You are on page 1of 10

Eur. J. Biochem.

265, 308317 (1999) q FEBS 1999

The phosphotransferase system (PTS) of Streptomyces coelicolor


Identification and biochemical analysis of a histidine phosphocarrier protein HPr encoded by the gene ptsH
Stephan Parche1, Roland Schmid2 and Fritz Titgemeyer1
1

Lehrstuhl fur Mikrobiologie, Friedrich-Alexander-Universitat Erlangen-Nurnberg, Germany, 2Universitat Osnabruck, Abteilung fur Mikrobiologie, Germany

HPr, the histidine-containing phosphocarrier protein of the bacterial phosphotransferase system (PTS) controls sugar uptake and carbon utilization in low-GC Gram-positive bacteria and in Gram-negative bacteria. We have purified HPr from Streptomyces coelicolor cell extracts. The N-terminal sequence matched the product of an S. coelicolor orf, designated ptsH, sequenced as part of the S. coelicolor genome sequencing project. The ptsH gene appears to form a monocistronic operon. Determination of the evolutionary relationship revealed that S. coelicolor HPr is equally distant to all known HPr and HPr-like proteins. The presumptive phosphorylation site around histidine 15 is perfectly conserved while a second possible phosphorylation site at serine 47 is not wellconserved. HPr was overproduced in Escherichia coli in its native form and as a histidine-tagged fusion protein. Histidine-tagged HPr was purified to homogeneity. HPr was phosphorylated by its own enzyme I (EI) and heterologously phosphorylated by EI of Bacillus subtilis and Staphylococcus aureus, respectively. This phosphoenolpyruvate-dependent phosphorylation was absent in an HPr mutant in which histidine 15 was replaced by alanine. Reconstitution of the fructose-specific PTS demonstrated that HPr could efficiently phosphorylate enzyme IIFructose. HPr-P could also phosphorylate enzyme IIGlucose of B. subtilis, enzyme IILactose of S. aureus, and IIAMannitol of E. coli. ATP-dependent phosphorylation was detected with HPr kinase/phosphatase of B. subtilis. These results present the first identification of a gene of the PTS complement of S. coelicolor, providing the basis to elucidate the role(s) of HPr and the PTS in this class of bacteria. Keywords: phosphotransferase system; protein phosphorylation; HPr; sugar transport; Streptomyces.

Streptomyces are high-GC, Gram-positive soil bacteria which grow vegetatively as a branching mycelial mass using a wide spectrum of carbon sources such as cellulose, chitin, xylan, and many mono- and disaccharides. Upon nutrient depletion this primary metabolic phase may switch to a secondary metabolic phase resulting, for example, in antibiotic production and morphogenesis [1]. Despite the interesting life cycle and the commercial importance, there is limited knowledge on nutrient sensing, carbohydrate transport, and regulation of carbohydrate utilization, and how these may influence secondary metabolic processes. So far, the mechanism of sugar uptake has been described for only a few carbohydrates. It was demonstrated that cellobiose, cellotriose, maltose, and xylobiose are taken up via ABC transport systems, and that fructose is apparently transported via a phosphoenolpyruvate:fructose phosphotransferase system
Correspondence to F. Titgemeyer, Lehrstuhl fur Mikrobiologie, Friedrich-Alexander-Universitat Erlangen-Nurnberg, Staudtstrasse 5, D-91058 Erlangen, Germany. Fax: + 49 91318528082, Tel.: + 49 91318528095, E-mail: ftitgem@biologie.uni-erlangen.de Abbreviations: PTS, phosphoenolpyruvate-dependent sugar phosphotransferase system; EI, enzyme I; HPr, histidine containing phosphoryl carrier protein of the PTS; II(ABC)sugar, enzyme II(ABC) transporter protein of the PTS; CCR, carbon catabolite repression; aMG, methyl a-glucoside; TMG, methyl thio-b-d-galactoside. Enzymes: enzyme I of the phosphotransferase system (EC 2.7.3.9); enzyme II of the PTS (EC 2.7.1.69). (Received 25 February 1999, accepted 19 July 1999)

(PTS) [25]. The utilization of carbohydrates in many cases is governed by carbon catabolite repression (CCR) [6]. CCR can be exerted by various carbohydrates such as glucose, fructose, mannitol, or gluconate [7]. The signal transduction pathway leading to CCR is not known. Mutations in glkA, encoding glucose kinase, in bldB, encoding a putative regulator protein, and in ccrA, cause a pleiotropic loss of CCR [810]. Of these genes, only glucose kinase has been studied in detail with respect to its global role in CCR [7,11]. However, not all genes that are subject to CCR depend on glucose kinase [12,13]. If, and how, the encoded proteins interact with each other, or if there are additional proteins involved remains to be demonstrated [7,11,14,15]. The molecular understanding of carbon regulation in Gramnegative bacteria and in low-GC Gram-positive bacteria is much more advanced. Here, the proteins of the phosphotransferase system (PTS) play a central role [16,17], yet, the particular mechanisms are different. In E. coli, the histidine kinases enzyme I (EI), HPr, and IIAGlc have regulatory functions dependent on their phosphorylation state. Nonphosphorylated EI triggers chemotaxis towards PTS carbohydrates by inhibiting autophosphorylation of the sensor kinase CheA [18]. HPr regulates the activity of glycogen phosphorylase and stimulates adenylate cyclase [19,20]. Nonphosphorylated IIAGlc inhibits glycerol kinase and several sugar permeases by a mechanism termed inducer exclusion [21]. Phosphorylated IIAGlc stimulates cAMP synthesis necessary for the global catabolite activator protein, CAP, to activate transcription of cAMP-dependent genes and operons [17]. In B. subtilis

q FEBS 1999

The HPr of Streptomyces coelicolor (Eur. J. Biochem. 265) 309

chemotaxis is governed by phosphorylated EI to trigger CheA [22]. In many low-GC Gram-positive microorganisms, HPr and HPr kinase/phosphatase are centrally involved in CCR [23,24]. HPr, phosphorylated at serine 46 by HPr kinase/phosphatase operates as a corepressor of the catabolite control protein, CcpA, the global repressor of catabolite-controlled genes [23,25]. HPr also modulates the activity of transcriptional regulators of genes involved in carbohydrate utilization, and glycerol kinase via phosphorylation [23,26]. Thus, HPr can be considered as a multifunctional protein involved in sugar transport and carbon regulation in both Gram-negative and low-GC Gram-positive bacteria. The presence of PTS components including EI, HPr, and a fructose-specific enzyme II in several species of Streptomyces has been reported previously [4,27]. The individual components of the PTS were identified and showed that the general proteins EI and HPr were similar in molecular size and activity to the corresponding proteins of other microorganisms. Because of the central role of HPr in PTS-mediated phenomena in other bacteria, we are interested in characterizing HPr of S. coelicolor at the molecular level. In this communication, we report the identification and the cloning of the ptsH gene, the overexpression and purification of the gene product HPr, and its biochemical properties.

