UNIVERSITY OF OTTAWA Faculty of Science Biochemistry

BCH 3356 MOLECULAR BIOLOGY LABORATORY Fall 2011

LABORATORY MANUAL

Coordinator: Luc Poitras Technicians: Christian Prud’homme Marc Fredette Jean Kan

Biosciences 202 and 211 30 Marie Curie

Table of Contents Schedule ........................................................................................................................................ iii General information ..................................................................................................................... iv Objectives .................................................................................................................................. iv Organization ............................................................................................................................... v Attendance ................................................................................................................................. v Safety in the Laboratory ............................................................................................................. v WHIMIS ...................................................................................................................................... vi Evaluation ................................................................................................................................. vii Assignments ..................................................................................................................... vii In Lab performance .......................................................................................................... vii Lab Notebook .................................................................................................................. viii In lab teaching ................................................................................................................. viii Laboratory reports .......................................................................................................... viii Exams ................................................................................................................................ ix General introduction for Laboratory class I-IV ............................................................................ 1 Introductory Laboratory Basic techniques and Polymerase Chain Reaction (PCR) amplification .................................... 3 Laboratory Class I Amplification of a target DNA sequence by PCR ..................................................................... 17 Laboratory Class II Ligation of PCR products into a cloning vector ....................................................................... 31 Laboratory Class III Bacterial transformation of the ligation products .................................................................. 47 Laboratory Class IV Screening for recombinant plasmid and DNA sequencing ...................................................... 59 General introduction for Laboratory class V-VIII ........................................................................ 75 Laboratory Class V Protein expression ................................................................................................................... 77 Laboratory Class VI Protein purification .................................................................................................................. 89
i

..................................................................................................... 103 Laboratory Class VIII Western analysis and enzymatic assay (Part II) ............................................................................................................................ 115 Appendices Appendix SI (Système International) units and prefixes .................... 136 Appendix E : Techniques Appendix E1 : Agarose gel casting ........................................................................ 132 Appendix D3 : Percentage of error .............................. 122 Appendix B In-Lab teaching ....................................................................................................... 137 Appendix E2 : Estimation of length and amount of DNA bands ................................................................................. 140 ii ............................................ 138 Appendix E3 : DNA purification by affinity chromatography ........... 127 Appendix C Laboratory reports ....................................................................................................................................................................................... 130 Appendix D2 : Beer-Lambert Law ............................................................Laboratory Class VII Western analysis and enzymatic assay (Part I) . 134 Appendix D4 : Insert/vector molar ratio for ligation .................................................................................. 139 Glossary .................................................................................................. 135 Appendix D5 : Bacterial competency .................................................................................................................................. 121 Appendix A Laboratory notebook ....................... 128 Appendix D: Calculations Appendix D1 : Serial dilution ............

TBT333 DGD Friday / 14:30 – 16:00. BB CA DA.Schedule fall 2011 Section Schedule LAB SECTION AA. results and discussion Second assignment report for section introduction First Formal Lab report Second Formal Lab report iii . AB BA. MNT203 Detailed Schedule WEEK 1 2 3 4 5 6 7 8 9 10 11 12 13 14 September 12-15 September 19-22 September 26-29 October 3-6 October 10-13 October 17-20 October 24-27 Oct 31-Nov 3 November 7-10 November 14-17 November 21-24 Nov 28-Dec 1 December December 12-15 LAB Introduction Lab 1 : PCR amplification Lab 2 : Ligation Lab 3 : Transformation No lab Lab 4 : Screening and DNA sequencing Reading week Practical Exam Lab 5 : Protein expression Lab 6 : Protein purification Lab 7 : Western and enzymatic assay Lab 8 : Western and enzymatic assay Final Exam No Lab Due dates First assignment report for section Materials and methods. DD All sections All sections DAY/TIME Monday / 11:30 – 17:30 Tuesday / 13:00 – 19:00 Wednesday / 11:30 – 17:30 Thursday / 11:30 – 17:30 DGD Thursday / 8:30 – 10:00.

We can summarize these goals into five specific objectives: 1. 3. you will first employ these techniques to characterize a mutation that has been introduced into the gene coding sequence of an enzyme. you will express and purify this enzyme with the goal of assessing the effect of this mutation on the enzyme’s enzymatic activity. you should have gained an understanding of the techniques and skills used in a molecular biology laboratory. iv . To provide you with experience in scientific communication. in the form of In-lab teaching and laboratory reports. 2. Lab coordinator: Luc Poitras Office: GNN170A. To introduce you to the theory behind each technique and to describe common applications of each methodology in molecular biology. Objectives: The Molecular Biology Laboratory (BCH3356) is intended to introduce you to a variety of techniques required to conduct research in the field of molecular biology. 2039 Office/lab hours: Monday to Thursday 13:00 to 17:00 lpoitras@uottawa.ca Teaching Assistants (TAs): During the course of this lab. TAs will evaluate your In-lab performance. 4. In addition. A list containing the contact information for all TAs will be available on virtual campus. Subsequently. To teach you how to explore the scientific literature and to use various bioinformatics web sites. video demonstrations of specific techniques. To prepare you for a future career in research. 5. you will learn to write laboratory reports modeled on those present in scientific literature. mark your assignments and your lab reports as well as answer your questions. you will be supervised by a TA. Upon completion of this project. During the course of this laboratory. you will find this manual. lab results as well as discussion forums. On this site.General information Web site: Course BCH3356 – Molecular Biology Laboratory is on the virtual campus of the University of Ottawa. Each TA will be responsible for eight lab stations corresponding to 16 students. To provide you with essential laboratory skills and 'hands on' experience in performing basic molecular biology techniques. Tel.

2. Absences at two lab sessions or more. Your group number will determine the TA who will supervise your lab work. Attendance at laboratory sessions is compulsory. 2. 4. two discussion groups will be held. you need to justify your absence to the course coordinator and provide the necessary documentation. will result in a final grade of “Incomplete” for the BCH3356 lab. If you have two justified laboratory absences. Thursday’s DGD will be held in Tabaret 333 (TBT333) from 8h30 to 10h whereas Friday’s DGD will be presented in Montpetit 203 (MNT203) from 14h30 to 16h. consult the lab coordinator as soon as possible in order to make up for the missed sessions on a different day. For an unjustified absence. During this session you will be grouped in teams of two students (If you do not have a partner. Attendance at the DGD is highly recommended. exercises involving common calculations seen in molecular biology and lectures on how to write scientific reports. even if they are justified. Never pipette anything by mouth. we will help you find one). there will be eight 6-hour sessions (See Detailed schedule on page iii).Course Organization: 1. All laboratory sessions will be held in the afternoon from 11:30 to 17:30 or from 13:00 to 19:00 (See Section schedule on page iii). You can choose to attend one of the two sessions. This rule will be strictly enforced. There will be seven laboratory sections from Monday to Thursday. Safety in the laboratory It is extremely important to work safely in a laboratory environment. 3. Following the introduction session. Topics covered at the DGD will include: the theory behind the techniques used in the lab. v . Medical certificates issued by a licensed physician must be provided. Please read y the following general guidelines carefully: General Laboratory guidelines     There will be no drinking. Long hair must be tied back or restrained. If you miss a laboratory session. Failure to wear a lab coat will result in expulsion from the lab and loss of marks for that experiment. Your lab coat must be worn and properly fastened at all times. The first laboratory session (Introduction) will take place on the week of September 12th. a mark of zero (0) will be automatically assigned for the corresponding laboratory session. Attendance: 1. eating or makeup application in the laboratory at any time. It must not be worn in non-laboratory areas. Every week.

You may also have to remove your gloves to handle certain instruments. or think you are developing. Through different computers in the lab. Use a fume hood when working with volatile chemicals. be sure to inform your TA or a member of the staff. showers and first aid stations. You can also use the links provided in the lab manual. Dispose of waste in the appropriately labeled containers. (This is normally indicated in the lab manual). including microorganisms. If you are not sure. Familiarize yourself with the location of fire extinguishers. vi . eye wash stations. Keep your working space clean and free from clutter. Wear safety glasses for all procedures. you will have to buy them. Contact lenses should not be worn when you are working with volatile solvents. start a washing procedure and inform your TA or a member of the staff immediately. or if you believe that you have been exposed to hazardous materials.        Wear latex or plastic gloves to protect your skin from exposure to chemicals or infectious materials. If you have. as well as decontamination procedures for a particular substance. ask first. be labeled and that a Material Safety Data Sheet (MSDS) accompany each hazardous substance. WHIMIS Federal legislation such as the Workplace Hazardous Materials Information System ( WHIMIS) requires that all hazardous substances. bags and coats should be left in lockers outside the lab. Contact lenses should only be worn when other forms of corrective eyewear are not suitable. you have online access to the MSDS for all reagents used during a laboratory session (Click on the MSDS Search icon on the desktop window). An MSDS describes hazardous properties. You must remove your gloves and immediately wash your hands before leaving the laboratory and at any time after handling materials known or suspected to be contaminated. Gloves will not be provided by the lab. If an accident or a spill occurs. Gloves should be removed carefully and disposed with other laboratory waste. Personal belongings such as books. handling and storage precautions. a latex allergy.

your TA will evaluate your compliance with the safety guidelines provided by this manual and staff members. the quality of your lab results will be taken into consideration for the in lab performance assessment. 1. In Lab performance (10%) In Lab performance will be assessed based on technical ability and the quality of your results: 1. All assignments will be equally weighted.Evaluation: The Molecular Biology laboratory will be marked according to the following scheme: Your lab TA will be evaluating all components related to the assignments. Evaluation of in lab performance should not be considered as a strict marking scheme since a number of marks may get subtracted every time an incorrect action or behavior is noticed. A different TA will be correcting your lab reports. vii . Therefore. 2. Ice buckets must be emptied and excess reagents disposed as demonstrated by your TA. Assignments (10%) Most labs include a section: To be individually handed to your TA when entering the lab. Quality of results (5%): The quality of your lab results generally reflects the quality of your work in the lab. Also. 2. work organization and efficiency as well as the proper use of equipment. The Introduction lab assignment will be completed during the lab session whereas the remaining 9 assignments are to be completed before entering the following lab. precision. in-lab performance and teaching. You will not be responsible for cleaning glassware: however you will be required to leave a tidy work station. Technical ability (5%): Your TA will evaluate your dexterity.

more formal assessment will be done at the end of lab 8. Notebooks will be assessed by the coordinator at two different occasions during the semester. You will be required to produce a complete laboratory report (formal report) for each module. Laboratory reports (25%: 2. At the end of each class section in this manual there is a subsection called. These two assessments will be equally weighted (5% each). <Results>. The objective of these teaching presentations is to highlight important experimental aspects of each laboratory and to stimulate discussion among students and TAs. Lab notebooks will be initialed by your TA twice at every session. The form that will be used for the evaluation of the teaching sessions is an adapted version of the one used for the Biochemistry Seminar class (BCH4932). In lab teaching marks will be assigned by TAs. In lab teaching (10%) During the course of this lab. Reading Materials for Teaching Topics.5 % for each of the two assignment reports and 10% for each of the two formal laboratory reports) The semester is divided in two modules.3. All teaching sessions will be equally weighted. and <Discussion> sections of the PCR reaction performed in Lab 1. Guidelines for the maintenance of your laboratory notebook are listed in Appendix A. Before handing in your first formal laboratory report. Every group will have the opportunity to present 2 or 3 times during the semester. 4. The number beside each teaching topics corresponds to the group in charge of preparing and delivering the teaching lesson. Understanding these aspects will help you better appreciate the molecular principles that underlie molecular biology techniques. It is your responsibility to ask your TA to initial your notebook (1) immediately upon your arrival and (2) just before your departure from the lab. Your TA will initial your notebook immediately below the very last lane of written information. Lab notebook (10%) You are expected to record all your experimental work in a personal lab notebook. you will be asked to do two or three presentations. Each presentation should fit within a timeslot of 5-10 minutes and you only have access to a chalk and a black board for illustrating information (Power Point slideshows are not possible). you will be required to prepare two short assignment reports (or drafts). subcloning and protein purification. The first draft report will be about the <Materials and methods>. These teaching topics are to be taught during down times by pre-designated groups. The first assessment will be done randomly during any of the laboratory classes and a second. 5. The second draft report will be the <Introduction> of your formal viii . In lab teaching sessions are to be prepared and presented in groups (the regular lab groups).

All lab reports are to be directly handed in to the lab coordinator at your arrival in the lab at the due dates indicated in the Detailed Schedule on page iii. For this exam. Your report can be prepared and submitted in pairs OR on an individual basis.uottawa. one treatment and one negative control. In preparing your reports. All assignment reports should be prepared according to the guidelines that are provided in A Guide to Writing in the Sciences. by agarose gel electrophoresis. calculations or sentences from previous reports or any other non-quoted sources will be considered plagiarism. Analytical skills will also be assessed by written questions to be answered during the downtime of the PCR amplification.pdf). academic fraud. This book. According to the Academic Regulations of the University. you will use only your own data. The final exam will assess your general understanding of ix . Half marks will be assigned if a draft report receives an unsatisfactory rating. Late reports will be penalized at the rate of 10% per day.ca/plagiarism. Laboratory reports will be evaluated by a TA.5%. Any evidence of plagiarism will result in an academic fraud report to the Faculty. who has been specifically assigned for marking lab reports. including plagiarism and falsified data. Evaluation will be based on the quality of PCR products (5%) and analytical skills to be assessed through your written answers (5%).lab report. each laboratory section will be divided in two groups: the team member whose last name comes first alphabetically should attend the first three hours of the laboratory session while the other partner must attend the second half of the laboratory session. can be purchased at the University of Ottawa bookstore (≈ 20$). b. Additional suggestions on how to organize and write your report are provided in Appendix C. Every student will prepare a reaction mixture for PCR amplification and assess the products of. Any explicit discordance between your report and the recorded data from the lab session will be also considered as evidence of plagiarism. Use of results. The purpose of these two short assignment reports is to provide you with some feedback before you hand in your first formal laboratory report. section 9B. Exams (35%) a. Full marks will be assigned as long as a satisfactory assignment is submitted. In lab practical exam (10%) A practical exam will be administered on an individual basis during the regular laboratory classes scheduled on the week of Oct 31-Nov 3. different then your regular TA. may result in severe sanctions (see http://www. Each assignment report is worth 2. The marking scheme that will be used by the TA in charge of evaluating your report is also provided in the same appendix. which is essential for BCH3356. 6. Final exam (25%) The faculty of Science will release a date for a final exam which counts for 25% of your final mark.

One full DGD will be dedicated to review the final exam from last year. The content of the final exam will be based on the specific objectives (<Underlying molecular principles> and <Analytical skills>) listed at the beginning of each laboratory class. x .the concepts described in the lab manual and your ability to analyze and interpret experimental results. The questions from the assignments are also representative of what you should expect for the final exam.

Francis Crick proposed one of the “central dogmas” of biology by suggesting that information passed from DNA to RNA to the proteins (2). You will express. T7 RNA polymerase is often used in molecular biology since it can synthesis RNA from any piece of DNA located downstream of its specific promoter. Through PCR amplification and subcloning techniques. T7 RNA polymerase was first discovered in the T7 Bacteriophage (Enterobacteria Phage T7).General Introduction for Lab I-IV 2011 General Introduction for Laboratory I-IV Recombinant DNA technology In 1953. In the first half of the semester (Laboratory I to IV). a phage capable of infecting various bacteria. you will be provided with a recombinant plasmid vector containing the coding sequence of one of three T7 RNA polymerase sequences. including several E. you will transfer the coding sequence of your T7 RNA polymerase to a plasmid vector that is suitable for protein production (pTrcHisB)and identify which version of the T7 coding sequence you have received. Francis Crick made another ground breaking discovery in 1961 when he discovered that individual amino acids were specified by specific codons in the DNA sequence (3). Francis Crick and James Watson made one of the most important discoveries of the 20th century by determining the structure of DNA (1). More specifically. RNA polymerase catalyzes the synthesis of RNA in a 5’ to 3’ direction. the T7 promoter (whose length is around 20 base pairs). These discoveries paved the way for the development of recombinant DNA technology which is also referred to as genetic engineering. a series of powerful techniques were designed to manipulate. Recombinant DNA refers to an artificially made piece of DNA that has been created by combining two or more unique DNA sequences into a single recombinant molecule. 1 . A few years later. in 1957. purify and charactherize your specific T7 RNA polymerase recombinant protein in the second half of the semester. we will manipulate and characterize the DNA sequence and the protein product of an enzyme called T7 RNA polymerase. One of these sequences contains a point mutation that results in the substitution of a glutamic acid for an alanine. modify and even create new DNA sequences not found in nature. a second one has a mutation substituting a serine for an alanine and the last sequence is the wild type sequence. you will find a short introduction on the theory and principles of each technique involved in a specific lab session. coli strains (4). The main objective of the BCH3356 Molecular Biology Laboratory is to give you the opportunity to become familiar with the most commonly used techniques in recombinant DNA technology. At the beginning of each laboratory section in the manual. Complementary information will be provided by your lab TA and by the TA in charge of the preceding week’s DGD. To achieve this.

.

LEARNING OBJECTIVES Underlying molecular principles  Understand the underlying principles of a PCR amplification Hands-On skills  Use a pipettor to transfer micro-volumes  Prepare serial dilutions  Prepare a suitable microenvironment for an enzyme assay  Measure the UV absorbance of a DNA solution to estimate its concentration  Amplify DNA using PCR  Cast an agarose gel  Load DNA samples onto an agarose gel and proceed to electrophoresis Analytical skills  Estimate the concentration of a DNA solution based on its absorbance at 260nm  Assess the size and amount of DNA fragments visible on an agarose gel picture  Estimate PCR amplification yield by comparing the amount of DNA amplified to the amount of DNA template initially added to the reaction mixture 3 . By the end of this introductory laboratory. These skills are crucial for successful experiments in molecular biology. However. all protocols are to be completed on an individual basis. groups of students (2 or 3 if needed) will be formed. At the beginning of this lab. for this laboratory session. you should feel comfortable with the hands-on procedures listed in the Learning objectives.Introductory Laboratory 2011 BASIC TECHNIQUES AND POLYMERASE CHAIN REACTION (PCR) AMPLIFICATION OVERVIEW This introductory laboratory quickly reviews some basic laboratory skills that you learned last year in the Introduction to Biochemistry: BCH2333 laboratory component.

If the denaturation step is too short.5°C. For instance. Mullis and his colleagues further improved PCR by using a thermostable DNA polymerase isolated from the hot-spring bacterium Thermus aquaticus. for instance. called Polymerase Chain Reaction or PCR. To overcome this problem. the Taq polymerase. Since then.Introductory Laboratory 2011 BACKGROUND A. or if the temperature is too low. PCR amplification In 1983. On the other hand.5°C. dsDNA will be partially denaturated and can renature rapidly. Step 2: Primer annealing: The melting temperature (Tm) of primers is of critical importance in designing the parameters of a successful PCR amplification. or if the denaturation step is too long. as the likelihood of primer annealing is reduced. The annealing temperature (Ta). Amplification of DNA by PCR occurs through a repetitive series of three fundamental steps that define one PCR cycle (see Figure 1): Step 1: Denaturation: During this step. excessive loss of enzyme activity will occur with each cycle. corresponds to the temperature of the thermocycler during the annealing step. A simple formula for estimating the Tm of short DNA oligonucleotides is: Tm = 64. to amplify specific pieces of DNA from a few copies to millions of copies using a DNA polymerase and short complementary DNA fragments known as primers (5-6). 40 minutes at 95°C. A rule of thumb is to use a Ta value that is about 5°C below the lowest Tm of the two primers. more stable DNA polymerases have been engineered. A consequence of a Ta that is too high is lower amplification. Taq DNA polymerase has a halflife of more than two hours at 92. This incorrect annealing can lead to "non-specific" amplification (extra amplification products that can be seen on an agarose gel) and reduced yield of the desired product. One consequence for using a Ta value that is too low is that one or both primers might anneal to sequences other than their true targets. Kary Mullis developed a new technique. a high temperature is necessary to convert double stranded DNA (dsDNA) into single stranded DNA (ssDNA). Several years after their discovery. as internal singlebase mismatches or partial annealing may be tolerated.4)/N Where N is the total number of nucleotides. The Ta is adjusted according to the length and the relative GC content composition of the primers. 4 . which is sometimes confused with the Tm. but only 5 minutes at 97. you will be using Phusion High-Fidelity DNA polymerase (NEBiolabs).9°C + 41°C x (# of G’s and C’s – 16. This step is essential so that each primer can access and anneal to its complementary single-stranded DNA template (2nd step). if the temperature is too high. Annealing does not take long: most primers will anneal efficiently within 30 sec or less. PCR has revolutionized medical and biological research. In this laboratory.

html. Overview of the process of PCR amplification of a target DNA sequence. make sure to watch this animation on PCR amplification: http://www. Optimal extension activity occurs at about 72°C.Introductory Laboratory 2011 Step 3: Primer extension: This is the DNA synthesis step mediated by a DNA-dependent DNA polymerase. DNA extension can be initiated only at a free 3’ end. although the extension rate for the Phusion High-Fidelity polymerase used in this lab is significantly higher.org/ddnalc /resources/pcr. (http://scienceblogs. It is the annealing of primers onto their complementary target sequences that generates the necessary free 3’ ends for priming DNA extension. You should notice that by the end of the third cycle only 2 out of the 8 amplified copies have the correct lengths. This schematic describes the first 3 cycles of a PCR reaction. A heat-stable DNA polymerase is required to withstand the denaturing steps carried out at 95-98°C. Depending on the pH and salt concentration. To better understand how the target fragment gets selectively amplified during the subsequent PCR cycles. the rate of nucleotide incorporation for Taq DNA polymerase at 72°C varies from 35 to 100 nucleotides per second. Many commercial DNA polymerases were originally purified from a thermophilic bacterium such as Thermus aquaticus.jpg) 5 .dnalc. Figure 1. which lives in hot springs.com/insolence/upload/2007/06/PCR.

Agarose gel electrophoresis of DNA Gel electrophoresis is a technique used to separate macromolecules – especially proteins and nucleic acids .5 to 2%. DNA fragments will be visualized by staining with SYBR safe®. A final extension step of 5-10 min is usually added at the end of the very last PCR cycle to ensure the full extension of all DNA fragments. These factors include: % agarose concentration. larger fragments migrate proportionally faster than small fragments).5 fg/mL) is added to the gel at this point to facilitate visualization of DNA after electrophoresis. When charged molecules are placed in an electric field. we will instead use a safer DNA stain.that differ in size. By varying the concentration of agarose. However. The higher the agarose concentration. The gel is immersed within an electrophoresis buffer that provides ions to carry a current and some type of buffer to maintain the pH at a relatively constant value. Fragments of linear DNA migrate through agarose gels with a mobility that is inversely proportional to the log of their molecular weight. Circular forms of DNA migrate in agarose differently from linear DNAs of the same mass. fragments of DNA from about 200 to 50. In DNA/RNA agarose electrophoresis (8). The molecular weight of a 6 . DNA or RNA fragments appear as green bands when the gel is exposed to UV light.Introductory Laboratory 2011 A PCR reaction usually involves 25-40 amplification cycles. it is poured into a casting tray containing a sample comb and allowed to solidify at room temperature or in the cold. This fluorescent dye intercalates between bases of DNA and RNA. as ethidium bromide is toxic mutagen. It is often incorporated into the gel so that staining occurs during electrophoresis. Agarose is a polysaccharide extracted from seaweed. known as SYBR safe® (Invitrogen). Agarose gels are prepared by mixing agarose powder with buffer solution to a final concentration of 0. ethidium bromide (final concentration 0. B. the choice of electrophoresis buffer and SYBR safe®. Following separation. nucleic acids have a negative charge at neutral pH. Most commonly. Several factors have important effects on the mobility of DNA fragments in agarose gels. charge or conformation (7). voltage (as the voltage applied to a gel is increased. In contrast to proteins. After cooling the agarose solution to about 55 °C. a gel of agarose is cast in the shape of a horizontal thin slab.000 bp can be separated. they migrate toward either the positive (anode) or negative (cathode) electrode according to their charge. with wells for loading the sample close to the cathode (usually indicated by a black wire). and can be used to advantage in optimizing separation of DNA fragments. but the gel can also be stained after electrophoresis by soaking in a dilute solution of SYBR safe®. the "stiffer" the gel will be and the smaller the size of the DNA or RNA fragments that can be separated. followed by heating until a clear solution is obtained. The relative migration distance of each molecule is determined by the charge density of the molecule and the resistance of the matrix (or gel) media to the passage of the molecule. The porosity of the gel is inversely related to the agarose concentration. which can have either a net positive or net negative charge. PCR primer design will be further discussed in the Background section of Laboratory class I. due to their backbone phosphate groups of.

