INACTIVACIÓN DE P53 Y AMPLIFICACIÓN DE LA CICLINA D1 EN LOS CARCINOMAS EPIDERMOIDES DE CABEZA Y CUELLO

J. P. RODRIGO TAPIA1,2, M. V. GONZÁLEZ MEANA2, L. A. G ARCÍA GONZÁLEZ1, E. COTO3, J. GARCÍA PEDRERO2, F. NÚÑEZ BATALLA1,2, C. SUÁREZ NIETO1,2
1

SERVICIO DE ORL, HOSPITAL CENTRAL DE ASTURIAS. 2INSTITUTO UNIVERSITARIO DE ONCOLOGÍA, UNIVERSIDAD

DE

OVIEDO. 3LABORATORIO DE GENÉTICA MOLECULAR. HOSPITAL CENTRAL DE ASTURIAS. OVIEDO. ASTURIAS. INACTIVATION OF P53 AND AMPLIFICATION OF CYCLIN D1 IN SQUAMOUS CELL CARCINOMAS OF THE HEAD AND NECK

RESUMEN
Correspondencia: Juan Pablo Rodrigo Tapia. C/ Fernández Ladreda, 32-A, 4ºB. 33011 Oviedo. E-mail: jrodrigot@seorl.org Fecha de recepción: 28-6-2001 Fecha de aceptación: 3-1-2002

INVESTIGACIÓN BÁSICA

L

os genes P53 y CCND1 (ciclina D1) juegan un papel clave en el control

del ciclo celular. Las anomalías de dichos genes son frecuentes en diversos tipos de cánceres, incluyendo los de cabeza y cuello. El objetivo de este estudio es investigar sí existe una relación entre la inactivación del gen P53 (determinada como pérdida de heterocigosidad) y la amplificación del gen CCND1 (determinada mediante PCR diferencial) y si dichas anomalías se correlacionan con el pronóstico en una serie de 56 carcinomas epidermoides de cabeza y cuello. Se halló pérdida de heterocigosidad del gen P53 en 39 casos (70%) y amplificación del gen CCND1 en 17 casos (30%). Ambas anomalías fueron encontradas conjuntamente en 11 casos (20%), no habiendo una relación significativa entre ellas (P=0,83). La inactivación de P53 no se asoció con ninguno de los parámetros clínicopatológicos analizados, ni con la evolución de los pacientes. La amplificación del CCND1 se relacionó con estadios T avanzados (P=0,02), con la presencia de metástasis ganglionares (P=0,01) y con una menor supervivencia (P=0,002). La combinación de ambas anomalías genéticas parece tener un patrón aditivo, pues se asoció con una mayor incidencia de recidivas tumorales y con una peor supervivencia que los casos con una sola de las alteraciones. En conclusión, las anomalías de los genes P53 y CCND1 son frecuentes en los carcinomas epidermoides de cabeza y cuello. Cuando se consideran conjuntamente son más informativas que cada una de ellas individualmente y podrían tener valor pronóstico en estos carcinomas.