(pH 8.0), 25 mm EDTA (pH 8.0) Tris/EDTA, and in the same volume of Tris/EDTA plus 125 mm NaCl (Tris/EDTA/NaCl). Cells were resuspended in 1 m NaCl, incubated for 2 h at 4 8C, before they were washed in 2 mL Tris/EDTA/NaCl, and finally suspended in 2 mL Tris/EDTA. Further steps were carried out as described [29]. All DNA modifying enzymes were used according to the manufacturers recommendations. Cloning procedures and plasmid construction Cloning of the ptsH gene of S. coelicolor A3(2) strain M145 was performed as follows. A chromosomal DNA fragment of 282 bp comprising ptsH was amplified by PCR with Taq DNA polymerase using S. coelicolor M145 wild-type chromosomal DNA as template together with oligonucleotides engineered to introduce the restriction sites NdeI and BamHI, respectively (SP1, AAGGAGATAACATATGGCTGAGCGCCGCGTTAACGTTGGCTG and SP2, GGATCCTCAGACGGTCTCGGGAAGCTCCTCG). The amplified DNA fragment was ligated into pBluescript II SK+ treated with EcoRV, giving plasmid pFT1. DNA sequencing of the insert of pFT1 revealed that the cloned ptsH gene was identical to a reported DNA sequence (GenBank AL009204). The ptsH gene was further subcloned as a NdeI BamHI fragment from pFT1 into plasmids pET3c and pET15b digested with the same restriction enzymes, resulting in ptsH expression plasmids pFT2 and pFT3, respectively. A two-step PCR mutagenesis procedure as described by Landt et al. was used to change the codon for histidine 15 to an alanine codon giving pFT4 (ptsH-H15A) [30]. Plasmid pFT1 served as template DNA together with oligonucleotide SP3 (GCCGAGGGTCTCGCCGCCCGCCCCGCC; altered positions are underlined) and the two flanking primers described above. All PCR-based constructs were confirmed by DNA sequencing. Strain construction To construct an E. coli expression strain deleted for the pts operon, phage P1 was grown on strain TP2811 (DptsHIcrr, KmR). The ptsHIcrr operon deletion was transduced into BL21(DE3)/pLysS as described by Arber [31]. Transductants were selected for kanamycin resistance, clonally isolated, and tested on MacConkey agar plates supplemented with

M AT E R I A L S A N D M E T H O D S
Bacterial strains and growth conditions Relevant bacterial strains used in this study are listed in Table 1. Cells of S. coelicolor were grown for 3072 h with vigorous shaking at 28 8C or 37 8C using tryptic soy broth without dextrane as complex medium (TSB, Difco) or mineral medium (MM) as described by Hopwood et al. [28]. Sugars when present were added to a final concentration of 2050 mm. Unless it is not stated otherwise, cells of B. subtilis, S. aureus, and E. coli were grown in LuriaBertani broth (LB) at 37 8C. DNA isolation and manipulation Total DNA from S. coelicolor M145 was isolated as follows. A 100-mL culture grown on TSB at 37 8C for 24 h was harvested by centrifugation and washed in 15 mL 10 mm Tris/HCl
Table 1. List of strains. Strain S. coelicolor M145 B. subtilis QB5350 S. aureus S710A S797A E. coli DH5a BL21(DE3)/pLysS FT1/pLysS M15/pREP4 TP2811 Genotype/phenotype

Reference/source

SCP12, SCP22, prototroph trpC2 ptsH-(H15A) amyE::(levD H - H lacZ aphA3), KmR ptsI ptsH supE44, D lacU169 (f80lacZD M15M) hsdR17 recA1 endA1 gyrA96 thi-1 relA1 F2 lon ompT rBmB hsdS gal (cIts857 ind1 Sam7 nin5 lacUV5-T7 gene 1)/pLysS CmR BL21(DE3) D( ptsHI crr)/pLysS, KmR F2 lac ara gal mtl/pREP4 lacI neo F2 xyl argH1 D lacX74 aroB ilvA?( ptsHIcrr)

[28] [59] [60] [60] [29] [61] This study [33] [62]

310 S. Parche et al. (Eur. J. Biochem. 265)

q FEBS 1999

kanamycin (40 mgmL21) and 50 mm of glucose, mannitol, or fructose, respectively. Transductants carrying a chromosomal deletion of the ptsHIcrr operon were identified as white colonies on the three MacConkey indicator plates. One transductant was termed FT1/pLysS. It was used as the host strain for S. coelicolor ptsH expression. Western blot analysis Detection of S. coelicolor HPr was performed by SDS/PAGE of 75 mg S. coelicolor cell extract on a 15% polyacrylamide gel. Proteins were transferred by electroblotting onto a poly(vinylidene difluoride) membrane (Fluorotrans, Pall). HPr was detected with rabbit polyclonal antibodies raised against HPr of Bacillus megaterium using a dilution of 1 : 3000. Antibodies were in turn detected using anti-rabbit peroxidase conjugate (ECL, Amersham) as described by the manufacturers. Protein purification Purification of HPr from S. coelicolor was performed as follows. Cells of a 1.5-L culture grown in TSB containing 20 mm fructose were harvested by centrifugation, washed twice with 10 mm Tris/HCl (pH 7.5) containing 3 mm dithiothreitol and 1 mm phenylmethanesulfonyl fluoride (TDP buffer), and ruptured by sonification. Cell debris and unbroken cells were removed by centrifugation at 4 8C for 30 min at 14 000 g. The supernatant was subjected to ultracentrifugation at 4 8C for 2 h at 110 000 g. The resultant membrane-free supernatant (50 mL) was loaded on a DEAE-Sephacel column (19-mL bed volume) pre-equilibrated with 10 mm Tris/HCl (pH 7.6). Proteins were eluted with a linear salt gradient (00.25 m NaCl) in the same buffer. Fractions were collected and assayed for HPr activity. HPr eluted at 0.140.17 m NaCl. Fractions exhibiting HPr activity were pooled and concentrated in an Amicon chamber to a final volume of 4 mL. The resulting supernatant was loaded on a pre-equilibrated G75-Superdex column (48-mL bed volume) and eluted with 10 mm Tris/HCl (pH 7.6). Fractions containing HPr activity were concentrated by centrifugation with Filtron tubes (K3, Microsep) and analyzed by SDS/PAGE. Protein bands of the expected HPr size were transferred onto a poly(vinylidene difluoride) membrane to perform N-terminal amino acid sequence analysis as described by Schmid et al. [32]. For the purification of recombinant His-tagged HPr of S. coelicolor A3(2) M145, E. coli FT1/pLysS was transformed with pFT3. Cells were grown at 28 8C until the culture reached an D600 of 0.7. Gene expression was induced by a final concentration of 1 mm isopropyl thio-b-d-galactoside. Incubation was continued for 23 h. Cells were harvested by centrifugation, washed, and ruptured by sonification in 20 mm Tris/HCl (pH 7.5), 0.2 m NaCl (start buffer). The soluble proteins obtained after centrifugation at 4 8C for 30 min at 14 000 g were loaded onto a Ni2+-column (1-mL bed volume). After washing with 10 mm imidazol, proteins were eluted with a linear gradient (10500 mm imidazol) in start buffer. Histagged HPr of B. subtilis (pAG2) and His-tagged EI of B. subtilis (pAG3) were overexpressed and purified as described [33]. Matrix-assisted laser desorption ionization mass spectra (MALDI-MS; Micromass, TofSpec) of His-tagged HPr of S. coelicolor were recorded to verify the correct size of the fulllength protein. Partial purification of HPr and EI from crude cell extracts of S. coelicolor A3(2) M145 grown on TSB supplemented with