For example. It is important to keep in mind that the distance travelled by a DNA fragment is dependent on its length.Introductory Laboratory 2011 linear DNA sample can be estimated by running a mixture of linear DNA fragments of known size under the same conditions (Figure 2). Figure 2. AlphaQuant™ 1 DNA molecular weight marker (Cell Biosciences). The AlphaQuant™ 1 molecular weight marker has 14 DNA fragments ranging in size from 200 base pairs (bp) to 10. 5 microliters (L) of ladder contains 100 ng of the 10. 7 .000 bp. The amount of each DNA fragment is dependent on the volume of ladder that was loaded on your agarose gel. Fixed amounts of each DNA fragment were mixed to produce this ladder.000 bp DNA fragment whereas 10 L contains 200 ng of the same fragment.

youtube.Introductory Laboratory 2011 PROCEDURES REVISION OF YOUR BASIC LABORATORY SKILLS Performing experiments in a biochemistry lab involves basic skills such as pipetting.com/watch?v=3ukaT_Ih9d8)  Gel electrophoresis Part 2 (8:13) or (http://www. we will review these basic laboratory skills and make sure that you are comfortable performing them.com/watch?v=Q7o1FGFKcvM) Exercise 1: Pipetting (individual exercise) 1.com/watch?v=a1Zyev4BBMs)  Safety procedures (2:30) or (http://www. In the preparation of a microenvironment this kind of error is disastrous. 3.com/watch?v=_QxxB65Gi78)  Ecological practices (3:53) or (http://www.youtube. go to the second position) and put this droplet beside the true 1 L volume.youtube.com/watch?v=NvDTRVxOoZY)  Gel electrophoresis Part 1 (13:05) or (http://www. you will be using a variety of enzymes. You should have mastered these skills in your second year Introduction to Biochemistry laboratory (BCH2333). Make sure you are comfortable with pipetting before proceeding to the second exercise. Now pipet 1 L by misusing the pipettor (e. vortexing and preparing dilutions of concentrated solutions. Exercise 2: Pipetting and mixing viscous solution (individual exercise) One of the most common mistakes observed in the biochemistry lab is not properly mixing enzymatic reactions. Before performing these exercises you should watch the following videos:  Introduction to pipettes (10:04) or (http://www. In this molecular biology lab. Pipet the following volumes directly on your lab bench (use water): 1 L. 5 L. Also practice rinsing 1 L of water in a 10 L droplet that is present in a 0. These enzymes are most often provided in a storage buffer containing a high percentage of glycerol (25-50%). you could end up with twice as much buffer as required and this could inhibit the enzyme or reduce its activity. 8 . 10 L and 50 L.youtube.5 mL micro centrifuge tube. This glycerol acts as a cryoprotectant.youtube. In these exercises. need to be mixed well when transferred to a reaction mix. 2 L. 2.g. Storage buffers are often viscous and therefore. Try to do the same with the other volumes.

R-squared and slope values obtained with your TA. a majority of enzymes will be inhibited by the high concentration of glycerol present at the bottom of the tube. Prepare an extra cuvette with 900 L of water. Exercise 3: Pipetting accuracy and dilution skills (individual exercise) You will now prepare a serial dilution of a concentrated solution of Brilliant Blue R. Consequently. mix the solution using a 10 L micropipettor.025-0. Prepare these dilutions in labeled 1. the r-squared value of the linear regression of your result should be close to one. Because of their high density and viscosity.5 mL centrifuge tubes.035 interval. Transfer 1 L of a 50% glycerol solution into a 20 L droplet of water that is present in a 0. Zero the spectrophotometer at 559 nm with water (extra cuvette) and read the absorbance of your samples. prepare 6 dilutions (5. 25 and 30 g/mL) in a final volume of 1000 L each (see Table 1). Dilution experiment Components Brillant Blue R sol.5 997. Once plotted on a graph. Table 1. Discuss the absorbance.98 or a slope value that is outside of the 0. Note the R-squared and slope values given by the spectrophotometer.5 mL micro centrifuge tube without mixing (a blue dye was added to the glycerol solution to help you visualize the effect of the glycerol). enzymes won’t be well distributed in your reaction mix. The absorbance at 559nm of your diluted samples will be read on a spectrophotometer. at 2 g/L (L) Water (L) Final volume (L) 5 g/mL Dilution 2. Furthermore. You will be given a Brillant Blue R solution at a concentration of 2 g/L. enzyme storage solutions tend to fall at the bottom of the reaction mix after transfer. If you obtain an R-squared value which is less than 0. 5. 20. Now. 9 . 15. 2. Transfer 900 L of each dilution into 6 pre-identified 1 mL cuvettes.Introductory Laboratory 2011 1. 3. 1. 4. you will be asked to repeat this exercise. 10.5 1000 1000 1000 1000 1000 1000 10 g/mL Dilution 15 g/mL Dilution 20 g/mL Dilution 25 g/mL Dilution 30 g/mL Dilution 2.

you should take advantage of this opportunity to ask questions and make sure you are comfortable with all three procedures. Keep all your samples on ice until they are transferred into the thermocycler preset to 4⁰C.ncbi. PCR reactions setup PCR Components H2O (Brown tube) PCR Buffer (Blue tube) MgCl2 (Purple tube) dNTPs (Green tube) Forward primer (Pink tube) Reverse primer (Yellow tube) DNA template (Clear tube) Taq DNA polymerase See TA Total volume Target Concentration concentration of the stock in reaction sample tube 10X 50 mM 10 mM 10 M 10 M 0.0L 1. and in the positive control.0L 1.0L 1.2 mL). Each student should use the following format to label their tubes: Group #.5 L 1.0L 1. a negative control and the test sample. The quality of your results won’t be assessed today and therefore.GGAAGTGTGTAAGAACTATGCTGAGG -3' Primer reverse: 5'.2 M 0. In the negative control.nlm.0L 1. a template will be provided.Introductory Laboratory 2011 BASIC MOLECULAR LABORATORY TECHNIQUES The aim of the next three experiments is to prepare you for future molecular biology laboratory sessions. Prepare two PCR reactions as indicated in the table below.5L 5.0 L 1.5 L 5. Group 14 = 14+P and 14-P).GTGATGTGTTTAGGCTAAGGCTTCT -3' Usually in a PCR experiment. you have a minimum of 3 samples: a positive control.0L 1.gov/nuccore/55627) using two primers:   Primer forward: 5'. 2.5L 1.0 L 10. Luc Poitras.nih. Experiment #1: PCR amplification on a cDNA fragment encoding for the rat serum albumin (Individual exercise) You will be amplifying a fragment of a DNA template containing the cDNA sequence for rat serum albumin (V01222.1 or http://www.2 mM 0. 1. water is used instead of the DNA template.1 ng/50L 5 U/50 L Volume per reaction: Positive control 29.01 ng/L 1X 1. + or – (positive and negative controls) and the first letter of your family name (e.g. For today’s exercise each student will prepare only 2 control samples (negative and positive) for PCR amplification.0 L 50L 10 . PCR reactions should be setup in labeled PCR tubes (0.0L 1.5 mM 0.0L 50L Volume per reaction: Negative control 39.2 M 0. Table 2.

4. VI. Load your aliquot on a 1% agarose gel.5 L of 10X DNA loading buffer. Read the absorbance of your DNA dilution at 260nm (Remember that 1 OD260 = 50 g/mL of dsDNA). close the lid and load your two samples in the pre-cooled thermocycler.5 L of water and 1. mix thoroughly. Using a spectrophotometer. Once the concentration of the DNA solution has been determined. 1. V. III. Experiment #2: Analysis of plasmid DNA by absorbance at 260nm and 280nm. II. 2. 5. you can proceed to Experiment #2. While you wait for your PCR to be completed. Add 3. 6. VII.0mL. individual exercise) You will be provided with an aliquot of plasmid DNA at an unknown concentration. 4. 3. Transfer this dilution into a 1.Introductory Laboratory 2011 3. you will be required to calculate its concentration and then determine the 260/280 ratio. The thermocycler will run the following PCR program for this experiment: I. IV. Prepare a 1:50 dilution of the unknown DNA solution in a final volume of 1. you will load 50 ng of the plasmid DNA on an agarose gel to validate your calculation. Once the PCR reaction is completed. Initial denaturation: Denaturation: Annealing: Extension: Repeat step II to IV 19 times Final extension: Hold temperature: 95°C 95°C 55°C 72°C 72°C 4°C 1 min 30 sec 30 sec 30 sec 10 min 5.5 mL spectrophotometer cuvette. Once you know the concentration. After adding all the components. Prepare a second cuvette with 1mL of water for the blank. Water should be used for the dilution. 11 . prepare an aliquot that contains 50 ng of plasmid DNA in a final volume of 10 L. and by agarose gel electrophoresis (to be done during PCR amplification. 6. retrieve your two tubes and proceed to the electrophoresis procedure (Experiment #3).

Run the gel at 100 volts until the bromophenol blue. Make sure that your tubes are labelled properly. is available on the virtual campus of this course (Useful material folder).Introductory Laboratory 2011 Your TA will also load a standard aliquot containing 50 ng of plasmid DNA. a copy of this software. 4. 1. Your TA will demonstrate the procedure for casting a 1% agarose gel as described in Appendix E1. 2. Your TA will load 5 L of AlphaQuant™ 1 molecular weight marker in two preassigned wells. The support staff will do the electrophoresis of your PCR repeats and post the gel pictures on the course virtual campus. If you want to use this software at home. Students repeating the PCR exercise should fill the DNA Loading Sample Form to facilitate the identification of the different wells on the posted gel pictures. Close your tubes and mix the solution by gently flicking the tube. Analysis of the gel will be achieved using the Alphaview™ software. A picture of your gel will be taken using a gel documentation system (AphaImager mini). Your sample will be compared to this standard to determine your accuracy. gets halfway through the gel (It should correspond roughly to the distance travelled by a 150 bp DNA fragment).) 3. which is used as a tracking dye. you will be asked to prepare two more PCR reactions. Collect the solution from the wall of the tube by using a centrifuge (Your TA will demonstrate how to use the centrifuge. please wait until you know how to use it before proceeding to this step. Pay attention to the demonstration because every team will be asked to cast an agarose gel at least once this semester. as well as the documentation on how to use it. This software was also installed on some computers at the CUBE. Load your samples onto the agarose gel (Make sure your put your name on the sign-up sheet).5 mL micro centrifuge tubes containing 7 L of water and 1 L of 10X DNA loading buffer. Future in lab performance marks will reflect your accuracy in performing similar tasks. 5. If your PCR reaction did not succeed. and then some groups will be required to cast extra gels for the analysis of the PCR amplicons and plasmid DNA aliquots (Experiment #2). Experiment #3: Analysis of the PCR amplicons by agarose gel electrophoresis. 12 . Transfer 2 L from each PCR reaction to two 1.

Show your full calculations for the preparation of your diluted samples of Exercise #3. you will have to complete two separate assignments. ASSIGNMENT TO BE HANDED TO YOUR TA BEFORE LEAVING THE LAB ( /10 Marks) 1. with the DNA marker loaded by your TA. the absorbance obtained for each dilution as well as the corresponding theoretical absorbance values calculated from the Beer-Lambert equation (see Appendix D2) using a coefficient of extinction of 30 L g-1 cm-1 and a cell path length of 1 cm. You should answer questions from the first assignment before leaving the lab today. Refer to the picture of your agarose gel to assess the percentage error for the preparation of your DNA aliquot (see Appendix E3 for percentage error example). Show your full calculations for the preparation of your plasmid DNA sample (50 ng/10L). ( /3 Marks) 3. Also attach a copy of your gel picture. (Don’t forget to put a title for your table). Add ( /3 Marks) 2. by how many times was the initial amount of template DNA amplified (for this part of the question you have to assume that the length of template is similar to the length of the PCR product)? Provide your full calculation details. Your second assignment needs to be handed at the beginning of lab #1 next week (see next page). Prepare a summary table (similar to Table 1) with the volume of Brilliant Blue R and water needed for each dilution. Refer to your agarose gel picture containing your PCR amplicon and estimate the amount of DNA that was amplified within the total PCR mixture (50 L) (see Appendix E2 on how to quantify DNA on agarose gel). If your percentage error is significant. which directly relates to the amount of DNA.Introductory Laboratory 2011 ASSIGNMENT This week. at which step would you suspect that an error could have been made? Are visual estimates of band intensities on agarose gel accurate? ( /4 Marks) 13 . This can be done by visually comparing the intensity of your band. What’s the experimental amplification factor you obtained for your reaction? In other words.

you will have to narrow your search by choosing a source organism.gov/) and perform a search for “T7 RNA polymerase gene”. In order to get the coding sequence of the T7 RNA polymerase. what is the source organism for T7 RNA polymerase? From the list of entries you now have. Notice that most pairs of primers are designed to amplify only one part of the gene of interest. which database results should you choose? Once you have selected results from this specific database. (Do not choose the sequence with the accession number M38308. ( /2 Marks) 14 . The <Pick Primers> tool offers two main options. This can be done by typing the appropriate DNA sequence in each of the two boxes circled in the figure below. Now proceed to a new request by specifying the forward and reverse primers you will be using in the Lab #1 (see page 21 and 22).nlm.nih. what is the important piece of information (other than “T7 RNA polymerase gene”) should you be looking for in the underlined blue title? Indicate the specific GenBank entry number for the T7 RNA polymerase gene you found. the server returns a list of optimal pairs of primers that could be used to amplify the gene of interest. ( /3 Marks) 2. To be successful in this alignment. How many pairs of primers are suggested? Explain why none of those pairs of primers can be used for the subcloning exercise you will complete during the semester? ( /3 Marks) 3. in this case. You can submit a request without specifying any forward or reverse primers and.1.ncbi. why should you use only the nucleotides of your primers that are complementary to the DNA template and omit the nucleotides coding for the recognition site of a restriction enzyme? A hard copy of your alignment results should be appended to your answer and handed in to your TA. access the option <Pick Primers> (see below).Introductory Laboratory 2011 ASSIGNMENT TO BE HANDED IN INDIVIDUALLY TO YOUR TA WHEN ENTERING NEXT WEEK LAB ( /10 Marks) 1. this sequence is a variant of the sequence you will be using for the lab). Once you have retrieved the proper DNA sequence for the T7 RNA polymerase. Access the nucleotide database of NCBI (http://www.

What’s the theoretical length of the expected PCR product to be amplified during Lab 1? Be as accurate as possible when describing the expected length. specify the exact number of nucleotides to be contained in the PCR amplicon. i. ( /2 Marks) 15 .Introductory Laboratory 2011 4. Justify your answer by specifically referring to your BLAST alignment result from question #3 and your primer sequences.e.

Voët. 1985. 3rd Ed. pp 144. Nature. 2. Voët.html 2 16 .. 1970.cellbiosciences. Biochemistry. J. and Waskell. pp 227-31. 230(4732): pp 1350-4. (2007) John Wiley &Sons. Methods in Enzymology. Horn GT. 1957.4. 8. Griffith JS and Orgel LE. (2007) John Wiley &Sons. 1953. 43(5): pp 416-21.com/consumables_alphaimager... Molecular structure of nucleic acids.. Arnheim N.6C. 171(4356): pp 737-8. Chamberlin. Science. Biochemistry. 192: pp 1227-32.neb. 1961. D and Voët. 5. Section 6.Introductory Laboratory 2011 REFERENCES 1.asp SYBR safe: http://www. Faloona F. Proc Natl Acad Sci U S A. Codes without commas.. J. Section 6. 3. 228.com/sybrsafe AlphaQuant™ 1 molecular weight marker http://www. Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. L. Scharf S. Saiki RK. Web references for the materials used in the lab Phusion DNA polymerase: http://www. Watson. 6. Mullis KB. D and Voët. K and Faloona F. 1987. 3rd Ed. pp 156. Mullis. a structure for deoxyribose nucleic acid. 7. Crick FH. Nature.. J.com/nebecomm/tech_reference/polymerases/phusion_high. JD and Crick FH. Specific Synthesis of DNA In Vitro Via a Polymerase Catalyzed Chain Reaction. McGrath. Brenner S and Watts-Tobin RJ. M. New RNA polymerase from Escherichia coli infected with bacteriophage T7.invitrogen. 155 : pp 335-50. General nature of the genetic code for proteins. 4. Erlich HA.. Barnett L. Nature. Crick FH.

As a first step. in sufficient amounts so that its function can be assessed. we will employ a PCR-based subcloning strategy to transfer the coding sequence of a T7 RNA polymerase mutant into a destination plasmid vector. T7 RNA polymerase. Following this PCR amplification. In fact.Laboratory Class 1: Amplification 2011 AMPLIFICATION OF THE T7 RNA POLYMERASE CODING SEQUENCE BY PCR OVERVIEW The purpose of this course is to make use of recombinant DNA technology to purify an enzyme. You won’t know until the end of laboratory session #4 which sequences you received. we will PCR amplify the coding sequence of your polymerase mutant using primers that were specially designed to ensure proper ligation into the destination plasmid vector. As a first step in our PCR-based subcloning. you will be required to identify which T7 RNA polymerase sequence you received as well as the position of the point mutation where applicable. the pTrcHisB vector. the resulting amplicon will be purified and assessed by agarose gel electrophoresis to ensure that a product with the appropriate length has been made. LEARNING OBJECTIVES Underlying molecular principles  List and explain the different steps involved in PCR  Explain the underlying principle for the QIAquick spin column Hands-On skills  Amplify a target DNA sequence of interest using PCR  Perform agarose gel electrophoresis  Perform a BLAST alignment  Purify a PCR amplicon using a Wizard SV Gel and PCR Clean-up system Analytical skills  Design PCR primers with proper 5’ and 3’ ends for subcloning at specific restriction site(s) within a destination vector  Estimate the size and amount of DNA fragments on an agarose gel by relative comparison to quantitative DNA markers  Refer to the picture of an agarose gel to discuss the specificity of PCR amplification  Refer to the picture of an agarose gel to estimate the PCR amplification yield (# of copies amplified)  Use BLAST alignment to predict the length of PCR amplicons 17 . you will be provided with a recombinant plasmid vector containing the coding sequence (cDNA) of one of three T7 RNA polymerase sequences. During this laboratory session.

 Figure 1. Because the two DNA strands are antiparallel (they are side-by-side but in opposite directions). The newly synthesized strand corresponds to the sense strand. In this representation. Therefore. The template sequence that will be given to you is a complementary DNA. we will amplify the coding sequence of the T7 RNA polymerase. Antisense strand: This is the strand that is complementary to the sense strand. Conversion of an mRNA into cDNA. Then. This is done by using a DNA polymerase called Reverse transcriptase forming the antisense strand (First strand cDNA synthesis). ATG corresponds to the start codon (AUG in the mRNA) and the TGA (UGA in the mRNA) represents the stop codon (for simplicity. or cDNA. The polyadenine tail of the transcript is designated by five adenines. only one of the three stop codons is shown). RNaseH is used to remove the mRNA and the second strand of the cDNA is subsequently synthesized by the DNA polymerase I (in combination with specific primers). except for U’s that are substituted with T’s. the sequence of the antisense corresponds to the reverse complement of the sense strand. This semester. Design of PCR primers PCR is a very sensitive technique that requires the oligonucleotide primers to be appropriately designed to ensure specific amplification with low background signal. PCR Amplification Please refer to the Background section of the Introductory Lab to refresh your memory on the basic principles of PCR amplification. 18 .Laboratory Class 1: Amplification 2011 BACKGROUND A. The sense strand is also referred as the coding strand. By convention. The first step in the production of a cDNA is the conversion of the messenger RNA (mRNA) into a complementary DNA strand. fragment of the T7 RNA polymerase mRNA (Figure 1). A thorough understanding of the underlying mechanism for the PCR amplification of each of two DNA strands is essential for successful primer design. B. the sequence of a gene is represented as its sense strand and is displayed 5’ to 3’. we can assign the following nomenclature to the two strands of your cDNA:  Sense strand: this is the DNA strand that corresponds to the mRNA sequence.

Laboratory Class 1: Amplification 2011 To delineate the two ends of the PCR amplicon. they should not be able to anneal to each other) to prevent the formation of primer dimers. the reverse primer will anneal near the stop codon region on the sense strand of the cDNA. this problem is more common when genomic DNA is used as a template. Once you have selected a region you want to amplify. Anneals to the sense (coding) strand to prime elongation of the antisense strand. a forward and a reverse primer: FORWARD primer:   REVERSE primer:   This sequence reads as the reverse complement of the mRNA molecule or the antisense strand of your cDNA. you need to design your primers by following these basic general rules:      Primers usually have a length of 17-28 nucleotides. 19 . Runs of three or more consecutive C’s or G’s within primers may promote mispriming at GC-rich sequences (because of the stability of annealing). this sequence reads identical to the coding sequence of the mRNA molecule or the sense strand of your cDNA. Inversely. By convention. The primer’s base composition should be 50-60% (G+C). two primers are necessary. The 3'-ends of the forward and reverse primers should not be complementary (i. Primers 3’-end should have one or two terminal C or G’s. Anneals to the antisense (non-coding) strand to initiate elongation of the sense strand from its 5’ to 3’ ends Figure 2. the forward primer sequence will anneal near the start codon on the antisense strand of the cDNA (see A and B). The 5’ to 3’ polymerization activity of the Taq DNA polymerase will synthesize a new strand of DNA from the 3’ end of each primer (C) generating an antisense strand from the reverse primer and a sense strand from the forward primer. When amplifying a cDNA. This allows a firm adhesion of primer’s 3’ terminal nucleotides onto the template. Forward and reverse primers.e.

PCR Subcloning Subcloning is a technique used to move a particular gene of interest from a point of origin (parent plasmid vector. it is necessary to engineer the PCR primers to include the appropriate restriction site at each of the two ends. Restriction sites used in our PCR-based subcloning are XhoI (CTCGAG) and EcoRI (GAATTC) (both sites are shown in boxes). Important features of the vector are also displayed on this map: the Ptrc hybrid promoter. This sequence corresponds to nucleotides 361 to 604 of the pTrcHisB vector. pTrcHisB map (Invitrogen). In this laboratory. To successfully achieve this insertion.Laboratory Class 1: Amplification 2011 Finally. the lac operator and the 6 Histidine tag (6xHis). the melting temperature (Tm) of your primers should be optimized for your PCR conditions (see Background section of the Introductory Lab). Figure 3. Once digested by XhoI and EcoRI. C. We will be using the pTrcHisB destination vector for the subcloning of the T7 RNA polymerase. our PCR amplicon will be inserted into a pTrcHisB vector which was previously digested with the same enzymes (boxes). Multiple cloning site (MCS) of the pTrcHisB vector. you will subclone your PCR product which corresponds to the coding sequence of the T7 RNA polymerase into the XhoI and EcoRI recognition sites of your destination plasmid vector. Translation of the MCS is provided below the nucleotide sequence. pTrcHisB (Figure 3 and 4). These features will be further discussed in the second half of the semester. genomic DNA. 20 . Figure 4. etc) into a suitable destination vector. The ATG start codon for the fusion protein is also displayed on the map (dashed line box). You can easily notice the reading frame dictated by the vector start codon (ATG in bold at position 413).

The ATG of the T7 RNA polymerase will not be the start codon of our fusion protein during translation. the reading frame will be dictated by the pTrcHisB vector.Laboratory Class 1: Amplification 2011 Specific aspects of the destination plasmid need to be considered when engineering PCR primers for subcloning: 1. restriction sites will be inserted in our PCR primers in order to insert the PCR amplicon into the destination vector.REV primers during the first and second cycles of the PCR.3' TAT 1 CTCGAG 2 3 G ATGAACACGATTAACATCGCTAAG 4 1 : Three extra nucleotides to ensure optimal XhoI activity 2 : XhoI recognition site 3 : One extra G to maintain the reading frame 4 : Coding sequence (open reading frame) of the T7 RNA polymerase. Engineering of the T7 RNA polymerase Forward primer (T7RNA.TATCTCGAGGATGAACACGATTAACATCGCTAAG . it is advisable to include at least 3-4 additional bases in front of a restriction recognition site to optimize the cutting efficiency of your restriction enzymes.FWR and T7RNA. 2. 21 . see Figure 4). Figures 5 and 6 illustrate the different parts of the two PCR primers you will be using to amplify your T7 RNA polymerase mutant during this lab session.FWR) 5' . you will find two supplementary figures (Supplementary Figures 1 and 2) describing the amplification process of the T7 RNA polymerase using the T7RNA. As mentioned before. ATG of the T7 RNA polymerase is shown in bold. In the Manual section of virtual campus. Figure 5. The ATG start codon is located upstream the 6xHis tag in the pTrcHisB vector (position 413-415 on the pTrcHisB sequence. Therefore. The reading frame of your T7 RNA polymerase needs to be adjusted to the reading frame provided by the destination vector. Because certain restriction enzymes inefficiently cleave recognition sequences located at the very end of a DNA fragments.

Engineering of the T7 RNA polymerase Reverse primer (T7RNA.REV) 5' .3' TAT GAATTC TTACGCGAACGCGAAGTCC 1 2 3 1: Three extra nucleotides to ensure optimal EcoRI activity 2: EcoRI recognition site 3: Coding sequence for the 3’ end of the T7 RNA polymerase cDNA.Laboratory Class 1: Amplification 2011 Figure 6. 22 .TATGAATTCTTACGCGAACGCGAAGTCC . This sequence is the reverse complement of the sense strand.

