You are on page 1of 10

Polimorfismo nel TAS2R38 e il fattore trofico delle papille, il gene gustin coopera nella modulazione del fenotipo del

gusto al PROP. Sommario: Il fenotipo del gusto del PROP varia grandemente tra gli individui, influenzando il comportamento a tavola e quindi gioca un ruolo nella composizione corporea. Questa variazione associata al polimorfismo nel gene recettore del gusto amaro TAS2R38 e nel fattore trofico delle papille gustative gustin . Lo scopo di questo studio fu di esaminare la relazione tra gli aplotipi TAS2R38 e il molimorfismo del gene gustin rs2274333 nella modulazione del fenotipo del gusto PROP. Il fenotipo del PROP fu determinato in 76 volontari (29 maschi, 47 donne, et 253y) con metodi di scale e misurazioni di soglie. Il genotipo TAS2R38 e del gustin fu eseguito usando tecniche PCR. La pi bassa reattivit nei PROP nontasters fortemente associata con la variante nontasteing AVI del TAS2R38 e la pi alta reattivit nei supertaster fortemente associata all'allele A e il genotipo AA del gustin gene. Questi dati supportano l'ipotesi che la maggiore sentibilit dei supertaster potrebbe essere mediata da una maggiore densit delle papille gustative. Polimorfismi nel TAS2R38 e nel gene gustin, insieme, sono responsabili per un massimo del 60% della varianza fenotipica nell'amarezza del PROP e del 40% dei valori di soglia. Questi dati suggeriscono che altri fattori non definiti potrebbero essere pi rilevanti per individuare concentrazioni basse di PROP. In pi, la presenza della variante PAV del recettore potrebbe essere importante per individuare un'alta concentrazione di PROP, mentre la presenza dell'allele A nel polimorfismo del gustin potrebbe essere rilevante per la percezione delle concentrazioni basse. Questi dati mostrano come la combinazione del TAS2R38 e dei genotipi del gene gustin modulano il fenotipo PROP, fornendo uno strumento in pi per la valutazione del comportamento a tavola umano e per lo stato nutrizionale.

1. Introduzione: La capacit di percepire i composti amari della tiourea, PTC e PROP varia grandemente tra gli individui ed un tratto umano ben studiato [1]. I composti della tiourea contengono la porzione di tiocianato (N-C=S) che responsabile del loro gusto amaro [2,3]. Il gruppo N-C=S anche caratteristico dei glucosinolati e goitrin, sostanze presenti in natura comunemente trovate in verdure crocifere e altre piante della famiglia dei Cavoli [4]. Il goitrin ha delle potenti propriet anti-tiroide, e pu essere tossica quando consumata in grandi quantit da popolazioni a rischio per deficienza della tiroide [5]. Una spiegazione intrigante per la persistenza di questo tratto negli esseri umani che sia servito come un adattamento evoluzionistico a ci che l'ambiente locale offriva da mangiare [6]. Un pi grande rifiuto per le piante di cavolo fornirebbe vantaggi di sopravvivenza a chi fosse pi sensibile al loro gusto amaro [7]. Studi contemporanei della nutrizione umana hanno anche rivelato che l'amarezza del PROP potrebbe anche servire come marcatore generale per le sensazioni orali e preferenze sul cibo. Questa ipotesi basata su dati che mostrano che quelli che percepiscono il PROP/PTC come pi amaro percepiscono anche una maggiore dolcezza, asprezza e maggiore consistenza cremosa dei cibi, ed essi mostrano tipicamente una minore preferenza e scelta per una versione

"forte" di questi cibi [8-13]. Cos, la reattivit al PROP potrebbe avere ampie implicazioni per la salute umana e nella nutrizione [14,15], sebbene non tutti gli studi siano d'accordo con questa conclusione [16]. Basati su metodi di soglia, gli individui sensibili o meno al PROP sono definiti come taster e nontaster. La frequenza dei nontasters varia tra le popolazioni, dal pi basso 7% a pi del 40% [17]. Nella popolazione caucasica, la frequenza stimata di nontaster ~30% [6,18-20]. Bartoshuk [21,22] us per primo il termine di "supertaster" per distinguere individui che percepivano il PROP come estremamente amaro da quelli che percepivano il PROP come moderatamente amaro. Sebbene numerosi studi sostengano questa