20 mm fructose was carried out by gel filtration. A volume of 0.5 mL corresponding to about 5 mg total protein was loaded onto an FPLC G200-Superdex column (24-mL bed volume) and eluted with 20 mm Tris/HCl (pH 7.5), 15 mm KCl, and 3 mm dithiothreitol. Fractions of 0.35 mL were collected and assayed by measuring HPr and EI activity, respectively. Protein concentrations were determined spectrophotometrically using Bio-Rad protein assay. HPr was stored at 220 8C. EI was stored in aliquots at 270 8C. Enzyme assays HPr activity was assayed by complementation of the glucosePTS of B. subtilis measuring phosphoenolpyruvate-dependent phosphorylation of methyl a-[14C]glucoside ([14C]aMG) in the presence of B. subtilis QB5350 ptsH-H15A cell extract. Similarly S. coelicolor EI and HPr were assayed by complementation of the lactose-PTS of S. aureus using cell extracts of S. aureus S710A ptsI and S797A ptsH, respectively, following phosphorylation of [methyl-14C]methyl thio-b-d-galactoside ([14C]TMG) [4]. The assay was carried out for 30 min at 30 8C in a reaction volume of 0.1 mL containing 12 mm [14C]aMG (40 mCimmol21) or 15 mm [14C]TMG (17 mCimmol21), respectively. A IIFru activity assay was carried out with [14C] fructose at a final concentration of 12 mm (42 mCimmol21). Membranes containing IIFru were prepared by ultracentrifugation at 4 8C for 1 h at 110 000 g from crude cell extracts of S. coelicolor A3(2) M145 grown on TSB supplemented with 20 mm fructose. Membranes were washed once in 10 mm Tris/HCl (pH 7.5), 3 mm dithiothreitol and stored in aliquots at 270 8C. Protein phosphorylation [32P]Phosphoenolpyruvate was prepared from [g32P]ATP as described by Roossien et al. [34]. Phosphorylation of purified or partially purified EI and HPr proteins of S. coelicolor, purified His-tagged EI of B. subtilis, and purified His-tagged HPr of B. subtilis or HPr of B. megaterium was carried out in a total volume of 20 mL. Routinely, 35200 pmol of HPr were incubated at 37 8C for 10 min with 18 pmol His-tagged EI or partially purified EI of S. coelicolor in 50 mm Tris/HCl (pH 7.5), 15 mm MgCl2, and [32P]phosphoenolpyruvate (0.1 mm) with a specific radioactivity of 4 mCimmol21. The reaction was stopped by adding 5 mL protein gel loading buffer to the mixture. An aliquot was subjected to SDS/PAGE. Radiolabeled proteins were detected by radioluminography on a phosphoimager (Fuji), or by autoradiography. [g32P]ATP-dependent phosphorylation was conducted as described by Reizer et al. [35]. Crude cell extract (10 mg) of strain FT1/pLysS/pFT2 grown under conditions when S. coelicolor HPr was expressed, or 100 pmol of B. megaterium HPr, were incubated with 0.2 mg E. coli DH5a/p4813 extract containing B. subtilis HPr kinase/phosphatase in a total volume of 20 mL at 37 8C for 10 min [35]. Termination of the reaction and analysis of radiolabeled proteins were performed as described above. Similarly crude cell extracts of S. coelicolor were tested as a potential source for an HPr kinase. Computer analyses The program dna striderTM 1.2 and the lasergene workstation software (DNASTAR, Inc.) were used to process DNA sequence data [36]. DNA databank and protein databank

q FEBS 1999

The HPr of Streptomyces coelicolor (Eur. J. Biochem. 265) 311

searches were performed using the blast server of the National Center for Biotechnology Information at the National Institutes of Health Bethesda, MD, USA (http://www.ncbi.nlm.nih.gov). Binary sequence comparison were computed with the fasta program to determine sequence identity and with the rdf2 program to establish homology, expressed as more than 8 SD above the mean for the randomized sequence comparisons [37]. Multiple alignments and phylogenetic trees were calculated with the clustalx software using the implemented neighbor joining method [38].

R E S U LT S
Identification of the ptsH gene HPr activity was detected in cell extracts of S. coelicolor by complementation assay. Western blot analysis with antibodies raised against HPr of B. megaterium revealed a weak signal corresponding to a 15-kDa protein (data not shown). HPr was purified from crude cell extracts of S. coelicolor A3(2) strain M145 as outlined in Materials and methods. Two protein bands of identical shape and intensity migrating on a 15% SDS polyacrylamide gel at 14 kDa and 15 kDa, respectively, were found to correlate with HPr activity. These proteins were blotted onto a poly(vinylidene difluoride) membrane and subjected to N-terminal sequence analysis. Interestingly, both bands revealed the same amino acid sequence, AERRVNVGXAEGLHARPA, indicating that some unknown modification of the protein may have occurred, leading to a doublet protein band on the denaturing protein gel. The sequence matched the N-terminus of the gene product of an orf located on cosmid SC9B10 (GenBank AL009204). The sequence has been determined as part of the S. coelicolor genome sequencing project and the orf has been designated ptsH based on sequence comparison analysis. Genetic organization The genetic organization of the ptsH gene is depicted in Fig. 1A. ptsH is situated between two genes transcribed in opposite directions spaced by 202 bp and 154 bp, respectively. Thus, ptsH appears to constitute a monocistronic operon. The GC content of ptsH is 74% while both intergenic regions exhibit 65% GC content. This correlates well with the overall 71% GC content of coding regions of S. coelicolor, and with a lowered GC content of 62% found in promoter regions of Streptomyces ssp. [39]. A perfect tandem repeat of 14 bp (ACTGGTCTAGACAA) is located at positions 237 and 252 upstream of ptsH. Within each repeat, a potential 235 region (TAGACA) of a streptomycete E. coli-like promoter is found [39]. However, potential 210 regions were not predictable. An inverted repeat that might serve as a transcription termination signal is located 19 bp downstream of ptsH (Fig. 1A). This structure is followed by an unusual pentarepeat of the hexamer (TTCCGC) located 5 bp further downstream. Interestingly, none of the adjacent genes shares similarity to genes of the PTS. The orf 232 downstream of ptsH is homologous to genes encoding transcriptional regulators of the GntR family [40]. The product of the orf1039 upstream of ptsH shows significant similarity to proteins of unknown function in the databank. The ptsH gene encodes a protein of 93 amino acids with a deduced molecular mass of 9259 Da excluding the N-terminal methionine. It is preceded by a potential ribosome binding site spaced by 10 bp (GAAGG). The size and a calculated

isoelectric point of 4.5 are characteristic features found for most other HPrs [41]. A databank search revealed 31 homologues which were aligned using the clustalx program. S. coelicolor HPr shares between 27% to 38% amino acid identity (nine to 18 standard deviations) throughout the entire length with HPr proteins and HPr homologues. A phylogenetic tree was calculated with clustalx using the implemented neighbor joining method (Fig. 1C). The derived evolutionary relationships suggest that HPr of S. coelicolor forms a separate cluster equally distant to all other members of the family. Inspection of putative phosphorylation sites showed the S. coelicolor HPr to match perfectly the consensus site around the catalytic histidine 15 which in other bacteria is phosphorylated by EI-P (Fig. 1B). A conserved serine residue at position 47 could serve as a putative ATP-dependent phosphorylation site for HPr kinase. However, only eight out of 13 residues around serine 47 matched the consensus sequence (Fig. 1B). In addition, S. coelicolor HPr shares a C-terminal sequence motif at position 8486, EGL, conserved in all HPrs of Gram-positive bacteria and absent in all other proteins of the family. Overexpression and purification of S. coelicolor HPr and HPr H15A mutant protein To study the function of S. coelicolor HPr, we heterologously overexpressed the ptsH gene in E. coli. Plasmids pFT2 and pFT3 were transformed into E. coli strain FT1/pLysS and HPr protein was produced as outlined in Materials and methods. Cell extracts of E. coli producing His-tagged HPr or native HPr exhibited HPr activity (data not shown). These cell extracts were analyzed on a 15% SDS polyacrylamide gel. While no prominent band became visible with the E. coli strain producing the native HPr protein, the E. coli strain producing the His-tagged HPr showed overexpression characteristics revealing a prominent protein band at the expected molecular mass of 15 kDa (data not shown; Fig. 2A, lane 2). Histagged HPr was purified to homogeneity by Ni2+-affinity chromatography yielding about 5 mg protein per liter E. coli culture (Fig. 2A, lane 3). MALDI-MS revealed a molecular size of 11 406 ^ 11 Da for His-tagged HPr (data not shown). This is in agreement with an expected molecular mass of 11 415 Da for His-tagged HPr lacking an N-terminal methionine. Analogously a His-tagged HPr(H15A) protein was produced and purified (Fig. 2A, lane 4). Phosphoenolpyruvate-dependent phosphorylation In vitro phosphorylation assays were performed to demonstrate phosphorylation of S. coelicolor His-tagged HPr. As shown in lane 1 of Fig. 2B, EI of B. subtilis became phosphorylated upon incubation with radiolabeled phosphoenolpyruvate. The purified HPr of S. coelicolor alone was not phosphorylated (lane 2) while addition of B. subtilis EI led to phosphorylation of Histagged HPr (lane 3). When the mutated HPr(H15A) was incubated with [32P]phosphoenolpyruvate and EI, no HPr phosphorylation occurred (lane 4). After boiling of phosphorylated EI and HPr in the presence of trichloroacetic acid prior to protein gel loading, no phosphorylated protein was detectable indicating that the amino acyl-phosphates were acid-labile (lane 5). When the same sample was boiled without trichloroacetic acid, EI retained the radioactive phosphoryl group but not HPr (data not shown). This is in agreement with the evidence that EI becomes phosphorylated at the more stable N12 position of histidine 189, while HPr is phosphorylated at the Nd1 position