P

53 and CCND1 (cyclin D1) genes play a critical role in the cell

Prognosis. P53.002). The aim of this work is to investigate whether P53 inactivation (determined by loss of heterozygosity analysis) is related to CCND1 gene amplification (determined by differential PCR analysis). Abnormalities of these genes are frequent in different types of cancers. nodal metastases (P=0. RODRIGO TAPIA ET AL. and if these alterations are correlated with clinical outcome in a series of 56 patients with squamous cell carcinoma of the head and neck. son particularmente atractivas. Loss of heterozygosity of the P53 gene was found in 39 cases (70%) and CCND1 amplification in 17 cases (30%). Ciclina D1. a pesar de los avances en el diagnóstico y el tratamiento. including those of the head and neck. como el P53 y la ciclina D1 (CCND1). In conclusion. debido a las variaciones en el comportamiento biológico de estos tumores. Nuestra capacidad para predecir el pronóstico de los pacientes con carcinoma epidermoide de cabeza y cuello es pobre. particularmente en el caso de los tumores avanzados. without a significant association between them (P=0. P. P53. No relationship was found between P53 inactivation. P53 and CCND1 abnormalities are frequent in squamous cell carcinomas of the head and neck. The combination of both abnormalities shows a pattern that seems to be additive. La inactivación del gen P53 es una de las más .83). since it was associated with an increase in tumor recurrences and a decrease in survival that was higher than for either of them individually. Cyclin D1. the clinico-pathological parameters analyzed and the clinical outcome. ABSTRACT PALABRAS CLAVE: Carcinoma epidermoide. Head and neck. Es por tanto necesario identificar nuevos marcadores (por ejemplo marcadores genéticos) que puedan distinguir estas diferencias de comportamiento biológico. Both abnormalities together were found in 11 cases (20%). las anomalías que afectan a los genes que participan en el control del ciclo celular. Cabeza y cuello.02). CCND1 amplification was associated with advanced T-stages (P=0. En este sentido. INACTIVACIÓN DE P53 Y AMPLIFICACIÓN DE LA CICLINA D1 226 Acta Otorrinolaringol Esp 2002. The combined analysis of these abnormalities seems to be more informative than either of them individually and may have a prognostic value in these carcinomas. 53: 225-232 INTRODUCCIÓN La supervivencia de los pacientes con carcinoma epidermoide de cabeza y cuello ha permanecido invariable en los últimos años.01) and a decreased survival (P=0. J.cycle regulation. Pronóstico. KEY WORDS: Squamous cell carcinoma.

La amplificación del gen CCND1 (aumento del número de copias). a pesar de la importancia biológica del gen P53. Dicha amplificación se ha asociado con una mayor agresividad tumoral y un peor pronóstico de la enfermedad5. Todos los pacientes fueron intervenidos . También se pretende determinar si dichas anomalías genéticas. juega un papel crucial en la progresión de lesiones preinvasivas a cáncer2. El gen CCND1 (PRAD1). solas o en combinación. y que ambas participan en la regulación del mismo punto del ciclo celular (la transición G1/S). En todos los casos se trataba de tumores primarios que no habían recibido tratamiento previamente. MATERIAL Y MÉTODOS Pacientes Se estudian 80 pacientes con carcinoma epidermoide de cabeza y cuello intervenidos entre 1992 y 1995. Dada la importancia que parecen tener estas anomalías genéticas en el desarrollo de los carcinomas epidermoides de cabeza y cuello. el significado pronóstico de su inactivación permanece por esclarecer debido a los resultados contradictorios que se hallan en la literatura (revisado por Blobe y Amrein1). es una anomalía frecuente en los carcinomas epidermoides de cabeza y cuello. una proteína que tiene un papel clave en la regulación del ciclo celular en la transición G1/S4. guardan relación con el pronóstico en nuestra serie de pacientes. El producto del gen P53 controla funciones esenciales de la célula relacionadas con el ciclo celular y la apoptosis3. codifica la ciclina D1. localizado en la región cromosómica 17p13. Este gen. con la consiguiente sobreproducción de la ciclina D1.6.frecuentes alteraciones genéticas en los carcinomas epidermoides de cabeza y cuello1. en este trabajo investigamos si existe relación entre la inactivación del gen P53 (determinada mediante análisis de pérdida de heterocigosidad o pérdida de la región cromosómica que contiene al gen) y la amplificación del gen CCND1. localizado en la región cromosómica 11q13. Sin embargo.

