JOURNAL OF BACTERIOLOGY, Apr. 1986, p.

20-28

Vol. 166, No. 1

0021-9193/86/040020-09$02.00/0 Copyright 1986, American Society for Microbiology

Molecular Cloning and Nucleotide Sequence of a DNA Fragment from Bacillus natto That Enhances Production of Extracellular Proteases and Levansucrase in Bacillus subtilis
YOICHI NAGAMI1 AND TERUO TANAKA2*

Central Research Laboratories of Mitsubishi Chemical Industries, Kamoshida, Midoriku, Yokohama-shi, Kanagawa 227,1 and Mitsubishi-Kasei Institute of Life Sciences, Minamiooya, Machida-shi, Tokyo 194,2 Japan
Received 26 September 1985/Accepted 31 December 1985
A DNA fragment from Bacillus natto IF03936 has been cloned which enhances the production of both extraceilular alkaline and neutral proteases in Bacillus subtilis. The DNA sequence analysis around the gene responsible for the hyperproduction, prtR, revealed one open reading frame (comprising 60 amino acid residues) which was bounded by potential transcriptional and translational regulatory signals in its preceding and following regions. This open reading frame was not homologous to the published sequences of the structural genes of the two proteases. The calculated molecular weight (7,109) of the polypeptide predicted from the DNA sequence is much smaller than those of the two proteases, indicating that the gene product is distinct from those enzymes. In-frame fusion between the N-terminal region of the coding sequence and the lacZ gene of Eschenichia coli demonstrated that the coding region was indeed translated in vivo. By deletion analysis it was suggested that prtR was the structural gene for the 60-amino-acid polypeptide. Cells carrying a prtR plasmid secreted both proteases 40 to 400 times more than the cells carrying the vector alone. Furthermore, it was found that prtR also enhanced the production of levansucrase by 1 or 2 orders of magnitude. There was no difference, however, in the amount of the other extracellular enzymes such as oa-amylase, RNase, and alkaline phosphatase. These results indicate that prtR is specffic for the hyperproduction of the proteases and levansucrase.

One of the most remarkable features of the genus Bacillus is the secretion of various extracellular enzymes. Bacillus natto, used in Japan for preparation of a food for human consumption, is known to produce large amounts of extracellular enzymes such as a-amylase and proteases (50, 56). Especially, proteases are known to be secreted 15 to 20 times more from B. natto than from Bacillus subtilis (50). Two major extracellular proteases have been characterized in Bacillus spp. One is an alkaline protease known as subtilisin, a serine protease sensitive to diisopropylfluorophosphate with an alkaline pH optimum (28), and the other is a neutral protease, a metaloenzyme sensitive to EDTA with a neutral pH optimum (58). Recently, the structural genes of the two proteases from both B. subtilis and Bacillus amyloliquefaciens have been cloned and determined for their nucleotide sequences (40, 51, 53, 55, 57). A novel feature of the two proteases is that, preceding the mature protein, there is a "prepro region" consisting of more than 100 amino acids (106 for the alkaline protease and 221 for the neutral protease) which constitutes a signal peptide and a net positively charged propeptide. Both proteases are produced after the exponential growth phase, and the production is in parallel with the process of spore formation (13). Although the exact physiological role of these two proteases is not clear, it was postulated that they may play a role in the normal development of the spore or in the regulation of cell wall turnover or may function as scavenger enzymes (17, 29). Recently, however, a double mutant deficient in both proteases was shown to be normal in sporulation (18, 57), excluding one of the possibilities described above.
* Corresponding author.
20

A number of pleiotropic mutations affecting the production of extracellular proteases have been reported, i.e., pap (59), amyB (36), sacU (19), hpr (12), catA (14), and scoC (9, 15). The mutations pap, amyB, and sacU are identical with respect to their genetic locations, their simultaneous effects on the hyperproduction of proteases, a-amylase, and levansucrase, the absence of flagellation, and the reduced competency for DNA-mediated transformation. All of these effects appear to be due to the mutation of a membrane component (42). On the other hand, hpr, catA, and scoC are mapped on the same locus and show similar pleiotropic phenomena including the hyperproduction of extracellular proteases, delay of spore formation, and catabolite repression-resistant sporulation (9). Furthermore, the mutation of a regulatory gene, nprR2, which is linked to the structural gene (nprE), leads to a 30-fold increase of the extracellular neutral protease production as compared with the wild-type allele, nprRl (49). In no case, however, is the mechanism for the hyperproduction understood. More information about the genetic and biochemical properties is needed to understand the expression and regulation of the extracellular proteases. To know more about the regulation of proteases, we have tried to clone genes from B. natto that may affect the production of the extracellular proteases. We used B. natto since the species is known to secrete a high amount of proteases (50). In addition, DNA from B. natto has extensive homologies with that from B. subtilis 168 and therefore can transform mutants of this host (45, 50). Therefore, once genes are cloned from B. natto, it should be able to manipulate the genes and transform the resulting DNA into the B. subtilis chromosome. In this paper, we describe cloning of a regulatory gene (prtR) from B. natto causing hyperproduction of the extra-