3.2 M 0. 23 .05 ng/L).5 mL microcentrifuge tube to prepare a Master mix for 3 reactions even though you only have 2 samples (experimental treatment and .Laboratory Class 1: Amplification 2011 PROCEDURES EXPERIMENT #1: PCR amplification of the T7 RNA polymerase insert You will be provided with an aliquot of a recombinant plasmid containing the wild type coding sequence or one of the two mutant T7 RNA polymerases to be subcloned into pTrcHisB. PCR Components Concentration Desirable of the stock concentration sample in reaction tube 5X 10 mM 10 uM 10 uM 2 U/L 1X 0. the destination plasmid vector. we will be amplifying the coding sequence of your T7 RNA polymerase aliquot. You should also add your group number on the lid) and add 90 L of the master mix into each one.0 L 0. Record your mutant template number in your lab notebook. Add 10 L of the aliquot into the appropriate PCR tube (0. Failure to do so will result in a loss of in lab performance marks and also result in failed reactions. therefore. For today’s experiment.5 L 90 L Master Mix for 3 reactions (L) H2O (Brown tube) 5X Phusion HF buffer (Blue tube) dNTPs (Green tube) T7RNA. Use a 1. Keep your reagents and master mix on ice at all times.control). we will substitute the DNA template for water. This aliquot contains a recombinant plasmid vector with the full length sequence for your mutant T7 RNA polymerase to be used as the DNA template for your experimental treatment.reverse (Yellow tube) Phusion DNA polymerase Total volume 270 L 2. You will also perform a negative control.2 M 1U/50 L Volume per reaction: (L) 63.0 L 2. 1. Your TA will supply the DNA template (0. Keep all your tubes on ice until they are transferred into the thermocycler pre-set to 4°C.forward (Pink tube) T7RNA.5ng of template DNA) and add 10 L of water to your negative control. The addition of sufficient reagents for an extra reaction will ensure you don’t run out of the Master mix for the last sample. Respect the sequence indicated in the table when adding the reagents. Mix your master mix well before transferring it to the PCR tubes. This control is used to assess for the presence of background amplification and.2 mM 0.0 L 2. Label 2 PCR tubes (T7 pol and – control). Ask your TA for the Phusion polymerase.0 L 2.5 L 20.

taken from the Promega Wizard handbook. XI. V. VIII. create a salt bridge between the negatively charged phosphate groups of the DNA and the silica column. X. The process works via binding of DNA to silica at high ionic strength. (a PDF copy of this handbook can be found in the “Useful resources” folder of the course virtual campus. and release at low ionic strength. IX. etc. This figure. we will purify your T7 RNA polymerase amplicon using the Promega Wizard SV Gel and PCR Clean-up System®. VII. VI. II.) 24 . Initial denaturation: 98°C Denaturation: 98°C Annealing: 55°C Extension: 72°C Repeat step II to IV 4 times Denaturation: 98°C Annealing: 65°C Extension: 72°C Repeat step VI to VIII 29 times Final extension: 72°C Hold: 4°C 30 sec 10 sec 30 sec 45 sec 10 sec 30 sec 45 sec 10 min EXPERIMENT #2: Purification of the T7 RNA polymerase PCR amplicon. III. Purification of your amplicon is necessary because the conditions (pH. In this experiment. Addition of chaotropic salts. The thermocycler will run the following PCR program for this experiment: I. IV. such as guanidine.Laboratory Class 1: Amplification 2011 4.) used for PCR amplification are not necessarily compatible with the conditions to be used for the restriction digest to be performed next week. represents a schematic of the purification procedure with the Wizard SV Gel and PCR Clean-up System. salt concentrations.

To remove these contaminants from your PCR amplicon. being careful not to wet the bottom of the column with the flowthrough. Proceed to the next step with your remaining T7 RNA polymerase PCR reaction. Discard the column and keep the 1. Apply your sample to the SV Minicolumn and incubate for 60 sec at RT. 9. 25 . 7. Discard the flow-through and return the column to the collection tube. therefore. Transfer 2 L of each PCR reaction (T7 RNA and .5 mL microcentrifuge tube containing your purified T7 RNA polymerase amplicon. This should remove any residual ethanol contained in the Wash buffer from your SV Mini column. Your PCR amplicon is now attached to the silica column.Laboratory Class 1: Amplification 2011 5. The . Centrifuge for 60 sec at 13 000 RPM. Place a SV Minicolumn into a 2 mL collection tube.control) into two labeled microcentrifuge tubes. and then centrifuge for 1 min at 13 000 RPM to elute your purified T7 amplicon. Label your tube with your group number and give it to your TA.) Incubate your SV Minicolumn at RT for 1 min (this step is really important to permit the complete desorption and resolubilization of your DNA). Add 500 L of the Membrane Wash Solution and Centrifuge for 5 min at 13 000 RPM. Discard the flowthrough and return the column to the collection tube. (Be careful not to touch the membrane with the tip of the pipette. 12. 8. 6. 14. This aliquot will be analyzed in parallel with your unpurified T7 amplicon (refer to Step 5) by agarose gel electrophoresis (Experiment #3). However there are also contaminants present that need to be removed. Transfer 2 L of your purified amplicon into a new 1. It is crucial to eliminate residual ethanol left inside the column since it will prevent or lower the solubilization of DNA in water and. 10. Retrieve your tubes from the thermocycler. Centrifuge again for 1 min at 13 000 RPM to evaporate any Ethanol residue on the column. 13. add 700 L of the Membrane Wash Solution to the column and centrifuge for 1 min at 13 000 RPM. Make sure to write a U on the lid of your T7 RNA polymerase aliquot (U for Unpurified). Combine the remaining fraction of your T7 RNA polymerase PCR amplicon (about 98 L) with 1 volume of the Membrane binding Solution (98 L) and mix thoroughly.5 mL microcentrifuge tube.controls will not be purified as it will not be used for ligation next week. Discard the flow-through and place the column back in the same tube. The remaining of your purified T7 RNA polymerase amplicon will be stored at -20°C until next week.5 mL micro centrifuge tube and add 50 L of water directly onto the center of the membrane. Place the column in a clean 1. lower the amount of DNA that can be eluted. 11.

26 . If this is your case. Since only one technician will be present to assist you. Your TA will decide who will be responsible for preparing a gel.Laboratory Class 1: Amplification 2011 EXPERIMENT #3: Agarose gel electrophoresis You will now analyze your PCR product by agarose gel electrophoresis. 15. you will be required to prepare another set of PCR reactions before leaving the lab. Load 5 L of each of your 4 samples and reserve one lane for the DNA ladder (5L) near the middle of the gel. Add 7 L of water and 1L of 10X loading buffer into each tube. This is necessary to ensure that all students can use their own amplicon for ligation next week. To facilitate the identification of samples. Your different amplicons should first be mixed with the loading buffer before being loaded onto the gel. You should have 4 sample tubes: 2 PCR controls and the purified (Step 14) and unpurified (Step 5) T7 amplicon. Cast a 1% agarose gel as described in Appendix E1. Four groups will be sharing one gel (4 samples x 4 groups = 16 wells). please fill the “Loading log sheet”. 18. All the gel pictures will be posted on the BCH3356 virtual campus so you can retrieve and analyze your results. 19. Carry out electrophoresis at 100V until the dark blue dye (bromophenol blue) has moved about halfway down the gel. book a specific time on the log sheet. make sure that your second set of PCR tubes are properly labeled and handed in to your TA before leaving the lab. 17. If your PCR amplification failed. It takes about 40 min to properly separate the DNA bands. Take a picture of your gel using the AlphaImager™ mini. Shorter electrophoresis times might result in partial overlapping of DNA markers and inaccurate length estimate of your PCR products. Mix the contents of each tube thoroughly. Your PCR reactions will be amplified overnight and ONE MEMBER OF THE TEAM should be designated to come back to the lab the following morning (9-12AM) to purify and analyze the amplicon by agarose gel electrophoresis. 16. Ask for a print out of your gel picture to be inserted in your notebook.

1) 27 . What was the rationale for using two different annealing temperatures in the PCR amplification procedure? 2. ( /3 Marks) a. Two different annealing temperatures were used for the PCR amplification (see step 4). Use a diagram to illustrate which specific part of the forward and reverse primers can anneal onto the DNA template for the very first PCR cycle. Refer to the gel picture obtained by this group to fill the summary table provided hereafter. question 4 is intended to serve as preparation for your next lab (Laboratory class 2: Ligation).Laboratory Class 1: Amplification 2011 ASSIGNMENT This week’s assignment can be divided into two separate sections. But a better estimate can be obtained by plotting the log of the length of the DNA markers (on the Y axis) versus the distance traveled on the agarose gel (on the X axis. A molar ratio of 7:1 means that there should be 7 molecules of insert for every molecule of plasmid. b. see also Appendix E2 for an example). c. Questions 1 to 3 will evaluate the knowledge you acquired during this laboratory session whereas. you are expected to systematically generate a standard curve for every gel picture you analyze. Your calculations should take into consideration that samples had been diluted with water and the 10X loading buffer before being loaded onto the gel. Refer to the formula for calculating oligonucleotide melting temperatures presented on page 2 to estimate the melting temperature for the DNA hybrids formed between the forward primer and the DNA template at (1) the very first and (2) very last PCR cycle. Prepare this plot to obtain an accurate estimate of the length of your PCR amplicon. How comparable is your recovery yield to the value that is claimed by the manufacturer (90-95%)? ( /1 Mark) 4. A rough appreciation of the length of your amplicon can be obtained by visually comparing its position against the DNA markers. Estimate the recovery yield for the purification of your T7 amplicon with the Wizard PCR clean-up system. Provide all your calculation details. A group of students from last year completed ligation under conditions similar to the ones you will be using this week. ASSIGNMENT TO BE HANDED IN INDIVIDUALLY TO YOUR TA WHEN ENTERING NEXT WEEK LAB ( /10 Marks) 1. ( /3 Marks) 3. Assuming that the length of your PCR amplicon and vector are 2571bp and 4304bp respectively. Your diagram should specify the specific base pairs of the two DNA hybrids (one for the forward primer and one for the reverse primer). All standard curves must be included in the appendix of your laboratory reports. Notice that for the purpose of this course. You should assume a ligation molar ratio of insert/plasmid of 7:1 and that you will use 30ng of plasmid for the ligation.

Laboratory Class 1: Amplification 2011 Estimate the concentration of the purified digested insert and plasmid (gel below). fill the table with the appropriate volume of the different components of the ligation reaction. ( /3 Marks) Ligation reaction H2O (L) Purified and digested plasmid + purified and digested PCR amplicon Purified and digested plasmid 10ng (L) Purified and digested PCR amplicon (L) Ligation buffer 5X Ligase (1U/L) Total volume (L) (L) (L) 2 40 28 . you will have to perform similar calculations with your own experimental results before you can proceed with ligation. 2) Using the concentrations obtained in 1). Please include all your calculations. In the lab next week.

12 and 20: A Guide to Writing in the Sciences. guanidine. 10 and 18: SYBR Safe DNA stain. See also reference #2 and 3. See also reference #4 and 5. a) What’s the molecular structure of the packing medium inside the column? b) The binding buffer contains a chaotropic agent. a) What is the chemical structure of SYBR (look for SYBR green)? b) Is SYBR Safe really safe for humans? c) Can SYBR Safe be used for staining single-stranded DNA and RNA? d) Describe the two binding modes of SYBR Safe with dsDNA.Laboratory Class 1: Amplification 2011 READING MATERIALS FOR IN LAB TEACHING TOPICS GROUPS 1. c) Organization and contents of the sections results and discussion. processivity and yield b) Discuss the relative effectiveness of Phusion High-Fidelity for amplifying DNA compared with other enzymes. GROUPS 4. 11 and 19: Phusion High-Fidelity DNA polymerase a) Define the following concepts: fidelity. 9 and 17: Promega Wizard SV Gel and PCR Clean-up System (Promega handbook). 29 . 15-26) a) Figure versus table? b) Guidelines for the preparation of complete figures and tables. e) Can salts affect the binding of SYBR Safe onto DNA? GROUPS 3. Results and Discussion (pp. What’s the purpose of adding guanidine in the binding buffer? c) What’s the maximum retention capacity of the column? d) Do you think the column might have been oversaturated when your PCR product was purified? GROUPS 2.

Boom R.qiagen. Bernhagen J.32(12):e103. Rapid and simple method for purification of nucleic acids.com/nebecomm/tech_reference/polymerases/phusion_high. Nucleic Acids Res.com/resources/info/qiagen_purification_technologies_1. http://bitesizebio. Wertheim-van Dillen PM.com/articles/how-silica-spin-column-dna-and-rna-preps-work/ 4. 1990 Mar. 495-503.neb. Jansen CL.com/resources/protocols/technical-bulletins/101/wizard-sv-gel-and-pcrcleanup-system-protocol/ 30 .promega. Vitzthum F. 2. J Clin Microbiol.Laboratory Class 1: Amplification 2011 REFERENCES 1. http://www. its structure determination and methodological implications. http://www. Investigations on DNA intercalation and surface binding by SYBR Green I. Brunner H.co. 2004 Jul 12. van der Noordaa J. Web references for the materials used in the lab Phusion DNA polymerase: http://www.invitrogen. Sol CJ.aspx 3.uk/site/us/en/home/References/Molecular-Probes-TheHandbook/Technical-Notes-and-Product-Highlights/SYBR-Safe-DNA-Gel-Stain.28(3):pp.html 5.asp Promega Wizard SV Gel and PCR Clean-up System: http://www. Salimans MM. Zipper H.

Laboratory Class 2: Ligation 2011 LIGATION OF THE T7 RNA POLYMERASE AMPLICON INTO THE pTRCHISB PLASMID VECTOR OVERVIEW The primers used last week to amplify the insert coding for T7 RNA polymerase had been engineered with a recognition sequence at their 5’ ends. This week. you’ll use the appropriate restriction enzymes. The last step will be to seal the nicks by forming phosphodiester bonds using T4 DNA ligase LEARNING OBJECTIVES Underlying molecular principles    Discuss the functional organization of the different components of the cloning vector to be used for ligation. pTrcHisB/T7. pTrcHisB Explain the procedure for preparing recombinant DNA plasmids Explain the difference between directional and non-directional cloning and discuss the benefits and limitations of each strategy Hands-On Skills     Digest plasmid and a PCR product with restriction enzymes Purify restriction digests using the Wizard SV Gel and PCR Clean-up system Quantify DNA by agarose gel electrophoresis Ligate DNA fragments using T4 ligase Analytical Skills    Design or engineer PCR primers for subcloning Estimate the size and amount of DNA bands on an agarose gel by comparison with quantitative DNA markers Estimate the recovery yield for the purification of digests with the Wizard SV Gel and PCR Clean-up system 31 . These enzymes will generate compatible “sticky” ends necessary for the insertion of T7 RNA polymerase insert into the pTrcHisB vector to form a recombinant plasmid. to digest your amplicon as well as the destination plasmid vector. pTrcHisB. XhoI and EcoRI.

water is added across the phosphodiester bond. an endonuclease cuts each of the two strands to generate a double-strand cut. we will transfer our T7 RNA polymerase amplicon into our destination vector. pTrcHisB. and a second segment with a phosphate group at the 5' position.edu 32 . Figure modified from http://chem wiki. B. Notice that the result of this hydrolytic cleavage reaction generates one segment of DNA with a hydroxyl group at the 3' position. In order to transfer our amplicon in the destination vector. In this case. Cloning strategies In this laboratory session. in which phosphodiester bonds are formed by splitting out a water molecule. During restriction.Laboratory Class 2: Ligation 2011 BACKGROUND A. By contrast. a reaction in which water is added across a bond. we first need to digest both DNA fragments with two predetermined endonucleases. Cleavage of a phosphodiester bond. Most plasmid vectors have a multiple cloning site in which several unique restriction endonucleases recognition sites can be found. nucleotides are joined by condensation reactions. we will join both DNA fragments using T4 DNA ligase. Cleavage is the result of hydrolysis. Restriction Enzymes Restriction endonucleases (also known as restriction enzymes) are enzymes that recognize and cleave double-stranded DNA within specific recognition sequences. Cleavage of the phospho diester bond is achieved through hydrolysis reaction (a water molecule is added to break the bond). XhoI and EcoRI. To complete this first step of the subcloning process. This process will ensure that the ends of the amplicon and our vector are compatible. thereby breaking it. DNA and RNA polymerases and DNA ligases are enzymes that function via condensation.ucdavis. The cleavage mediated by restriction enzymes yields 5’-phosphate and 3’-hydroxyl termini (Figure 2). The following Background sections will provide more in-depth information about digestion and ligation. Figure 1. cleaving the two adjacent nucleotides (Figure 1).

These sequences are specific to each restriction enzyme.Laboratory Class 2: Ligation 2011 As mentioned before. (A) The EcoRI enzyme recognizes the 5’-GAATTC-3’ sequence and performs the hydrolysis of the phosphodiester bond linking the guanine (G) and the adenine (A) on both strands generating cohesive 5’ overhang ends.) For example. Ligation Principle Double-stranded DNA fragments with compatible cohesive termini or blunt ends can be covalently joined (ligated) in an ATP-dependent reaction that involves the formation of phosphodiester bonds between 5'-phosphate residues and 3'-hydroxyl residues. (C) By cutting between the T and A of the 5’-GATATC-3’ sequence. Cohesive 5’ and 3’ overhangs are preferably chosen for preparing DNA fragments to be ligated since blunt-end ligations are less efficient than cohesive-end ligations and require higher concentrations of both DNA ligase and the DNA to be ligated. the EcoRI restriction site can be read GAATTC on both strands (always remember that DNA sequences are read in a 5’ to 3’ orientation). C. Three examples are displayed in this figure. A common enzyme used in molecular biology laboratories for the ligation of DNA fragments (for example. (B) KpnI cuts between the two cytosines (C) of the 5’-GGTACC-3’ sequence to generate cohesive 3’ overhang ends. In ligation reactions. cohesive 3’ overhangs and blunt ends. This means that the 5’ to 3’ nucleic acids sequence you read on one strand is identical to the 5’ to 3’ sequence on the complementary strand (See Figure 2. you will cut DNA at a specific position and you will generate three possible types of ends. Restriction sites are often palindromic sequences. Depending on the restriction enzyme you use. cohesive 5’ overhangs. Three types of ends can be produced by restriction endonucleases. 33 . restriction enzyme cut a specific DNA sequence called a restriction site. Figure 2 Types of ends produced by restriction endonucleases. the insertion of a DNA fragment into a linearized plasmid vector) is T4 DNA ligase (Figure 3). the optimal ratio of vector to insert DNA depends on the vector (lambda. EcoRV generates blunt ends.

ucdavis. Thus we can artificially block ligation by removing the 5’ phosphate of thic DNA strand. or M13 phage). The amount of ligase needed. the size of the DNA fragments. Figure 3. Once ligated. A new phosphate diester bond can be formed between the 3' hydroxyl and 5' phosphate ends of two DNA strands by using an enzyme called T4 DNA ligase in the presence of ATP. and the nature of the DNA termini (cohesive vs blunt ends). DNA-2). This dephosphorylation can be achieved using an enzyme called Alkaline Phosphatase. edu It is important to note that the ligation process can proceed without the 5’ phosphate on one of the DNA strands (Figure 3. the temperature of the reaction and the incubation time can vary considerably depending upon the type of ligation that is being carried out (Cohesive end or blunt end). Dephosphorylation is often used in non-directional ligation strategies since it can prevent can self-ligation of the plasmid vectors digested with only one enzyme (See the next section on Ligation strategies). plasmid. Formation of a phospho diester bond through ligation. D. Dephosphorylation of DNA ends. Figure 4. This enzyme can hydrolyze monoester bonds but not diester bonds (Figure 4). Alkaline phosphatase hydrolyzes the monoester bond between the 5’phosphate and the oxygen atom at the end of a DNA fragment.Laboratory Class 2: Ligation 2011 cosmid. Figure taken from: http://chemwiki. DNA can then be introduced into prokaryotic cells through transformation (to be done next week). A good compromise for ligation is an insert:vector molar ratio of 3:1 with 20-75 ng of vector DNA in a reaction volume of 40 L. Ligation Strategies There are two basic strategies for ligating DNA fragments into plasmid vectors depending on the kind of termini in the insert and vector: 34 .

Only one ligation orientation is possible with this strategy. This prevents recircularization of the vector and also ensures that the insert is oriented in a specific direction inside the vector (Figure 4). arrows were placed where open reading frame are found. Compatibles DNA ends were created at both ends of the insert and in the circular plasmid vector. After ligation. Directional ligation. To illustrate the reading frame concept. Figure 4. you should noticed that the open reading frame of the vector and insert are in the same orientation and this results in one long open reading frame. XhoI and EcoRI were used to digest the destination vector as well as the insert. 35 .Laboratory Class 2: Ligation 2011 a) Directional ligation: This is when two different enzymes are used to produce noncomplementary (non-cohesive) protruding DNA termini. In this example.

Following ligation. 36 . This strategy can result in the formation of undesirable.Laboratory Class 2: Ligation 2011 b) Non-directional ligation: Non-directional ligation occurs when only one enzyme is used to produce either blunt or protruding ends (Figure 5). only one restriction enzyme was used to digest the vector and the insert (XhoI). a recombinant molecule in which the insert was inserted in the right orientation (bottom center) and a recircularized vector (bottom right). alkaline phosphatase should be used to avoid recircularization of the vector when non-directional ligation is performed. As mentioned before. we will be subcloning the coding sequence of the T7 RNA polymerase in a specific orientation to match the reading frame of the pTrcHisB vector and therefore. Figure 5 Non-directional ligation. recircularized plasmid molecules without any insert. three molecules could potentially be found: a recombinant molecule in which the insert was inserted in the wrong orientation (bottom left). it will be a directional ligation.This semester. In this example.

Control Treatments for Ligation The following controls are usually recommended for ligation:   Positive control: usually a plasmid vector that has been digested with only ONE enzyme. These controls are in ADDITION to the controls that will be included for the bacterial transformation portion of the lab next week. Negative control: a doubly digested plasmid with non compatible termini. Notice that a partial digest for which the plasmid is cut with only one of the two restriction enzymes would result in compatible termini that might be ligated. the open plasmid should be recircularized. In this lab. These controls are ONLY for the ligation portion of the experiment (that will verify that your ligase enzyme is functioning properly. 37 . In the presence of T4 ligase. and that your restriction enzymes cut appropriately).Laboratory Class 2: Ligation 2011 E. you will pre-digest pTrcHisB with both XhoI and EcoRI to generate incompatible overhangs so that self-ligation cannot occur.

This latter aliquot (40 ng/40 L) of the undigested pTrcHisB is to be handed in to your TA for storage at -70°C. prepare the agarose gel you will require at step 8 (4-5 groups can share one gel). You will be provided with 2. you shouldn’t have to dephosphorylate your vector since you are using two different enzymes. we will prepare our ligation reactions. While waiting for your digests.) that might interfere and lower the activity of T4 ligase. This step was added to ensure that vector re-ligation cannot occur and to help avoid false positives in later labs. Finally. which is the enzyme to be used for ligation. During the dephosphorylation procedure keep the T7 amplicon digestion in the 37°C water bath. Sample Sample volume (L) 40 L 20 L H2O (L) 10X Buffer React 3 (L) XhoI [10units/L] EcoRI [10units/L] (10 units) 1 L 1 L (10 units) 1 L 1 L Final volume (L) 100 L 100 L T7 Amplicon pTrcHisB (2 g) 2.1 g of pTrcHisB in a final volume of 9 L to be electrophoresed at steps 8-9 (sample 1). 1.Laboratory Class 2: Ligation 2011 PROCEDURES There is three parts to this week experiment. our T7 RNA polymerase amplicon (hereafter referred to as T7 amplicon) and our destination vector. cofactors. At the end of the 2 hour incubation. ect.5 g/25 L of the plasmid vector pTrcHisB. 4. pTrcHisB will be digested using XhoI and EcoRI. Part A: Digestion of the T7 amplicon and the pTrcHisB vector by XhoI and EcoRI. Use the remaining fraction of the undigested pTrcHisB for preparing: 1) An undigested control containing 0. Prepare the restriction digest of your PCR amplicon and pTrcHisB as described in the table below. add 2 L (1 U/L) of Shrimp Alkaline Phosphatase (SAP) to the vector digestion sample and put it back in the water bath for 30 min. Both digests will be further purified using the Wizard PCR clean-up column for removing any contaminants (buffer salts. 38 . First. Digest your two samples for 2 hour at 37°C. 2) An aliquot containing 40 ng in a final volume of 40 L. Under normal circumstances. This undigested aliquot will serve as a positive control for the transformation protocol to be completed next week. 3.

7. Prepare your DNA aliquots to be electrophoresed as follows: 1) 9 L of undigested pTrcHisB vector from step 1 + 1 L of 10X loading buffer 2) 2. Clean up your doubly digested PCR amplicon and pTrcHisB samples using the Wizard PCR clean-up column as described in Appendix E3.5 L of purified digested pTrcHisB vector + 6. 6. 9.5 L of H2O + 1 L of 10X loading buffer.Laboratory Class 2: Ligation 2011 5. 3) 2. 8. Proceed with electrophoresis at 100 V for about 40 min and take a picture of your gel using the AlphaImager™ mini. Transfer 2 L of your doubly digested and purified pTrcHisB in a tube already containing 38 L of water. This aliquot will serve as a negative control for the transformation next week and it has to be handed in to your TA for storage at -70°C.5 L of purified digested T7 amplicon + 6. you need to estimate the concentration of your purified amplicon and vector by agarose gel electrophoresis to figure out the appropriate volumes to be used for ligation. Cast a 1% agarose gel as described in Appendix E1 (4-5 groups can share one gel) and prepare your DNA aliquots to be electrophoresed as explained in the figure below. Incubate for 15 min. Inactivate the SAP by transferring the vector digestion sample from the 37°C water bath to a 65°C heat block. Before proceeding Part C of the experiment. Part B: Estimation of the concentration of your purified doubly digested amplicon and vector. 10.5 L of H2O + 1 L of 10X loading buffer. 39 . Notice that only 5 L of the Alpha Quant DNA ladder are to be loaded onto the gel. Request a print out of your gel picture to be inserted into your laboratory notebook.