5 g . Todos los pacientes eran varones. y 74 además de alcohol. en cada reacción de PCR se emplearon simultáneamente dos pares de oligonucleótidos. Los controles positivos se obtuvieron mezclando ADN de tejidos normales con cantidades conocidas de un fragmento del gen CCND1 previamente amplificado por PCR. con una media de edad de 58. De esta manera se evitan los falsos positivos debidos a duplicaciones cromosómicas. Todos ellos. Como controles negativos se empleó ADN extraído de tejidos normales obtenidos en cirugía no oncológica (amígdalectomías de niños). excepto uno. Brevemente. En 46 casos se administró radioterapia postoperatoria (en general. Las mezclas de la PCR contenían 0.2-0.7 años (rango entre 38 y 83 años). se administró a los casos localmente avanzados y/o con metástasis ganglionares). manteniéndose a 4ºC hasta la extracción del ADN de los leucocitos. Simultáneamente se obtuvo sangre periférica del paciente. de manera que se podían simular diferentes grados de amplificación. Análisis de la amplificación del gen CCND1 (ciclina D1) El estudio de la amplificación del oncogen CCND1 se realizó mediante la PCR (reacción en cadena de la polimerasa) diferencial. Los pacientes fueron estadificados según la clasificación de la Unión Internacional Contra el Cáncer (4ª Edición). Obtención de las muestras y extracción del ADN Las muestras tumorales fueron obtenidas en el momento de la intervención quirúrgica. congeladas inmediatamente y conservadas a –70º C hasta su procesamiento. tal como se describió previamente6. uno para amplificar el gen a estudio (CCND1) y el otro para el gen de referencia.con intención curativa. localizado en el mismo cromosoma que el primero (en este caso se empleó el gen de la tirosinahidroxilasa). tenían antecedentes de consumo habitual de tabaco. y en todos ellos se obtuvieron márgenes quirúrgicos libres de neoplasia (se excluyeron previamente los que tuvieran márgenes afectos).

3. 10 mM Tris-HCl pH 8. 1 M de cada cebador. 50 mM KCl.5 mM MgCl2. 0. amplificando un fragmento de 188 bp. y elongación a 75°C). anillamiento a 55°C. del inglés Loss Of Heterozygosity) del gen P53 fueron estudiadas mediante el análisis de marcadores microsatélites (un dinucleótido y una repetición en tandem variable –VTR–) intragénicos al locus P53. Los cebadores para el gen CCND1 fueron 5’-CGTACCCCGATGCCAACC y 5’-ATGGACGGCAGGACCTCC. 10 mM TrisHCl pH 8. Los cebadores fueron obtenidos de MWG-Biotech.5 mM MgCl2. también tal como se describió previamente7. 10 pM de cada cebador. Las mezclas de la reacción contenían 50 ng del ADN a estudio. Los cebadores del gen de la tirosina-hidroxilasa fueron 5’-GCCCCAGCTGCATCCTAC y 5’CTTGGCAGACACCTGGGG.del ADN a estudio. Los ciclos de la PCR consistieron en 1 minuto a cada temperatura (desnaturalización a 94°C. . y 1 U de Taq polimerasa (Boehringer Mannheim) en un volumen total de 50 μl. Análisis de la pérdida de heterocigosidad del gen P53 Las pérdidas alélicas o pérdidas de heterocigosidad (LOH. y cuantificadas mediante técnicas de análisis de imagen (Kodak Digital Science. 10 l fueron sometidos a electroforesis en geles de Agarosa al 3%. 1. 1. y elongación a 72°C). 50 mM KCl. Los microsatélites fueron amplificados mediante PCR. De cada reacción de PCR. Los ciclos de la PCR consistieron en 1 minuto a cada temperatura (desnaturalización a 98°C.2 mM de cada dNTP. y 1 U de Taq polimerasa (Boehringer Mannheim) en un volumen total de 25 l. amplificando un fragmento de 121 pares de bases (bp). 200 M de cada dNTP (añadiendose dCTP marcado con 32 P). Las bandas correspondientes a los productos de la PCR fueron visualizadas por tinción con bromuro de etidio en un transiluminador de luz ultravioleta.3. Eastman Software). anillamiento a 56°C. por un total de 30 ciclos. y un ciclo final de 7 minutos a 72°C. fotografiadas con una cámara digital.

Los patrones autorradiográficos fueron analizados mediante densitometría. Ambas anomalías fueron halladas conjuntamente en 11 casos (20%). sólo 56 (70%) eran informativos para el gen P53 (heterocigotos para los polimorfismos analizados en la sangre).por un total de 30 ciclos. y un ciclo final de 7 minutos a 75°C. Los valores de P ≤ 0. y se consideró como pérdida de heterocigosidad una reducción en la señal de más del 80% en uno de los alelos de la muestra tumoral.0. Los cebadores del marcador P53-VTR fueron 5’ACTCCAGCCTGGGCAATAAGAGCT y 5’-ACAAAACATCCCCTACCAAACAGC. Estos 56 pacientes contituyen la población a estudio y sus características clínico-patológicas se muestran en la Tabla 1. Los geles fueron secados y autorradiografiados. No se encontró . Las curvas de supervivencia fueron calculadas con el método de Kaplan-Meier. Los productos de la PCR fueron separados mediante electroforesis en geles de poliacrilamida al 6%. En la Figura 1 se muestran ejemplos representativos de la detección de estas alteraciones.05 fueron considerados estadísticamente significativos. Las muertes que no fuesen debidas al tumor primario o sus metástasis no fueron consideradas fracaso del tratamiento. Se halló LOH del gen P53 en 39 de los 56 casos (70%). La amplificación del gen CCND1 se observó en el 30% de los casos (17/56). Los cebadores para el marcador dinucleótido (P53-AC/GT) fueron 5’-CGACTTTCCTCAACTCTACA y 5’-AACAGCTCCTTTAATGGCAG. RESULTADOS Alteraciones genéticas De los 80 pacientes inicialmente seleccionados. con la corrección de Yates cuando era preciso. Análisis estadístico Para el análisis estadístico se empleó el test de chi-cuadrado. siendo dichos casos censurados en el análisis de la supervivencia específica para la enfermedad. Los pacientes fueron seguidos un mínimo de 36 meses. Las diferencias entre las curvas de supervivencia fueron analizadas con el método logrank. con la ayuda del programa informático SPSS 8.

pero se puede apreciar que la amplificación aislada de la ciclina D1 se seguía asociando con estadios locales avanzados y la presencia de metástasis ganglionares (Tabla 3).83. regional o metástasis a distancia) durante el seguimiento. RODRIGO TAPIA ET AL. Los pacientes con ambas alteraciones simultáneamente presentaban tumores en estadios locales más avanzados y con mayor incidencia de metástasis ganglionares.5 meses para los pacientes vivos. Asociación de las alteraciones del P53 y el CCND1 con el curso clínico Nueve de los pacientes fallecieron por causas no relacionadas con el tumor o fueron perdidos.01). aunque se observó una mayor incidencia de amplificación en los tumores supraglóticos y en los de hipofaringe (Tabla 1).una asociación significativa entre ambas alteraciones (P=0.02) y con la presencia de metástasis ganglioACTA OTORRINOLARINGOLÓGICA ESPAÑOLA Acta Otorrinolaringol Esp 2002.5 meses para la población total. la presencia de metástasis ganglionares. 27 (57%) tuvieron recidiva tumoral (recidiva local. Los pacientes con una sola de las dos alteraciones tenían características intermedias. por lo que no se incluyeron en el análisis del curso clínico. Asociación de las alteraciones del P53 y el CCND1 con las características clínico-patológicas No se observó ninguna asociación entre la LOH del P53 y la localización del tumor. 53: 225-232 227 nares (P=0. el tamaño local del mismo. La amplificación del CCND1 se asoció estadísticamente con estadios locales avanzados (P=0. P. La frecuencia de recidivas tumorales no fue significativamente mayor en los casos con LOH del J. ni el grado histológico (Tabla 1). pero no con el grado histológico ni la localización del tumor. De los restantes 47 pacientes. y de 15 meses para los pacientes muertos por el tumor. de 41. Tabla 2). comparado con los pacientes que no mostraban ninguna de las dos alteraciones. INACTIVACIÓN DE P53 Y AMPLIFICACIÓN DE LA CICLINA D1 . El seguimiento medio fue de 24.

53 Moderadamente diferenciado 27 17 (63) 10 (37) Pobremente diferenciado 3 1 (33) 1 (33) Estadio de la enfermedad I-II 7 7 (100) 0.12 III 15 11 (73) 4 (27) IV 34 21 (61) 13 (38) * Test de Chi-cuadrado. no se apreció una asociación .228 Acta Otorrinolaringol Esp 2002.11 1 (6) 0. probablemente también por un insuficiente número de casos (Tabla 4). †Test de t de student P53 que en los casos sin ella (Tabla 4). aunque las diferencias tampoco fueron significativas. probablemente por el pequeño número de casos con amplificación.9a 0. como el estadio N (agrupando N0-N1 frente a N2-N3).25 0 0. aunque las diferencias no fueron significativas. El valor pronóstico de estas alteraciones genéticas parece menor que el de los parámetros clínico-patológicos clásicos. 53: 225-232 Tabla 1: Características clínico-patológicas de la población a estudio y la asociación de la pérdida de heterocigosidad (LOH) del P53 y la amplificación del CCND1 con estos parámetros Característica Total LOH de P* Amplificación de P* P53 (%) CCND1 (%) Edad media 58. Por el contrario la amplificación de la ciclina D1 (CCND1) sí se asoció con una mayor frecuencia de recidivas tumorales (Tabla 4). Los casos con ambas alteraciones mostraron la mayor frecuencia de recidivas tumorales.02 T3 18 12 (67) 2 (11) T4 24 17 (71) 12 (50) Estadio N N0 16 12 (75) 0.01 N+ 40 27 (68) 16 (40) N1 13 11 (85) 4 (31) N2 17 12 (71) 7 (41) N3 10 4 (40) 5 (50) Grado histológico Bien diferenciado 26 21 (81) 0.89† 57. el estadio de la enfermedad (agrupando los estadios I-III frente al estadio IV) y la localización tumoral (agrupando los casos de faringe frente a los de laringe) (Tabla 4).91 3 (25) 0. De forma similar.083 6 (23) 0.34 Supraglotis 14 10 (71) 6 (43) Glotis 10 7 (70) 1 (10) Hipofarínge 20 14 (70) 7 (35) Estadio T T1-T2 14 10 (71) 0.91† Localización Orofaringe 12 8 (67) 0.91 3 (21) 0.7a 59.1a 0.

Figura 2). siendo las diferencias significativas (log-rank P=0. DISCUSIÓN En el presente estudio hallamos una frecuencia de inactivación del gen P53 (estimada mediante la determinación de la pérdida de uno de los alelos del gen) y de amplificación del gen CCND1 concordantes con los estudios previos. y TH la tirosina-hidroxilasa. se aprecia (flecha) una disminución de la intensidad de la banda correspondiente a uno de los alelos en el tumor (T) comparado con la sangre (S). siendo los casos con LOH de P53 aislada los que tenían la mayor supervivencia (log-rank P=0. y pobre diferenciado 7 (64) 12 (43) 5 (83) 6 (55) * Test de Chi-cuadrado. P53 normal LOH de P53 Total CCND1 Normal (%) 11 (65) 28 (72) 39 CCND1 Amplificado (%) 6 (35) 11 (28) 17 Total 17 39 56 Tabla 2: Pérdida de heterocigosidad (LOH) del P53 y amplificación del CCND1 en los pacientes estudiados Figura 1. se ha descrito que aproximadamente el 50% de los carcinomas epidermoides de cabeza y cuello presentan pérdida alélica del P538-12. Mod: moderadamente. Así.25. Pobre: pobremente. C+ el control positivo. una y dos anomalías genéticas (P53 y/o CCND1) Característica Ninguna CCND1 CCND1 Las dos P* anomalía (%) normal/P53 anormal/P53 anomalías (%) anormal (%) normal (%) Estadio T T1-T3 8 (73) 19 (68) 2 (33) 3 (27) 0.002. (B) Autorradiografía de un caso con pérdida de heterocigosidad del gen P53 con el marcador VTR. N indica el control con tejido normal . (A) Electroforesis en gel de agarosa de los productos de la PCR diferencial de dos casos con amplificación del gen CCND1.09 N1-N3 7 (64) 17 (61) 6 (100) 10 (91) Grado histológico Bien diferenciado 4 (36) 16 (57) 1 (17) 5 (45) 0.27 Mod. 53: 225-232 229 Tabla 3: Características clínico-patológicas de los casos con ninguna.12-14.6. La supervivencia de los casos con ambas alteraciones fue inferior a la de los casos con ninguna o con una sola de las alteraciones. Figura 2). . y un tercio tienen amplificación del gen CCND15. ACTA OTORRINOLARINGOLÓGICA ESPAÑOLA Acta Otorrinolaringol Esp 2002. Figura 2).entre la LOH del P53 y la supervivencia específica de la enfermedad (log-rank P=0.006.05 T4 3 (27) 9 (32) 4 (67) 8 (73) Estadio N N0 (36) 4 (36) 11 (39) 0 1 (9) 0. Los casos con amplificación de la ciclina D1 sí mostraron una menor supervivencia que los casos sin amplificación.

no encuentran ninguna relación entre ambas alteraciones. de forma que la amplificación del CCND1 sería favorecida por la inestabilidad genética provocada por la inactivación del P53. P. 53: 225-232 Parámetro Número de Recidiva P* pacientes P53 Anormal 32 17 (53) 0. estadio N. La falta de correlación que hallamos en este estudio entre la inactivación del P53 y los parámetros clínico-patológicos analizados (estadio T. Mineta y cols. y concordante con la hipótesis de que la inactivación del P53 es un evento precoz en la carcinogénesis de cabeza y cuello1.15 hallan una asociación significativa entre la inactivación del gen P53 y la amplificación del gen CCND1. de acuerdo con nuestros resultados.57 Normal 15 10 (67) CCND1 Amplificado 16 12 (75) 0. INACTIVACIÓN DE P53 Y AMPLIFICACIÓN DE LA CICLINA D1 230 Acta Otorrinolaringol Esp 2002.003 IV 29 22 (76) Localización Faringe 24 18 (75) .Pocos estudios han analizado simultáneamente ambas alteraciones. localización) es común en los estudios previos9.12. La asociación entre la amplificación del J. RODRIGO TAPIA ET AL.15 No amplificado 31 15 (48) Anomalías de P53/CCND1 Ninguna anomalía 9 6 (67) 0.5) 0. Sin embargo. otros autores.16. siendo los resultados contradictorios.10. lo cual sugiere que las dos son igualmente importantes en la carcinogénesis de cabeza y cuello. grado histológico.12 T4 19 14 (74) Estadio N N0-N1 22 7 (32) 0. y suficientes para alterar el control del ciclo celular12.09 P53 anormal solo 22 8 (36) CCND1 anormal solo 6 4 (67) Ambas anomalías 10 8 (80) Estadio T T1-T3 28 14 (46. sugiriendo que la primera precedería a la segunda.002 N2-N3 25 20 (80) Estadio global I-III 18 5 (28) 0.

Curvas de supervivencia obtenidas según el método de Kaplan-Meier de: (A) los pacientes con y sin pérdida de heterocigosidad del gen P53. Lógicamente. y (C) los pacientes con ninguna. como en nuestro estudio. Esto sugiere que la amplificación de este gen es una alteración más tardía que la inactivación del P53. previamente deberemos profundizar en nuestro conocimiento sobre las alteraciones genéticas existentes. con múltiples alteraciones genéticas e interacciones entre productos de diferentes genes. (B) los pacientes con y sin amplificación del gen CCND1. En cuanto al valor pronóstico de estas alteraciones.12. La carcinogénesis es un proceso complejo. Por el contrario. muchos de los estudios que han analizado la amplificación de la ciclina D1 han hallado una asociación con tumores más agresivos y con una menor supervivencia5. El hecho de que la combinación de ambas alteraciones tenga mayor poder predictivo que cada una de ellas aisladamente es también concordante con otro estudio similar al nuestro12. su secuencia en la progresión tumoral.12.18. Por tanto. nuestros resultados nuevamente confirman lo previamente descrito. CCND1 y los tumores en estadios locales avanzados y con metástasis ganglionares también es concordante con los estudios previos14.028 * Test de Chi-cuadrado Tabla 4: Evolución de los pacientes según diferentes parámetros clínico-patológicos y las anomalías en P53 y CCND1 Figura 2.11. una de las dos. si queremos incrementar nuestra precisión pronóstica para cada individuo con cáncer probablemente deberemos analizar el patron de alteraciones genéticas de cada tumor más que una alteración concreta.Laringe 23 9 (39) 0.19. y con varios trabajos previos que muestran que la acumulación de varias alteraciones genéticas tiene un significado pronóstico negativo10. No es sorprendente que la combinación de varias alteraciones genéticas tenga mayor valor pronóstico que cada una de ellas aisladamente (incluso. en el caso de que alguna de ellas no tenga valor pronóstico por sí misma). o las dos anomalías.17. y . Ninguno de los estudios que han analizado las pérdidas alélicas del gen P53 han hallado una significación pronóstica a esta alteración9.10.

García Pedrero están financiadas por una ayuda al Instituto Universitario de Oncología de la Obra Social de CajAstur.V. nuestros resultados sugieren que el análisis combinado de los genes P53 y CCND1 puede tener un valor predictivo y ayudar a identificar a los pacientes con mayor riesgo de recidivas (los cuales tal vez podrían beneficiarse de un tratamiento más agresivo). Para que estos marcadores puedan aplicarse en la clínica deben confirmarse en estudios más amplios. incluyendo mayor número de pacientes en estadios iniciales de la enfermedad. M.las interacciones entre las diferentes alteraciones. AGRADECIMIENTOS Los autores quieren agradecer al Dr. Enrique F. Las Dras. Trabajo financiado por el FIS (ayudas a la investigación 97/1092 y 97/1062). En conclusión. . Bustillo su ayuda en el análisis estadístico. González Meana y J.

6:048.../ 4 7.907.203478:507.4333:3.8.7:5...../048.848./48..0850..4 5.478:507.94 .7 3480. 39:247.907..8/048..  0089.9.  01472.0203476:00/0485.. ..8 24897. :3.. 3/0..48 .4333:3.. 8.0310720/..848 /01...84883.43 /0!..9...251. 48 .43:3. ./../0...730  %.03.8/10703..8:507..7..8. /0!.7 209748.848.-./48 170390. 1.743 :3.3 .7:5./ ..03.82.5.7:5.03. 4 7.73485    %.3! :7.8:507.94O.84..8.251.730170390.43..84.4308 803/4 48.4240089.-.4.3/448089.  % % ## # _$!]  .3.848 ..4 5.J3../4 ./4 ' .8 4 7.848.4. 3 03970. 3  803/4.089.0310720/.J.2.3/4  170390..03.8 !.907J89.3! :7..3/448.70.43.43081:0310747.48/0.486:0903 .570.3 ! :7.. :3.8 03F9..48 .8831. /0./048.2-.8. 947734../4/0..848 .342.. 3.

3:3.8/48!  ...  3472..907J89.7..4  .342.J.

!.3472..

./009074.84.948 /0./4.       251./../../48.251.3 5 7//.748.907.251.:03.342..//0./4       %49.974147088030/0...2-.   0.47/.170..47708543/0390..4348089:/48570.J.3:3.//003!.203900 /048../4 4/24/07.7.  3472.O3/0...8.20390 !4-7054-7020390  !3472..97483.. 3/003     !4..435F7//../0!  :3907.7.48/.8 05/0724/08/0. .O3/00348 5..3.   :9477../0:34/048..:34/048..43974 5489.251.43974. 10./4% % %          %         89.4397. /03.43.4390/43472..:.48 .3/./0/48.94748  309.03908089:/. 472.-./0:3 .3908. /74.O3/003 3/. 3 .848.425./048574/:..490303 .7.. /0!%49.1J. /090723.43.3.7946:0..20390 .././.84./823:./4894O..251.5 7//. /08.:045708039..  0.   89. 3/0.48/./7.048 /003 /0.5742.!./009074../4         %089/0 . 39038/../48 :7.48089:/48./4                        7. 3/003 .8   .4 03/10703.370 $  $&$  3057080390089:/4../    /0!. 3/003! 0892..570.430 2.3472./47.9.-0./4          4/ 54-70/10703.48 8 80..4308 803/448708:9..0. %.....!#/10703.048030 9:247 % ..4 %..-..342.248:3./482:9 30.20/.43.8.!F7//. :3.8.390./47'%#80.

:..84. /01472.5 9088 /06:0.0:.574.7. 3 /0! $302-.47/.9.:04 8:1.-0. 3.1....3. 36:0.4770...48   ..-0..!  5..73485   !.3.470. .7   .403../03 9.48. 3/003!.907.3 33:3..9...-/.0394 570.42 303 48089:/48570./4% 089.9.3.251.831.:04 .8/48843:. 3089..9.03908 5.../4  7./48 3403.03908 ! 3472./48 089.248030890 089:/403970.547.7E209742074/0#0.34 3088/0./..547.:94708 /0 . 303970./4    4. 8:0706:0.7.03970....:0397. 3/0!485.4.7..6:0. 57207.9..4308 4.34 3088/0. ..251.8..4 4./4894 ....     251.251..2-..9..2039025479... 3/003 8:703/46:0.    472.43.4 5..0/07 .8/0!.1..:07/4....570...390.251../4   342... 303970./. 3 08./.43. 3/0  ! # # %!% %'_!!_ 947734..... 3/0!08:30.7 209748 .70.3.80:3/..4.43974/0..74 49748./0..3.94 .. 3/0807 .390803 .433:089748708:9. .. .907.70.

/4           89../4  ..9.7089..  :3.4383 ..47/.5.7E209748.:.48  8948:070 6:0.      '   4.88. .. 3:3.08.8/003 .../48 .3 4570.8    89.7/ .8.342..907.3472.880302F94/4 /0.3 007/0  485..43. %.4/0089..251.4333:3. :7..844   2-.J..J.4 5.342..43835F7//. 3 2 89.:.85 7//.8/08:507.4308  3:089748708:9..43209 89..3..20390.6:0.03908.4-903/..390.. 3/008900308:3...475743 89.844   .730    %089/0 ..8 03! :7.8/48.J3./4.03908803/10703908 5...43172.    !.3.8.//003!   485.O3 .3../0 09074..8/48 4./44-.907.20390/08./484.9.48./0.394.251.343.342.730   ./7.8  489:2470803089.794 3:34/048089:/48 6:0.03.03908.-../4% % %     %   89. .3.8. 3/0!  3.2- 308 .O3/0485.4348089:/48570.03908..94O. .342.8.3472.4:....48/..O3/003   485./483:0..

:/.907.83907..3 88.475743 89.47/../4/0480308! 5:0/090307:3.486:02:0897.089./0 0.8.9...907.430803970.:84 ..203478:507.42-3.  ..7..430..43. 3 .780/0 :397.    0.948/0/10703908 0308 !479.477084/070..808903908  8:80.251.../... .3.3-0301.430803 9..7./4 5743 89.70 5.485.430803 9.6:0089482..7..43.3..574708 39:247.054/7 .42-3..3./00.4/06:0.././.03908.203942 8.394 86:0702483...43.8/10703908.2-..74 2:.....089.8.907..907..4754/07570/.8./4:3..7.9../0-03.20394 84-70.2548 3.03.-.:/.3/.3. 3.9743/0..20390  570..!.430803970574/:...3.4308 903.3:08974 ./483.8 35743 89.907.5.390.430803 9.3.439:24708 2 8.3.834903.7....3. .. 3.570..4 %7.03.07574-.907../488:0703 6:00.89030:3831..0390803089..8... .8 48.4.48 570...47 3 2074/05..2.:2:.702039.7.4397.709./4708 5:0/.-..:3.:03/42...46:0....084.4308 03 9.7.8..9.7.:3../.3. 3/0.831.4 !.84.424033:08974089:/4  030.43.8.42504 ..5.47././4.708./ 89.36:0.. 35743 89.2- 3.9.7.8/0. .708..../.907.4   4088475703/03906:0 ...08/0 .:03. 3/0 .:./  #% $ 48./0.43172. 3/0.48/048 089:/486:0./4:3..7..84/06:0..  .8.74897..2.8.20390 3. /00./.47570/.78003...0310720/.089.46:0.:947086:0703...475743 89.907..07./45470$ ..45478 282.48.20390089.7033:08974.434..20390/0-0702485741:3/.:/.432 9508.8.3 88089.43 4974089:/482.34 3088 08:3574.780 03089:/482 8..:3.7 376:0  :8948:.4308  3. 3   !470.42-3./:4 . 3/0.:8 3 3:089748708:9. 3.7 3:0897. /0391.-020390/0-070248.803907..43..43:3..907.8 903.430803 9. 3.030.9:247 2 86:0:3.432.4 13.

 .

 -7.. ..!0/7074089 313..3899:94&3./0.74/0 3.8547:3.  .7. .:/.87.$4.44 .3.8  ' 43 00.3./0.0789./.  .89:7  .

Sign up to vote on this title
UsefulNot useful