classificazione di individui in tre gruppi di fenotipi (nontaster, medium taster e supertaster) [9,12,19,23-29], altri lavori suggeriscono che il PROP tasting potrebbe essere un fenotipo pi continuo [9,24-26,30]. Ciononostante, studi hanno costantemente riportato che i supertasters hanno una densit maggiore di papille fungiformi sulla parte anteriore della superficie della lingua rispetto agli altri gruppi [11,22,31,32]. Queste differenze anatomiche potrebbero spiegare in parte la maggiore reattivit dei supertasters ad una gamma di sensazioni orali che non sono mediate dai recettori dellamaro. Labilit di sentire il PROP associata con gli aplotipi del gene TAS2R38 definito da tre singoli polimorfismi del nucleotide che risultano da tre sostituzioni di amminoacidi (Pro49Ala, Ala262Val e Val296Ile) [25,30]. Ci sono due aplotipi comuni, la variante dominante PAV (sensibile) e AVI il recessivo (non sensibile). I nontasters sono omozigoti per laplotipo AVI, e fu supposto che i supertasters fossero omozigoti per laplotipo PAV e i medium taster fossero eterozigoti per laplotipo PAV. Comunque, gli studi hanno segnalato una sovrapposizione di genotipi considerevole tra i gruppi di medium e supertasters [19,25,30] con un numero sostanzioso di supertasters portatori di diplotipo PAV/AVI. Altri lavori suggeriscono che la presenza di due alleli PAV (al contrario di uno) non conferisce vantaggi addizionali per la percezione di unintensit maggiore dellamaro del PROP, almeno nella gamma dei suprathreshold (oltre soglia) [26]. Cos, i genotipi TAS2R38 non spiegano completamente le differenze oro-sensoriali tra i medium e i supertasters. Infatti, il genotipo TAS2R38 predice la maggioranza (55-85%) ma non tutte le variazioni fenotipiche nella soglia del PROP, il che implica che fattori epigenetici possono essere coinvolti nellespressione del tratto [14,20,26,33]. Infatti, le prove che sostengono la presenza di geni modificatori, vengono da studi che usano una variet di approcci (segregazione familiare, collegamenti basati sulla famiglia e studi su unampia associazione di genomi [34-36]). Il nostro laboratorio ha studiato il ruolo del gene gustin (CA6), un fattore trofico per lo sviluppo delle papille gustative, nella sensibilit al PROP [37]. Abbiamo mostrato che il polimorfismo rs2274333 (A/G) del gene gustin portava ad una modificazione della struttura prima del gustin che cruciale per legare lo zinco e un funzionamento pieno della proteina [37]. Il genotipo AA (associato ad una proteina completamente funzionale) fu pi frequente nei supertasters, mentre il genotipo GG (associato con una rottura di proteine) fu pi frequente nei nontasters. Questi dati suggeriscono che la variazione nel gustin pu essere associata con differenze nella densit di papille e abilit orali chemosensoriali attraverso i gruppi fenotipici di PROP. Lo scopo di questo lavoro fu di studiare come le combinazioni del TAS2R38 e dei genotipi

del gustin gene modulano il fenotipo del gusto di PROP in una coorte etnicamente omogenea. In questo lavoro, il fenotipo del gusto del PROP fu valutato con una misure di soglia e oltresoglia per affrontare il rilevamento e la reattivit a pi alte concentrazioni [14,22,26,28,37-39]. I due metodi misurano caratteristiche differenti del sistema del gusto che potrebbe essere importante per capire le relazioni gene-gusto [26]. 2. Materiali e metodi 2.1. Soggetti Furono reclutati 76 soggetti non fumatori caucasici della Sardegna, Italia (29 uomini e 47 donne) attraverso dei manifesti pubblicitari alluniversit locale. Let media dei soggetti era di 25 anni (un intervallo dai 21 a 28 anni) e tutti avevano un indice di massa corporea normale (BMI) che misurava dai 18.6 ai 25.3 kg/m. I soggetti non mostrarono alcuna variazione di peso di pi di 5kg rispetto ai precedenti 3 mesi. Non seguivano una dieta prescritta o prendevano medicine che potessero interferire con la percezione del gusto e nessuno aveva allergie alimentari. I soggetti valutati come estremamente moderati e/o disinibiti [40] dal Three-Factor Eating Questionnaire di Stunkard e Messick [41] furono esclusi. Al fine di escludere qualsiasi deficit gustativo, le soglie per i 4 gusti di base (dolce, acido, salato, amaro) furono valutati in tutti i soggetti. Tutti furono informati verbalmente circa la procedura e lo scopo dello studio. Ogni soggetto leggeva e firmava un modulo di consenso informativo allinizio del protocollo. Lo studio fu approvato dallEthical Committee delluniversit dellospedale di Cagliari, ed stato quindi eseguito in accordo con gli standard etici previste nella Dichiarazione di Helsinki del 1964. 