You are on page 1of 22

AEM Accepts, published online ahead of print on 3 September 2010 Appl. Environ. Microbiol. doi:10.1128/AEM.

01257-10 Copyright © 2010, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.

1

2 3

Enhancement of the diversity of polyoxins by THase homolog outside the polyoxins biosynthetic gene cluster

4 5 6 7 8 9

Changming Zhao, Tingting Huang, Wenqing Chen, Zixin Deng*

Laboratory of Microbial Metabolism and School of Life Science & Biotechnology Shanghai Jiaotong University, Shanghai 200030 China

10 11 12 13 14

* Corresponding author Tel: 86-21-62933404 E-mail: zxdeng@sjtu.edu.cn

15

16

Running title: Polyoxins diversity enhanced by THase homolog

1

1

Abstract:
Polyoxins consist of 14 structurally variable components which differentiate at three branch sites of the carbon skeleton. ORF SAV_4805 of Streptomyces avermitilis, showing similarity to thymine-7-hydroxylase, was proved to enhance the diversity of polyoxins at C5 group of the 1-(5'-amino-5'-deoxy-β-D-allofuranuronosyl) pyrimidine moiety.

2 3 4 5 6 7

8 9

Key

words: Streptomyces, polyoxins, thymine-7-hydroxylase, iso-orotate

decarboxylase, thymidine salvage pathway

2

It was deduced that the nucleoside moiety was originated from the condensation of uridine with phosphoenolpyruvate (PEP) to afford octosyl acid as the intermediate 7.10. Most of the polyoxins have a common nucleoside skeleton but attached with variable side groups at three different places (Polyoxin C. In the prime pathway of nucleotide metabolism.13. Polyoxins are grouped into four different classes according to the identity of the side group R1 attached at C5 of 1-(5'-amino-5'-deoxy-β-D-allofuranuronosyl) pyrimidine moiety.20. The detailed biosynthetic pathway of nucleoside moiety of polyoxins remains obscure. asoensis (S. a subsequent oxidative elimination of the two terminal carbons would 12 create the nucleoside moiety . I and N have a modified skeleton). Our previous work showed that heterologous expression of the polyoxins biosynthetic gene cluster pol in S.1 2 3 4 5 6 7 8 9 The antifungal nucleoside antibiotic polyoxins synthesized naturally by Streptomyces cacaoi var. Different classes of polyoxins differ markedly in their activity spectrum against plant pathogenic fungi 1. Then. which was only characterized in some fungi (Fig. which could be located outside the polyoxins biosynthetic gene cluster in the native producer. 1) 6. cacaoi hereafter) consist of a mixture of at least 14 different compounds called polyoxin A-N (Fig.14 10 11 12 13 14 15 16 17 18 19 . S1. lividans TK24 produces only thymine-derived polyoxin H (Class III) 5. 3 . This prompted us to investigate the origin of gene(s) related to the structural variation of polyoxins at R1 site.25 .12. Supplementary information) 22 20 21 22 . The pyrimidine rings of polyoxins one-to-one correspond to the intermediates of the thymidine salvage pathway.

It indicated a potential thymidine salvage pathway in Streptomyces and the salvage pathway provides alternative nucleoside monophosphates as precursors for polyoxins biosynthesis. IDCase catalyzes the subsequent decarboxylation reaction and uracil-5-carboxylic acid is converted to uracil in the end 21. official name thymine dioxygenase) and isoorotate decarboxylase (IDCase). BLAST analysis with the amino acid sequence of THase from Rhodotorula glutinis and IDCase from Neurospora crassa as queries in the 25 sequenced Streptomyces strains (five finished and 20 in process) genome database (from NCBI GenBank. avermitilis strain MA4680 and SCO_6305 (sharing 25% identity and 44% similarity with idcase) from S. thymine-7-hydroxylase (THase.11. This process catalyzes by THase and IDCase is the core step of thymidine salvage pathway in fungi. 2010) results showed that thase and idcase homolog distributes extensively in Streptomyces. coelicolor strain A3(2) 2. July 24. 5-hydroxymethyluracil to 5-formyluracil.1 2 3 4 5 6 7 8 9 10 11 dUMP could be converted to dTMP under the catalysis of thymidylate synthase (TS) with tetrahydrofolic acid as methyl donor while dTMP could not be converted back to dUMP reversibly 4. In the 1970’.17 . ORF SAV_4805 enhanced the structural diversity of polyoxins 4 22 . Abbott’s group separated two enzymes.23 12 13 14 15 16 17 18 19 20 21 . and 5-formyluracil to uracil-5-carboxylic acid (also designated as isoorotate) 18. THase is a trifunctional oxygenase and catalyzes three enzymatic reactions: thymine to 5-hydroxymethyluracil. from fungal source which showed potential ability to convert thymine to uracil 22. such as ORF SAV_4805 (sharing 27% identity and 45% similarity with thase) from S.26 .

