Grupo de Investigaciones Mellitopalinologicas y Propiedades Fisicoquímicas de Alimentos

FUNDAMENTOS DE LA REACCION EN CADENA DE POLIMERASA  `PCR´ FUNDAMENTOS DE LA REACCION EN CADENA DE POLIMERASA  `PCR´ Y SU APLICACIÓN EN ALIMENTOS

Mónica Patricia Osorio Tangarife 30 de Abril de 2009 Ibagué Tolima Ibagué Tolima
Universidad del Tolima

Grupo de Investigaciones Mellitopalinologicas y Propiedades Fisicoquímicas de Alimentos

Es un tipo de ácido nucleico una macromolécula que forma parte de nucleico, todas las células. Contiene la información genética usada en el desarrollo y el funcionamiento de los organismos vivos conocidos, siendo el responsable de la herencia de las características genotípicas.

ADN

el ADN es un polinucleótido constituidos por d‐AMP, d‐GMP, d‐CMP, d‐TMP. Esta formado por un nucleótido y a su vez, está formado por p , p un azúcar, una base nitrogenada y un grupo fosfato que actúa como enganche de cada nucleótido con el siguiente.

Universidad del Tolima

Grupo de Investigaciones Mellitopalinologicas y Propiedades Fisicoquímicas de Alimentos Ácidos nucleídos Ácidos nucleídos 3´ Fosfato Moni Di Tri Ribosa Desoxiribosa 5` Composición  estructural Azucares  Bases nitrogenadas Purinas: A ‐ G Pirimidinas: U ‐ T ‐ C  Adenina Purinas Guanina Timina  (ADN) Citosina Uracilo  (RNA) Universidad del Tolima Pirimidinas .

 d‐GMP.    Universidad del Tolima Estructura primaria . d‐TMP.  d‐CMP.Grupo de Investigaciones Mellitopalinologicas y Propiedades Fisicoquímicas de Alimentos ADN Polinucleótidos constituidos por d‐AMP.

• Constituido por única cadena sin estructura superior. J. Masa molecular elevada. Miller. 2000.Grupo de Investigaciones Mellitopalinologicas y Propiedades Fisicoquímicas de Alimentos ARN Polinucleótidos constituidos Ribosa. Gelbart... W. No forma dobles cadenas. • Determina el orden en que se unirán los aminoácidos.. Griffiths. Universidad del Tolima . • Se sintetiza en el núcleo celular y pasa al i i l ú l l l l citoplasma. A diferencia de ADN reemplaza la Timina por Uracilo. A. RNAm • Contiene información genética del ADN. R. Lewontin. para utilizarla en la síntesis de proteínas.

g p g p . su utilidad es que. tras la amplificación. resulta mucho más fácil identificar con una muy alta probabilidad microorganismos en alimentos alimentos.Grupo de Investigaciones Mellitopalinologicas y Propiedades Fisicoquímicas de Alimentos Reacción en Cadena de la Polimerasa Reacción en Cadena de la Polimerasa Técnica de biología molecular descrita en 1985 por Kary Mullis. Universidad del Tolima . cuyo objetivo es obtener un gran número de copias de un fragmento de ADN particular. partiendo de un mínimo Amplifica un fragmento de ADN.

• Resultado es la duplicación del número de moléculas de una secuencia concreta de ADN. consiguiendo un aumento o amplificación exponencial de copias del fragmento de ADN molde. se obtendrá 230 moléculas idénticas (1`073. • Si se parte de una molécula única de ADN en la muestra inicial y en cada ciclo se duplica el numero de moléculas. • El proceso se repite un número determinado de veces (30). Universidad del Tolima . mediante la acción de la ADN Polimerasa. al final de los 30 ciclos.824 moléculas).Grupo de Investigaciones Mellitopalinologicas y Propiedades Fisicoquímicas de Alimentos Fundamentos de PCR F d d PCR • Técnica que permite la copia In vitro de secuencias especificas de ADN ADN.741. • Consiste en la separación por calor de las dos cadenas de ADN que se desea amplificar y su copia simultanea a partir de un punto determinado por un fragmento de ADN artificial llamada cebador.

Alta sensibilidad Alta sensibilidad Alta especificidad Amplifica únicamente el fragmento de ADN que se desea aunque esté en bajas cantidades o en presencia de altas cantidades de ADN semejantes La reacción es eficaz si se parte de una muestra poco purificada. en presencia de otros componentes Fragmento Klenow PM: 68 KDa El mayor de los dos fragmentos que se produce en la ruptura proteolítica con subtilisina (serina endopeptidasa) de la DNA polimerasa I de E coli Retiene la E. 5’→ 3’ DNA polimerasa 5’→ 3’ DNA  5’→ 3’ DNA polimerasa 3’→ 5’ exonucleasa 3’→ 5’ exonucleasa ADN Polimerasa I Holoenzima Proteólisis ADN Polimerasa 5´ → 3´ Fragmento Klenow Fragmento Klenow Exonucleasa 3´ → 5´ Exonucleasa 5´ → 3´ Universidad del Tolima 5´ → 3´ Exonucleasa . posee actividad 3´ → 5' exonucleasa. utilizando ADN polimerasa del fragmento Klenow de la ADN polimerasa I de E. pero carece de la actividad 5‘ → 3' exonucleasa que se encuentra normalmente en la DNA polimerasa I de E. coli. coli. actividad de 5´→ 3´ polimerasa.Grupo de Investigaciones Mellitopalinologicas y Propiedades Fisicoquímicas de Alimentos Fundamentos de PCR Desarrollada por Kally Mullis en 1985. coli.

 C. TWEEN 20. KCl… Termociclador: Permite realizar ciclos de temperatura necesarios para l amplificación d la lifi ió de ADN Existen otras tecnologías menos populares utilizando distribución de aire caliente en tubos suspendidos.Grupo de Investigaciones Mellitopalinologicas y Propiedades Fisicoquímicas de Alimentos Fundamentos de PCR Que se necesita Mg++ Primers Pi ADN polimerasa Cadena de ADN molde Nucleótidos: dNTPs (A. logrando el mismo objetivo de transferir calor p q p eficientemente a la reacción para que cambien los ciclos de temperaturas Universidad del Tolima . G. T) Buffer de la reacción: TRIS‐HCl.

 GTATGTAACAGACGGCCAGT 1 GTATGTAACAGACGGCCAGT 2. ACCTCGCGGGGGATCGCGAA 2.5 µM Tamaño recomendado  de 20 a 30 pb Tamaño recomendado de 20 a 30 pb Evitar C  y G  en el extremo 3´ No largas secuencias de una sola base Evitar complementariedad entre cada uno y entre varios Extensión del primer La ADN polimerasa realiza extensión del primer  usando la cadena complementaria como molde ADN Polimerasa ADN Polimerasa 3 5 dNTPs 5 Universidad del Tolima +   Mg  ++ 3 3 5 . ACCAGCTATGACCATGATGA NO  5 5´ 3 3´ 1.Grupo de Investigaciones Mellitopalinologicas y Propiedades Fisicoquímicas de Alimentos Elección de los primers Elección de los primers SI  5´ 3´ 1.1 a 0. TTCGCCCCATCGCCTTCGC Contengan C y G ∼ Contengan C y G 50% Concentración de 0.

 coli • Fragmento Klenow de ADN polimerasa • T4 ADN polimerasa • Actividad exonucleásica 3´→ 5´ Termoestables • Temp. Universidad del Tolima . Se añade igual cantidad para dNTPs en la mínima concentración posible.Grupo de Investigaciones Mellitopalinologicas y Propiedades Fisicoquímicas de Alimentos ADN polimerasas Termolábiles • Temp. óptima de actuación a 72‐74ºC • Taq ADN polimerasa ADN polimerasa • Tth polimerasa • No poseen actividad exonucleásica Taq polimerasa Aumenta la fidelidad:   p No posee actividad exonucleásicas. No se añaden cantidades excesivas de Mg++. óptima de actuación a 42ºC • ADN polimerasa I de E coli ADN polimerasa I de E.

Contribuye a aumentar la temperatura de hibridación [Mg++]: Disminuye la especificidad Universidad del Tolima [Mg++]: Aumenta la especificidad . Gelatina. dGTP. PEG… Mg++ La concentración es fundamental para la optimización de la reacción. dependiendo de las casas comerciales: KCl . dTTP.  BSA.  • Se recomienda una concentración de 20 a 200 µM de cada uno Se recomienda una concentración de 20 a 200 µM de cada uno  • La concentración debe ser similar entre cada uno de ellos y se debe relacionar con la Mg++. DMSO. Detergentes: Tritón. La concentración es fundamental para la optimización de la reacción.Grupo de Investigaciones Mellitopalinologicas y Propiedades Fisicoquímicas de Alimentos dNTPs dNTP • dATP. dCTP. TRIS‐HCl. Buffer de la reacción Composición distinta. dependiendo de las casas comerciales: Composición distinta.

Grupo de Investigaciones Mellitopalinologicas y Propiedades PCR Fisicoquímicas de Alimentos El termociclador Perkin Elmer Cetus: • Permite la programación flexible de la temperatura • Rápido calentamiento y enfriamiento paso a paso para resultados consistentes. • Rango de temperatura de 0‐99°C • Bloque de aluminio para 48 tubos de reacción de 0 5 ml 0. Universidad del Tolima .5 ml.

Grupo de Investigaciones Mellitopalinologicas y Propiedades Fisicoquímicas de Alimentos Desnaturación Universidad del Tolima .

 10 mM TRIS‐HCl. 3 mM MgCl2. dGTP y dTTF 10 – 20 pmol de primer (cada uno 0.25 unidades de Taq polimerasa Reacción de la mezcla R ió d l l 1 X buffer de PCR (50 mM KCl.2 mM) 0.625 a 1.Grupo de Investigaciones Mellitopalinologicas y Propiedades PCR Fisicoquímicas de Alimentos dATP. pH 9 a 25ºC)  MgCl2 pH 9 a 25ºC) Cadena de ADN molde o  plantilla l ill Volumen final de  25 µl o 50 µl Superpone con una  gota de aceite mineral  Cada ciclo de PCR consiste  Denaturacion a 94ºC por 30´´ Hibridación a 60ºC (para H1 y H2 55ºC) por 30´´ Amplificación  a 72ºC por 1´ Muestras de tamaño normal: 35 ciclos Muestras de tamaño de biopsia: 40 ciclos Universidad del Tolima . dCTP.

Esto lleva a una serie de DESVENTAJAS: No detectar en que fase de la cadena de recepción y/o producción se produce la contaminación microbiológica o fisicoquímica del alimentos Se requiere un muestreo estadísticamente significativo lo que supone la recogida de un importante numero de muestras con limitaciones económicas y temporales que ello supone. La inspección visual y el análisis microbiológico del Producto final. debe desecharse T d el L t con l consiguiente d h Todo l Lote.Grupo de Investigaciones Mellitopalinologicas y Propiedades Fisicoquímicas de Alimentos Los métodos tradicionales de Control de calidad en las empresas alimentarias se basan en dos únicos procesos. la i i t Universidad del Tolima pérdida financiera . ll En el caso de detectarse una anomalía.

lo que supone una mala imagen para la empresa y el peligro potencial de que el consumidor desconfíe de esa casa comercial en el futuro.Grupo de Investigaciones Mellitopalinologicas y Propiedades Fisicoquímicas de Alimentos En muchos casos la industria tiene conocimiento de los problemas cuando el producto ya se halla en el mercado. Las técnicas de PCR son rápidas para la detección de microorganismos en alimentos. Se caracterizan por su: •Especificidad •Sensibilidad ibilid d •Corto tiempo de análisis •Capacidad de inclusión en sistemas integrados •Sencillez S ill Universidad del Tolima •Integración en sistemas HACCP .

Grupo de Investigaciones Mellitopalinologicas y Propiedades Fisicoquímicas de Alimentos Universidad del Tolima .

Grupo de Investigaciones Mellitopalinologicas y Propiedades Fisicoquímicas de Alimentos Universidad del Tolima .

Grupo de Investigaciones Mellitopalinologicas y Propiedades Fisicoquímicas de Alimentos Universidad del Tolima .

Grupo de Investigaciones Mellitopalinologicas y Propiedades Fisicoquímicas de Alimentos Universidad del Tolima .

Exp. Journal Histochemistry and cytochemistry. A.. A.aebm. Improved PCR method for detecting monoclonal inmunoglobulin heavy chain rearrangement in B cell neoplasm.org/jornadas/guadalajara/EXTRACCI%D3N%20DE%20DNA%20Y%20 PCR. Conceptos generales de biologia molecular . Boylston. . Tomado de http://www. Brisco. cytochemistry Vol 41 No 5 41. S.pdf PCR pdf • Shibata. Trainor. 43: 888‐890. P. Tissue extraction of DNA and RNA and analysis by the polymerase chain reactions. J. Morley. 2007. Universidad del Tolima . 1990. I. J. Martin. W.. F.. B. Arnheim. Brisco. Detection of human papilloma virus in paraffin‐embedded tissue using the polymerase chain reaction. N.. 1988. D. Taylor. A. 1990. 45:770‐775.. G. K. Abril.. 1992. O.. • Ramasamy. Rapid preparation of tissue DNA from paraffin‐embedded blocks and analysis by polymerase chain reactions. G. J. Clejan.. P. R.. Med.REFERENCIAS Grupo de Investigaciones Mellitopalinologicas y Propiedades Fisicoquímicas de Alimentos • Wan.. H. • Chen. Quirke. 1993. Morley. A. • Jackson. Clin Pathol. J. k. No. M. 167: 225‐230. Clin Pathol. Monoclonality in B cell lymphoma detectec in paraffin wax embedded sections using the polimerase chain reaction. M. Extracción de DNA y reacción en cadena de polimerasa (PCR). W. 43: 499‐ 504. Lewis. A. d. • Redondo.. 5.

J. A 890 159–166. Application of magnetite and silica–magnetite composites to the isolation of genomic DNA. C. Greene. Russell.  Universidad del Tolima . Manual.H.. g . D W Russell 2001 Molecular Cloning: a Laboratory Manual third J. Microbiol. p ribosomal DNA with polymerase chain reaction. 28 1942–1946. Biotechnol. Bacteriología clínica. Wu. D.I. •C. Chen..D.. Premio de la  g British Medical Association. Yoza. NY. Hsu. Davies.J. Chiang. J. J. Matsumoto.. N. M. Chromatogr. C. Taylor. 2005. DNA extraction using modified bacterial magnetic particles in the presence of amino silane compound. Bruce.. •K. •B.. T.W. Biotechnol 94 2002) 217 224 217–224. I. •J. Application of super paramagnetic nanoparticles in purification of plasmid DNA from bacterial cells J cells. R. M. 2000. Ed. 2002. Westran. Hurst.L. C.Y. Sung. Cold Spring Harbor Laboratory Press. Masson.C.. Chromatogr. J... Matsunaga.B.. T.. Struthers. Clin. Wilson.. 1990. R. Cold Spring Harbor. R. Amplification of bacterial 16S . B 822 54–60.. •J Sambrook .F.S. Sachsinger. J. 2001.. C.. 2001.Referencias Grupo de Investigaciones Mellitopalinologicas y Propiedades Fisicoquímicas de Alimentos •J. Blitchington. ed. Sambrook.Y.

Sign up to vote on this title
UsefulNot useful