2.2 Valutazione del fenotipo PROP Il fenotipo PROP di ogni soggetto fu valutato con un metodo scaling per classificazione dello stato del taster e dal rilevamento e misurazione della soglia. La classificazione dei soggetti attraverso lo stato del taster fu determinata con la loro valutazione del PROP e NaCl usando il test a 3 soluzioni [28,42]. Il test consiste in tre soluzioni oltresoglia di PROP (0.032, 0.32 e 3.2 mmol/l) e NaCl (0.01,0.1, 1.0 mol/l) dissolte in acqua di sorgente. LNaCl fu usato come uno standard perch lintensit al gusto per lNaCl non cambiava dallo status del taster PROP in questo metodo [28]. Le soglie del PROP furono determinate usando una variazione di concentrazione ascendente, una procedura a 3alternative a scelta forzata (3-AFC) [43-45]. Per il test di soglia, le soluzioni variavano da 0.00001 a 32mM in passi da quarti. Il reagente PROP (Sigma-Aldrich, Milano, Italia) fu dissolto in acqua di sorgente. Per entrambi i metodi, le soluzioni furono preparate il giorno prima di ogni sessione e conservate in un frigorifero fino ad unora prima del test. I test furono presentati a temperatura ambiente in campioni da 10ml. 2.3 Analisi molecolare I soggetti furono genotipati per i polimorfismi di tre singoli nucleotidi (SNPs) a coppiedi basi 145 (C7G), 785 (C7T) e 886 (G/A)del luogo TAS2R38, e per il polimorfismo rs2274333(A/G) del luogo del gene gustin (CA6). Il TAS2R38 SNPs d luogo a 3 scambi di codifica non sinonimi; prolina ad alanina al residuo 49; alanina a valina al residuo 262; e

valina a isoleucina al residuo 296. Queste sostituzioni risultano in due aplotipi maggiori (PAV e AVI) e tre rari (AAI, PVI e AAV) che sono conosciuti nella popolazione umana. Il polimorfismo rs2274333 (A/G) consiste in una sostituzione dell aminoacido Ser90Gly. Il DNA fu estratto da dei campioni di saliva usando il kit Invitrogen Charge Switch Forensic DNA Purification (Invitrgen, Carlbad, CA, USA) secondo le istruzioni del produttore. La concentrazione del DNA purificato fu stimato da misurazioni di OD260. Tecniche PCR furono usate per amplificare le due brevi regioni del gene TAS2R38 che includevano i tre polimorfismi, e la regione del gene gustin che includeva il polimorfismo rs2274333. I primer usati furono sistetizzati dallInvitrogen (Europrim, Invitrogen Cambridge, UK). Per determinare gli aplotipi TAS2R38, lamplificazione PCR segu le analisi di restrinzione usando lHaeIII per la rivelazione di SNP alla posizione 145 del nucleotide, e un sequenziamento diretto per lidentificazione dellSNPs alle posizioni 785 e 886 del nucleotide. Il seguente set di primer fu usato per emplificare un frammento del 221 bp incluso i primi tre SNPs: 5-CCTTCGTTTTCTTGGTGAATTTTTGGGATGTAGTGAAGAGGCGG-3 (sense primer) 5AGGTTGGCTTGGTTTGCAATCATC-3 (antisense Primer). Il primer si lega in avanti allinterno del gene TAS2R38, dai nucleotidi 101 a 144. C una sola mancata corrispondenza alla posizione 143, dove il primer ha un G (sottolineato in grassetto) e il gene ha una A. Questa mancata corrispondenza cruciale per lesperimento PCR, perch il nucleotide A nella sequenza del gene TAS2R38 sostituito da un G in ognuno dei prodotti amplificati. Questo crea il primo G del HaeIII di riconoscimento di sequenza GGCC, permettendo allallele amplificato del gusto di essere tagliato. Allele amplificato nontaster legge GGGC e non tagliato. Le miscele di reazione PCR (25 L) contenevano 250 ng DNA, 10 pmol di ogni primer, 1.5 mM MgCl, 100mM Tris-HCl a pH8.3, 50 mMKCl, 200 M di dNTP mix, e 1.5 unit di Hot Master Taq Eppendorf. Cicli termici di amplificazione sono stati effettuati in un Personal Eppendorf Mastercycler (Eppendorf Germany). Il protocollo di amplificazione consisteva di una denaturazione iniziale a 95 C per 5 minuti, seguita da 35 cicli di denaturazione a 95 C per 30 secondi, ricottura a 64 C per 45 secondi, e poi estensione a 72 C per 45 secondi. Per lanalisi del polimorfismo G/C alla posizione 143, unaliquota 3 l di prodotti PCR fu mischiata con una soluzione 17 l contente 2 l 10xNE Buffer (50 mM NaCl, 10 mM Tris.HCL, 10 mM MgCl, 1 mM ditiotreitolo, pH 7.9), 0.2 HaeIII (10,000 U ml) (Sigma-Aldrich, St. Louis, MO), e 14.8 l di H2O sterile e deionizzata. La soluzione fu incubata a 37 C per 4 h. Il riassunto fu mischiato con 5 ml di tampone di caricamento e elettroforesi su un gel di poliacrilamide a 10% di verticale. Le bande di DNA furono evidenziate attraverso una colorazione argentata [46]. Il PCR 100bp Low Ladder DNA fu usato come Mr markers (Sigma-Aldrich). Polimorfismi alle posizioni del nuclotide 785 e 886 furono indentificati con una singola reazione PCR usando un primer sensibile 5-TCGTGACCCCAGCCTGGAGG-3 e un primer non sensibile 5-GCACAGTGTCCGGGAATCTGCC-3 delimitando un frammento 298 bp. Le miscele di reazione PCR (25 L) contenevano 250 ng DNA, 10 pmol di ogni primer, 1.5 mM MgCl 100 mM Tris-HCl a pH 8.3, 50 mM KCl, 200 M di dNTP mix, e 1.5 unit di Hot Master Taq Eppendorf. Cicli termici di amplificazione furono effettuati in un Personal Eppendorf Mastercycler (Eppendorf, Germany). Il protocollo di amplificazione consisteva in una denaturazione iniziale a 95 C per 5 min, seguita da 30 cicli di denaturazione a 95 C per 30s, ricottura a 60 C per 30s, e poi estensione a 72 C per 30s. I campioni amplificati furono analizzati su un 1% di gel di agarosio e su un 6% di gel di

poliacrilamide e colorati con etidio bromuro. Il PCR 100 bp Low Ladder DNA fu usato come Mr markers. Per genotipare il polimorfismo sul gustin gene rs2274333, un frammento di 253 bp fu amplificato con il primer diritto 5TGACCCCTCTGTGTTCACCT3 e al rovescio 5GTGACTATGGGGTTCAAAGG3. Le miscele di reazione (25 L) contenevano 250 ng DNA, 10 pmol di ogni primer, 1.5 mM MgCl, 100 mM Tris-HCl a pH 8.3, 50 mM KCl, 200 M di dNTP mix, e 1.5 unit di Hot Master Taq Eppendorf. I cicli termici di amplificazione furono effettuati in un Personal Eppendorf Mastercycler (Eppendorf, Germay). Il protocollo di amplificazione incluse una denaturazione iniziale a 95 C per 5 min, seguita da 35 cicli di denaturazione a 95 C per 30 s, ricottura a 54 C per 30 s, e poi estensione a 72 C per 30s. Unestensione finale fu effettuata a 72 C per 5 min. I campioni amplificati furono analizzati su di 1% di gel di agarosio e su un 6% di gel di poliacrilamide e colorati con etidio bromuro. Il pUC18 HaeIII digest phage DNA fu usato come Mr markers (SigmaAldrich). I prodotti PCR furono sequenziati con un sequenziatore automatico ABI Prism. Le analisi del nucleotide e della sequenza di aminoacidi dedotti furono eseguite con lOMIGA software versione 2.0 (Oxford Molecular, Madison, WI). 2.4 Procedura sperimentale I test dei soggetti furono effettuati in tre visite in giorni diversi sparati da un periodo di 1 mese. Nelle donne, le valutazioni del gusto furono effettuate intorno al sesto giorno di ciclo mestruale per evitare cambiamenti di sensibilit dovuti alla fase di estrogeni [47]. AI soggetti fu richiesto di astenersi dal mangiare, bere e usare prodotti per ligiene orale o gomme da masticare per un minimo di 8 h prima del test. Essi dovevano essere nella stanza del test 15 minuti prima dellinizio della sessione (9.00 AM per la prima visita e 10AM per la seconda e la terza) in modo da adattarsi alle condizioni dellamiente (23-24 C; 40-50% di umidit relativa)che furono tenute costanti durante la sessione sperimentale. Durante la prima visita, fu prelevato un campione di 5 ml di saliva non stimolata direttamente dalla bocca di ogni soggetto e messe in un tubo acid-washed polypropylene mediante un aspiratore di plastica morbida, mentre scorreva nel pavimento anteriore della bocca. I campioni furono conservati a -80 C fino a quando le analisi molecolari furono completate come descritto sopra. Unora dopo aver raccolto i campioni di saliva, ogni soggetto fu classificato per il suo status di PROP taster. Ogni soggetto fu testato due volte durante la prima visita e nella seconda. Lordine della presentazioni degli stimoli furono invertiti nelle due sessioni. Le soluzioni NaCl e PROP furono presentate in un ordine controbilanciato, e i campioni allinterno di ogni tipo di soluzioni furono testate in modo casuale. Ogni stimolazione fu seguita da un risciacquo orale con acqua di sorgente. Gli intervalli tra gli stimoli furono fissati a 60s. I risultati di intensit per ogni soluzione di PROP o NaCl furono raccolti usando la Labeled Magnitude Scale (LMS) [48]. Questa scala segnata nella parte pi alta con pi forte immaginabile. La scala d ai soggetti la libert di valutare gli stimoli relativamente al gusto pi forte immaginabile o ad ogni altro stimolo che abbiano provato nella loro vita. Dopo aver provato ogni campione, i soggetti mettevano un segno sulla scala corrispondente alla loro percezione degli stimoli. Fu calcolata la media delle risposte replicate e i risultati furono tracciati per ogni soggetto. Questa procedura genera intensit di funzioni oltresoglia per i due composti [28,40]. Se le valutazioni dellNaCl

crescevano pi rapidamente attraverso le concentrazioni rispetto alle valutazioni del PROP, il soggetto fu classificato come non taster. Se le valutazioni del PROP crescevano pi rapidamente di quelle dellNaCl, il soggetto fu classificato come medium taster. Le soglie di PROP furono determinate per ogni soggetto alla terza visita. Tutti sciacquarono le loro bocche con acqua di sorgente prima della sessione sperimentale. Gli furono presentate 3 tazze in ordine causale, in una cera una concentrazione di PROP e due contenevano acqua di sorgente. Gli fu detto di mettere in bocca lintero contenuto di una tazza per 5 s e poi sputarlo. Prima di passare alla tazza successiva, essi sciacquavano le loro bocche con acqua di sorgente. Dopo aver provato tutti e tre i campioni, gli fu chiesto di scegliere quale fosse quello differente dagli altri due. La rivelazione della soglia fu ideata come la pi bassa concentrazione a cui il soggetto identificava correttamente lo stimolo su tre prove consecutive. Gli intervalli tra gli stimoli cos come gli intervalli tra le prove furono fissati a 60s. 2.5 Analisi statistiche Unanalisi di varianza a tre vie (ANOVA) fu usata per mettere a paragone lintensit della valutazione del PROP e dellNaCl allinterno dei gruppi di taster (nontaster, medium e supertaster). ANOVA a un senso fu usato con il gruppo di taster per paragonare i valori medi SE per i valori di amaro sulla soglia o oltre soglia per il PROP (3.2 mM). Il test Tukey fu usato per un paragone post-hoc. Le relazioni tra i valori oltresoglia e sulla soglia di PROP furono valutati usando unanalisi di correlazione lineare. Il metodo di Fisher (Genepop sftware versione 4.0) [49] fu usato per testare la distribuzione del genotipo TAS2R38 e la frequenza dellaplotipo, e la distribuzione del genotipo e le frequenze dellallele del polimorfismo del gene gustin rs2274333 (A/G) secondo lo stato del PROP. Differenze genetiche tra i tre gruppi di taster basati sulla distribuzione del TAS2R38 e delle combinazioni del genotipo del gene gustin furono testate col metodo Markov Chain (Arlequin software versione 3.1) [50]. Unanalisi quantitativa della contribuzione del TAS2R38 e del gene gustin alla sensazione di amaro del PROP e della soglia fu eseguita usando la procedura Generalized Linea Model (GLM). La procedura GLM fornisce analisi di regressione e analisi di varianza per una variabile dipendente da una o pi variabili indipendenti. Il GLM fu realizzato attraverso una procedura a rovescio passo passo, che parte col modello completo, incluse le variabili indipendenti e per seconda interazione tra di esse, e poi cancellando passo dopo passo le interazioni e le variabili non significative. Gli effetti differenti tra le condizioni eterozigoti e omozigoti furono analizzati per entrambi i geni. Gli effetti dellinterazione tra i due geni fu anche inclusa nel modello. Il Partial Eta Squared rappresenta la forza dellassociazione di ogni variabile indipendente (genotipo di TAS2R38 e il loci del gene gustin) con la variabile dipendente (amarezza o soglia), dopo gli effetti di tutte le variabili indipendenti furono contabilizzate. La procedura GLM fu usata per stimare i valori medi attesi di amarezza e soglia per ogni combinazione di TAS2R38 e genotipi di gustin gene. Il grado di sovrapposizione tra i valori medi attesi e osservati determinati stabilirono in che misura lamarezza del PROP e le soglie sono spiegate dal TAS2R38 e il loci del gustin gene. Gli individui con aplotipi rari furono esclusi dalle analisi GLM. Le analisi statistiche furono condotte usando STATISTICA per WINDOWS (versione 7.0; StatSoft Inc, Tulsa, OK, USA) e SPSS software (SPSS Inc. Headquarters,

Chicago, IL, USA). I valori p<0.05 furono considerati significativi. 3 Risultati Basandosi sul gruppo di taster a cui sono stati assegnati, il 27.63% dei soggetti furono nontasters (n=21); il 36.84% furono medium taster (n=28); e il 35.52% furono supertaster (n=27). ANOVA a tre vie rivel una significativa interazione a tre vie di Gruppo Taster X Tipo di soluzione X Concentrazione sullintensit della valutazione (F[4,438]=21.438; p<0.0001) (Fig.1). Comparazioni successive mostrarono che i nontaster diedero una valutazione di intensit pi bassa alle due pi alte concentrazioni di PROP rispetto alle due pi alte concentrazioni di NaCl, rispettivamente (p<0.0001; Tukey Test). I medium taster diedero una valutazione simile per il PROP e lNaCl a tutte le concentrazioni (p>0.0001; Tukey Test). I supertaster diedero una valutazione pi alta a 0.32 e 3.2 mmol/l PROP rispetto alle due pi alte concentrazioni di NaCl, rispettivamente (p<0.0001; Tukey test). LANOVA a una via mostr che lintensit della soglia e dellamarezza del PROP (3.2 mM) variavano con lo status del taster (soglia: F[2,69]=18.260; p<0.0001; amarezza: F[2,69]=85.464; p<0.0001) (Fig.2). Raffronti successivi mostrarono che la media delle soglie era statisticamente pi alta nei nontaster rispetto agli altri gruppi (p=0.0001; test Tukey), ma non differenti tra i medium e i supertaster (p>0.05; Tukey test). Come previsto, lintensit dellamarezza oltresoglia del PROP (3.2 mM) fu statisticamente pi alto nei supertaster rispetto ai medium taster, e i medium taster diedero un valori di intensit pi alto rispetto ai nontaster (p=0.0001; Tukey test). I TAS2R38 SNPs furono associati con lo status del taster PROP basato sulla distribuzione del genotipo e le frequenze dellaplotipo (x>50.00; p<0.0001; Fishers test) (Tavola 1). Comparazioni successive mostrarono che il genotipo AVI/AVI e laplotipo AVI erano i pi frequenti (95.00% e 97.50%, rispettivamente) nei nontaster rispetto agli altri gruppi (x>50.00; p<0.0001; Fishers test). I supertaster non furono statisticamente differenti rispetto ai medium taster (genotipi x=4,52; p=0.104 e aplotipi x=2.89; p=0.23; Fishers test). Furono trovati pochi aplotipi rari nei nostri campioni (n=76): furono trovati tra i supertaster due aplotipi AAV, un AAI nei medium taster e un AAI nei nontaster (le differenze statistiche con e senza la loro inclusione nelle analisi furono le stesse). Analisi molecolari del polimorfismo rs227433 (A/G) del gustin gene mostrarono che i tre gruppi di PROP taster differivano statisticamente basandosi sul loro genotipo gustin (x=24.334; p<0.0001; Fishers test) e frequenze di allele (x=32.684; p<0.0001; test di Fisher) (Tavola 2). In questo caso, i paragoni a coppia distinsero tutti i gruppi luno dallaltro (x>10.254; p<0.006; test di Fisher). I supertasters ebbero una frequenza molto alta del genotipo AA (85.19%) e lallele A (92.6%), mentre i nontaster ebbero una frequenza pi alta del genotipo GG (57.14%) e dellallele G (64.28) (genotipi x=26.053; p<0.0001 e alleli x=34.563; p<0.0001; test di Fisher). Lallele A fu anche pi frequente (69.6 4%) dellallele G (30.35%) nei medium tasters. I tre gruppi di taster differivano stastisticamente basandosi sulla distribuzione del TAS2R38 e sulla combinazione del genotopo del gustin gene (p<0.0001; metodo Markow Chain) (tavola 3). Paragoni successivi distinsero tutti i gruppi fra loro (p0.04545; metodo Markov Chain). La condizione omozigota degli alleli non sensibili ad entrambi i loci (AVI/AVI-GG) fu pi frequente (55%) nei nontasters (p<0.0001; Markov Chain method). La