312 S. Parche et al. (Eur. J. Biochem. 265)

q FEBS 1999

of histidine 15 [42]. Finally, labeling of EI and HPr was prevented in the presence of an excess of nonlabeled phosphoenolpyruvate (lane 6). After having demonstrated that His-tagged HPr can be heterologously phosphorylated, we investigated whether S. coelicolor contains an EI which phosphorylates this HPr, and whether native HPr is also phosphorylated. Therefore, native HPr was produced in E. coli strain FT1/pLysS/pFT2,

which carries a deletion of the ptsHIcrr operon. Cellular extracts of this strain were incubated with B. subtilis EI and [32P]phosphoenolpyruvate showing a labeled protein migrating slightly below His-tagged HPr (Fig. 2C, lane 4). As a control, we examined cell extracts of E. coli FT1/pLysS/pET3c bearing the expression plasmid without the ptsH gene. No protein became phosphorylated (lane 5). Native HPr was also partially purified by gel filtration from S. coelicolor cell extracts. The

Fig. 1. Genetic organization of the S. coelicolor ptsH gene, protein alignment, and phylogenetic relationship. (A) The ptsH gene is shown with the two flanking orfs encoding putative proteins with a length of 1039 amino acids and 232 amino acids, respectively (GenBank AL009204). Values of GC content (%) are denoted below coding regions and intergenic regions. Numbers in square brackets show the lengths of intergenic regions in bp. A perfect tandem repeat of 14 bp preceding ptsH is marked by two arrows. A putative terminator sequence is indicated by a stem loop sign, which is followed by a pentarepeat of 6 bp highlighted by five arrows. (B) The HPr sequence is shown with a consensus sequence derived from an alignment with 31 HPr homologues (see below) found in the current databank. Residues conserved in more than 90% of all proteins are shown in capital letters while residues conserved in more than 50% of all proteins are shown in small letters. Insertions are indicated by a dash. The phosphorylation sites are marked by asterisks. Signature sequences for the phosphorylation sites are given below the consensus sequence. They were derived from HPr proteins of which phosphorylation was demonstrated. (C) An unrooted phylogenetic tree is presented. Branch lengths are labeled with arbitrary units. Bootstrap values (1000 sample runs) are expressed in percentage and underlined. A bootstrap value of $ 95% suggests a correct topology. Bootstrap values below 50% found for very short branches are not labeled. Abbreviations are as follows: HPr proteins from Sco, Streptomyces coelicolor (GenBank GB AL009204); Bsu, Bacillus subtilis (P08877); Bme, Bacillus megaterium (AJ005075); Bst, Bacillus stearothermophilus (P42013); Smu, Streptococcus mutans (P45596); Ssa, Streptococcus salivarius (P24366); Spy, Streptococcus pyogenes (contig 286); Lsa, Lactobacillus sakei (P007125); Efa, Enterococcus faecalis (P07515); Sau, Staphylococcus aureus (P02907); Sca, Staphylococcus carnosus (P23534); Lmo, Listeria monocytogenes (O31148); Mca, Mycoplasma capricolum (P45611); Mpn, Mycoplasma pneumoniae (P75061); Mge, Mycoplasma genitalium (P47287); Psa, Pseudomonas aeruginosa (contig 299); Aeu, Alcaligenes eutrophus (P23537); Ngo, Neisseria gonorrhoe (contig 253); Tpa, Treponema pallidum (AE001234); Eco, Escherichia coli (P07006), Kpn, Klebsiella pneumoniae (P16481); Hin, Haemophilus influenzae (P43921); Bbu, Borrelia burgdorferi (AE001157). FPr protein domains are from Eco, E. coli (P24217); Sty, Salmonella typhimurium (P17127); Hin, H. influenzae (P44715); Rca, Rhodobacter capsulatus (P23388); Xca, Xanthomonas campestris (P45597). NPr proteins are from Eco, E. coli (P33996) and Kpn, K. pneumoniae (P51185). Crh is from B. subtilis (Z94043). Accession numbers from SWISSPROT have the prefix O or P while others are from GenBank. Sequences from preliminary versions of the sequenced genomes have the contig number as identifier.

q FEBS 1999

The HPr of Streptomyces coelicolor (Eur. J. Biochem. 265) 313

HPr containing fraction was concentrated and incubated in the presence of B. subtilis EI and [32P]phosphoenolpyruvate. Only one protein became phosphorylated, migrating at a slightly higher molecular mass than S. coelicolor HPr produced in E. coli (lane 6). To demonstrate that S. coelicolor HPr is phosphorylated by its own EI, we partially purified EI by gel filtration from S. coelicolor cell extracts. As can be seen in lane 8 of Fig. 2C, His-tagged HPr became phosphorylated in the presence of the fraction containing EI activity while no protein phosphorylation was observed when only the EI-containing fraction was assayed (Fig. 2C, lane 7). It should be noted that under these conditions

S. coelicolor EI-P was not detectable due to the low amount of EI. HPr can phosphorylate enzyme IIFru We previously reported that S. coelicolor possesses a fructosespecific PTS, but is lacking the PTSs for glucose and mannitol widely distributed among other bacteria [4]. Therefore, we examined if this HPr could phosphorylate enzyme IIFru. Figure 3 shows addition of His-tagged HPr to a mixture of EI of B. subtilis and IIFru-containing membranes resulted in IIFru acticivity (7.5 pmol fructose 1-phosphatemin21) while no

Table 2. Complementation of ptsH mutants of B. subtilis and S. aureus. Protein of cell extracts of ptsH mutant strains of B. subtilis and S. aureus were used as indicated. Purified His-tagged HPr was added in rate-limiting amounts. Values were determined in triplicate and varied from the mean by less than 10%. ptsH mutant extract (mg) B. subtilis QB5350 35 35 35 S. aureus S797A 35 35 35 S. coelicolor HPr (mg) Phosphorylation activity (pmol sugar-phosphatemin21) aMG-P # 0.03 # 0.03 3.70 # 0.03 TMG-P # 0.03 # 0.03 0.9 # 0.03

0.5 0.5 0.5 HPr (H15A) 0.5 0.5 0.5 HPr (H15A)