VOL. 166, 1986

ENHANCED PROTEASE AND LEVANSUCRASE PRODUCTION

21

cellular proteases in B. subtilis and determination of its nucleotide sequence. Our experiments suggest that prtR codes for a polypeptide that could be produced in B. subtilis cells. We further demonstrate that, among the extracellular enzymes tested, the prtR gene also had an enhancing activity of levansucrase production.
MATERIALS AND METHODS Bacterial strains and plasmids. B. subtilis MI112 (leuB8 arg-15 thr-S recE4 hsmM hsrM) is a derivative of B. subtilis 168 (43). B. natto IF03936 is a stock culture at Institute for Fermentation, Osaka. The cloning vector used in this study was pTL12, which carries the trimethoprim-resistant (Tmpr) dihydrofolate reductase and the leuB genes as described previously (44). Plasmid pNC6 is a deletion plasmid derived from pTL121 and shows only the Tmpr phenotype. Cells carrying pNC6 have three times as many copy numbers as those carrying pTL12 (Tanaka et al., unpublished data). The plasmid pSK10A6 carries the Escherichia coli lacZ gene lacking the first eight codons of the P-galactosidase gene and was the kind gift of R. Losick (60). Construction of other plasmids described in this paper is shown in Fig. 1 and 5. Media and reagents. The media used in this study were LB broth and LB agar (21), Penassay broth (Difco Laboratories), and DM3 agar (5). Trimethoprim, casein (Hammarsten), and 5-bromo-4-chloro-3-indolyl-D-galactopyranoside were added to final concentrations of 1 jxg/ml, 10 mg/ml, and 40 ,xg/ml, respectively. For levansucrase production, Spizizen minimal medium (39) lacking glucose but containing 1% glyceroi, 2z%o sucros and 50 ,ug each of the auxotrophic requirements per ml (L , medium) was used. Restriction endonucleases, DNA polymerase I, nuclease S1, T4 DNA ligase, T4 polynucleotide kinase, and alkaline phosphatase were purchased from Takara Syuzo Co., Bethesda Research Laboratories, New England Biolabs, Toyobo Co., and Boehringer Mannheim Corp. All other chemicals were of reagent grade. Each enzyme was used according to the manufacturer's specifications. Preparation of plasmid and chromosomal DNA. Plasmid DNA was prepared by either the rapid alkaline extraction method (4) or CsCl-ethidium bromide equilibrium density gradient centrifugation as described previously (44). Chromosomal DNA was prepared by the method of Saito and Miura (33). Transformation and detection of protease-hyperproducing transformants. Transformation of B. subtilis MI112 competent cells was performed as described previously (44). Transformants of B. subtilis cells which secrete high levels of protease were detected by the ability to form a large halo on LB agar plates containing casein (1%) and gelatin (1%). The polyethylene glycol-induced protoplast transformation procedure developed by Chang and Cohen (5) was used for the shotgun cloning experiment. The regenerated cells on trimethoprim-containing DM3 plate were transferred by toothpick plating onto the detecting plates for high-protease producers. Assay of extracellular enzymes. Protease activities of the culture supematants were assayed at 37C with remazolbrilliant blue-hide (7) by the change in absorbance at 595 nm per 30 min with reference to the standard curve obtained with subtilisin (Sigma Chemical Co.). For the distinction between alkaline and neutral proteases, the culture supernatants were assayed with EDTA (20 mM) for alkaline protease activities and with diisopropylfluorophosphate (2 mM) for neutral

protease activities. Levansucrase, a-amylase, RNase, and alkaline phosphatase in the culture supernatants were assayed as described previously (2, 8, 32, 48). DNA sequence analysis. DNA sequencing was done by both the Sanger et al. dideoxy chain termination method (34) and the Maxam-Gilbert method (22). Specific restriction fragments were cloned into the M13 mp8 or mp9 vectors for the dideoxy sequencing (24). For the Maxam-Gilbert sequencing, DNA fragments were dephosphorylated with bacterial alkaline phosphatase and cut with second enzymes. DNA fragments labeled at only one end were prepared by using T4 polynucleotide kinase and [-y-32P]ATP (Amersham Corp.) and purified by gel electrophoresis before chemical degradation. Si nuclease mapping. RNA was isolated from the cells carrying pNC61 or pNC6 grown overnight (14 h) in trimethoprim-containing LB medium by the procedure of Gilman and Chamberlin (10), except that the cells were suspended in 25 ml of the disruption buffer and were sonicated for four 30-s pulses at 10 W with a Branson sonifier. RNA (200 ,ug) was mixed with 10,000 to 50,000 cpm of 32P-5'-end-labeled DNA and precipitated by the addition of 3 volumes of ethanol. The precipitates were dissolved in 30 RI of the hybridization buffer [40 mM piperazine-N,N'-bis(2ethanesulfonic acid) (pH 6.4), 0.4 M NaCl, 80% formamide (deionized), and 1 mM EDTA] and heated at 70C for 10 min. The hybridization reaction was performed at 31 or 35C for 3 h and then terminated by dilution into 300 ,l of the Si digestion buffer (30 mM sodium acetate [pH 4.6], 0.25 M NaCl, 1 mM ZnSO4, 0.1% sodium dodecyl sulfate) containing 5,000 U of S1 nuclease. The S1 digestion was carried out for 30 min at the same temperature as that used for the hybridization and terminated by the addition of 6 RI of 0.25 M EDTA and 1 RI of yeast tRNA (10 mg/ml). The S1resistant hybrids were collected by ethanol precipitation and analyzed on an 8% polyacrylamide gel containing 8 M urea. Construction of a fusion plasmid with the lacZ gene. pNC61 which had been treated with EcoRV was ligated with pSK10A6 linearized with SmaI and transformed into M1112 (see Fig. 5). After selection on LB plates containing 5bromo-4-chloro-3-indolyl-D-galactopyranoside and trimethoprim, several blue colonies were detected. One such colony harbored a hybrid plasmid, pNZ2, which had the expected structure shown in Fig. 5. ,l-Galactosidase assay. B. subtilis cells carrying pNZ2 or pNC61AV10 were suspended in 10 ml of the trimethoprimcontaining LB medium, and the growth was monitored by measuring absorbance at 600 nm. These samples were centrifuged, and the pellets were suspended in 7 ml of Z buffer (60 mM Na2HPO4 * 7H20, 40 mM NaH2PO4 2H20, 10 mM KCl, 1 mM MgSO4 * 7H20, 2-mercaptoethanol, 1 mM phenylmethylfluorosulfate, pH 7). Three drops of toluene was added to cell suspension (2.1 ml), and the mixture was vortexed vigorously for 10 s. After samples were shaken at 37C for 1 h to evaporate the toluene, they were further incubated at 28C for 5 min. After the addition of 0.6 ml of orthonitrophenylgalactoside solution (4 mg of orthonitrophenylgalactoside per ml in 0.1 M sodium phosphate buffer, pH 7), the reaction mixture was vortexed immediately and shaken at 28C for 1 to 60 min until sufficient yellow color developed. The reaction was stopped by adding 1.5 ml of 1 M Na2CO3 with stirring. After the cells were pelleted by centrifugation for 2 min, the absorbance at 420 nm of the clear supematant was measured. The ,B-galactosidase activity was expressed as Miller units as described by Wang and Doi (52).
-

