You are on page 1of 54

CAPITULO

11

Utilizacin de la informacin gentica: de la transcripcin a la traduccin


11-1 Relacin entre genes y protenas 11-2 Transcripcin: el proceso bsico 11-3 Transcripcin y procesamiento del RNA en clulas eucariotas La perspectiva humana: Posible uso de las ribozimas en medicina 11-4 Codificacin de la informacin gentica 11-5 Traduccin de la informacin gentica La va experimenta]: Papel del RNA como catalizador

l avance de la biologa en el siglo pasado se reflej de muchas maneras en nuestro concepto cambiante de la naturaleza del gen. Los trabajos de Mendel ensearon a los bilogos que los genes son elementos discretos que controlan el desarrollo de rasgos especficos. En su oportunidad, Mendel pudo haber argumentado en favor del concepto de que cada gen determina un solo rasgo. Boveri, Weismann, Sutton y sus contemporneos descubrieron que los genes posean un cuerpo fsico como parte del cromosoma. Morgan, Sturtevant y sus colaboradores demostraron que los genes ocupan sitios especficos: residen en lugares particulares sobre cromosomas especficos. Estos sitios permanecen constantes en cada individuo de una especie y se transmiten a la siguiente generacin. La formulacin de estas ideas represent una serie de avances importantes en el camino hacia el conocimiento gentico, pero an faltaba aclarar cmo opera la informacin almacenada en un gen para controlar las actividades de la clula. Este es el principal tema que analizaremos en el presente captulo. Iniciaremos estudiando algunos conceptos adicionales respecto de la naturaleza del gen para tener una idea ms aproximada de su papel en la sntesis de productos codificados.

FIGURA 11-A. Imagen generada por computadora de una subunidad ribosmica en a cual el RNA ribosnco aparece como una lnea azul y las protenas ribosmicas como "lluvia de estrellas" esfrica, (Cortesa de Barr/ Noler, Universidad de California, Santa Cruz.)

11-1 Relacin entre genes y protenas


En 1908, el mdico escocs Archibald Garrod public que los sntomas observados en personas afectadas por ciertas

434

CAPITULO 11 Utilizacin de la informacin gentica: de la transcripcin a la traduccin

435

enfermedades hereditarias raras son resultado de la ausencia de enzimas especficas; este fue el primer conocimiento significativo de la funcin de un gen. Una de las enfermedades investigadas por Garrod, la alcaptonuria, es un padecimiento fcil de diagnosticar por el color oscuro que adquiere la orina cuando se expone al aire. Garrod observ en personas con alcaptonuria la ausencia en la sangre de una enzima que oxida el cido homogentsko, compuesto formado durante el desdoblamiento de los aminocidos fenilalanina y tirosina {fig. 11-1). El cido homogentsico acumulado se excreta por la orina, a la cual confiere un color oscuro al ser oxidado por el aire. Garrod haba descubierto la relacin entre un gen especfico, una enzima especfica y una enfermedad metablica especfica. Denomin a estas enfermedades "errores congnitos del metabolismo". Igual como ocurri con otras observaciones tempranas de importancia bsica en gentica, los descubrimientos de Garrod fueron ignorados durante decenios. En 1940, George Beadle y Edward Tatum, del California Insttute of Technology, revivieron la idea de que los genes controlan la formacin de enzimas. Neurospora es un moho tropical del pan que en condiciones normales puede crecer en medios muy simples con una sola fuente de carbono inorgnico (p. ej., un azcar), sales inorgnicas y biotina (una vitamina del complejo B). Puesto que sus necesidades para vivir son tan escasas, debe tener capacidad para sintetizar todos los metabolitos que requiere. Beadle y Tatum asumieron que un organismo con capacidad de sntesis tan amplia deba ser muy sensible a deficiencias enzmticas, fciles de descubrir mediante el protocolo experimental apropiado. Bsicamente, Beadle y Tatum irradiaron las esporas del moho y las distribuyeron de modo que cada una produjera una poblacin genticamente idntica de clulas, y luego investigaron deficiencias metablicas especficas en muestras de estas poblaciones utilizando el protocolo mostrado en la figura 11-2, El inicio fue por irradiacin de miles de clulas. Dos de dichas clulas perdieron su capacidad de

crecer en un medio mnimo: una necesit piridoxina (vitamina B6) y la otra requiri tiamina (vitamina BI). Por ltimo, se investig la descendencia de casi 100 000 esporas irradiadas y se aislaron docenas de diferentes tipos de mutantes. Cada mutante careca de un gen y en consecuencia presentaba una deficiencia enzimtica que impeda a la clula catalizar una reaccin metablica particular. Los resultados fueron claros: un gen especfico portaba informacin para elaborar una enzima particular. Esta conclusin fue conocida como la hiptesis de "un gen-una enzima". Posteriormente, cuando se supo que las enzimas a menudo se componen de ms de una cadena de polipptidos, cada una codificada por un gen diferente, el concepto se modific a "un gen-una cadena de polipptidos". Esta relacin se aproxim mucho ms a la funcin bsica de un gen, pero tuvo que modificarse debido al descubrimiento de que un solo gen con frecuencia genera varios polipptidos relacionados como resultado de nsamblamientos alternativos (estudiados en la seccin 12-3). Los datos de Beadle y Taum plantearon una pregunta acerca de la naturaleza molecular del defecto ocurrido en una protena a causa de una mutacin gentica. La respuesta a esta pregunta se obtuvo en 1956, cuando Vernon Ingram, de la Universidad de Cambridge, public un trabajo acerca de las consecuencias moleculares de la mutacin causante de la anemia drepanoctica. La hemoglobina consta de cuatro grandes polipptidos, demasiado grandes para secuenciar con la tecnologa de aquella poca, pero Ingram tom un atajo. Obtuvo preparaciones aislando hemoglobina de clulas normales y de clulas drepanocticas en cierto nmero de tramos especficos usando la enzima proteoltica tripsina. A continuacin someti los fragmentos del pptido a cromatografa en papel para determinar si poda diferenciar alguno de los tipos de hemoglobina normal y drepanoctica entre los productos digeridos por la tripsina. De los 30 pptidos o ms presentes en la mezcla, uno migr de manera diferente en las dos preparaciones (como lo ilustrado en la figura 2-29); esta nica diferencia al parecer

NH2

NH2

CH 2 CHCOOH

HO

CH 2 CHCOOH

COOH

Fenilalanina

Tirosina

Acido homogentsico

HC COOH HOOC CH II HC COOH Acido fumrico CH 3 CCH 2 COOH II O Acido acetoactico

Oxidasa del cido homogentsico

HC C CH2 C COOH i II O O Acido 4-maleilacetoactico

FIGURA 11-1. "Error congnito del metabolismo". Los pasos en la va conducen al desdoblamiento de los aminocidos aromticos (fenilalanina y tirosina). Las alteraciones de la enzima oxidasa del cido homogentsico en personas con alcaptonuria causan acumulacin del cido homogentsico en la orina.

436

CAPITULO 11 * Utilizacin de la informacin gentica: de la transcripcin a la traduccin

O
Tipo nativo de Neurospora Irradiar con rayos X o luz ultravioleta

o
Desarrollar en medio complementado Esporas producidas por meioss seguido por una sola mitosis

Meiosis

Medio mnimo Prueba de la capacidad de crecimiento

Medio mnimo + vitaminas

Medio mnimo + aminocidos

Los mutantes pueden crecer en medio complementado, pero no en medio mnimo

Medio mnimo complementado con:

A,

Piridoxina

Acido p-aminobenzoico

Colina

Inositol

Acido flico

Acido Miacina Riboflavina Tiamina pantotnico

Control del medio mnimo

KIOL'KA 11-2. Experimento de Beadle y Tatum para aislar mutantes genticos en Nenrosporu. Se irradiaron esporas para inducir mutaciones (paso 1) y luego se permiti crecer colonias en tubos que contenan medio complementario (SM) (paso 2). A continuacin se prob la capacidad de esporas individuales producidas por las colonias para crecer en un medio mnimo (MM) (paso 3). Las que no crecieron eran murantes y la tarea consisti en determinar la naturaleza del gen mutante. En el paso 4 del ejemplo mostrado se observ una muestra de clulas que crecen en un medio mnimo complementado con vitaminas, pero que no crecen en medio complementado con aminocidos. Esta observacin indica deficiencia de la enzima que controla la sntesis de vitaminas. En el paso 5, el crecimiento de estas mismas clulas en un medio mnimo complementado con una u otra de las vitaminas indica que la deficiencia reside en un gen que participa en la sntesis de cido pantotnico (una parte de la coenzima A).

causaba todos los sntomas de la anemia drepanoctica. Una vez separados los ppdos, Ingram obtuvo un solo pequeo fragmento para secuenciar, ms bien que una protena completa. La diferencia observada fue la sustitucin de una valina en la hemoglobina drepanoctica por un cido glutmico de la molcula normal. Ingram haba demostrado que una mutacin en un solo gen poda causar una sola sustitucin en una secuencia de aminocidos de una sola protena. Flujo de informacin a travs de la clula: panorama general Hasta aqu se ha establecido la relacin entre informacin gentica y secuencia de aminocidos, pero este conocimiento por s solo no proporciona indicios acerca del mecanismo para generar cadenas de polipptidos especficos. Segn

sabemos ahora, hay un intermediario entre un gen y su polipptido, el RNA mensajero intermediario (RNAm). Un RNA mensajero se ensambla como copia complementaria de una de las dos cadenas de DNA que constituyen un gen. La sntesis de un RNA a partir de una plantilla de DNA se denomina transcripcin. Esta secuencia de nucletidos es complementaria a la del gen a partir del cual fue transcrita, por lo que el RNAm retiene la misma informacin contenida en el propio gen. El uso de un RNA mensajero permite a las clulas separar informacin almacenada a partir de la utilizacin de informacin (fig. 11-3). El gen permanece almacenado, aislado dentro del ncleo como parte de una enorme molcula inmvil de DNA, pero puede transmitir su informacin a un RNA movible mucho ms pequeo capaz de llegar al citoplasma. Una vez en el citoplasma, el RNAm puede servir como plantilla para controlar la incorporacin de ami-

DNA del cromosoma l-'IGURA 11-3. Flujo de informacin en una clula eucariota. El DNA de los cromosomas localizados en el ncleo contiene toda la informacin gentica almacenada. Sitios seleccionados del DNA se transcriben al RNA (paso 1), que se procesa a RNA mensajero (paso 2). El RNA mensajero se transporta fuera del ncleo (paso 3) hacia el interior del citoplasma, donde se traduce en polipptidos mediante un ribosoma que se desplaza a lo largo del RNAm (paso 4). Luego de la traduccin, el polipptido se pliega para asumir su conformacin nativa (paso 5). Citoplasma

Pre-RNAm

Segmento de DNA que se transcribe

RNAm que se traduce

Protema

{^

RNAm Ncleo

nocidos en el orden particular codificado por la secuencia de nucletidos del DNA y del RNAm. El uso del RNA mensajero tambin permite a la clula amplificar enormemente su actividad. Una molcula de DNA puede servir como plantilla para la sntesis de gran nmero de cadenas de polipptidos. Las protenas se sintetizan en el citoplasma mediante un proceso muy complejo denominado traduccin. La traduccin requiere la participacin de docenas de diferentes elementos, incluyendo ribosomas. Los ribosomas son componentes inespecficos del mecanismo de traduccin, una especie de "banco de trabajo" sobre el cual cualquier ribosoma puede traducir cualquier RNAm. Por esta razn se pueden utilizar clulas bacterianas como "laboratorios farmacuticos" para elaborar protenas codificadas por los RNAm humanos. Conforme lo analizado en la pgina 69, un ribosoma funcional consta de una subunidad grande y una pequea. El ribosoma se ensambla a partir de estas subunidades en el momento de iniciar la sntesis de un polipptido particular, y se desensambla cuando la sntesis concluye. Los ribosomas constan de RNA y protena (como se ilustra en la fotografa de la pgina 434). El RNA de un ribosoma se denomina RNA ribosmico (o RNAr), e igual que los RNAm, cada uno se transcribe a partir de una cadena de DNA de un gen. En vez de capacidad de informacin, los RNAr desempean funciones estructural y cataltica. El RNA de transferencia (o RNAt) constituye una tercera clase principal de RNA necesario durante la sntesis de protenas (fig. 11-3). Se requiere RNA de transferencia para traducir la informacin codificada en el "alfabeto" de un nucletido de RNAm aJ "alfabeto" del aminocido de un polipptido. Los RNAt y los RNAr son molculas de vida media prolongada dentro de la clula {tpicamente, horas a das), pero los RNAm de ordinario son inestables y su vida media se mide en minutos u horas.

El RNAr y el RNAt deben su actividad a su capacidad para adoptar estructuras complejas secundarias y terciarias. Por lo tanto, a diferencia del DNA, que tiene una estructura relativamente definida cualquiera que sea su fuente, los RNA se pliegan en formas tridimensionales complejas, notablemente diferentes de un tipo de RNA a otro. As pues, igual que las protenas, los RNA pueden efectuar diversas funciones debido a que adoptan gran variedad de formas diferentes. Como en las protenas, el plegamiento de las molculas de RNA sigue ciertas reglas. As corno la regla principal del plegamiento de protenas es cubrir residuos hidrofbicos (pg. 72), una regla primaria del plegamiento del RNA es formar regiones que posean pares de bases complementarias (fig. 11-4). En las siguientes secciones de este captulo analizaremos con detalle los funciones del RNAm, el RNAr y el RNAt. Las bases de la estructura material del RNA se estudiaron en la pgina 67.

11-2

Transcripcin: el proceso bsico

La transcripcin es un proceso mediante el cual un tipo de cido nucleico produce otro tipo de cido nucleico. Por consiguiente, la transcripcin es mucho ms simple que la traduccin y puede efectuarla una sola enzima (que trabaje en conjunto con varias protenas auxiliares). En clulas procariotas y eucariotas, las enzimas encargadas de la transcripcin se denominan RNA polimerasas dependientes de DNA o simplemente RNA polimerasas. Estas enzimas pueden ensamblar una cadena lineal de nucletidos cuya secuencia es complementara de una de las cadenas de DNA que le sirve como plantilla. El primer paso en la sntesis de un RNA es la asociacin de la polimerasa con la plantilla de DNA. Esto conduce a un tema de mayor inters general, a saber, las interacciones

438

CAPITULO 11 * Utilizacin de la informacin gentica: de la transcripcin a a traduccin

FIGURA 11-4. Estructura bidimensional de un RNA ribosmico bacteriano que muestra el extenso acoplamiento de pares de bases entre diferentes regiones de una sola cadena.

especficas de dos macromolculas muy diferentes, protenas y cidos nucleicos. As como diferentes protenas han evolucionado para unirse a diversos tipos de sustratos y catalizar distintos tipos de reacciones, as tambin algunas evolucionaron para reconocer y unirse a secuencias especficas de nucletidos en una cadena de cido nucleico. El sitio donde se enlaza la molcula de RNA polimerasa antes de iniciar la transcripcin se denomina promotor. Adems de suministrar un sitio de enlace para la polimerasa, el promotor contiene la informacin que determina cul de las dos cadenas de DNA ser transcrita y el sitio donde se inicia la transcripcin (g. 11-7). La polimerasa se desplaza en la direccin 3' a 5' a lo largo de la plantilla de la cadena de DNA ensamblando una cadena complementaria antiparalela de RNA que crece desde el extremo terminal 5' en direccin 3' (fig. 11-5, a). Las polimerasas pueden formar RNA prodigiosamente largos. En consecuencia, la enzima debe permanecer fija al DNA sobre largos tramos de la plantilla (se dice que la enzima es de proceso). AI mismo tiempo, la asociacin de la enzima debe ser lo bastante laxa para que pueda desplazarse de un nucletido al siguiente en la plantilla. Como se indica en la figura 11-5, b, la RNA polimerasa cataliza la reaccin RNA,, + NPPP -> RNA, I+1 + PP (-> 2 P) en la cual los precursores trifosfato de ribonuclesido {NPPP) son hidrolizados para producir monofosfato de nuclesido

conforme se polimerizan en una cadena covalente. La hidrlisis de este enlace ster de fosfato es una reaccin altamente exergnica cuyo equilibrio se encuentra muy desplazado hacia la formacin de pirofosfato (PP). La reaccin est orientada adicionalmente en esa direccin por hidrlisis del pirofosfato mediante una pirofosfatasa para formar iones de fosfato inorgnico. Las reacciones que conducen a la sntesis de cidos nucleicos (y de protenas) son intrnsecamente diferentes a las del metabolismo intermediario estudiadas en el captulo 3, ya que es imperativo que la reaccin proceda en una sola direccin; o sea, la reaccin es prcticamente irreversible. En tanto que algunas de las reacciones que conducen a la formacin de molculas pequeas, como aminocidos, pueden estar muy cercanas al equilibrio que pueda medir una reaccin inversa considerable, las reacciones que conducen a la sntesis de cidos nucleicos y protenas deben ocurrir en condiciones donde prcticamente no haya reaccin inversa. Esta condicin puede cumplirse si se acoplan estas reacciones a la hidrlisis altamente exergnica de molculas como el pirofosfato. Conforme se desplaza la polimerasa a lo largo de la plantilla debe introducir el nucletido apropiado en cada sitio de la cadena creciente. La enzima presumiblemente puede seleccionar el trifosfato de ribonuclesido complementario que debe incorporar gracias a la capacidad del nucletido para formar la estructura estereoqumica apropiada con el nucletido en la cadena de DNA que se transcribe (fig. 11-5, b). Una vez que la polimerasa pasa sobre un sitio particular, se reconstituye la doble hlice de DNA (como en la figura 11-5, a); la cadena de RNA no permanece asociada a su plantilla como un hbrido de DN A-RN A (excepto para unos cuantos nucletidos justo detrs del sitio donde la polimerasa est operando). Una polimerasa de RNA bacteriano puede incorporar unos 50 nucletidos por segundo a una molcula de RNA en crecimiento. La microfotografa electrnica de la figura 11-5, c, muestra una molcula de DNA de un fago con cierto nmero de molculas de RNA polimerasa enlazadas. En este punto del anlisis es necesario diferenciar los procesos de transcripcin en clulas procariotas y eucariotas. Transcripcin en procariotes Las clulas procariotas contienen un solo tipo de RNA polimerasa compuesta de cinco subunidades firmemente asociadas para formar un ncleo enzimtico central. Si este ncleo enzimtico se purifica a partir de clulas bacterianas y se aade a una solucin de molculas de DNA bacterianas y ribonucletidos, la enzima se une al DNA y sintetiza RNA. Sin embargo, las molculas de RNA producidas por la polimerasa purificada no son iguales a las encontradas dentro de la clula porque el ncleo enzimtico se fija a sitios inapropiados en el DNA, sitios que normalmente seran ignorados en la clula. Sin embargo, si a la RNA polimerasa se aade un polipptido accesorio purificado \\amadofactor sigma (a) antes de fijarse al DNA, la transcripcin comienza en los sitios apropiados (fig. 11-6). La fijacin del factor sigma al ncleo enzimtico aumenta la afinidad de la enzi-

RNA naciente

(5'

Cadena de DNA en contrasentido * 5'

Subenrollamiento

Burbuja de transcripcin

Superen rol la miento

Terminal 5' del RNA

*5S5!""> - --. '-.-'' -- " . ,-.--'; --;;>- -. -.,.: <^g

fW KHilJKA I 1 -. Alargamiento de la cadena durante la transcripcin, a) Modelo esquemtico del alargamiento de una molcula de RNA recin sintetizada durante la transcripcin. En este modelo, el DNA gira conforme genera el transcrito y por lo tanto sufre arrollamiento excesivo por delante del sitio de incorporacin del nucletido y desenrollamiento detrs de ese sitiu. Este modelo se basa en la suposicin de que tanto la polimcrasa como el DNA se encuentran fijos al ncleo del armazn estructural interno (indicado por las barras negras), lo que evita su rotacin. La cadena de DNA transcrita se denomina cadena en contrasentido porque es complementaria de la de KNA, que contiene la informacin (determina el sentido), b) El alargamiento de la cadena ocurre como resultado de un ataque por el 3' OH del nucletido al extremo de la cadena en crecimiento sobre el 5' a fosfato del trifosfato de nuclesido en crecimiento. El pirofosfato liberado se desdobla a continuacin impulsando an mas la tendencia de la reaccin hacia la polimerizacin. La geometra del acoplamiento de bases entre el nucletido de la cadena de la plantilla y el nucletido en crecimiento determina cul de los cuatro posibles trifosfatos de nuclesido se incorporan a a cadena de l\NA en crecimiento en cada sitio, f) Micrografa electrnica de varias molculas de RNA polimerasa enlazadas a la plantilla de DjM A del fago, (u: Scyii /i. Fiitclicr, Trenas Genet. 4:271-272, 198S; c: cortesa ilc R.C. WUliaiiia.)

440

CAPITULO 11 Utilizacin de la informacin gentica: de a transcripcin a la traduccin Enzima del ncleo (contiene 5 subunidades)

^2^^^^^^^^

Falta de asociacin entre DNA y la enzima del ncleo. Las cadenas de RIMA iniciadas no comenzaron en los sitios apropiados

(a)
Enzima completa

Factor sigma

^^^7^^^^^^

(b)

Asociacin de la enzima completa con DNA en el sitio apropiado y abertura de una doble hlice

(c)

Prdida del factor sigma conforme la cadena RNA se alarga

FIGURA 1 1 -6. Inicio de la transcripcin en procariotes. a) En ausencia del factor sigma, la enzima central no puede interactuar con el DNA en los sitios especficos de inicio, b-d) Cuando la enzima central se asocia al factor sigma inicia la sntesis de RNA en los sitios apropiados. Despus el factor se disocia de la enzima central, que entonces puede sufrir alargamiento.

ma por los sitios promotores sobre el DNA y disminuye su afinidad general por DNA. Una vez iniciada la transcripcin, la subunidad sigma se separa de la plantilla de DNA, en tanto que la polimerasa contina ensamblando una cadena de RNA complementaria. Los promotores bacterianos se localizan en la regin de una cadena de DNA, justo antes {o en la parte alta) del sitio

donde se inici la sntesis de RNA.1 El anlisis de las secuencias de DNA en la parte alta de numerosos genes bacterianos indica dos tramos cortos similares de un gen al otro. Uno de dichos tramos contiene alrededor de 35 bases en la parte alta a partir del sitio de inicio y ocurre como una variacin de la secuencia TTGACA (fig. 11-7). Este sitio (conocido como regin -35) es la secuencia reconocida por el factor sigma relacionado con la polimerasa. Las clulas bacterianas poseen varios factores sigma diferentes que reconocen diversas versiones de la secuencia 35. El uso de diferentes factores sigma es un mecanismo que la clula utiliza para seleccionar una batera particular de genes para posible transcripcin. Por ejemplo, cuando las clulas E. coli se someten a una sbita elevacin de temperatura, sintetizan un nuevo factor sigma que reconoce una secuencia promotora distinta, lo que conduce a la transcripcin de una batera de genes de choque trmico. La segunda secuencia de consenso se presenta unas 10 bases hacia arriba del sitio de inicio y ocurre como variacin de la secuencia TATAAT (fig. 11-7). Este sitio, denominado segmento Pribnow por su descubridor, se encarga de identificar el nucletido preciso que iniciar la transcripcin. Aunque la mayor parte de las mutaciones en regiones promotoras reducen la tasa de transcripcin, ciertas sustituciones de bases en las regiones -35 y -10 pueden incrementar mucho esa tasa. Por o tanto, los promotores son algo ms que simples regiones de reconocimiento; actan como importantes sitios de control para regular la tasa de expresin de genes. As como la transcripcin se inicia en puntos especficos del cromosoma, tambin termina cuando se alcanza una secuencia especfica de nucletidos. En algunos casos, para concluir la transcripcin se requiere una protena llamada factor rho, pero en Ja mayor parte de los casos la polimerasa puede detener la transcripcin y liberar la cadena de RNA sin factores adicionales. Los sitios de terminacin independientes de rho poseen una secuencia notablemente similar en la regin precedente al sitio de conclusin. Esta regin incluye dos tramos de pares G-C dispuestos en forma de un par repetido invertido seguido por una hilera de adeninas en la cadena transcrita (fig. 11-8). Como consecuencia de esta simetra en su secuencia de bases, se asume que el extremo 3' del RNA naciente forma una asa en forma de gancho para el cabello (fig. 11-8} que impide el avance de la enzima. Los datos indican que la polimerasa se detiene cuando llega a esta regin. Esto suministra un buen ejemplo de la importancia de la estructura secundaria del RNA. Se cree que el tramo de nucletidos de! DNA que contiene adenina facilita la liberacin de la cadena de RNA, puesto que los pares de bases formados entre la U de una cadena de RNA y una A de la cadena de DNA son especialmente dbiles. Las mutaciones: 1) que debilitan la estructura del asa en forma de gancho de cabello, o 2) que fortalecen la interaccin entre la plantilla de DNA y el RNA transcrito en

1 El nucletido donde se inicia la transcripcin se denomina +1 y crece en direccin hacia arnba, que se escribe a la derecha. El nucletido que precede al sitio de inicio se denomina 1 y el nmero se vuelve cada vez ms negativo en direccin hacia arriba (a la izquierda).

CAPITULO 11 Utilizacin de la informacin gentica: de la transcripcin a la traduccin AATXXXXXXXJftX XXXXXXTTGACAXXXXXXXXXXXXXXXXXXXTAT XXXXXX Cadena de p-p^p ' RNA naciente 1A"X" X X X X X X A A C T G T X X X X X X X X X X X X X X X X X X X A T kr^0^ ^ r_ n\.t:ha X X X X X X Lauena ue id pianusia
T T A X X X X X X X | T X

441

Secuencia -35

Secuencia -10

Punto de inicio

FIGURA 11-7. Elementos bsicos de una regin promotora en el DNA de una bacteria E. coli. La secuencia reguladora clave requerida para el inicio de la transcripcin se observa en regiones localizadas a -35 y -10 pares de bases a partir del sitio donde se inicia la transcripcin.

la regin rica en U, pueden ser causa de que la polimerasa lea el sitio de terminacin.

11-3 Transcripcin y procesamiento del RNA en clulas eucariotas


Las clulas eucariotas poseen tres enzimas transcriptoras distintas, cada una encargada de la sntesis de diferentes grupos de RNA. La RNA polimerasa I sintetiza RNA ribosmico grande (28S, 18S y 5.8S); la RNA polimerasa II sin-

tetiza RNA mensajero y la mayor parte de los RNA nucleares pequeos (estudiados ms adelante); y la RNA polimerasa III sintetiza RNA de bajo peso molecular, incluyendo varios RNA de transferencia y el RNA ribosmico 5S. No se han encontrado procariotes con RNA polimerasas mltiples, en tanto que los eucariotes ms simples (levaduras) poseen los mismos tres tipos presentes en clulas de mamferos. Esta diferencia en el nmero de RNA polimerasas es otra aguda diferencia entre los dos tipos de clulas. Las polimerasas eucariotas son enzimas sumamente complejas que contienen de ocho a 14 polipptidos distintos

Cadena de la plantilla de DNA 5' 31 X-X-X-X-G-C-C-C-G-C-X-X-X^ X-X-X-X-C-G-G-G-C-G-X-X-X-X-X-X-X-C~G-C-C--G-A-A^W\-A A A A-X-X-X-X-X-X-X-X 3' 5'

Transcrito de RNA

Transcrito de RNA plegado para inducir terminacin

x X
X

x X
x

C-G G-C C-G C-G C-G G-C

5'

X X X X U U U U U U U U-OH

FIGURA 11-8. Terminacin independiente de Rho de la transcripcin en E. coli. La regin de terminacin contiene dos tramos de pares G-C dispuestos en forma de una unidad repetida inversa seguida por una hilera de adeninas en la cadena transcrita. Como resultado de esta secuencia de bases, el extremo 3' del RNA naciente puede formar una asa en forma de gancho para el cabello, que detiene el movimiento de la RNA polimerasa.

442

CAPITULO 11 Utilizacin de la informacin gentica: de la transcripcin a la traduccin CUADRO 1.1-1. Los RNA nucleares pequeos

RNA
Nucleoplasma Ul U2 U4 U5 U6 U7 Ull U12 7SK 8-2 Nuclolo U3 U8 U13 7-2

Funcin

Abundancia (copias/clula)

RNA polimernsi

Pre-RNAm ensamblador Pre-RNAm ensamblador Pre-RNAm ensamblador Pre-RNAm ensamblador Pre-RNAm ensamblador Histona pre-RNAm ensamblado? a Desconocida Desconocida Desconocida Pre-RNAt de procesamiento (Rnasa) Pre-RNAr de procesamiento Desconocida Desconocida Desconocida

1 x 106 5 x 105 2 x 105 2 x 105 4 x 105 5 x 103 1 x 104 5 x 103 2 x 105 1 x 105 2 4 1 1 x 105 x 1CH x 104 x 105

11 II II II III II II II III III lili II III

* U3 se sintetiza por accin de la RNA polimerasa III en plantas. FUENTE: S.J. Baserga y J.A. Steitz, RNA World, R.F. Gesteland y J.F. Atkins. eds. Cold Spring Harbor Laboratory Press, 1993.

(subunidades), y son lo bastante grandes para visualizarse con facilidad en las micrografas electrnicas (fig. 11-5, c). Adems de las subunidades que constituyen las enzimas, cada una de las polimerasas se auxilia durante su operacin con varias protenas auxiliares denominadas factores de transcripcin. Se pueden distinguir dos categoras amplias de factores de transcripcin: factores generales de transcripcin, requeridos para que la polimerasa inicie la transcripcin, y factores especficos de transcripcin (o protenas reguladoras de genes) que determinan la tasa de transcripcin de un gen o grupo particular de genes. El mecanismo de accin de los factores especficos de transcripcin se encuentra en el verdadero centro del proceso de expresin selectiva de genes y se analiza con detalle en el captulo 12. Los tres tipos de RNA polimerasa eucariota pueden distinguirse segn su sensibilidad a la a-amanitina, octapptido sumamente txico (ocho aminocidos unidos). La C!-amanitina se aisla de un hongo venenoso comn, Amanita phalloides, que tambin es fuente de la faloidina, toxina para microfilamentos (pg. 357). La actividad de la RNA polimerasa II es muy sensible a la amanitina-alfa, en tanto que la RNA polimerasa I no es afectada por ese compuesto. La RNA polimerasa III se inhibe en menor grado que la RNA polimerasa II. Una persona envenenada por ingestin de estos hongos no muestra sntomas inmediatos, sino que la funcin heptica se deteriora en los das subsecuentes debido a la falta de produccin de un nuevo RNAm necesario para controlar la sntesis continua de protenas. En casos graves, la nica manera de salvar la vida de la persona puede ser un trasplante heptico. Los tres principales tipos de RNA se derivan de molculas de un precursor de RNA considerablemente mucho

mayor que el producto RNA "maduro". La molcula de RNA inicialmente sintetizada, de longitud equivalente a la longitud completa del DNA transcrito, se denomina transcrito primario, o pre-RNA. El segmento de DNA correspondiente sobre el cual se transcribe el transcrito primario se denomina unidad de transcripcin. Tpicamente, los transcritos primarios tienen existencia fugaz y son procesados para formar RNA funcional ms pequeo mediante una serie de reacciones de procesamiento. El procesamiento del RNA requiere varios RNA pequeos (90 a 300 nucletidos de largo) y sus protenas relacionadas. Los RNA se denominan RNA nucleares pequeos (RNAnp) debido a su corto tamao y a que funcionan dentro del ncleo. No hay ms de una docena de diferentes RNAnp; las especies mejor definidas se muestran en el cuadro ^1-1. (La U en el nombre del RNA indica que es rico en nucletidos que contienen uracilo.) En las siguientes secciones examinaremos las actividades relacionadas con la transcripcin y procesamiento de cada uno de los RNA cucariotas principales.

RNA ribosmico
En la pgina 408 se mencion el DNA que codifica al RNA ribosmico como parte de una fraccin moderadamente repetida del genoma. Las clulas eucariotas contienen millones de ribosomas, cada uno con varias molculas de RNAr junto con docenas de protenas ribosmicas. En realidad, ms de 80% del RNA de una clula consta de RNA ribosmico. Para suministrar a la clula un nmero tan grande de transcritos, las secuencias de DNA que codifican

CAPITULO 11

443

RNAr normalmente se repiten cientos de veces. Este DNA, llamado DNAr, de ordinario se agrupa en una o unas pocas regiones del genoma (fig. 11-9). En la clula en inferase (o sea, que no se encuentra en estado de divisin), los racimos de DNAr se agrupan como parte de una o ms estructuras nucleares de forma irregular denominadas nuclolos, que funcionan corno organelos productores de ribosomas. Los nuclolos desaparecen durante la mtosis y luego reaparecen en el ncleo de as clulas hijas alrededor de las partes del genoma que contienen genes de RNA ribosmico. Por consiguiente, las regiones del cromosoma que contienen DNAr se denominan organizadores nucleolares. Como se indic en la micrografa electrnica de la figura 11-10, la masa del nuclolo se compone de partculas de unos 15 a 20 nm de dimetro que confieren al nuclolo un aspecto granuloso. Integrados en esta masa granular se encuentran uno o ms corpsculos redondos que consisten principalmente en material fibrilar. En breve mostraremos la base molecular de las regiones fibrilar y molecular.
FIGURA 11-10. Estructura del nuclolo. Micrografa electrnica de una seccin del ncleo con su nuclolo. La masa del nuclolo consta de un componente granular (ge). Integrados dentro de los granulos se encuentran centros fibrilares (fe) rodeados por un componente fibrilar ms denso (dfc). Segn un modelo actual, la transcripcin del precursor RNA ribosmico tiene lugar en e borde situado entre fe y dfc. Barra, 1 //m. (Segn Pavel Hozak \ cois. }. Cell Science 107:641, 1994; con permiso de Company of BioSogists Ltd.)

Sntesis de los precursores de RNAr

De ordinario, los oocitos son clulas muy grandes (p. ej., 100 /m de dimetro); los de anfibio en general son enormes (ms de 2.5 mm de dimetro). Durante el desarrollo de oocitos de anfibios, el DNAr se amplifica selectivamente y aumenta mucho el nmero de nuclolos que alojan los genes de RNAr (fig. 11-11, a). Este paso de amplificacin del DNA es necesario para suministrar el gran nmero de ribosomas necesarios para que el huevo fertilizado inicie su desarrollo embrionario. Debido a que estos oocitos contienen cientos de nuclolos, cada uno elaborando activamente RNAr, son sujetos ideales para estudiar sntesis y procesamiento de los RNAr. Los centros fibrilares de los nuclolos del oocito se pueden apartar cuidadosamente para revelar la presencia de una fibra circular. Cuando se examina esta fibra en el micrescopio electrnico muestra un aspecto que recuerda una cadena de "rboles de Navidad" (fig. 11-11, b). El examen de una parte de la fibra con mayor amplificacin (fig. 11-11, c) revela algunos aspectos de la actividad nucleolar y la sntesis de RNA ribosmico.
FIGURA 11-9. Localizacin experimental mediante hibridacin n sitn del DNA que codifica RNA ribosmico en el anfibio Xeuopus. Se aisl DNA ribosmico y se utiliz como plantilla para sintetizar RNA in vitro complementario marcado con istopos radiactivos. A continuacin el RNA marcado se hibridiz con DNA desnaturalizado de una preparacin de cromosomas de Xenopus, y la Idealizacin de la radiactividad enlazada se determin mediante autorradiografa. El DNA que codifica RNAr se localiza en uno o ms sitios donde se forman nuclolos (por lo tanto, estos sitios se denominan organizadores nucieolares). Puesto que los organizadores nucleolares de ambos miembros de un par homlogo de cromosomas Xenopus se unen entre s, la radiactividad aparece localizada en un sitio sobre el juego de cromosomas (flecha). (Segn Mari/ Lew Pardue, Cold Spring Harbor Symp. Quant. Biol. 35:476, 1973.)

1. La micrografa de la figura 11-11, b, muestra genes distintos para RNA ribosmico situados uno despus del otro a o largo de una molcula simple de DNA, o que revela la disposicin en fila de los genes de RNAr repetidos. 2. La micrografa de la figura 11-11, b, muestra una imagen esttica de lo que ocurre en el nuclolo. Podemos interpretar esta fotografa para obtener mayor informacin respecto del proceso de transcripcin del RNAr. Cada una de las casi 100 fibrillas que surgen del DNA como rama del "rbol de Navidad" es un transcrito del RNAr naciente sorprendido en el acto de alargamiento.

444

CAPITULO 11 Utilizacin de la informacin gentica: de a transcripcin a la traduccin Nuclolos

(b)
(a)

2 |jm

FIGURA 11-11. Sntesis del RNA ribosmico. a) Micrografa tomada con microscopio de luz de un ncleo aislado do un oocito de Xenopus teido para revelar los cientos de nuclolos, b) Micrografa electrnica de un segmento de DNA aislado de uno de los nuclolos de un oocito de Xenopus. El DNA (llamado DNAr) contiene los genes que codifican los dos RNA ribosmicos grandes, seccionados de un solo transcrito primario. Se muestran varios genes, cada uno en el proceso de transcripcin, lo cual se manifiesta por las fibrillas fijas al DNA. Estas fibrillas constan de RNA naciente y protenas relacionadas. Los tramos de DNA entre los genes transcritos son espaciadores no transcritos, c) Vista ms cercana de dos genes nucleolares en el momento de ser transcritos. La longitud del transcrito primario de RNAr en crecimiento aumenta conforme crece la distancia a partir del punto de inicio. Se pueden observar las molculas de RNA polimerasa como puntos en la base de cada fibrilla, (a: Segn David D. Brown c Igor B. Daivid, Science 360:272, 1968; copyright 1968 por American Association for the Advancement of Science, b-c: cortesa de Osear L. Mier, }r. y Barbara R. Beatty.)
(c)

0.5 vim

El granulo oscuro en la base de cada fibrilla, visible con mayor resolucin en la fotografa de a figura 11-11, c, es la molcula de la RNA polimerasa I encargada de la formacin de dicho transcrito. La longitud de las fibrillas aumenta gradualmente de un extremo al otro del "tronco del rbol de Navidad". Las fibrillas ms cortas son molculas de RNA con menor nmero de nucletidos fijos a molculas de polimerasa que a su vez estn enlazadas al DNA ms prximo al sitio de inicio de la transcripcin. Cuanto ms larga la fibrilla ms cerca se encuentra de completar el transcrito. La longitud del DNA entre las fibrillas de RNA ms cortas y ms largas corresponde a una sola unidad de transcripcin. El promotor se sita justo arriba del sitio donde se inicia la transcripcin. La elevada densidad de las molculas de

RNA polimerasa a lo largo de cada unidad de transcripcin (casi una cada 100 pares de bases de DNA) refleja la elevada tasa de sntesis de RNAr en los nuclolos de estos oocitos. 3. En las micrografas electrnicas se puede observar que las fibrillas de RNA contienen grumos y partculas acompaantes. Estas partculas constan de RNA y protena que participan en la conversin de los precursores de RNAr a su producto final RNAr y su ensamblado en subunidades ribosmicas. 4. En la figura 11-11, b, se puede notar que la regin de la fibra de DNA entre unidades de transcripcin adyacentes est desprovista de cadenas de RNA nacientes. Debido a que esta regin de agrupamientos de genes ribosmicos no se transcribe, se le conoce como espa-

CAPITULO 11 Utilizacin de la informacin gentica: de la transcripcin n la traduccin

445

ciador no transcrito. Los espaciadores no transcritos se presentan en varias unidades repetidas, grupos de genes, incluyendo los de RNAt, e histonas. Debido a su organizacin en fila, todos los genes del grupo pueden estar bajo control comn, de modo que se puede echar a andar o desconectar simultneamente toda una batera de genes.
Procesamiento del precursor de RNAr

Los ribosomas eucariotas tienen cuatro RNA ribosmicos distintos, tres en la subunidad grande y uno en la subunidad pequea. En el hombre, la subunidad grande contiene una molcula RNA 28S, una 5.8S y una 5S, en tanto que la subunidad pequea contiene una molcula RNA 18S.2 Tres de estos RNAr (285,18S y 5.8S) se derivan de un solo transcrito primario (denominado pre-RNA), mostrado en la figura 11-12. El RNAr 5S se sintetiza a partir de un precursor RNA separado fuera del nuclolo. Iniciaremos con el primer grupo de tres. Durante el procesamiento, varias enzimas que hidrolizan enlaces fosodister especficos del esqueleto de RNA desdoblan el pre-RNAr. Una de las peculiaridades del preRNAr, en comparacin con otros transcritos de RNA, es su alto grado de metilacin. En el momento que el precursor pre-RNAr sufre su primer desdoblamiento, ms de 100 grupos metilo se han aadido ya a la molcula. Casi todas las metilaciones ocurren sobre la ribosa, aunque unos pocos

2 El valor S (o unidad Svedberg) se refiere al coeficiente de sedimentacin del RNA; cuanto mayor sea el nmero, ms rpidamente se desplaza la molcula a travs de un campo de fuerza durante la centrifugacin y (para un grupo de molculas qumicamente similares) mayor ser el tamao de la molcula. Los RNA 28S, 18S, 5.8S y 5S consisten en nucletidos de longitud aproximada a 5 000, 2 000, 160 y 120 nucletidos, respectivamente.

radicales metilo se colocan sobre bases especficas. Los nucletidos que contienen los grupos metilo se localizan en posiciones especficas y se agrupan en porciones de la molcula. Todos los nucletidos del pre-RNAr metilados permanecen como parte de los productos finales, en tanto que las secciones no metiladas se destruyen durante el procesamiento. La presencia de los grupos metilo probablemente proteja estas regiones del RNA contra el desdoblamiento enzimtico, sea directamente o como resultado de cambios impuestos a !a estructura secundaria del RNA. Debido a que el RNAr sufre una metilacin tan intensa, se puede seguir su sntesis incubando clulas con el aminocido metionina, cuyos grupos metilo se marcan con istopos radiactivos. La metionina se emplea en el metabolismo como grupo donador de metilo; el grupo metilo se transfiere a la metionina mediante la accin de varias enzimas sobre un aceptor especfico, incluyendo el pre-RNAr. Cuando se suministra 14C-metionina a un cultivo de clulas de mamfero durante breve tiempo, se incorpora una fraccin considerable de radiactividad a la molcula de RNA 45S, que corresponde a una longitud de casi 13 000 nucletidos. El RNA 45S es precursor de las molculas 28S, 18S y 5.8S. La longitud combinada de los tres RNAr maduros es de aproximadamente 7 000 nucletidos, poco ms de la mitad del transcrito primario. Los intermediarios formados a lo largo de la va de procesamiento, desde el pre-RNAr 45S hasta el RNAr maduro, se pueden descubrir incubando brevemente clulas de mamfero con metionina marcada y luego siguiendo las clulas en un medio no marcado durante diferentes periodos (fig. 11-13). En este tipo de experimento, la primera especie en ser marcada es el transcrito primario 45S, observado luego de 10 minutos como un pico de radiactividad (lnea punteada) en la fraccin de RNA nucleolar. Luego de un breve periodo, la radiactividad aparece en varias molculas de

Rana

Ratn

25kb

FIGUKA 11-12. Unidad de transcripcin del RNAr. La parte superior del dibujo muestra el aspecto de una porcin del DNA procedente de un nuclolo conforme es transcrito por el RNAr. En la parte inferior se ilustra una de las unidades de transcripcin que codifica el RNAr en Xenopus y en el ratn. Las partes del DNA que codifican los productos RNAr maduros se muestran en azul. Las regiones de espaciador transcrito, o sea, porciones del DNA transcritas pero cuyos RNA correspondientes son degradados durante el procesamiento se muestran en amarillo. El espaciador no transcrito, situado entre las unidades de transcripcin, contiene la regin promotora en el lado 5' del gen y un amplificador (una regin de DNA que aumenta la velocidad de transcripcin). (Segn B. Sollner-Webb, Trends Biochem. Sci. 16:59, 991.]

446

CAPITULO 11 Utilizacin de la informacin gentica; de la transcripcin a la traduccin

10

20

10

20

10

20

10

Nmero de fraccin FIGURA 11-13. Anlisis cintico de la sntesis y procesamiento del RNAr. Durante 10 minutos se incub un cultivo de clulas de mamfero con metionina marcada con 14C y a continuacin se observ en un medio sin radiactividad durante diferentes periodos, corno se indica en cada recuadro. Despus del seguimiento, las clulas se lavaron para liberarlas del istopo y se homogeneizaron para preparar las fracciones nucleolar y citoplsrm'ca. De cada fraccin se extrajo RNA que se analiz mediante ultracentrifugacin para separar el RNA segn su tamao (cuanto ms grande el RNA, ms prximo se encuentra al fondo del tubo, el cual corresponde a la fraccin 1). La lnea continua representa la absorbancia UV de cada fraccin celular que suministra una medida de la cantidad de RNA de cada tipo. Este perfil de absorbancia no cambia con el tiempo. La lnea punteada muestra la radiactividad en diferentes momentos durante el seguimiento. Las grficas de RNA nucleolar (perfiles de arriba) muestran la sntesis del precursor RNAr 45S y su subsecuente conversin a una molcula 32S, un precursor del RNAr 28S. Los otros productos principales del precursor 45S dejan el ncleo con gran rapidez y, por lo tanto, no se muestran de manera prominente en el RNA nucleolar. Los perfiles de abajo muestran el curso temporal de la aparicin de las molculas de RNAr maduras en el citoplasma. El RNAr 18S aparece en el citoplasma mucho antes que las especies 28S de mayor tamao, lo que se correlaciona con la rpida salida del primero desde el nuclolo. (Segn H. Greenberg y S. Penman, ]. Mol. Biol. 21:531, 1966.)

RNA ms pequeas {fig. 11-13), lo que indica el desdoblamiento del precursor ms grande en productos en la va hasta la formacin de las especies de RNA maduras. El intermediario de vida ms prolongada sedimenta a 32S y se observa como un pico distinto en el RNA nucleolar luego de 40 a 150 minutos. El RNA 32S sirve como precursor del RNAr 28S. Una de las vas en el procesamiento de la transcripcin primaria de RNAr se indica en la figura 11-14. El procesamiento del pre-RNAr se efecta conforme la molcula se asocia firmemente a las partculas de ribonucleoprotena {RNP), lo cual, como se indica en la mcrografa de la figura 11-11, c, ocurre incluso antes de completarse la transcripcin del precursor 45S. Las partculas de ribonucleoprotenas se ensamblan en el citoplasma y posteriormente se desplazan al interior del ncleo y despus a los nuclolos. La primera partcula RNP que se fija al transcrito RNAr contiene el RNAsn U3 que se enlaza al extremo terminal 5' del transcrito RNAr. Esta partcula de RNA se puede obser-

var como una "pelota" situada en el extremo externo de las fibrillas de RNA nacientes mostradas en la figura 11-11, c, donde cataliza la eliminacin del extremo 5' del transcrito (fig. 11-14). El nuclolo no slo es sitio de procesamiento de RNAr, sino tambin de ensamblado de las dos subunidades ribosmicas. Por consiguiente, conforme se procesa el RNA se asocian dos tipos de protenas: las protenas que permanecern en la subunidad ribosmica y las protenas del nuclolo que interactan transitoriamente con los RNAr intermedios y slo se requieren para el procesamiento. Adems de las enzimas que desdoblan con xito al RNA, se cree que este ltimo grupo tambin contiene protenas que protegen los sitios donde ocurre el desdoblamiento y otras que hacen a dichos sitios ms accesibles al procesamiento enzirntico. Iniciaremos esta seccin acerca de la sntesis del RNAr con una descripcin de la estructura microscpica del nuclolo, al cual regresamos. El nuclolo tiene estructura

CAPITULO 11 Utilizacin de la informacin gentica: de a transcripcin a la traduccin

447

FIGURA 11-14. Esquema para el procesamiento del RNA ribosmko de mamferos. El transcrito primario para RNAr es una molcula 45S de casi 13 kilobases. Los cuatro principales sucesos de desdoblamiento que ocurren durante el procesamiento de este pre-RNAr estn indicados por los nmeros en crculos. El desdoblamiento del transcrito primario en el sitio 1 elimina la secuencia terminal principal 5' y produce un intermediario 41S. El segundo desdoblamiento puede ocurrir en el sitio 2 o en el 3, segn el tipo de clula. El desdoblamiento en el sitio 3 genera un intermediario 32S observado en las curvas de la figura previa. Los pasos finales del procesameinto implican la separacin de las secciones 28S y 5.8S entre s. (Segn R.P. Pernj, J. Cell Biol. 91:29s, 1981; con permiso de Rockefeler University Press.)

'

5.8S

simple y carece de un componente membranoso, por lo que es uno de los organelos celulares mejor comprendidos. La parte central fibrilar del nuclolo (fig. 11-10) consiste en transcriptos de DNAr y RNAr nacientes. Los granulos que rodean este centro constan de subunidades ribosmicas en varias etapas de maduracin. Cuando se suministra a las clulas 3H-uridina y se practica autorradiografa en diferentes momentos de la incubacin (como se describi para las protenas secretorias en la pgina 279), la radiactividad aparece primero en las regiones fibrilares, lo que indica que son los sitios de sntesis de RNA. Como sera de esperar, conforme el tiempo de incubacin aumenta, la radiactividad se desplaza hacia afuera al interior de las regiones granulares. Sntesis y procesamiento del RNAr 5S El RNAr 5S, de 120 nucletidos de largo aproximadamente, forma parte de la subunidad ribosmica grande. En los ribosomas de procariotes y eucariotes se encuentra una especie de RNA similar. En clulas eucariotas, los genes RNAr 5S estn totalmente separados de los genes que codifican los otros RNAr y se localizan fuera del nuclolo. Estos genes se organizan en fila con las posiciones transcritas, alternando con espaciadores no transcritos para formar unidades repetidas (fig. 11-15) anlogas a las unidades repetidas que codifican los RNAr 18S y 28S. La RNA polimerasa III transcribe os genes RNAr 5S. El extremo 5' del transcripto primario es idntico al del RNAr 5S maduro, pero el extremo 3' de ordinario contiene nucletidos extra que son eliminados durante el procesamiento. Luego de su sntesis, el RNAr 5S se transporta al nuclolo para unirse a los otros componentes que participan en el ensamblado de subunidades ribosmicas. De las tres polimerasas, la RNA polimerasa III raras veces se enlaza a un sitio promotor localizado dentro de la porcin transcrita del gen en vez de un sitio hacia arriba en el flanco 5' del gen, que sera el sitio "lgico" donde la enzima se enlaza inicialmente al DNA, El uso de un promotor interno se demostr claramente introduciendo genes

RNAr 5S modificados en la clula husped y determinando la capacidad del DNA para servir como plantilla de la polimerasa III del husped. Se observ que poda eliminarse toda la regin del flanco 5' y que la polimerasa todava transcriba el DNA iniciador en el sitio normal de inicio. Sin embargo, cuando la supresin incluye la parte central del gen (desde el nucletido 50 al 80 de los casi 120 pares de bases del gen), la polimerasa no transcribe el DNA y ni siquiera se enlaza al mismo. Si el promotor interno del gen RNAr 5S se introduce en otra regin del genoma, el nuevo sitio se convierte en plantilla para la transcripcin de la RNA polimerasa III. Se requieren tres factores distintos de transcripcin antes que la RNA polimerasa III inicie la transcripcin de un gen codificador de RNArSS. Uno de los factores (TFIIIA) es especfico para iniciar la transcripcin de RNA 5S, en tanto que los otros dos factores (TFIIIB y TFIIIC) son necesarios para iniciar la transcripcin de todos los RNA sintetizados por la RNA polimerasa III.

RNA de transferencia
Se estima que las clulas eucariotas tienen aproximadamente 60 especies diferentes de RNA de transferencia, cada una

Hindlll

H/ndIII

FIGURA 11-15. Unidad repetida del DNA que contiene el gen RNAr 5S en Xenoptts. El gen que codifica el RNAr 55 se muestra en azul. El fragmento de DNA mostrado en esta figura se gener por tratamiento del DNA genmico (DNA extrado de los cromosomas) con la enzima de restriccin HmdlII. La porcin roja representa un sitio en el cual pueden existir algunas secuencias pequeas repetidas.

448

CAPITULO 11 Utilizacin de n informacin gentica; de la transcripcin a la traduccin

codificada por una secuencia de DNA repetida varias veces dentro del genoma. El grado de repeticin vara con el organismo; se estima que las clulas de una levadura tienen casi 300 genes de RNAt en total, la mosca de la fruta casi 850 y el hombre cerca de 1 300. El RNA de transferencia se sintetiza a partir de genes localizados dentro de pequeos grupos dispersos alrededor del genoma. Un soio grupo tpicamente contiene mltiples copias de diferentes genes de RNAt, e inversamente, la secuencia de DNA que codifica un RNAt de ordinario se encuentran en ms de un grupo. Dentro de un grupo, el DNA (DNAt) consta principalmente de secuencias espaciadoras no transcritas junto con el RNAt que codifica las secuencias situadas a intervalos irregulares en disposicin en serie repetida (fig. 11-16). La RNA polimerasa III transcribe los RNAt, igual que el RNAr 5S, y la secuencia promotora del gen se sita dentro de la seccin codificante de ste en vez de localizarse en su flanco 5'. El transcrito primario de una molcula de RNA de transferencia es mayor que el producto final y deben seccionarse los fragmentos sobre ambos extremos 5' y 3' del RNAt precursor (y un fragmento interior en algunos casos). Todo RNAt maduro posee un tripleto con secuencia CCA en su extremo 3'. Luego de procesar el RNAt, los tres nucletidos se aaden por medio de enzimas. RNA mensajero Las molculas de RNA de una clula constan de RNAr, RNAt y RNAsn. Pero cuando se incuban clulas eucariotas durante breve tiempo (cinco minutos) en 3 H-urdina o 32Pfosfato, la cantidad de radiactividad incorporada a estos RNA particulares o sus precursores es relativamente escasa {fig. 11-17, a). Casi toda ia radiactividad se incorpora a un grupo mayor de molculas de RNA que muestran las siguientes propiedades. 1) Peso molecular elevado (ms de SOS o 50 000 nucletidos); 2) en conjunto, corresponden a RNA con diversas secuencias de nucletidos (heterogneos); y 3) slo se encuentran en el ncleo. Debido a estas propiedades, este RNA se conoce como RNA nuclear heterogneo (RNAhn). Cuando se colocan clulas incubadas en 3Huridina o 32 P-fosfato durante un breve lapso (pulso) en un medio sin elementos marcados y se les "sigue" durante una hora aproximadamente antes de destruirlas y extraer su RNA, la radiactividad desciende bruscamente en los RNA nucleares grandes y aparece en los RNA citoplsmicos ms pequeos (fig. 11-17, b).

Q O

(a)

Nmero de fraccin

I o
Q O

5.0

3.0

1.0
10
fW

20

30

r;

Nmero de fraccin FIGURA 11-17. Formacin de RNA nuclear heterogneo (RNAnh) y su conversin a RNAm ms pequeo, a) Curvas que muestran el patrn de sedimentacin del RNA total extrado de las clulas sanguneas de patos luego de exponerlo a fosfato marcado con 32P durante 30 minutos. El RNA ms grande es el que se desplaza mayor distancia durante la centrifugacin y se deposita lo ms cercano al fondo del tubo. La absorbancia (lnea de color prpura) indica la cantidad total de RNA en diferentes regiones del tubo de centrifugacin, en tanto que la lnea roja indica la radiactividad correspondiente. Es evidente que la mayor parte del RNA recin sintetizado es muy grande, mucho mayor que los RNAr 28S y 18S estables. Los RNA grandes son los RNAnh. b) Perfiles de absorbancia y radiactividad del RNA extrado de clulas sometidas a un pulso de 30 minutos en un medio con radiactividad como en la parte n, luego seguido por tres horas en presencia de actinomicina D, que evita la sntesis de RNA adicional. Es evidente que el RNAnh grande se ha procesado para formar productos RNA ms pequeos. (Segn G. Attardi, H. Parns, M}. Hwang y B. Attardi, J. Mol. Biol. 20:160, 1966.)

1 kb
Tir*__-!_- U

2 kb I

Met-A Met-B >-

-4-1

]
Asn

Fen

3 kb 1 Leu>- Lis>GD O Ala

FIGURA 11-16. Disposicin de los genes que codifican RNA de transferencia en Xenopus. Segmento de 3.18 kilobases de DNA genmico que muestra la disposicin de varios genes de RNAt y de los espaciadores. (Segn S.G. Clarkson y cois., en D.D. Brmun, ed., Developmental Biology Using Purified Genes, Academic Press, 1981.)

Cuando se efectuaron por primera vez estos experimentos en el decenio de 1960, se interpretaron como la demostracin de una relacin "precursor-producto" entre el RNAnh del ncleo y los RNAm citoplsmicos. Segn estos estudios, se propuso que el RNAm no se sintetiza como cuando se une a ribosornas citoplsmicos, sino ms bien como parte de molculas mucho mayores de RNAnh. Posteriormente esta interpretacin fue confirmada por los resultados de muchos trabajos de investigacin en los ltimos 25 aos. Por lo tanto, aunque el RNAm (y sus precursores RNA nucleares heterogneos) slo constituye un pequeo porcentaje de! RNA total, en la mayor parte de las clulas eucariotas significa, en todo momento, un elevado porcentaje del RNA sintetizado en dichas clulas ffig. 11-17, a). El RNAnh es sumamente

CAPITULO 11 Utilizacin de la informacin gentica: de la transcripcin a la traduccin

449

inestable (por su rpido procesamiento en el ncleo); el RNAm es relativamente inestable (debido a su descomposicin en el citoplasma); los RNAr y RNAt son relativamente estables, y por lo tanto se acumulan gradualmente y as llegan a ser la especie predominante dentro de la clula.
Mecanismo utilizado para la transcripcin de RNAm

Ovalbmina de pollo Globina^ de conejo Globina/3 principal de ratn

\i/
JtX

-\j>\j

CCCCAGGGCTCAGCCAGTGTCTGTCA GCAGAGCAGGGCAGCTGCTGCTAJCACT TGAGGTAGGATCAGTTGCTCCTCSCATTT

La RNA polimerasa II sintetiza a todos los RNAm precursores con ayuda de algunas protenas auxiliares denominadas factores generales de transcripcin, cuyo papel preciso an no se define. Estas protenas se conocen como factores "generales" de transcripcin porque son las mismas requeridas por la polimerasa para la transcripcin de diversos arreglos de genes. El promotor de la polimerasa II se sita en el lado 5' de la unidad de transcripcin. En la mayor parte de los genes estudiados, la porcin ms crtica del promotor (denominada elemento promotor central) se sita entre las bases 24 y 32 hacia arriba a partir del sitio en el cual se inicia la transcripcin (fg. 11-18, a). Esta regin contiene una secuencia de bases idntica a otra del oligonucletido 5'-TATAAA3', tambin conocida como compartimiento TATA. El compartimiento TATA del DNA es el sitio donde se ensambla un complejo preinicial que contiene los factores generales de transcripcin y la polimerasa. El complejo preinicial debe ensamblarse antes de comenzar la transcripcin del gen. El primer paso en el ensamblado del complejo preinicial es la unin de una protena, denominada protena de enlace TATA (PET), que reconoce especficamente la secuencia de DNA de los promotores eucariotas. El dominio de enlace a DNA de la PET se compone de una lmina /3 de 10 cadenas (pg. 56), incurvada para formar una estructura en forma de silla de montar donde cabalga el DNA (fig. 11-18, b). La PET no acta por s misma, ms bien sirve como subunidad para algunos factores de transcripcin de mltiples protenas. Cuando forma parte del complejo multiprotena TFIID (factor de transcripcin de la polimerasa II de la protena D), la PET reconoce especficamente la secuencia de DNA de un promotor polimerasa II. La cristalografa de rayos X ha revelado que el enlace de la PET a un promotor polimerasa II causa deformacin espectacular de la conformacin del DNA (fig. 11-18, c). El DNA enlazado genera un claro retorcimiento en toda su longitud, y el doblete de DNA se desenrolla en un tramo de ocho pares de bases. Es probable que este cambio de conformacin del DNA desempee un papel importante para el subsecuente inicio de la transcripcin, que requiere una separacin de la doble cadena de DNA para permitir la entrada de la polimerasa a la cadena que acta como plantilla. Por lo tanto, el primer paso en la sntesis de un complejo preinicial para polimerasa II es la unin de TFIID al promotor de DNA. El enlace de TFIID prepara el escenario para la unin ordenada de otros factores de transcripcin y de la polimerasa para formar el complejo preinicial completo. En la figura 11-19 se muestra un modelo para el enlace secuencial de estos diferentes factores. Una vez iniciada la transcripcin, algunos de los factores generales (especficamente TFIIB y TFIID) quedan detrs del promotor y otros permanecen asociados a la polimerasa conforme avanza sobre la plantilla (fig. 11-20). En tanto la TFIID permanezca enlazada al promotor, las molculas adicionales de RNA polime-

(a) NH5

COOH

FIGURA I 1 -1 i. El segmento TATA en los promotores eucariotas. a) Secuencia de nucletidos de la regin justo arriba del sitio donde se inicia la transcripcin en tres genes eucariotas diferentes. El segmento TATA est indicado por el sombreado verde y el nucletido en el cual se inicia la transcripcin por el sombreado rojo. i>) Estructura tridimensional de la protena de unin a TATA (PUT) de la planta en floracin Arabidopsis thaliana colocada a horcajadas sobre el DNA. c) El enlace de PUT se acompaa de notable distorsin en la conformacin de la hlice de DNA que desenrolla un tramo de ocho pares de bases, (b: Segn S. Burley y cois. Cold Spring Harbor Symp. Quant Biol. 58:124, 1993; c: reimpreso con permiso de K. Struhl, Science 263:1104, 1994. Copyright 1994 por American Association for the Aduancement of Scieyce,)

rasa pueden fijase al sitio promotor e iniciar sin retraso vueltas adicionales de transcripcin. El dominio C terminal (DCT) de la subunidad ms grande de RNA polimerasa II tiene una estructura poco habitual; consta de una secuencia de siete aminocidos (Tir-SerPro-Tre-Ser-Pro-Ser-) repetida una y otra vez. En mamferos, el DCT consta de 52 unidades repetidas de este heptapptido. De los siete aminocidos, todos menos las dos prolinas son candidatos primarios para fosforilacin mediante proteincinasas. Los estudios indican que la RNA polimerasa que ensambla el complejo preinicial no est fosforilada, en tanto que la misma enzima que participa en la transcripcin est intensamente fosforilada; todos los gru-

450

CAPITULO 11 Utilizacin de la informacin gentica: de la transcripcin a la traduccin -- Sitio de inicio


DNA

TFIIE TFIIjlTFIIF
TFIID

TATA TFIID TFIIH


DNA

DNA

DNA

DNA

TATA

TFIIF RMAI1 polimerasa (RNAP1I)

DNA

FIGURA 11-20. Inicio de la transcripcin por la RNA polimerasa II precedida por fosforilacin del dominio terminal C (DTC). Se cree que la fosforilacin de la polimerasa provoca la separacin del complejo de transcripcin de los factores generales de transcripcin que permanecen en el segmento TATA.

TRIE TFUjlTFIIF TFIID *- Sitio de inicio

DNA
TATA FIGURA 11-19. Etapas propuestas en el ensamblado del complejo de inicio para la RNA polimerasa II en el segmento TATA de un promotor eucariota. La polimerasa en s se denota con RNAPII; los otros componentes son los diferentes factores generales de transcripcin requeridos en el ensamblado de todo el complejo. (Segn B.M.. Herschbach y A.D. Johnson, reproducido con permiso de Annual Reviciv of Cell Biology, vol. 9, 1993, por Annual Revieras Inc.)

cadenas de DNA del doblete para que la polimerasa prosiga a lo largo de la cadena sencilla de la plantilla. De igual manera que el segmento Pribnow de los procariotes, al cual se parece, el segmento TATA determina el sitio preciso donde se inicia la transcripcin. Si se alteran o borran partes del segmento y luego se ensayan como plantillas en diferentes tipos de sistemas de prueba, la transcripcin se inicia en varios sitios anormales. Otros muchos sitios del gen localizados hacia arriba desempean un papel clave para determinar a qu velocidad inicia la enzima nuevos turnos de transcripcin a partir del segmento TATA. El papel de estos sitios se analiza en el captulo acerca del control de la expresin de genes (seccin 12-3). ^
Estructura de los RNAm

pos fosfato se localizan en el DCT (fig. 11-20). Pareciera que la RNA polimerasa II se fosforilara justo antes de iniciar la transcripcin. Los datos indican que la fosforilacin de la polimerasa es catalizada por una subunidad de uno de los factores de transcripcin (TFIIH) que acta como proteincinasa. La fosforilacin de la polimerasa puede actuar como desencadenante para separar la enzima de los factores de transcripcin que permanecen enlazados al compartimiento TATA y permitir que la enzima se desplace sobre la plantilla de DNA. Se cree que una de las otras subunidades de TFIIH desempea un papel clave en la separacin de las

Todos los RNA mensajeros comparten ciertas propiedades: contienen una secuencia continua de nucletidos que codifica un polipptido especfico; se encuentran en el citoplasma y estn fijos a ribosomas o tienen capacidad para unirse a ellos para ser traducidos. La mayor parte de los RNAm contienen un segmento significativo no codificante, o sea, una porcin que no controla el ensamblado de aminocidos. Por ejemplo, casi 25% de cada RNAm de globina consta de regiones no codificantes, no traducidas (fig. 11-21). Las porciones no codificantes se observan en los extremos 5' y 3' de un RNA mensajero y contienen secuencias con un papel regulador importante (seccin 12-3). Adems de nucletidos no codificantes, los RNAm eucariotas presentan modificaciones especiales en sus extremos terminales 5' y 3' no observadas en los mensajeros procariotas. El extremo 5' de

CAPITULO 11 Utilizacin de la informacin gentica: de la transcripcin a la traduccin Cdigos para un polipptido de 146 aminocidos de largo
5' Cap j ,-''
' 5'

451

Apndice poli(A)

^ Regin codificante '


3' ''

Regin no traducida

Regin no traducida

2'-0-metil ribonuclesido
OH OH\CH,-0-P-0-P-0-P-0-CH

OH

mRNA

F1GLKA 1 1 - 2 1 . Estructura del RNAm de la globina f humana. EL RNAm contiene un casquete de metilguanosina 5', regiones no codificantes 5' y 3' que flanquean el segmento codificante, y un apndice poli(A). La longitud de cada segmento se marca como nmero de nucleticos. La longitud del apndice po(A) es variable. Tpicamente comienza a una longitud de casi 250 nucletidos y poco a poco se reduce en longitud, como se analiza en el captulo 12. Se muestra la estructura del casquete 5'.

un RNAm eucariota tiene un "casquete" de guanosina mediada, en tanto que el extremo 3' tiene una cadena de 50 a 250 residuos de adenosina que forman un apndice poli(A) (g. 11-21). En breve describiremos cmo adquieren los RNAm sus caractersticos extremos terminales especializados 5' y 3'. Sin embargo, primero es necesario invertir un poco de tiempo para entender cmo se forman los RNAm en la clula.
Desdoblamiento de genes: un hallazgo inesperado

Casi en seguida del descubrimiento de los RNAnh se propuso que ese grupo de RNA nuclear que con rapidez capta el material marcado era precursor de los RNAm citoplsmicos {pg. 449). Conforme se adquiri mayor conocimiento acerca de los RNAnh durante los decenios de 1960 y 1970, se estableci con mayor firmeza una relacin precursorproducto entre el RNAnh y el RNAm. Por ejemplo, se demostr que el RNAnh, igual que los RNAm, contiene un casquete 5' de metilguanosina y un apndice polifA) 3' y, todava de mayor importancia, que la secuencia especfica

de RNAm estaba presente en la poblacin de RNAnh. El principal punto de controversia fue la diferencia de tamao de los RNA de ambas poblaciones: los RNAnh son varias veces ms grandes que los RNAm (fjg. 11-22). Por qu las clulas sintetizan molculas enormes como precursores de versiones mucho ms pequeas? Los primeros estudios del procesamiento de RNA ribosmico demostraron que poda formarse RNA maduro a partir de precursores de mayor tamao. Recordemos que durante el procesamiento de los RNAr (fig. 11-14) se eliminan los segmentos grandes de los lados 5' y 3' de diferentes intermediarios para producir los RNA finales maduros. Se pens que una va similar pudiera explicar el procesamiento de RNAnh para formar RNAm. Infortunadamente, los RNAm constituyen una poblacin tan diversa que casi es imposible seguir los pasos del procesamiento de una sola especie de RNAm como se ha hecho para los RNAr. El problema se resolvi gracias a una inesperada secuencia de acontecimientos. Aun en 1977, los bilogos moleculares asuman que una secuencia lineal continua de nucletidofi del RNA mensajero es complementaria de una secuencia continua de nucletidos que compone la cadena de DNA de un gen. Por entonces, Philip Sharp y sus colegas del MIT, y Richard Roberts y colaboradores, de Cold Spring Harbor Laboratories de Nueva York, hicieron un notable descubrimiento. Ambos grupos de investigadores observaron que las molculas de RNA se transcriben a partir de segmentos discontinuos de DNA, segmentos que estaban separados entre s a lo largo de ia cadena de la plantilla de DNA. Las observaciones iniciales ms importantes se hicieron durante el anlisis de la transcripcin del genoma de un adenovirus. El adenovirus es un patgeno capaz de infectar gran variedad de clulas de mamfero. Se observ que algunos de los diferentes RNA mensajeros del adenovirus se componen de los mismos 150 a 200 nucletidos terminales. Podra esperarse que esta secuencia principal represente un tramo de nucletidos repetidos localizados cerca de la regin promotora de cada uno de los genes para estos RNAm. Sin embargo, un anlisis ms atento revel que la secuencia principal 5' no es complementaria de una secuencia repetida y, ms an, ni siquiera es complementaria de un tramo continuo de nucletidos en la plantilla de DNA. En vez de eso* la secuencia principal se transcribe a partir de tres segmentos de DNA distintos y separados (representados por los bloques x, y y z en la figura 11-23). Las regiones de DNA situadas entre estos bloques, conocidas como secuencias interpuestas (Ij a 13 en la figura 11-23), por alguna razn estn ausentes en el RNAm correspondiente. Se podra argumentar que la presencia de secuencias interpuestas es una peculiaridad de genomas virales, pero esta observacin bsica pronto se ampli a los propios genes celulares. Segn se analiz en la pgina 418, las bacterias contienen enzimas de restriccin que reconocen y desdoblan molculas de DNA en el sitio de ciertas secuencias de nucletidos. A mediados del decenio de 1970 se us una gran variedad de dichas enzimas para analizar los sitios de desdoblamiento (sitios de restriccin) bien estudiados presentes en algunos genes y alrededor de ellos. Alee Jeffreys y Richard Flavell, de la Universidad de Amsterdam, estudia-

452

CAPITULO 11 * Utilizacin de la informacin gentica: de la transcripcin a la traduccin

iVi:-'.V-V/fc'%^;:^;-vl^.^Vf's\v;>-;^^^ ''"'W v ii*'" \V--::v:/;n-V-;vr:-;^-^ ::.'-.--.-.:.A;v:"'--*-'V.-;C^K; 1M .>-*;.};= ':-,- :--::*'"-:'ViA>;.-.: ^:i.v.':.v"-=v--=:;;..V-';. i '~

_.

RNAnh .RNAm
(X0.5)

3G (O

24

18

12

0.5

Tamao molecular (kb}

KICl'KA 1 1-22. Diferencia de tamao entre las poblaciones de RNAnh y RNAm. a,b) Micrografas electrnicas de preparaciones de molculas poH(A)-RNAm (a) y poli(A)-RNAnh (b) con sombreado metlico. Se muestran los tamaos representativos de los diferentes tipos. La molcula de referencia es el DNA viral <I>X174. c) Distribucin de los tamaos de RNAnh y RNAm de las clulas L de ratn segn se determinan mediante sedimentacin en gradiente de densidad. La lnea roja representa el RNAnh que rpidamente muestra la marca, en tanto que la lnea prpura representa los RNAm aislados de los polirribosomas luego de cuatro horas del periodo de marcado. La abscisa se convirti de nmeros de fraccin (indicado por los puntos) a tamao molecular calibrando los gradientes. (Sc^iin folm A. Bnntlc v W. E. Hahn, Cell 8:145, 1976; con permiso de Cei! Press.)

ron el DNA de conejo que contena el gen de globina /?. Observaron que el DNA posee un sitio de restriccin para la enzima BamHl (B en la figura 11-24) localizada aproximadamente a 700 pares de bases a partir del sitio de restriccin para la enzima EcoRl (E en la figura 11-24). En notable contraste, cuando trataron una preparacin de globina DNAc fun DNA complementario sintetizado a partir del RNAm purificado para globina/? por la enzima transcriptasa inversa, seccin 17-12) con estas mismas enzimas, los sitios correspondientes B y E se localizaron a una distancia de 67 nucletidos (lnea de abajo en la figura 11-24). Al parecer, el gen globina contiene una secuencia interpuesta de casi 600 pares de bases localizada directamente dentro de una porcin del gen que codifica la secuencia de aminocidos del polipptido globina. Un anlisis posterior indic que este inserto no codificante estaba presente en el DNA extrado de varios tejidos del conejo, incluyendo espermatozoides, y por lo tanto no tiene relacin con la expresin del gen. Ms tarde, la determinacin de la secuencia completa del gen de globina /? demostr que contiene una segunda secuencia interpuesta ms pequea no descubierta en los estudios iniciales. Los conocimientos acerca de la estructura del gen logrados con el gen de globina pronto se extendieron a otros genes, y se demostr que la presencia de genes con secuencias interpuestas, llamados genes cortados, es nas la regla que la excepcin. Las partes de un gen cortado que contribuyen a un producto RNA maduro se denominan exones, en tanto que las partes que corresponden a las secuencias interpuestas se denominan intrones. Los genes cortados son ms abundantes en los eucariotes, tanto en eucariotes ms simples como en levaduras y protozoarios, y en los reinos animal y vegetal. (Sin embargo, los intrones de los eucariotes inferiores tienden a ser ms escasos y de menor tamao que los de plantas y animales.) Se observan en todo tipo de gen, incluyendo RNAt, RN Ar, RNA vira! y genes que codifican protenas celulares. No obstante, la mayor parte de los genes que codifican RNAt y RNAr no son genes cortados y algunas protenas (incluyendo histonas, intcrfern y ciertos polipptidos virales} tambin son codificadas por secuencias de DNA continuas. El descubrimiento de los genes con secuencias interpuestas plante de inmediato la pregunta de cmo dichos genes pueden producir RNA mensajero que carezca de esas secuencias. Una posibilidad era que las clulas produjeran un transcrito primario que correspondiera a toda la unidad de transcripcin y que las porciones de RNA correspondientes a las secuencias de intervencin del DNA de alguna manera fueran eliminadas. Si este era el caso, entonces en el transcrito primario debieran estar presentes los segmentos correspondientes a los intrones. Esta explicacin tambin debiera suministrar una razn acerca del tamao mucho mayor de las molculas de RNAnh, en comparacin con las molculas de RNAm que finalmente producen. La investigacin acerca del RNA nuclear ha proseguido en estos ltimos aos hasta el punto que se han determinado las dimensiones de unos pocos precursores de RNAm (preRNAm). Por ejemplo, se observ que la secuencia de globina est presente en una molcula de RNA nuclear que sedimenta a 15S, a diferencia del RNAm de globina final cuyo coefi-

CAPITULO 11 Utilizacin de la informacin gentica: de la transcripcin a la traduccin V


DNA

453

\2

Gen exn

Exn Transcrito primario 5'ppp

Exn Procesamiento 7mGppp intermedio

RNAm maduro

x y z 7mGppp

Exn poli A

F I < ; n \ . Descubrimiento de las secuencias interpuestas. En la parte de arriba se muestra el genoma de un adenovirus. Los bloques de la secuencia discontinua marcados x, y i/ z aparecen en disposicin continua en el RNAm que codifica varios polipptidos, como la protena exn. Segn se analiza ms adelante en el texto, la conversin del precursor a RNAm implica eliminar (excisin) as secuencias interpuestas (Ii[3) y ligar las porciones restantes para producir una molcula de RNA continua (abajo). En la figura 11-36 se muestran los pasos del proceso.

I_L

F M l ' I . V I 1-24. Descubrimiento de las secuencias interpuestas en un gen eucariota. Mapa de los sitios de desdoblamiento por enzimas de restriccin en la regin del gen de globina/i de conejo (arriba) y el correspondiente mapa de DNAc preparado del RNAm de globina /? (abajo). (Un DNAc es un DNA formado f vitro por la transcriptasa inversa utilizando RNAm como plantilla. Por lo tanto, el DNAc posee la secuencia complementaria al RNAm.) Las letras indican los sitios donde las diferentes enzimas ce restriccin separan al DNA. Segn los sitios donde las enzimas rompen a los dos DNA, es evidente que el DNA preparado a partir del genoma tiene una regin cuantificable ausente del correspondiente DNAc (y por lo tanto ausente del RNAm a partir del cual se produjo el DNAc). (Segn A.}. Jeffreys y R.A. Flnvel, Cell 12:1103, 1977; con permiso de Cc!l Press.)

cente de sedimentacin es de IOS. Shirley Tilghman, Philip Leder y sus colaboradores, de los National Institute of Health en Estados Unidos, emplearon una ingeniosa tcnica (conocida como formacin de una asa R) para determinar la relacin fsica entre los RNA de globina 15S y IOS y obtener informacin acerca de la transcripcin de genes cortados. Recordemos de la pgina 402, que las cadenas simples de DNA complementario pueden enlazarse especficamente entre s. Tambin pueden enlazarse entre s el DNA de una sola cadena y las molculas de RNA, siempre y cuando posean secuencias complementarias de nucletidos; esta es la base de la tcnica de hibridacin de DNA-RNA analizada en la seccin 17-12 (el complejo DNA-RNA se denomina hbrido). Tilghman y sus colaboradores observaro,p en el microscopio electrnico que cuando se formaba un hbrido entre un fragmento de DNA que contiene el gen de globina y el RNA 155, las dos molculas se enlazaban entre s para formar un hbrido de DNA-RNA de doble cadena continua (fig. 11-25, a). En contraste, cuando se incubaba el mismo fragmento de DNA con RNAm de globina IOS maduro, emerga un gran segmento de DNA en el centro de la regin codificante para formar una asa de doble cadena (fig. 11-25, b). Esta asa se formaba como resultado de la interposicin en el DNA de una gran secuencia no complementaria de cualquier parte del mensaje globina ms pequeo. Al parecer, el RNA 15S en realidad contiene segmentos correspondientes a secuencias interpuestas en los genes que son eliminadas durante la formacin del RNAm IOS. Ms o menos al mismo tiempo se efectu un experimento de hibridacin de tipo similar entre el DNA que co-

454

CAPITULO 11 Utilizacin de la informacin gentica: de la transcripcin a la traduccin

Hbrido DNA-RNA

DNAde cadena sencilla desplazado

(a)

DNA de cadena sencilla desplazado DNA de doble ia del intrn

Hbrido DNA-RNA

DNAde cadena sencilla desplazado

(b) KIGlilA 11-25. Visualizacin de una secuencia interpuesta en el gen de globina. Micrografas electrnicas de hbridos formados entre: a) RNA 15S precursor de globina y DNA de un gen de globina, y b) RNAm IOS de globina y el mismo DNA como en a. Las lneas de color indican las posiciones de las molculas de RNA. El RNAm precursor equivale en longitud y secuencia al DNA del gen de globina, pero el RNAm 105 carece de una porcin presente en el DNA del gen. Estos resultados sugieren que el RNA 155 es procesado al eliminar la secuencia de RNA interno y volviendo a unir las regiones de los flancos. (Segn Shirley M. Tilghman \j cois. Proc. Nati. Acad. Sci. U.S.A. 75:1312, 1978.)

difica la ovalbmina, una protena que se encuentra en los huevos de gallina, y su correspondiente RNAm. El hbrido formado entre el DNA y el RNAm de la ovalbmina contiene 7 asas distintas que corresponden a 7 secuencias interpuestas (g. 11-26). Consideradas en conjunto, las secuencias interpuestas equivalen a casi tres veces ms el DNA que las ocho porciones codificadas combinadas (exones). Estudios subsecuentes han revelado que los intrones de un gen promedian 4 a 10 veces la longitud de los exones, y por esta razn las molculas del RNAnh en condiciones tpicas son mucho ms largas que las de RNAm. Un gen de ratn se extiende ms de 20 veces que el DNA necesario para codificar sus correspondientes mensajes, y el gen para colgena tipo I contiene ms de 50 secuencias interpuestas. Estos y otros datos suministraron fuertes pruebas para proponer que la formacin del RNAm ocurre por supresin

de la secuencia interna de ribonucletidos a partir de un pre-RNAm mucho ms grande. Volvamos a los pasos por los cuales ocurre esto.
Procesamiento del RNA mensajero

La RNA polimerasa II ensambla un transcrito primario complementario del DNA de toda la unidad de transcripcin. A continuacin este transcrito se procesa en el ncleo para formar RNAm maduro que se transporta al citoplasma. El examen de genes transcriptores activos en el microscopio electrnico indica que los transcritos de RNA se asocian a diferentes protenas huspedes y a numerosas partculas distintas, mientras an se encuentran en proceso de sntesis (g. 11-27). Estas partculas constan de protenas y ribonucleoprotenas, e incluyen los agentes encargados de convertir el transcrito primario en el mensajero maduro. Los pri-

CAPITULO 11 Utilizacin de la informacin gentica: de a transcripcin a a traduccin

455

FIGURA 11-26. Secuencias interpuestas en el gen de ovalbmina. Micrografa electrnica de un hbrido formado entre el RNAm de ovalbmina y un fragmento de DNA genmico de pollo que contiene el gen de ovalbmina. El hbrido mostrado en esta microfotografa es similar en naturaleza al de la figura 11-25, b. En ambos casos, el DNA contiene toda la secuencia del gen y por lo tanto se aisl directamente del genoma. En contraste, el RNA fue completamente procesado y las partes transcritas de las secuencias interpuestas fueron eliminadas. Cuando el DNA gcnmico y el RNAm se hibridizan, las porciones de DNA no representadas en el RNAm forman asas. Se pueden observar la asas de las siete secuencias interpuestas (A-G). (Cortesa de Fierre Chambn.)

meros pasos de este proceso de conversin incluyen la adicin de un casquete 5' y el apndice poli(A) 3'. Casquete 5' y apndices poli(A). El extremo 5' de todos los RNAm posee inicialmente un trifosfato derivado del primer trifosfato de nuclesido incorporado en el sitio

donde se inicia la sntesis de RNA. Una vez que se forma el extremo 5' de un precursor RNAm mediante la accin de la RNA polimerasa II, varias enzimas actan para modificar ese extremo de la molcula (fig. 11-28). En el primer paso, se elimina el ltimo de los tres fosfatos convirtiendo el extremo

FIGURA 1 1 - 2 7 . Asociacin de protenas con las molculas preRNAm nacientes para formar fibrillas de ribonucleoprotenas. a) Micrografa electrnica de una unidad de transcripcin no ribosmica. b) Trazo para interpretar la micrografa mostrada en la parte a. La lnea punteada representa la cadena de croinatina, la lnea slida representa fibrillas de ribonucleoprotena (RNP) y los crculos slidos representan partculas de RNP relacionadas con las fibrillas. Las partculas de RNP no se distribuyen al azar a lo largo del transcrito naciente, sino ms bien se enlazan a sitios especficos donde tiene lugar el procesamiento de RNA. (Segn Ann L. Beyer, Osear L. Miller, }r. y Steven L. McKnight, Cell 20:78, 1980; con permiso de Cell Press.)

(a)

(b)

456

CAPITULO 11 Utilizacin de la informacin gentica: de la transcripcin a a traduccin

Transcrito primario

Metilo

Casquete de guanina

Apndice po(A)

11-28. Etapas en la adicin de un casquete de metilguanosina 5' y un apndice poli(A) 3' a un pre-RNAm. El extremo 5' del prc-RNAm naciente se enlaza a una fosfohidrolasa (paso 1) que elimina el grupo fosfato terminal. En el paso 2, una guanilil transferasa aade un residuo de guanina en orientacin inversa mediante una unin de 5' a 5'. En el paso 3, a los grupos metilo se les aade tanto el casquete de guanina terminal como el nucletido situado en el extremo del RNA naciente. En el extremo 3' del pre-RNAm ocurre una serie muy diferente de acontecimientos. Primero, una endonucleasa reconoce una secuencia especfica (UAAUUU) y desdobla la cadena de RNA, generando un nuevo extremo 3'. En los pasos a-c, la polimerasa polifA) aade residuos de adenosina al extremo 3'. Un RNAm tpico de mamfero contiene de 200 a 250 residuos de adenosina en su apndice poli(A); este nmero es considerablemente menor en eucariotes inferiores. (Segn D.A. Micklos y G.A. freyer, DNA Science, Carolina Biolgica! Supply Co.)

terminal 5' en difosfato (paso 1, fig. 11-28). A continuacin se aade un GMP en orientacin invertida, de modo que el extremo 5' de la guanosina quede frente al extremo 5' de la cadena de RNA (paso 2, fig. 11-28). Como resultado, los dos ltimos nuclesidos se encuentran unidos por un puente 5'5' trifosfato. Por ltimo, el extremo terminal "invertido" de guanosina se metila en la posicin 7 sobre su base de guanina, en tanto que el nucletido del lado interno del puente de trifosfato se metila en la posicin 2' de la ribosa (paso 3, fig. 11-28). El extremo 5' del RNA ahora contiene un casquete de metilguanosina (como se muestra con mayor detalle en la figura 11-21). Estas modificaciones enzimticas en el extremo 5' del transcrito primario ocurren con gran rapidez, mientras la molcula de RNA todava se encuentra en las etapas iniciales de sntesis. Adems de la mediacin de los nucletidos terminales del precursor RNAm, varios residuos de nucletidios internos tambin pueden ser mediados o no serlo. Se cree que el casquete de metilguanosina del extremo 5' de un RNAm tiene varias funciones: evita que el extremo 5' del RNAm sea digerido por nucleasas, ayuda a transportar RNAm hacia afuera del ncleo y desempea un papel importante para iniciar la traduccin del RNAm. Como se mencion antes, el extremo 3' de un RNAm contiene una cadena de residuos de adenosina que forman un apndice poIi(A). Este apndice invariablemente se encuentra a unos 15 nucletidos hacia abajo de una secuencia AAUAAA que sirve como sitio de reconocimiento para una nucleasa que desdobla el pre-RNAm situado justamente hacia abajo de este sitio (fig. 11-28, lado derecho del RNA). Normalmente, una vez pasado este sitio la RNA polimerasa avanza bien sobre la plantilla de DNA hasta que concluye la transcripcin. Luego del desdoblamiento por las nucleasas, una enzima llamada polmernsa pol(A) aade las adenosinas que componen el apndice poli(A) (pasos a-c, fig. 11-28). Como se analiza en la seccin 12-3, poli(A) participa en a estabilizacin del RNAm dentro del citoplasma protegindolo del desdoblamiento prematuro. Puesto que un porcentaje considerable del RNAm carece de apndice poIi(A) (incluyendo los que codifican histonas), la presencia de esta modificacin no es requisito para la sntesis, procesamiento, transporte o traduccin de un RNAm eucariota. Empalme del transcrito primario: eliminacin de las secuencias interpuestas. Las partes de un transcrito primario que corresponden a secuencias de DNA interpuestas (intrones) se eliminan mediante un proceso complejo conocido como empalme del RNA. Para empalmar un RNA, se debe introducir una pausa en la cadena a nivel de los bordes 5' y 3' (o sitios de desdoblamiento) de cada intrn, y los exones situados a ambos lados de los sitios de empalme deben unirse mediante enlaces covalentes (ligados). En la figura 11-29 se muestra todo el proceso de ensamblado del preRNAm de globina. Es imperativo que el proceso de empalme ocurra con absoluta precisin, puesto que la presencia o ausencia de un solo nucletido anormal en cualquiera de las uniones de empalme cambia el cuadro de lectura del mensaje y causa errores de traduccin. Cmo puede el mecanismo de empalme reconocer el lmite entre un exn y un intrn? Inicialmente, esta pregunta se respondi mediante el anlisis de la secuencia de DNA. El examen de cientos de uniones entre exones e intrones en

CAPITULO 11 Utilizacin de la informacin gentica: de la transcripcin a la traduccin Gen de globina


DNA !

457

; Transcrito mG primario y Procesamiento intermedio

Transcripcin por la RNA polmera RNA polimerasa II y el casquete

Eliminacin del extremo 3' por la nucleasa

\n
Desdoblamiento endonucleoltico en las uniones de empalme

o
IOS
RNAm maduro

Ligadura de los exones AAA

FIGURA 11-29. Esquema general de las etapas que ocurren durante el procesamiento del RNAm de globina. Las secuencias interpuestas se muestran en color rosa, en tanto que las porciones azul oscuro del gen indican as posiciones de los exones, o sea, las secuencias de DNA representadas en el RNA mensajero maduro.

eucariotes, desde levaduras e insectos hasta vertebrados, revel la presencia en los sitios de empalme de una secuencia de nucletidos altamente conservada de origen evolutivo ancestral. En notable contraste, las secuencias de la porcin interna de los intrones tienden a ser muy divergentes. En la figura 11-30 se muestra la secuencia encontrada con mayor frecuencia en el lmite exn-intrn dentro de las molculas de RNAnh. La G/GU en e! extremo 5' del intrn (sitio de empalmado 5') y la AG/G en el extremo 3' del intrn (sitio de empalmado 3') prcticamente aparecen en todos los pre-RNAm eucariotas. La sustitucin de una sola base en la secuencia de DNA dentro de estos tramos invariables bloquea la excisin del intrn, lo que conduce a la acumu-

lacin de precursores no empalmados. Esto ocurre en ciertos tipos de talasemias humanas, una deficiencia de globina caracterizada por anemia. En la mayor parte de los casos, los RNA no empalmados son reconocidos y desdoblados de modo que no se envan al citoplasma y se traducen a polipptidos no funcionales. En los ltimos 10 aos se elabor una descripcin para explicar muchos de los pasos implicados en el empalmado de los transcritos pre-RNAm. Conforme las molculas grandes de RNAnh se transcriben, cada intrn se asocia a un complejo macromolecular llamado espliceosoma. El espliceosoma contiene varias protenas y algunas partculas de distintas ribonucleo pro tenas denominadas RNPnp porque se componen de RNAnp enlazado a protenas especficas (cuadro 11-1). El anlisis de RNPnp recibi gran apoyo cuando se descubri que la sangre de pacientes afectados de ciertas enfermedades autoinmunitarias (como lupus eritematoso generalizado, en el cual la persona produce anticuerpos contra sus propios componentes celulares) contena anticuerpos que reaccionan con partculas pequeas presentes en el ncleo celular (fig. 11-31). Usando antisuero obtenido de estos pacientes, Joan Steitz y sus colegas, de la Universidad de Yale, pudieron purificar algunos RNPnp. Aislaron cuatro RNPnp diferentes: RNPnp Ul, RNPnp U2, RNPnp U4/U6 y RNPnp U5. Algunas protenas son peculiares de un RNPnp particular; otras son compartidas como una porcin del ncleo central comn. Mecanismo de empalmado de los pre-RNAm. El descubrimiento, en 1982, de que los precursores RNAr de los protozoarios ciliados Tetrahymena podan empalmarse por s mismos (analizado en La va experimental, al final del captulo) cambi el concepto de los bilogos acerca del mecanismo de empalmado del RNA. El intrn del pre-RNAr de Tetraliymena es un ejemplo de intrn del grupo I. Los intrones del grupo I se observan con mayor frecuencia en mitocondrias de hongos y plantas, cloroplastos de plantas y en el RNA nuclear de eucariotes evolutivamente inferiores, como Tetrahyrnena. Aunque la secuencia de nucletidos de los intrones del grupo I puede ser muy variable, todos tienen capacidad para formar estructuras tridimensionales muy parecidas (fig. 11-32). Esta compleja estructura plegada, junto con varias placas bien situadas de nucletidos conservados, permite a estos intrones desdoblarse por s mismos. Posteriormente se descubri otro tipo de intrn autoempalmable, denominado intrn grupo II, en las mitocondrias de hongos y cloroplastos de plantas. Los intrones del grupo II tambin se pliegan en una estructura muy compleja (fig. 11-33, a), pero muy diferente de los intrones del grupo I. A

Sitio 5' de empalme Exn


c

Sitio 3' de empalme Intrn Exn


bu

Ab

FIGritA 11-SO. Secuencias de nucletidos en los sitios de empalmado de pre-RNAm. Las secuencias de nucletidos mostradas en las regiones de los sitios de empalmado se basan en el anlisis de numerosos pre-RNAm. Las bases mostradas en amarillo prcticamente son invariables. Las que se muestran en negro representan la base preferida en dicha posicin. N representa cualquiera de los cuatro nucletidos; Y es una pirimidina.

458

CAPITULO 11 Utilizacin de la informacin gentica: de la transcripcin a la traduccin

FKLIKA 1 1 - 3 1 . Localizacin mediante inmunofluorescencia de Ul RNPnp en los ncleos celulares mediante anticuerpos presentes en el suero de un paciente con enfermedad autoinmunitaria. El suero de diferentes pacientes contiene anticuerpos dirigidos contra distintos componentes nucleares. Las clulas cultivadas que aqu se muestran fueron tratadas con un anticuerpo fluorescente contra Ul RNPnp, que tie al ncleo, pero no al nuclolo ni al citoplasma. El antisuero, como el que aqu se emplea, ha mostrado utilidad para identificar y purificar los componentes del mecanismo de empalmado. (Cortesa de oan A. Steitz.)

diferencia de los intrones del grupo I, los intrones de! grupo II se empalman por s mismos pasando por una etapa intermedia denominada lazada (fig. 11-33, b), debido a que recuerda el tipo de lazo usado por los vaqueros para lazar becerros a la carrera. Los pasos que ocurren durante la eliminacin de intrones en molculas pre-RNAm de clulas animales prcticamente son idnticos a [os seguidos por los intrones del grupo II. La principal diferencia es que el pre-RNAm no se puede empalmar por s mismo, sino que requiere mltiples RNAnp nucleares (fig. 11-34) y sus protenas relacionadas (fig. 11-35). El hecho de que: 1) el pre-RNAm se empalme siguiendo la misma serie de reacciones qumicas que ocurren en los intrones del grupo II cuando se autoempalman, y 2) el RNAnp requerido para el empalmado del pre-RNAm se parezca mucho a porciones de los intrones del grupo II (fig. 11-34), sugiere fuertemente que el RNAsn es e! componente catalticamente activo de los RNPnp, y no las protenas. Si esto es cierto, las protenas ejerceran un papel complementario, por ejemplo, mantener la estructura tridimensional apropiada de los RNAnp para transportar a los RNAm empalmados a la envoltura nuclear y actuar como sitios de interaccin con factores reguladores. Nuestra comprensin del mecanismo de empalmado del RNA se logr principalmente a travs de estudios de extractos de clulas libres que pueden empalmar con precisin pre-RNAm in vitro. La secuencia de acontecimientos que supuestamente ocurren durante el empalmado de un intrn de pre-RNAm se indican en la figura 11-36 y se describen con cierto detalle en el pie de la figura acompaante. Los sucesos descritos en la figura 11-36 suministran el ejem-

FIGUHA 11-32. Estructura de los intrones del grupo I. En este modelo se indica la compleja estructura tridimensional del intrn del grupo I de Tctraln/mcna. Los dos exones que flanqea el intrn se muestran en color blanco. Como consecuencia del plegamiento del intrn, los dos exones se aproximan estrechamente hasta un punto donde pueden unirse luego de eliminar el intrn. Los pares de bases se indican como puentes fosfato-fosfato entre las cadenas apareadas. (Cortesa de E. Westhof.)

po rrtejor estudiado de las complejas y dinmicas interacciones que pueden ocurrir entre molculas de RNA. De los diferentes RNAnp que participan en el empalmado del RNA se cree que el RNA U6 es el ribosoma que efecta los dos cortes en el pre-RNAm requeridos para eliminar el intrn. Puesto que la mayor parte de los genes contienen algunas secuencias interpuestas, las reacciones de empalmado mostradas en la figura 11-36 deben ocurrir repetidas veces sobre un solo transcrito primario para eliminar todos los intrones del pre-RNAm. Las pruebas sugieren que los intrones se eliminan en un orden preferido generando intermediarios especficos de procesamiento cuyo tamao vara entre el del transcrito primario y el RNAm maduro. En la figura 11-37 se muestra un ejemplo de los intermediarios formados durante el procesamiento nuclear de RNAm ovomucoide en las clulas del oviducto de la gallina.

CAPITULO 11 Utilizacin de la informacin gentica: de la transcripcin a la traduccin

459

FIGURA 11-33. Estructura y va de autoempalmado de los intrones del grupo II. a) Estructura bidimensional de un intrn del grupo II. El intrn se pliega con seis dominios caractersticos. El asterisco indica el nucletido de adenosina que sobresale del dominio VI y forma la estructura de lazo descrita abajo. Los dos extremos del intrn se aplican estrechamente entre s, como se indica por la proximidad de los dos lmites intrn-exn. b) Pasos en el autoempalmado de los intrones del grupo II. En el paso 1, el 2' OH de una adenosina dentro del intrn (asterisco en el dominio VI de la parte a) ataca el sitio de ensamblado 5', desdoblando el RNA y formando una rama 2'-5' con el primer nucletido del intrn. Esta estructura ramificada se describe como lazo de vaquero. En el paso 2, el 3' OH libre del exn desplazado ataca al sitio 3' de empalme, que desdobla al RNA en el otro extremo del intrn. Como resultado de esta reaccin, el intrn se libera como lazo de vaquero libre y los extremos 3' y 5' de los dos exones que flanquea quedan ligados (paso 3). Se sigue una va similar en el empalme de intrones a partir de pre-RNAm, pero ocurre ms bien por autoempalmado. Estos pasos requieren la ayuda de algunos factores adicionales.

51 31

Implicaciones evolutivas del rompimiento de genes y el empalmado de RNA El descubrimiento de la capacidad del RNA para catalizar reacciones qumicas tuvo un enorme impacto sobre nuestro concepto de la evolucin biolgica. Una de las preguntas fundamentales planteadas por los bilogos evolutivos desde el descubrimiento del DNA ha sido: cul fue el primer material gentico, la protena o el DNA? El dilema se origina en las funciones aparentemente no superpuestas de estos dos tipos de macromolculas. Los cidos nucleicos almacenan informacin, en tanto que las protenas catalizan reacciones. Con el descubrimiento de os ribosomas fue evidente que un tipo de molcula, el RNA, poda hacer ambas cosas. Estos datos condujeron a especular que durante las primeras etapas de la evolucin de la vida no existan DNA ni protena. Tal vez las molculas de RNA pudieron haber ejecutado una doble tarea: sirvieron como material gentico y como catalizadores de las reacciones enzimticas necesarias. En esta etapa, la vida poda describirse como incluida en "un mundo de RNA". Slo en la ltima etapa de la evolucin "se conectaron" las funciones de almacenamiento de informacin y de catlisis al DNA y a la protena, respectivamente, dejando a RNA la funcin primara de "intermediario" en el flujo de informacin gentica. Muchos investigadores opinan que el empalmado es un buen ejemplo de herencia del mundo del RNA. El descubrimiento reciente de intrones del grupo II en las bacterias prpura y las cianobacterias, quiz parientes cercanos de los ancestros de las mitocondrias y los cloroplastos, respectivamente, arroj nueva luz acerca de los ascendientes del empalmado del RNA. Este dato apoya la hiptesis de que los intrones del grupo II son la fuente a partir de la cual se originaron los intrones pre-RNAm. La hiptesis se presenta en la figura 11-38. Segn esta hiptesis, los intrones originalmente estuvieron presentes en organelos endosimbiticos que residan en clulas eucariotas primitivas. Con el tiempo, los intrones dejaron el DNA del organelo e invadieron el DNA nuclear, donde establecieron su residencia permanente. La transferencia de las secuencias
Exn 1

Intrn

Exn 2
Sitio 3' de empalme

Pre-RNAm

Sitio 5' de empalme G

2'OH

Exn 1 + intrn-exn 2 Exn 2 A

,y
/
2'

J ,e^-

'/X 1 /yr Exn EXC


Lazo de vaquero del intrn + exones ligados Exn 1 Exn 2

(b)

DNA de las mitocondrias y los cloroplastos al ncleo celular est bien comprobada, de modo que el movimiento de DNA en esta direccin no es inesperado. Una vez en e! ncleo, los intrones pudieron desplazarse de un sitio a otro mediante el proceso de transposicin analizado en la pgina 414 del captulo previo. El anlisis de las secuencias de intrones sugiere que tienen capacidad de actuar como elementos genticos movibles. Puesto que los intrones originalmente fueron ca-

460

CAPITULO 11 Utilizacin de a informacin gentica: de la transcripcin a la traduccin

U6 ACAGAGAuGAUC
A ACUAG A U

Uc

3.

U2

Pre-RNAm

Dominio \1 FIGURA 11 -.. Demostracin visual de la presencia de ribonu-

r A G C n n n r Ur\

i deoprotenas nucleares pequeas (RNPnp) relacionadas con transi \PA


critos nacientes. Cromosomas politenos gigantes de las glndulas salivales de Drosofliiln melanogasler teidos con anticuerpos fluorescentes contra la protena de las partculas de RNPnp. Los anticuerpos fluorescentes brillantemente teidos se enlazan de manera selectiva al material presente en las regiones esponjadas de los cromosomas, que son sitios donde ocurre la transcripcin. (Scgm Erikn L Mtittiniz, Michael J. Matunis y Gideon Dreyfiss, ]. Cell Biol. 121:226, 1993; con permiso de Rockefeer Uiiiversity Press.)

\n

Gr r r r r r
1 I ! i II

' Exn 2

yA

yyyyyy AOH Exn 1 GU

Dominio VI

(b)
FIGURA 1 1-3-1. Semejanza estructural propuesta entre las reacciones de empalme efectuadas por el espliceosoma sobre preRNAm y las reacciones de autoempalmado del grupo II de intrones. a) Interaccin estructural entre un intrn de una molcula pre-RNAm (flanqueada por los exones 1 y 2) y dos RNAnp (U2 y U6) requeridos para el empalme, b) Estructura de un intrn del grupo II que muestra la disposicin de partes crticas que quedan alineadas durante el autoempalmado (como se indic en la figura previa). Es evidente la semejanza de las partes del intrn del grupo II ai RNA combinado en la letra a. Arriba se muestran los residuos invariables en letras maysculas; las purinas y pirimidinas conservadas se denotan por r i/ y, respectivamente. Los residuos variables se marcan con n. (Segn A.M. Weiner, Ccll 72:162, 1993; con permiso de Ccll Press.)

paces de autoensamblarse, su presencia a mitad de los genes no causara problema porque las secuencias correspondientes a los intrones simplemente se cortan a s mismas a partir de los transcritos de RNA primarios antes de convertirse en RNAm. Con el tiempo, las porciones catalticas de los intrones fueron separadas de los RNA ms grandes corno fragmentos aparte que continan participando en el proceso de empalmado. Tiempo despus, la evolucin conform estos fragmentos en RNAnp cuya actividad cataltica se volvi dependiente de la presencia de protenas. En conjunto, RNAnp y las protenas evolucionaron para convertirse en los componentes RNPnp del espliceosoma. A medida que esto ocurra, los nucletidos internos de los intrones no tuvieron ya funcin alguna, lo que explica su longitud variable y la divergencia en las secuencias de nucletidos. Aunque la presencia de intrones pudo haber creado una "carga" adicional a las clulas debido a que deben eliminar estas secuencias interpuestas de sus transcritos, los intrones tienen sus virtudes. Como veremos en el siguiente captulo, el empalme de RNA es uno de los pasos sometido a regula-

MGI'li\ l-:tfi. Disposicin del mecanismo de empalme a nivel del intrn y algunos de los pasos durante el empalmado. Ei paso 1 muestra la porcin del pre-KNAm que ser empalmada. En el paso 2, el primero de los componentes de empalme, Ul RNPnp, se encuentra fijo al sitio de empalme 5' del intrn. La secuencia de nucletidos de Ul RNAnp es complementaria del sitio de empalme 5' del pre-RNAm y muestra que Ul RNAnp inicialmente se enlaza al extremo 5' del intrn mediante la formacin de un par de bases especficas entre el sitio de- empalme y Ul RNAnp. U2 RNPnp es el siguiente en introducirse al complejo de empalme, enlazndose al pre-RNAm (como se muestra en el recuadro A), de manera que un residuo de adenosina sobresale (punteado) por fuera de la hlice que lo rodea (paso 3). Este es el sitio que finalmente se transforma en el punto de ramificacin del lazo de vaquero. El siguiente paso es el enlace de U4/U6 y U5 RNPnp al pre-RNAm (paso 4). Una vez que todos los RNPnp se encuentran enlazados al intrn, concluye la disposicin del espliceosoma (paso 4), y est listo el escenario para una serie de interacciones dinmicas entre el pre-RNAm y los RNAnp especficos, y entre los propios R N A n p . A medida que forman el complejo con pre-RNAm, los RNAnp U4 y U6 se aparean a las bases para formar un gran nmero de p<lres (recuadro B). Despus de su entrada al complejo, los puentes de hidrgeno entre U4 y U6 se rompen y las regiones de U6 que forman pares con U4 se convierten en pares de bases para una porcin de U2 RNAnp (recuadro C). Se cree que U es una ribozima y U4 un inhibidor de su actividad cataltica. Una vez que U4 RNAnp se desplaza, U6 RNAnp se encuentra en posicin para efectuar los dos cortes requeridos para eliminar el intrn. Tambin se piensa que Ul y U5 RNAnp vuelven a juntar los sitios de empalmado para facilitar el desdoblamiento de los enlaces a cada lado del intrn (recuadro D). El ensamblado del espliceosoma va seguido por el desdoblamiento del sitio de ensamblado 5', formando un exn 5' libre y un intrn-3' de lazo de vaquero del exn intermediario (paso 5). Se cree que el exn 5' libre puede mantenerse en su sitio por su asociacin a RNAnp del espliceosoma. La primera reaccin de desdoblamiento en el sitio 5' de empalme va seguida rpidamente por un segundo desdoblamiento en el sitio de empalme 3', que secciona al intrn del lazo de vaquero y simultneamente junta los extremos de los dos exones vecinos (paso 6). Luego del empalmado, el KNPnp tal vez se libere del pre-RNAm como partcula individual que se pueda volver a ensamblar en los sitios de otros intrones.

CAPITULO II . Utilizacin de cripn a la traduccin SitioS' de empalme


5 "

461

Sitio 3' de empalme

Bcn 1

Intrn

punt de ramificacin

E xn

462

CAPITULO 11 Utilizacin de la informacin gentica: de la transcripcin a la traduccin

Cito-".

plsmico origen'

Nuclear

5450 nucletidos

3100. 2750 2500 2300 2000


1700

RNAmoni maduro

1100

FIGURA 11-37. Procesamiento del RNAm ovomucoide. La fotografa muestra una tcnica llamada mancha Northern, en la cual el RNA extrado (en este caso de ncleos de clulas del oviducto de gallina) se fracciona mediante electroforesis en ge y se extiende sobre papel filtro en forma ce manchas. El RNA inmovilizado sobre el papel filtro se incuba con DNAc marcado con istopo radiactivo (en este caso, el DNAc se elabora a partir del RNAm ovomucoide) para producir bandas que revelan la posicin de los RNA con la secuencia complementaria. El RNAm maduro que codifica la protena ovomucoide tiene 1 100 nucletidos de largo y se muestra en la parte inferior de la mancha. Es evidente que el ncleo contiene algunos RNA de tamao mayor que tambin contiene la secuencia de nucletidos del RNAm ovomucoide. Los RNA ms grandes situados sobre la mancha muestran una longitud de 5 450 nucletidos que corresponde al tamao de la unidad de transcripcin ovomucoide; se supone que este RNA es el transcrito primario a partir del cual se copia finalmente el RNAm, Otras bandas prominentes contienen RNA con longitudes de 3 100 nucletidos (correspondientes a un transcrito que carece de los intrones 5 y 6), 2 300 nucletidos (transcrito que carece de los intrones 4, 5, 6 y 7) y 1 700 nucletidos (transcrito que carece de todos los intrones, excepto el nmero 3). (Cortesa de Bcrt O'Mnlley.)

El intrn invade al DNA nuclear

Citoplasma

-Exn 1 -Intrn -Exn 2

El intrn es autoempalmado

- Exn 1 - Intrn . - Exn 2

Organelo endosimbitico Las porciones catalticas de los introneS se convierten en genes separados cuyos Gen que codifica productos de RNA al RNA requerido se requieren para para el empalme el empalmado de de pre-RNAm los pre RNAm - Exn 1 - Intrn - Exn 2 Intrones ahora variables de tamao debido a que ya no se alargan por autoempalme

El intrn se desplaza hacia el interior del creciente nmero de genes nucleares

Los intrones se autoempalman

FIGURA I 1-38. Hiptesis que puede explicar el origen evolutivo de los intrones en el DNA eucariota. Pasos propuestos en la evolucin de un intrn autoempalmable en un simbionte ancestral procariota en el interior de intrones del genoma eucariota. Los pasos se analizan en el texto.

CAPITULO 11 Utilizacin de a informacin gentica: de la transcripcin a la traduccin

463

cin celular a lo largo de la va para formar RNAm. Muchos transcritos primarios pueden procesarse en dos o ms vas, de modo que la secuencia que acta como ntrn en una va se convierte en exn en una va alterna. Como resultado de este proceso, denominado ensamblado alterno, el mismo gen puede codificar varios polipptidos diferentes. Tambin se cree que la presencia de intrones tuvo mayor impacto en la evolucin biolgica. En la pgina 59 vimos que con frecuencia as protenas se componen de segmentos distintos, o dominios, que funcionan de manera semindependiente. En algunos casos, los dominios de un polipptido corresponden a la parte del mismo codificada por exones distintos. Por ejemplo, los receptores de LDL, protenas que desempean un papel crucial en la captacin de colesterol sanguneo (pg. 314), se componen de partes que claramente son homologas de partes de otras protenas. Una porcin central del polipptido receptor de LDL contiene un dominio muy similar en estructura y secuencia a una porcin de otra protena llamada factor de crecimiento epidrmico (FCE). Este dominio es codificado por algunos exones vecinos que tambin estn presentes en el gen FCE. Otro dominio del receptor de LDL se parece mucho a una porcin de a protena sangunea denominada factor C9 del complemento codificada por una serie de exones similares a los observados en el gen C9. Es evidente que el gen que codifica al receptor de LDL se ha ensamblado de partes de otros genes (fig. 11-39). E! desplazamiento de "mdulos" genticos entre diferentes genes, proceso denominado revolver los exones, pudo haber participado de manera importante en el ensamblado

de ancestros de muchos de os genes presentes en los organismos actuales. Durante largos periodos, los exones pudieron ser revueltos independientemente en varias formas, permitiendo un nmero casi infinito de combinaciones en la bsqueda de nuevas y tiles secuencias de codificacin. Gracias al entremezclado de los exones, la evolucin no necesariamente ocurre slo a travs de la lenta acumulacin de mutaciones puntuales, sino que tambin puede avanzar a "saltos cunticos" con la aparicin de nuevas protenas literalmente de la noche a la maana. Creacin de nuevos ribosomas en el laboratorio El principal "punto difcil" en la mente de muchos bilogos respecto de la posibilidad de un mundo de RNA en el cual el RNA acte como nico catalizador, es que hasta ahora slo se han encontrado unas pocas reacciones catalizadas por RNA en la clula. En la actualidad, stas incluyen las reacciones de desdoblamiento y de ligadura requeridas para el empalmado del RNA y la formacin de enlaces peptdicos durante la sntesis de protenas. En la actualidad, varios grupos de investigadores exploran el potencial cataltico del RNA creando nuevas molculas de RNA en el laboratorio. Con uno de los mtodos adoptados se modifica de diferente manera el RNA existente y se prueba su capacidad de participar en nuevos tipos de actividades. Por ejemplo, se ha demostrado que algunos RNA modificados pueden catalizar ciertas reacciones qumicas que seran necesarias si el RNA fuera capaz de autoduplicarse. Puesto que la autoduplicacin es una propiedad fundamental de la vida, este dato apoya la existencia de un "antiguo mundo de RNA". Otros grupos de investigadores estn creando los RNA deseados a partir de "raspado" sin ningn diseo preconcebido de cmo se debe construir el RNA. El RNA se forma permitiendo que mquinas automticas sintetizadoras de DNA ensamblen el DNA con secuencias de nucletidos al azar y luego transcriban el DNA para formar una vasta poblacin de RNA cuyas secuencias de nucletidos tambin se determinan al azar. Una vez obtenida una poblacin de RNA, se pueden seleccionar miembros individuales de la poblacin en virtud de las propiedades particulares que poseen. Este mtodo se describe como "evolucin molecular en el laboratorio". En un grupo de estudios se seleccion RNA sinttico por su capacidad para enlazarse a un ligando particular, como el trifosfato de nuclesido o un pptido, mediante cromatografa por afinidad (seccin 17-7). En estos experimentos, los ligandos se unen a esferitas, utilizadas luego para empacar una columna de cromatografa. Cuando se permite que la preparacin de RNA se deslice a travs de la columna, los RNA capaces de enlazarse al ligando inmovilizado son retirados de la solucin, en tanto que la mayor parte de las molculas de RNA simplemente pasan a travs sin ser afectadas. Una vez seleccionada la subpoblacin de RNA se puede incrementar su nmero y someter a otra vuelta selectiva bajo condiciones ms estrictas. Con cada vuelta selectiva, los RNA que "pasan la prueba" cada vez son ms adecuados para la tarea que se les impone.

Receptor de LDL

Intrones

Exones

ffiffiffl
Complemento C9 Precursor de FCE
FIGURA 11-39. Origen de los exones del gen que codifica el receptor de LDL. Los 18 exones que constituyen el gen para el receptor de LDL se muestran en la parte de arriba; las flechas indican la posicin de los 17 intrones. El receptor de LDL contiene una secuencia de aminocidos que muestra una homologa distinta para el factor de crecimiento epidrmico (FCE) y la protena del complemento C9. Los estudios indican que el gen para el receptor de LDL contiene una regin (mostrada en azul} que corresponde al gen del complemento C9 y otra regin (indicada en amarillo) que corresponde al gen que codifica al precursor para el factor de crecimiento epidrmico. El gen para el precursor del FCE se muestra en la parte inferior de la figura con sus exones delimitados. Algunos de los exones del gen precursor del FCE corresponden a los exones del gen receptor de LDL, otros no. Es de suponer que los intrones nicos para uno u otro gen aparecieron despus del ensamblado del gen receptor de LDL durante la evolucin. (Segn B. Lcwin, Genes V, p. 697, Oxford University Press, 1994.)

464

CAPITULO 11 Utilizacin de la informacin gentica; de la transcripcin a la traduccin

LA PERSPECTIVA HUMANA
Posible uso de las ribozimas en medicina
Las ribozimas poseen dos propiedades importantes que los convierten en agentes potenciales de la lucha contra ciertas enfermedades crnicas: 1) contienen tramos de nucletidos que les permiten formar pares de bases con un RNA complementario y 2) tienen un sitio cataltico capaz de desdoblar el esqueleto del RNA complementario (fig. PH 11-1). Con estas propiedades, las ribozimas son sujetos ideales para manipulacin en ingeniera gentica, puesto que se pueden disear a la medida para reconocer y destruir cualquier RNA especfico. Ya se inici el uso de ribozimas diseadas a la medida en la lucha contra enfermedades virales. Para que un virus dae a una clula infectada, el genoma viral debe transcribirse en RNA viral, que posteriormente se traduce en protena virales. Consideremos lo que ocurre si una clula infectada posee un gen que codifica a una ribozima capaz de enlazarse especficamente y destruir el RNA viral. Podra esperarse que la clula fuese inmune contra el virus, aunque el genoma viral se encuentre integrado al DNA de las clulas husped. Experimentos recientes efectuados por Flosie Wong-Staal, de la Universidad de California, y Arnold Hempel, de la Northern Illinois University, demostraron la posibilidad de utilizar ribosomas de esta manera. En sus experimentos, Wong-Staal y Hempel aislaron Hnfocitos T de pacientes con SIDA y transfectaron las clulas (seccin 17-12) con una secuencia de DNA manipulada por ingeniera gentica que codifica una ribozima capaz de reconocer y desdoblar RNAm del HIV. El gen para ribozimas se coloca hacia abajo de un promotor "fuerte", que garantiza su transcripcin activa. Las pruebas indican que la ribozima reduce la cantidad de virus producido por clulas infectadas con HIV por un factor aproximado de 10 000 en comparacin con clulas infectadas con HIV no transfectadas. Lo ms importante es que la ribozima evidentemente es eficaz para destruir el RNA viral sin daar al RNA normal de la clula. El siguiente paso en el proyecto es iniciar ensayos clnicos a gran escala en los cuales se introducen linfocitos portadores de un gen para ribozima de regreso al cuerpo del paciente del cual se tomaron las clulas. Se espera que las clulas transfectadas sean resistentes al virus y preserven el sistema inmunitario deficiente del paciente. El objetivo final de esta geneterapia es introducir el gen para ribozimas destructores de RNA en todas las clulas del cuerpo infectadas por el virus y no slo en aquellas presentes en la circulacin sangunea. Como se analiz en la pgina 153, se han desarrollado diferentes vectores para suministrar genes extraos a diferentes sitios del cuerpo. Las ribozimas tambin pueden ser tiles en la lucha contra ciertos tipos de cncer. Como se estudia en el captulo 16, se ha demostrado que ciertos tipos de cncer humano son resultado de una mutacin en un gen {un encogen) que codifica una protena que participa en la regulacin de la divisin celular. Puesto que la malignidad de estas clulas se debe a la sntesis de un RNA diferente del producido por una clula normal, sera factible revertir el estado maligno de la clula destruyendo el RNA alterado, tarea apropiada para una ribozima. Se han aislado clulas del cncer humano de la vejiga y se han transfectado con un gen diseado a la medida que codifica un ribosoma capaz de reconocer y destruir el RNA transcrito del oncogen alterado. Normalmente, las clulas vesicales malignas pueden causar tumores cuando se inyectan a ratones de la-

KIGURA l'H 1 1 - 1 . Accin de una ribozima. La ribozima que aqu se muestra, llamada ribozima de cabeza de martillo, es capaz de enlazarse al RNA que tiene una secuencia complementaria de nucletidos y catalizar una reaccin para desdoblar el esqueleto del sustrato del RNA. (Reimpreso con permiso de T.R. Ccch y O.C. lUenbcck, Na tu re 372:39, 1994; copyright 1994 por Macmillftn Mngazincs Ltd.)

CAPITULO 11 Utilizacin de la informacin gentica: de la transcripcin a la traduccin

465

boratorio, pero las clulas cancerosas transfectadas con la ribozima pierden sus propiedades malignas y ya no son capaces de formar tumores en el ani-

mal husped. Para ser eficaz como tratamiento para el cncer, el gen que codifica el ribosoma tendr que introducirse en todas las clulas del tumor, lo

cual, como se analiz antes, requiere el desarrollo de un vector capaz de entregar el gen a los tejidos internos del cuerpo.

Es de esperar que un RNA que se enlaza con gran afinidad a un ligando posea actividad cataltica capaz de modificar dicho ligando. Esta expectativa se cumpli en experimentos recientes en los cuales inicialmente se seleccionaron RNA capaces de unirse al ATP y despus se eligi una subpoblacin que hidroliza ATP y transfiere el grupo fosfato al extremo de otro RNA. La transferencia de un grupo fosfato del ATP a un donador adecuado es uno de los tipos de reacciones ms importantes efectuadas por enzimas de protenas en las clulas vivientes. La demostracin de que un ribosoma sinttico puede catalizar una reaccin de este tipo aade mayor credibilidad al concepto de que las molculas de RNA son capaces de catalizar todas las reacciones requeridas para mantener la vida de una clula primitiva antigua.

sibles que pueden ocurrir en un sitio particular del DNA (o el RNAm). Con una letra hay cuatro palabras posibles, 16 palabras posibles con dos letras y 64 (43) posibles palabras con tres letras. Puesto que se deben especificar 20 aminocidos diferentes (palabras), los codones deben contener cuando menos tres nucletidos sucesivos (letras). Pronto se comprob en diferentes experimentos de gentica la existencia del tripleto natural. Adems de proponer que el cdigo era un tripleto, Gamow tambin propuso que es un cdigo superpuesto. Consideremos la siguiente secuencia de nucletidos: AGCAUCGCAUCGA Si el cdigo est superpuesto, entonces el ribosoma se mover a lo largo del RNAm avanzando un nucletido cada vez y reconociendo un nuevo codn con cada movimiento. En la secuencia precedente, AGC especificara un aminocido, GCA el siguiente aminocido, CAU el siguiente, y as sucesivamente. Sin embargo, si el cdigo no estuviera stipej'puesto, cada nucletido a lo largo del RNAm sera parte de uno y slo un codn. Se pueden extraer conclusiones acerca de la superposicin o no superposicin del cdigo a partir de estudios en protenas imitantes, como la hemoglobina muante que causa la anemia drepanoctica. En la anemia drepanoctica, como en muchos otros casos estudiados, se observ que en la protena mutante se ha sustituido un solo aminocido. Si el cdigo estuviera superpuesto a un cambio en uno de los pares de bases del DNA debera afectar a tres codones consecutivos (fig. 11-40) y, por lo tanto, a tres aminocidos consecutivos en el polipptido correspondiente. Sin embargo, si el cdigo no est superpuesto y cada nucletido es parte de un solo codn, entonces sera de esperar la sustitucin de un solo aminocido. Estos y otros datos indican que el cdigo no est superpuesto y que la proposicin de Gamow al respecto era incorrecta. El uso de un cdigo no superpuesto aade una dificultad tcnica al ribosoma. Puesto que el ribosoma se mueve a lo largo del RNAm una distancia equivalente a tres nucletidos a la vez, entonces la secuencia de aminocidos que se ensambla al ribosoma es determinada por los tripletos particulares "ledos". Una vez unido el ribosoma a un RNAm comienza a leer el primer codn y siempre se desplaza a lo largo en bloques consecutivos de tres nucletidos. Para garantizar la lectura de los tripletos apropiados, el ribosoma se fija al RNAm en un sitio preciso llamado codn de inicio, AUG, que automticamente coloca al ribosoma en el cua-

11-4 Codificacin de la informacin gentica


Una vez descrita la estructura del DNA era evidente que la secuencia de aminocidos de un polippdo fuera especificada por la secuencia de nucletidos en el DNA de un gen. Pareca poco probable que el DNA pudiera servir como plantilla fsica directa para el ensamblado de una protena. En vez de eso, se asumi que la informacin almacenada en la secuencia de nucletidos se presentaba en algn tipo de cdigo gentico. Con el descubrimiento del RNA mensajero como intermediario del flujo de informacin del DNA a la protena, la atencin se orient a investigar de qu manera una secuencia "escrita" en un "alfabeto" ribonucletido puede codificar una secuencia "escrita" en un "alfabeto" muy diferente de aminocidos. Propiedades del cdigo gentico Uno de los primeros modelos del cdigo gentico fue postulado por el fsico George Gamow, quien propuso que cada aminocido de un polipptido estaba codificado por una secuencia de tres nucletidos. En otros trminos, las palabras del cdigo, o codones, para aminocidos eran tripletos de nucletidos. Gamow lleg a esta conclusin con una lgica un poco de escritorio. Razon que deben requerirse cuando menos tres nucletidos por cada aminocido que posea su propio codn nico. Consideremos el nmero de palabras que se pueden deletrear utilizando un alfabeto de cuatro letras diferentes correspondientes a las cuatro bases po-

466

CAPITULO 11 Utilizacin de a informacin gentica: de la transcripcin a la traduccin

Secuencia original ...AGCATCG... Secuencia despus de la sustitucin de una sola base ..AGAATCG..

Cdigo superpuesto
. . ., A G C , GCA, CAT, ATC, TCG

Cdigo no superpuesto
., A G C , ATC

Cdigo superpuesto ., A G A i G / \ A 1 A A J _ i A T C , T C G , .

Cdigo no superpuesto
.. A G A . A T C , .

FIGURA 11-40. Distincin entre un cdigo gentico superpuesto y uno no superpuesto. Efecto de la sustitucin de una sola base en el RNAm sobre el contenido de informacin en cada uno de estos dos tipos de cdigo. Los codones afectados se muestran subrayados en rojo.

dro de lectura apropiado, de modo que lea correctamente todo el mensaje desde ese punto en adelante. Por ejemplo, en el siguiente caso, CUAGUUACAUGCUCCAGUCCGU el ribosoma se desplaza desde el codn de inicio, AUG, a los siguientes tres nucletidos, CUC, y as sucesivamente a lo largo de toda la lnea. Algunas de las mutaciones ms destructivas son aquellas que slo aaden o borran un par de bases al DNA. Un ejemplo de adicin de un solo nucletido a la secuencia previa se ilustra por CUAGUUACAUGCUCGCAGUCCGU Las mutaciones de este tipo se denominan mutaciones por cambio de cuadro y causan que el ribosoma se mueva a lo largo del RNAm en el cuadro de lectura incorrecto desde el punto de la mutacin hacia el resto de la secuencia codificadora. Como resultado, estas mutaciones con cambio de cuadro conducen a ensamblar una secuencia enteramente anormal de aminocidos desde el punto de la mutacin hasta el extremo del polipptido. Irnicamente, despus de ms de veinte aos asumiendo que el ribosoma siempre se mueve de un tripleto al siguiente, se han descubierto varios ejemplos donde el RNAm contiene una seal de recodificacin para que el ribosoma cambie su cuadro de lectura, de ordinario regresando un nucletido hacia atrs (cambio al cuadro -1) o saltando un nucletido (cambio al cuadro +1). Considerando que los organismos emplean un cdigo de tripletos con capacidad para especificar 64 aminocidos diferentes y que en realidad slo hay 20 aminocidos para especificar, se plantea la pregunta sobre cul es la funcin de los 44 tripletos extra. Hay tres posibilidades: todos ellos, algunos de ellos o ninguno de ellos codifica aminocidos. Si alguna de las dos primeras posibilidades es correcta, entonces cuando menos uno de los aminocidos ser especificado por ms de un codn. Se dice que un cdigo de este tipo est deteriorado. Como despus se comprob, el cdigo est muy deteriorado, puesto que casi los 64 codones posibles especifican aminocidos. Los que no lo hacen (3 de los 64) tienen una funcin especial: el ribosoma los reconoce como codones de terminacin y detienen la lectura del mensaje.

El deterioro del cdigo fue pronosticado originalmente por Francis Crick sobre fundamentos tericos cuando consider la extensa gama de composicin de bases por diferentes DNA bacterianos. Por ejemplo, se observ que el contenido de G + C poda variar de 20 a 74%, en tanto que la composicin de aminocidos en las protenas de estos organismos mostraba poca variacin total. Esto sugiri que los mismos aminocidos eran codificados por diferentes secuencias de bases, lo que constitua el deterioro del cdigo.
Identificacin de los codones

En 1961 ya se conocan las propiedades generales del cdigo, pero an no se descubra alguna codificacin especfica asignada a los tripletos. En aquel tiempo, casi todos los genetistas pensaban que deban transcurrir cinco a 10 aos antes de descifrar todo el cdigo. Pero Marshall Nirenberg y Heinrich Matthaei dieron un gran paso cuando desarrollaron una tcnica para sintetizar sus propios "mensajes genticos" artificiales y luego determinar qu tipo de "protena" codificaban. El primer mensaje sometido a prueba fue un polirribonucletido compuesto exclusivamente de uridina; el mensaje se denomin "poIi(U)". Cuando se aadi po!i(U} al tubo de ensaye que contena un extracto bacteriano con los 20 aminocidos adems de los materiales necesarios para la sntesis de protenas (ribosomas y varios factores solubles), el sistema sigui las instrucciones del mensajero artificial y elabor un polipptido. Analizando el polipptido ensamblado se observ que era una polifenilalanina, un polmero del aminocido fenilalanina. Nirenberg y Matthaei haban demostrado as que el codn UUU especifica fenilalanina. En los siguientes cuatro aos, varios investigadores se unieron a la bsqueda y se elaboraron otros RNAm sintticos para probar las especificaciones de aminocidos de todos los 64 codones posibles. El resultado fue la carta descodificadora universal o "cdigo gentico" mostrado en la figura 11-41 (el pie de la figura contiene las instrucciones para leer la carta). Las asignaciones suministradas al codn en la figura 11-41 son prcticamente universales: cualquiera que sea el tipo de clula, como bacteria, levadura, hongo, pino gigante de California o ser humano, los mismos codones especifican a los mismos aminocidos. La principal excepcin a la universalidad del cdigo gentico se observa en los codones del RNAm mitocondral. Por ejemplo, en la mito-

CAPITULO 11 Utilizacin de la informacin gentica: de la transcripcin a la traduccin 1a letra ra EL CDIGO GENTICO

467

C
Fenilalanina Fenilalanina Leucina Leucina Leucina Leucina Leucina Leucina Isoleucina Isoleucina Isoleucrna Metionina {inicio} Valina Valina Valina Valina Serina Serina Serina SerJna Prolina Prolina Prolina Prolina Treonina Treonina Treonina Treonina Alanina Alanina Alanina Alanina

A
Tirosina Tirosina Paro Paro Histidina Hjstidina~ Glutamina" ^-^ Glutamina Asparagina Asparagina Lisina Lisina Acido asprtico Acido asprtico Acido glutmico Acido glutmico

Cistena Cistena'' Paro Triptfano Arginina Argidina Arginina Arginina Serina Serina Arginina Arginina Glicina Glicina
.-

U
C
"^ A

G U C A G
~"^

ACG

C
A

G U

^j
A

Glicina Glicina

ccu

4
3a letra

FIGURA 11-41. El cdigo gentico. La correlacin entre codn y aminocidos indicada en esta carta descodificadora es igual casi en todos los organismos. Por ejemplo, para emplear la carta en la traduccin del codn UGC se debe encontrar la primera letra (U) sobre ei rengln indicado a la izquierda. Seguir este rengln a la derecha hasta encontrar la segunda letra (G), indicada en la parte de arriba; a continuacin encontrar el aminocido que coincide con la tercera letra (C) en la fila de la derecha. UGC especifica la introduccin de cistena. Cada aminocido (excepto 2) posee varios codones que ordenan su introduccin. Estos son "sinnimos" genticos, sistemas de respaldo que reducen el peligro de que mutaciones letales destruyan las clulas. Como se analiza en la siguiente seccin, la descodificacin en las clulas la efecta ei RNAt, algo de lo cual se ilustra esquemticamente a la derecha de la figura.

condra humana, UGA se lee como triptfano en vez de alto, AUA se lee como metionina en vez de isoleucina, y AGA y AGC se leen como paro en vez de arginina. Aun con estas discrepancias, las similitudes de los cdigos genticos mitocondrial y nuclear sobrepasan con mucho sus diferencias y en general se cree que uno se deriv del otro, y que todos los organismos presentes sobre la tierra en la actualidad comparten un origen evolutivo comn. El examen de la carta de codones de la figura 11-41 indica claramente que la asignacin de aminocidos no es al azar. Ms bien, hay una semejanza evidente en los codones que especifican el mismo aminocido. Como resultado, las mutaciones espontneas que provocan cambios en el gen de una sola base con frecuencia no producen cambio en la secuencia de aminocidos de la protena correspondiente. La comparacin de las secuencias de nucletdos de la misma protena entre especies diferentes indica que se acumu-

lanmuchas ms sustituciones de nucletdos que no cambian la secuencia de aminocidos de la protena en comparacin con las sustituciones que s causan cambios. Ei aspecto del "margen de seguridad" del cdigo es ms importante que el de su deterioro. La asignacin a los codones es tal que aminocidos similares tienden a ser especificados por codones similares. Por ejemplo, los codones de diferentes aminocidos hidrofbcos se agrupan en las primeras dos columnas de la carta. Por consiguiente, la sustitucin de una base en uno de estos codones probablemente sustituya a un residuo hidrofbico por otro. Adems, las principales semejanzas entre aminocidos y codones relacionados aparecen en los primeros dos nucletidos del tripleto, en tanto que la mayor variabilidad ocurre en el tercer nucletido. La explicacin de este fenmeno se revela en la siguiente seccin, donde se describe el papel del RNA de transferencia.

468

CAPITULO 11 Utilizacin de a informacin gentica: de la transcripcin a la traduccin

Descodificacin de los codones: papel de los RNA de transferencia cidos nucleicos y protenas son como dos lenguajes escritos con diferentes tipos de letra. Cmo puede la informacin codificada en una secuencia de nucletidos controlar el ensamblado secuencial de aminocidos en una protena? A fines de los aos 1950, Francis Crick propuso una respuesta a esta pregunta con base en su conviccin de que la manera predominante para que un cido nucleico exprese su especificidad era mediante la formacin de uniones de hidrgeno entre nucletidos complementarios. Crick postul la existencia de una molcula "adaptadora" de cido nucleico, la cual "descodificara" el mensaje gentico de los nucletidos para convertirlo en aminocido. Cada aminocido tendra su propia especie de adaptador, y de esta manera, una secuencia especfica de bases podra traducirse en una cadena

definida de polipptidos. Esta era una hiptesis atrevida: predecir un tipo de molcula enteramente nueva con base en la lgica bioqumica y no en su aislamiento. Poco tiempo despus se descubri el RNA de transferencia en la fase soluble del citoplasma celular, y casi de inmediato se confirm su papel como adaptador en la sntesis de protenas. Puesto que cada RNAt puede reconocer dos diferentes tipos de molculas, un RNAm y un aminocido, debemos considerar de qu manera tienen lugar ambas formas de reconocimiento. Sin embargo, primero analizaremos la estructura de las molculas del RNAt que les permite efectuar estas funciones. En 1965, luego de siete aos de trabajo, Robert Holley, de la Universidad Cornell, public la primera secuencia de bases de una molcula de RNA, la del RNA de levadura especfico para el aminocido alanina (fig. 11-42, a). Esta molcula RNAt se compone de 77 nucletidos, 10 de los cuales son modificaciones de los cuatro nucletidos

3' A ~OH

Tallo aceptor

Anticodn

Anticodn

(a)
FKil'llA 11-42. Estructura bidimensional del RNA de transferencia, a) Secuencia de nucletidos en forma de hoja de trbol de RNAtAla de levadura. Los aminocidos se encuentran unidos al extremo 3' del RNAt, en tanto que el extremo opuesto posee el anticodn, en este caso IGC. La funcin del anticodn se analiza ms adelante. Adems de las cuatro bases, A, U, G y C, este RNAt contiene ty, seudouridina; T, ribotimidina; mi, metilinosina; I, inosina; rr^G, dimetilguanosina; D, dihidrouridina; meG, metilguanosina. Los sitios de las 10 bases modificadas en este RNAt se indican por el sombreado en color, b) Representacin generalizada del RNAt en forma de hoja de trbol. Las bases comunes a todos los RNAt (procariota y eucariota) se indican con letras; R es una purina invariable, Y es una pirimidina invariable, >p es una seudouridina invariable. Los crculos claros indican sitios donde las bases participan en la formacin de pares de bases no de Watson-Crick. A menudo, pero no siempre, los nuclesidos mostrados se modifican. La mayor variabilidad entre los RNAt ocurre en el brazo V (variable), que puede oscilar de 4 a 21 nucletidos. Hay dos sitios de menor variabilidad a lo largo del brazo D.

CAPITULO 11 Utilizacin de la informacin gentica: de la transcripcin a la traduccin

469

estndar (A, G, C, U) del RNA, como lo indica el sombreado de la figura. En los siguientes aos se publicaron y secuenciaron algunas otras especies de RNAt y se observaron varias similitudes en todos los diferentes RNAt (fig. 11-42, b). Todos ellos constan casi del mismo pequeo nmero de nucletidos,, entre 73 y 93, y todos tienen un porcentaje significativo de bases poco comunes que al parecer son resultado de modificaciones enzimticas de una de las cuatro bases estndar despus que se incorporan a la cadena de RNA (es decir, luego de la transcripcin). Adems, todos los RNAt poseen secuencias de nucletidos en una parte de la molcula que son complementarias de secuencias localizadas en otras partes de la molcula. A causa de estas secuencias complementarias, todos los RNAt tienen posibilidad de plegarse de igual manera para formar una estructura parecida a una hoja de trbol. En la figura 11-42 se muestran los tallos con pares de bases y las asas no apareadas de las hojas de trbol del RNAt. El aminocido siempre se fija a la A en el extremo 3' de la molcula. Las bases poco comunes, que se concentran en las asas, actan para interrumpir la formacin de puentes de hidrgeno en estas regiones y tambin sirven como sitio potencial de reconocimiento para enzimas. Hasta este punto slo se ha considerado la estructura secundaria o bidimensional de estas molculas adaptadores. Los RNA de transferencia pueden plegarse para formar una estructura terciaria nica definida. El anlisis de difraccin de rayos X demuestra que los RNAt asumen forma de L (fig. 11-43). Como en el caso de la estructura terciaria de las protenas, el plegamiento de una molcula de RNAt se facilita por la formacin de enlaces dbiles entre partes de otra

manera distantes de la molcula. Las bases observadas en sitios comparables en toda molcula de RNAt (bases invariantes de la figura 11-42, b) tienen particular importancia para generar la estructura terciaria comn en forma de L. La forma comn de todos los RNAt refleja el hecho de que todos deben tomar parte en la misma serie de reacciones durante la sntesis de protena. Sin embargo, al mismo tiempo, varias enzimas deben distinguir los diferentes RNAt, de modo que el aminocido apropiado se pueda fijar a su RNAt apropiado (conocido). Los RNA de transferencia se encargan de leer las palabras en el alfabeto nucletido del RNAm y asegurarse de traducirlas a las palabras apropiadas en el alfabeto aminocido de la protena. El reconocimiento entre una molcula de RNAt determinada y un tripleto de RNAm determinado (codn) se logra por la formacin de puentes de hidrgeno entre secuencias de bases complementarias sobre los RNA de transferencia y mensajeros. La parte del RNAt que participa en esta interaccin especfica con el codn del RNAm es un tramo de tres nucletidos secuenciales, denominado anticodn, que se localiza en el asa media de la molcula de RNAt (fig. 11-43, a). En todos los RNAt, esta asa se compone de siete nucletidos, los tres de en medio formando el anticodn. El anlisis de la estructura terciaria indica que el anticodn se localiza en un extremo de la molcula de RNAt en forma de L, opuesto hacia el cual el aminocido se encuentra fijo (fig. 11-43, b). Conforme el RNAt se enlaza secuencialmente a su codn complementario del RNAm, los aminocidos que transporta se ensamblan de modo secuencial en una cadena de polipptidos. Como resultado, la secuencia de nucletidos del RNAm controla la secuencia de aminocidos del polipptido.

Anticodn

(a)

(b)

FIGURA 11-43. Estructura tridimensional de un RNAt. a) Dibujo esquemtico. El brazo aceptor de aminocidos (AA) y el brazo T^C (T) forman una doble hlice continua, y el brazo anticodn (AC) y el brazo D forman la otra doble hlice parcialmente continua. Estas dos columnas helicoidales forman una L. El esqueleto de fosfato-ribosa se muestra como una fibra continua, excepto por los tres segmentos punteados en los cuales vara el nmero de nucletidos entre los diferentes RNAt. b) Fotografa de un modelo de 2.5 A de un fenilalanil RNAt de levadura tomada por B.F.C Clark y J.E. Ladner utilizando coordinados suministrados por A. Klug. La distancia del anticodn al extremo 3' terminal es de casi 8 nm. (a. Reimpreso con permiso de S.-H. Kim, Nature 256:680, 1975; copyright 1975 por Macmillan Magazines Limited; b: cortesa de B.F.C. Clark.)

470

CAPITULO 11 Utilizacin de la informacin gentica: de la transcripcin a la traduccin

Puesto que son 61 los diferentes codones que puede especificar un aminocido, sera de esperar que una clula tuviera cuando menos 61 diferentes RNAt, cada uno con un anticodn diferente complementario de uno de los codones de la figura 11-41. Pero recordemos que las ms grandes similitudes entre codones que especifican el mismo aminocido ocurren en los primeros dos nucletidos del tripleto, en tanto que la mayor variabilidad en estos mismos codones ocurre en el tercer nucletido del tripleto. Consideremos los 16 codones que terminan en U. En cada caso, si la U cambia a C, se especifica el mismo aminocido (primeras dos lneas de cada cuadro en la figura 11-41). De manera similar, en la mayor parte de los casos, un cambio entre una A y una G en el tercer sitio tampoco tiene efecto en la determinacin del aminocido. La posibilidad de intercambiar la base de la tercera posicin llev a Francis Crick a proponer que el mismo RNA de transferencia puede reconocer ms de un codn. Su proposicin, llamada hiptesis de la inestabilidad, sugiere que en tanto el requerimiento estrico entre el anticodn del RNAt y el codn del RNAm pueda ser muy estricto para las primeras dos posiciones, quiz sea ms flexible en la tercera posicin, lo que permite a dos codones que especifican el mismo aminocido y que slo difieren en la tercera posicin puedan emplear el mismo RNAt en la sntesis de protenas. Una vez ms, la hiptesis de Crick result correcta. Las reglas que gobiernan la inestabilidad en la tercera posicin del codn son las siguientes (fig. 11-44): la U del anticodn puede formar par con A o G del RNAm; la G del anticodn puede formar par con U o C del RNAm; y la I (inosina, derivada de la guanina en la molcula de RNAt original) del anticodn puede formar par con U, C o A del RNAm. La hiptesis de la inestabilidad se comprob demostrando que ciertas molculas de RNAt purificado se unen a ms de un codn para el aminocido especificado. Como consecuencia de la inestabilidad, los seis codones para leucina, por ejemplo, slo requieren tres RNAt.
Activacin de aminocidos

apropiados para aquel aminocido (o sea, todos los RNAt cuyos anticodones reconozcan los diferentes codones para ese aminocido, como se indica en la figura 11-41). Las aminoacil-RNAt sintetasas constituyen un excelente ejemplo de la especificidad de las interacciones protena-cido nucleico. Deben existir ciertas caractersticas comunes entre todas las especies de RNAt de un aminocido determinado para permitir a la enzima apropiada del grupo reconocer todos estos RNAt y al mismo tiempo discriminar todos los RNAt para otros aminocidos. Se ha determinado la estructura tridimensional de varias de estas enzimas (fig. 11-45) y se ha venido acumulando informacin acerca de las caractersticas estructurales de los RNAt que pueden causar que sean seleccionados o rechazados como sustratos. Puesto que los sustratos de RNAt para las diferentes aminoacilRNAt sintetasas son tan parecidos, se podra pronosticar que las enzimas tambin son similares entre s. En realidad, representan un conjunto ms bien heterogneo de protenas que se cree han evolucionado a partir de diferentes protenas ancestrales. Es posible que esas enzimas aparecieran en una etapa muy primitiva de la evolucin antes que muchas otras partes del mecanismo de traduccin. Las aminoacil-RNAt sintetasas efectan la siguiente reaccin en dos pasos: Primer paso: ATP + aminocidos - aminoacil-AMP + PP Segundo paso: aminoacil-AMP + RNAt -^ aminoacil-RNAt + AMP En el primer paso, la energa del ATP se emplea para "activar" el aminocido mediante la formacin de un aminocido adenilado que se enlaza a la enzima. Este es el paso primario de requerimiento de energa en todo el proceso de ensamblado del polipptido. Los acontecimientos subsecuentes, como la transferencia del aminocido a la molcula RNAt (paso 2 de arriba), y finalmente el crecimiento de la cadena de polipptidos, son todos termodinmicamente favorables. El PP producido en la primera reaccin se hidroliza a continuacin para formar P, forzando an ms la reaccin total hacia la formacin de productos (durante la sntesis de protenas se consume energa, pero no se emplea en la formacin de uniones peptdicas). El segundo paso 'en la formacin de una molcula de RNAt cargada tiene lugar cuando la enzima transfiere su aminocido en-

Durante la sntesis de protena es de gran importancia que cada molcula de RNA de transferencia se una al aminocido "correcto" (conocido). Los aminocidos se unen mediante enlaces covalentes a los extremos 3' de su RNAt conocido por accin de una enzima llamada aminoacil-RNAt sintetasa. Una aminoacil-RNAt sintetasa especfica reconoce cada aminocido, la cual es capaz de "cargar" todos los RNAt

Leu

Codones de RNAm 5' FIGURA 11-44 Flexibilidad en la interaccin entre codones y anticodones. En algunos casos, el nucletido situado en el extremo 5' del anticodn del RNAt puede formar par con ms de un nucletido situado en el extremo 3' (tercera posicin) del codn de RNAm. En consecuencia, el mismo RNAt puede usar ms de un codn. Las reglas para la formacin de parejas flexibles se indican en la figura y tambin en el texto.

CAPITULO 11 Utilizacin de la informacin gentica: de la transcripcin a la traduccin

471

te convirtieron la cistena fijada en alanina y observaron el efecto que esto tena sobre la incorporacin del aminocido. No tuvo efecto. El grupo de reconocimiento del RNAt, que es su anticodn, no mostr alteraciones y, por lo tanto, sigui reconociendo los mismos nucletidos del RNAm como si no se hubiera alterado qumicamente el aminocido. Por consiguiente, siempre que se encontr una cistena codificada en el mensaje se incorpor una alanina en la cadena del polipptido.

11-5 Traduccin de la informacin gentica


La sntesis o traduccin de protenas es la actividad sinttica ms compleja que ocurre en la clula. En tanto que otras macromolculas de las clulas se elaboran por medio de reacciones enzimticas relativamente directas, el ensamblado de una protena requiere todos los diferentes RNAt con sus aminocidos unidos, ribosomas, RNA mensajeros y algunas protenas con varias funciones, cationes y GTP. La complejidad no es sorprendente si consideramos que la sntesis de protenas requiere la incorporacin de cada uno de los diferentes 20 aminocidos en la secuencia precisa dictada por un mensaje codificado escrito en un lenguaje que emplea distintos smbolos. En la descripcin siguiente, casi siempre nos referimos a los mecanismos de traduccin que operan en clulas bacterianas. El proceso es notablemente similar en clulas eucariotas. La diferencia principal es que la traduccin en clulas eucariotas implica numerosos factores protenicos solubles (no ribosmicos). La sntesis de una cadena de polipptidos se puede dividir en tres actividades distintivas: inicio, alargamiento y terminacin de la cadena. Consideraremos por separado cada una de estas actividades. Inicio En la figura 11-47 se ilustran los pasos bsicos del inicio de la traduccin en procariotes. Es indispensable que el riboso-

FIGURA 11-45. Modelo tridimensional de la interaccin entre un RNAt y su aminoacil-RNAt sintetasa. Estructura de cristal de glutamil-RNAt sintetasa de E. cali (en azul) que forma un complejo con RNAtGln {en rojo y amarillo). La enzima reconoce este RNAt especfico y puede identificarlo entre otros a travs de extensas interacciones con el tallo aceptor y el anticodn del RNAt. (Segn Tilomas A. Steitz, Science vol. 246, cover of 12/1/89 issue.)

lazado a! extremo 3' del RNAt conocido. Si por alguna razn la sintetasa coloca un aminocido particular sobre un RNAt inapropiado, se activa un mecanismo de control de calidad de la enzima y se secciona la unin entre el aminocido y el RNAt. A partir del anlisis anterior, es evidente que el aminocido en s no desempea un papel directo para determinar si se coloca en un polipptido. Ms bien, los codones del RNAm se interpretan segn la capacidad de reconocimiento de la aminoacil-RNAt sintetasa. Esto se demostr en uno de los primeros experimentos efectuados por Fritz Lipmann y sus colaboradores, cuando alteraron qumicamente un aminocido despus de fijado a su RNAt especifico (fig. 11-46). En ese experimento, estos investigadores prepararon primero RNAt de cistena cargado con cistena. Posteriormen-

NH|

O-

NH3*

O C C CH 2 SH
H
NH uc PU no l_/ri2 f w r*' v>,

O P O C C CH 3
O H

RNAt de cistena sintetasa

Reducida por nquel Raney

H ATP
Cistena
2P,

AMP + PP
Cis-RNAtCis

FIGURA 11-46. Demostracin experimental de que la especificidad de la incorporacin de un aminocido es determinada por RNAt y no por el aminocido fijado. La sustitucin de una cistena por una alanina luego que se ha fijado a RNAtCls no afecta su incorporacin a la cadena de polipptido; o sea, la alanina se incorpora en los sitios que normalmente ocupan los residuos de cistena.

472

CAPITULO 11 Utilizacin de la informacin gentica: de la transcripcin a la traduccin

ma se fije a un punto determinado sobre el RNAm de modo que el mensaje se lea en el cuadro de lectura correcto (pg. 466). Esto se logra obligando al ribosoma a iniciar la traduccin en un sitio especfico del mensaje, llamado codn inicial. Como pronto ser evidente, el RNAm no se enlaza a ribosomas intactos, sino ms bien el mensaje lo hace a subunidades pequeas y grandes en etapas separadas. El primer paso principal de inicio es el enlace de la subunidad ribosmica pequea a la primera (o a una de las primeras) secuencia AUG del mensaje, la cual sirve como codn inicial.3 Cmo puede la subunidad pequea seleccionar el codn AUG inicial en comparacin con algn otro codn interno? Los RNAm bacterianos poseen una secuencia especfica de nucletidos (llamada secuencia Shine-Dalgarno, por sus descubridores) que reside cinco a 10 nucletidos antes del codn inicial. La secuencia Shine-Dalgarno es complementaria de una secuencia de nucletidos cercana al extremo 3' del RNA ribosomico 16S en la subunidad ribosmica pequea.
RNAr RNAm - - A C C U C C U U U A 3' GGGGA 5'

Varios de los pasos delineados en la figura 11-47 requieren la ayuda de protenas solubles, llamadas factores de inicio (designados FI en los procariotes y Fie en eucariotes). Por ejemplo, se cree que el FIe4E en eucariotes se enlaza al casquete situado en el extremo 5' del RNAm y es mediador de la interaccin entre el mensaje y la subunidad

RNAm

fmet

El reconocimiento del codn inicial AUG es resultado de la interaccin entre estas secuencias complementarias en el RNAm y el RNAr conforme la subunidad pequea se enlaza al mensaje. En eucariotes, la subunidad ribosmica pequea reconoce primero el extremo 5' del mensaje que precede al casquete de metilguanosina (pg. 456), y luego se desplaza a lo largo del RNAm hasta alcanzar una secuencia de nucletidos (tpicamente 5'-CCACCAUGC-3') que contiene el tripleto AUG en un contexto en el cual se le puede reconocer como codn inicial. En casi 90% de los RNAm eucariotas, el primer tripleto AUG es el codn de inicio. Cuando se examinan las asignaciones de codones (fig. 11-41) se puede observar que AUG es algo ms que un simple codn inicial; es el nico codn para metionina. En realidad, la metionina siempre es el primer aminocido que se incorpora al extremo N terminal de la cadena naciente de polipptido. (En los procariotes, la metionina inicial posee un grupo formilo que lo convierte en N-formilmetionina.) En la mayor parte de los casos, la metionina (o N-formilmetionina) posteriormente se elimina mediante accin enzimtica, pero la metionina permanece como aminocido N terminal en casi 50% de las cadenas de polipptido maduras. Las clulas poseen dos metionil-RNAt distintos: uno se usa para iniciar la sntesis de protenas (designado RNAt Met) y otro diferente (designado RNAtMet) para incorporar residuos metionilo al interior de un polipptido. Es interesante que mitocondrias y cloroplastos de clulas eucariticas usan iV-formilmetionina para iniciar la traduccin en vez de metionina, dato que suministra una de las piezas ms fuertes en el argumento del origen procariota de estos organelos.

RNAm

3 GUG tambin puede servir como codn inicial y se observa como tal en unos pocos mensajes naturales. Cuando se usa GUG, todava se utiliza N-formilmetionina para formar el complejo inicial a pesar de que los codones GUG internos especifican valina.

FIGURA 11-47. Pasos en el inicio de la sntesis de protena en procariotes. En el paso 1, la subunidad ribosmica SOS a la cual se encuentra fijo el factor de inicio FI3 se enlaza al RNAm en el codn de inicio AUG. Esta interaccin es facilitada por una interaccin que ocurre entre una secuencia complementaria de nucletidos situados sobre el RNAr y el RNAm, segn se indica en el texto. En el paso 2, N-formilmetionil-RNAt (RNAt M ^) con el factor de inicio FI2 enlazado y GTP, se enlaza al complejo subunidad 30S-RNAm. A continuacin se hidroliza GTP. En el paso 3, la subunidad SOS se une al complejo con la liberacin acompaante de FI2, FI3 y los productos de la hidrlisis del GTP (GDP y P).

CAPITULO 11 Utilizacin de la informacin gentica: de la transcripcin a la traduccin

473

ribosmca pequea. Un factor acompaante se desplaza a lo largo del extremo 5' del mensaje eliminando cualquier regin de doble cadena que pudiera impedir los movimientos del ribosoma a medida que se desplaza en busca del codn inicial. Adems de los factores protenicos, tambin se requiere GTP para que el inicio tenga xito. Una molcula de GTP se enlaza al RNAtM^ antes que entre la subunidad ribosmica pequea. Una vez que el RNAt iniciador se fija, la subunidad grande se une al complejo, los factores solubles se liberan y el GTP se hidroliza. La hidrlisis de GTP tal vez provoque un cambio de conformacin en el ribosoma, requerido para el inicio de la traduccin. Cada ribosoma tiene dos sitios para asociarse a las molculas de RNA de transferencia (fig. 11-48). Estos dos sitios, llamados sitio A (aminoacilo) y sitio P (peptidilo), tienen papeles diferentes en la traduccin. Por lo general, el sitio A es en el que entra el aminoacil-RNAt al complejo RNAm ribosmico, en tanto que el sitio P es donde el RNAt dona aminocidos a la cadena en crecimiento.4 El RNAt iniciador (RNAtM?1) probablemente aparezca al principio en el sitio P del ribosoma, segn se ndica en la figura 11-47. Alargamiento Con el RNAt iniciador firmemente cargado en su lugar dentro del sitio P, el ribososma queda disponible para la entra-

4 En la actualidad se acepta un tercer sitio, llamado sitio E (salida, del ingls exit], como sitio separado donde el RNAt abandona el ribosoma despus de donar su aminocido al extremo de la cadena en crecimiento. Puesto que esto aade poco al anlisis, se omite la referencia al sitio E, pero se ndica en la figura 11-48.

Subunidad 50S Subunidad 305

RNAt

=aa

FI<;iRA ll-48. Loralizacin aparente para el ribosoma enlazado al RNAt en los sitios A, P y E. Se muestra la polaridad del RNAm. Las flechas indican la probable va de un RNAt cuando se desplaza hacia adentro y afuera del ribosoma. El sitio E, a partir del cual sale el RNAt del ribosoma, no se analiza en el texto.

da de un segundo aminoacil-RNAt en el sitio A vacante, lo cual es el primer paso en el alargamiento (paso 1, fig. 11-49, a). Ant^s que el segundo aminoacil-RNAt o cualquiera de los subsiguientes pueda enlazarse de manera eficaz al RNAm en el sitio A, debe combinarse con uno de los diversos factores de alargamiento de protenas (este factor particular de alargamiento se denomina Tu en los procariotes y FAel en eucariotes) unido al GTP. Aunque cualquier complejo aminoacil-RNAt-Tu-GTP puede entrar al sitio A, slo aqullos cuyo anticodn sea complementario del codn RNAm situado en el sitio A puede quedar atrapado all porque se une especficamente al RNAm. Una vez que el aminoacil-RNAt-Tu-GTP apropiado se enlaza al codn RNAm, el GTP se hidroliza y el complejo Tu-GDP se libera. E! complejo RNAt-Tu-GTP se regenera, segn se muestra en el paso 2 de la figura 11-49, a. El segundo paso en el ciclo de alargamiento es la formacin de un enlace peptdico entre los aminocidos enlazados a los dos RNAt (paso 3, fig. 11-49, a, y fig. 11-49, b). La reaccin ocurre por transferencia de la metionina (o de la Nformlmetionina) situada sobre el RNAt iniciador del sitio P al aminocido unido al RNAt, unido a su vez al segundo codn en el sitio A. Esta reaccin es catalizada por pcptidi! transferasa, un componente de la subunidad grande del ribosoma. Durante aos, se asumi que la peptidil transferasa era una protena del ribosoma. Despus, conforme fue aparente la potencia cataltica del RNA, la atencin se volvi al RNA ribosmico como catalizador para la formacin de enlaces peptdicos. En la actualidad se ha demostrado que la actividad de la peptidil transferasa en realidad reside en la molcula del RNA ribosmico grande de la subunidad ribosmica grande. En otras palabras, la peptidil transferasa es una ribozima (estudiada en La va experimenta! de la pgina 479}. La formacin del primer enlace peptdico deja un extremo de la molcula de RNAt del sitio A todava fijo a su codn complementario sobre el RNAm y el otro extremo de la molcula fijo a un dipptido. El RNAt del sitio P queda entonces desprovisto de todo aminocido unido. El tercer paso en el ciclo de alargamiento implica: 1) expulsin del RNAt no cargado del sitio P, y 2) movimiento del ribosoma trinucletido (un codn) junto con el RNAm en la direccin 3' {paso 4, fig. 11-49, T). Este ltimo paso, llamado translocacin, se acompaa de movimiento del RNAt dipptido hacfa el sitio P del ribosoma, todava enlazado mediante un puente de hidrgeno al segundo codn del RNAm. La translocacin requiere otro factor de alargamiento (G en procariotes y FAe2 en eucariotes) y la hidrlisis de GTP. Puesto que la translocacin implica el movimiento de una partcula sobre una distancia aproximada de 1 nm a lo largo del mensaje, debe acompaarse de notables cambios de conformacin en la estructura del ribosoma. La energa requerida para impulsar la translocacin es suministrada por la hidrlisis del GTP. As, por cada ciclo de alargamiento cuando menos se hidrolzan dos molculas de GTP, una (o ms) durante la seleccin del aminoacil-RNAt y otra durante la translocacin. Una vez separado el pcptidil-RNAt del sitio P, el sitio A una vez ms se encuentra abierto a la entrada de otro aminoacil-RNAt, en este caso uno cuyo anticodn sea com-

474

CAPITULO 11 Utilizacin de a informacin gentica: de a transcripcin a la traduccin

Pptido CC

R
RNAt,

H O H I II I Pptido CCNC

R'
RNAt, Sitio P vaco Sitio A

(b)
GTP
GDP-Tu + P Tu-Ts
AARNAt

Tu-GTP

GTP-Tu-AA-RNA

RNAm

GDP

J L Peptidi transferasa

FIGl'RA 11-49. Pasos en el alargamiento del polipptido naciente durante la traduccin en procariotes. a) En el paso 1, un aminoacilRNAt cuyo anticodn es complementario al segundo codn del RNAm entra al sitio vaco A del ribosoma. En el paso 2 el enlace del RNAt se acompaa de la liberacin de GDP-Tu, que ser reciclado segn se muestra. En el paso 3 tiene lugar la formacin de un enlace peptdico mediante la transferencia de la cadena del polipptido naciente desde el RNAt en el sitio P al aminoacil-RNAt del sitio A. La reaccin es catalizada por una porcin del RNAr 285 que acta como ribozima. En el paso 4, el enlace del factor G (FA-G) y la hidrlisis de GTP dan como resultado la liberacin del RNAt del sitio P y la translocacin del ribosoma relacionado con el RNAm. b) Formacin de un enlace peptdico y desplazamiento subsecuente del RNAt desacilado del sitio P.

plementario del tercer codn. Cuando el tercer RNAt cargado se asocia al RNAm en el sitio A, el dipptido del RNAt del sjtio P se transfiere al aminocido sobre el RNAt del sitio A formando el segundo enlace peptdico y un tripptido fijo al RNAt del sitio A. El RNAt del sitio P otra vez se encuentra desprovisto de un aminocido. La formacin de enlaces peptdicos va seguida de la expulsin del RNAt del sitio P y la translocacin del ribosoma al cuarto codn, y el ciclo est listo para comenzar una vez ms. Precisin de la traduccin La interaccin entre los tripletos del RNAm y el RNAt no ocurre con la suficiente fuerza para explicar por s misma la precisin conocida de la sntesis de protenas (slo uno de cada 10 000 aminocidos se incorpora de manera incorrecta). Se han propuesto diferentes hiptesis para explicar esta tasa relativamente baja de errores. Una hiptesis sugiere que slo codones y anticodones complementarios entre s pueden adaptarse dentro de la hendidura formada por el

CAPITULO 11 Utilizacin de la informacin gentica: de la transcripcin a la traduccin

475

RNA ribosmico, y slo cuando la hendidura est ocupada puede formarse la unin peptdica. En otra hiptesis se da importancia al retraso aparente entre el enlace del complejo RNAt-Tu-GTP con el RNAm y el momento en que el aminocido se aade a la cadena de polipptido en crecimiento. Cuanto mayor sea el tiempo que un codn y un anticodn inapropiados (no complementarios) permanezcan enlazados, mayor ser la probabilidad de que su dbil interaccin provoque la disociacin y separacin de los dos RNA. Otra hiptesis invoca la hidrlisis del GTP como medio para garantizar la fidelidad de la traduccin. Aunque desde hace mucho se ha asumido que cada ciclo de alargamiento se acompaa de la hidrlisis de dos GTP, hay suficientes datos que sugieren que el verdadero nmero es de tres o ms. La energa adicional puede ser consumida para liberar los RNAt enlazados de manera inadecuada. La estreptomicina, uno de los antibiticos ms ampliamente prescritos, ejerce su efecto porque se enlaza selectivamente a la subunidad ribosmica pequea de las clulas bacterianas causando que ciertos codones del RNAm se lean de manera equivocada e incrementando, por lo tanto, la sntesis de protenas anormales. Puesto que el antibitico no se enlaza a ribososmas eucariotas, no tiene efectos sobre la traduccin de los RNAm de las clulas del husped. As, la estreptomicina al parecer acta enlazndose a la protena ribosmica llamada S12, que de alguna manera participa en el control de la interaccin precisa entre el RNAt especfico

y el complejo ribosoma-RNAm. La resistencia bacteriana a la estreptomicina se puede atribuir a cambios en las protenas ribosmicas, en particular S12. Una gran variedad de antibiticos deben su efecto a la interferencia con diferentes aspectos de la sntesis de protenas en clulas bacterianas. En el cuadro 11-2 se presenta un resumen de la accin de algunos de estos antibiticos. Terminacin Como se mencion en la pgina 467, tres de los 64 codones trinucletidos posibles son codones de paro cuya funcin es concluir el ensamblado de polippdos en vez de codificar otro aminocido. No existe RNAt cuyos anticodones sean complementarios de los codones de paro. Cuando el ribosoma alcanza uno de estos codones, UAA, UAG, UGA, la seal que se lee es detener todo alargamiento adicional y liberar el polipptido asociado al ultimo RNAt. La terminacin requiere la presencia de factores de liberacin que interactan directamente con los codones de paro; las bacterias tienen dos factores de liberacin (FL1 reconoce UAA y UAG, y FL2 reconoce UGA), en tanto que las clulas eucariotas slo poseen uno (FLe). El factor de liberacin posee un GTP enlazado que posteriormente se hidroliza. Una vez detenida la traduccin, el polipptido terminado se separa de su fijacin al RNAt, y ambos, factor de liberacin y RNAt

CUADRO 11-2. Antibiticos que inhiben la sntesis de protenas Sitio de accin Antibitico Puromicina Tetraciclinas Estreptomicina Tipo de clula Eu, Pro* Pro Pro Subunidad Etapa Alterado en imitantes resistentes Efectos especficos

R, P R I, R

Protena S12

Kasugamicina Espectinomicina Cloranfenicol, lincomicina Esparsomicina Ertromicina Siomicina, tiostrepton Kirromicina Pulvomicina Acido fusdico Viomicina

Pro Pro Pro Eu, Pro Pro Pro


Pro

Protena 52; RNA 16S ^ Protena S5

Libera peptidil-puromicina Bloqueo estable del enlace en el sitio A 1. Irreversible: bloquea el movimiento del complejo de inicio 2. Causa lectura errnea por alargamiento del ribosoma Bloquea la formacin de! complejo de inicio Bloquea el movimiento despus del inicio Bloquea la transferencia de peptidil Bloquea la reaccin de puromicina y el enlace establece en el sitio A Bloquea la extensin de la cadena poco despus del inicio Irreversible; bloquea la unin de G-GTP, y de Tu-aa-RNAt-GTP Bloquea la liberacin de Tu-GDP Bloquea la formacin de aa-RNAt-Tu-GTP Bloquea la liberacin de G y de GDP Bloquea el sitio P

L L S S L S, L

P T, R R R T T

RNA 23S, Protenas L4, L26 RNA 235

Pro Eu, Pro Pro

Tu G S, L

* Eu, pro = eucariote, clulas procariotas; L, S = subunidad ribosmica grande y pequea; R = reconocimiento; P - transferencia de peptidil; T = translocacin; I = inicio. FUENTE: B.D. Davis, R. Dulbecco, H.N. Eisen y H.S. Ginsberg, Mcrobiology, 5a. ed., Lippincott, 1990, p. 211.

476

CAPITULO 11 Utilizacin de la informacin gentica: de la transcripcin a la traduccin

Extremo parecido a la cadena RNAt

ocn

Parecido a fenilalanina Terminal 3' del fenilalanil-RNAt

FIGURA 11-50. Semejanza entre puromicina y la terminal 3' de fenilalanil-RNAt. Debido a esta similitud, la puromicina entra al sitio A y provoca la liberacin prematura del polipptido naciente.

desacilado, se liberan del ribosoma. La hidrlisis del enlace entre el polipptido y el ltimo RNAt puede ser catalizada por la misma porcin del RNAr encargada de la formacin de enlaces peptdicos durante el alargamiento. Cuando la terminacin concluye, el ribosoma se separa del mensaje y

se disocia en sus subunidades como preparacin para otro turno de traduccin. Puesto que los tres codones de terminacin pueden formarse con facilidad mediante cambios en una sola base a partir de muchos otros codones, podran esperarse mutaciones que originen codones de paro dentro de un gen. Tales mutaciones provocaran la terminacin prematura de la cadena de polipptidos en crecimiento. Durante decenios se han estudiado mutaciones de este tipo, llamadas mutaciones sin sentido, y se sabe que provocan varias enfermedades hereditarias en el hombre. Las mutaciones sin sentido de ordinario ocasionan las formas ms graves de una enfermedad hereditaria debido a que slo se sintetiza una parte de la protena y, por lo tanto, invariablemente es no funciona!. Otra forma de terminar prematuramente el crecimiento de la cadena es aadir el antibitico puromicina. Esta molcula se parece al extremo 3'de un RNAt cargado (fig. 11-50) y puede penetrar al sitio A del ribosoma. Una vez en dicho sitio, el pptido del sitio P se transfiere a la puromicina del sitio A y se forma un enlace covalente. La transferencia de la cadena naciente de polipptido a la puromicina coloca un casquete sobre el extremo carboxilo de la cadena, de modo que ya no pueden fijarse ms aminocidos. En vez de ello, el complejo peptidil-puromicina separa al ribosoma.

RNAm

Subunidad grande Subunidad pequea Polipptido concluido

Subunidad grande Subunidad pequea

(b)
FIGURA 11-51. Polirribosomas. a) Dibujo esquemtico de un polirribosoma (polisema), b) Micrografa electrnica de un corte transversa] a ras del borde exterior de una cisterna de retculo endoplsmico rugoso. Los ribosomas estn alineados en asas y espirales, lo que indica su fijacin a la molcula de RNAm para formar polisomas. c) Micrografa electrnica de polisemas con sombreado metlico y aislados de reticulocitos que participan en la sntesis de hemoglobina. La mayor parte de estos polisemas tienen entre cuatro y seis ribosomas. (b: Cortesa de E. Yantada; c: cortesa de Alexander Rich.)

(c)

CAPITULO 11 Utilizacin de a informacin gentica: de la trntiscripcin a la traduccin

477

Formacin de polirribosomas Cuando se examina en e microscopio electrnico un RNA mensajero durante el proceso de traduccin, invariablemente se observan numerosos ribosomas fijos a todo lo largo de la cadena de RNAm. A este complejo de ribosomas y RNAm se le denomina polirribosoma, o polisema (fig. 11-51). Inicialmente, cada uno de los ribosomas se ensambla a partir de sus subunidades en el codn de inicio y luego se desplaza desde ese punto hacia el extremo 3' del RNAm hasta alcanzar un codn de terminacin. Tan pronto como cada ribosoma se desplaza una distancia suficiente a lo largo del mensaje a partir del codn inicial, el siguiente ribosoma se fija al RNAm y comienza la actividad de traduccin. La traduccin simultnea del mismo RNAm por un gran nmero de ribosomas incrementa mucho la tasa de sntesis de protenas dentro de la clula. Ahora que se han descrito los acontecimientos bsicos de la traduccin, es adecuado concluir el captulo con foto-

grafas de este proceso, una tomada de una clula procariota (fig. 11-52, a) y la otra de una clula eucariota (fig. 11-52, b). A diferencia de las clulas eucarotas, en las cuales ocurre la transcripcin ocurre en el ncleo y la traduccin en el citoplasma y los dos procesos estn separados por muchos pasos interpuestos, en las clulas procariotas las correspondientes actividades se encuentran firmemente acopladas. Por lo tanto, la sntesis protenica en las clulas bacterianas se inicia sobre plantillas de RNAm mucho antes de concluir la sntesis del RNAm. La sntesis de un RNAm procede en la misma direccin que se mueven los ribosomas cuando traducen el mensaje, o sea, desde el extremo 5' al 3'. En consecuencia, tan pronto como una molcula de RNA comienza a sintetizarse, el extremo 5' est disponible para fijarse a ribosomas. La micrografa de la figura 11-52, a, muestra la cadena de DNA sobre la cual ocurre la transcripcin, el RNAm de longitud creciente de un extremo al otro del gen, y los ribosomas fijos a cada RNAm naciente que forma los polirribosomas. En la micrografa de la figura

'i:'-''"':".:,' ''Wi--:~ .i i* '!'_-..'

- '-" " ' '

' '

'

'"" "-'-'-'"

' ''-' ".'"""-." -- '- '--."'; --.".--;-.

'-,. - -.-;: .,..

(a)
FIGURA 11-52. Observacin visual de la transcripcin y la traduccin, a) Micrografa electrnica de partes de un cromosoma de E. coli que participa en la transcripcin. El DNA se observa como lneas dbiles que corren a lo largo de las fotos, en tanto que las cadenas de RNAm nacientes se observan fijas a uno de sus extremos, al parecer por una molcula de RNA polimerasa. Las partculas asociadas al RNA naciente son ribosomas en el acto de la traduccin; en bacterias, la transcripcin y la traduccin ocurren simultneamente. Las molculas de RNA aumentan de longitud conforme crece la distancia al sitio de inicio, b) Micrografa electrnica de un polirribosoma aislado de las clulas de la glndula de la seda de un gusano de seda, las cuales producen grandes cantidades de la protena fibroma de la seda. Esta protena es lo bastante grande para ser visible en la micrografa (las flechas apuntan a las cadenas de polpptido naciente), (a: Reimpreso con permiso de Osear L Miller, /)., Barbara A. Hamkalo y C.A. Tilomas, Science 169:392, 1970; copyright 1970 por American Association for the Advancement of Science; b: cortesa de Steven L. McKnight y Osear L. MiUer, r.)

478

CAPITULO 11 Utilizacin de la informacin gentica: de la transcripcin a la traduccin

11-52, a, no se observa la cadena naciente de protena, pero puede verse en la micrografa de la figura 11-52, b, que muestra un solo polirribosoma aislado de una clula en la glndula secretoria de seda del gusano de seda. La protena de la seda sintetizada es visible debido a su gran tamao y naturaleza fibrosa. Las tcnicas para visualizar la transcripcin y la traduccin desarrolladas por Osear Mller, Jr., del Oak Ridge National Laboratory, suministran una demostra-

cin visual adecuada del proceso previamente descrito en trminos bioqumicos. Al iniciar este captulo analizamos el cambiante concepto del gen. Se comenz como una unidad hereditaria abstracta que gobierna las caractersticas de una planta de guisante, posteriormente el gen se convirti en un sitio sobre un cromosoma, un segmento de una molcula de DNA, y ms recientemente como unidad de transcripcin. Es no-

LA VIA E X P E R I M E N T A L

Papel del RNA como catalizador


La investigacin en bioqumica y biologa molecular durante el decenio de 1970 consolid nuestros conocimientos acerca del papel de las protenas y los cidos nucleicos. Las protenas eran los agentes que ponen en marcha a la clula, las enzimas las que aceleran la velocidad de las reacciones qumicas dentro de los organismos. Los cidos nucleicos, por otra parte, constituan la molcula encargada de la informacin en la clula, almacenando instrucciones genticas en sus secuencias de nucletidos. La divisin del trabajo entre protenas y enzimas pareca tan bien definida como cualquier definicin establecida en las ciencias biolgicas. Despus, en 1981, se public un trabajo que comenz a empaar esta distincin.1 Thomas Cech y sus colaboradores, de la Universidad de Colorado, han estado estudiando el proceso mediante el cual el precursor de RNA ribosmico sintetizado por el protozoario ciliado Tetrahymena thermophila era convertido en molculas de RNAr maduro. A diferencia del pre-RNAr de mamferos estudiado en la pgina 447, T. thermophila pre-RNAr contiene una secuencia interpuesta de casi 400 nucletidos seccionados de transcrito primario antes de unirse a los segmentos que deben juntarse (ligados). Previamente, Cech haba observado que los ncleos aislados de las clulas podan sintetizar el precursor pre-RNAr y efectuar la reaccin de empalme en su totalidad. Todava no se aislaban enzimas empalmadas de ningn tipo de clula y Tetrahymena poda ser un buen sistema para estudiar dichas enzimas. El primer paso fue aislar el precursor pre-RNAr en su estado intacto y luego determinar el nmero mnimo de componentes nucleares que deban aadirse a la mezcla de reaccin para obtener un empalme preciso. Se observ que cuando se incuban ncleos aislados en un medio con cationes monovalentes en baja concentracin (5 mM NHL}"1"), se sintetiza la molcula pre-RNAr pero el intrn no se separa. Esto permiti a los investigadores purificar el precursor intacto que planeaban utilizar como sustrato para ensayar la actividad de empalme en extractos nucleares. Sin embargo, observaron que cuando se incuba el precursor purificado por s solo en concentraciones ms elevadas de iones NH4+ en presencia de Mg2+ y un compuesto de guanosina (p. ej., GMP o GTP), la secuencia interpuesta se desempalma del precursor (fig. VE 11-1).: El anlisis de la secuencia de nucletidos confirm que el RNA pequeo separado del precursor era el intrn con un nuclendo aadido que contena guanina en su extremo 5'. Se demostro que el nucletido adicional se deriva del GTP aadido a la mezcla de reaccin.
"Nativa" Desnaturalizada por calor 5* 25 50 120 5 5* 25 50 120 E.coli

{NH4);,SO4.mM

1VS RNA-

FIGURA VE 11-1. RNA ribosmico purificado procedente de Tetrahymena marcado con 32P, transcrito a diferentes concentraciones de (NPL^SO,), que se analiz mediante gradiente de electroforesis en gel de poliacrilamida. Los nmeros en la parte de arriba indican la concentracin del sulfato de amonio. Se presentan dos grupos de muestras, "nativas" y desnaturalizadas por calor. Las muestras de este ltimo grupo fueron hervidas durante cinco minutos en amortiguador y enfriadas sobre hielo para disociar toda molcula que pueda unirse mediante puentes de hidrgeno entre bases complementarias. Las dos columnas de la derecha contienen RNAr 16S y 23S bacteriano que proporcionan marcadores de tamao conocido contra los cuales se pueden comparar otras bandas del gel. A partir de la posicin de las bandas se puede observar que conforme se eieva la concentracin de sulfato de amonio, aparece RNA pequeo cuyo tamao es igual al de las secuencias interpuestas aisladas. Estos datos suministraron la primera indicacin de que el RNAr tena capacidad para seccionar al intrn sin ayuda de factores adicionales. (Segn T.R. Cech y cois. Cel 27:488, 1931; con permiso de Cell Press.)

CAPITULO 11 Utilizacin de la informacin gentica: de la transcripcin a la traduccin

479

table que a travs de todos estos cambios en el camino hacia el conocimiento de los factores hereditarios, cada idea acerca del gen retuvo su validez aunque se adapt a los nuevos datos citolgicos y moleculares. El descubrimiento de secuencias interpuestas cambi nuestro concepto una vez ms, terminando con el dogma prevaleciente de que una secuencia lineal ininterrumpida de nucletidos genera una secuencia correspondiente de aminocidos, y revel la inesperada complejidad de la transferencia de informacin dentro de la clula eucariota.

Como ocurre con frecuencia, el descubrimiento de nuevas circunstancias enigmticas ayuda a explicar otras. En este caso, se comprob que la mayor parte de los genes contienen un conjunto de intrones que en total corresponden a una longitud igual a varias veces la de los segmentos codificantes; esto fue un gran avance en el camino para explicar la existencia de demasiado DNA en los genomas de los organismos evolutivamente elevados y por qu los transcritos primarios son mucho ms largos que los mensajeros producidos en ltimo trmino.

El empalme de un intrn es una reaccin complicada que requiere reconocimiento de las secuencias que limitan el intrn, desdoblamiento de los enlaces fosfodister en ambos lados del intrn y unin de los fragmentos adyacentes, Se han efectuado todo tipo de esfuerzos para eliminar cualquier protena que pudiera adherirse al RNA antes de probar su capacidad de empalme, El RNA se ha extrado con detergente-fenol, se ha centrifugado a travs de un gradiente y se ha tratado con una enzima proteoltica. Slo hubo dos explicaciones razonables: el empalme lo efectuaba una protena enlazada firmemente al RNA o la molcula pre-RNAr era capaz de empalmarse por s misma. Esta ltima idea no era fcil de aceptar. Para resolver la cuestin de la presencia de una protena contaminante, Cech y colaboradores utilizaron un sistema artificial en el cual era imposible la existencia de protenas nucleares de empalme.2 El DNA que codifica al precursor de RNAr fue desarrollado en . coli mediante clonacin del DNA, a continuacin se purific y utiiiz como plantilla para la transcripcin in vitro por una RNA polimerasa bacteriana purificada. El pre-RNAr sintetizado in vitro se purific e incub por s solo en presencia de iones monovalentes y divalentes, y un compuesto de guanosina. Puesto que el RNA nunca haba estado en una clula, era imposible que estuviera contaminado por enzimas celulares empalmadas. Aun as, el pre-RNAr aislado sufri la reaccin de empalme precisa que haba ocurrido en la clula. El RNA tena que haberse empalmado por s solo. Como resultado de estos experimentos, se demostr que el RNA era capaz de catalizar una reaccin compleja de mltiples pasos. Los clculos indicaron que la reaccin se efectu con una velocidad diez millones de veces mayor, aproximadamente, en comparacin con la reaccin no catalizada. Por lo tanto, igual que las enzimas de protena, el RNA era activo en concentraciones pequeas, no se alteraba por la reaccin y pudo acelerar mucho una reaccin qumica. La nica diferencia entre este DNA y las "enzimas estndar" fue que el RNA acta sobre s mismo en vez de hacerlo sobre un sustrato independiente. Cech Hamo "ribozima" al RNA. En 1983 se descubri un segundo ejemplo, aunque no relacionado, de catlisis de RNA.3 Sidney Altman y colaboradores, de la Universidad de Vale, y Norman Pace y colegas, del National Jewish Hospital en Denver, colaboraron en un estudio acerca de la ribonucleasa P, enzima que participa en el procesamiento de un precursor de RNA de transferencia en bacterias. La enzima era poco comn por estar compuesta tanto de protenas como de RNA. Cuando se incub en amorti-

guadores con una concentracin elevada de Mg2+ (60 mM), la subunidad RNA purificada pudo eliminar el extremo 5' del precursor de RNAt (fila 7, fig. VE 11-2), as como la molcula ntegra de ribonucleasa P lo hara dentro de la clula. Se demostr que los productos de la reaccin in vitro incluyen la molcula de RNAt madura procesada. En contraste, la subunidad de protena aislada de la enzima estaba desprovista de actividad cataltica (fila 5, fig. VE 11-2). Para eliminar la posibilidad de que una protena contaminante fuera realmente la que catalizaba a reaccin, se sintetiz in vitro la porcin de RNA de la ribonucleasa P a partir de una

1 2 3

4 5

6 7 8 9 1 0

FIGURA VE 13-2. Resultados de la electroforesis en gel de poliacrilamida de la reaccin entre mezclas que contienen el precursor de tirosinil-RNAt (pTir) y el precursor de otro RNA llamado RNA 4.5S (p4.5). Nos centraremos exclusivamente en pTir, normalmente procesado por la RNAasa P en dos molculas de RNA, Tir y 5'-Tir (que corresponde al extremo 5', el precursor). Las posiciones a las cuales se desplazan estos tres RNA (pTir, Tir y 5'-Tir) durante la electroforesis se indican en el lado izquierdo del gel. La lnea 1 muestra los RNA que aparecen en la mezcla de reaccin cuando se incuba pTir (y p 4.5) con la enzima RNAasa P completa. Muy poco del pTir permanece en la mezcla porque se convierte en los dos productos (Tir y 5'-Tir). La lnea 5 muestra los RNA que aparecen en la mezcla de reaccin cuando pTir se incuba con el componente protenico purificado de la enzima. La protena no tiene capacidad para desdoblar el precursor RNAt, segn se manifiesta por la ausencia de bandas donde se desplazaran los dos productos. En contraste, cuando se incuba pTir con el componente RNA purificado de la enzima (lnea 7), pTir se procesa de manera tan eficiente como si se empleara la RNAasa P intacta. (Segn C. GuerrierTokada y cois. Cell 35:351, 1983; con permiso de Cell Press.)

480

CAPITULO 11 Utilizacin de la informacin gentica: de la transcripcin a la traduccin

plantilla de DNA recombinante. Igual que con e RNA extrado de clulas bacterianas, este RNA sintetizado artificialmente, sin protena alguna aadida, pudo desdoblar con precisin el precursor de RNAt.4 A diferencia de la enzima procesadora de RNAr estudiada por Cech, el RNA de la ribonucleasa P actu sobre otra molcula como sustrato y no sobre s misma. Por lo tanto, se demostr que las ribozimas pueden tener las mismas propiedades catalticas de las enzimas proteinceas. En la figura VE 11-3 se muestra un modelo reciente de interaccin entre la subunidad de RNA cataltica de la ribonucleasa P y un sustrato precursor de RNAt. La demostracin de que el RNA puede catalizar reacciones qumicas gener la atmsfera apropiada para volver a investigar una antigua pregunta: qu componente de la subunidad ribosmica grande es la peptidiltransferasa, o sea, el catalizador de la formacin de los enlaces peptdicos (pg. 474). En el decenio de 1970, varios hallazgos independientes plantearon la posibilidad de que el RNA ribosmico poda hacer algo ms que actuar simplemente como un molde para sostener protenas ribosmicas particulares en la posicin apropiada de modo que las protenas puedan efectuar importantes actividades. Entre las pruebas se incluyen los siguientes tipos de datos. 1. Ciertas cepas de E. cali portan genes que codifican protenas que destruyen bacterias llamados colicinas. Se sabe que una de estas toxinas, llamada colicina E3, inhibe ia sntesis de protenas en clulas bacterianas sensibles. Los ribosomas aislados de clulas tratadas con colicina E3 parecen perfectamente normales segn la mayor parte de los criterios, pero no apoyan la sntesis de protenas in vitro. Un anlisis ms atento de dichos ribosomas revel que el defecto reside en el RNAr, no en la protena ribos-

mica. El RNA 16S de la subunidad pequea fue desdoblado por la colicina en casi 50 nucletidos desde su extremo 3', y sta es la causa de que la subunidad no apoyara la sntesis de protenas.5 2. Se observ que e! tratamiento de la subunidad ribosmica grande con ribonucleasa TI, una enzima que desdobla los enlaces entre nucletidos adyacentes del RNA, destruye la capacidad de la subunidad para efectuar la reaccin de la peptidiltransferasa.6 3. Estudios muy variados con antibiticos que inhiben la formacin del enlace peptdico, incluyendo cloranfenicol, carbomicina y eritromicina, sugieren que estos frmacos actan sobre el RNA ribosmico y no sobre la protena. Por ejemplo, se observ que los ribosomas se vuelven resistentes a los efectos del cloranfenicol como resultado de sustituciones en las bases del RNA ribosmico.7 4. Se ha demostrado que el RNA ribosmico se conserva con gran persistencia en la secuencia de bases, mucho ms que la secuencia de aminocidos de las protenas ribosmicas. Algunas regiones del RNA ribosmico prcticamente son invariables en ribosomas aislados de bacterias (tanto arqueobacterias como eubacterias), hongos, plantas y animales, y tambin en ribosomas aislados de mitocondrias y cloroplastos. Casi todas las regiones persistentemente conservadas se proyectan en la superficie del ribosoma. El hecho de que la secuencia de RNAr est tan conservada sugiere que estas molculas tienen un papel crucial en la funcin del ribosoma.8'9 En realidad, una conclusin del trabajo de C.R. Woese y sus colaboradores, publicado en 1975,8 afirma: "Puesto que la correlacin entre estas regiones conservadas y los sitios conocidos de unin ribosmica es escasa o no existe, hay una fuerte implicacin de que las grandes reas de RNA participan directamente en la funcin ribosmica." Luego del descubrimiento del RNA cataltico en los laboratorios de Cech y Altman se intensific la investigacin sobre el papel del RNA ribosmico. Varios estudios efectuados por Harry Noller y sus colegas en la Universidad de California, en Santa Cruz, precisaron el sitio en ei RNA ribosmico donde reside, o alrededor del cual se encuentra, el centro de la peptidiltransferasa. En un estudio, sintetizaron una versin modificada de fenilalanil-RNAt (fig. VE 11-4, a) que, cuando se enlaza al sitio P de un ribosoma, forma por s solo un enlace cruzado con la molcula RNAr. Incluso en esta etapa de unin cruzada, el RNAt anlogo retiene su capacidad de participar en la formacin de enlaces peptdicos, dato que indica que el anlogo debe estar situado en el sitio P con la orientacin apropiada. Anlisis subsecuentes del RNAr en estos experimentos indicaron que los nucletidos con enlace cruzado en el RNAr se localizan en un sitio altamente conservado que forma una asa central localizada en el dominio V de la molcula (fig. VE 11-4, b).10 Esta es precisamente la misma regin del RNAr que recientemente se seal como sitio de mutaciones que confieren resistencia al cloranfenicol o a la eritromicina (fig. VE 11-4, b). En conjunto, estos datos sealan fuertemente a esta asa del RNA como componente integral del centro de la peptidiltransferasa. En otra serie de experimen-

FIGURA VE 11-3. Modelo de la molcula de una porcin de la subunidad de RNA cataltico de la ribonucleasa P bacteriana (blanco) y de su sustrato enlazado, RNAt precursor (rojo). El sitio sobre el RNAt precursor donde ocurre el desdoblamiento causado por la ribozima est indicado por una esfera amarilla. (Cortesa de Michael E. Harris y Norman R. Pace.)

CAPITULO 11 Utilizacin de la informacin gentica: de la transcripcin a la traduccin

481

Fen-RNAt

10 A

(a)

AGA

GGGUGCCGUCU CC
1
2620

A U_C

FIGURA VE 11-4, a) Estructura de la fenilalanil-RNAt modificada que se emplea en los experimentos, b) Estructura secundaria del dominio V del RNAr 23S bacteriano. Los residuos U en los sitios 2584 y 2585 estn marcados por fotoafinidad para el RNAt anlogo mostrado en 17 en el sitio ribosmico P. Las secuencias en cuadro son altamente conservadas a travs de la evolucin; tambin se muestran sitios donde hay cambio de bases como resultado de la resistencia a cloranfenicol (tringulo slido) y eritromicina (asterisco). (Segn A. Baria \j cois. Proc. Nati. Acad. Sci. U.S.A. 51:3607-3610, 1984.)

C GGUUGUGGCGG U I C

249

G C U
24BO

2500

2600NA K\A<S 2590 G \ \ \G


G CU UG

Gf /S/ J 258Q U * G

<$*y ji>^

^/

C - G G - C -2510

PB-Fen-RNAt

.A G - C ** A U 2570 G ~ C G V

X:
U G A A A

*
AUCCUGGGGCU
i i i i i i i i i
G

,.
A
_

UGGGACCCUGG.U
U 2560-A C C G A U G G-2550 C 40

(b)

tos se demostr que el RNA de transferencia enlazado al ribosoma protege bases especficas en el RNAr de la subunidad grande contra el ataque de agentes qumicos especficos. La proteccin contra ataques qumicos indica que el RNAt debe estar situado muy cerca de las bases RNAr protegidas. Diferentes grupos de bases son protegidos dependiendo de que el RNAt se enlace al sitio A o al P, pero en cualquier caso los nucletidos protegidos se sitan dentro del asa central del dominio V, o alrededor de sta.11 La proteccin se pierde si el extremo 3' del RNAt fel extremo con el CCA enlazado al aminocido) se elimina. Este es el extremo del RNAt implicado en la formacin del enlace peptdico, el cual sera de esperar que residiera en estrecha proximidad al sitio de la peptidiltransferasa.

Los intentos para asignar una funcin particular al RNA ribosmico aislado siempre han fracasado. Se considera que aun si la protena ribosmica no tiene funcin especfica, su presencia cuando menos es necesaria para mantener el RNAr en su conformacin apropiada. Considerando que las protenas ribosmicas y el RNAr evolucionaron conjuntamente durante cientos de millones de aos, sera de esperar que las molculas fueran interdependientes. A pesar de esta expectativa, en 1992 Harry Noller y sus colaboradores finalmente demostraron a potencia cataltica del RNAr aislado.12 Trabajando con ribosomas particularmente estables de Tiiermtis aquaticus, una bacteria que vive a temperaturas elevadas, Noller trat preparaciones de la subunidad ribosmica grande con un detergente extractor de protena (DSS), una enzima que degrada

482

CAPITULO 11 Utilizacin de la informacin gentica: de la transcripcin a la traduccin

protenas (proteinasa K) y varios pasos en fenol desnaturalizado! de protenas. En conjunto, estos agentes eliminaron cuando menos 95% de la protena de la subunidad ribosmica dejando nada ms RNAr. Se demostr que ms de 5% de la protena que permaneci asociada al RNAr constaba de pptidos pequeos, que eran fragmentos de las protenas ribosmicas. Pero a pesar de eliminar casi toda la protena, el RNAr retuvo 80% de la actividad peptidiltransferasa de la subunidad intacta. La actividad cataltica fue bloqueada por cloranfenicol y por el tratamiento con ribonucleasa. Cuando se someti el RNA a tratamientos adicionales para eliminar la pequea cantidad de protena restante, la preparacin perdi su actividad cataltica. Puesto que es muy poco probable que los fragmentos restantes de protena sean lo bastante grandes para mostrar cualquier actividad cataltica importante, hay acuerdo general de que estos experimentos demostraron que la peptidiltransferasa es una ribozima. BIBLIOGRAFA
1. Cech, T.R., Zaug, A.J. y Grabowski, P.J. 1981. In vitro splicing of the ribosomal RNA precursor of Tetrahymena. CeU 27:487-496. 2. Kruger, K. y cois. 1982. Self-splicing RNA: Autoexcision and autocyclization of the ribosomal RNA intervening sequence of Tetrahymena. Cell 31:147-157.

3. Guerrier-Tokada, C. y cois. 1983. The RNA moiety of ribonuclease P is the catalytic subunit of the enzyme. Cell 35:849-857. 4. Guerrier-Tokada, C. y cois. 1984. Catalytic activity of, an RNA molecule prepared by transcription in vitro. Science 223:285-286. 5. Bowman, C.M. y cois. 1971. Specific inactivation of 16S ribosomal RNA produced by colicin E3 in vivo. Proc, Nati Acad. Sel U.S.A. 68:964-968. 6. Cerna, ]., Rychlick, I. y Jonak, J. 1975. Peptidyl transferase activity of Escherichia cali ribosomes digested by ribonuclease TI. Eur. J. Biochem. 34:551-556. 7. Kearsey, S. y Craig, I.W. 1981. Altered ribosomal RNA genes in mitochondria from mammalian cels with chloramphenicol resistance. Nature 290:607-608. 8. Woese, C.R. y cois. 1975. Conservation of primary structure in 16S ribosomal RNA. Nature 254:83-86. 9. Noller, H.F. y Woese, C.R. 1981. Science 212:403. 10. Barta, A. y cois. 1984. Identification of a site on 23S ribosomal RNA located at the peptidyl transferase center. Proc. Nati. Acad. Sci. U.S.A. 81:3607-3611. 11. Moazed, D. y Noller, H.F. 1989. Interaction of tRNA with 23S rRNA in the ribosomal A, P, and E sites. Cell 57:585-597. 12. Noller, H.F., Hoffarth, V. y Zimniak, L. 1992. Unusual resstante of peptidyl transferase to protein extraction procedures. Science 256:1416-1419.

SINOPSIS
Nuestro conocimiento de la relacin entre genes y protenas es resultado de algunas observaciones clave. La primera observacin importante fue efectuada por Garrod, quien concluy que las personas que sufren enfermedades metablicas hereditarias carecen de enzimas especficas. Ms tarde, Beadle y Tatum pudieron inducir mutaciones en los genes de Neurospora e identificar la reaccin metablica especfica afectada. Estos estudios condujeron al concepto de "un gen-una enzima" y posteriormente a la versin ms refinada de "un gen-una cadena de polipptidos". Las consecuencias moleculares de una mutacin fueron descritas por primera vez por Ingram, quien demostr que la anemia drepanoctica, una enfermedad hereditaria, se debe a la sustitucin de un solo aminocido en una cadena de globina (p. 434). El primer paso en la expresin de un gen es la transcripcin de una cadena de la plantilla de DNA por una RNA polmerasa. Las molculas de polimerasa se dirigen al sitio apropiado sobre el DNA al enlazarse a una regin promotora, que en casi todos los casos se sita justamente por delante del sitio en el cual se inicia la transcripcin. La polimerasa se desplaza en la direccin 3' a 5' a lo largo de la cadena de DNA que sirve como plantilla, que se ensambla a una cadena complementaria antiparalela de RNA que crece desde su extremo terminal 5' en direccin 3'. A cada paso a lo largo de la va, la enzima cataliza una reaccin en la cual se hidrolizan trifosfatos de ribonuclesido (NTP) para convertirse en monofosfatos de nuclesido conforme son incorporados. La reaccin tambin es controlada por hidrlisis del pirofosfato liberado. Los procariotes poseen un solo tipo de RNA polimerasa que puede asociarse a varios factores sigma diferentes que determinan cules genes se transcriben. El sitio donde se inicia la transcripcin es determinado por una secuencia de nucletidos localizada aproximadamente 10 bases adelante del sitio de inicio (p. 437). Las clulas eucariotas tienen tres RNA polimerasas distintas (I, II y III), cada una encargada de la sntesis de grupo diferente de RNA. Casi 80% del RNA de la clula consta de RNA ribosmico (RNAr). Los RNA ribosmicos (con excepcin de la especie 5S) son sintetizados por RNA polimerasa I; transfieren RNA mediante la RNA polimerasa III; y el RNAm por la RNA polimerasa II. Los tres tipos de RNA se derivan de transcritos primarios que son ms largos que el producto RNA final. El procesamiento de RNA requiere varios RNA nucleares pequeos (RNAnp) (p. 441). Tres de los cuatro RNAr eucariotas (5.8S, 18S y 28S) se sintetizan a partir de una sola unidad de transcripcin, constituida por DNA (DNAr) localizada dentro del nuclolo, y se procesa mediante una serie de reacciones nucleolares. Los nuclolos de oocitos de anfibios se pueden dispersar para revelar activamente el DNAr transcrito que toma la forma de una cadena de "rboles de- Navidad". Cada uno de los rboles es una unidad de transcripcin cuyas ramas ms pequeas representan a los RNA ms cortos que se encuentran en la etapa ms temprana de transcripcin, o sea, ms prximos al sitio donde se inici la sntesis de RNA. El anlisis de esto;

CAPITULO 11 Utilizacin de la informacin gentica: de la transcripcin a la traduccin

483

complejos revela la disposicin en serie de los genes RNAr, la presencia de espaciadores no transcritos que separan las unidades de transcripcin y la presencia de partculas de ribonucleoprotenas acompaantes (RNP) implicadas en el procesamiento de los transcritos. Los pasos que ocurren en el procesamiento del RNAr fueron estudiados al exponer clulas de mamfero cultivadas a precursores marcados, como 14C-metionina, cuyos grupos metilo se transfirieron a algunos nucletidos del pre-RNAr. Se cree que la presencia de los grupos metilo protege ciertos sitios del RNA a partir del desdoblamiento por nucleasas implicadas en el procesamiento del transcrito. Casi la mitad de los transcritos primarios 45S se eliminan durante la formacin de los tres productos RNAr maduros. El nuclolo tambin es sitio de ensamblado de las subunidades ribosmicas (p. 443). Los precursores del RNAr 5S y del RNAt son sintetizados por la RNA polimerasa III, cuyo promotor se localiza en la porcin transcrita del gen en vez de la regin que lo flanquea hacia arriba. Ambos tipos de RNA se sintetizan en tramos de DNA en los cuales los genes estn organizados en serie, con las porciones transcritas alternando con espaciadores no transcritos. Luego de su procesamiento, los RNAr 5S son transportados al nuclolo donde son ensamblados con otros componentes en la subunidad ribosmica grande. Los genes de RNA de transferencia se localizan en grupos que contienen mltiples copias de diferentes genes (P- 447). Estudios de cintica de RNA rpidamente marcado sugieren que el RNAm se deriva de precursores mucho mayores. Cuando se incuban clulas eucariotas de uno a pocos minutos en 3H-uridina u otros precursores de RNA marcados, la mayor parte de la marca se incorpora al grupo de molculas RNA de peso molecular muy elevado y diversas secuencias de nucletidos, y se restringen al ncleo. Estos RNA se conocen como RNA nuclear heterogneo (o RNAnh). Cuando las clulas incubadas brevemente con 3H-uridina se siguen en un medio que contenga precursores no marcados durante una hora o ms, la radiactividad aparece en el RNAm citoplsmico ms pequeo. Este y otros datos, como la presencia de casquete 5' y apndice poli(A) 3' en ambos RNAnh y RNAm, llev a la conclusin de que el RNAnh es el precursor del RNAm (p. 448). Los pre-RNAm son sintetizados por accin de molculas de RNA polimerasa II junto con algunos factores de transcripcin general que permiten a la polimerasa reconocer el sitio del DNA apropiado e iniciar la transcripcin en el nucletido apropiado. En casi todos los genes estudiados, el promotor se sita entre las bases 24 y 32 adelante del sitio de inicio en una regin que contiene el segmento TATA. Este segmento TATA es identificado por la protena de enlace TATA (PET), cuyo enlace al DNA inicia el ensamblado de un complejo de preinicio. La fosforilacin de una parte de la RNA polimerasa provoca la separacin de la polimerasa y el inicio de la transcripcin (P- 449). Una de las revisiones ms importantes en nuestro concepto de gen tuvo lugar a fines del decenio de 1970 con el descubrimiento de que las regiones codificantes de un gen no forman

una secuencia continua de nucletidos. Las primeras observaciones a este respecto fueron efectuadas en estudios de transcripcin del genoma de un adenovirus, en el cual se observ que la porcin terminal de algunos RNA mensajeros diferentes se componen de la misma secuencia de nucletidos codificados por segmentos discontinuos en el DNA. Las regiones situadas entre los segmentos codificantes se denominan secuencias interpuestas. Pronto se observ una condicin similar para los genes celulares, como los que codifican globina 3 y ovalbmina. En cada caso, las regiones de DNA que codifican porciones del polipptido (exones) estn separadas entre s por regiones no codificantes (intrones). Un anlisis subsecuente indic que todo el gen se transcribe a un transcrito primario. Las regiones correspondientes a los intrones son eliminadas posteriormente del pre-RNA y se le unen los segmentos codificantes adyacentes. Este proceso de separacin y reunin se denomina empalmado del RNA (p- 451). Los principales pasos en el procesamiento de los transcritos primarios para convertirlos a RNAm incluyen adicin de un casquete 5', formacin de un extremo 3', adicin de un apndice poli(A) 3' y eliminar las secuencias interpuestas. La formacin del casquete 5' ocurre mediante una reaccin por pasos en la cual se extrae el fosfato terminal, se aade GMP en orientacin inversa, y se agregan grupos metilo a la guanosina aadida y al primer nucletido del propio transcrito. E! extremo 3' final del RNAm se genera por desdoblamiento del transcrito primario justo en el sitio situado por debajo de un punto de reconocimiento AAUAAA y la adicin de residuos de adenosina, uno a la vez, mediante la polimerasa poli(A). La eliminacin de los intrones del transcrito primario depende de la presencia de residuos invariables en ambos sitios de empalme 5' y 3' sobre cualquier lado de cada intrn. El empalme se efecta por un esplceosoma multicomponente que contiene varias protenas y partculas de ribonucleoprotenas {RNPnp} que se ensamblan de manera gradual en el sitio donde se retira el intrn. El conocimiento de la evolucin de los mecanismos de empalme se obtuvo a partir de estudios de reacciones de autodesdoblamiento de los intrones del grupo I y el grupo II de RNA en eucariotes inferiores, mitocondrias y cloroplastos. Estos estudios sugieren fuertemente que los RNAnp del espliceosoma, no las protenas, son los componentes catalticamente activos de los RNPnp. Uno de los beneficios aparentes del desdoblamiento de genes es la facilidad con la cual se pueden barajar los exones dentro del genoma y generar nuevos genes a partir de secciones de otros genes preexistentes (P- 455). La informacin para la incorporacin de aminocidos a un polipptido est codificada en la secuencia de tripletos de codones en el RNAm. Adems de encontrase en el tripleto, el cdigo gentico no es un cdigo superpuesto y est deteriorado. En un cdigo no superpuesto, cada nucletido es parte de uno y slo de un codn, y el ribosoma debe desplazarse a lo largo del mensaje, tres nucletidos cada vez. Para asegurar la lectura de los tripletos apropiados, el ribosoma se fija al RNArn en el sitio preciso denominado codn de inicio, AUG, que automticamente coloca al ribosoma en el cuadro de lectura apropiado de modo que lea correctamente todo el mensaje. Un cdigo tripleto formado por cuatro diferentes nucletidos puede tener 64 (43) codones diferentes. El cdigo est

484

CAPITULO 11 Utilizacin de la informacin gentica: de la transcripcin a la traduccin

deteriorado debido a que muchos de los 20 aminocidos tienen ms de un codn. De os 64 codones posibles, 61 especifican un aminocido, en tanto que los otros tres son codones para detener el proceso y provocan que el ribosorna concluya la traduccin. Las funciones asignadas a los codones son prcticamente las mismas en toda clula y sus secuencias son tales que la sustitucin de bases en el RNAm tiende a reducir al mnimo el efecto sobre las propiedades del polpptido (p. 465). La informacin contenida en el alfabeto de nucletidos del DNA y el RNA es descodificada por el RNA de transferencia durante el proceso de traduccin. Los RNA de transferencia son RNA pequeos (73 a 93 nucletidos de largo} que comparten una estructura tridimensional similar en forma de L y algunos residuos invariables. Un extremo del RNAt posee el aminocido y el otro extremo contiene una secuencia anticodn de tres nucletidos complementaria del tripleto de codn del RNArn. Los requerimientos estricos de complementariedad entre codn y anticodn son menos estrictos en la tercera posicin del codn para permitir que diferentes codones que especifican el mismo aminocido utilicen el mismo RNAt. Es indispensable que cada RNAt se una al aminocido apropiado (conocido), o sea, el aminocido especificado por el codn RNAm al cual se une el anticodn RNAt. El enlace de los RNAt con sus aminocidos conocidos est garantizado por un grupo diverso de enzimas denominadas aminoacil-RNAt sintetasas. Cada enzima es especfica para uno de los 20 aminocidos y puede reconocer todos los RNAt a los cuales cada aminocido debe unirse. El consumo de energa durante la formacin de los aminoacil-RNAt es el paso primario que requiere energa en todo el proceso de ensamblado de polipptidos (p. 468).

La sntesis de protenas es la actividad sinttica ms compleja que ocurre dentro de una clula, e implica todos los diferentes RNAt con los aminocidos a los cuales se unen los ribosomas, el RNA mensajero, algunas protenas, los cationes y GTP. El proceso se divide en tres actividades: inicio, alargamiento y terminacin. Las actividades principales de inicio incluyen la unin precisa de la subunidad ribosmica pequea al codn de inicio del RNAm, que establece el marco de lectura para todo el proceso de traduccin; la entrada al ribosoma de un RNAt/ Met especial de inicio, y el ensamblado del mecanismo de traduccin. Durante el alargamiento ocurre un ciclo de entrada del RNAt, formacin de enlace peptdico y salida del RNAt autorrepetido con cada aminocido incorporado. El aminoacil-RNAt penetra a travs del sitio A, donde se une al codn complementario del RNAm. Conforme penetra cada RNAt, el polipptido naciente fijo al RNAt del sitio P es transferido al aminocido sobre el RNAt del sitio A, formando una unin peptdica. La formacin de uniones peptdicas es catalizada por una porcin del RNAr grande que acta como ribozima. A continuacin el RNAt no cargado del sitio P es expulsado y el ribosoma se transloca al siguiente codn del RNAm, listo para repetir el ciclo. Tanto el inicio como el alargamiento requieren hidrlisis de GTP, que se cree que sirve principalmente para incrementar la precisin de la traduccin. La traduccin termina cuando el ribosoma alcanza uno de los tres codones de paro. Luego que un ribosoma se ensambla en el codn de inicio y se desplaza una corta distancia hacia el extremo 3' del RNAm, generalmente otro ribosoma se fija al codn de inicio, de modo que cada RNAm es traducido simultneamente por varios ribosomas, lo que incrementa mucho la tasa de sntesis de protena dentro de la clula. El compiejo formado por un RNAm y sus ribosomas acompaantes constituyen un polirribosoma (p. 471).

PREGUNTAS DE REPASO
1. Por qu razn Beadle y Tatum concluyeron que un gen codifica una enzima especfica? 2. Cmo pudo Ingram determinar el aminocido sustituido en la hemoglobina de personas con anemia drepanoctica sin secuenciar la protena? 3. Cul es el papel de un promotor en la expresin de genes? Dnde se localizan los promotores para diferentes polimerasas procariotas y eucariotas? 4. Describir la diferencia entre un transcrito primario, una unidad de transcripcin, un RNAm maduro y un intermediario de procesamiento. 5. Dibujar un esquema de una micrografa electrnica de DNAr que est siendo transcrito. Marcar el espaciador no transcrito, el espaciador transcrito, las molculas de RNA polimerasa, el RNPnp U3 y el promotor. 6. Comparar la organizacin de los genes que codifican RNAr grandes y RNA 5S, y el RNAt dentro del genoma de un vertebrado. 7. Qu es la separacin de un gen? Cmo se descubri el rompimiento de genes? 8. Cul es la relacin entre RNAnh y RNAm? Cmo se descubri esta relacin? 9. Cules son los pasos generales en el procesamiento de un pre-RNArn a un RNAm? Cul es e papel de los RNAnp y del espliceosoma? 10. Qu significa el trmino "mundo de RNA"? Qu tipo de pruebas argumentan en favor de su existencia? 11. Explicar qu significa la expresin: el cdigo gentico es tripleto y no superpuesto. Qu sugiere el dato de que la composicin de bases del DNA vara mucho entre diferentes organismos en relacin con el cdigo gentico? Cmo se estableci la identidad del codn UUU? 12. Por qu se conocen los RNAt como molculas adaptadoras? Qu aspecto estructural tienen en comn los RNAt? 13. Describir a naturaleza de la interaccin entre RNAt y arninoacil-RNAt sintetasas. Describir la naturaleza de la interaccin entre RNAt y RNAm. Qu significa la hiptesis de la flexibilidad de la interaccin? 14. Describir algunas diferencias entre los pasos de inicio de la traduccin y los pasos de alargamiento de la misma. 15. Qu es un polirribosoma? En qu difiere su formacin en procariotes y eucariotos?

CAPITULO 11 Utilizacin de la informacin gentica: de la transcripcin a la traduccin

485

PREGUNTAS ANALTICAS
1. Qu codones esperara usted que tengan un RNAt nico, o sea, uno que slo se emplea para ese codn? Por qu muchos codones no tienen su propio RNAt nico? 2. La proflavina es un compuesto que se autointroduce en el DNA y provoca mutaciones que cambian los cuadros de lectura. En qu difiere el efecto de las mutaciones inducidas por proflavina en la secuencia de aminocidos de un cdigo superpuesto y de otro no superpuesto? 3. Se acaba de aislar un nuevo frmaco que slo tiene un efecto claro sobre el metabolismo celular: inhibe totalmente el desdoblamiento de pre-RNAr a RNA ribosmico. Luego de tratar un cultivo de clulas con este frmaco, se suministra a las clulas 3H-uridna durante dos minutos y luego se les deja crecer durante cuatro horas en presencia del frmaco en un medio no marcado antes de extraer el RNA y centrifugarlo a travs de un gradiente de sucrosa. Dibujar las curvas que se obtienen graneando absorbancia a 260 nm y radiactividad contra nmero de fracciones del gradiente. En la abscisa, utilizar valores S de RNA. 4. Empleando los mismos ejes para la grfica de la pregunta anterior, dibujar el perfil de un RNA radiactivo obtenido luego de incubar clulas cultivadas durante 48 horas en 3H-uridina sin frmaco inhibidor alguno. 5. Supongamos que usted elabora un RNA sinttico a partir de un dmucetido repetido (p. ej., AGAGAGAG) y luego utiliza este RNA como mensajero para sintetizar un polipptido en un sistema sintetizador de protenas in viiro, como el empleado por Nirenberg y Matthaei para producir polifenilalanina. Qu tipo de polipptido esperara producir a partir de este polinucletido particular? Esperara tener rns de un tipo de polipptidos producido? Por qu s o por qu no? 6. Supongamos que encuentra una enzima que se incorpora al azar a nucletidos dentro de un polmero sin el requerimiento de una plantilla. Cuntos codones diferentes podra encontrar en el RNA sinttico elaborado utilizando dos diferentes precursores nucletidos (p. ej., CTP y ATP)? (Una enzima denominada polinucletido fosforilasa cataliza este tipo de reaccin y se utiliz en estudios para identificar codones.) 7. Dibujar las partes de una globina 155 pre-RNAm marcando las porciones no codificantes. 8. Cul es el menor nmero de GTP que se necesitara para sintetizar un pentapptido? 9. En los mismos ejes de la grfica, dibujar dos curvas de renaturalizacin (vase la figura 10-20): una para DNA extrado de tejido cerebral de Xenopus y la otra de DNA extrado de oocitos de Xenopus. 10. Estara de acuerdo con la siguiente afirmacin? El descubrimiento de que la anemia drepanoctica es resultado del cambio en un solo aminocido demuestra que el cdigo gentico no es superpuesto. Por qu s o por qu no? 11. La talasemia es una enfermedad caracterizada por mutaciones que convierten codones de aminocidos en codones de terminacin. Supongamos que debe comparar los polipptidos sintetizados in vtro a partir de RNAm purificado de una gran variedad de pacientes de talasemia. Cmo esperara comparar estos polipptidos? Observe la carta de codones de la figura 11-41. Cuntos codones de aminocidos pueden convertirse en codones de paro sustituyendo una sola base? 12. Piensa usted que sera posible obtener un cdigo gentico con slo dos letras, A y T? Si su respuesta es afirmativa, cul sera el menor nmero de nucletidos requeridos para elaborar un codn? 13. Durante el alargamiento de una cadena de polipptidos: 1) el RNAt se desplaza de un codn del RNAr al siguiente; 2) el ribosoma se mueve acercndose al extremo 3' del RNAm; 3) la cadena creciente del polipptido pasa del RNAt del sitio P al aminocido presente en el sitio A; 4) el RNAt entra al sitio P vaco. Encierre en un crculo las respuestas correctas. 14. Cmo es posible que la sntesis de RNAm ocurra a una mayor tasa en las clulas bacterianas que en cualquier otro tipo de RNA, aunque muy poco RNAm se encuentra dentro de esa clula? 15. Si un codn para serina es 5'-AGC-3', el anticodn para este tripleto sera 5-. -3'. Cmo afectara la flexibilidad esta interaccin codn-anticodn?

BIBLIOGRAFA
Cdigo gentico y mutagnesis Crick, F.C. 1966. The genetic code III. Sci. Am. 215-55-62 (oct.) Fox, T.D. 1987. Natural variation in the code. Ann. Rev. Gen. 21:67-9*.. Khorana, H.G. 1966. Polynucleotide synthesis and the genetic code. Harvey Lects. 62:79-106. Nirenberg, M.W. 1966. The genetic code II. Sci. Am. 208:80-94 (marzo). Schimmel, P. 1991. Classes of aminoacyl-tRNA synthetases and the establishment of the genetic code. Trenas Biochem. Sci. 16:1-3. Wong, J.T. 1988. Evolution of the genetic code. Microbiol. Sci. 5:174181. Transcripcin y funcin del promotor Buratowski, S. 1994. Th basics of basal transcription by RNA polymerase II. Cell 77:1-3. Conaway, R.C. y Conaway, J,W. 1993. General initiation factors for RNA polymerase II. Ann. Rev. Biochem. 62:161-190. Dahmus, ME. 1994. The role of multisite phosphorylation in the regulation of RNA polymerase II activity. Prog. Nucleic Acid. Res. Mol. Btol. 48:143-179. Das, A. 1993. Control of transcription termination by RNA-binding proteins. Ann. Rev. Biochem. 62:893-930. Drapkin, R. y Reinberg, D. 1994. The essential twist. Natitre 369:523524. Horwitz, M. y Loeb, L.A. 1990. Structure-functon relationships in E. coli promoter DNA. Prog. Nucleic Acia Res, Mol. Biol. 38:137-164. Klug, A. 1993. Opening the gateway. Nature 365:486-487. Koleske, A.J. y Young, R.A. 1995. The RNA polymerase II holoenzyme and its implications. Trenas Biochem. Sci. 20:113-116.

486

CAPITULO 11 Utilizacin de la informacin gentica: de la transcripcin a la traduccin Green, M.R. 1991. Biochemical mechanisms of constitutive and regulated pre-mRNA splicing. Ann, Rev. Cell Biol. 7:559-599. Hurst, L.D. 1994. The uncertain origin of introns. Nature 371:381-382. Kohtz, J.D. y cois. 1994. Protein-protein interactions and 5'-spIice site recognition in mammalian mRNA precursors. Nature 368:119-124. L,Tnbowtz, A.M. y Belfort, M. 1993. Introns as mobile genetic elements. Ann. Rev. Biochem. 62:587-622. Lamond, A. I. 1993. The spliceosome. Bioess. 15:595-603. McKeown, M. 1993. The role of small nuclear RNAs in splicing. Curr. Opin. Cell Biol. 5:448-454. Newman, A. 1994. Small nuclear RNAs and pre-mRNA splicing. Curr. Opin. Cel! Biol. 6:360-367. Nielsen, T.W. 1994. RNA-RNA interactions in the spliceosome: Unraveling the ties that bind. Cell 78:1-4. Pyle, A.M. 1993. Ribozymes: A distinct class of metalloenzymes. Science 261:709-714. Sharp, P.A. 1994. Split genes and RNA splicing. Cell 77:805-815 (Nobel lecture). Spector, D.L. 1993. Nuclear organization of pre-mRNA processing. Curr. Opin. Cell Biol. 5:442-447. Spector, D.L. 1994. Cycling splicing factors. Nature 369:604. Steitz, J.A. 1992. Splicing takes a Holliday. Science 257:888-889. Stoltzfus, A. y cois. 1994. Testing the exon theory of genes: The evidence from protein Structure. Science 265:202-207. Wahle, E. 1992. The end of the message: 3' end processing leading to polyadenylated messenger RNA. Bioess. 14:113-118. Wahle, E. y Keller, W. 1992. The biochemistry of 3'-end cleavage and polyadenylation of messenger RNA precursors. Ann. Rev. Biochem. 61:419-440. Weiner, A.M. 1993. mRNA splicing and autocatalytic introns: Distant cousins or the producs of chcmical determination. Cell 72:161-164. Wise, J.A. 1993. Cuide to the heart of the spliceosome. Science 262:19781979. Xing, Y. y cois. 1993. Higher level organization of individual gene transcription and RNA splicing. Science 259:1326-1330. RNA de transferencia y RNAt sintetasas Giege, R. y cois. 1993. tRNA Structure and aminoacylation efficiency. Prog. Nucleic Acia Res. Mol. Biol. 45:129-206. Holley, R.W. 1966. The nucleotide sequence of a nucleic acid. Sci. Am. 214:30-39 (feb.). McCIain, W.H. 1993. Transfer RNA identity. FASEB }. 7:72-78. Moras1, D. 1992. Structure and function relationship between aminoacyl-tRNA synthetases. Trenas Biochem. Sci. 17:159-164. Rch, A. y Kim, S.H. 1978. The three-dimensional Structure of transfer RNA. Sci. Am. 238:52-62 (ene.). Saks, M.E., Sampson, J.R. y Abelson, J.N. 1994. The transfer RNA identity problem: A search for rules. Science 263:191-197. Traduccin Clark, B. 1980. The elongaion step in protein synthesis. Trends Biochem. Sci. 5:207-210. HU, W.E. y cois. 1990. The Ribosome: Structure, Function, and Evolution. Am. Soc. Microbiol. Jacques, N. y Dreyfus, M. 1990. Translation initiation in Escherichia coli: od and new questions. Mol. Microbiol. 4:1063-1067. Kisselev, L.L. y Wolfson, A.D. 1994. Aminoacyl-tRNA synthetases from higher eukaryotes. Prog. Nucleic Acid Res. Mol. Biol. 48:83-142.

McKnight, S.L. y Yamamoto, K. 1992. Tmnscriptional Regulation. Cold Spring Harbor Lab. Press. Peterson, M.G. y Tijan, R. 1992. The tell-tail trigger. Nature 358:620621. Struhl, K. 1994. Duality of TBP, the universal transcription factor. Science 263:1103-1104. Young, R.A. 1991. RNA polymerase II. Ann. Rev. Biochem. 60:689-715. Zawel, L. y Reinberg, D. 1993. Initiation of transcription by RNA polymerase II: A multi-step process. Prog. Nucleic Acia Res. Mol. Biol. 44:67-108. Zawel, L. y Reinberg, D. 1995. Common in assembly and function of eukaryotic transcription complexes. Ann. Rev. Biochem. 64:533-561. Nuclolo y sntesis del RNAi Fournier, M.J. y Maxwell, E.S. 1993. The nucleolar snRNAs: Catching up with the spliceosomal snRNAs. Trenas Biochem. Sci. 18:131-135. Miller, O.L., Jr. 1973. The visualization of genes in action. Sci. Am. 228:34-42 (marzo). Scheer, U. y Benavides, R. 1990. Function and dynamic aspects of the mammalian nucleolus. Bioes. 12:14-21. Scheer, U. y cois. 1993. Structure, function and assembly of the nucleolus. Trenas Cell Biol. 3:236-241. Scheer, U. y Weisenberger, D. 1994. The nucleolus. Curr. Opin. Cell Biol. 6:354-359. Sollner-Webb, B. y Mougey, E.B. 1991. News from the nucleolus: rRNA gene expression. Trenas Biochem. Sci. 16:58-62. Sollner-Webb, B. 1993. Novel intron-encoded small nucleolar RNAs. Cell 75:403-405. Ribozimas Barinaga, M. 1993. Ribozymes: Kilng the messenger. Science 262:15121513. Benner, S.A. 1993. Catalysis: Design versus selection. Science 261:14021403. Cech, T.R. 1986. RNA as an enzyme. Sci. Am. 255:64-75 (nov.). Cech, T.R. 1993. Catalytic RNA: Structure and mechanism. Biochem. Soc. Trans 21:229-234. Cech, T.R. 1993. Fishing for fresh catalysis. Nature 365:204-205. Gray, M.W. y Cedergren, R., eds. 1993. The new age of RNA. FASES /. 74:123. Joyce, G.F. 1992. Directed molecular evolution. Sci. Am. 267:90-97 (dic.). Lorsch, J.R. y Szostak, J.W. 1994. In vitro evolution of new ribozymes with polynucleotide kinase activity. Nature 371:31-36. