, Howdle SM, Shakeshe KM, et al. The eect of mesenchymal populations and vascular endothelial growth factor delivered from biodegradable polymer scaolds on bone formation. Biomaterials. 2008;29(12):1892900. [195] Silva EA, Mooney DJ. Spatiotemporal control of vascular endothelial growth factor delivery from injectable hydrogels enhances angiogenesis. Journal of Thrombosis and Haemostasis. 2007;5(3):590598. [196] Silva EA, Mooney DJ. Eects of VEGF temporal and spatial presentation on angiogenesis. Biomaterials. 2010;31(6):12351241. [197] Freeman I, Cohen S. The inuence of the sequential delivery of angiogenic factors from anity-binding alginate scaolds on vascularization. Biomaterials. 2009;30(11):212231. [198] Jay SM, Saltzman WM. Controlled delivery of VEGF via modulation of alginate microparticle ionic crosslinking. Journal of Controlled Release. 2009;134(1):2634. [199] Ennett AB, Kaigler D, Mooney DJ. Temporally regulated delivery of VEGF in vitro and in vivo. Journal of Biomedical Materials Research: Part A. 2006;79(1):176 184.

166

Bibliography [200] Lee J, Lee K. Local and Sustained Vascular Endothelial Growth Factor Delivery for Angiogenesis Using an Injectable System. Pharmaceutical Research. 2009;26(7):17391744. [201] Chung YI, Kim SK, Lee YK, Park SJ, Cho KO, Yuk SH, et al. Ecient revascularization by VEGF administration via heparin-functionalized nanoparticle-brin complex. Journal of Controlled Release. 2010;143(3):2829. [202] Vallbacka JJ, Sefton MV. Vascularization and Improved In Vivo Survival of VEGF-Secreting Cells Microencapsulated in HEMA-MMA. Tissue Engineering. 2007;13(9):225969. [203] Huang M, Vitharana SN, Peek LJ, Coop T, Berkland C. Polyelectrolyte complexes stabilize and controllably release vascular endothelial growth factor. Biomacromolecules. 2007;8(5):16071614. [204] Rocha F, Sundback C, Krebs N, Leach J, Mooney DJ, Ashley S, et al. The eect of sustained delivery of vascular endothelial growth factor on angiogenesis in tissue-engineered intestine. Biomaterials. 2008;29(19):28842890. [205] Schmidt D, Breymann C, Weber A, Guenter CI, Neuenschwander S, Zund G, et al. Umbilical cord blood derived endothelial progenitor cells for tissue engineering of vascular grafts. Annals of Thoracic Surgery. 2004;78(6):20942098. [206] Kupatt C, Horstkotte J, Vlastos G, Pfosser A, Lebherz C, Semisch M, et al. Embryonic endothelial progenitor cells expressing a broad range of proangiogenic and remodeling factors enhance vascularization and tissue recovery in acute and chronic ischemia. FASEB Journal. 2005;19(9):15761578. [207] Ziebart T, Yoon CH, Trepels T, Wietelmann A, Braun T, Kiessling F, et al. Sustained Persistence of Transplanted Proangiogenic Cells Contributes to Neovascularization and Cardiac Function After Ischemia. Circulation Research. 2008;103(11):13271334. [208] Kawamoto A, Asahara T, Losordo DW. Transplantation of endothelial progenitor cells for therapeutic neovascularization. Cardiovascular Radiation Medicine. 2002;3(3-4):221225. [209] Taguchi A, Soma T, Tanaka H, Kanda T, Nishimura H, Yoshikawa H, et al. Administration of CD34+ cells after stroke enhances neurogenesis via angiogenesis in a mouse model. Journal of Clinical Investigation. 2004;114(3):330338.

167

Bibliography [210] Kocher AA, Schuster MD, Szabolcs MJ, Takuma S, Burkho D, Wang J, et al. Neovascularization of ischemic myocardium by human bone-marrow-derived angioblasts prevents cardiomyocyte apoptosis, reduces remodeling and improves cardiac function. Nature Medicine. 2001;7(4):430436. [211] Ferreira LS, Gerecht S, Shieh HF, Watson N, Rupnick MA, Dallabrida SM, et al. Vascular progenitor cells isolated from human embryonic stem cells give rise to endothelial and smooth muscle like cells and form vascular networks in vivo. Circulation Research. 2007;101(3):28694. [212] Homan LM, Carpenter MK. Characterization and culture of human embryonic stem cells. Nature Biotechnology. 2005;23(6):699708. [213] Ferreira LS, Squier T, Park H, Choe H, Kohane DS, Langer R. Human embryoid bodies containing nano- and microparticulate delivery vehicles. Advanced Materials. 2008;20(12):22852292. [214] Gerecht S, Burdick JA, Ferreira LS, Townsend SA, Langer R, Vunjak-Novakovic G. Hyaluronic acid hydrogel for controlled self-renewal and dierentiation of human embryonic stem cells. Proceedings of the National Academy of Sciences. 2007;104(27):11298303. [215] Rahman N, Purpura KA, Wylie RG, Zandstra PW, Shoichet MS. The use of vascular endothelial growth factor functionalized agarose to guide pluripotent stem cell aggregates toward blood progenitor cells. Biomaterials. 2010;31(32):8262 8270. [216] Ferreira LS, Gerecht S, Fuller J, Shieh HF, Vunjak-Novakovic G, Langer R. Bioactive hydrogel scaolds for controllable vascular dierentiation of human embryonic stem cells. Biomaterials. 2007;28(17):270617. [217] Murday JS, Siegel RW, Stein J, Wright JF. Translational nanomedicine: status assessment and opportunities. Nanomedicine: Nanotechnology, Biology, and Medicine. 2009;5(3):25173. [218] Lin W, Coombes AG, Davies MC, Davis SS, Illum L. Preparation of sub-100 nm human serum albumin nanospheres using a pH-coacervation method. Journal of Drug Targeting. 1993;1(3):23743. [219] Gao X, Cui Y, Levenson RM, Chung LWK, Nie S. In vivo cancer targeting and imaging with semiconductor quantum dots. Nature Biotechnology. 2004;22(8):96976.

168

Bibliography [220] Gao J, Zhang W, Huang P, Zhang B, Zhang X, Xu B. Intracellular spatial control of uorescent magnetic nanoparticles. Journal of the American Chemical Society. 2008;130(12):37103711. [221] Byrne MT, Gunko YK. Recent Advances in Research on Carbon NanotubePolymer Composites. Advanced Materials. 2010;22(15):16721688. [222] Kim TG, Park TG. Surface functionalized electrospun biodegradable nanobers for immobilization of bioactive molecules. Biotechnology Progress. 2006;22(4):1108 13. [223] Gao J, Xu B. Applications of nanomaterials inside cells. 2009;4(1):3751. Nano Today.

[224] Fahmy T, Fong P, Goyal A, Saltzman W. Targeted for drug delivery. Materials Today. 2005;8(8, Supplement 1):1826. [225] Zhang S, Uluda H. Nanoparticulate systems for growth factor delivery. Pharmaceutical Research. 2009;26(7):156180. [226] Quintanar-Guerrero D, Allmann E, Fessi H, Doelker E. Preparation techniques and mechanisms of formation of biodegradable nanoparticles from preformed polymers. Drug Development and Industrial Pharmacy. 1998;24(12):111328. [227] Ye S, Wang C, Liu X, Tong Z. Multilayer nanocapsules of polysaccharide chitosan and alginate through layer-by-layer assembly directly on PS nanoparticles for release. Journal of Biomaterials Science - Polymer Ed. 2005;16(7):90923. [228] Thienen TV, Lucas B, Flesch F, van Nostrum C, Demeester J, Smedt SD. On the synthesis and characterization of biodegradable dextran nanogels with tunable degradation properties. Macromolecules. 2005;38(20):85038511. [229] Lemarchand C, Gref R, Passirani C, Garcion E, Petri B, Mller R, et al. Inuence of polysaccharide coating on the interactions of nanoparticles with biological systems. Biomaterials. 2006;27(1):10818. [230] Aggarwal P, Hall J, McLeland C, Dobrovolskaia M, McNeil S. Nanoparticle interaction with plasma proteins as it relates to particle biodistribution, biocompatibility and therapeutic ecacy. Advanced Drug Delivery Reviews. 2009;61(6):428437. [231] Walczyk D, Bombelli FB, Monopoli MP, Lynch I, Dawson KA. What the cell "sees" in bionanoscience. Journal of the American Chemical Society. 2010;132(16):5761 8.

169

Bibliography [232] Hu Y, Litwin T, Nagaraja AR, Kwong B, Katz J, Watson N, et al. Cytosolic delivery of membrane-impermeable molecules in dendritic cells using pH-Responsive coreshell nanoparticles. Nano Letters. 2007;7(10):30563064. [233] Elbert DL, Hubbell J. Conjugate addition reactions combined with free-radical cross-linking for the design of materials for tissue engineering. Biomacromolecules. 2001;2(2):43041. [234] Weng L, Pan H, Chen W. Self-crosslinkable hydrogels composed of partially oxidized hyaluronan and gelatin: in vitro and in vivo responses. Journal of Biomedical Materials Research: Part A. 2008;85(2):35265. [235] Kolb HC, Finn MG, Sharpless KB. Click Chemistry: Diverse Chemical Function from a Few Good Reactions. Angewandte Chemie Int Edit. 2001;40(11):2004 2021. [236] Malkoch M, Vestberg R, Gupta N, Mespouille L, Dubois P, Mason AF, et al. Synthesis of well-dened hydrogel networks using Click chemistry. Chemical Communication. 2006;(26):27742776. [237] Slager J, Domb AJ. Stereocomplexes based on poly(lactic acid) and insulin: formulation and release studies. Biomaterials. 2002;23(22):43894396. [238] Tiyaboonchai W, Woiszwillo J, Middaugh CR. Formulation and characterization of DNA-polyethylenimine-dextran sulfate nanoparticles. European Journal of Pharmaceutical Sciences. 2003;19(4):191202. [239] Khutoryanskaya O, Williams A, Khutoryanskiy V. pH-Mediated Interactions between Poly (acrylic acid) and Methylcellulose in the Formation of Ultrathin Multilayered Hydrogels and Spherical Nanoparticles. Macromolecules. 2007;40(21):77077713. [240] Thomas JA. Locking self-assembly: strategies and outcomes. Chemical Society Reviews. 2007;36(6):85668. [241] Grenha A, Gomes ME, Rodrigues M, Santo VE, Mano JF, Neves NM, et al. Development of new chitosan/carrageenan nanoparticles for drug delivery applications. Journal of Biomedical Materials Research: Part A. 2010;92(4):126572. [242] Boddohi S, Moore N, Johnson P, Kipper M. Polysaccharide-Based Polyelectrolyte Complex Nanoparticles from Chitosan, Heparin, and Hyaluronan. Biomacromolecules. 2009;10(6):14021409.

170

Bibliography [243] Tiyaboonchai W, Woiszwillo J, Sims RC, Middaugh CR. Insulin containing polyethylenimine-dextran sulfate nanoparticles. International Journal of Pharmaceutics. 2003;255(1-2):13951. [244] Tiyaboonchai W, Woiszwillo J, Middaugh C. Formulation and characterization of amphotericin B-polyethylenimine-dextran sulfate nanoparticles. Journal of Phamaceutical Sciences. 2001;90(7):902914. [245] Akiyoshi K, Kobayashi S, Shichibe S, Mix D, Baudys M, Kim SW, et al. Selfassembled hydrogel nanoparticle of cholesterol-bearing pullulan as a carrier of protein drugs: complexation and stabilization of insulin. Journal of Controlled Release. 1998;54(3):313320. [246] Choi KY, Min KH, Na JH, Choi K, Kim K, Park JH, et al. Self-assembled hyaluronic acid nanoparticles as a potential drug carrier for cancer therapy: synthesis, characterization, and in vivo biodistribution. Journal of Materials Science. 2009;. [247] Tang M, Dou H, Sun K. One-step synthesis of dextran-based stable nanoparticles assisted by self-assembly. Polymer. 2006;47(2):728734. [248] Jhaveri SB, Carter KR. Triggered decomposition of polymeric nanoparticles. Macromolecules. 2007;40(22):78747877. [249] Huang X, Zhuang J, Chen D, Liu H, Tang F, Yan X, et al. General Strategy for Designing Functionalized Magnetic Microspheres for Dierent Bioapplications. Langmuir. 2009;25(19):1165711663. [250] Leobandung W, Ichikawa H, Fukumori Y, Peppas N. Preparation of stable insulinloaded nanospheres of poly(ethylene glycol) macromers and N-isopropyl acrylamide. Journal of Controlled Release. 2002;80(1-3):357363. [251] Steinhauser I, Spnkuch B, Strebhardt K, Langer K. Trastuzumab-modied nanoparticles: optimisation of preparation and uptake in cancer cells. Biomaterials. 2006;27(28):497583. [252] Green JJ, Chiu E, Leshchiner ES, Shi J, Langer R, Anderson DG. Electrostatic ligand coatings of nanoparticles enable ligand-specic gene delivery to human primary cells. Nano Letters. 2007;7(4):8749. [253] Rothenuh DA, Bermudez H, ONeil CP, Hubbell J. Biofunctional polymer nanoparticles for intra-articular targeting and retention in cartilage. Nature Materials. 2008;7(3):24854.

171

Bibliography [254] Homan AS. The origins and evolution of "controlled" drug delivery systems. Journal of Controlled Release. 2008;132(3):153163. [255] Dinbergs ID, Brown L, Edelman ER. Cellular response to transforming growth factor-beta1 and basic broblast growth factor depends on release kinetics and extracellular matrix interactions. Journal of Biological Chemistry. 1996;271(47):298229. [256] Bowen-Pope DF, Malpass TW, Foster DM, Ross R. Platelet-derived growth factor in vivo: levels, activity, and rate of clearance. Blood. 1984;64(2):45869. [257] Cleland J, Duenas ET, Park A, Daugherty AL, Kahn J, Kowalski J, et al. Development of poly-(D,L-lactide-coglycolide) microsphere formulations containing recombinant human vascular endothelial growth factor to promote local angiogenesis. Journal of Controlled Release. 2001;72(1-3):1324. [258] King TW, Patrick CW. Development and in vitro characterization of vascular endothelial growth factor (VEGF)-loaded poly(DL-lactic-co-glycolic acid)/poly(ethylene glycol) microspheres using a solid encapsulation/single emulsion/solvent extraction technique. Journal of Biomedical Materials Research. 2000;51(3):38390. [259] Gu F, Amsden B, Neufeld R. Sustained delivery of vascular endothelial growth factor with alginate beads. Journal of Controlled Release. 2004;96(3):46372. [260] Chung YI, Tae G, Yuk SH. A facile method to prepare heparinfunctionalized nanoparticles for controlled release of growth factors. Biomaterials. 2006;27(12):26216. [261] Oh KS, Han SK, Lee HS, Koo HM, Kim RS, Lee KE, et al. Core/Shell nanoparticles with lecithin lipid cores for protein delivery. Biomacromolecules. 2006;7(8):23627. [262] Duester G. Retinoic acid synthesis and signaling during early organogenesis. Cell. 2008;134(6):92131. [263] Clarke N, Germain P, Altucci L, Gronemeyer H. Retinoids: potential in cancer prevention and therapy. Expert Reviews in Molecular Medicine. 2004;6(25):123. [264] Szuts EZ, Harosi FI. Solubility of retinoids in water. Archives of Biochemistry and Biophysics. 1991;287(2):297304. [265] Thunemann A, Beyermann J, von Ferber C, Lowen H. Immobilization of retinoic acid by polyamino acids: Lamellar-structured nanoparticles. Langmuir. 2000;16(2):850857.

172

Bibliography [266] Thunemann A, Beyermann J. Polyethylenimine complexes with retinoic acid: Structure, release proles, and nanoparticles. Macromolecules. 2000;33(18):6878 6885. [267] Thunemann A, Beyermann J, Kukula H. Poly(ethylene oxide)-b-poly(L-lysine) complexes with retinoic acid. Macromolecules. 2000;33(16):59065911. [268] Kim D, Choi C, Jeong Y, Jang M, Nah J, Kang S, et al. All-trans retinoic acidassociated low molecular weight water-soluble chitosan nanoparticles based on ion complex. Macromolecular Research. 2006;14(1):6672. [269] Park JS, Koh YS, Bang JY, Jeong YI, Lee JJ. Antitumor eect of all-trans retinoic acid-encapsulated nanoparticles of methoxy poly(ethylene glycol)-conjugated chitosan against CT-26 colon carcinoma in vitro. Journal of Phamaceutical Sciences. 2008;97(9):40119. [270] Kim DG, Jeong YI, Nah JW. All-trans retinoic acid release from polyion-complex micelles of methoxy poly(ethylene glycol) grafted chitosan. Journal Applied Polymer Science. 2007;105(6):32463254. [271] Vasir JK, Labhasetwar V. Biodegradable nanoparticles for cytosolic delivery of therapeutics. Advanced Drug Delivery Reviews. 2007;59(8):718728. [272] Ferreira LS. Nanoparticles as tools to study and control stem cells. Journal of Cellular Biochemistry. 2009;108(4):74652. [273] Bale SS, Kwon SJ, Shah DA, Banerjee A, Dordick JS, Kane RS. Nanoparticlemediated cytoplasmic delivery of proteins to target cellular machinery. ACS nano. 2010;4(3):14931500. [274] Breunig M, Bauer S, Goepferich A. Polymers and nanoparticles: intelligent tools for intracellular targeting? European Journal of Pharmaceutics and Biopharmaceutics. 2008;68(1):112128. [275] Wan ACA, Ying JY. Nanomaterials for in situ cell delivery and tissue regeneration. Advanced Drug Delivery Reviews. 2010;62(7-8):731740. [276] Hu Z, Lu X, Gao J, Wang C. Polymer gel nanoparticle networks. Advanced Materials. 2000;12(16):11731176. [277] Wu Y, Zhou Z, Fan Q, Chen L, Zhu M. Facile in-situ fabrication of novel organic nanoparticle hydrogels with excellent mechanical properties. Journal of Materials Science. 2009;19:73407346.

173

Bibliography [278] Wang C, Flynn N, Langer R. Controlled structure and properties of thermoresponsive nanoparticle-hydrogel composites. Advanced Materials. 2004;16(13):1074 1079. [279] Bencherif SA, Washburn NR, Matyjaszewski K. Synthesis by AGET ATRP of degradable nanogel precursors for in situ formation of nanostructured hyaluronic acid hydrogel. Biomacromolecules. 2009;10(9):24992507. [280] Yang Z, Ding J. A thermosensitive and biodegradable physical gel with chemically crosslinked nanogels as the building block. Macromolecular Rapid Communications. 2008;29(9):751756. [281] Klajn R, Bishop KJM, Grzybowski BA. Light-controlled self-assembly of reversible and irreversible nanoparticle suprastructures. Proceedings of the National Academy of Sciences. 2007;104(25):103059. [282] Guthrie R. The" dialdehydes" from the periodate oxidation of carbohydrates. Advances in Carbohydrate Chemistry. 1961;16:105158. [283] Novikova E, Tishchenko E, Iozep A, Passet B. Inuence of Synthesis and Isolation Conditions on Properties of Dextran Polyaldehyde. Russian Journal of Applied Chemistry. 2002;75(6):985988. [284] Aalmo KM, Grasdalen H, Painter T, Krane J. Characterization by 1H- and 13CNMR spectroscopy of the products from oxidation of methyl alfa-and beta-Dgalactopyranoside with periodic acid in dimethyl sulfoxide. Carbohydrate Research. 1981;91(1):111. [285] Basedow A, Ebert K, Ederer H. Kinetic Studies on the Acid Hydrolysis of Dextran. Macromolecules. 1978;11(4):774781. [286] Ioan C, Aberle T, Burchard W. Structure properties of dextran. 2. Dilute solution. Macromolecules. 2000;33(15):57305739. [287] Xu X, Li H, Zhang Z, Qi X. Hydrodynamic properties of aqueous dextran solutions. Journal of Applied Polymer Science. 2009;111(3):15231529. [288] Jones D. Dynamic mechanical analysis of polymeric systems of pharmaceutical and biomedical signicance. International Journal of Pharmaceutics. 1999;179(2):167 178. [289] Scandola M, Ceccorulli G, Pizzoli M. Molecular motions of polysaccharides in the solid state: dextran, pullulan and amylose. International Journal of Biological Macromolecules. 1991;13(4):254260.

174

Bibliography [290] Coelho JFJ, Carreira M, Goncalves PMOF, Popov AV, Gil MH. Processability and characterization of poly(vinyl chloride)-b-poly(n-butyl acrylate)-b-poly(vinyl chloride) prepared by living radical polymerization of vinyl chloride. Comparison with a exible commercial resin formulation prepared with PVC and dioctyl phthalate. Journal of Vinyl and Additive Technology. 2006;12(4):156165. [291] Icoz D, Moraru C, Kokini J. Polymer-polymer interactions in dextran systems using thermal analysis. Carbohydrate Polymers. 2005;62(2):120129. [292] Izutsu K, Heller M, Randolph T, Carpenter J. Eect of salts and sugars on phase separation of polyvinylpyrrolidone-dextran solutions induced by freeze-concentration. Journal of the Chemical Society, Faraday Transactions. 1998;94(3):411417. [293] Randolph T. Phase separation of excipients during lyophilization: Eects on protein stability. Journal of Pharmaceutical Sciences. 1997;86(11):11981203. [294] Katsikas L, Jeremic K, Jovanovic S, Velickovic J, Popovic I. The thermal degradation kinetics of dextran and pullulan. Journal of Thermal Analysis and Calorimetry. 1993;40(2):511517. [295] Hussain MA, Shahwar D, Tahir MN, Sher M, Hassan MN, Afzal Z. An ecient acetylation of dextran using in situ activated acetic anhydride with iodine. Journal of the Serbian Society of Chemistry. 2010;75(2):165173. [296] Amo EMD, Urtti A. Current and future ophthalmic drug delivery systems. A shift to the posterior segment. Drug Discovery Today. 2008;13(3-4):13543. [297] Schachar RA, Chen W, Woo BK, Pierscionek BK, Zhang X, Ma L. Diusion of nanoparticles into the capsule and cortex of a crystalline lens. Nanotechnology. 2008;19(2):025102. [298] Urtti A. Challenges and obstacles of ocular pharmacokinetics and drug delivery. Advanced Drug Delivery Reviews. 2006;58(11):11315. [299] Bourlais CL, Acar L, Zia H, Sado PA, Needham T, Leverge R. Ophthalmic drug delivery systemsrecent advances. Progress in Retinal and Eye Research. 1998;17(1):3358. [300] Homan AS. Hydrogels for biomedical applications. Advanced Drug Delivery Reviews. 2002;54(1):312.