then digested with NdeI/EcoRI and inserted into the NdeI/EcoRI site of plasmid pJTU968 (a pRSET B derivative with PermE* promoter and a polylinker) 27 . polyoxin A (hydroxymethyl at R1 site) was detected from the fermentation supernatant of recombinant strains SJTU5003 apart from polyoxin H (methyl at R1 site) (Fig. This result indicated that some enzyme(s) in S. avermitilis strain NRRL8165 was conducted. Different from S. 2 (3)). 10 g glucose. The PermE*-SAV_4805 MfeI/EcoRI fragment was separated out and inserted into the 5 . lividans TK24/m5A7. 2 g KH2PO4. heterologous expression of the pol cluster in S. 2 g NaCl and 0. Polyoxins complex was purified by IRC-50 cation exchange resin (Sigma product) from the fermentation supernatant of recombinant strains and detected by LC-MS as described previously 5. ORF SAV_4805 was amplified with primer pair 480501/480502 17 18 19 20 21 22 (GCCATATGAGTGACGCCCGTACCC/GGAATTCACGAAAGTT GCCCGCTGA) and with S.08 g FeSO4·(NH4)2SO4·6H2O per liter) at 30℃ for polyoxins production.1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 To investigate the deduced influence of this potential thymidine salvage pathway to the component variation of polyoxins. avermitilis NRRL8165 must have played a role in polyoxins structural variation at R1 site. Fermentation supernatant was harvested at 72 hours. avermitilis strain NRRL8165 to give strain SJTU5003 with the method described by our previous work 5. 10 g yeast extract. avermitilis strain NRRL8165 genome DNA used as template. Cosmid m5A7 bearing pol gene cluster was transferred into S. 4 g CaCO3. 15 g corn flour. Streptomyces was cultured in liquid fermentation medium (containing 20 g soy flour.

which encoding dihydroorotase. 2 (6)). while not in mammals or prokaryotic bacteria. although its relative content was lower than that of S.1 2 3 4 5 EcoRI site of plasmid pPM927 to create plasmid pJTU5001 24 . Thymidine salvage pathway is not functional in S. lividans TK24/m5A7 to give strain SJTU5001. The recombinant S. Unexpectedly. it is realizable to construct a complete thymidine salvage pathway in Streptomyces by recombine these two ORFs in one host. such as S. cacaoi (Fig. to interrupt the UMP 6 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 . avermitilis NRRL8165. Then plasmid pJTU5001 was transferred into S. Thymidine salvage pathway is a UMP compensatory pathway which was characterized in fungi only. avermitilis UMP is de novo biosynthesized from carbamoylphosphate and aspartate in organism 15. In the supernatant of PermE*-SAV_4805 and pol gene cluster co-expressing strain SJTU5001. polyoxin A was additionally detected. To knock out gene pyrC. 2(1)) has not been detected from recombinant strains fermentation supernatant yet. avermitilis should exhibit normal phenotype when thymine is fed even though its UMP de novo biosynthetic pathway is interrupted since the thymidine salvage pathway could convert thymine to uracil in vivo. which might be attributed to the weaker hydroxymethyl-to-carboxyl catalytic ability of enzyme encoded by SAV_4805 relative to THase from fungal source. polyoxins harboring carboxyl at R1 site (such as polyxoin F shown in Fig. If the SAV_4805 protein works like THase and SCO_6305 protein works like IDCase.

avermitilis NRRL8165.4 kb upstream and 2.1 kb EcoRI/SpeI fragment was separated out from plasmid pJTU5006 and inserted into the EcoRI/SpeI site of plasmid pJTU1278 to construct recombinant plasmid pJTU5007 9. After antibiotic free culture and kanamycin selection.1 2 3 4 5 6 7 8 9 de novo biosynthetic pathway in S.16. avermitilis strain NRRL8165.mutation SJTU5009 was picked up and confirmed by PCR with primer pair validate1/ validate2. The nptII gene fragment with 39 nt homology extensions (underlined sequence) amplified by primer pair targeting1/targeting2 (CGTCAGCCACACCCGTATCGAGGAGAAGTAAGACAGATGAGCTATTCCAG 10 11 12 13 14 15 16 17 18 19 20 AAGTAGTGAGG/TCTGTCCGGCGGCAAGGTACGTCTGATGCAGTGATGTCA GCTCTGGATGCCGACGGATTTG) was used to target plasmid pJTU5005 in E. the double cross-over pyrC. avermitilis strain NRRL8165 to give recombinant strain SJTU5008 16.coli strain BW25113/pIJ790 8. The coding sequence of pyrC gene was amplified with primer pair dih1/dih2 (CACGACATATGAGCAAGATCCTGATCCGTGGTG/GGAATTCACTTCTGTCC 7 21 22 .19 . The 8. a 6. According to the genome sequence of S. avermitilis strain MA4680. Recombinant plasmid pJTU5006 was created when pyrC gene (from ATG to TGA) was replaced by nptII gene. cosmid 20E4 was selected out by PCR screening with primer pair validate1/validate2 (TTGGCGGCAACGAACCC/TGAGGGTGGTGGTGGGAGA) from the genome library of S.9 kb downstream) was separated out from cosmid 20E4 and inserted into the PstI site of plasmid pOJ260 to give recombinant plasmid pJTU5005 3.7 kb PstI DNA fragment which covers the pyrC gene and its flanking sequence (2. Plasmid pJTU5007 was transferred by conjugation into S.

plasmid pJTU5011 bearing fusion gene PermE*-pyrC also reversed mutation strain SJTU5009 back to wild-type (Fig. the constructed thymidine salvage pathway does not work in S. strain SJTU5013 still showed abnormal phenotype when thymine was fed (Fig. 3(4). Unfortunately. Fusion gene PermE*-SCO_6305 was created and inserted into the EcoRI site of plasmid pSET152 to create plasmid pJTU5010. neither 5-hydroxymethyluracil nor uracil-5-carboxylic acid could restore SJTU5013 strain to normal phenotype (Fig.1 2 3 4 5 GGCGGCAAGG) and fusion gene PermE*-pyrC was created similar to the construction of PermE*-SAV_4805. The SJTU5009 mutation was used to test if the potential thymidine salvage pathway works in Streptomyces. 3(3)). As shown in Fig. Absolutely. 3(2)). avermitilis. 3(5)). ORF SCO_6305 was amplified by primer pair IDCase05/IDCase04 6 7 8 9 10 11 (GACATATGCCCACTCCAGCCGTGCCC/GCGAATTCAGTCGAGCTGCTTGTC GTAGTCC) with S. 3(1)). The PermE*-pyrC MfeI/EcoRI fragment was inserted into the EcoRI site of plasmid pSET152 to create plasmid pJTU5011 and pJTU5011 was then introduced into strain SJTU5009 to give recombinant strain SJTU5014 3. the pyrC. In addition. In another word.mutation SJTU5009 strain showed abnormal morphological differentiation under the growth conditions investigated while resumed normal when exogenous uracil was supplied (Fig.3. These results indicated that thymine and its derivates could not be converted to uracil in strain SJTU5013. then pJTU5010 was introduced into strain SJTU5009 to give recombinant strain SJTU5013. although 8 12 13 14 15 16 17 18 19 20 21 22 . coelicolor strain A3(2) total DNA used as template.

We also wish to thank the Ministry of Science and Technology [973 (2003CB114205) and 863 programs]. 3 4 5 6 7 8 9 10 11 Acknowledgements: We are very grateful to Dr. it seemed more likely that SAV_4805 protein is not a full THase and can not catalyze the oxidation reaction from hydroxymethyl to carboxyl (attached on the C5 of pyrimidine ring) as a result that only polyoxin H (methyl at R1 site) and A (hydroxymethyl at R1 site) while no polyoxin F (carboxyl at R1 site) was detected when pol gene cluster and PermE*-SAV_4805 fusion gene co-expressed in polyoxins non-producing strain S. and the Shanghai Municipal Council of Science and Technology for research supports. Tobias Kieser for critical reading of the manuscript and many valuable comments. lividans TK24.1 2 SAV_4805 and SCO_6305 protein shared certain sequence similarity with fungal THase and IDCase. China Postdoctoral Science Foundation of the Chinese Ministry of Education. 12 13 14 15 16 17 18 9 . the National Science Foundation of China. respectively. Despite the disability which might be due to the limited capability of ORF SCO_6305.

Li. Wietzorrek. Harper. and D. Sharp. R. R. 417(6885):141-147 13 14 15 3. James. Chater. Larke. 164(3):653-658 2 3 4 5 6 7 8 9 10 11 12 2. Barrell. E. G.. 116(1):43-49 16 17 4. Characterization of the polyoxin biosynthetic gene cluster from Streptomyces cacaoi and engineered production of polyoxin H. B. Meng. A. M. M. K. A. D. 2009. D. K. Fraser. Bentley S. J. Hidalgo. Thomson. Li. Cronin.. Saunders. 284(16):10627-1063 10 . Santi. Squares. 64:721-762 18 19 20 21 5. Rao. Goble. L. Warren. E. A. L. Schoner. Carreras C. 2002. Huang. Zhou. J. Chem. Seeger. S. Bierman M. Q. D. Z. D. 1992. F. J. O'Brien. Taylor. J. You. C. Xie. X. Huang.1 References: 1. T. L. J. K.. Wu. Seno. Rajandream. Archer D. M. Rabbinowitsch. B. and D. Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp. He. M. A. D. S. O'Neil. K. Kieser. Brown.. 1977. and Z. A. Annu. Harris. W. H. E. S. R. Collins. Deng. T. Quail. K. R. Biol. Chandra. A. S. Cerdeño-Tárraga. L. J. T. H. Gene. Oliver. D. Rev. Biochem. Complete genome sequence of the model actinomycete Streptomyces coelicolor A3(2). Logan. Bai. Rutherford. Parkhill. A. Squares. Zhou. Howarth. G. M. Challis. G. W. Murphy. H. Chitin biosynthesis in protoplasts and subcellular fractions of Aspergillus fumigatus. Woodward. and B. N. N. Tan. V. Nature. Bateman. K. Chen. C. The catalytic mechanism and structure of thymidylate synthase. K. Rutter. S. 1995. A. Chen W. X. Hopwood. Hornsby. T. R. T. S. H Kieser. Biochem. E. A.

Misato. Zhou. Nat. Norwich NR47UH. Bai. J. He Y. J. 2010. and K. X. Macheroux. 11 13 14 15 16 17 18 19 20 21 . PCR targeting system in Streptomyces coelicolor A3(2). Hori M. Microbiol. VI. Kikuchi. M. Kakiki. 1978. Kakiki. 104(1):189-196 3 4 5 7.. Endo A. H. John Innes Centre. 3'-Enolpyruvyl-UMP. Appl. Biotechnol. Amrhein.. Liu. Ikeda H. 2002. Kieser. J. M. Y. Colney. a novel and unexpected metabolite in nikkomycin biosynthesis. 1970. H. Cloning of the separate meilingmycin biosynthetic gene clusters through acyltransferase-ketoreductase (AT-KR) di-domain PCR amplification. Antibiot (Tokyo). K. Y. Eguchi. J. Shinose.. A. Bacteriol. K. T. and T. N. Omura. J. Hanamoto. L. Biosynthesis of the nucleoside skeleton of polyoxins. T. Norwich Research Park. Effect of polyoxin B on chitin synthesis in polyoxin-sensitive and resistant strains of Alternaria kikuchiana. Chater. and Z.1 2 6. 2003. Studies on the mode of action of polyoxins. Mechanism of action of the antifugal agent polyoxin D. UK 9 10 11 12 9. Am. and T. and S. Shiba. Gust B. and P. T. 1974. 2005. F. Sun. 76(10):3283-3292 10. Hattori. Ishikawa.. 27(4):260-266 11. 21(5):526-531 12. Ginj C. Sakaki. Isono K. Environ. 6(11):1974 -1976 6 7 8 8. Complete genome sequence and comparative analysis of the industrial microorganism Streptomyces avermitilis. Misato. Rüegger.. Chembiochem. Deng.

Stoichiometry of the pyrimidine deoxyribonucleoside 2'-hydroxylase reaction and of the conversions of 5-hydroxymethyluracil to 5-formyluracil and of the latter to uracil-5-carboxylic acid. and D. Analysis of Streptomyces avermitilis genes required for avermectin biosynthesis utilizing a novel integration vector. I. McCroskey. Jones M.. 1972. McCloskey. and M. G. Soc. Isono K. and T. M. Lesley. Gibbons. Norwich Research Park. Norwich NR4 7UH. 100(12):3937-3939 13. Abbott. Bibb. J. P. 111:61-68 12 9 10 11 12 13 14 15 16 17 18 19 20 21 .. Nature. enzymes. 2000. Isono K. Am. J. biological activity. Isolation and structure of octosyl acids. Biochem. L. Conrad. Annu. and regulation of UMP biosynthesis. A. R. MacNeil. A. Pyrimidine nucleotide biosynthesis in animals: genes. Dezeny. J. Kieser T. A. 41(12):1711-1739 14.. Colney. P. Chater. K. Koehn E. 1988. M. and J. P. S. Liu C. 1992. Buttner. B. 458(7240):919-923 18. Nucleoside antibiotics: structure. 1975. 1980. England 17. Chem. Palfey. T. An unusual mechanism of thymidylate biosynthesis in organisms containing the thyX gene. Biochemistry. M. Crain. 2009. Mathews. 97(4): 943-945 2 3 4 5 6 7 8 15. M. Slaughter. E. Gewain.A. Practical Streptomyces Genetics. MacNeil D. F. Anhydrooctose uronic acid nucleosides. F. Gene. C. Antibiot (Tokyo). Fleischmann. R. K. Soc. Ruby.. J. M. John Innes Foundation. J. T. K. J. P. and biosynthesis. Rev. 11(11):2172-2176 19. A. S. Shaffer. H. Kohen.1 Chem. 49:253-279 16. I. and A. Hopwood.

Antimicrob. Axhemi. F. Mizuno. T. M. A. J. 94(1):53-59 25. Gene. C. J. Hsu. 1723(1-3):256-264 24. and T. Kundracik.. A new antibiotic. H. Palmatier R. D. Acta. S. Abbott. McCroskey. 1965. A. R.. and M. J.. and M.. J. R. and A. C. 1990. 1975. Smiley J. Landfried. Barnes Sr. Biol. Bacteriol. Metabolism of pyrimidine deoxyribonucleosides in Neurospora crassa. Chemother. Agents. Boccard. Construction of a series of pSAM2-based integrative vectors for use in actinomycetes. R. M. Abbott. A. P. Smokvina T.. J. Chem. T. Synthesis and biological activity of tripeptidyl polyoxins as antifungal agents. 245(8):2023-2026 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 13 . Boney. A. 2005. A. Naider F. Thompson. 1970. 18:131 26. P. 121(2):648-655 23. Suzuki S. Isono. Mazodier. C. J. Watanabe M. Y. Biophys. T. 245(24):6706-6710 22.1 2 3 20. Antibiot (Tokyo). V. Kawashima. Becker. A. Biochim. D.. The enzymatic conversion of uracil 5-carboxylic acid to uracil and carbon dioxide. 1970. and M. T. Biol. P. Guérineau. Shenbagamurthi. and J. 24(5):787-796 21. Genes of the thymidine salvage pathway: thymine-7-hydroxylase from a Rhodotorula glutinis cDNA library and iso-orotate decarboxylase from Neurospora crassa. S. P. 1983. Mizutani. polyoxin A.. K. Steinfeld. Shaffer P.. Abbott. and M. M. Nagatsu. The enzymatic conversion of 5-formyluracil to uracil 5-carboxylic acid. Smith. McCroskey. Chem.

L. Y. T. Xu H.. and Z. Yang. Zhang. 16(5):567-576 4 5 6 14 . Chem. Mahmud. a large protein of the vicinal oxygen chelate superfamily.1 2 3 27. Bai. J. Deng. Alternative epimerization in C(7)N-aminocyclitol biosynthesis is catalyzed by ValD. Biol. 2009.

2. pyrC and different pyrimidine derivatives. SFM medium with 5 mM uracil-5-carboxylic acid. 1) The class is determined by R1. Figure 2 Extracted ion graph from LC-MS analysis of polyoxins samples. Letter A represent polyoxin A. SFM medium with 5 mM 5-hydroxymethyluracil. avermitilis 15 5 6 7 8 9 10 11 12 13 14 15 .1 2 Table and figures list of this manuscript Table 1 Bacteria strains and plasmids used in this study Figure 1 Figure 2 Figure 3 Chemical structure of polyoxins complex Extracted ion graph from LC-MS analysis of polyoxins samples The pyrC. S. 5008. avermitilis SJTU5003 strain. (3).mutation restored by ORF SCO_6305. (2). (4). S. (1). lividans TK24/m5A7/pPM927. (6). 4. SJTU5001 strain. cacaoi. S. pyrC and different pyrimidine derivatives 3 4 Figure legends: Figure 1 Chemical structure of polyoxins complex. 1. (5). lividans TK24/pSET152. 5. S. avermitilis NRRL8165/pSET152. SFM medium. 3.mutation restored by ORF SCO_6305. SFM medium with 5 mM uracil. S. SFM medium with 5 mM thymine. recombinant S. 2) × indicates different skeleton that does not have this particular residue. Figure 3 The pyrC. H represent polyoxin H and F represent polyoxin F.

16 . avermitilis strain SJTU5014. 5009. 5014. 5013. avermitilis strain SJTU5009. recombinant S. recombinant S.1 2 3 strain SJTU5008. recombinant S. avermitilis strain SJTU5013.

avermitilis NRRL8165 harboring Streptomyces SJTU5003 cosmid m5A7 This study S. coelicolor A3(2) Wild-type strain 2 S. avermitilis NRRL8165 This study Strain SJTU5009 harboring Streptomyces SJTU5013 pJTU5010 This study Strain SJTU5009 harboring Streptomyces SJTU5014 pJTU5011 1 This study . cacaoi var. lividans TK24/m5A7 harboring Streptomyces SJTU5001 pJTU5001 This study S. avermitilis NRRL8165 harboring Streptomyces SJTU5008 pJTU5007 This study pyrC. lividans TK24/m5A7 heterologous producing 5 S.mutation derived from Streptomyces SJTU5009 S. asoensis Polyoxins producer 5 S. avermitilis NRRL8165 Wild-type strain 9 Recombinant strain for polyoxins S.Table 1 Bacteria strains and plasmids used in this study Strains/plasmids Description References Strains S.

oriT RK2 9 pPM927 harboring pJTU5001 PermE*-SAV_4805 MfeI/EcoRI fragment This study pJTU5005 pOJ260 harboring a 6. oriT RK2 3 Streptomyces integrating vector. oriT RK2 3 Streptomyces replicating vector. oriT RK2 24 E. addC(3)Ⅳ. attp ØC31.coli ET12567/pUZ8002 conjugation Plasmids E. int ØC31. rep pIJ101. int pSAM2. coli plasmid harboring a pJTU968 constitutive promoter of gene ermE* 27 16. tsr. bla. pPM927 ori pBR322. pOJ260 ori pUC18. coli colon vector.7 kb PstI DNA 2 This study .coli/Streptomyces E. addC(3)Ⅳ.16 Host for E. tsr. pSET152 ori pUC18.E.19 Streptomyces integrating vector. attp pSAM2. pJTU1278 ori ColEI. addA.coli BW25113/pIJ790 Host for PCR targeting 8.

fragment which covers pyrC gene and the flank sequence pyrC gene of pJTU5005 replaced by pJTU5006 nptII gene This study pJTU1278 harboring 8. cacaoi genome library cosmid cosmid m5A7 covers polyoxins biosynthetic gene cluster pol 5 S.1 kb EcoRI/SpeI fragment (covering nptII pJTU5007 gene and the frank sequence) from pJTU5006 This study pSET152 harboring pJTU5010 PermE*-SCO_6305 MfeI/EcoRI fragment This study pSET152 harboring PermE*-pyrC pJTU5011 MfeI/EcoRI fragment This study S. avermitilis NRRL8165 genome cosmid 20E4 library cosmid covers pyrC gene and the flank sequence 9 3 .

Skeleton of polyoxins complex Polyoxin Class1) R1 R2 R3 Polyoxin A CH2OH B CH2OH OH C CH2OH OH ⁄2) G CH2OH OH I CH2OH H CH3 J CH3 OH OH OH H ⁄ OH OH D COOH OH E COOH OH F COOH K H L H OH M H OH N ⁄ ⁄ OH Class R1 R2 R3 OH H OH OH OH H OH Figure 1 .

2 H 631.2 H 100 (6) 601.2 A 601.2 H 50 50 617.Relative abundance % 100 Relative abundance % (1) 617.2 H 0 5 10 15 20 25 30 min 50 100 (2) 0 0 5 10 15 20 25 30 min 0 0 5 10 15 20 25 30 min 100 (3) 617.2 F 100 (4) 0 00 50 0 5 10 15 20 25 30 min 100 0 (5) 601.2 A 0 0 0 5 10 15 20 25 30 min 0 5 10 15 20 25 30 min Figure 2 .2 A 601.