22

NAGAMI AND TANAKA

J. BACTERIOL.
p Oa

RESULTS
B.natto

Cloning of the gene causing hyperproduction of extracellular proteases. The chromosomal DNA from B. natto IF03936 (about 20 ,ug) was digested with the restriction endonuclease EcoRI and ligated with an EcoRI digest of pTL12 (about 1.5 pLg) which had been dephosphorylated with calf intestine alkaline phosphatase in a total volume of 200 i,l. The ligation mixture was transformed into B. subtilis MI112 by the polyethylene glycol-induced protoplast transformation procedure (5). Tmpr transformants were regenerated on trimethoprim-containing DM3 plates and were transferred by toothpick plating onto LB agar plates containing trimethoprim, caseine, and gelatin. Among about 7,000 colonies tested, 4 colonies were found to produce large halos. Recombinant plasmids prepared from each clone were capable of transforming M1112 competent cells into Tmpr colonies forming large halos. Restriction with EcoRI revealed that all plasmids carried the same 1.65-kilobase (kb) insert (data not shown). Accordingly, one such plasmid (designated pNT5) was chosen for further study. To amplify this 1.65-kb insert, we constructed a plasmid, pNC61, as shown in Fig. 1. pNT5 was cleaved with EcoRI, and the small fragment (1.65-kb insert) was purified from an agarose gel. Then this fragment was inserted into the EcoRI site of pNC6, whose copy number was increased about threefold compared with that of pTL12 (see Materials and Methods). Transformation of the ligated DNA into competent M1112 resulted in colonies showing larger and thicker halos than those produced by MI112(pNT5) colonies. Plasmid DNA was isolated from one of these transformants and designated as pNC61. pNC61 was obtained in about threefold higher yield than was pNT5. Localization of the region responsible for the hyperproduction of the extracellular proteases. We reduced the size of the insert to identify the essential region on pNC61 for the hyperproduction of the extracellular proteases. pNC61 was cut with Hindlll, and the resulting fragments were ligated and transformed into MI112. All of the Tmpr colonies produced large halos around them. From one such colony, a recombinant plasmid, pNC61AH8, was obtained which carried the 680-base-pair (bp) EcoRI-HindIII fragment of the insert (Fig. 1). In contrast, when pNC61 was digested with EcoRV, ligated, and transformed into competent MI112, no halos were detected around the Tmpr transformants. One such colony carried a plasmid, pNC61AV10, which lacked the internal 600-bp EcoRV fragment (Fig. 1). Next, we excised the 700-bp RsaI fragment from the insert, attached EcoRI linkers to both ends of the fragment, and ligated them to the EcoRI-treated pNC6 (Fig. 1). Tmpr transformants which produced halos harbored a plasmid, pNC61AR5, carrying the expected 700-bp EcoRI fragment, indicating that the RsaI fragment carried the region responsible for hyperproducing the proteases. These results indicate that the essential region for the hyperproduction is located on the left RsaI-HindIII fragment (370 bp) (Fig. 1). Since the molecular weights of alkaline and neutral proteases are about 27,000 and 45,000, respectively (28, 58), the fragment size (370 bp) is to small to code for the structural gene for either alkaline or neutral protease. Therefore, we reasoned that this region carried a regulatory gene for the extracellular proteases. We designate this gene as prtR. Effect of prtR on the production of the extracellular proteases. In the case of the large halo-forming transformants carrying plasmids such as pNT5, pNC61, pNC61AR5, and

Chromosomal DNA

IF03936

EcoRIfragments

pT2
or (9.9)

w_

"-\ Rasi
Hindlil T411gase Transformation
H
H

EcoRV
4

T411gas*

4 Transformation
H

-a

-ApNC6 1'HS ( 4.9)

E vH

pNCS1AVO
67

E ~.

plasmids. Physical maps of the plasmids were constructed by endonuclease analyses: Ba, BamHI; Bg, BglII; E, EcoRI; H, HindIII; R, RsaI (only those sites in the EcoRI insert are shown); S, SmaI; V, EcoRV. Arabic numerals inside the circles indicate the molecular size in kb. Ori indicates the origin of replication. Tmpr and Ampr designate resistance to trimethoprim and ampicillin, respectively. The heavy line indicates the inserted chromosomal
DNA of B. natto IF03936.

FIG. 1. Schematic illustration of construction of recombinant

pNc61AH8, the extent of extracellular production of the proteases could be quickly judged on the casein-containing plates. However, very small halos formed by MI112 and MI112(pNC61AV10) were difficult to judge on this basis. Accordingly, for the purpose of quantitative and accurate
tants from B. subtilis MI112 with and without the recombinant plasmids and B. natto IF03936 were examined (Table

estimation, the protease activities of the culture superna-

1). The recipient strain, B. subtilis MI112, produced a low level of protease (0.011 U/ml), whereas the transformant carrying pNT5 produced a high level of protease (2.7 U/ml) comparable to that of the donor strain, B. natto IF03936 (5.1 U/ml). The transformants carrying either pNC61, same pNC61AR5, or pNC61AH8 produced almost the In levels of protease as the transformant carrying pNT5. contrast, the transformants carrying pNC6 or pNC61AV10 produced low levels of protease equivalent to the level found in the

VOL. 166, 1986

ENHANCED PROTEASE AND LEVANSUCRASE PRODUCTION

23

TABLE 1. Production of extracellular proteases and levansucrase by B. subtilis and B. natto cells
Strain
Proteasea

(U/ml)
0.011 2.7 0.012 3.9 3.4 4.7 0.010 5.1

Levansucraseb

(U/ml)

B. subtilis MI112

M1112(pNT5) MI112(pNC6) M1112(pNC61) MI112(pNC61AH8) MI112(pNC61AR5)

B. natto IF03936

M1112(PNC61AV10)

<0.01 1.05 <0.01 1.56 1.44 1.71 0.01 0.92

a Each strain was cultured in LB medium containing 1 p.g/ml of trimethoprim (trimethoprim was omitted for the strains without plasmids) at 37C for 16 h. The culture supernatants (1 ml) were assayed as described in Materials and Methods. Protease activity shows the total activity of both the alkaline and neutral proteases. b For the levansucrase assay, each strain grown overnight in the LB medium with or without trimethoprim was transferred to the LS medium (2.5% inoculation) with or without trimethoprim. After 20 h the culture was centrifuged, and the levansucrase activities of the supernatants were determined as described in Materials and Methods.

recipient strain. Thus, the large halo-forming transformants produced 270- to 470-fold higher protease activities than did the recipient strain. These results are consistent with those of the plate assay. It should be noted here that the values of protease production varied according to the culture conditions such as aeration and temperature. Further, the transformant carrying pNC61 was unstable after 1 month of storage at -70C. Accordingly, either retransformation or purification of the hyperproducers was required for accurate measurement. Nucleotide sequence of the prtR region. The physical map of the inserted DNA of pNC61 is shown in Fig. 2. The nucleotide sequence of the approximately 680-bp EcoRIHindIII fragment carrying the regulatory gene (prtR) was determined by the Sanger dideoxy chain termination method and the Maxam-Gilbert method as shown in Fig. 2. The

result of the nucleotide sequencing (676 bp) is shown in Fig. 3. From a computer analysis of the sequence, only one open reading frame (ORF) bounded by potential transcriptional and translational regulatory signals was found. Starting from the ATG codon (nucleotides 417 to 419, methionine) and ending in AAA (594 to 596, lysine), the ORF consisted of 60 codons (Fig. 3). There are many stop codons in all three reading frames in front of the ORF. About 10 bases upstream from the ATG codon, there is a potential Shine-Dalgarno sequence, AGAGAAGGGG, which could form a stable base pair with 3' end of 16S rRNA (23), with a AG of -18 kcal (ca. 75.3 kJ) per mol (46). This is equivalent to the other Shine-Dalgarno sequences seen in gram-positive organisms (25). Putative promoters (-35 and -10 regions) are shown in Fig. 3. Two regions, TTTATGTACCAAAATAGAAAAGAA AATAAA (nucleotides 303 to 332, promoter A) and TTGAACCAGAATAAATAGGACCGTTTTACT (nucleotides 351 to 380, promoter D), are presumed to be sequences recognized by cr43-RNA polymerase (formerly called -55_ RNA polymerase [11]). These two potential promoters are somewhat different from the a43 consensus sequence consisting of TTGACA for the -35 region and TATAAT for the -10 region (25). However, in both cases the distance between the -35 and -10 regions is 18 bp, which is in agreement with 17 or 18 bp usually seen in u43-type promoters (25, 26). Besides, 20 out of 25 bp upstream from the -35

(AATTCATCC AGCTGATGCT CGCTGTCATC TAGCAGTTGC TGTTGCTGCT TTACAAATTC

60

AGGATCATCG AGAGCTGCCA GCTCTTCAGA TTGTGACAGT TCTCTAGCAT CCTCAATGGC 120

TTGGTATGCA GAGTCAACTA ATGTTTTGCT TTZWCTC GTCGCGGCTC CTGTTGTTTT 180

CTGCGCTGTT TCCACCGCTA GTTCCAGCTG CCGCTTATCC GTAAAGCCAG TCTGATCCTC 240

ATTATGAAAT TCTGAAGTCA CCAAAAACAC CTCCGCCATT ATTTTGCAGA GTTTTGA 300

RsaI AAflT]GW CCAAAATAGA AAAGAAAATA AAAATAAGCC_GQTATAACTA TTGAACCAGA 360 D-35 B*-10 A.-10 B.-35 A*-35

ATAAATAGGA CCGTTTTACT ATTTGAGGTA TCTTGATAGA GAAGGGGAAC

Met Asp Asp Lys Asp Leu Lys Leu
( 7.3 )

GC'LAT

416
464 464 46

SD D~-10 ;A ATC CTT CAC AAA ACA TT Thr ATe LTT GAG AAC ATG GAT CAT AAA D@-10TTG AAG SLS, GAC

Ilie

Leu His Lys Thr Phe

Ilie Giu

ATA GAA

ATA TAC AGT GAT TTA GAA GAA CTG GCG GATIATC GCG AAA AAA GGA AAA
Ile Tyr Ser Asp Leu Glu Glu Leu Ala Asp Ile Ala Lys Lys Gly Lys

ECORV

512 560

? INCS

CCA TCA ATG GAA AAG TAT GTT GAA GAG ATT GAA CAG AGG TGT AAA CAA
Pro Ser Met Glu Lys Tyr Val Glu Glu Ile Glu Gln Arg Cys Lys Gln
Asn Ile Leu Ala Ile Glu Ile Gln

AAC ATT TTG GCG ATT GAA ATC CAG ATG AAA ATC AAA TAG

GAGAGGCGAA 609

Met Lys Ile Lys Term

TGCCTCTCCT CTATTTGTCA TCTCATCATC ATGTATTGAG TTTAGAGTTT TACAACATTA 669

^

o-,*
*

GA1AGCIT

676

--S1

0.1Kb -

FIG. 2. Physical map of pNC61 and the strategy for determining the DNA nucleotide sequence of the prtR region. The double line indicates the 1.65-kb inserted fragment. The heavy line within the double line indicates the region where the nucleotide sequence was determined. The direction and extent of the sequence determination are shown by horizontal arrows. The arrows with and without a circle show DNA sequencing done by the Maxam-Gilbert method and by the Sanger dideoxy chain termination method, respectively. The probe used in the Si nuclease mapping is indicated by a heavy arrow.

FIG. 3. Nucleotide sequence of the prtR gene region. Numbering of the nucleotides starts from the EcoRI site. The deduced amino acid sequence of the ORF is given below the sequence. The possible Shine-Dalgarno sequence is underlined twice. The arrows and dots before the ORF indicate the 5' ends of the transcripts as deduced from the S1 mapping analyses shown in Fig. 4 (see text). These sites (A through D) correspond to the bands (A through D) shown in Fig. 4. Three putative promoter regions (the -35 region and the -10 region) corresponding to the bands A, B, and D in Fig. 4 are underlined with a heavy line. The inverted repeat sequence, a potential transcriptional terminator, is indicated by convergent
arrows.

24

NAGAMI AND TANAKA

J. BACTERIOL.

regions of the two potential promoters are in a stretch of

either A or T which is found in typical c43-promoter regions (25). The other region, TAGAAAAGAAAATAAAAAT AAGCCGATATA (nucleotides 317 to 346, promoter B), is somewhat similar to the consensus sequences recognized by the cr28-RNA and ar29-RNA polymerases (16). Immediately following the end of the coding sequence there is a G+C-rich sequence which could form a hairpin structure (nucleotides 598 to 619) with a stem of 9 bp, a loop of 4 bases, and a AG of -21 kcal (ca. 87.9 kJ) per mol. This is similar to the potential transcription terminators seen for several genes from both gram-positive (37, 40, 57) and gram-negative (31) organisms. As shown above, the necessary region for the hyperproduction is between the RsaI and HindlIl sites. The possibility that the region between the RsaI site and the translation start codon might be involved in the hyperproduction could be denied by the fact that the plasmid pNC61AV10, carrying this region but lacking the downstream region from the EcoRV site (Fig. 1) (nucleotides 495 to 676), had no ability for hyperproduction (Table 1). This raises the possibility that a peptide deduced from ORF is involved in the hyperproduction of protease. We found no homology between the prtR region and the published structural genes of both the neutral and alkaline proteases (40, 55, 57) with respect to the nucleotide sequences and the deduced amino acid sequences. Therefore, we concluded that prtR was involved in the regulation of the extracellular proteases but did not direct a proteolytic peptide. To elucidate whether the postulated transcriptional and translation signals shown in Fig. 3 function normally, we performed Si nuclease mapping analysis as well as a gene fusion experiment by using the ,B-galactosidase gene fused to the ORF (see below). Transcriptional start site of the prtR gene region. The transcription start site of the prtR gene region was determined by Si nuclease mapping with mRNA prepared from B. subtilis M1112 carrying the pNC61 plasmid. This mRNA and pNC6 mRNA used as a control were hybridized with the EcoRV-RsaI (185-bp) fragment labeled at the EcoRV 5' terminus (Fig. 3). Because of the low melting point of this DNA fragment (below 35C), we chose 31 and 35C as the hybridization temperatures. These heteroduplex mixtures were treated with Si nuclease. The results of the mapping experiments are shown in Fig. 4 along with a sequence ladder (C+T, lane 6) generated by the Maxam-Gilbert method performed on the EcoRV-EcoRI 494-bp fragment. A major band was detected at the full-length position of the EcoRV-RsaI probe, and several minor bands designated as A, B, C, and D were also seen (Fig. 4, lanes 3 and 5). In contrast, pNC6 mRNA was not hybridized with the DNA probe (lanes 2 and 4), eliminating the possibility of renaturation of double-stranded probe DNA under these conditions. When we used an another probe, a 340-bp EcoRV-HaeIII fragment, a similar result was obtained (data not shown). These experiments show the prtR transcript to arise mainly from a readthrough transcription from a promoter located upstream from the HaeIII site. It has been reported that the untranslated region of mRNA is more susceptible to degradation than the region carrying ribosomes (35). The EcoRI site of pTL12 and pNC6 is located in the seventh amino acid from the C-terminal end of dihydrofolate reductase (M. Iwakura, M. Kawata, and K. Tsuda, manuscript in preparation), and this reading frame continues to the first stop codon, TGA (nucleotides 14 to 16),