Fig. 2. Overproduction, purification, and phosphorylation of HPr and EI. (A) A 15% SDS polyacrylamide gel stained with Coomassie Brilliant Blue shows crude cell extract of 20 mg FT1/pLysS/pET15b (lane 1) and 20 mg FT1/pLysS/pFT3 ptsH+ (lane 2). Lanes 3 and 4 show 1 mg of purified His-tagged HPr and His-tagged HPr(H15A), respectively. (B) The autoradiography of a 15% SDS polyacrylamide gel shows [32P]phosphoenolpyruvate-dependent phosphorylation of purified His-tagged S. coelicolor HPr (50 pmol), His-tagged S. coelicolor HPr(H15A) (50 pmol), and His-tagged B. subtilis EI (15 pmol). The following combinations were examined: Lane 1, EI; lane 2, HPr; lane 3, EI and HPr; lane 4, EI and HPr(H15A); lane 5, EI and HPr boiled in 16% trichloroacetic acid for 10 min prior to protein gel electrophoresis; lane 6, EI and HPr incubated in the presence of an excess of unlabeled phosphoenolpyruvate (10 mm). (C) The autoradiography of a 15% SDS polyacrylamide gel shows [32P]phosphoenolpyruvate-dependent phosphorylation of native S. coelicolor HPr and phosphorylation of His-tagged S. coelicolor HPr by partially purified S. coelicolor EI. Lane 1, 5 pmol His-tagged EI of B. subtilis plus 3 pmol HPr of B. megaterium; lane 2, 5 pmol His-tagged EI of B. subtilis; lane 3, 7.5 pmol His-tagged EI of B. subtilis and 20 pmol His-tagged HPr of S. coelicolor; lane 4, 7.5 pmol His-tagged EI of B. subtilis and 5 mg E. coli FT1/pFT2 cell extract containing native HPr of S. coelicolor; lane 5, 7.5 pmol His-tagged B. subtilis EI plus 5 mg E. coli FT1/pLysS/pET15b cell extract (control); lane 6, 15 pmol His-tagged EI of B. subtilis and 20 mL S. coelicolor HPr of HPr-containing gel filtration fraction; lane 7, 5 mL S. coelicolor EI of EI-containing gel filtration fraction; lane 8, 5 mL S. coelicolor EI of EI-containing gel filtration fraction plus 200 pmol Histagged HPr of S. coelicolor.

314 S. Parche et al. (Eur. J. Biochem. 265)

q FEBS 1999

Fig. 3. Reconstitution of the fructose-specific PTS. Enzyme IIFru activity was monitored by fructose phosphorylation. Membranes containing IIFru (20 mg) were incubated in the presence of His-tagged EI of B. subtilis (30 pmol) and His-tagged HPr of S. coelicolor (900 pmol) (X), in the presence of His-tagged EI of B. subtilis (30 pmol) (P), and without additional protein (B).

Fig. 5. ATP-dependent phosphorylation of HPr. [g32P]ATP-dependent phosphorylation was performed by incubation of 300 pmol of B. subtilis His-tagged HPr (lane 1) or S. coelicolor His-tagged HPr (lane 2) and 2 mg of B. subtilis HPr kinase/phosphatase-containing cell extract of DH5a/p4813.

activity was observed when only IIFru-containing membranes with or without EI were assayed. Heterologous interaction of HPr with enzymes II The fact that ptsH is not linked to the gene encoding IIFru leads to the suggestion that HPr may have multiple functions. As no other enzyme II is known from S. coelicolor, we studied the phosphoryl transfer activity of HPr with respect to the glucose-PTS of B. subtilis and the lactose-PTS of S. aureus for which appropriate ptsH mutant strains were available (Table 2). Extracts of B. subtilis ptsH strain QB5350 were incubated with increasing amounts of pure His-tagged HPr in the presence of phosphoenolpyruvate and [14C]aMG. While the crude cell extract alone showed no sugar phosphorylation activity,

addition of S. coelicolor His-tagged HPr yielded formation of methyl aMG-phosphate. Addition of His-tagged HPr(H15A) did not result in methyl aMG phosphorylation indicating that histidine 15 is crucial for HPr activity. Similarly, cell extracts derived from S. aureus ptsH mutant S797A, which expressed the genes encoding the lactose-PTS constitutively, exhibited phosphorylation of [14C]TMG when His-tagged HPr, but not His-tagged HPr(H15A), was added (Table 2). We further examined whether the IIA component of IIMtl of E. coli could interact with S. coelicolor HPr. Figure 4 shows that the IIAMtl protein domain became phosphorylated by His-tagged HPr (lane 2). Thus, HPr of S. coelicolor could serve as a phosphoryl donor for enzymes II of both Gram-positive and Gram-negative bacteria. ATP-dependent phosphorylation As many low-GC Gram-positive bacteria possess an ATPdependent HPr kinase/phosphatase, we examined the possibility of the phosphorylation of S. coelicolor HPr by the HPr kinase/phosphatase of B. subtilis [35,43]. As can be seen from Fig. 5, His-tagged HPr became phosphorylated by B. subtilis HPr kinase/phosphatase (Fig. 5, lane 2). The phosphorylation was also observed when His-tagged HPr(H15A) was used (data not shown). This finding suggests that HPr kinase may exist in S. coelicolor. However, such a phosphorylation activity was not detectable when S. coelicolor cell extracts were used as a source of HPr kinase employing conditions established for B. subtilis HPr kinase/phosphatase.

DISCUSSION
The study describes the first identification of a gene of the PTS complement of S. coelicolor. A protein exhibiting HPr activity was purified from S. coelicolor cell extracts. It could be associated with a gene which has been sequenced as part of the S. coelicolor genome project (Genbank AL009204). This gene has been designated ptsH merely based on fasta sequence comparisons. The fact that our obtained N-terminal protein sequence matched the deduced amino acid sequence of ptsH demonstrates that the gene is expressed in vivo, and therefore is operative. Based on the presented results, we support the gene designation ptsH.

Fig. 4. Phosphorylation of IIAMtl of E. coli. [32P]Phosphoenolpyruvatedependent phosphorylation was carried out with 10 pmol of B. subtilis His-tagged EI, 90 pmol of S. coelicolor His-tagged HPr, and 130 pmol of E. coli IIAMtl in the following combinations: lane 1, EI and HPr; lane 2, EI, HPr, and IIAMtl; lane 3, HPr and IIAMtl.

q FEBS 1999

The HPr of Streptomyces coelicolor (Eur. J. Biochem. 265) 315

From the analysis of the genetic organization it appears that ptsH forms a monocistronic transcription unit as both flanking genes are transcribed in opposite directions, and both intergenic regions exhibit a typical lowered GC content [39]. Interestingly, the adjacent genes do not encode other proteins of the PTS. Such a genetic structure is a so far unique feature within the Gram-positive bacteria. Many low-GC Gram-positive bacteria possess a ptsHI gene arrangement, in which ptsH and ptsI are co-ordinately transcribed [44]. Enteric bacteria possess a tricistronic ptsHIcrr operon, and thus, expression of the general pts genes is also coregulated [16]. A different ptsH gene location was recently found in the Gram-negative organism Treponema pallidum, which apparently does not encode PTS-specific transporters [35,45]. Here, the putative ptsH gene is followed by an orf encoding a protein homologous to HPr serine kinase/phosphatase, suggesting that HPr of T. pallidum may be triggered by ATP-dependent phosphorylation. Interestingly, a monocistronic ptsH gene is also found in species of Mycoplasmae [41,46,47]. In addition, the complement of pts genes in Mycoplasmae comprises genes encoding an HPr serine kinase/phosphatase, an EI, and enzymes II specific for glucose and fructose, respectively [48,49]. The current data on HPr function in species of Mycoplasmae suggest a role in sugar transport and carbon source regulation [48]. Comparative analysis of the gene product HPr revealed it to be equally distant to other HPrs and HPr-like proteins such as those containing the FPr domain specific for a fructose-PTS, or the NPr proteins which may function in nitrogen regulation [50,51]. Therefore, it is likely that the ptsH gene originated from an ancestral gene before gene duplication events occurred that gave rise to the various ptsH gene orthologues and paralogues found at the present stage. To elucidate the functional capacities, S. coelicolor HPr was overproduced and purified in E. coli. A drastic difference in the level of expression was observed, when production of native HPr was compared with production of His-tagged HPr although expression was driven by the same promoter. These differences are explainable by the low E. coli codon usage of the S. coelicolor ptsH gene that has a codon adaptation index of 0.202 corresponding to a poorly expressed gene [52]. The Histagged HPr fusion protein contained 20 codons with an optimal codon usage for E. coli, allowing efficient initiation of translation obviously leading to a significant increase in HPr production. This strategy may be a useful tool to achieve high level expression of other genes of Streptomyces in E. coli. Phosphoenolpyruvate-dependent phosphorylation assays established that HPr was readily phosphorylated in the presence of partially purified S. coelicolor EI, demonstrating that this HPr is operative in S. coelicolor through phosphoenolpyruvatedependent phosphorylation via EI. His-tagged HPr was also phosphorylated heterologously by EI-P of B. subtilis. The phosphorylation was acid-labile and absent in His-tagged HPr(H15A) suggesting that this residue is phosphorylated by EI. There was no marked difference observed in HPr phosphorylation between native HPr and His-tagged HPr fusion protein. Interestingly, when HPr was purified for N-terminal sequence determination, two protein bands corresponding to about 14 kDa and 15 kDa were purified showing an identical N-terminus. And furthermore, the migration behaviour on polyacryalmide gels of native HPr produced in E. coli compared to HPr purified from S. coelicolor was slightly different. This may indicate that HPr in S. coelicolor might exist in different forms, possible as a result of post-translational modification.

We have demonstrated that HPr can operate in the phosphorylation chain of the fructose-specific PTS. Biochemical analyses of fructose-PTSs are only available from Gramnegative bacteria [51,5355]. They all contain an operon with a gene encoding an HPr-like domain, termed FPr, as part of a diphosphoryl transfer protein or a multiphosphoryl transfer protein, respectively. In these cases the FPr-containing proteins transfer the phosphoryl group to the IIFru-complex. By contrast, within the genomes of B. subtilis and Mycoplasmae no equivalent gene is found which might encode a fructosespecific HPr [48,56]. Yet, these bacteria possess a gene encoding a putative IIFru. Thus, it remains to be shown if the ptsH gene in S. coelicolor is part of the fructose-PTS or if S. coelicolor possesses a gene encoding a fructose-specific HPr domain. Complementation analysis of ptsH mutant extracts combined with S. coelicolor HPr showed that it could be phosphorylated by S. aureus EI and B. subtilis EI, and that it could transfer its phosphoryl group to the lactose-specific IIALac of S. aureus, and to the glucose-specific enzyme IICBAGlc of B. subtilis [16]. Furthermore, the IIAMtl protein of E. coli could be phosporylated by S. coelicolor HPr. These data suggest that HPr might be operative for other, not yet discovered, PTSs in S. coelicolor. Recently, an orf located on cosmid St4 A1 has been sequenced as part of the S. coelicolor genome project which encodes a product homologous to IIMalX of E. coli (ftp://ftp.sanger.ac.uk/pub/S_coelicolor/sequences). IIMalX belongs to the glucose-family of PTS transporter proteins [16]. However, the specific substrate has not been identified and it remains to be demonstrated if HPr is required for IIMalX activity. Another interesting feature of S. coelicolor HPr is that it could be phosphorylated by ATP through HPr kinase/phosphatase of B. subtilis, while E. coli HPr which also has a conserved seryl residue at position 46 clearly becomes unphosphorylated [35]. This raises the question whether S. coelicolor possesses an HPr kinase/phosphatase. Such a finding would strengthen the hypothesis that HPr might serve a regulatory role in S. coelicolor. However, we tested S. coelicolor cell extracts for HPr kinase activity in the presence of excess HPr from S. coelicolor or from B. megaterium employing conditions established for B. subtilis HPr kinase/phosphatase. An ATPdependent phosphorylation of a protein corresponding to the size of HPr was not detected (S. Parche, unpublished results). Thus, it remains to be seen whether S. coelicolor possesses an HPr kinase/phosphatase. It should be mentioned that such an HPr kinase/phosphatase might be activated mechanistically different from the B. subtilis protein, observed for HPr kinase/ phosphatase of Enterococcus faecalis and Acholeplasma laidlawii [43,57]. As HPr is centrally involved in the phenomena of carbon regulation such as catabolite repression and inducer exclusion in other bacteria, it will be interesting to study if it has the same regulatory role in S. coelicolor [4,16,21,27]. The signal pathway of CCR is not well-understood in S. coelicolor. It will be worthwhile to investigate whether HPr might interact with one of the known components of this pathway such as glucose kinase, BldB, and the product(s) encoded or regulated by ccrA [7,911,15]. A hint as to a possible role of HPr in carbon regulation may come from the fact that a perfect tandem repeat of 14 bp is located upstream of ptsH. This tandem repeat is highly similar to a 12-bp tandem repeat found within the chi63 promoter as well as to promoters of chitinase genes of other Streptomyces species [58]. Mutational analysis of this cis element demonstrated that chi63 has an essential role mediating

316 S. Parche et al. (Eur. J. Biochem. 265)

q FEBS 1999
14. Titgemeyer, F., Reizer, J., Reizer, A. & Saier, M.H. Jr (1994) Evolutionary relationships between sugar kinases and transcriptional repressors in bacteria. Microbiology 140, 23492354. 15. Pope, M.K., Green, B.D. & Westpheling, J. (1996) The bld mutants of Streptomyces coelicolor are defective in the regulation of carbon utilization, morphogenesis and cellcell signalling. Mol. Microbiol. 19, 747756. 16. Postma, P.W., Lengeler, J.W. & Jacobson, G.R. (1993) Phosphoenolpyruvate:carbohydrate phosphotransferase systems of bacteria. Microbiol. Rev. 57, 543594. 17. Saier, M.H. Jr (1993) Regulatory interactions involving the proteins of the phosphotransferase system in enteric bacteria. J. Cell. Biochem. 51, 6268. 18. Lux, R., Jahreis, K., Bettenbrock, K., Parkinson, J.S. & Lengeler, J.W. (1995) Coupling the phosphotransferase system and the methylaccepting chemotaxis protein-dependent chemotaxis signaling pathways of Escherichia coli. Proc. Natl Acad. Sci. USA 92, 1158311587. 19. Peterkofsky, A., Seok, Y.J., Amin, N., Thapar, R., Lee, S.Y., Klevit, R.E., Waygood, E.B., Anderson, J.W., Gruschus, J., Huq, H.al. (1995) The Escherichia coli adenylyl cyclase complex: requirement of PTS proteins for stimulation by nucleotides. Biochemistry 34, 89508959. 20. Seok, Y.J., Sondej, M., Badawi, P., Lewis, M.S., Briggs, M.C., Jaffe, H. & Peterkofsky, A. (1997) High affinity binding and allosteric regulation of Escherichia coli glycogen phosphorylase by the histidine phosphocarrier protein, HPr. J. Biol. Chem. 272, 2651126521. 21. Saier, M.H. Jr (1989) Protein phosphorylation and allosteric control of inducer exclusion and catabolite repression by the bacterial phosphoenolpyruvate:sugar phosphotransferase system. Microbiol. Rev. 53, 109120. 22. Garrity, L.F., Schiel, S.L., Merrill, R., Reizer, J., Saier, M.H. Jr & Ordal, G.W. (1998) Unique regulation of carbohydrate chemotaxis in Bacillus subtilis by the phosphoenolpyruvate-dependent phosphotransferase system and the methyl-accepting chemotaxis protein McpC. J. Bacteriol. 180, 44754480. 23. Reizer, J., Romano, A.H. & Deutscher, J. (1993) The role of phosphorylation of HPr, a phosphocarrier protein of the phosphotransferase system, in the regulation of carbon metabolism in gram-positive bacteria. J. Cell. Biochem. 51, 1924. 24. Hueck, C.J. & Hillen, W. (1995) Catabolite repression in Bacillus subtilis: a global regulatory mechanism for the gram-positive bacteria? Mol. Microbiol. 15, 395401. 25. Deutscher, J., Kuster, E., Bergstedt, U., Charrier, V. & Hillen, W. (1995) Protein kinase-dependent HPr/CcpA interaction links glycolytic activity to carbon catabolite repression in gram-positive bacteria. Mol. Microbiol. 15, 10491053. 26. Stulke, J., Arnaud, M., Rapoport, G. & Martin-Verstraete, I. (1998) PRD a protein domain involved in PTS-dependent induction and carbon catabolite repression of catabolic operons in bacteria. Mol. Microbiol. 28, 865874. 27. Titgemeyer, F., Walkenhorst, J., Cui, X., Reizer, J. & Saier, M.H. Jr (1994) Proteins of the phosphoenolpyruvate:sugar phosphotransferase system in Streptomyces: possible involvement in the regulation of antibiotic production. Res. Microbiol. 145, 8992. 28. Hopwood, D.A., Bibb, M.J., Chater, K.F., Kieser, T., Bruton, C.J., Kieser, H.M., Lydiate, D.J., Smith, C.P., Ward, J.M. & Schrempf, H. (1985) Genetic Manipulation of Streptomyces. A Laboratory Manual. John Innes Foundation, Norwich. 29. Ausubel, F.A., Brent, R., Kingston, R.E., Moore, D.D., Seidmann, J.G., Smith, J.A. & Struhl, K. (1990) Current Protocols in Molecular Biology. Greene Publishing and Wiley-Interscience, New York. 30. Landt, O., Grunert, H.P. & Hahn, U. (1990) A general method for rapid site-directed mutagenesis using the polymerase chain reaction. Gene. 96, 125128. 31. Arber, W. (1960) Transduction of chromosomal genes and episomes in E. coli. Virology 11, 250272. 32. Schmid, R., Bernhardt, J., Antelmann, H., Volker, A., Mach, H., Volker, U. & Hecker, M. (1997) Identification of vegetative proteins for a

glucose repression. Two adenosines at positions 7 and 9 were reported to be crucial for glucose-repression. They are also conserved in the tandem repeat preceding ptsH. The present study has provided molecular evidence that the ptsH gene encodes a protein with properties resembling those typical for a general HPr constituent of the PTS. Further detailed analyses such as phenotype characterization of a ptsH mutant are required to uncover the physiological function(s) of this HPr in S. coelicolor.

ACKNOWLEDGEMENTS
We are grateful to Steffi Bachem, Anne Galinier, Knut Jahreis, George Robillard, Jorg Stulke, and Andrea Wagner for gifts of strains, plasmids, and protein. We thank Esther de Boef and Elke Dietel for performing mass spectrometry analysis, and Eva Uhlemann for technical assistance. We thank Kerstin Mahr for critical reading of the manuscript. These studies were carried out in the laboratory of Wolfgang Hillen. His support is greatly appreciated. The work was funded by the SFB171 and SFB473 of the Deutsche Forschungsgemeinschaft.

REFERENCES
1. Chater, K.F. (1998) Taking a genetic scalpel to the Streptomyces colony. Microbiology. 144, 14651478. 2. Schlosser, A. & Schrempf, H. (1996) A lipid-anchored binding protein is a component of an ATP-dependent cellobiose/cellotriose-transport system from the cellulose degrader Streptomyces reticuli. Eur. J. Biochem. 242, 332328. 3. Schlosser, A., Kampers, T. & Schrempf, H. (1997) The Streptomyces ATP-binding component MsiK assists in cellobiose and maltose transport. J. Bacteriol. 179, 20922095. 4. Titgemeyer, F., Walkenhorst, J., Reizer, J., Stuiver, M.H., Cui, X. & Saier, M.H. Jr (1995) Identification and characterization of phosphoenolpyruvate:fructose phosphotransferase systems in three Streptomyces species. Microbiology. 141, 5158. 5. Hurtubise, Y., Shareck, F., Kluepfel, D. & Morosoli, R. (1995) A cellulase/xylanase-negative mutant of Streptomyces lividans 1326 defective in cellobiose and xylobiose uptake is mutated in a gene encoding a protein homologous to ATP-binding proteins. Mol. Microbiol. 17, 367377. 6. Chater, K.F. & Hopwood, D.A. (1983) Streptomyces. In Bacillus Subtilis and Other Gram-Positive Bacteria (Sonenshein, A.L., Hoch, J.A. & Losick, R., eds), pp. 8399. American Society for Microbiology, Washington DC. 7. Kwakman, J.H. & Postma, P.W. (1994) Glucose kinase has a regulatory role in carbon catabolite repression in Streptomyces coelicolor. J. Bacteriol. 176, 26942498. 8. Angell, S., Schwarz, E. & Bibb, M.J. (1992) The glucose kinase gene of Streptomyces coelicolor A3(2), its nucleotide sequence, transcriptional analysis and role in glucose repression. Mol. Microbiol. 6, 28332844. 9. Pope, M.K., Green, B. & Westpheling, J. (1998) The bldB gene encodes a small protein required for morphogenesis, antibiotic production, and catabolite control in Streptomyces coelicolor. J. Bacteriol. 180, 15561562. 10. Ingram, C., Delic, I. & Westpheling, J. (1995) ccrA1: a mutation in Streptomyces coelicolor that affects the control of catabolite repression. J. Bacteriol. 177, 35793586. 11. Angell, S., Lewis, C.G., Buttner, M.J. & Bibb, M.J. (1994) Glucose repression in Streptomyces coelicolor A3(2), a likely regulatory role for glucose kinase. Mol. Gen. Genet. 244, 135143. 12. Walter, S. & Schrempf, H. (1996) The synthesis of the Streptomyces reticuli cellulase (avicelase) is regulated by both activation and repression mechanisms. Mol. Gen. Genet. 251, 186195. 13. Ingram, C. & Westpheling, J. (1995) The glucose kinase gene of Streptomyces coelicolor is not required for glucose repression of the chi63 promoter. J. Bacteriol. 177, 35873588.

q FEBS 1999
two-dimensional protein index of Bacillus subtilis. Microbiology 143, 991998. Galinier, A., Haiech, J., Kilhoffer, M.C., Jaquinod, M., Stulke, J., Deutscher, J. & Martin-Verstraete, I. (1997) The Bacillus subtilis crh gene encodes a HPr-like protein involved in carbon catabolite repression. Proc. Natl Acad. Sci. USA 94, 84398444. Roossien, F.F., Brink, J. & Robillard, G.T. (1983) A simple procedure for the synthesis of [32P]phosphoenolpyruvate via the pyruvate kinase exchange reaction at equilibrium. Biochim. Biophys. Acta. 760, 185187. Reizer, J., Hoischen, C., Titgemeyer, F., Rivolta, C., Rabus, R., Stulke, J., Karamata, D., Saier, M.H. Jr & Hillen, W. (1998) A novel protein kinase that controls carbon catabolite repression in bacteria. Mol. Microbiol. 27, 11571169. Marck, C. (1988) `dna strider': a `C' program for the fast analysis of DNA and protein sequences on the Apple Macintosh family of computers. Nucleic Acids Res. 16, 18291836. Pearson, W.R. & Lipman, D.J. (1988) Improved tools for biological sequence comparison. Proc. Natl Acad. Sci. USA 85, 24442448. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F. & Higgins, D.G. (1997) The clustal_x windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25, 48764882. Strohl, W.R. (1992) Compilation and analysis of DNA sequences associated with apparent streptomycete promoters. Nucleic Acids Res. 20, 961974. Haydon, D.J. & Guest, J.R. (1991) A new family of bacterial regulatory proteins. FEMS Microbiol Lett. 63, 291295. Zhu, P.P., Reizer, J., Reizer, A. & Peterkofsky, A. (1993) Unique monocistronic operon (ptsH ) in Mycoplasma capricolum encoding the phosphocarrier protein, HPr, of the phosphoenolpyruvate:sugar phosphotransferase system. Cloning, sequencing, and characterization of ptsH. J. Biol. Chem. 268, 2653126540. Weigel, N., Kukuruzinska, M.A., Nakazawa, A., Waygood, E.B. & Roseman, S. (1982) Sugar transport by the bacterial phosphotransferase system. Phosphoryl transfer reactions catalyzed by enzyme I of Salmonella typhimurium. J. Biol. Chem. 257, 1447714491. Kravanja, M., Engelmann, R., Dossonnet, V., Bluggel, M., Meyer, H.E., Frank, R., Galinier, A., Deutscher, J., Schnell, N. & Hengstenberg, W. (1999) The hprK gene of Enterococcus faecalis encodes a novel bifunctional enzyme: the HPr kinase/phosphatase. Mol. Microbiol. 31, 5966. Stulke, J., Martin-Verstraete, I., Zagorec, M., Rose, M., Klier, A. & Rapoport, G. (1997) Induction of the Bacillus subtilis ptsGHI operon by glucose is controlled by a novel antiterminator. Mol. Microbiol. 25, 6578. Fraser, C.M., Norris, S.J., Weinstock, G.M., White, O., Sutton, G.G., Dodson, R., Gwinn, M., Hickey, E.K., Clayton, R., Ketchum, K.A., Sodergren, E., Hardham, J.M., McLeod, M.P., Salzberg, S., Peterson, J., Khalak, H., Richardson, D., Howell, J.K., Chidambaram, M., Utterback, T., McDonald, L., Artiach, P., Bowman, C., Cotton, M.D., Venter, J.C.al. (1998) Complete genome sequence of Treponema pallidum, the syphilis spirochete. Science. 281, 375388. Himmelreich, R., Hilbert, H., Plagens, H., Pirkl, E., Li, B.C. & Herrmann, R. (1996) Complete sequence analysis of the genome of the bacterium Mycoplasma pneumoniae. Nucleic Acids Res. 24, 44204449. Fraser, C.M., Gocayne, J.D., White, O., Adams, M.D., Clayton, R.A., Fleischmann, R.D., Bult, C.J., Kerlavage, A.R., Sutton, G., Kelley, J.M. & et al. (1995) The minimal gene complement of Mycoplasma genitalium. Science. 270, 397403.

The HPr of Streptomyces coelicolor (Eur. J. Biochem. 265) 317


48. Reizer, J., Paulsen, I.T., Reizer, A., Titgemeyer, F. & Saier, M.H. Jr (1996) Novel phosphotransferase system genes revealed by bacterial genome analysis: the complete complement of pts genes in Mycoplasma genitalium. Microb. Comp. Genomics 1, 151164. 49. Zhu, P.P., Nosworthy, N., Ginsburg, A., Miyata, M., Seok, Y.J. & Peterkofsky, A. (1997) Expression, purification, and characterization of enzyme IIA (glc) of the phosphoenolpyruvate: sugar phosphotransferase system of Mycoplasma capricolum. Biochemistry 36, 69476953. 50. Powell, B.S., Court, D.L., Inada, T., Nakamura, Y., Michotey, V., Cui, X., Reizer, A., Saier, M.H. Jr & Reizer, J. (1995) Novel proteins of the phosphotransferase system encoded within the rpoN operon of Escherichia coli. Enzyme IIANtr affects growth on organic nitrogen and the conditional lethality of an erats mutant. J. Biol. Chem. 270, 48224839. 51. Geerse, R.H., Izzo, F. & Postma, P.W. (1989) The PEP: fructose phosphotransferase system in Salmonella typhimurium: FPr combines enzyme IIIFru and pseudo-HPr activities. Mol. Gen. Genet. 216, 517525. 52. Sharp, P.M. & Li, W.H. (1987) The codon adaptation index a measure of directional synonymous codon usage bias, and its potential applications. Nucleic Acids Res. 15, 12811295. 53. de Crecy-Lagard, V., Binet, M. & Danchin, A. (1995) Fructose phosphotransferase system of Xanthomonas campestris pv. campestris: characterization of the fruB gene. Microbiology 141, 22532260. 54. Macfadyen, L.P., Dorocicz, I.R., Reizer, J., Saier, M.H. Jr & Redfield, R.J. (1996) Regulation of competence development and sugar utilization in Haemophilus influenzae Rd by a phosphoenolpyruvate: fructose phosphotransferase system. Mol. Microbiol. 21, 941952. 55. Wu, L.F., Tomich, J.M. & Saier, M.H. Jr (1990) Structure and evolution of a multidomain multiphosphoryl transfer protein. Nucleotide sequence of the fruB (HI) gene in Rhodobacter capsulatus and comparisons with homologous genes from other organisms. J. Mol. Biol. 213, 687703. 56. Kunst, F., Ogasawara, N., Moszer, I., Albertini, A.M., Alloni, G., Azevedo, V., Bertero, M.G., Bessieres, P., Bolotin, A., Borchert, S., Borriss, R., Boursier, L., Brans, A., Braun, M., Brignell, S.C., Bron, S., Brouillet, S., Bruschi, C.V., Caldwell, B., Capuano, V., Carter, N.M., Choi, S.K., Codani, J.J., Connerton, I.F., Danchin, A. et al. (1997) The complete genome sequence of the gram-positive bacterium Bacillus subtilis. Nature. 390, 249256. 57. Hoischen, C., Dijkstra, A., Rottem, S., Reizer, J. & Saier, M.H. Jr (1993) Presence of protein constituents of the gram-positive bacterial phosphotransferase regulatory system in Acholeplasma laidlawii. J. Bacteriol. 175, 65996604. 58. Ni, X. & Westpheling, J. (1997) Direct repeat sequences in the Streptomyces chitinase-63 promoter direct both glucose repression and chitin induction. Proc. Natl Acad. Sci. USA 94, 1311613121. 59. Stulke, J., Martin-Verstraete, I., Charrier, V., Klier, A., Deutscher, J. & Rapoport, G. (1995) The HPr protein of the phosphotransferase system links induction and catabolite repression of the Bacillus subtilis levanase operon. J. Bacteriol. 177, 69286936. 60. Hengstenberg, W., Penberthy, W.K., Hill, K.L. & Morse, M.L. (1969) Phosphotransferase system of Staphylococcus aureus: its requirement for the accumulation and metabolism of galactosides. J. Bacteriol. 99, 383388. 61. Studier, F.W. (1991) Use of bacteriophage T7 lysozyme to improve an inducible T7 expression system. J. Mol. Biol. 219, 3744. 62. Levy, S., Zeng, G.Q. & Danchin, A. (1990) Cyclic AMP synthesis in Escherichia coli strains bearing known deletions in the pts phosphotransferase operon. Gene 86, 2733.

33.

34.

35.

36. 37. 38.

39. 40. 41.

42.

43.

44.

45.

46.

47.