condizione omozigota del locus sensibile di gustin (AA) combinata con Pav omozigota o eterozigota (PAV/AVI-AA e PAV/PAV-AA) furono pi rappresentati nei supertasters (48% e 32%), mentre i medium taster, eterozigoti PAV insieme con genotipo AA o AG (PAV/AVIAA e PAV/AVI-AG) furono pi frequenti (40.74% e 37.04%). La Figura 3 mostra grafico a dispersione raffigurante la correlazione lineare tipicamente negativa tra lintensit di amarezza oltresoglia del PROP e la soglia PROP (r= -0.71; p<0.0001). Gli individui sono identificati nella trama attraverso il loro status di taster, TAS2R38 e genotipo del gustin gene. I nontaster con allelei non sensibili ad entrambi i loci (AVI/AVI-GG) avevano la pi alta soglia e diedero la valutazione di amarezza pi bassa al PROP, mentre quelli con la combinazione di genotipo AVI/AVI-AA mostrarono un fenotipo meno estremo. Supertasters con alleli sensibili ad entrambi i luoghi (PAV/PAVAA) ebbero una soglia pi bassa e diedero una valutazione di intensit di amarezza pi bassa del PROP, mentre quelli con il genotipo PAV/AVI-AA mostrarono unfenotipo meno sensibile. I medium taster con la combinazione PAV/AVI-AA sembrarono avere una soglia pi bassa rispetto agli individui PAV/AVI-AG. La procedura GLM defin la contibuzione del TAS2R38 e dei luoghi del gene gustin nella modulazione quantitativa dellintensit dellamaro del PROP (il Global R Squared fu 0.598). In particolare, il modello applicato mette in evidenza unassociazione significativa tra lamarezza del PROP e gli eterozigoti PAV/AVI (Partial Eta Squared 0.274; p<0.0001) o omozigoti PAV/PAV (Partial Eta Squared 0.424; p<0.0001). Unassociazione significativa tra lamarezza del PROP fu anche trovata per gli omozigoti AA (Partial Eta Squared 0.128; p=0.003); nessuna associazione fu osservata tra lamarezza del PROP e gli eterozigoti AG (Partial Eta Squared 0.033; p=0.136). Inoltre, non fu riscontrata alcuna interazione significativa neppure tra il TAS2R38 e i luoghi del gustin gene. La procedura GLM defin anche la contribuzione dei due loci nella modulazione quantitativa della soglia di PROP, e in questo caso il gloal R Squared fu 0.413. Per misurazioni di soglia, il modello GLM mostr una significativa associazione tra la soglia egli eterozigoti PAV/AVI (Partial Eta Squared 0.129; p=0.002) o omozigoti PAV/PAV (Partial Eta Squared 0.111; p=0.005), e eterozigoti AG (Partial Eta Squared 0.103; p=0.007) o omozigoti AA (Partial Eta Squared 0.149; p=0.001). Anche per la soglia, non fu trovata alcuna interazione significativa tra il TAS2R38 e i loci del gustin gene. La Tavola 4 mostra i valori medi (SE) di intesit dellamarezza del PROP e le soglie osservate per ogni TAS2R38 e combinazione del genotipo di gustin gene e i valori medi attesi stimati dal modello GLM. I valori medi attesi dellamarezza del PROP variavano da 16.3 negli individui AVI/AVI-GG a 83.9 nei PAV/PAV-AA, e i valori attesi ebbero un alto grado di sovrapposizione con quelli osservati (Global R Squared = 0.598). Il modello mostr che avere dye coppie di alleli AA nel gene gustin aumentava lintensit dellamarezza in ogni gruppo di genotipo TAS2R38, e la progressione attraverso i gruppi fu vicina alla perfezione. Per le misurazioni di soglia, la media attesa dei valori stimati attraverso il modello GLM si sovrappose parzialmente con i valori osservati (Global R Squared = 0.413). In questo caso, il modello mostr che un singolo allele A nel gene gustin riduceva il valore di soglia. Infine, cera unassociazione significativa tra gli eterozigoti AG e la soglia (Partial Eta Squared 0.103; p=0.007) ma nessuna associazione tra gli eterozigoti AG e lintensit dellamaro (Parzial Eta Squared 0.033; p=0.136).