175

Bibliography [301] Jia X, Burdick J, Kobler J, Clifton R, Rosowski J, Zeitels S, et al. Synthesis and characterization of in situ cross-linkable hyaluronic acid-based hydrogels with potential application for vocal fold regeneration. Macromolecules. 2004;37(9):3239 3248. [302] Natu MV, Sardinha JP, Correia IJ, Gil MH. Controlled release gelatin hydrogels and lyophilisates with potential application as ocular inserts. Biomedical Materials. 2007;2(4):241249. [303] MacCallum DK, Lillie JH, Scaletta LJ, Occhino JC, Frederick WG, Ledbetter SR. Bovine corneal endothelium in vitro. Elaboration and organization and of a basement membrane. Experimental Cell Research. 1982;139(1):113. [304] Vervoort L, Vinckier I, Moldenaers P, den Mooter GV, Augustijns P, Kinget R. Inulin hydrogels as carriers for colonic drug targeting. Rheological characterization of the hydrogel formation and the hydrogel network. Journal of Phamaceutical Sciences. 1999;88(2):20914. [305] Lee K, Bouhadir K, Mooney DJ. Degradation behavior of covalently cross-linked poly(aldehyde guluronate) hydrogels. Macromolecules. 2000;33(1):97101. [306] Chirile T, Hong Y. Handbook of Biomaterials Properties. Black J, Hastings GW, editors. London: Chapman and Hall; 1998. The vitreous humor. [307] Grabner G, Boltz G, Forster O. Macrophage-like properties of human hyalocytes. Investigative Ophthalmology and Visual Science. 1980;19(4):333340. [308] Ambati J, Canakis CS, Miller J, Gragoudas E, Edwards A, Weissgold D, et al. Diusion of high molecular weight compounds through sclera. Investigative Ophthalmology and Visual Science. Investigative Ophthalmology and Visual Science;41(5):11811185. [309] Rando R, Orr G, Bangerter F. Throshold eects on the concanavalin-Amediated agglutination of modied erythrocytes. Journal of Biological Chemistry. 1979;254(17):83188323. [310] Chen YM, Shiraishi N, Satokawa H, Kakugo A, Narita T, Gong JP, et al. Cultivation of endothelial cells on adhesive protein-free synthetic polymer gels. Biomaterials. 2005;26(22):45884596. [311] Schneider GB, English A, Abraham M, Zaharias R, Stanford C, Keller J. The eect of hydrogel charge density on cell attachment. Biomaterials. 2004;25(15):30238.

176

Bibliography [312] Oh JK, Drumright R, Siegwart DJ, Matyjaszewski K. The development of microgels/nanogels for drug delivery applications. Progress in Polymer Science. 2008;33(4):448477. [313] Langenhan J, Thorson J. Recent carbohydrate-based chemoselective ligation applications. Current Organic Synthesis. 2005;2(1):5981. [314] van de Weert M, Hoechstetter J, Hennink WE, Crommelin DJ. The eect of a water/organic solvent interface on the structural stability of lysozyme. Journal of Controlled Release. 2000;68(3):3519. [315] Sah H. Protein behavior at the water/methylene chloride interface. Journal of Phamaceutical Sciences. 1999;88(12):13201325. [316] Zhang X, Chu C. A responsive poly(N-isopropylacrylamide)/poly(ethylene glycol) diacrylate hydrogel microsphere. Colloid and Polymer Science. 2004;282(12):1415 1420. [317] Franssen O, Hennink WE. A novel preparation method for polymeric microparticles without the use of organic solvents. International Journal of Pharmaceutics. 1998;168:17. [318] Stenekes RJ, Franssen O, van Bommel EM, Crommelin DJ, Hennink WE. The preparation of dextran microspheres in an all-aqueous system: eect of the formulation parameters on particle characteristics. Pharmaceutical Research. 1998;15(4):55761. [319] Stenekes RJ, Franssen O, van Bommel EM, Crommelin DJ, Hennink WE. The use of aqueous PEG/dextran phase separation for the preparation of dextran microspheres. International Journal of Pharmaceutics. 1999;183(1):2932. [320] Henry TD, Rocha-Singh K, Isner JM, Kereiakes DJ, Giordano FJ, Simons M, et al. Intracoronary administration of recombinant human vascular endothelial growth factor to patients with coronary artery disease. American Heart Journal. 2001;142(5):87280. [321] Chen RR, Silva EA, Yuen WW, Brock AA, Fischbach C, Lin AS, et al. Integrated approach to designing growth factor delivery systems. FASEB Journal. 2007;21(14):38963903. [322] Kraehenbuehl TP, Ferreira LS, Zammaretti P, Hubbell J, Langer R. Cell-responsive hydrogel for encapsulation of vascular cells. Biomaterials. 2009;30(26):43184324.

177

Bibliography [323] Livak K, Schmittgen T. Analysis of relative gene expression data using real-time quantitative PCR and the 2(deltaCt) method. Methods. 2001;25(4):402408. [324] Jentoft N, Dearborn DG. Labeling of proteins by reductive methylation using sodium cyanoborohydride. Journal of Biological Chemistry. 1979;254(11):4359 65. [325] Muller YA, Christinger HW, Keyt BA, de Vos AM. The crystal structure of vascular endothelial growth factor (VEGF) rened to 1.93 A resolution: multiple copy exibility and receptor binding. Structure. 1997;5(10):132538. [326] Fairbrother WJ, Champe MA, Christinger HW, Keyt BA, Starovasnik MA. Solution structure of the heparin-binding domain of vascular endothelial growth factor. Structure. 1998;6(5):63748. [327] Brock TA, Dvorak HF, Senger DR. Tumor-secreted vascular permeability factor increases cytosolic Ca2+ and von Willebrand factor release in human endothelial cells. American Journal of Pathology. 1991;138(1):213221. [328] Bates D, Harper S. Regulation of vascular permeability by vascular endothelial growth factors. Vascular Pharmacology. 2002;39(4-5):225237. [329] Dawson NS, Zawieja DC, Wu MH, Granger HJ. Signaling pathways mediating VEGF165-induced calcium transients and membrane depolarization in human endothelial cells. FASEB Journal. 2006;20(7):9913. [330] Gupta K, Kshirsagar S, Li W, Gui L, Ramakrishnan S, Gupta P, et al. VEGF prevents apoptosis of human microvascular endothelial cells via opposing effects on MAPK/ERK and SAPK/JNK signaling. Experimental Cell Research. 1999;247(2):495504. [331] Pedram A, Razandi M, Levin ER. Extracellular signal-regulated protein kinase/Jun kinase cross-talk underlies vascular endothelial cell growth factor-induced endothelial cell proliferation. Journal of Biological Chemistry. 1998;273(41):267228. [332] Burbridge MF, Cog F, Galizzi JP, Boutin JA, West DC, Tucker GC. The role of the matrix metalloproteinases during in vitro vessel formation. Angiogenesis. 2002;5(3):215226. [333] Selzman CH, Miller SA, Zimmerman MA, Gamboni-Robertson F, Harken AH, Banerjee A. Monocyte chemotactic protein-1 directly induces human vascular smooth muscle proliferation. American Journal of Physiology, Heart and Circulatory Physiology. 2002;283(4):14551461.

178

Bibliography [334] Rollins B, Yoshimura T, Leonard E, Pober J. Cytokine-activated human endothelial cells synthesize and secrete a monocyte chemoattractant, MCP-1/JE. American Journal of Pathology. 1990;136(6):12291233. [335] Heydarkhan-Hagvall S, Helenius G, Johansson BR, Li JY, Mattsson E, Risberg B. Co-culture of endothelial cells and smooth muscle cells aects gene expression of angiogenic factors. Journal of Cellular Biochemistry. 2003;89(6):12501259. [336] Ferreira LS, Karp JM, Nobre L, Langer R. New opportunities: The use of Nanotechnologies to manipulate and track stem cells. Cell Stem Cell. 2008;3(2):136 146. [337] Hwang NS, Varghese S, Elissee J. Controlled dierentiation of stem cells. Advanced Drug Delivery Reviews. 2008;60(2):199214. [338] Sachlos E, Auguste DT. Embryoid body morphology inuences diusive transport of inductive biochemicals: a strategy for stem cell dierentiation. Biomaterials. 2008;29(34):447180. [339] Kim M, Habiba A, Doherty JM, Mills JC, Mercer RW, Huettner JE. Regulation of mouse embryonic stem cell neural dierentiation by retinoic acid. Development Biology. 2009;328(2):45671. [340] Castro GA, Orce RL, Vilela JMC, Andrade MS, Ferreira LAM. Development of a new solid lipid nanoparticle formulation containing retinoic acid for topical treatment of acne. Journal of Microencapsulation. 2007;24(5):395407. [341] Akinc A, Thomas M, Klibanov AM, Langer R. Exploring polyethyleniminemediated DNA transfection and the proton sponge hypothesis. Journal of Gene Medicine. 2005;7(5):657663. [342] Agasse F, Roger M, Coronas V. Neurogenic and intact or apoptotic non-neurogenic areas of adult brain release diusible molecules that dierentially modulate the development of subventricular zone cell cultures. European Journal of Neurosciences. 2004;19(6):14591468. [343] Agasse F, Bernardino L, Silva B, Ferreira R, Grade S, Malva JO. Response to histamine allows the functional identication of neuronal progenitors, neurons, astrocytes, and immature cells in subventricular zone cell cultures. Rejuvenation Research. 2008;11(1):187200. [344] Pinheiro PS, Rodrigues RJ, Rebola N, Xapelli S, Oliveira CR, Malva JO. Presy-

179

Bibliography naptic kainate receptors are localized close to release sites in rat hippocampal synapses. Neurochemistry International. 2005;47(5):30916. [345] Kramer M, Stumbe J, Turk H, Krause S, Komp A, Delineau L, et al. pH-responsive molecular nanocarriers based on dendritic core-shell architectures. Angewandte Chemie Int Edit. 2002;41(22):42524256. [346] Choi Y, Kim SY, Kim SH, Lee KS, Kim C, Byun Y. Long-term delivery of alltrans-retinoic acid using biodegradable PLLA/PEG-PLLA blended microspheres. International Journal of Pharmaceutics. 2001;215(1-2):6781. [347] Lois C, Alvarez-Buylla A. Proliferating subventricular zone cells in the adult mammalian forebrain can dierentiate into neurons and glia. Proceedings of the National Academy of Sciences. 1993;90(5):20747. [348] Zhao C, Deng W, Gage FH. Mechanisms and functional implications of adult neurogenesis. Cell. 2008;132(4):64560. [349] Lledo PM, Alonso M, Grubb MS. Adult neurogenesis and functional plasticity in neuronal circuits. Nature Reviews Neurosciences. 2006;7(3):17993. [350] Abdallah B, Hassan A, Benoist C, Goula D, Behr JP, Demeneix BA. A powerful nonviral vector for in vivo gene transfer into the adult mammalian brain: polyethylenimine. Human Gene Therapy. 1996;7(16):19471954. [351] Goula D, Remy JS, Erbacher P, Wasowicz M, Levi G, Abdallah B, et al. Size, diusibility and transfection performance of linear PEI/DNA complexes in the mouse central nervous system. Gene Therapy. 1998;5(5):7127. [352] Lemkine GF, Mantero S, Mign C, Raji A, Goula D, Normandie P, et al. Preferential transfection of adult mouse neural stem cells and their immediate progeny in vivo with polyethylenimine. Molecular and Cellular Neuroscience. 2002;19(2):165 74. [353] Reynolds BA, Weiss S. Generation of neurons and astrocytes from isolated cells of the adult mammalian central nervous system. Science. 1992;255(5052):170710. [354] Levison SW, Goldman JE. Multipotential and lineage restricted precursors coexist in the mammalian perinatal subventricular zone. Journal of Neuroscience Research. 1997;48(2):8394. [355] Gage FH. Mammalian neural stem cells. Science. 2000;287(5457):14338.

180

Bibliography [356] Goetz AK, Scheer B, Chen HX, Wang S, Suslov O, Xiang H, et al. Temporally restricted substrate interactions direct fate and specication of neural precursors derived from embryonic stem cells. Proceedings of the National Academy of Sciences. 2006;103(29):110638. [357] Agasse F, Bernardino L, Kristiansen H, Christiansen SH, Ferreira R, Silva B, et al. Neuropeptide Y promotes neurogenesis in murine subventricular zone. Stem Cells. 2008;26(6):16361645. [358] Kim KK, Adelstein RS, Kawamoto S. Identication of neuronal nuclei (NeuN) as Fox-3, a new member of the Fox-1 gene family of splicing factors. Journal of Biological Chemistry. 2009;284(45):3105261. [359] Wohl CA, Weiss S. Retinoic acid enhances neuronal proliferation and astroglial dierentiation in cultures of CNS stem cell-derived precursors. Journal of Neurobiology. 1998;37(2):28190. [360] Takahashi J, Palmer TD, Gage FH. Retinoic acid and neurotrophins collaborate to regulate neurogenesis in adult-derived neural stem cell cultures. Journal of Neurobiology. 1999;38(1):6581. [361] Wang TW, Zhang H, Parent JM. Retinoic acid regulates postnatal neurogenesis in the murine subventricular zone-olfactory bulb pathway. Development. 2005;132(12):272132. [362] Maden M. Retinoic acid in the development, regeneration and maintenance of the nervous system. Nature Reviews Neurosciences. 2007;8(10):75565. [363] Lu J, Tan L, Li P, Gao H, Fang B, Ye S, et al. All-trans retinoic acid promotes neural lineage entry by pluripotent embryonic stem cells via multiple pathways. BMC Cell Biology. 2009;10:57. [364] Etchamendy N, Enderlin V, Marighetto A, Vouimba RM, Pallet V, Jaard R, et al. Alleviation of a selective age-related relational memory decit in mice by pharmacologically induced normalization of brain retinoid signaling. Journal of Neurosciences. 2001;21(16):64239. [365] Crandall J, Sakai Y, Zhang J, Koul O, Mineur Y, Crusio WE, et al. 13-cis-retinoic acid suppresses hippocampal cell division and hippocampal-dependent learning in mice. Proceedings of the National Academy of Sciences. 2004;101(14):51116. [366] Pla AF, Maric D, Brazer SC, Giacobini P, Liu X, Chang YH, et al. Canonical transient receptor potential 1 plays a role in basic broblast growth factor (bFGF)/FGF

181

Bibliography receptor-1-induced Ca2+ entry and embryonic rat neural stem cell proliferation. Journal of Neurosciences. 2005;25(10):26872701. [367] Platel JC, Dave KA, Gordon V, Lacar B, Rubio ME, Bordey A. NMDA receptors activated by subventricular zone astrocytic glutamate are critical for neuroblast survival prior to entering a synaptic network. Neuron. 2010;65(6):859872. [368] Danielyan L, Schfer R, von Ameln-Mayerhofer A, Buadze M, Geisler J, Klopfer T, et al. Intranasal delivery of cells to the brain. European Journal of Cell Biology. 2009;88(6):315324. [369] Roy I, Stachowiak MK, Bergey EJ. Nonviral gene transfection nanoparticles: function and applications in the brain. Nanomedicine: Nanotechnology, Biology, and Medicine. 2008;4(2):8997.

182