-A

-B

-D

SD

FIG. 4. Determination of the transcription initiation sites in the prtR region. mRNAs were prepared from MI112 cells carrying pNC61 and pNC6 and hybridized at 31 or 35C with the DNA probe (EcoRV-RsaI, 185 bp) labeled at the 5' end of the EcoRV site (Fig. 2). After nuclease Si digestion, the DNA probe protected by the mRNAs was separated on a 8% polyacrylamide gel in the presence of 8 M urea. The EcoRV-EcoRI fragment (494 bp, Fig. 3) labeled at the 5' end of the EcoRV site was used for the sequence ladder (C+T). A 1.5-nucleotide correction has been made between the sequence ladder and the product of the enzyme reaction (38). Lane 1 shows the EcoRV-RsaI DNA probe. The hybridization reaction was carried out at 35C with mRNA isolated from M1112(pNC6) (lane 2) and M1112(pNC61) (lane 3) and at 31C with mRNA obtained from M1112(pNC6) (lane 4) and M1112(pNC61) (lane 5). Lane 6 shows the C+T sequence ladder. SD indicates the potential ribosome-binding site (Shine-Dalgarno sequence).

in the prtR region (Fig. 3). This shows that the DNA region from nucleotide 14 to 416 is untranslated, on the assumption that the ORF is translated (see below). Therefore, one explanation for the appearance of bands A, B, C, and D is due to the degradation of the readthrough transcript from the promoter for dihydrofolate reductase. An alternative explanation is that the putative promoters functioned normally, but the upstream promoter interfered with their normal transcription (1). Actually, bands A, B, and D correspond to the potential transcription start sites located five or six bases downstream from the -10 regions of the putative promoters A, B, and D, respectively (Fig. 3). However, a potential promoter sequence for the C band could not be found. Further characterization of the potential promoters is necessary to answer whether they are indeed functional when the influence from an external promoter is negligible. The results shown here demonstrate that the region containing the ORF is expressed at the transcriptional level, although most of the mRNAs are readthrough transcripts. Furthermore, the results show that there is not a major transcription termination site between the EcoRI and the RsaI sites (Fig. 3), since the enzyme levels of MI112(pNC61) and M1112(pNC61ARS) were almost the same (Table 1). Expression of P-galactosidase by the fusion of the lacZ gene

VOL. 166, 1986

EcoRI

ENHANCED PROTEASE AND LEVANSUCRASE PRODUCTION

Smal BamHI

25

GLAATTCCCpG AMthCC CTTA|DGCCCT4G

',
H

th codon

V.

Smal

T4Iigas.
Transformation

FIG. 5. Construction of pNZ2 carrying the gene fusion between the ORF of prtR and the lacZ gene. The heavy line indicates the E. coli lacZ gene that lacks the first eight codons of the amino-terminal end (60). The dotted region indicates the ORF of prtR. The arrow in pNZ2 shows the direction of translation. The other descriptions are the same as those in the legend to Fig. 1. Details of the construction are provided in the text.

The profile of the protease activity shown by the cells carrying pNC61 was different from that of the ,Bgalactosidase activity, which ran parallel to the growth curve (Fig. 6). This is probably because the expression of the gene is due to the readthrough transcription started from the promoter for Tmpr dihydrofolate reductase gene carried in pNC6. Furthermore, the difference in those profiles shown in Fig. 6 suggests that a late limiting step exists between the expression of the ORF and the extracellular production of protease. Although the protease production at 3 h appears very low in Fig. 6, the cells carrying pNC61 had already produced about 40-fold more protease by this time than the cells carrying pNC6 (0.052 and 0.0012 U for the cells carrying pNC61 and pNC6, respectively), indicating that the extracellular production of protease is closely associated with the expression of the sequence encoding the 60-aminoacid polypeptide. These results suggest strongly that the prtR gene region directs a polypeptide of 60 amino acids. Since the prtR region was confined to the RsaI-HindIII region (Fig. 3) and contains one ORF which was indeed found to direct a polypeptide, we conclude that prtR overproduces or regulates the extracellular proteases by producing a polypeptide of 60 amino acids. Characterization of prtR clones transformed by pNC61. To investigate which protease among the extracellular proteases prtR regulates, we measured the production of the alkaline and neutral proteases separately. We also studied the effects of prtR on the production of other extracellular enzymes such as levansucrase, a-amylase, RNase, and alkaline phosphatase. The cells carrying pNC61 produced both proteases about 1 or 2 orders of magnitude higher than the cells carrying pNC6 during the stationary phase (12, 24, and 36 h) (Table 2). Levansucrase levels were greatly increased in the cells carrying pNC61 as compared with those in pNC6-carrying cells. In contrast, there was no detectable difference, at least in our hands, in the other extracellular enzymes produced by the cells carrying pNC61 and pNC6 (Table 2).

with the ORF. To determine whether the putative protein deduced from the nucleotide sequence exists in vivo, we constructed an in-frame fusion between the first 26 codons of the ORF and the E. coli lacZ gene lacking the first eight codons (Fig. 5). The plasmid pSK1OA6, carrying the lacZ gene, was cleaved with SmaI and blunt end ligated with pNC61 which had been treated with EcoRV. Then B. subtilis M1112 competent cells were transformed with this ligation mixture. The transformants were selected for blue colonies on trimethoprim-containing 5-bromo-4-chloro-3-indolyl-Dgalactopyranoside plates. Fronm one of the blue colonies a plasmid, pNZ2, was obtained (Fig. 5). pNZ2 had the expected structure as shown by restriction enzyme analyses and sequence determination around the fusion area. We measured the ,B-galactosidase activities of the fusion gene product at various times from exponential growth to the stationary growth phase. The activity increased in proportion to the growth curve, reached the maximum level at an early stationary phase, and remaiped at the same level during the stationary phase (Fig. 6). The cells carrying pNC6 or pNC61AV10 showed negligible activity throughout the growth cycle (data not shown). The maximum level of P-galactosidase activity in the cells carrying pNZ2 (5,200 U) was about 2,500-fold higher than that in the cells carrying pNC61AV10 used as a control (2.3 U). These results indicate that the protein deduced from the DNA sequence does exist in vivo.

10 0

PC o
S rx

E 8_ 60

0
2
0

4-

0.

2-

0Hours of culture

FIG. 6. Expression of ,-galactosidase activity in the M1112 cells carrying pNZ2. The specific activity of P-galactosidase is expressed in Miller units (52). Growth of the strain M1112(pNZ2) in LB broth was monitored in a Klett-Summerson colorimeter. The protease activity was measured for the strain M1112(pNC61) grown in LB broth, and the profile obtained was superimposed.

26

NAGAMI AND TANAKA

TABLE 2. Effects of prtR on the production of extracellular enzymes
Enzyme activityb (U/ml)

J. BACTERIOL.

Strain Strain

Culture timea (h)

T

Proteasec
N
A

Levansucrase

a-Amylase

RNase

Alkaline phosphatase (x 104)

M1112(pNC61)

12 24 36 12 24 36

0.74 2.4 7.0 0.0083 0.048 0.16

0.56 1.7 4.5 0.0054 0.034 0.13

0.053 0.48 2.4

0.98 1.45 1.63

0.13 0.40 0.86

240 170 130

4.4 6.7 13

M1112(pNC6)

were taken at the times indicated. b Proteases, levansucrase, a-amylase, RNase, and alkaline phosphatase were assayed as described in Materials and Methods. c T shows total protease activity measured with no inhibitors added. A and N show the alkaline and neutral protease activity, respectively, measured as described in Materials and Methods.

0.0037 0.008 0.13 7.2 170 0.0078 0.048 0.32 170 12 0.046 0.084 1.1 180 21 a Each strain was cultured in the LB or the LS (for the levansucrase assay) medium with trimethoprim (1 p.g/ml) as described in footnote a to Table 1. Samples

To determine which region of the cloned DNA is necessary for the overproduction of levansucrase, we again used those deletion plasmids used to localize the region for the protease overproduction (Fig. 1, Table 1). The same DNA region enhanced the production of levansucrase (Table 1). The ORF region of the cloned prtR had no homology with the published sequence of levansucrase (41). ot-Glucosidase, a cell-bound enzyme, was not detectable in the culture fluids of the cells carrying pNC61 and pNC6 at 24 h, when it was produced considerably in the cell bodies (data not shown). The number of viable cells was almost the same between the 36-h cells carrying pNC61 and pNC6 (data not shown). These results show that the increased production of the extracellular proteases is not due to cell lysis. With a phase-contrast microscope, we found that the 12-h cells carrying pNC61 had delayed spore formation as compared with those carrying pNC6 and exhibited cellular filamentation, which is seen in B. subtilis cells grown in a medium containing subtilisin or in cells hyperproducing proteases (17). After 36 h, however, the cells carrying pNC61 exhibited normal sporulation and the cellular filamentation disappeared (data not shown). These phenotypes of prtR resemble those of the mutations pap (59), amyB (36), and sacUh (19), except that the cells carrying latter mutations are overproducers of a-amylase. To examine the relationship between prtR, pap, and others, the genetic mapping of the prtR gene would be necessary. DISCUSSION We have cloned a DNA fragment from B. natto which enhances the production of the extracellular proteases and levansucrase of the host B. subtilis cells. Our data showed that the cloned gene (prtR) was involved in the regulation of the extracellular proteases and levansucrase, but did not encode the enzymes themselves. The prtR gene is specific for the production of both the alkaline and neutral proteases and levansucrase, but showed no detectable effects on the production of the other extracellular enzymes, such as a-amylase, RNase, and alkaline phosphatase. The determined nucleotide sequence of the prtR gene region (676 bp) revealed only one ORF encoding a small protein comprising 60 amino acid residues. This ORF is preceded by a putative Shine-Dalgarno sequence and by three potential promoter sequences (Fig. 3). By the several criteria described in Results, we suggested that the 60amino-acid polypeptide is responsible for the hyperproduc-

tion of both proteases and levansucrase and therefore is the product of the prtR gene. Recently, several cases of tandemly overlapping promoters were found to exist in Bacillus spp. genes, and they are thought to contribute to quantitative and timely regulation of gene expression (16, 52, 54, 55). Our Si nuclease mapping experiment was unable to provide definitive evidence for functional activities of the putative overlapping promoters (A, B, and C), since the transcription from the upstream promoter might have overridden those promoters (Fig. 4). In this regard, "promoter occlusion" is known where an upstream promoter inhibits the utilization of a downstream promoter (1). Additional Si nuclease mapping without the influence of an upstream promoter will be required for the determination of the functional promoter sites. In-frame fusion of ORF with the lacZ gene indicated that it was indeed translated in vivo. This protein, with a calculated molecular weight of 7,109, is rich in the charged amino acids (42%) with nearly equal numbers of acidic and basic residues (13 versus 12). These charged residues are randomly distributed. The secondary structure of this protein as predicted by the method of Chou and Fasman (6) suggests a protein of reasonably high a-helical (48%) and low ,-sheet (20%) conformation. The average hydropathy for the entire amino acid composition was -0.49 as calculated by the method of Kyte and Doolittle (20). Although the knowledge of the primary structure of the prtR gene product provides little information on the roles which it plays in the process of extracellular production of proteases, the trans-acting effect of prtR suggests protein-mediated regulation. Since the DNA sequence encoding the 60 amino acids was indeed shown to be translated in vivo and appears to be responsible for the hyperproduction of the proteases and levansucrase (see Results), it is likely that the potypeptide is involved in the regulation of both protease and levansucrase production in the host strain, B. subtilis MI112. In procaryotic cells, a few phenomena are known which are under the positive control of the activator systems (30). Hence, it will be of interest to elucidate the mechanism of action of the prtR gene product. There are several functions which could be considered for the prtR gene. First, the prtR gene might regulate the synthesis of the two proteases and levansucrase by increasing the level of either transcription or translation. Second, this gene could affect the posttranslational regulation involved in the processing or the secretion. Third, prtR might show pleiotropic effects, one of which might cause alterations such as hyperproduction of the