4. Discussione Uno scopo iniziale di questo studio fu di determinare se una modulazione del fenotipo del gusto amaro del PROP fosse determinato da una combinazione di aplotipi del gene TAS2R38 e polimorfismo rs2274333 (A/G) del gene gustin che risiede sul cromosoma 1. Le analisi della distrubuzione del genotipo e le frequenze dellallele del TAS2R38 e del gustin gene in accordo allo status PROP mostrarono che il TAS2R38 distinse solo i taster dai nontaster, mentre il gene gustin distinse tutti e tre i gruppi di PROP. In pi, queste analisi unite con le analisi della distribuzione dei due luoghi di combinazione del genotipo mostrarono il luogo del TAS2R38 caratterizza geneticamente gli individui nontaster, mentre il luogo del gene gustin caratterizza i supertasters. Inoltre, la reattivit pi bassa al PROP dei nontaster fu fortemente associata con la variante AVI nontasteing del TAS2R38 (97.5% di nontaster portavano laplotipo AVI e il 95% erano omozigoti AVI) in quelli con almeno 1 allele G del luogo del gustin gene. Daltra parte, la reattivit pi alta al PROP dei supertaster fu fortemente associata con allele A e il genotipo AA (93% dei supertaster portavano allele A e 85% sono omozigoti A). Noi mostrammo in precedenza che lallele G in questo luogo del gustin fosse associato con le attivit funzionali ridotte della proteina gustin, mentre lallele A in questo luogo fu associata con una funzionalit piena della proteina [37]. Insieme queste scoperte, sostengono le ipotesi che la maggiore abilit dei supertaster a distinguere gli stimoli sia amari che non, potrebbe essere mediata da una maggiore intensit delle papille gustative dovuta ad una proteina gustin completamente funzionale che, come fattore trofico, favorisce la crescita e lo sviluppo delle papille gustative [51]. Abbiamo effettuato unanalisi quantitativa della contribuzione del TAS2R38 e dei loci del gene gustin sul modulazione del fenotipo del gusto amaro del PROP usando un metodo di soglia, che valuta labilit di distinguere concentrazioni basse del prodotto chimico, e attraverso valutazioni oltresoglia di intensit per le concentrazioni pi alte. Le analisi GLM mostrarono che il TAS2R38 e i luoghi gustin avevano effetti indipendenti nella modulazione del fenotipo PROP. Comunque, i due luoghi hanno rappresentato un massimo del 60% della varianza fenotipica nellintensit dellamarezza del PROP ma solo un massimo il 40% della variazione nella soglia del PROP. Queste scoperte suggeriscono che altri fattori ancora sconosciuti potrebbero essere importanti per la rivelazione basse concentrazioni di PROP. Stiamo attualmente esaminando questa possibilit. Lassociazione pi forte tra lamarezza del PROP il luogo del TAS2R38 suggerisce che le valutazioni oltresoglia dellintensit del PROP sono principalmente determinate dal luogo del TAS2R38 (rispetto al luogo del gene gustin). Queste scoperte sono coerenti agli studi che usano varianti del recettore umano funzionalmente espresse che mostrano che la variante PAV del TAS2R38 necessaria per rispondere al PROP attraverso laumento di concentrazione [30]. Le nostre scoperte non escludono il coninvolgimento di altri geni modificatori che risaputo svolgano un ruolo nella percezione del PROP [35,36]. Daltro canto, lanaloga associazione tra i due luoghi e i valori di soglia indicano che sia il TAS2R38 sia i luoghi del gene gustin sono importanti per discernere le basse concentrazioni della sostanza chimica. In particolare, la presenza di un singolo allele A nel gene gustin fu sufficiente agli individui per mostrare una soglia diminuita non curante del gruppo del genotipo GAS2R38, mentre due copie degli alleli AA sono necessarie per determinare lintensit dellamarezza accresciuta. Cos, ipotizziamo che labilit ad

individuare il PROP a basse concentrazioni potrebbe essere legata allattivit della proteina gustin, che si pensa giochi un suolo nello sviluppo delle papille e del loro mantenimento. Per confermare questa possiblit, gli studi futuri misureranno direttamente la densit delle papille egli individui determinate dal TAS2R38 e luoghi del gene gustin. In conclusione, questo lavoro ricapitola il lavoro precedente [26] mostrando che il TAS2R38 non pu spiegare i supertaster, e si estende identificando un nuovo polimorfismo candidato che potrebbe spiegarlo parzialmente. In pi, le nostre scoperte aiutano a spiegare alcune incongruenze riportate nella letteratura, come ad esempio che gli omozigoti AVI che percepiscono pi amarezza del PROP rispetto a quello che ci si aspetterebbe dal loro genotipo, o gli eterozigoti PAV/AVI che risponde come i supertasters [26,30]. Queste nuove intuizioni rafforzano la nostra comprensione degli effetti di questo fenotipo sul comportamento a tavola degli umani e favorir lobiettivo di progettare strategie di dieta personalizzate.

Simona Affabile comincia lo studio del canto moderno subito dopo il liceo e partecipa a diversi spettacoli musicali organizzati al Parco Virgiliano, a Castel SantAngelo e per beneficenza con i ragazzi del carcere di Nisida. Partecipa diverse volte, come parte del coro, a programmi televisivi come Il Concerto dellEpifania su Rai 2. Collabora con grandi nomi della musica come Eliades Ochoa (Buena Vista Social Club), Gary Brooker (Procol Harum), Mauro Pagani e Mariano Caiano (Orchestra Italiana di Renzo Arbore). Insegna canto in diverse scuole campane e si diploma in Canto Lirico presso il conservatorio di S. Pietro a Majella nel 2011.