11. pTrcHisB digested with XhoI only. Sometimes the amplicon and pTrcHisB bands are hardly visible on agarose gel due to technical difficulties during the purification.Laboratory Class 2: Ligation 2011 Part C: Ligation of doubly digested T7 RNA polymerase amplicon into doubly digested pTrcHisB. then mix and quick spin all your tubes again. and quick spin all your tubes. 40 . H2O Treatments Description (L) I (T7 amplicon +pTrcHisB) II (Negative control) III (Positive control) 1 pTrcHisB digested with XhoI (L) 0 Doubly digested pTrcHisB 40 ng (L) Doubly digested T7 RNA pol. you will require these ligation products for the transformation protocol. Your TA will add the T4 ligase. 8 2 40 0 8 2 40 21 0 8 2 40 You will be provided with an aliquot of pTrcHisB that had already been digested with XhoI (20 ng/L) 13. Incubate the ligations overnight in a thermocycler pre-set to 16°C. Refer to your agarose gel results to estimate the concentrations of your T7 RNA polymerase amplicon and pTrcHisB samples. amplicon (L) Ligation buffer 5X T4 DNA ligase Total volume (L) (L) (L) Digested and purified T7 amplicon and pTrcHisB Digested and purified pTrcHisB alone. This can be done by comparing intensities of the DNA bands of your samples to those of the DNA markers (see Appendix E2). first consult your TA to discuss whether you should use your samples for ligation or borrow someone else`s samples (ligation in presence of low concentrations of DNA is rarely successful). An example of an insert:vector molar ratio calculation is provided in appendix D4. All ligation tubes should be clearly labeled with your group number and the treatment number (Gr2-I. Tomorrow the Technical Staff will store your samples at -70°C. Prepare your ligation reactions as described in the table below. Next week. you have to estimate the concentrations of your PCR amplicon and pTrcHisB samples. Gr2-iii). 12. If this is your case. First. Use your estimated concentrations to fill the table below targeting an insert:vector molar ratio of 7:1 and 40 ng plasmid. mix thoroughly. Before you proceed with ligation. add all components except the T4 ligase. Gr2-ii.

give the leftovers of your pTrcHisB and amplicon samples to your TA.Laboratory Class 2: Ligation 2011 14. 41 . Before leaving the lab.

( /1. ( /1 Mark) 4. had been properly digested. Can you propose a molecular mechanism explaining how the pTrcHisB pre-digested with EcoRI and XhoI can be recircularized once in a while? ( /1. Restriction digest of pTrcHisB Refer to your agarose gel picture and discuss whether your destination plasmid vector.5 Marks) b. you should be as specific as possible and provide the exact number of base pairs for each of the two samples. ( /1 Mark) c. ( /3 Marks) a. Subcloning Primer design is an essential skill for successful PCR amplification.Laboratory Class 2: Ligation 2011 ASSIGNMENT ASSIGNMENT TO BE HANDED IN INDIVIDUALLY TO YOUR TA WHEN ENTERING NEXT WEEK LAB ( /10 Marks) 1. although none should be theoretically expected. Determine the competency of the competent bacteria used in this experiment (see appendix D5). Why is it important to maintain the reading frame of the insert in frame with the reading frame of the poly-His tag when engineering primers? ( /1 Mark) b. What is the exact expected length for (1) your PCR amplicon and (2) pTrcHisB plasmid vector after the digest with EcoRI and XhoI? For this question. removal. What could be an indicator that the plasmid vector was partially digested? ( /1 Mark) 2. Lengths of doubly digested and purified pTrcHisB and PCR amplicon Refer to your agarose gel picture to plot the log of the length of the DNA markers (on the Y axis) vs the mobility as measured by the distance traveled on the agarose gel (on the X axis. The table below (see next page) shows approximate colony numbers (mock results) you might expect for some of the transformation treatments (See next laboratory session for more details of each condition). ( /3 Marks) a. pTrcHisB. see also Appendix E2 for an example).5 Marks) 42 . Explain your reasoning. A couple of transformant colonies can be observed for the negative ligation control (transformation treatment II: pTrcHisB without any inserts). substitution or nucleotides) to keep the reading frame of the DNA insert coding for T7 RNA polymerase in frame with the reading frame of the poly-His tag. ( /1. Transformation.5 Marks) 3. Explain how the forward primer was modified (addition.5 Marks) b. ( /3 Marks) a. What was the experimental length you obtained by comparison to the DNA markers for (1) your PCR amplicon and (2) pTrcHisB? Are the expected lengths for the amplicon and pTrcHisB plasmid comparable with the ones measured from the agarose gel? ( /1. Identify to first 10 amino acids that will be present at the N-terminus when your T7 RNA polymerase is translated from the recombinant pTrcHisB/T7 plasmid.

Laboratory Class 2: Ligation 2011 Treatment Transformation Mock # colonies (LB-agar plate with ampicillin) 48 5 50 (10X dilution) I II VI pTrcHisB + T7 Insert pTrcHisB without any insert DNA (negative control for ligation) Positive transformation treatment with undigested pTrcHisB (1 ng) 43 .

Laboratory Class 2: Ligation 2011
READING MATERIALS FOR IN LAB TEACHING TOPICS

Groups 5, 13 and 21: Plasmid conformations and mobility on agarose gel vs oxidative stress: http://www3.interscience.wiley.com/cgi-bin/fulltext/113449269/PDFSTART a) How could you assess if a plasmid was completely digested by a restriction enzyme or not by exclusively considering the results from agarose gel electrophoresis? b) Could you estimate the size of a supercoiled plasmid using the Alphaquant1 DNA ladder? Groups 6, 14 and 22: T4 DNA ligase a) What are the different possible controls for a ligation treatment? b) Discuss the difficulties sometimes encountered when DNA ligation is completed with T4 DNA ligase. Groups 7, 15 and 23: A Guide to Writing in the Sciences (pp. 10-11 and 23-26) a) Introduction versus abstract Groups 8, 16 and 24: A Guide to Writing in the Sciences, References (pp. 26-30 and 33-35) a) When should a reference be included? b) Plagiarism versus referencing

44

Laboratory Class 2: Ligation 2011
REFERENCES

General references 1. Endonucleases: http://onlinelibrary.wiley.com/doi/10.1002/0471142727.mb0301s31/pdf 2. Ligases : http://onlinelibrary.wiley.com/doi/10.1002/0471142727.mb0314s94/pdf 3. Phosphatases : http://onlinelibrary.wiley.com/doi/10.1002/0471142727.mb0310s00/pdf

Web references for the materials used in the lab EcoRI: http://www.neb.com/nebecomm/products/productr0101.asp XhoI: http://www.neb.com/nebecomm/products/productr0146.asp Shrimp Alkaline Phosphatase or SAP http://www.fermentas.com/en/products/all/modifying-enzymes/phosphatases-kinase/ef051shrimp-ap T4 DNA ligase http://tools.invitrogen.com/content/sfs/manuals/t4dnaligase_1U_man.pdf

45

you will count the transformant colonies and analyze some of the colonies to confirm the presence of the expected recombinant plasmid. coli cells Transform competent cells Cast agar plates Inoculate agar plates with bacterial suspensions under sterile conditions Analytical Skills  No results to be generated this week (colonies will only be counted next week) 47 . your T7 RNA polymerase PCR amplicon was ligated into the pTrcHisB vector at the XhoI and EcoRI restriction sites. Next week. In this laboratory. pTrcHisB/T7. LEARNING OBJECTIVES Underlying molecular principles   Explain the concept of cell competence and the procedure for making cells competent List and explain the genetic features of the DH5 cell line that justify its common use for subcloning Hands-On Skills     Prepare competent E. you will recuperate your ligation products and use them to transform competent E coli cells. and only the successfully transformed cells having integrated an intact copy of pTrcHisB or pTrcHisB/T7 will survive and grow. You will then plate your transformation mixtures on agar plates containing the ampicillin antibiotic.Laboratory Class 3: Transformation 2011 BACTERIAL TRANSFORMATION OF THE LIGATION PRODUCTS OVERVIEW Last week.

coli DH5.Laboratory Class 3: Transformation 2011 BACKGROUND A. 9:2501). step 1). is nearly 106 transformants per µg of plasmid DNA in presence of 50 mM Ca2+ compared to less than 10 transformants per µg of plasmid DNA without Ca2+ (J Bacteriol 1995. the transformation efficiency of E. and the phosphate groups within the plasmid DNA backbone (Biomacromol 2008. 177:486). for instance. bacteria are made “competent”. as this vector has a gene coding for resistance to ampicillin. you will use an agar plate with ampicillin to screen for successfully transformed cells containing pTrcHisB. The importance of divalent cations. Ca2+. E. addition of plasmid DNA (step 2). Artificial transformation of bacterial cells with plasmid DNA has become a routine procedure. especially Ca2+. uptake (step 3) and selection of phenotypic trait such as resistance to ampicillin (step 4). Bacterial Transformation Genetic transformation is a process in which a bacterial recipient can take up exogenous DNA. yet the mechanism by which the hydrophilic DNA molecule is transported across the plasma membrane is still poorly understood. A complete transformation process includes: the development of cell competence (Figure 1. The mechanism by which the negatively charged DNA gets transported across the plasma membrane involves the formation of transitory coordination complexes between lipopolysaccharides. 48 . coli is normally made competent for uptake of exogenous DNA in the laboratory by artificial means that usually involve chemical treatments. In the lab. for inducing competence is well established. To enhance the efficacy with which bacterial cells take up DNA and become transformed. Step 4 displays screening of transformant cells using a selective medium.

Bacteria having integrated an empty or a recombinant pTrcHisB molecule can therefore survive in the presence of ampicillin. C. If contaminants are transferred onto the agar plates during inoculation. Antibiotic Resistance DNA vectors such as plasmids usually contain a resistance gene for facilitating the screening of cells that have been successfully transformed. and other contaminants.Laboratory Class 3: Transformation 2011 B. Sterile conditions are important in this experiment to prevent contamination of your LB agar plates. The following general guidelines will help you maintain a sterile environment: 49 . This selection process is very valuable because bacterial transformation is relatively exceptional with only a very small percentage of competent cells being transformed. pTrcHisB contains a gene coding for β-lactamase. At the ampicillin concentration found in agar (200 g/mL). the ampicillin concentration remaining in agar will be lowered due to degradation (The half life of ampicillin is approximately 2-5 days) or metabolism by transformant cells. although the growth of many others will only be retarded (bacteriostatic effect) and some microorganisms will not be affected at all. ideally only the transformant cells will be able to actively grow. although all other non-transformed cells cannot. But after a couple of days. an enzyme hydrolyzing the β-lactam ring of ampicillin. Sterile Conditions Sterile conditions refer to laboratory practices to avoid exposing preparations to bacteria. For the purpose of this lab. most microorganisms will not survive (bactericidal effect). maintenance of sterile conditions is imperative as your plates will be kept in the lab for one week – you will only return to the lab by next week for counting colonies and proceeding to the inoculation of some liquid cultures (see lab 4). This explains why initially `clean` agar plates might become contaminated after a couple of days. and the bacteriostatic effect is lessened. mold.

Why are we using the DH5 E. minimize the amount of time the container is exposed to air. sterile pipettor tip for every transfer and keep your tip box closed as much as possible to minimize cross contamination Keep the lids of your tubes closed when not using your samples The lids of microcentrifuge tubes can be easily contaminated by contact with non-sterile surfaces (e.: Does not carry the F+ plasmid for conjugation.. Work near a flame when opening tubes or dishes to decrease air borne contamination. media bottles or tubes that are open Set up your work area so that you don’t have to manipulate or move things directly above your plates Always work near the flame (working distance should be less than 20cm) Use a new. Media can be also contaminated by contact with non-sterile surfaces or by air borne organisms. 50 . your fingers) or by air borne particles. Be careful when transferring solutions from one tube to another. Open lids and coverings carefully avoiding contact with any part of the cover that may contact the media.g. Some features contributing to the stability of the DH5cell line and making it suitable for cloning purposes are:  F. An important step in ensuring biosafety since it prevents accidental dissemination of plasmids.Laboratory Class 3: Transformation 2011          Maintain a clean work area by washing with 70% ethanol before and after transformation Wear clean gloves Avoid talking or breathing directly above agar plates. coli Cells? The DH5 cell line has been designed for routine cloning applications.  D.

EndA+ cell lines have been observed to degrade plasmid DNA during long term storage. DeoR and nupG: Permits uptake of larger sized plasmids LacZM15: Deletion of the alpha portion of the beta-galactosidase gene. EndA.Laboratory Class 3: Transformation 2011     RecA1.: Lack of the functional endonuclease EndA. coli cells will be transformed with the undigested pTrcHisB that contains the resistance gene to ampicillin. These transformation controls are in ADDITION to the controls that were included in the ligation portion of the experiment 51 .: Lack of the RecA1 functional protein that is necessary for DNA recombination. The specific controls you will be doing in the lab this week are:  Positive transformation control: Competent E. A RecA1. E.cell line therefore minimizes unwanted recombination between plasmid and bacterial chromosome. strictly refer to the transformation portion of the experiment. Blue-white screening is not possible with pTrcHisB. Important Considerations: TRANSFORMATION CONTROLS Controls should be included to assess the efficacy of the experimental procedure when transforming competent cells. This control will allow you to calculate the transformation efficiency. Allows screening of transformant colonies based on their color (blue/white screening). which verify competence and absence of background ampicillin resistance of bacteria. but only with certain plasmid vectors.  Notice that these controls. It is the efficiency with which competent cells can take up exogenous DNA and survive the antibiotic selection process. This treatment is to assess for background resistance of the competent DH5 cells to ampicillin without any plasmid DNA. Amp r. Transformation efficiency is always represented as the number of transformants or colony forming units (cfu) per microgram of DNA used for the transformation (See Appendix D5) Negative transformation control: Competent cells will be incubated without any plasmid DNA.

1M CaCl2 plus 15% glycerol are on ice.6). Centrifuge the cells for 10 min at 3300g and 4°C. Before performing this exercise you should watch the following video: Sterile conditions (10:04) or (http://www. and this inoculated broth was incubated overnight at 37°C on a rotary shaker (225 cycles/min). It is important that you can cast your agar plates at the very beginning of the lab to get them ready for plating today’s transformation.youtube. the Technical Staff members transferred 1 mL of this overnight LB liquid culture. Centrifuge the cells for 10 min at 3. 5. Discard the medium and gently resuspend the pellet of cells in 5 mL of cold 0. 2 mL of Luria Bertani (LB) liquid broth without ampicillin was inoculated with a colony of DH5 cells by the Technical Staff. Over incubation of the liquid agar with ampicillin at high temperature (45-60°C) might also result in ampicillin degradation. The flask was then kept under vigorous agitation at 37°C until an optical density at 600nm of ~0. Your cell preparation is now ready for transformation. (DO NOT VORTEX) 7. Remove the supernatant and gently resuspend the cell pellet in 1.30 was reached (about 2 hours). 4. Also ensure that the two working solutions of 0.Laboratory Class 3: Transformation 2011 PROCEDURES Your TA will demonstrate how to prepare agar plates with ampicillin (200g/mL). 2. you will be provided with 10 mL of this liquid culture. 52 . 6. E. Pour 10 mL of the DH5 liquid culture into a centrifuge tube and immediately chill the tube on ice for 15 min.1M CaCl2 s and 0. 1. It is important to note that this optical density was chosen due to time constraints (an optimal optical density would be around 0. At your arrival in the laboratory. They will easily lyse and die if vortexed or handled roughly. which had reached the stationary phase by then.1M CaCl2 (DO NOT VORTEX). coli cells treated with CaCl2 have very weak cell walls.1 M CaCl2 solution containing 15% glycerol. Keep the cells on ice for 30 min.300g and 4°C. into a flask containing 100 mL of fresh LB medium without ampicillin.25-0. At their arrival in the lab this morning. This will result in your transformation failing due to insufficient competent cells. Keep your tubes on ice until you are ready to proceed with the transformation.0 mL 0.com/watch?v=j2a36DJpdbo) Part A: Preparation of Competent Bacteria Yesterday. 3.

Laboratory Class 3: Transformation 2011 Part B: Transformation of Competent DH5a Cells with Ligation Products You will transform DH5 cells made competent in Part A with aliquots of the ligation treatments performed last week. 8. Incubate on ice for 30 min. 12. 11. 9. 53 . Add 40 L of each plasmid DNA source into the appropriate tube (see table below). digested by XhoI/EcoRI (Ligation treatment II. no T4 DNA ligase (aliquot of 40 L from Step 7 of Lab Class 2) (2nd negative transformation treatment) 40 ng of undigested pTrcHisB (aliquot of 40 ng in 40 L put aside at Step 1 of Lab Class 2) (Positive transformation treatment) Volume of DH5 (L) 100 Volume of DNA (L) 40 I II 100 40 III 100 40 IV 100 0 V 100 40 VI 100 40 10. Transfer the tubes to a rack placed in a water bath preheated to 42°C and incubate for exactly 1 min. Gently transfer 100 L of you competent cells prepared at step 7 into six different pre-labelled microcentrifuge tubes (Your tubes should be labelled with your group and the treatment number. Negative control for the ligation) pTrcHisB digested by XhoI only (Ligation treatment III. Keep all your tubes on ice. see table below). Do not shake the tubes. Positive control for the ligation) No DNA (1st negative control for the transformation) pTrcHisB digested by Xho/EcoRI. Treatment Description of the transformation pTrcHisB XhoI/EcoRI + T7 amplicon XhoI/EcoRI (Ligation treatment I) pTrcHisB alone. Mix well by gently tapping the tubes. Transfer the tubes to ice and allow the cells to chill for 2 min. Do not vortex as the cells are fragile at this point.

Leave your agar plates at room temperature until the liquid is completely absorbed this should take about 20 min. The Support Staff members will put all agar plates at 37°C for 24 hrs. you should make sure that the minimum volume you will transfer on your agar plate is 10 L. Carefully add 0.5 mL of LB broth to each tube and transfer the tubes to a shaking incubator (225 cycles/min) set at 37°C for 45 min. 14. 54 . Pipet 100 L of each bacterial suspension onto the pre-identified LB-Ampicillin agar plate. While preparing your dilutions.for treatment VI. 15.Laboratory Class 3: Transformation 2011 13. and then spread the bacteria evenly over the entire plate surface. proceed to step 14 with treatment I to V and to step 15. At the end of this incubation. condensation droplets falling back onto the agar surface would result in cross contamination among the colonies. All plates will be put upside down to prevent condensation on the lid. and then transfer them at 4°C until colony counting is done next week. Your TA will inform you where to put your plates. Prepare 100X and 1000X dilutions of the treatment VI solution. 16.

How many strands of DNA are amplified from a one single double-stranded template after 20 cycles of (1) a conventional PCR amplification and (2) a sequencing PCR amplification? ( /2 Marks) 55 . ( /4 Marks) 3. and then paste this sequence into NebCutter. ( /3 Marks) a. Digestion of recombinant plasmids Predict the expected DNA bands for the XhoI/EcoRI digest of (1) pTrcHisB and (2) pTrcHisB/T7 (your recombinant plasmid vector with the T7 RNA polymerase insert) using NebCutter. ( /3 Marks) a) Define what is a plasmid copy number? ( /1 Mark) b) Is the pBR322-derived pTrcHisB considered a low or high copy number plasmid? Why? ( /1 Mark) c) What is a reasonable range for the copy number value to expect for the pTrcHisB/T7 plasmid you will purify in this lab? ( /1 Mark) 2. Explain your reasoning and insert a copy of the pTrcHisB/T7 sequence you used as well as a copy of your NebCutter results. You should first generate the exact sequence of your recombinant plasmid vector. Plasmid copy number The concept of copy number is an important factor to consider when preparing a minipreparation of plasmid DNA. Don’t forget to take into consideration the ligation details. though conventional PCR amplification with two delineating primers gives exponential amplification. What does linear amplification mean? ( /1 Mark) b.Laboratory Class 3: Transformation 2011 ASSIGNMENT ASSIGNMENT TO BE HANDED IN INDIVIDUALLY TO YOUR TA WHEN ENTERING NEXT WEEK LAB ( /10 Marks) 1. DNA sequencing The PCR amplification that occurs during a sequencing reaction results in linear amplification.

8090) Groups 2. Scientific writing style (pp. coli. (See reference 4 to 6) a) Explain to your colleagues the principle of chemical transformation and electroporation of E. coli. 12 and 20: Bacterial transformation: Role of membrane potential (J Biotechnol 2006. a) Explain how membrane potential varies throughout the transformation protocol. coli cell surface (Biomacromolecules 2008. Groups 3. 9:2501) a) Several molecular techniques and details are covered in this article. but you don’t need to cover all of them.Laboratory Class 3: Transformation 2011 READING MATERIALS FOR IN LAB TEACHING TOPICS Groups 1. b) Discuss the advantages and disadvantages of both transformation methods. Groups 4. 127:14). 56 . 9 and 17: Writing A Guide to Writing in the Sciences. 10 and 18: Bacterial transformation: Plasmid DNA binding onto E. Make sure to talk about the transformation efficiency. Simply emphasize the underlying molecular principle for DNA binding onto the cell surface. 11 and 19: Chemical transformation versus electroporation of E.

Genetic competence in Escherichia coli requires poly-beta hydroxybutyrate/calcium polyphosphate membrane complexes and certain divalent cations. 2.cl/index.od.mfa. Basu T. Plasmid DNA binds to the core oligosaccharide domain of LPS molecules of E. Jana B.pdf 57 .ua/page61. Reusch RN. 2008 Sep. http://www. coli cell surface in the CaCl2-mediated transformation process. J Bacteriol.ua/page55.9(9):2501-9. Biomacromolecules.com/content/sfs/manuals/subcloningefficiencydh5alpha_man.htm 5.mfa. Panja S.htm 4. http://www. Aich P. 1995 Jan. http://www.Laboratory Class 3: Transformation 2011 REFERENCES 1. 3.invitrogen.php/ejbiotechnology/article/view/v13n5-11/1234 Web references for the materials used in the lab DH5 http://tools.od.177(2):pp 486-90. Huang R.ejbiotechnology.

.

the one for which the expected insert will be confirmed. LEARNING OBJECTIVES Underlying molecular principles   Identify and explain the main procedural steps for the (mini)preparation of plasmid DNA by alkaline lysis. will be put aside and used for the second part of the course that will relate with the expression.Laboratory Class 4: Screening and sequencing 2011 SCREENING FOR RECOMBINANT PLASMID AND DNA SEQUENCING OVERVIEW This week. You should obtain at least one positive transformant colony out of your five inoculates. You will then sequence the T7 insert from your positive clone to identify the point mutation that had been introduced in the coding sequence of the mutant you received at the beginning of the semester. The positive transformant cell line you will identify this week. Identify and explain the main procedural steps for DNA sequencing Hands-On Skills      Inoculate a liquid culture with a transformant colony Isolate plasmid DNA (miniprep) Digest recombinant plasmid DNA to screen for a given DNA insert Sequence DNA Cryopreserve a cell culture in glycerol-supplemented liquid medium Analytical Skills        Analyze and discuss transformation results Discuss the efficacy of ligation based on the number of colonies obtained for the different treatments Estimate the transformation yield in # colonies/g plasmid DNA Select appropriate restriction enzymes to screen for the presence of a DNA insert in recombinant plasmids Use Nebcutter to simulate restriction digests and predict the size of the expected DNA fragments Use nucleotide BLAST to analyze DNA sequencing results Assemble the individual sequencing results to reconstruct the whole sequence of your DNA insert coding for T7 RNA polymerase 59 . You will first inoculate and screen five transformant colonies to confirm the presence of the T7 insert into the pTrcHisB/T7 plasmid. we will finalize the sub-cloning procedure of the T7 insertion in pTrcHisB. purification and functional assessment of your T7 RNA polymerase mutant. i..e.

The miniprep protocol permits the rapid isolation of small amounts of plasmid DNA (1-10 g). Under these renaturing conditions. Effective lysis of bacterial cells is a key step in plasmid isolation and it directly affects DNA yield and quality. Typical yield for the alkaline lysis protocol is about 1-2 g of plasmid DNA per mL of liquid culture. a cross-appointed member of the uOttawa Biochemistry. Birnboim.). the solution is neutralized by the addition of Potassium Acetate. The research article in which the miniprep procedure was first described still constitutes one of the most commonly referred article nowadays in science (1). 60 . The solution is then neutralized with potassium acetate. The alkaline conditions (pH 12-12. chromosomal DNA and proteins precipitate because it is impossible for them to renature correctly (due to their large size).5) denature both the chromosomal DNA and the plasmid DNA and SDS denatures proteins. Figure modified from Qiagen. The plasmid isolation procedures make use of the covalently closed circular nature of bacterial plasmids and their small size in relation to the bacterial chromosome. During neutralization. rapidly reanneals. Figure 1. Once the cells are lysed under conditions which denature both nucleic acids and proteins. This procedure takes advantage of the fact that plasmids are relatively small closed circular DNA molecules and bacterial chromosomal DNA is much larger. Alkaline lysis protocol for plasmid purification. Minipreparation of plasmid DNA You will isolate plasmid DNA using a small scale or minipreparation protocol that was first designed by Dr. Plasmids renature correctly and stay in solution. Microbiology and Immunology department. The chromosomal DNA cannot renature as quickly and is therefore trapped along with proteins in an insoluble complex. bacterial cells are lysed in a solution containing NaOH and sodium dodecyl sulphate (SDS) (Figure 1. This difference in size allows for selective precipitation of the chromosomal DNA and cellular proteins from plasmids.Laboratory Class 4: Screening and sequencing 2011 BACKGROUND A. whose two strands remained intertwined during the alkaline lysis. effectively separating them from chromosomal DNA and proteins. In the alkaline lysis method that you will be using. the plasmid DNA. The precipitate is removed by centrifugation and the plasmid is precipitated from the supernatant through the addition of ethanol.