VOL. 166, 1986

ENHANCED PROTEASE AND LEVANSUCRASE PRODUCTION

27

proteases and levansucrase through one of the mechanisms described above. At present, the relationship between the prtR and the other regulatory mutations for proteases such as pap (amyB and sacU"), hpr, and nprR2 is not clear. However, in the sense that production of both protease and levansucrase is enhanced, the phenotypes of cloned prtR are similar to those of the pap (amyB and sacU") mutation. Recently Aubert et al. (3) cloned the sacU gene and showed that it encodes a 46,000-dalton protein. They also showed that the protein is found in the membrane fraction and that the overproduction of exoenzymes in SacUh mutants may be a consequence of the presence of the 46,000dalton protein in high amounts. It will be interesting to examine whether the cloned prtR influences the amount of the 46,000-dalton protein in the membrane and, if so, the relationship between the protein and the 60-amino-acid polypeptide. Judging from the predicted physicochemical data described above, the 60-amino-acid polypeptide should be hydrophilic and thus may not be a membrane intrinsic

genetic regulation of Bacillus subtilis genes transcribed byo28RNA polymerase. Cell 35:285-293. 11. Gitt, M. A., L.-F. Wang, and R. Doi. 1985. A strong homology exists between the major RNA polymerase crfactors of Bacillus
subtilis and Escherichia coli. J. Biol. Chem. 260:7178-7185. 12. Higerd, T. B., J. A. Hoch, and J. Spizizen. 1972. Hyperproteaseproducing mutants of Bacillus subtilis. J. Bacteriol. 112:1026-1028. 13. Hoch, J. A. 1976. Genetics of bacterial sporulation. Adv. Genet. 18:69-98. 14. Ito, J., and J. Spizizen. 1972. Early-blocked asporogenous mutants of Bacillus subtilis 168, p. 107-112. In H. 0. Halvorson, R. Hanson, and L. L. Campbell (ed.), Spores V. American Society for Microbiology, Washington, D.C. 15. Jeannoda, V., and G. Balassa. 1978. Spore control (Sco) mutations in Bacillus subtilis. IV. Synthesis of alkaline phosphatase during sporulation of Sco mutants. Mol. Gen. Genet. 163:65-73. 16. Johnson, W. C., C. P. Moran, Jr., and R. Losick. 1983. Two RNA polymerase sigma factors from Bacillus subtilis discriminate between overlapping promoters for a developmentally regulated gene. Nature (London) 302:800-804. 17. Jolliffe, L. K., R. J. Doyle, and U. N. Streips. 1980. Extracellular proteases modify cell wall turnover in Bacillus subtilis. J. Bacteriol. 141:1199-1208. 18. Kawamura, F., and R. H. Doi. 1984. Construction of Bacillus subtilis double mutant deficient in extracellular alkaline and neutral proteases. J. Bacteriol. 160:442-444. 19. Kunst, F., M. Pascal, J. Lepesant-Kejzlarova, J.-A. Lepesant, A. Billault, and R. Dedonder. 1974. Pleiotropic mutations affecting sporulation conditions and the synthesis of extracellular enzymes in Bacillus subtilis 168. Biochimie 56:1481-1489. 20. Kyte, J., and R. F. Doolittle. 1982. A simple method of displaying the hydropathic character of a protein. J. Mol. Biol. 157:105-132. 21. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: a laboratory manual, p. 68. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 22. Maxam, A. M., and W. Gilbert. 1980. Sequence end-labeled DNA with base-specific chemical cleavages. Methods Enzymol. 65:499-560. 23. McLaughlin, J. R., C. L. Murray, and J. C. Rabinowitz. 1981. Unique features in the ribosome binding site sequence of the gram-positive Staphylococcus aureus P-lactamase gene. J. Biol. Chem. 256:11283-11291. 24. Messing, J., and J. Vieira. 1982. A new pair of M13 vectors for selecting either DNA strand of double-digest restriction fragments. Gene 19:269-276. 25. Moran, C. P., Jr., N. Lang, S. F. J. LeGrice, G. Lee, M. Stephens, A. L. Sonenshin, J. Pero, and R. Losick. 1982. Nucleotide sequences that signal the initiation of transcription and translation in Bacillus subtilis. Mol. Gen. Genet. 186:339-346. 26. Murphy, N., D. J. McConnel, and B. A. Cantwell. 1984. The DNA sequence of the gene and genetic control sites for the excreted B. subtilis enzyme P-glucanase. Nucleic Acids Res. 12:5355-5367. 27. Okada, J., H. Shimogaki, K. Murata, and A. Kimura. 1984. Cloning of the gene responsible for the extracellular proteolytic activities of Bacillus licheniformis. Appl. Microbiol. Biotechnol. 20:406-412. 28. Ottensen, M., and I. Svendsen. 1970. The subtilisins. Methods Enzymol. 19:199-215. 29. Priest, F. G. 1977. Extracellular enzyme synthesis in the genus Bacillus. Bacteriol. Rev. 41:711-753. 30. Raibaud, O., and M. Schwertz. 1984. Positive control of transcription initiation in bacteria. Annu. Rev. Genet. 18:173-206. 31. Rosenberg, M., and D. Court. 1979. Regulatory sequences involved in the promotion and termination of transcription. Annu. Rev. Genet. 13:319-353. 32. Rushizky, G. W., A. E. Greco, R. W. Hartley, Jr., and H. A. Sober. 1963. Studies on B. subtilis ribonuclease. I. Characterization of enzymatic specificity. Biochemistry 2:787-793. 33. Saito, H., and K. Miura. 1%3. Preparation of transforming

protein. Several groups have cloned regulatory genes for proteases from Bacillus. Okada et al. (27) cloned a DNA fragment from B. licheniformis which enhances production of the B. subtilis proteases. However, since the DNA sequence has not been determined, it is impossible to compare this fragment with the prtR gene. Tomioka et al. (47) cloned a similar DNA fragment from B. amyloliquefacines. Neither the DNA sequence of this DNA fragment (1.75 kb) nor the aminoacid sequence predicted from it had homology with those of the prtR gene. Levansucrase activity has not been described by those two groups. These independently isolated genes differ in the extent to which they enhance protease production.
ACKNOWLEDGMENTS We thank M. Kawata and N. Takamatsu for technical assistance and Y. Teranishi for the support and interest in this work. We are grateful to R. Losick for the plasmid pSK10A6 and to M. Yamashita for typing the manuscript.

LITERATURE CITED 1. Adhya, S., and M. Gottesman. 1982. Promoter occlusion. Transcription through a promoter may inhibit its activity. Cell 29:939-944. 2. Aiba, S., K. Kitai, and T. Imanaka. 1983. Cloning and expression of thermostable a-amylase gene from Bacillus stearothermophilus in Bacillus stearothermophilus and Bacillus subtilis. Appl. Environ. Microbiol. 46:1059-1065. 3. Aubert, E., A. Klier, and G. Rapoport. 1985. Cloning and expression in Escherichia coli of the regulatory sacU gene from Bacillus subtilis. J. Bacteriol. 161:1182-1187. 4. Birnboim, H. C., and J. C. Doly. 1979. A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res. 7:1513-1523. 5. Chang, S. C., and S. N. Cohen. 1979. High frequency transformation of Bacillus subtilis protoplast by plasmid DNA. Mol. Gen. Genet. 168:111-115. 6. Chou, P. Y., and G. D. Fasman. 1978. Prediction of the secondary structure of proteins from their amino acid sequence. Adv. Enzymol. 47:45-148. 7. Dancer, B. N., and J. Mandelstam. 1975. Production and possible function of serine protease during sporulation of Bacillus subtilis. J. Bacteriol. 121:406-410. 8. Dedonder, R. 1%6. Levansucrase from Bacillus subtilis. Methods Enzymol. 8:500-505. 9. Dod, B., and G. Balassa. 1978. Spore control (Sco) mutations in Bacillus subtilis. III. Regulation of extracellular protease synthesis in the spore control mutation ScoC. Mol. Gen. Genet.
163:57-63.
10. Gilman, M. Z., and M. J. Chamberlin. 1983. Developmental and

28

NAGAMI AND TANAKA

deoxyribonucleic acid by phenol treatment. Biochim. Biophys. Acta 72:619-629. Sanger, F., S. Nicklen, S., and A. R. Coulson. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467. Schneider, E., M. Blundeli, and D. Kennell. 1978. Translation and mRNA decay. Mol. Gen. Genet. 160:121-129. Sekiguchi, J., N. Tanaka, and 0. Okada. 1975. Genes affecting the productivity of a-amylase in Bacillus subtilis Marburg. J. Bacteriol. 121:688-694. Shimotsu, H., F. Kawamura, Y. Kobayashi, and H. Saito. 1983. Early sporulation gene spoOF: nucleotide sequence and analysis of gene product. Proc. Natl. Acad. Sci. USA 80:658-662. SoUiner-Webb, B., and R. H. Reeder. 1979. The nucleotide sequence of the initiation and termination sites for ribosomal RNA transcription in X. laevis. Cell 18:485499. Spizizen, J. 1958. Transformation of biochemically deficient strains of Bacillus subtilis by deoxyribonucleate. Proc. Natl. Acad. Sci. USA 44:1072-1078. Stahl, M. L., and E. Ferrari. 1984. Replacement of the Bacillus subtilis subtilisin structural gene with an in vitro-derived deletion mutation. J. Bacteriol. 158:411-418. Steimmetz, M., L. C. Dominique, S. Aymerich, G.-T. Genevieve, and P. Gay. 1985. The DNA sequence of the gene for the secreted Bacillus subtilis enzyme levansucrase and its genetic control sites. Mol. Gen. Genet. 200:200-228. Steinmetz, M., F. Kunst, and R. Dedonder. 1976. Mapping of mutations affecting synthesis of extracellular enzymes in Bacillus subtilis. Mol. Gen. Genet. 148:281-285. Tanaka, T. 1982. Construction of a Bacillus subtilis plasmid and molecular cloning in B. subtills, p. 208-213. In D. Schlessinger (ed.), Microbiology-1982. American Society for Microbiology, Washington, D.C. Tanaka, T., and N. Kawano. 1980. Cloning vehicles for the homologous Bacillus subtilis host-vector system. Gene 10:131-136. Tanaka, T., and T. Koshikawa. 1977. Isolation and characterization of four types of plasmids from Bacillus subtilis (natto). J. Bacteriol. 131:699-701. Tinoco, I., Jr., P. N. Borer, B. Dengler, M. D. Levine, 0. C. Uhlenbeck, D. M. Crothers, and J. Grafla. 1973. Improved estimation of secondary structure in ribonucleic acids. Nature (London) New Biol. 246:40-41. Tomioka, N., M. Honjo, K. Funakoshi, K. Manabc, A. Akaoka, I. Mita, and Y. Furutani. 1985. Cloning, sequencing, and some properties of a novel Bacillus amyloliquefaciens gene involved

J. BACTERIOL.

34. 35.
36.

48.
49.

50.

37.

51.

38. 39.
40.
41.

52.

53.

54.
55.

42.

43.

56.

44.

57.

45.
46.

58. 59.
60.

47.

in the increase of extracellular protease activities. J. Biotechnol. 3:85-96. Torriani, A. 1968. Alkaline phosphatase of Escherichia coli. Methods Enzymol. 12:212-218. Uehara, H., K. Yamane, and B. Maruo. 1979. Thermosensitive, extracellular neutral proteases in Bacillus subtilis: isolation, characterization, and genetics. J. Bacteriol. 139:583-590. Uehara, H., Y. Yoneda, K. Yamane, and B. Maruo. 1974. Regulation of neutral protease productivity in Bacillus subtilis: transformation of high protease productivity. J. Bacteriol. 119:82-91. Vasantha, N., L. D. Thompson, C. Rhodes, C. Banner, J. Nagle, and D. Filpula. 1984. Genes for Alkaline protease and neutral protease from Bacillus amyloliquefaciens containing a large open reading frame between the regions coding for signal sequence and mature protein. J. Bacteriol. 159:811-819. Wang, P.-Z., and R. H. Doi. 1984. Overlapping promoters transcribed by Bacillus subtilis r55 and or" RNA polymerase holoenzymes during growth and stationary phases. J. Biol. Chem. 259:8619-8625. Wells, J. A., E. Ferrari, D. J. Henner, D. A. Estell, and E. Y. Chen. 1983. Cloning, sequencing, and secretion of Bacillus amyloliquefaciens subtilisin in Bacillus subtilis. Nucleic Acids Res. 11:7911-7925. Wong, IH. C., H. E. Schnepf, and H. R. Whteley. 1983. Transcriptional and translational start sites for the Bacillus thuringiensis crystal protein gene. J. Biol. Chem. 258:1960-1967. Wong, S.-L., C. W. Price, D. S. Goldfarb, and R. H. Doi. 1984. The subtilisin E gene of Bacillus subtilis is transcribed from a 37 promoter in vivo. Proc. Natl. Acad. Sci. USA 81:11841188. Yamaguchi, K., H. Matsuzaki, and B. Maruo. 1969. Participation of a regulator gene in the a-amylase production of Bacillus subtilis. J. Gen. Appl. Microbiol. 15:97-107. Yang, M. Y., E. Ferrari, and D. J. Henner. 1984. Cloning of the neutral protease gene of Bacillus subtilis and the use of the cloned gene to create an in vitro-derived deletion mutation. J. Bacteriol. 160:15-21. Yasunobu, K. T., and J. McConn. 1970. Bacillus subtilis neutral protease. Methods Enzymol. 19:569-575. Yoneda, Y., and B. Maruo. 1975. Mutation of Bacillus subtilis causing hyperproduction of a-amylase and protease, and its synergistic effect. J. Bacteriol. 124:48-54. Zuber, P., and R. Losick. 1983. Use of a lacZ fusion to study the role of the spoO genes of Bacillus subtilis in development regulation. Cell 35:275-283.