Laboratory Class 4: Screening and sequencing 2011
B. DNA Sequencing Different methods can be used for sequencing DNA. In this lab, you will be using the enzymatic base-specific chain termination procedure, which is essentially a ‘special’ PCR amplification. The PCR and the sequencing reactions will be performed at the McGill University’s Sequencing Center and the sequencing results will be posted, usually within one week, through the Nanuq server. As mentioned before, our samples will be sequenced using a Chain terminator method also known as the Sanger method (named after its developer Frederick Sanger) (2-3). This method was further improved by the use of fluorescent terminators. Here is a more detailed description of the different steps involve in the sequencing of your samples: Step 1: PCR amplification In the enzymatic sequencing procedure, the DNA to be sequenced is denatured and annealed with a single primer that delineates the origin of sequencing. One peculiar feature of PCR-based sequencing is the use of a mixture of regular deoxynucleotides (dNTPs) and altered dideoxynucleotides (ddNTPs) whose hydroxyl group on 3’C of the deoxyribose sugar has been substituted with H (Figure 2). These ddNTPs, which are found in much lower proportions than the dNTPs, can bind to DNA polymerases and be transferred at the 3’ end of the elongating strand, but they prevent the addition of any further nucleotides upon their incorporation. All PCR amplicons are therefore characterized by a single terminator ddNMP at their 3’ ends, and the identity of the chain-terminating nucleotide can be determined by tagging each ddNTP with a distinctive dye. Applied Biosystems introduced BigDyesTM, which consist of a fluorescein energy donor dye directly linked to an energy acceptor dichlororhodamine dye. Together the dyes make up an energy-transfer system that provides significantly greater sensitivity compared to single dyes. BigDyes also exhibit improved color resolution, a property that allows better base-calling. The additional sensitivity conferred by energy transfer dyes means that less template is needed for a sequencing reaction, a feature that is valuable for sequencing very large templates and even for direct sequencing of genomic DNA. Figure 2 Structure of a deoxynucleotides (dNTPs shown in A) and dideoxynucleotides (ddNTPs shown in B).

61

Laboratory Class 4: Screening and sequencing 2011

62

Laboratory Class 4: Screening and sequencing 2011
Figure 2. DNA sequencing. The double strand DNA template is first denatured by heat and then, the temperature is lowered so that the oligonucleotide primer can hybridize to its complementary sequence (step 1). The free 3’ hydroxylated group is recognized by DNA polymerase and elongation occurs until the addition of a dideoxynucleotide (ddNTPs) stops the reaction (step 2). A limited amount of ddNTPs is used in order to have fragments of various sizes, each one having a ddNTP at its 3’ end (see fragments on the left of the capillary). DNA fragments are then separated according to their sizes using by capillary electrophoresis (step 3). At the end of the capillary, a laser beam excites the dyes linked to the ddNTP (step 4). The resulting fluorescence is recorded by a photomultiplier (step 5) and a computer converts this signal into a graphic representation of the sequence called, a chromatogram (step 6). A colour version of this figure is available in the manual section of your virtual campus. Step 2: Analysis of PCR amplicons by capillary electrophoresis A mixture of DNA fragments with different lengths is obtained upon PCR amplification, but another step is required to resolve the fragments and identify their terminal ddNs. Capillary electrophoresis (CE) chromatography is commonly used for resolving the mixture of amplicons generated by PCR-based sequencing. In CE, DNA separation is achieved in a fused-silica capillary with a 25-100 m diameter. The high ratio of surface area to volume of the small capillary tube serves to efficiently dissipate heat produced during electrophoresis, allowing the use of higher electric fields that can decrease the run time and improve DNA resolution. Step 3: Automated base-calling The time profile of the fluorescence signal (color and intensity) is recorded at the output of the capillary tube throughout the analysis run of the PCR sequencing product. The fluorescence signal is then analyzed with a computer to determine the DNA sequence (this procedure is usually referred as base-calling analysis: a nucleotide is assigned to each fluorescence peak based on its fluorescence spectrum).

This animation: http://www.wellcome.ac.uk/Education-resources/Teaching-and-education /Animations/DNA/WTDV026689.htm provides a good resume of the Sanger sequencing method.

63

except for Monday sections that are to return to the lab on the preceding Thursday morning. You should therefore arrive in the lab by 10:30am at the latest to make certain you can exit the lab by 11:00am. 64 . Count your transformant colonies. 1.Laboratory Class 4: Screening and sequencing 2011 PROCEDURES Part A: Inoculation of transformant Colonies into Liquid Culture Medium One member of your team will be required to come to the lab between 8-11:00am on the day preceding your regular laboratory class. digested by XhoI/EcoRI (Ligation treatment II. You should plan about 30 min to complete the work. no T4 DNA ligase (2nd negative transformation treatment) 40 ng of undigested pTrcHisB 100X dilution (Positive transformation treatment) 40 ng of undigested pTrcHisB 1000X dilution (Positive transformation treatment) Volume of (L) I 100 Volume of DNA (L) 40 Number of colonies II 100 40 III 100 40 IV 100 0 V 100 40 VIa 100 40 VIb 100 40 2. Pick colonies that are well delineated to avoid cross contamination among neighboring colonies. You will inoculate five bacterial colonies from your transformation treatment I into five culture tubes. Negative control for the ligation) pTrcHisB digested by XhoI only (Ligation treatment III. Positive control for the ligation) No DNA (1st negative control for the transformation) pTrcHisB digested by XhoI/EcoRI. Treatment Description of the transformation pTrcHisB XhoI/EcoRI + T7 amplicon XhoI/EcoRI (Ligation treatment I) pTrcHisB alone. Inoculated cells will grow and divide rapidly (up to ~109 cells/mL of liquid broth) and each cell will contain several copies of the recombinant plasmid vector. You need five polystyrene snap cap tubes (17mm X 100mm) each containing 5 mL of LB broth with 100 g/mL ampicillin.

labelled 1. 65 . Discard the supernatant. Immediately add 150 L of K-acetate buffer (3M potassium. transfer the contents of each polystyrene culture tube into a pre-labeled 1. which one(s) contain(s) the expected pTrcHisB/T7 recombinant plasmid.8) into each of you tubes. Recover and vortex the five culture tubes. 5. Once you have identified at least one positive clone. Breakdown of genomic DNA into small fragments is not desirable as the smaller fragments might be extracted along with plasmid DNA. Add 200 L of Lysis Buffer (1% SDS. pH4. Transfer 0. and then simply drop the tip into a culture tube containing 5 mL of LB broth with ampicillin (100 g/mL). 0. Add 100 L of Resuspension Buffer (50mM Glucose. and then vortex at high speed to resuspend the pellets.0. Once the pellets have been completely resuspended. 11. Observe how the properties of the samples have changed.000g for 5 min using the centrifuge with a swinging bucket rotor. Mix thoroughly by inverting your tubes 3 times. 5M acetate. to resuspend the cells.Laboratory Class 4: Screening and sequencing 2011 3. Repeat the inoculation procedure for your four other colonies.5 mL microcentrifuge tube. 8. Examine your agar plate for transformation treatment 1 and identify five well delineated colonies. you will retrieve the appropriate tube and proceed to its cryopreservation as described at step 25. 10. Part B: Minipreparation of plasmid DNA (miniprep) 6. 25mM Tris-HCl pH8. Quickly vortex your culture tubes and put them back on a rack. Centrifuge your five polystyrene culture tubes at 3. Use a marker to identify the five colonies to be inoculated. 9. Those five microfuge tubes are to be kept on ice until you can identify. Use a sterile plastic tip to slightly touch the external surface of a colony. 7. by restriction digest (Part C). The Support Staff will transfer all tubes in a shaking incubator (200 rpm) at 37°C. 10mM EDTA.5 mL microcentrifuge tube.5 mL tubes and mix the content by inverting the tubes five times. shake or incubate your minipreparations for more than 5 min to minimize shearing of genomic DNA. which you inoculated yesterday. RNase A 20g/mL) into each of your tubes. Do not vortex.5 mL of each of your five culture tubes into a distinct.2N NaOH) into each of your 1. 4.

66 . 14.5 mL microcentrifuge tubes. it can be removed with a pipet tip. the pellets tend to weakly adhere to the bottom of the tubes: be careful not to lose your plasmid DNA pellets! 17. Resuspend each pellet in 50 L of water. After the 75% ethanol wash.Laboratory Class 4: Screening and sequencing 2011 12. Use a 1 mL pipettor to transfer about 75-80% of the supernatants into clean 1. Add 1 mL of 70% ethanol in each tube and rinse the pellets by vortexing for 5-10 sec (pellets do NOT have to be completely resuspended). Centrifuge at maximum speed for 5 min. Avoid transferring any of the white precipitate. Discard the supernatants. Add 900 L ethanol 95-99% that has been pre-cooled to -20°C. you can divide the total volume of Master mix by the number of reactions and you should get the total volume of one reaction (102L/6 reactions=17L) 19. Mix well by shaking. Prepare a Master mix to digest your five minipreps knowing that you will digest 3 L of each minipreps in a final volume of 20 L (do not forget to add 1 more reaction to the master mix to create a buffer zone so you don’t run short of your master mix) Components Volume per reaction (L) 13 2 1 1 171 Volume of the master mix (6 reactions) (L) 78 12 6 6 1022 H2O 10X Buffer H EcoRI (10 Units/L) XhoI (10 Units/L Total volume 1 2 Three microliters of plasmid DNA will be added for a final digestion volume of 20 L. 15. Centrifuge again at maximum speed for 5 min then invert the tubes over absorbent paper for ten minutes to drain out the remaining ethanol. To verify that your calculation were done properly. Transfer 17 L of master mix into 5 labelled 1.5 mL microcentrifuge tubes. Part C: Analysis of the Minipreparations by Restriction Digest and Cryopreservation of One Positive Clone 18. 13. 16. Centrifuge your tubes at maximum speed for 5 min to pellet cell debris and chromosomal DNA. If some of the precipitate gets transferred.

This positive miniprep is to be used as a template for DNA sequencing (Part D).5 L of each miniprep with 12 L of H2O and 1.5 L of each digest with 1. your 67 . Load 15 L of each digested or undigested miniprep sample along with 5 L of the DNA ladder. Once the five sequencing results will be returned to you.5 L of an undigested miniprep represents approximately the same DNA amount as 13. 24. 22. Cell cultures can be cryopreserved for long periods of time if frozen at -70°C in presence of 25% glycerol. Digested samples (5X): Mix 13. You will require this cell line next week for the protein expression procedure. Take a picture of your results. Lanes 12-20: 5 digested and only 4 undigested samples from 2nd group. 21. Part D: DNA Sequencing Each sequencing reaction can accurately sequence about 600 to 800 bp.5 L of 10X loading buffer (1. invert a few times to homogenize the content. Add 3 L of each miniprep to the corresponding tube. Add the appropriate volume of glycerol to your positive cell culture (0. you will use five sequencing reactions to ensure the full coverage of your T7 RNA polymerase insert containing about 2. Refer to your gel picture to identify one positive colony whose band profile corresponds to the expected bands for pTrcHisB/T7. Lane 11: 5 L of the Alpha Quant DNA ladder c. Each TA will choose one volunteer to cast an extra 1% agarose gel to be used in step 24.5 L of its digested preparation: band intensities should be similar). and then carry out electrophoresis at 100V for about 40 minutes. One of the two groups sharing a gel will only be able to load 4 undigested controls (see Step 22). 25. and then hand in your tube to your TA who will store it at -70°C. You should also retrieve the transformant cell line corresponding to your positive miniprep among the five cell lines that were put on ice at step 7.5 L of 10X loading buffer b.Laboratory Class 4: Screening and sequencing 2011 20. Cast a 1% agarose gel with a 20-well comb. Lanes 1-10: 5 digested and 5 undigested samples from 1st group b. Prepare your samples to be loaded on the agarose gel as follows: a.5 mL) to reach a final concentration of 25% glycerol. In this experiment. Two groups can share one gel as follows: a. 23.655bp. Undigested controls (4-5X see note below): Mix 1. Mix each tube well and incubate for at least one hour at 37°C.

The procedure for DNA sequencing is relatively straightforward. The sample names you enter will be the ones used when the sequencing results are posted. 28. Electrophorese at 100V for about 40 min. DNA sequencing will be performed at the McGill and Genome Quebec Innovation Centre in Montreal. an aliquot will be electrophoresed along with a quantitative DNA ladder (AlphaQuant1). 27. This modification will help ensure that the final concentration of the purified plasmid DNA is enough to meet the minimum concentration requirement for DNA sequencing. you will have to borrow the sequencing results of another group having worked with the same mutant number. and then load the whole volume on a 1% agarose gel. The five sequencing primers you will use for priming DNA sequencing are:      Seq F1: 5’CACTCGACCGGAATTATCG3’ Seq F2: 5’GGGCACGTCTACAAGAAAGC3’ Seq F3: 5’TACAAAGCGATTAACATTGCGC3’ Seq F4: 5’GCTGAGCAAGATTCTCCGT3’ Seq F5: 5’GCTGCTGGCTGCTGAGGTC3’ 26. You should use 35 L of water for the final elution volume instead of 50 L (see step 8 in Appendix E3). Monday_202_Gr8_M2_SeqF1). Take a picture of your gel and accurately estimate the concentration of your purified recombinant plasmid DNA. Retrieve the miniprep corresponding to your positive transformant and purify it using the Wizard PCR clean-up system as explained in Appendix E3 with one important modification. Combine 2 L of your purified plasmid to be sequenced with 7 L of water and 1 L of the 10X loading buffer in a microcentrifuge tube. 68 . The assembly process of different sequencing results is commonly referred to as gene assembly. Mix. The minimal concentration required for proceeding to DNA sequencing is 100 ng/L.Laboratory Class 4: Screening and sequencing 2011 challenge will be to examine the overlaps among the five sequencing results to deduce the complete sequence of your insert.g. Samples are to be labeled as Day_lab#_Group#_Mutant#_Primer (e. but that approach would require too much of your purified 35 L sample. but very sensitive. You will be asked to enter your sample names in an electronic file to be directly sent to the sequencing centre along with your samples. The amount of DNA template is critical: either a too low or a too high concentration of DNA can significantly reduce the number of nucleotides that can be read or sequenced. If your concentration is below that minimum threshold. To ensure a good estimate of the DNA concentration of your purified miniprep product to be sequenced. Your miniprep DNA could also be quantified by reading the absorbance at 260nm.

69 . Load 5 L of your purified DNA plasmid into each of the first five wells of your lane. and 10 L of the appropriate primer in each of the next five wells.Laboratory Class 4: Screening and sequencing 2011 29. Ask your TA or the Technical Staff if you unsure about the loading order. Samples are to be loaded on a 96 well plate with 1 row for each group. It is very important that you follow these guidelines when loading the 96 well plates.

( /5 Marks) 70 . choose the BLAST option. Analysis of your polymerase sequence. select the nucleotide blast option. The top and bottom figures respectively illustrate the alignment options and a graphical summary of a set of returned alignment results. in the Popular Resources window.Laboratory Class 4: Screening and sequencing 2011 ASSIGNMENT ASSIGNMENT TO BE HANDED IN INDIVIDUALLY TO YOUR TA WHEN ENTERING NEXT WEEK LAB ( /10 MARKS) 1. Access the Nanuq server and retrieve your sequences (F1 to F5). Go to the NCBI web site. the two DNA stretches do not overlap at all as they align at two distinct regions along T7 RNA polymerase. You are now ready to perform a multiple alignment between the coding sequence of the T7 RNA polymerase and your sequencing results. In this example. In this BLAST window.

( /2. Second set of extra controls A liquid culture of DH5 cells transformed with an empty pTrcHisB will be induced with IPTG.Laboratory Class 4: Screening and sequencing 2011 a. A 1 mL aliquot is will be withdrawn at time zero and after 2hr incubation. Did you successfully sequence the whole length of your DNA insert coding for T7 RNA polymerase? If not which part(s) were not sequenced? How would you proceed to sequence missing parts? ( /1 Mark) b. The overview figure provided in Part A of Laboratory class 5 shows the planning for the protein expression control aliquots. ( /2 Marks) c. By looking at the nucleotide-nucleotide alignment. can you identify the point mutation that had been inserted in your DNA insert coding for T7 RNA polymerase? Please indicate your mutant number to help your TA validate your result.5 Marks) b. First set of extra controls A liquid culture of DH5 cells transformed with a recombinant pTrcHisB/T7 will be induced with water instead of IPTG. A 1 mL aliquot will be withdrawn at time zero and after 2hr incubation.5 Marks) 71 . ( /2.( /2 Marks) 2. Provide a copy of your sequencing results as well as a printout of the sequence alignment figure (same as the one provided as example). Explain the information that will be obtained from each of the two extra sets of controls that will be done collectively: ( /5 Marks) a.

brcf. Applied Biosystems model 3730.edu/doc/dnaseq/interpret. 15 and 23: BLAST tutorials: http://www.uk/Education-resources/Teaching-andeducation/Animations/DNA/WTX056051. 13 and 21: Specificity of the DNA sequencer.digitalworldbiology.Laboratory Class 4: Screening and sequencing 2011 READING MATERIALS FOR IN LAB TEACHING TOPICS Groups 5.html Groups 8. This is the sequencer model to be used at McGill for sequencing your DNA.htm Groups 7. 16 and 24: Interpretation of sequencing chromatogram: http://seqcore. 14 and 22: Explain how Illumina sequencing works: https://www. Groups 6.ac.uppnex.med.html 72 .com/BLAST/index.uu.se/uppnex-book/technologies/solexa-sequencing http://www.umich.wellcome.

appliedbiosystems.ca/nanuq 73 . DNA sequencing with chain-terminating inhibitors. 1977 Dec. Doly J.7(3):pp.pdf Nanuq server: https://genomequebec.mcgill. Coulson AR.com/cms/groups/mcb_marketing/documents/generaldocume nts/cms_040741.Laboratory Class 4: Screening and sequencing 2011 REFERENCES 1. Sanger F. Web references for the materials used in the lab Big Dyes: http://www3. 267-8. 5463-7. 2001 Mar. Nicklen S. Nucleic Acids Res. 1513-23.7(6):pp. Sanger F. 1979 Nov 24.74(12):pp. A rapid alkaline extraction procedure for screening recombinant plasmid DNA. The early days of DNA sequences. 2. Birnboim HC. Proc Natl Acad Sci U S A. 3. Nat Med.

.

translation and some post-translational modifications. or chimeric. For your western analysis. Upon completion of the induction protocol. SDS-PAGE experiments will assess the presence as well as the length of your fusion protein whereas Western analysis will confirm that the purified protein contains the His-tag. your T7 RNA polymerase fusion protein will be analyzed by SDS-PAGE and Western analysis. The second part of the semester involves a series of experiments to be performed with your transformant DH5 clone containing the recombinant plasmid vector with containing your T7 RNA polymerase insert. Finally. the cells will be harvested and lysed to prepare a total protein extract. you will evaluate the enzymatic activity of your mutant fusion T7 RNA polymerase. 75 . There are several steps in the gene expression process. and all other peptides will be eluted and collected in the flowthrough fraction. Your fusion protein will be further purified using a His tag affinity chromatography column. Your fusion protein containing a His tag will be selectively retained within the column. pTrcHisB/T7.General Introduction for Lab V-VIII 2011 General Introduction for Laboratory V-VIII Gene expression is the process by which information from a gene is used to guide the synthesis of a functional protein product. you will be using an antibody that has been specifically raised against the His tag. You will first use your positive transformant cell line selected in laboratory class 4 to inoculate a liquid culture and induce the expression of the T7 RNA polymerase protein. Once eluted from the affinity column. including transcription. protein because the His tag has been merged to the N-terminal end of T7 RNA polymerase. Notice that your expressed protein constitutes a fusion. This will be achieved by comparing RNA transcription assays using your mutant T7 RNA polymerase in parallel with assays using a wild type T7 RNA polymerase.

.

you will be performing the first step in the expression of your fusion T7 RNA polymerase. Induction of the fusion protein’s expression will be achieved using genetic components of the lac operon which are present in the pTrcHisB/T7 construct in combination with an analog of allolactose (IPTG). LEARNING OBJECTIVES Underlying molecular principles  Explain the genetic components of the lac operon regulating the IPTG-inducible expression of T7 RNA polymerase in the TrcHisB/T7 and DH5 system Hands-On Skills      Inoculate and grow a transformant DH5 cell line Assess the cell growth phase by absorbance at 600nm Induce protein expression by adding IPTG Harvest cells from a liquid culture Prepare one buffer solution to be used in laboratory class 6 Analytical Skills  No results to be generated this week 77 . Notice that your expressed protein constitutes a fusion or chimeric protein because the His tag had been merged at the N-terminal end of T7 RNA polymerase. Upon completion of the induction protocol.Laboratory Class 5: Protein Expression 2011 PROTEIN EXPRESSION OVERVIEW This week. Your fusion protein will be further purified next week by His tag affinity chromatography. the cells will be harvested and lysed to prepare a crude bacterial protein extract.

6th Edition. This metabolite acts as an inducer by binding to the repressor lacI and consequently. y and a). causing a change in conformation. the βgalactoside permease (y) and the β-galactoside transacetylase (a). (B) In absence of lactose. reducing the affinity of this repressor for the operator element. repressor (i). the lac promoter is derepressed and transcription is allowed. lac operon. (A) Structure of the lac operon: promoter of lacI (p in white box) and of the operon (p in gray box). The repressor is now unable to bind to the operator. the lacI repressor binds to the lac operator (lac O) located downstream of the operon promoter and consequently. it is metabolized into allolactose (inducer). To get a better understanding of today’s experiment. operator (o) and the genes (z. the lacI repressor (i).Laboratory Class 5: Protein Expression 2011 BACKGROUND Expression of the T7 RNA polymerase from the recombinant T7/pTrcHisB construct is tightly regulated by a repressor system. Its transcription is tightly regulated by the constitutively expressed lacI repressor (Figure 1). In the absence of lactose. how the pTrcHisB plasmid takes advantage of the lac operon’s genetic components to regulate the expression of the T7 RNA polymerase insert subcloned in the pTrcHisB plasmid vector (Section B. Figure 1. A. In the presence of lactose. The metabolism of lactose by the -galactosidase produces a metabolite called allolactose. represses transcription of the operon. (C) When lactose is present in the cell. 78 . This figure was taken from Biochemistry. lac operon) and also. This operon is formed by a cluster of three consecutive genes: the β-galactosidase (z). which is constitutively expressed. (see Figure 2A). we need to have knowledge of how the different genetic components of the lac operon interact with each other (Section A. pTrcHisB expression regulation). In E. the lac operon is necessary for the transport and metabolism of sugar (1). this repression is lifted. binds to the lac operator (o) and thus prevents the transcription of the z. y and a genes by the lac promoter (p).coli. lac operon. This metabolite can bind to the repressor. The derepression of the lac operon leads to the transcription of the three lac genes.

Laboratory Class 5: Protein Expression 2011 B. Key genetic components of the operon were inserted in the pTrcHisB vector. (B) Molecular structure of the Isopropyl--thio-galactoside (IPTG). This release of the repression will allow transcription of the fusion T7 RNA polymerase to occur. (A) Conversion of lactose into allolactose by the -galactosidase. the lacI repressor will no longer be able to bind to the operator (Figure 2B). IPTG cannot be hydrolyzed and therefore. In laboratories. Once IPTG is added to the culture. This binding will lower the affinity of the repressor for the operator and therefore. A) OH HO H OH H H OH H H H OH O O H H OH H OH H H OH HO H OH Lactose OH O H OH Allolactose -galactosidase HO H OH H O O H H H OH H OH O H B) Isopropyl--D-thio-galactoside (IPTG) OH HO H OH H H OH H H O S CH3 CH3 Figure 2. 79 . IPTG is used mainly because. The lacI repressor (coded by the vector itself) binds to the lac operator present in the trp-lac hybrid promoter (Ptrc) and represses the expression of the T7 RNA polymerase located after this promoter (Figure 3A). in contrast to allolactose. it binds to the lacI repressor. its concentration remains constant. Engineering of the pTrcHisB vector for protein expression The pTrcHisB plasmid vector takes advantage of the lac operon transcription system. The induction of the fusion protein’s expression is achieved by using an analog of allolactose: the Isopropyl-β-D-thio-galactoside (IPTG) (Figure 2A).

(B) In presence of an inducer (IPTG). the lacI repressor binds to the inducer and therefore.Laboratory Class 5: Protein Expression 2011 Figure 3. The lacI gene is present on the pTrcHisB plasmid vector. This gene is constitutively expressed and translated (step 1 and 2). This binding leads to the repression of the transcription (step 4). Transcription via the Ptrc promoter can now proceed (step 4). (A) In absence of inducer. the lacI repressor binds to the lac operator which is located just after the Ptrc promoter (step 3). is removed from the lac operator (step 3). 80 . Induction mechanism of the pTrcHisB plasmid vector.

9 and 17  These groups will be in charge of preparing the 1st set of extra controls (see schematic on next page) Groups 2.9) Groups 7. 1 mM DTT. 16 and 24  Prepare 100 mL of 1X T7 Storage Buffer (30 mM HEPES. pH 7. 12 and 20  Prepare 20mL of 8X Wash Buffer (4 M NaCl. you should watch the following videos on solution’s preparation and on how to use a pH meter:  Solution preparation (5:32) or (http://www. 15 and 23  Prepare 10 mL of 8X Charge Buffer (400 mM NiSO4) Groups 8. 0.Laboratory Class 5: Protein Expression 2011 PROCEDURES The present laboratory class involves extensive downtimes during which you will be required to prepare the buffer solutions to be used next week for the His tag affinity chromatography (see pre-assigned solutions below). pH 7. 80 mM Tris-HCl. Be careful and ask your TA or someone else to verify your calculations.9) Groups 5. 11 and 19  Prepare 60 mL of 8X Binding Buffer (4 M NaCl. 160 mM Tris-HCl. 13 and 21  Prepare 20mL of 4X Elute Buffer (1M imidazole.com/watch?v=EHT0ChvArF8)  How to use a pH meter (10:02) or (http://www. This means that the results of all your colleagues might be affected if you make a ‘boo-boo’ when preparing your solution.05% Tween 20. 0.5) 81 . pH 7.youtube.9) Groups 4. 350 mM Tris-HCl. 80 mM imidazole. 320 mM imidazole. Before the lab.com/watch?v=dN4yOJaarpE) Groups 1. 14 and 22  Prepare 10 mL of 4X Strip Buffer (2 M NaCl. 10 and 18  These groups will be in charge of preparing the 2nd set of extra controls (see schematic on next page) Groups 3. The solutions will be put aside and returned to you by next week. 2 M NaCl. pH7.25 mM EDTA. pH 7.youtube. 400 mM EDTA.15M K-Acetate. 80 mM Tris-HCl. The solutions will be shared by all students working under the supervision of the same TA. 0.9) Groups 6.

Monday groups are to return to the lab on the preceding Thursday morning. The schematic below is a summary of this week’s experiment (presented in A). Groups 7. You should plan about 20 min to complete the inoculation procedure. 82 .Laboratory Class 5: Protein Expression 2011 Part A: Induction of the expression of the T7 RNA polymerase Step 1 is to be completed between 8-10:30am on the day preceding your regular lab class.16 and 24 will have the responsibility of preparing the 2nd set of extra controls (C). 15 and 23 will be asked to do the 1st set of extra controls (B) whereas groups 8.

Put your tube with your cryopreserved transformant cell line on ice until it is completely thawed. If the absorbance is below 0. The groups that are responsible for the collective controls should also take a sample at this step. return your flask in the incubator for another 30 min before verifying the absorbance again. This can be done by swirling the flask gently to homogenize the contents of the flask.5 mL of the cell suspension into a flask containing 50 mL of liquid LB+AMP. . This IPTG-induced aliquot (after induction control) is to be used to prepare of a total protein extract 83 5. You can now prepare the solution that was assigned to your group and that will be used for the His tag affinity chromatography next week.Laboratory Class 5: Protein Expression 2011 1.25. 6. Figure out the volume of a 100 mM IPTG stock that should add to your culture to obtain a final concentration of 1 mM.5 mL microfuge tube. tilting the flask to fill the sidearm with some liquid broth. Transfer 1 mL of the culture into a 1. Transfer 1mL of the culture into a 1. Then transfer 10 L of your cell culture into a snap-cap tube containing 3 mL of liquid LB medium with 100 g/mL ampicillin. Put your inoculated tube in the shaking incubator at 37°C. Return your inoculated flask to the shaking incubator at 37°C for 2 hours. This initial aliquot is to be compared with a second aliquot to be sampled at the end of the induction with IPTG (after induction.5 mL microfuge tube. Add the IPTG to the flask and put it back in the shaking incubator at 37°C for 2 hours. and then inserting the sidearm into the aperture of the spectrophotometer to read the absorbance at 600nm. 2. see steps 6 and 8). Culture flask with a sidearm A reference aliquot (before induction) is to be put aside before proceeding to induction with IPTG. 3. check the A600 of your cell culture. This non induced aliquot (before induction control) is to be used to prepare a total protein extract at Step 8. 4. Recover your inoculated snap cap tube from the incubator and transfer 0. After 2 hr of growth.

Those controls are to be assessed by SDS-PAGE next week. which is a strong hypotonic environment triggering cell bursting and release of cytosolic proteins. Discard the supernatants and resuspend each cell pellet in 25 L of distilled water. The other two 1 mL aliquots put aside at steps 4 and 6 are to be kept for SDS-PAGE analysis to be done in lab 6. lab 6.Laboratory Class 5: Protein Expression 2011 at Step 8. The groups that are responsible for the collective controls should also take a sample at this step. Transfer the contents of your flask into a 50 mL Nalgene centrifuge tube and centrifuge at 6.000 rpm. only your IPTG-induced cell pellet will be used for the purification of your His-tagged T7 RNA polymerase by His tag affinity chromatography. you will recuperate those aliquots for SDS-PAGE analysis to be done in lab 6. 8. Next week. and centrifuge them for 1 min at 13. The extra two series of controls prepared by pre-designated groups should be similarly mixed with the 2X loading buffer and returned to the TA. 7. Discard the supernatant and freeze your pellet of cells at -20°C until next week. Recuperate the two 1 mL aliquots put aside at Steps 4 and 6.000g for 5 min. 84 . These two aliquots are to be stored. Add 25 L of 2X Loading Buffer to each of your two tubes.

3%. For this question. you should assume that the average length of E. ( /3 Marks) b. Which coefficient of extinction should you use for each aliquot? ( /2 Marks) 85 . ( /2 Marks) 3. respectively (Anal Biochem.coli proteins The relative abundance of Tyr and Trp in proteins is 3.7 at 280nm. Coefficient of extinction of a mixture of E. coli proteins is around 360 amino acids. Explain the information to be obtained from each these aliquots. you will purify your recombinant T7 RNA polymerase. respectively (Expasy). ( /3 Marks) 2.2% and 1. Each tyrosine and tryptophan residue has a cumulative contribution to the global extinction coefficient of a protein of 1480M-1cm-1 and 5540M-1cm-1. you be asked to keep 5 aliquots (see Procedures section of laboratory session 6 and also Table 1 in Procedures section of laboratory session 7). Adjust the wild type T7 RNA polymerase sequence to take into consideration the few extra amino acids that were added at the N terminus of your recombinant T7 RNA polymerase. Purification controls In laboratory session 6. Refer to those values to estimate the extinction coefficient for a complex mixture of proteins. Use the extinction coefficient you obtained to estimate the protein concentration of a stock solution for which a 20X dilution gives an absorbance of 0. Coefficient of extinction of the T7 RNA polymerase First retrieve the amino acid sequence for the T7 bacteriophage T7 RNA polymerase from NCBI.Laboratory Class 5: Protein Expression 2011 ASSIGNMENT ASSIGNMENT TO BE HANDED IN INDIVIDUALLY TO YOUR TA WHEN ENTERING NEXT WEEK LAB ( /10 MARKS) 1. During the purification procedure. 1992). ( /5 Marks) a. Provide a hard copy of the print out generated from Prot Param Tool. Then access ProtParam Tool and paste the amino acid sequence of your recombinant T7 RNA polymerase to estimate its extinction coefficient.

html 86 . 9 and 17: Choice of host and vector for protein amplification.html Groups 4.com/techlib/basics/translation/index.de/pepcore/pepcore_services/protein_expression/ecoli/index.edu/people/faculty/lai/lab/protocols/GST%20Gene%20Fusion%20Syste m.ambion. describe this other system of recombinant protein production. 10 and 18: GST gene fusion system. 12 and 20: How to optimize your recombinant protein yield: Summarize these four sections from the web site below: 1) Optimization of expression levels 2) Improving protein solubility 3) improving protein stability and 4) Decreasing protein toxicity. 11 and 19: Production of recombinant protein in vitro: http://www.15.psu. page 2 to 6 from: https://homes.90.pdf Groups 3.pdf Groups 2.embl.Laboratory Class 5: Protein Expression 2011 READING MATERIALS FOR IN LAB TEACHING TOPICS Groups 1. page 8 and 9 from: http://130. http://www.bio.245/methods/handbooks%20and%20manuals/the%20recombinant%20protei n%20handbook.

Beckwith JR.156(3775):597-604.Laboratory Class 5: Protein Expression 2011 REFERENCES 1. Science. 1967 May 5. Recent studies on the regulation of lactose metabolism in Escherichia coli support the operon model. Web references for the materials used in the lab 87 . Regulation of the lac operon.

Laboratory Class 6: Protein purification 2011
PROTEIN PURIFICATION BY AFFINITY CHROMATOGRAPHY

OVERVIEW At the end of last week lab, bacterial cells were harvested by centrifugation. This week, you will proceed to the purification of the T7 RNA polymerase by Immobilized Metal ion Affinity Chromatography or IMAC. You will have to quantify your purified recombinant protein by UV absorbance. Finally, you will perform a SDS-PAGE analysis of the IPTG induction controls (harvested during Lab session #5). LEARNING OBJECTIVES Underlying molecular principles  Explain the underlying principle for immobilized metal ion affinity chromatography (IMAC) used to purify recombinant proteins with a His tag

Hands-On Skills     Lyse cells and prepare a crude protein extract Use IMAC to purify your recombinant his-tagged T7 RNA polymerase Quantitate proteins by UV absorbance Perform SDS-PAGE

Analytical Skills    Plan the procedure for the purification of your his-tagged T7 RNA polymerase by affinity chromatography; establish a list of important samples to be kept for further quantitation and SDS-PAGE analysis Discuss the efficacy of the His tag affinity chromatography based on your own set of experimental results Discuss the information that can be derived from the analysis of different controls for the IPTG-inducible protein expression

89

Laboratory Class 6: Protein purification 2011
BACKGROUND A- Immobilized Metal ion Affinity Chromatography (IMAC) IMAC was first described by Porath et al. in 1975 (1). It was developed to fractionate protein extracts based on their affinity for metal ions. Years later, this technique was adapted by Hochuli et al. to purify recombinant proteins that were engineered with a group of adjacent histidines attached at the C or N-terminus (2). a) Principle of the IMAC The molecular principle of the IMAC purification is based on the formation of a coordination bond between an immobilized metal ion (usually Ni2+ or Co2+) and an electron donor present on the recombinant protein to be purified. During this laboratory session, we will be using an IMAC column called His-Bind ® (Novagen). These columns are composed of agarose beads that are covalently linked to a metal chelater known as iminodiacetic acid (IDA). The IDA molecules chelate nickel ions (Ni2+) that can form co-ordination bonds with others substances (Figure 1A.). Looking at Figure 1A, you can observe that 3 sites of the coordination bond are available for interaction with metal ions (Site 1 to 3 that are occupied by water molecules). b) Purification of His-tagged proteins by IMAC. As mentioned before, purification of His-tagged proteins by IMAC was first described by Hochuli et al. (2). Histidine residues were chosen mainly because they have a strong affinity for metal ions (3-4). They are present in most proteins, but due to the fact that they are mildly hydrophilic, they are not always found on the protein surface. We can therefore use IMAC to specifically purify recombinant proteins by using plasmid vectors that have been genetically engineered to add histidine-tag (six consecutive histidines) to the C or N-terminals of recombinant proteins. These adjacent histidines can interact with the metal-ions of the IMAC column via the nitrogen of the imidazole ring (Figure 1B). These interactions between metal ions and proteins are extremely complex. They can also be the combined effect of electrostatic (or ionic), hydrophobic, and/or donor-acceptor (coordination) interactions (5). c) Elution of His-tagged proteins bound to the IMAC column. Imidazole is used to elute recombinant His-tag proteins bound to the Ni2+ of the IMAC column. An excess of imidazole is added to the column and this results in a competition between histidine and imidazole for the coordination bonds. The excess of imidazole in the column leads to the displacement of the histidines and therefore, the elution of the recombinant proteins (Figure 1C).

90

This treatment involves dissolving the sample in a buffer containing 1-2% sodium dodecyl sulfate (SDS. Mercaptoethanol reduces -S-S. For proteins separation. as well as three molecules of water. electrolysis. The rate of electrophoretic migration of a protein is a function of the voltage gradient. the most common support is a gel of polyacrylamide poured between 2 glass plates forming a very thin vertical slab (Figure 2). the sample can be treated to insure that all molecules have the same conformation. a detergent) and 0. The overall size of a protein molecule is determined by the folding of the protein and by the presence of intra.PAGE (Polyacrylamide Gel Electrophoresis) When an electric potential difference is applied to two electrodes immersed in a solution of substances whose molecules bear an electric charge. This phenomenon is called electrophoresis and may lead to discharge at the electrode. These bridges can hold the folded molecule together or form polymers of protein molecules by linking different molecules together. (C) An excess of imidazole is added to the column to eluate the recombinant proteins. the pore size of the support matrix and the charge and "size" of the protein.or intermolecular disulphide bridges. the electrostatic attraction causes movement of the charged particles towards the electrode of opposite charge. wetted with the appropriate buffer. also called IDA (HN(CH2CO2H)2). B. which is covalently attached to an agarose bead (gray box). The porous support not only decreases diffusion but it also provides a ‘molecular sieving’ effect.(A) A nickel ion (Ni2+) is held in place by a molecule of iminodiacetic acid.0 M mercaptoethanol (SHCH2CH2OH). The sample is usually applied to a porous solid support. such as a gel. if the particle reaches it at the appropriate potential. Immobilized Metal ion Affinity chromatography. The Ni2+ ion is at the center of a coordination bond formed by the nitrogen and the two carboxyl oxygen’s of the IDA molecule.4 g SDS/ g protein) and also unfolds 91 . To be able to distinguish between these folding and bridging effects. thereby making migration solely dependent upon molecular weight and electrical conditions.cross-linked polymers to monomers and SDS binds to all proteins at a high ratio (1.Laboratory Class 6: Protein purification 2011 Figure 1. (B) When recombinant His-tagged proteins are added to this column. the latter parameter combines both molecular weight and conformational effects (6-8). nitrogen from the imidazole ring of the histidines will replace the three molecules of water in the coordination bond.5-1.

In this lab. 225 = 225 kDa or 225. the mobility in SDS-polyacrylamide gel electrophoresis (SDS-PAGE) is independent of the intrinsic protein charge or conformation and is solely dependent on the protein molecular weight. This ladder is a mixture of individually colored and purified proteins of known molecular weights (Figure 3). A linear relationship is obtained when the log molecular weight of standards is plotted against mobility. Once separated. Figure 2: Slab gel electrophoresis apparatus In order to determine the molecular weight of a protein on a SDS-PAGE gel. the components of the sample may be recognized by a variety of means such as staining with Coomassie Blue R or other stains. Figure from GE Healthcare.000 Da) For a recommended loading volume of 5 L. you will be using a molecular weight marker called. we need to have a reference marker.g. Since SDS is negatively charged at the pH used for the electrophoresis. This technique (SDS-PAGE) has become the most widely used techniques for determining the molecular weight of a protein (6) and is now generally used to analyse proteins in conjunction with the Western blot method. Molecular weight is expressed in kiloDaltons (e. the SDS-protein complex becomes negative with a charge density that is independent of the protein size. 92 . the different marker bands add up to a total of 7. RainbowTM ladder. thus serving as one of the major means to determine protein molecular weight.Laboratory Class 6: Protein purification 2011 the protein at the same time. Figure 3. Thus.5 g. Rainbow colored protein molecular weight marker separated by SDS-PAGE (Full range).

Resuspend your cell pellet from last week in 10 mL ice-cold 1X Binding Buffer. Centrifuge your sonicated cell suspension at 14. 4. 3. Make sure to keep all your samples. Let your tube on ice for 1 min.5 mL microcentrifuge tube. Take a 50L sample of your sonicated cell extract and put it in a 1. 2. Then put your tube on ice. you should blank the spectrophotometer with the wash buffer when you will try to estimate the concentration of the wash controls)  Your final fraction containing your purified his-tagged recombinant T7 RNA polymerase should be mixed before being stored at -20⁰C. This fraction is to be loaded on the IMAC column at Step 9.  Make sure to properly label all your protein fractions. estimate their concentrations by absorbance at 280nm.  You will generate several protein samples throughout the purification of your recombinant His-tagged T7 RNA polymerase. This is the only fraction that will be assessed for enzyme activity next week. Repeat sonication/cooling two more times. Part B: His-Tag Affinity Chromatography Column Preparation 93 . This solution will be your “Input Control”. BE CAREFUL TO LABEL IT AND STORE IT PROPERLY! Part A: Cell Lysate Preparation 1.Laboratory Class 6: Protein purification 2011 PROCEDURES Important reminders:  Only your IPTG-induced pellet obtained from the 50mL cell culture last week will be used for the purification of your recombinant T7 RNA polymerase.000g for 20 min at 4°C. and put them at -20⁰C until next week for the analysis by SDSPAGE. Set the knob of the sonicator to half power and sonicate your cell suspension for 1 min while maintaining your tube on ice.g. Sonication helps solubilize proteins. Always keep your tube on ice during sonication to prevent overheating and protein denaturation. Remember that you should use the corresponding buffer to set the zero on the spectrophotometer (e. but it also shears DNA.

We need to reuse these columns and a column without its cannot be reused. Add 3 bed volumes of 1X Binding Buffer and run through column. Wash column with 7. After the Binding Buffer has drained.5 mL aliquot of this 12.5 mL aliquot of this 7. 10. Remove the bottom and top column caps and allow the remaining stripping buffer to flow through. Keep this solution on ice until the “Desalting procedure”. make sure that the level of liquid has just reached the bed surface before proceeding to another solution. Purification of His-Tagged Proteins 8. 5.5 mL aliquot of this 10 mL solution after it has gone through the column (Flowthrough control).5 ml 1X Wash Buffer. Discard this fraction. the transferred solution will be diluted and this might negatively affect the chromatography process.5 mL solution after it has gone through the column (Wash 1 control).25 mL. On the other hand. Take a 1. 9.5 mL solution after it has gone through the column (Wash 2 control). The solution coming out of your column contains your recombinant T7 RNA polymerase. 11. When pouring a solution into a column. Take a 1.5 ml 1X Binding Buffer.5 ml 1X Elute Buffer in a 15 mL tube. ready-touse columns.Laboratory Class 6: Protein purification 2011 This part involves the stripping and recharging of the column with Ni +2 ions. Elute protein from column with 7. The Monday groups should omit this part because they will be supplied with new. 4. 94 . 6. load column with prepared cell extract (10 mL). The column bed corresponds to the matrix that is packed into the column. If another solution is added while some liquid from the previous step still remains above the resin. Wash column with 12. Put the caps in a ‘safe’ place so you can recover them to seal your column when you have completed the process of purification. Add 5 bed volumes of 1X Charge Buffer and let it flow through the column (column should turn to a blue/green color). Take a 1. Add 3 bed volumes of distilled water onto the column and let it flow through. For the column you use. avoid extended delays between steps as the surface of the bed resin might dry out. 7. the bed volume is 1.

13. Transfer the final eluted sample from Part B by filling the inner column provided in the tube. the appropriate buffer is used to resuspend the large molecules that stayed inside the column. 20 mM Tris-HCl.5 M NaCl. 0. pH 7. Centrifuge at 4. 0. you will use a centrifugal filter column with a molecular weight cut-off of 50kDa for substituting the elution buffer (250 mM imidazole. might interfere with the activity of your recombinant T7 RNA polymerase that will be assessed next week.05% Tween 20. 1 mM DTT. In this experiment. 14.9) of your eluted fraction with T7 Storage Buffer (30 mM HEPES. Wash column with 3 column bed volumes of 1X Strip Buffer.25 mM EDTA. 0. but you will be able to add the remaining fraction after the first centrifugation. 0. Column Stripping 12.15 M K-Acetate.Laboratory Class 6: Protein purification 2011 Keep all the protein fractions you generated from the purification procedure so you can assess their concentrations by absorbance at 280nm BEFORE leaving the lab. After the solution has been filtered. Allow half of the buffer to run through column and then cap both ends of the column. The underlying principle for buffer substitution is to use a column with a filter that allows small molecules to flow through. Part C: Desalting of the Purified His-Tagged T7 RNA Polymerase Some contaminants that are found in the elution buffer. You should measure the absorbance at 280nm of all your controls as well as your purified protein (see table in question 1 of the assignment). pH 7. The figure below illustrates the procedure to be used.000g using a swinging bucket for 8 min. especially the high imidazole concentration. Notice that not all of your eluted sample can fit into the column tube. 95 .5). Return the capped column back to TA. but not the larger ones.

Transfer the solution remaining in the inner column to a 15 mL conical centrifuge tube and fill it up to 2 mL with T7 Storage Buffer. the protein profile of the different controls that were prepared by some groups in lab 5 will be compared to your IPTG-induced sample. For the electrophoresis. Transfer the rest of the purified protein sample into the column tube. and centrifuge again at 4. Repeat step 16. Part D: SDS-PAGE Analysis of IPTG Induction Controls In this section. If too much is left inside your column after the first centrifugation. Each TA will run two gels. you can simply centrifuge for another 5 min before loading the remaining fraction. 17. 19.000g for 8 min. It is recommended to have approximately 500 L left in the column before adding the second fraction. (Remember that these loading volumes include the 2X loading buffer pre-added in lab 5) 96 . Fill up the inner column with T7 storage buffer and centrifuge at 4. The loading sequence of samples to be analyzed are provided in the two tables below. you will be using two pre-cast gradient gels (4-20% acrylamide). 16.000g again for 10 min.Laboratory Class 6: Protein purification 2011 15. 18. Never let the membrane dry out completely. The rate of filtration during centrifugation can vary significantly due to the occlusion of the pores with large cell fragments.

10 or 18: 1 mL aliquot before induction Groups 2.5ug/5ul) Groups 8. Loading sequence on gel #2 Loading volume (L) 5 10 10 10 10 10 10 Lane 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 Sample Rainbow marker (7. 9 or 17: 1 mL aliquot before induction Groups 1. 16 or 24: 1 mL aliquot after induction Groups 8. Heat all samples. Loading sequence on gel #1 Loading volume (L) 5 10 10 10 10 10 10 10 10 5 10 10 10 10 10 Lane 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 Sample Rainbow marker (7. 13 or 21: 1 mL aliquot before induction Groups 5. except the Rainbow marker. 15 or 23: 1 mL aliquot before induction Groups 7. 15 or 23: 1 mL aliquot after induction Table 2.5ug/5ul) Groups 1. 11 or 19: 1 mL aliquot before induction Groups 3. in a thermocycler at 95°C for 5 min. 9 or 17: 1 mL aliquot after induction Groups 2. 14 or 22: 1 mL aliquot before induction Groups 6. 14 or 22: 1 mL aliquot after induction Groups 7. 12 or 20: 1 mL aliquot after induction Groups 5. After 97 .second 1 mL aliquot) 2nd set of extra controls: 1 mL aliquot before induction 2nd set of extra controls: 1 mL aliquot after induction 20. 13 or 21: 1 mL aliquot after induction Groups 6. 16 or 24: 1 mL aliquot before induction 1st set of extra controls: (no induction . 12 or 20: 1 mL aliquot before induction Groups 4.first 1 mL aliquot) 1st set of extra controls: (no induction . 10 or 18: 1 mL aliquot after induction Groups 3. 11 or 19: 1 mL aliquot after induction Groups 4.Laboratory Class 6: Protein purification 2011 Table 1.

and microwave for 90 seconds without a lid. This will cause the entire gel to fail. 21. place your gel into a microwavable tray containing about 100 mL of distilled water. 26. The running buffer in the outer chamber should be at least halfway between the tops of the short and the long glass plates.Laboratory Class 6: Protein purification 2011 the sample has been boiled. Gel staining 24. 25. Load 10 L of each sample. 27. 23. Position the tip above the well and insert it not more than 1mm into the well. Do not let solution boil to evaporation. 98 . then discard water. After electrophoresis. The level of the buffer in the inner chamber should be at least 3 cm above the bottom edge of the gel sandwich. and microwave without a lid for 1 minute or until the solution begins to boil. briefly spin down your tubes to collect your sample at the bottom. put the lid on it and transfer the tray onto the waver for 5 min under gentle agitation. Discard the water and repeat step 24. Use the pump dispenser to add just enough of the GelCode Blue Stain Reagent to cover your gel. Your TA will coordinate the scanning and file saving procedures. Incubate on the orbital waver with the lid on for about 10 min or until bands become clearly visible. Remove the tray from the microwave oven. Discard water wash from gel. 28. 30. Add distilled water to fully cover your gel and transfer the tray onto the waver for for 5 minutes under gentle agitation. To destain. 22. Run the gel at 150V until the blue tracking dye gets close to very bottom of the gel (about 30 to 45 minutes). Prepare 1X Running (HEPES) Buffer and fill the upper and lower chambers. but only 5 L of the Rainbow markers. Do not force the pipette tip too far into the well as this will separate the plastic casing around the gel and let your sample diffuse into the surrounding buffer. discard staining reagent in the sink and replace with 200 mL of distilled water. and slowly release the sample. Assemble the gel support and position the gels in the electrophoresis apparatus. 29. Gels are to be scanned so results can be posted on the course website.

Laboratory Class 6: Protein purification 2011 ASSIGNMENT ASSIGNMENT TO BE HANDED IN INDIVIDUALLY TO YOUR TA WHEN ENTERING NEXT WEEK LAB ( /10 MARKS) 1. Refer to the concentration obtained in Question #1 to calculate the volume of each fraction to be loaded. ( /5 Marks) 99 . All other fractions should be converted into protein amounts based on the ε 280 you estimated for a complex protein mixture. Based on your results in the above table. The first step will be to run a SDS-PAGE. Protein quantification for the purified aliquot should be based on the ε280 you estimated for the recombinant T7 RNA polymerase in lab 5 assignment. are provided in the following table (see next page). ( /3 Marks) Protein concentration (g/L) Total volume of the fraction (L) Total amount of protein (g) Control fraction Input control Flowthrough control Wash1 control Wash2 control Elution control Purified protein Absorbance at 280 nm 2. Please include your calculations. The amounts of protein the aliquots to be prepared for the Western analysis. Next week. can you estimate the percentage of the Histagged T7 RNA polymerase in the total protein preparation of the IPTG-induced treatment? ( /2 Marks) 3. as well as those for the staining with the Gel Code Blue Staining Reagent. Complete this table with regard to the protein amounts obtained at the different purification steps. you will initiate the Western analysis with the protein fractions you put aside different protein fractions while purifying your His-tag T7 RNA polymerase by affinity chromatography. Please include your calculations.

10 g or a maximum of 12. 50 g or a maximum of 12. 50 g or a maximum of 12. 10 g or a maximum of 12.5 g or a maximum of 12.5 L Wash2 control.5 L --------------------------Blank: cut zone-------------------------Rainbow marker (7. 5 g or a maximum of 12.5 L Purified protein. 0.5 L Flowthrough control.5 g or a maximum of 12.Laboratory Class 6: Protein purification 2011 Lane 1 2 3 4 5 6 7 -89 10 11 12 13 14 15 Sample Rainbow marker (7.5 L Wash1 control. 0.5ug/5ul) Input control.5 L Wash1 control.5 L Elution control.5 L Flowthrough control.5ug/5ul) Input control.5 g or a maximum of 12.5 L Wash2 control. 1 g or a maximum of 12.5 L Elution control.5 L Sample volume (L) - 2X Loading buffer (L) - Loading volume (L) 5 -------- ----------- ----------5 100 . 1 g or a maximum of 12. 0.5 g or a maximum of 12. 5 g or a maximum of 12.5 L Purified protein. 0.

15 and 23 : How SDS-PAGE works. 14 and 22 : Short review on Immobilized Metal Ion Affinity Chromatography: Trends in Analytical Chemistry 1988 7:254-259.com/articles/the-in%E2%80%99s-and-out%E2%80%99s-of-proteinconcentration-%E2%80%93-semi-permeable-membranes/ (You should present all three parts: Semi-permeable membrane. 13 and 21 : Statistical determination of the extinction coefficients of Trp and Tyr in proteins. http://bitesizebio. Make sure to talk about native PAGE versus denaturing PAGE.Laboratory Class 6: Protein purification 2011 READING MATERIALS FOR IN LAB TEACHING TOPICS Groups 5. Groups 7. 16 and 24 : Review article on how to concentrate proteins: http://bitesizebio. protein precipitation and chromatography) 101 . Anal Biochem 200:74 (1992) Groups 6.com/articles/how-sds-page-works/ Groups 8.

Metal chelate affinity chromatography. J. 5. 1989 Mar. Surface topography of histidine residues: a facile probe by immobilized metal ion affinity chromatography. Fundamental Laboratory Approaches for Biochemistry and Biotechnology. Porath J. 1991 Feb. p 1 8. Biotechnology (N Y). (1988) Trends Anal. One-dimensional polyacrylamide gel electrophoresis. 10. Separation & Purification Reviews. Statistical determination of the average values of the extinction coefficients of tryptophan and tyrosine in native proteins. J. 4. Biochemistry. In “Gel Electrophoresis of Proteins”. (2004). Metal-affinity separations: a new dimension in protein processing.com/instructions/2161472. Middaugh CR. Hochuli E. 9. Hemdan ES. Carlsson J. 2nd Ed. D. p65 and p144.(2007) 'Immobilized Metal-Ion Affinity Chromatography: Status and Trends'.com/catalogue/item/ufc805096 Precise™ Protein Gels (4-20% gradient gel) http://www.P.merck-chemicals. Web references for the materials used in the lab His bind http://www. 7. 3rd Ed. (Hames & Rickwood). Gutiérrez. (1990). Voet. IRL Press (London).J. pp71-111. Sulkowski E. Hames. Martín del and Galán. Nature.258(5536): pp598-9. J Chromatogr. Arnold FH.D.4. Lewis RV.com/usa/life-science-research/his-bind-columns/EMD_BIO70971/p_uuid?attachments=brochure Desalting column (Amicon® Ultra-4 Centrifugal Filter Units) http://www. 6. Olsson I.pdf 102 . 1975 Dec 18.86(6): pp1811-5. (1998). 1992 Jan.Laboratory Class 6: Protein purification 2011 REFERENCES 1. Fitzgerald Sciences Press (Mar). Ninfa. Valle. Schacher A.9(2): pp151-6. Chem. E. . 7. and Voet. A. R. John Wiley & Sons. 200 (1):pp 74-80. and Ballou. B. M. Döbeli H.millipore. 3. A. 2. Anal Biochem. a new approach to protein fractionation. Mach H. Porath. Porath J. M. p 127.411: pp177-84. Zhao YJ.piercenet. 1987 Dec 18. Belfrage G. pp 254-259. Proc Natl Acad Sci U S A. D. 6. 36: 1. New metal chelate adsorbent selective for proteins and peptides containing neighbouring histidine residues.

you will analyze your purified T7 RNA polymerase by SDS-PAGE.Laboratory Class 7: Western analysis and enzyme assay 2011 WESTERN ANALYSIS AND ENZYMATIC ASSAY (PART I) OVERVIEW This week. LEARNING OBJECTIVES Underlying molecular principles    Explain the different steps of Western analysis Explain the different steps of in vitro transcriptional assay Explain the principle for the colorimetric detection with alkaline phosphatase Hands-On Skills      Assess protein size and relative abundance by SDS-PAGE Transfer protein bands from SDS-PAGE to blot membrane by electrophoretic transfer Immunodetect His-tagged T7 RNA polymerase by Western analysis Assess the enzyme activity of your His-tagged T7 RNA polymerase mutant in parallel to its wild type version Prepare an agarose gel and proceed to the electrophoresis of RNA samples Analytical Skills   Assess protein size and relative abundance by SDS-PAGE Refer to your detection results to discuss the sensitivity and specificity of the Western analysis 103 . you will also optimize of the enzymatic assay that you will use to evaluate the activity of your mutant T7 RNA polymerase. These optimized conditions will be used next week to perform a formal evaluation of the enzymatic activity of your mutant enzyme in comparison to the wild type enzyme. You will also begin a Western analysis that should confirm that the purified protein contains the Histag. During this lab session. This analysis will provide an assessment of the size as well as the abundance of the recombinant protein.

This issue is easily solved by proceeding with longer transfer times for gradient gels then for regular gels having a steady acrylamide concentration. The electrophoresis run is longer. A drawback is the difficulty of transferring proteins from a gradient gel because ‘’these are tightly caught by the gel network at their pore limits’’ (Anal Chim Acta 1998. and protein transfer is more difficult as the proteins get more tightly captured in a fine-mesh network. 104 . SDS-PAGE on gradient gels In gradient SDS PAGE. allowing for efficient protein retention. Protein transfer onto PVDF membrane Protein transfer from polyacrylamide gels can be accomplished by electrophoretic transfer that is done by placing the buffer-soaked gel-membrane "sandwich" between plate electrodes (semi-dry transfer). Figure 1 depicts the different components of the “sandwich” in a semi-dry transfer Figure 1. 140150 g/cm2 membrane.Laboratory Class 7: Western analysis and enzyme assay 2011 BACKGROUND A. As the gel pores decrease in size. 372:91). In the lab this week. This can be explained by the constant focusing effect acting on the bands throughout the electrophoresis run: the molecules at the front are delayed as they are moving through a higher concentration area while those behind can catch up due to a faster migration through lower acrylamide concentration. One benefit of gradient gels compared to a gel of only one acrylamideconcentration is a better resolution of the protein bands. This problem can lead to less effective protein transfer and lower signal in Western analysis. proteins migrate from lower to higher concentrations of polyacrylamide. Components of the semi-dry protein transfer sandwich. the migration rate of proteins also decreases. you will be using a PVDF membrane with high binding capacity. B.

Detection of an antigen by western blotting. Denaturing conditions are used to ensure full linearization and optimal exposure of the His tag for binding of the anti-His tag antibody (the His tag could remained concealed within the protein core under non denaturing conditions). The immune probing of your his-tagged T7 RNA polymerase will be achieved with a primary monoclonal anti-His tag antibody able to bind with any polypeptide labelled with a stretch of 6 histidine residues. (A) Summary of the various steps in a western blotting procedure. (Figure 2) Figure 2. (B) This cartoon is a zoom in of the antigen-antibody complex which is representative of your western blot membrane at the end of the western blot procedure (step 7). which mediates the conversion of a colorless substrate into an insoluble blue product. Detection of the recombinant His-taggedT7 RNA polymerase by western blotting. 105 . This enzyme. is responsible for the colorimetric detection. You will be using a polyclonal secondary antibody raised against the constant or Fc fragment of the primary antibody that has been conjugated with alkaline phosphatase.Laboratory Class 7: Western analysis and enzyme assay 2011 C.

106 . you should be extremely careful while preparing your enzymatic assay. In this experiment. therefore. which will quickly digest your RNA transcript. ensure that all transcripts are the same length. 5’ T AAT ACG ACT CAC TAT A3’. a T7 polymerase inhibitor that is released during the transcription assay. The linearization of the plasmid DNA template is desirable to ensure that transcription can be terminated at a specific position and. diethylpyrocarbonate (DEPC) is used to inactivate any contaminating ribonucleases. T7 RNA polymerase is relatively easy to assay as its activity doesn`t require any cofactors. but highly recommended for preventing the enzymatic degradation of the transcribed product. In the lab. In research labs. Samples collected during the enzymatic assay should always be kept on ice. T7 RNA polymerase is often used in molecular biology since it can synthesis RNA from any piece of DNA located downstream of its specific promoter. (Optional) RNA inhibitor is facultative. our solutions won’t be treated with DEPC and therefore. the transcription product will be assessed by agarose gel electrophoresis.    In the protocol that you will use. Buffer and water are treated with DEPC before performing the transcription assay. The four essential reagents for assessing T7 RNA polymerase activity are:   An enzyme source. Enzymatic activity of the T7 RNA polymerase The T7 RNA polymerase catalyzes the synthesis of RNA in a 5’ to 3’ direction. Free ribonucleoside triphosphates Pyrophosphatase is added to remove inorganic pyrophosphate.Laboratory Class 7: Western analysis and enzyme assay 2011 D.8 kb. The DNA template to be used in a transcription assay for T7 RNA polymerase should therefore contain the T7 promoter motif. you will use a plasmid pre-digested with a restriction enzyme as the DNA template. since DEPC is toxic and volatile. you will be provided with an open DNA template derived from a recombinant pBluescript vector whose transcription product should be approximately 1. However. upon which the T7 RNA polymerase can bind and initiate transcription. You should also proceed quickly when loading your agarose gel with your RNA samples. the T7 promoter. Transcription activity will therefore be estimated based on the intensity of the RNA transcript visible on an agarose gel. which will be your recombinant T7 RNA polymerase A DNA template T7 RNA Polymerase exhibits extremely high specificity for its cognate promoter sequence.

5 L Please check with your TA before making your samples to ensure that your calculated volumes are correct.Laboratory Class 7: Western analysis and enzyme assay 2011 PROCEDURES Part A: Electrophoresis of the purification samples on SDS-PAGE gel You will be using a pre-cast gradient gel with 4-15% acrylamide. 10 g or a maximum of 12. 107 .5 L Elution control. 1. If necessary.5ug/5ul) Input control. The first part of the gel corresponding to Lanes 1 to 7 will be transferred to the PVDF membrane whereas the second part of the gel (Lanes #9 to 15) will be stained using the Gel code blue staining reagent 2. 1 g or a maximum of 12. your TA will assist you in using the electrophoretic cell. 1 g or a maximum of 12.5 g or a maximum of 12. 5 g or a maximum of 12.5 L --------------------------Blank: cut zone------------------------------------------.5 L Wash2 control. 0. 50 g or a maximum of 12.5 g or a maximum of 12. 5 g or a maximum of 12. At the end of the electrophoresis.5 g or a maximum of 12.5 L Elution control. Table 1.5 L Wash1 control.5 L Flowthrough control. Prepare aliquots for electrophoresis by mixing them with an equal volume of 2X Sample Loading.5 L Wash1 control. Refer to steps 18-28 of Experiment D in lab 6 for details on the preparation and staining of SDS-PAGE. Loading sequence on SDS-PAGE gel (Question 3 of last week’s assignment). place the gel on a clean surface and cut it at Well #8 with a blade. 10 g or a maximum of 12.----------Rainbow marker (7. 50 g or a maximum of 12.5 g or a maximum of 12. 0.5ug/5ul) 5 Input control.5 L Purified protein.5 L Flowthrough control. Sample volume (L) 2X Loading buffer (L) Loading volume (L) 5 Lane 1 2 3 4 5 6 7 -89 10 11 12 13 14 15 Sample Rainbow marker (7.5 L Purified protein. 0. 0.5 L Wash2 control.

b. Soak the membrane in methanol for a few seconds. Wash with gentle shaking for 15 minutes.Laboratory Class 7: Western analysis and enzyme assay 2011 Part B: Electrophoretic semi-dry protein transfer 3. 192mM glycine. Assemble the Trans Blot Semi-Dry Transfer System as follows: 108 . make sure to smooth out any air bubbles between each layer of the transfer assembly. The colour will change from opaque white to uniform. You should cut one corner of the membrane diagonally so that you can orient the membrane correctly after transfer. translucent gray. Carefully remove the piece of the gel dedicated to the transfer and place it in a 500 mL plastic dish containing 200 mL of Transfer Buffer (25mM Tris. The membrane should not be allowed to dry out during any of the above hydration steps. Meanwhile. Soak the membrane in distilled water for at least 2 minutes. 6. 20% methanol). Do not get any methanol on exposed skin and wipe up any spills immediately. Air bubbles will prevent efficient transfer of the proteins and will make subsequent analysis difficult. 4. 5. If any drying occurs (opaque areas appear on the membrane). pH 8. Be careful working with the methanol as it is toxic. cut a piece of PVDF membrane the same dimensions (7cm x 5cm) as your gel. Transfer will be carried out using the BioRad Transblot semi-dry transfer unit. Handle the membrane on the edges with forceps at all times!! Finally. The unit is large enough to simultaneously accommodate four SDS-PAGE gels. Prepare the membrane for transfer as follows: a. perform quick rinses as in steps 4a-c above. c. Soak the membrane in transfer buffer for at least 10 minutes.

At this point the transfer membrane can be sealed wet in a plastic bag and stored at 4°C until next week. Place the safety cover on the unit and connect the cables (these are colourcoded. too). If the transfer was successful. Turn off the power supply. This week’s goal is for you to optimize an experimental procedure that will assess the relative activity of your mutant T7 RNA polymerase preparation compared to a wild type preparation. e. g. Part C: Optimization of the T7 RNA polymerase enzymatic assay The procedure below only provides general guidelines. Place your pre-soaked PVDF membrane on top of the filter paper and roll out any air bubbles. To complete this 'sandwich' put a piece of transfer buffer-saturated filter paper on top of the gel and remove any air bubbles. The three following aspects should be taken into consideration while planning your protocol: 109 . 7. b. being careful not to disturb the stack. Your TA will supply you with a preparation of the wild type version of T7 RNA polymerase that was prepared under the same conditions as the ones you used for purifying your mutant T7 RNA polymerase. Rinse the membrane two times for 5 min in a plastic dish with 50 mL of PBS+Tween20 0. the colored markers should be visible on the membrane. d. place it on top of the membrane and roll a pipette or test tube over the gel to make sure that good contact is achieved with the membrane. Roll a pipette or glass rod over the surface of the paper to exclude all air bubbles that would interfere with ionic conductivity and protein transfer. 8. Be careful not to introduce any air bubbles. f. Load the bottom of the transfer unit (the platinum anode) with two sheets of filter paper pre-soaked in the Transfer Buffer and cut to the same size as your membrane. 9. c. Place the cathode of the transfer unit on top of the stack. 10.3A for 45 minutes. Transfer is done at 0. without the membrane. Carefully lift the gel from the transfer buffer. Maintain gentle agitation during the rinses.Laboratory Class 7: Western analysis and enzyme assay 2011 a. remove the cover and carefully peel off the upper layer of filter paper and the gel.05%.

At each specific time point (T1 to T3). (See Figure 4 for example of optimization). and then refine your experimental plan for the second week according to your initial data.Laboratory Class 7: Western analysis and enzyme assay 2011  Plan your work to make an effective use of the two full laboratory sessions that are dedicated to assay the enzymatic activity of your enzyme preparation. Examples of enzymatic assay. You will not have access to additional reagents. you will take out a reaction from the water bath and put it on ice. so plan your experiments carefully. including all the controls. In A). 2) you can also combine 3-5 transcription assay reactions into a larger reaction solution and take out aliquot of the assay reaction at specific time points. At each time point.   Figure 4. four individual reactions are prepared. You can decide to setup your reactions in two different ways: 1) you can prepare 3 to 5 individual reactions and start the incubation at the same time. One reaction will be kept on ice as a To control. The remaining three reactions will be placed in a water bath at 37°C. It is recommended that you plan a preliminary investigation with a couple of samples for the first week. You will be provided with enough reagents to perform a total of 20 reactions. 3 to 5 reactions 110 . one reaction will be taken out of the water bath and placed on ice to stop the reaction. In the second method (B).

Incubate @ 37°C for up to 30 min. At each time point. 3. a 5 to 10 L aliquot is taken and transfered to a new tube on ice which is pre-labeled (T0).5 L of RNaseOut RNase inhibitor (40U) (Invitrogen) o 0.Laboratory Class 7: Western analysis and enzyme assay 2011 are combined in one tube to create a master reaction. You should notice that all aliquots should be kept on ice.5 g of T7 RNA polymerase source o Complement to 10 L with water 1. Proceed to electrophoresis and take a picture of your agarose gel. you should immediately mix with DEPC-treated 10X Loading Buffer. Before you start the incubation. you will take a 5-10 L aliquot and transfer it to a new tube. 4.0 L of 5X Transcription buffer o 1. 2.5 L of Pyrophosphatase 100U/mL o 0.25 L of 10mM NTP mix (Invitrogen) o 0.5-1. The master reaction is then transferred to a water bath at 37°C. Remember that each time you take an aliquot or take out a reaction from the water bath. 111 . Keep all your reaction on ice until you have collected all your samples. General Guidelines for the Transcription Assay Mixture for one in vitro transcription assay with a final volume of 10L o 75 ng of DNA template (1 L @ 75 ng/L) o 2.

11 and 19: Western blotting: http://www.cfm?fldID=b06ffe8f-5056-8a76-4e15-af49e5f5a91f http://probes.com/browse.invitrogen.com/immunodetection/id3/western_blotting Groups 4.com/immunodetection/id3/proteintransfer Groups 3.pdf http://www.pdf Groups 2.millipore. 9 and 17: Advantages and disadvantages of different staining methods for protein gel: Coomassie blue.com/ps/pdf/protocols/WB-beginner. silver nitrate and SYPRO red staining: http://www.Laboratory Class 7: Western analysis and enzyme assay 2011 READING MATERIALS FOR TEACHING TOPICS Groups 1.millipore.com/media/pis/mp12000.millipore. 10 and 18: Wet versus semi-dry gel transfer in western blotting: http://www.abcam.piercenet. 12 and 20: Antibodies tutorial: http://www.com/immunodetection/id3/antibodiestutorial 112 .

Laboratory Class 7: Western analysis and enzyme assay 2011
REFERENCES 1. Yamaoka T. Pore gradient gel electrophoresis: theory, practice, and applications. Analytica Chimica Acta, 1998, Vol 372, 1, Oct 19, pp. 91-98.

Web references for the materials used in the lab PVDF membrane http://www.roche-applied-science.com/proddata/gpip/3_7_4_15_2_1.html BioRad Transblot semi-dry transfer unit http://www.bio-rad.com/LifeScience/pdf/Bulletin_9002.pdf

113

Laboratory Class 8: Western analysis and enzyme assay 2011
WESTERN ANALYSIS AND ENZYMATIC ASSAY (PART II)

OVERVIEW This week, you will finish the Western analysis. You will also complete the formal evaluation of your T7 RNA polymerase’s enzymatic activity. LEARNING OBJECTIVES Underlying molecular principles    Explain the different steps of Western analysis Explain the different steps of in vitro transcriptional assay Explain the principle for the colorimetric detection with alkaline phosphatase

Hands-On Skills      Assess protein size and relative abundance by SDS-PAGE Transfer protein bands from SDS-PAGE to blot membrane by electrophoretic transfer Immunodetect His-tagged T7 RNA polymerase by Western analysis Assess the enzyme activity of your His-tagged T7 RNA polymerase mutant in parallel to its wild type version Prepare an agarose gel and proceed to the electrophoresis of RNA samples

Analytical Skills   Assess protein size and relative abundance by SDS-PAGE Refer to your detection results to discuss the sensitivity and specificity of the Western analysis

115

5% non-fat dry milk). Recuperate your membrane and transfer it to a plastic dish with 50 mL of blocking buffer (TBS. but gently massage the bag content with your fingers every 10-15 min to ensure complete mixing.05% Tween20) onto the protein side of the membrane.4 Primary anti-His antibody binding 2. 9. 0. 5% nonfat dry milk) for 10 min with gentle mixing.05% Tween20.05% Tween20) for 10 min with gentle mixing. pH 7. Put your plastic dish onto the waver and incubate for 30 min with gentle mixing. Again gently massage the bag every 10-15 min. Discard the wash buffer and repeat the wash one more time. Place your membrane inside the space between the plastic sheets and pipette all 3 mL of the pre-diluted primary antibody (TBS. Place the membrane between plastic sheets provided by your TA and seal 3 of the sides with a vacuum sealer. Rinse the membrane with 50 mL of distilled water for about 30 sec.Laboratory Class 8: Western analysis and enzyme assay 2011 PROCEDURES Part A. 0. Carefully push out all air bubbles between the membrane and the baggie before sealing the 4 th side.05% Tween20. Place the membrane in a new baggie (refer to step 11) containing 3 mL of the pre-diluted secondary antibody and put on the waver for 1 hour. . Wash the membrane with 50 mL of wash buffer (TBS. 0. 8. 500mM NaCl. Discard water and 116 5. A 12000X dilution of the commercial anti-His antibody has already been prepared by the Support Staff. 6. Discard the wash buffer and repeat three more times. Re-block the membrane with 50 mL of blocking buffer (TBS. 7. Binding of secondary rabbit anti-mouse IgG conjugated with alkaline phosphatase 3. A 3000X dilution of the commercial secondary antibody has already been prepared by the Support Staff. Decant and discard the antibody/buffer. Wash the membrane with 50 mL of wash buffer (TBS. Completion of the western blot analysis Blocking membrane 1. Discard the blocking buffer and repeat one more time. Place the bag with your membrane onto the waver for 1 hr. TBS: 20mM Tris.05% Tween20) for 10 min with gentle mixing. 0. 4. Cut away all four sides of the baggie and discard the antibody/buffer solution. 0.

Longer reaction times will result in higher background. Reaction takes about 30 sec to 2 min. Part B: Enzymatic activity of the mutant T7 RNA polymerase Last week. The reaction can be stopped at any time by quickly decanting the Western Blue Substrate and substituting it with distilled water. Ask your TA to show you how to scan your membrane result. 10. you perform the optimization of your enzymatic assay. You are now ready to evaluate the activity of your mutant polymerase in comparison to the wild type polymerase that was provided 117 . 11. Apply 5 mL of Western Blue® Substrate and monitor the appearance of the blue bands. You can rinse with water one or two more times to completely remove the Western Blue® Substrate. Discard the water of the second rinse.Laboratory Class 8: Western analysis and enzyme assay 2011 repeat the rinse procedure one more time.

com/nebecomm/products/faqproductM0251.com/aptrix/upp00919.gelifesciences.com/browse.asp 118 .nsf/Content/4DE67EABFB9A9D25C12576280 01CDC12/$file/28955347AD.neb. 15 and 23: Recent studies of T7 RNA polymerase mechanism: FEBS Letters (1998) 440 264-267 Groups 8. http://www.Laboratory Class 8: Western analysis and enzyme assay 2011 READING MATERIALS FOR IN LAB TEACHING TOPICS Groups 5.piercenet.cfm?fldID=5A423056-5056-8A76-4E25-1E5F9C0596B2 Groups 6. 13 and 21: Principle of chromogenic western blotting: http://www. 14 and 22: Principle of chemiluminescence (ECL) western blotting.pdf (page 7-12) Groups 7. 16 and 24: Frequently asked questions about the T7 RNA polymerase : http://www.

Laboratory Class 8: Western analysis and enzyme assay 2011 REFERENCES Web references for the materials used in the lab Anti-His antibody (GE Healthcare) http://www.Par.promega.com/etc/medialib/docs/Sigma/Datasheet/6/a4312dat.0001.pdf Western blue® substrate http://www.sigmaaldrich.com/aptrix/upp01077.com/products/biochemicals-and-labware/biochemical-buffers-andreagents/western-blue-stabilized-substrate-for-alkaline-phosphatase/ 119 .gelifesciences.t mp/a4312dat.nsf/Content/Products?OpenDocument&mod uleid=164402 Secondary rabbit anti-mouse IgG conjugated with alkaline phosphatase http://www.File.

.

org/en/si/base_units/ SI prefixes: http://www.01 0. One dalton is equal to 1.Appendix 2011 SI (système international) units and prefixes SI Units: Length: meter (m) Mass: kilogram (kg) Time: second (s) [lower case] Electric current: ampere (A) Amount of substance: mole (mol) Non-SI units sometimes used: liter (L or l) used to measure volume.000.000. day (d) as units of time.001 0.000.000.000 1.000001 0.bipm. SI prefixes: SI prefix SI symbol Decimal value 10x (scientific) value 10-12 10-9 10-6 10-3 10-2 10-1 100 101 102 103 106 109 1012 piconanomicromillicentideci(no prefix) decahectokilomegagigatera- p n µ m c d da h k M G T 0.000 1.66×10−27 kg.000000001 0. Minute (min).1 1 10 100 1.000 References: SI units: http://www.000.bipm.000000000001 0. Dalton (Da) or unified atomic mass unit (u).000.html 121 . hour (h).000 1.org/en/si/si_brochure/chapter3/prefixes.

We recommend the blue notebook “lab notes” that is sold by the bookstore in the University Center. You need to plan ahead of time how to divide and share tasks with your partner. the title of the lab session. For the purpose of BCH3356 you will be working in pairs.Appendix A: Lab notebook 2011 Tips for maintaining a laboratory notebook One important skill that you will acquire in this laboratory course is the proper use and maintenance of a laboratory notebook. Notebook preparation and general rules o Find a durable hard-bound notebook. draw a line through the word or number rather than obliterating the error with an ink blob. o Write your full name. as well as your email. Write legibly! o If you make a mistake. The maintenance of your lab notebook is therefore crucial for effective communication with your partner. Your lab notebook should help keep you organized.  122 . 1. Prepare a flow chart showing your time management during the labs and the coordination of the workload with your partner. prelab calculations required by the lab manual and any questions that you may have about the performance of the experiment or the corresponding theoretical background. It could later become extremely useful to better understand what happened. o Devote pages 2 to 4 to a Table of Contents. Break the lab session into blocks and indicate the experimental steps you expect to be performing during each time interval. Never use correction liquid/tape. even if it seems insignificant. Before the laboratory session  Start a new page indicating the date. Don’t hesitate to ask your TA for advice on the maintenance of your laboratory notebook. on the front and/or first page of your notebook. 2. the course code. your section and group number. o If your notebook is not already numbered. but skillful notebook use is developed by most students only through continued special effort. o Write down everything. number all pages (one side is enough). the purpose of the experiments. Guidelines for the maintenance of your laboratory notebook are listed below. Flow charts should be prepared in pairs and before attending each laboratory class. o Use a pen. not pencil. do not use a spiral bound notebook as sheets can be removed. for all entries. The WHEN and WHO aspects should be emphasized in your flow chart. the techniques to be used.

(Make sure that added printouts do not cover or obscure other entries). All printout containing experimental results (gel pictures …) should be included in your lab manual along with a descriptive annotation. (Not all final graphics and tables need to appear on your lab-book). Remember to always include units. 4. After the lab session   Further analysis of your results. in a table format when appropriate. graphics and calculations when preparing your lab report.Appendix A: Lab notebook 2011  Get your note book initialed by the TA before you start your lab. all your readings from instruments (like a spectrophotometer). During the lab session      Annotate any required calculations. Record equipment details such as brand and model. 123 . Record all your observations Record your measurements. Have your note book initialed before you leave. 3. any variation from the manual protocol.

) table of contents (see next page). page numbers.Appendix A: Lab notebook 2011 5... 124 . Examples of lab-book recordings a) Good and bad (missing titles.

Appendix A: Lab notebook 2011 b) Good and bad (missing information) results recording 125 .

. no units for final result. variables identified. equation provided..Appendix A: Lab notebook 2011 c) Good (pointing specific protocol steps.) calculations recording. 126 ...) and bad (difficulty to understand what was done.

opportunities for others to ask for clarifications.   Presenter was able to deliver his talk At least one important aspect was not discussed Underlying molecular principle(s) briefly overviewed Presentation was more or less fluid Excellent (4.  Presenter seemed to not understand what he had to present Take home message missing or confusing Underlying molecular principle(s) were not covered Incohesive flow of information Presenter was on delivery mode with not much opportunities for audience to step in Meets expectations (3. Some of the reference documents for the teaching sessions CANNOT be completely covered within 5-10 min! You might be required to make some editorial decisions with regard to the specific aspects that are the most important and relevant for BCH3356.5/5) Between 5 and 10 min. The teaching sessions are also intended to promote exchange and discussion among students.Appendix C: In Lab Teaching 2011 Evaluation criteria for in lab teaching The purpose for the in lab teaching sessions is not for the students to prepare and deliver extensive lectures. but to simply clarify some important aspects for the underlying principles behind the experimental procedures. …) Knowledgeable    Overall planning of the presentation    Interaction with others  Minimally engaging presentation Other comments or suggestions for the presenter  127 .5/5) Timeline Less than 5 min.  Presenter knew the material very well  The most important aspects and their relevance to BCH3356 were emphasized  Underlying molecular principle(s) clearly explained  Presentation was well structured and it was easy to follow the progression  • Engaging presentation (questions. Below expectations (2.5/5) Between 5 and 10 min.

23 Abstract Introduction      Present tense to describe well established aspects Past and passive for describing the hypothesis or research goal that was assessed Past and passive for brief summary of methodology that had been used  Materials and methods   Results  Past tense at 3 person rd      Discussion    Past tense at 3 person when referring to results Present when referring to well established facts Past when referring to specific results from an article rd    Don’t use a flowchart and don’t list the different procedural steps.” “What do the findings mean?” Conclusion is in the last paragraph Bibliography and references    Expended referencing style is to be used throughout the Avoid lab manual and websites Bibliography is to be formatted as in middle of p. but specific and descriptive Purpose has to be stated Doesn’t have to be a complete sentence See steps 1-6 at p. “distinguish between facts (results show or indicate that …) and speculation (might. The table below provides specific guidelines for BCH3356. Be explicit and corroborate your statements with numbers whenever possible.Appendix C: Laboratory reports 2011 Tips for writing lab reports Your lab reports should be organized as described in A Guide to Writing in the Sciences. The main sections of this book will be further discussed in the lab via the in lab teaching topics. but “Describe what you did and explain how. Section Title Verbs     Active present except for findings which should be introduced in the past tense Present tense to describe well established aspects Past and passive for describing the hypothesis or research goal that was assessed Past and passive for brief summary of methodology that had been used Past and passive voice rd at 3 person  Contents Concise. 33 of writing guide) 128 text .29 and lower half of p. but every student is expected to read the book – a couple of hours should be enough as it’s concise and easy to read. In other words. providing sufficient details for readers to assess the reliability of your methods. which is available at the university bookstore at ~$20. could). Something like “A DNA fragment with an approximate length of 1200bp (lane 3. but simply describe what was obtained Descriptive text is to be used to highlight the key results that were obtained. Figure 4) was amplified by PCR.” Emphasize the results: your statements should first emphasize your results not what textbooks are saying.” First part of a lab report to be written Decide whether a table or a figure is more appropriate to effectively communicate the results Organize your tables and figures so they could be selfsufficient “Do not interpret the data here”.

… Results are discussed.29 and 33 of writing guide) Lab manual and websites will NOT be considered as acceptable references Grammar and punctuation Proper verb tenses Clarity: avoid jargon and use scientific terminology Conciseness: do NOT overuse adverbs and adjectives Forcefulness: emphasize your key ideas MARK /5 Abstract /5 Introduction /15 Materials and methods /10 Results /15 Discussion /25 Références /10 Writing style /10 129 . and passive voice References to original methods Computer programs are indicated (BLAST. labeling of axes with units. not interpreted Enough text to appreciate conclusions that are stated in Discussion section Descriptive text explicitly refers to the experimental results Proper presentation format of results (tables versus figures) Tables and figures are self-descriptive Descriptive titles and headings.Appendix C: Laboratory reports 2011 BCH3356 Lab report marking scheme Section Title                                              Key aspects to be covered Purpose Concise Descriptive of what was done Results are facultative Concise State the research goal or hypothesis Indicate the experimental approach used Report the most important results State the conclusion Introduce the general context relevant to the study and highlights the importance of research in this area Review the key concepts relevant to appreciating the report Elaboration of the scientific context: known vs unknown Statement of the hypothesis or research goal Importance of the study Reader should get enough information to be able to repeat the study Not a list of procedural steps Written for a purported audience of 3rd year university students Equipment names and model numbers 3rd person. …) Past tense (results were obtained) Proper format for figures Data are described. analyzed and interpreted: should directly refer to the experimental results (explanations should explicitly refer to appropriate figure and table numbers) What’s the meaning of your results? Are the results consistent with expectations? Conclusion is stated at the end Present tense Distinguish between facts and speculation Minimum of five original articles or technical manual of instructions Relevance of references (do not refer ``common knowledge`` Expanded referencing style (p. consistent number of significant digits. 28-29 in writing guide) Proper formatting of the bibliography at the end (list of references formatted as in p. past tense.

V2 and V3 (in fact it should be the same value)? See next page for the solution.Appendix D: Calculations 2011 Appendix D1 Serial Dilution: 1:10 1:10 1:10 V1 V2 V3 Va Vb Vc STOCK: C0 C0/100 CCCCCCCCCC CC C0/10 C0/100 C0/1000 CiVi = CfVf 1st dilution: where i refers to the initial solution and f to the final solution 2nd dilution: (C0/10) x V2 = (C0/100) x Vb V2 = (C0/100) x Vb (C0/10) V2 = Vb/10 C0 x V1 = (C0/10) x Va V1 = (C0/10) x Va C0 V1 = Va/10 Example You want to do a 1/5 serial dilution of a 2 mM solution of compound A. 130 . You decide to do 3 dilutions in a 1ml volume. What will be the final concentration of compound A in each dilution? What will be the values of V1.

2 mL 131 .016 mM Value of Va. Vb .08 mM 3rd dilution: C0/125 = 0.Appendix D: Calculations 2011 1:5 1:5 1:5 V1 V2 V3 Va Vb Vc STOCK: 2mM C0/100 C0/5 C0/25 C0/125 If C0 = 2mM and Va.2 mL 3rddilution: (C0/25) x V2 = (C0/125) x Vc V2 = (2 mM/125) x 1mL (2 mM/25) V2 = (2 mM/125) x 1mL (2 mM/25) V2 = 1 mL/5 V2 = 0.2 mL 2nd dilution: (C0/5) x V2 = (C0/25) x Vb V2 = (2 mM/25) x 1mL (2 mM/5) V2 = (2 mM/25) x 1mL (2 mM/5) V2 = 1 mL/5 V2 = 0.4 mM 2nd dilution: C0/25 = 0. Vb and Vc: 1st dilution: C0 x V1 = (C0/5) x Va V1 = (2 mM/5) x 1 mL 2 mM V1 = (2 mM/5) x 1 mL 2 mM V1 = 1 mL/5 V1 = 0. Vc = 1mL: CCCCCCCCC CC Concentration of your three dilutions shouldCbe: Stock solution: 2 mM 1st dilution: C0/5 = 0.

The absorbance intensity is related to the concentration by the Beer-Lambert law: Where A is the absorbance at a specific wavelength.Appendix D: Calculations 2011 Appendix D2 The Beer-Lambert law A UV-visible spectrum is a plot of the amount of light absorbed by a molecule versus the wavelength of the incident light in the range of 180 to 800 nm. It is the transmitted intensity. With many instruments. respectively. such as phenylalanine. It is important to note that the absorption properties of most molecules can be affected by pH. Usually bands in the region of 200-340 nm (UV) are indicative of π electrons (aromatic groups or double bonds). The C=O of the peptide bond absorbs strongly between 190 nm and 220 nm. Proteins absorb light strongly in two different regions of the UV spectrum. c is the concentration of compound and l is the path length of the cell (cuvette). For example. The number. readings of absorbance above 2 are not reliable since the light reaching the detector approaches its sensitivity limit. temperature etc. Io is the intensity of incident light. The Beer-Lambert equation is an analytical tool used very often to measure the concentration of biochemicals in solution. tyrosine. Any spectrophotometer shows optimal precision (minimal relative error) when the absorbance is 0. thus the real value of the absorbance is underestimated. ε is the absorption coefficient at the specified wavelength. and tryptophan absorb strongly around 280 nm. Experiment standards (of known concentrations of a specific compound) are often used to measure the concentration of an experimental solution containing the same compound. whereas bands in the region 340-800 nm (visible) are representative of multiple double-bond conjugation. The purine and pyrimidine bases of DNA and RNA absorb strongly around 260 nm. The concentrations of protein and DNA in solution are often estimated from the A280 and A260 of the solution. solvent polarity. A given band in a spectrum is characterized by the wavelength at which the absorbance intensity is a maximum (λmax) and by the intensity of the absorbed light. Also. These changes are due to alterations in the protonation state of the tyrosine hydroxyl group.434. both the εmax and λmax for tyrosine change substantially depending on the pH of the solution. This could be achieved by doing the following transformation on the Beer-Lambert law: 132 . Aromatic side chains. position and relative intensity of bands is characteristic of each molecule and can be used for the identification of compounds. the relative contribution of stray light (light with a different λ from the one being measured) increases at high absorbance.

Appendix D: Calculations 2011 Since the  is the same for the standard and the unknown (we are measuring the absorbance of the same specific compound). you can determine the concentration of your solution of unknown concentration by using its absorbance: 133 . if you have the concentration of the standard solution (cStandard) as well as its absorbance (AStandard). we can further transform our Beer-Lambert equation: Therefore.

but in most occasions you should have an idea of what you are supposed to get at the end of the procedure (in theory). you will get a negative percentage of error value. 134 . Example: You have to purify 2 g of DNA using a purification procedure. Sometime the theoretical value will be given to you. this information should be in your lab notebook). your theoretical value is 2 g. you got more than expected. you should get 2 g at the end of the purification. If you get a negative error value. it will be a loss of materials and therefore. you quantify your DNA and you found that you have 1 g. your experimental value is smaller than the theoretical value and therefore. Therefore. At the end of the procedure. you can determine easily the theoretical value: If everything works perfectly. you got less than expected. If your experimental value is higher than your theoretical value. In this formula (see below). it means that everything went well. You can now assume that 50% of the DNA was loss during the purification. the experimental value is the value that you experimentally got in the lab (if you kept a good record of your experimental results. You should notice that in almost all the percentage of error calculations you will be doing this semester. What is the percentage of error? First. The percentage of error can be useful to explain if your experiment was done properly or not.Appendix D: Calculations 2011 Appendix D3 Percentage of error. If you get a percentage of error close to 0%.

The mass of a DNA fragment can be calculated by multiplying the number of base pairs of this fragment by the average molecular weight of a nucleotide (660 Da): Now. In general. a ratio of 3:1 will be used as a starting point. To calculate the amount of DNA needed from each component (insert and vector). you can add the ratio (for example an insert to vector ratio of 10:1): or Example: You want to ligate 40 ng of vector with ratio of insert to vector of 8:1. if you want to do a 1:1 ratio of insert to vector: We can simplify the equation: or To this equation.Appendix D: Calculations 2011 Appendix D4 Molar ratios for ligations Calculation of the insert to vector molar ratio for a ligation is a critical step in a ligation procedure since it will have a major impact on the outcome of your ligation. how much insert should you add to the reaction? 135 . insert to vector molar ratios vary from 1:1 to 10:1. Typically. Assuming that the length of your vector and insert are respectively 4000 bp and 1000 bp. you need to know the length of your insert and vector as well as the quantity of vector you are planning to use for your ligation.

A poor preparation will be about ~10 4 / g or less. Knowing that you only plated 1/10 of your transformed bacteria. Therefore. you will get many colonies when you transform a plasmid of known concentration. If your preparation of competent cells is poor. you have to multiply by the dilution factor (10x). Here is an example calculating the level of competency of preparation of competent bacteria: You did a transformation with your new stock of competent cells.Appendix D: Calculations 2011 Appendix D5 Bacterial competency In order to prepare bacteria to take foreign DNA (e. what is the level of competency of your bacterial stock? With 10 ng.g. we need to make them “competent” (see Introduction of lab #3). coli colonies are successfully transformed per microgram of plasmid DNA used in the transformation. plasmid). If your preparation of competent cells is good. you get 100 colonies but this is only 1/10 of the transformation and therefore. The competency of a stock of competent cells can be determined by calculating how many E. Competent cells prepared using a chemical method (CaCl2 method) should give ~105-107 colonies per g of plasmid DNA transformed. This procedure makes the cells “competent” but also renders them more fragile. you will not get many colonies after transformation. A good practice would be to evaluate the “competency” of your competent cells. 100 colonies X 10 (dilution factor) for 10 ng 1000 colonies for 10ng or 100000 colonies for 1 g or 105 colonies/g 136 . You used 10 ng of plasmid and you got 100 colonies on your petri dish. many of them will die during the subsequent transformation procedures and the rest of them won’t take up any DNA.

but not tightened. prepare 1 liter of 1X TAE buffer using the 25X stock solution available. 7. Microwave until the agarose is completely dissolved in 3 x 30 sec pulses.3-diol)  28. If necessary.0)  Add H2O up to 1000 mL 137 . To prevent evaporation. Pouring a little buffer on the surface of the gel around the comb can help. Do not allow the agarose to boil over! 5. 9. 2. remove the comb carefully. 10. Dislodge any bubbles.Appendix E: Techniques 2011 Appendix E1 1% Agarose gel casting 1. Tightening the lid could lead to pressure buildup into the bottle during heating and possible explosion. 3. For 1 litre of 25X TAE buffer  121g Tris base (2-amino-2-hydroxymethyl-propane-1. 8. Write down your name and the preparation date on the flask. 4. Add 10 L of the 10000X stock SYBR Safe per 100 mL of gel. Once the gel has hardened. In a 500 mL Kimax flat bottle (see figure) prepare 100 mL of 1% (weight/volume) agarose in 1X TAE buffer.5M Na2EDTA (pH 8. the plastic lid should be loosely added mto the bottle. hardened and translucent) in about 30 min. Transfer the gel into the electrophoresis tank and add 1X TAE buffer up to 5mm above the gel upper surface – the gel should be completed covered. Allow the agarose solution to cool down to 50-55˚C (if the agarose is too hot it will warp the gel mold).6 mL glacial acetic acid  50 mL 0. The gel should be ready (cooled. Pour the agarose solution slowly into a casting tray fitted with a 20-well comb. 6.

e the amount of DNA in the 10000bp marker. One can estimate the length of the unknown on the gel at the top right by substituting its mobility.Appendix E: Techniques 2011 Appendix E2 Quantitative DNA Ladder and estimation of length and amount of DNA bands A quantitative DNA ladder contains known amounts of DNA molecules of different lengths. The graph shows that a linear regression between log(length) vs mobility has a high fit (r2=0. Amount of an unknown The intensity of a band is directly related with the number of SYBR Safe molecules bound onto the DNA and therefore. A visual estimate of the intensity of the unknown band indicates that it is roughly the same as the 10000bp marker.921 and a length value of 833bp.8. the number of bp or amount of DNA. Length of an unknown The mobility of the unknown in the gel picture above is ≈ 13. The information below shows how one can derive an equation describing the log(length) vs mobility for the markers. in the regression equation.8. which is ≈13. i. 138 . This gives a log(length) equal to 2.997). and then use this equation to predict the length of an unknown. It is applied to an agarose gel as a reference to estimate the size and mass of an unknown DNA band by comparison. Its amount can therefore be estimated as 100ng.

therefore. Place the column in a clean 1. Discard flow-through and return the column to the collection tube. Clean your DNA from impurities. 8. add 50 L of water directly onto the center of the membrane. Discard the column and keep the 1. Add 500 L of Membrane Wash Solution and centrifuge for 5 min to completely eliminate residual ethanol contained in the Wash buffer. Apply your sample to the SV Minicolumn and incubate 60 sec at RT. being careful not to wet the bottom of the column with the flowthrough. Combine your DNA sample with 1 volume of Membrane binding Solution and mix thoroughly. 5. (careful not to touch the membrane with the tip of the pipette) incubate at RT for 1 min (this step is really important to permit the complete desorption and resolubilization of your DNA). 9. lower the amount of DNA that can be eluted. 7. Place a SV Minicolumn in a 2 mL collection tube. 139 . 3.5 mL micro centrifuge tube. Centrifuge again for 1 min to evaporate any Ethanol residue on the column.5 mL microcentrifuge tube containing your purified DNA. and then centrifuge for 1 min at 13 000rpm to elute your DNA. Discard flow-through and place the column back in the same tube. Discard the flowthrough and return the column to the collection tube. Your DNA is now attached to the silica column. Centrifuge 60 sec at 13 000rpm. It is crucial to eliminate residual ethanol left inside the column since it will prevent or lower the solubilization of DNA in water and. 2. add 700 L of Membrane Wash Solution to the column and centrifuge for 1min at 13 000rpm.Appendix E: Techniques 2011 Appendix E3 DNA purification by affinity chromatography (Promega Wizard PCR Clean-up system) 1. 4. 6.

and make decisions that make sense based on available information. you will be using his-tag affinity chromatography to purify your recombinant T7 RNA polymerase Amplicon  Amplicons “… are pieces of DNA formed as the products of natural or artificial amplification events.” (Wikipedia) Bacterial transformation  “A genetics lab procedure where bacteria are induced to accept and incorporate into their genome foreign pieces of cell-less. and solve complex problems and concepts. enzyme and substrate. or receptor and ligand.” (Wikipedia)  In the context of BCH3356. often in the form of a plasmid.” (Wikipedia)  In the context of BCH3356.” (BioScience Dictionnary) Base-calling  A computer-based analytical algorithm used to identify the nucleotide bases corresponding to the peaks within a fluorescence trace recorded by the detector of a DNA sequencer 140 . (annealing) means for DNA or RNA to pair by hydrogen bonds to a complementary sequence. The DNA to be introduced usually contains a selectable marker so that the bacteria which successfully incorporate the DNA can be selected for. The term is also often used to describe the reformation (renaturation) of complementary strands that were separated by heat (thermally denatured). forming a double-stranded polynucleotide. isolated DNA. articulate.Glossary 2011 Glossary Affinity chromatography  “… is a method of separating biochemical mixtures. based on a highly specific biological interaction such as that between antigen and antibody.” (Wikipedia)  In BCH3356. The term is often used to describe the binding of a … primer to a DNA strand during a polymerase chain reaction. an amplicon will specifically refer to the amplification product obtained from a PCR reaction (an amplicon is assumed to be the same as a PCR product) Analytical skills  “The ability to visualize. the concept of analytical skills refers to the capacity to critically and thoroughly analyze and interpret experimental results: statements and conclusions should specifically refer to and be consistent with the experimental results! Annealing  “In genetics.

usually a plasmid or viral DNA chromosome into which foreign DNA is inserted in the process of cloning genes or other DNA sequences of interest. but the specific meaning for the BLAST-based alignment approach is beyond the scope of BCH3356 Cloning   Broadly speaking.  Several terms are used in the scientific literature for referring to a cloning vector. 141 .” (BioBasics Biotech Canada)  Important features of a cloning vector include the capacity to integrate and carry a foreign DNA fragment into a host cell. self-replicating DNA molecule . Negative controls confirm that the procedure is not observing an unrelated effect (therefore minimizing false positives). Positive controls are controls confirm that the procedure is effective in observing the effect (therefore minimizing false negatives). Competency  The ability of a cell to take up extracellular or naked DNA from its environment. cloning refers to the action of generating multiple copies of something. Cloning vector  “A small.  BLAST stands for Basic Local Alignment Search Tool. cloning will refer to molecular cloning that is the procedure of isolating a defined DNA sequence and obtaining multiple copies of it in vivo. expression vector. including plasmid vector. (Wikipedia) Control treatment  Experimental controls are intended to minimize artefacts  “The simplest forms of controls are positive and negative controls. cloning expression vector and vector. It can carry inserted DNA and be perpetuated in a host cell. In the context of BCH3356. and then to self-replicate once it has been inserted within a cell.” (Wikipedia) Electropherogram  A plot of results from an analysis done by electrophoresis  In the context of DNA sequencing.  In BCH3356 your will be using the plasmid vector. an electropherogram shows a trace of fluorescence recorded at the output of the capillary electrophoresis unit (see example below).  For the purpose of BCH3356.Glossary 2011 BLAST alignment  A computer-based analytical algorithm used to compare and align primary sequences of amino acids (proteins) or nucleotides (DNA or RNA). the concept of competency will specifically refer to the artificially induced competency “… that arises when cells in laboratory cultures are treated to make them transiently permeable to DNA”. pTrcHisB (the p at the front indicates that it is a plasmid vector).

Recombinant plasmid (vector)  A plasmid into which an exogenous DNA had been inserted in vitro by ligation 142 . but only two between A and T. handle and troubleshoot laboratory equipments (the know how skills)  Require basic knowledge about underlying principles of executed task Melting temperature  “… is the midpoint of the temperature at which 1/2 of the DNA molecules are denatured and 1/2 are annealed.” (Wikipedia)  In molecular biology.” (FAO Biotechnology Glossary) Quantitative DNA ladder  Set of usually equimolar DNA markers allowing estimation of length and amount of DNA fragments analyzed by gel electrophoresis.” (FAO Biotechnology Glossary) Plasmid vector  A special type of cloning vector in which the ‘carrier’ is a circular plasmid Primer  “A short DNA or RNA fragment annealed to a template of single-stranded DNA. recombinant DNA refers to DNA that has been engineered in vitro. The Tm is characteristic of each DNA species and gives an indication of its base composition. and therefore differs from in vivo genetic recombination. providing a 3´ hydroxyl end from which DNA polymerase extends a new DNA strand to produce a duplex molecule.Glossary 2011 Hands-on skills  Expertise or experimental knowledge exercised in the performance of some task  Capabilities to effectively execute laboratory procedures  Capabilities to effectively use.” (Baylor College of Medicine)  “The temperature at which a double-stranded DNA or RNA molecule denatures into separate single strands. DNAs rich in G:C base pairs are more resistant to thermal denaturation than A:T rich DNA since three hydrogen bonds are formed between G and C. which is created by combining DNA sequences that would not normally occur together.  The Alpha Quant 1 quantitative DNA ladder is used in BCH3356 (see Appendix E2) Recombinant DNA  “… is a form of DNA that does not exist naturally.

the gene coding for T7 RNA polymerase is subcloned from an unknown parent vector into pTrcHisB Western analysis  “A procedure in which proteins separated by electrophoresis in polyacrylamide gels are transferred (blotted) onto nitrocellulose or nylon membranes and identified by specific complexing with antibodies that are … tagged with a labelled secondary protein.” (Nexxus Glossary of Life Sciences)  “…a technique used to move a particular gene of interest from a parent vector to a destination vector” to better suit the requirements of a specific application or experimental context  In BCH3356.Glossary 2011  In BCH3356.” (MondoFacto dictionnary) 143 . the his-tagged T7 RNA polymerase to be expressed and purified is a recombinant protein Sensitivity  The lower significant signal (should be above background signal) that can be detected through an experimental procedure  For example. enzymes usually exhibit a fairly high substrate specificity (only the proper substrate can bind and trigger enzyme catalysis) Subcloning  “The … transfer of of a cloned fragment of DNA from one vector to another. the DNA fragment coding for T7 RNA polymerase was inserted into pTrcHisB to form the recombinant plasmid pTrcHisB/T7 Recombinant protein  A protein whose amino acid sequence is encoded by a recombinant DNA  In BCH3356. the sensitivity of the agarose gel procedure used as described in the BCH3356 Lab Manual is in the range of 5-20ng Specificity  The discrimination capacity of a test or procedure to detect a given signal  For example.

Master your semester with Scribd & The New York Times

Special offer for students: Only $4.99/month.

Master your semester with Scribd & The New York Times

Cancel anytime.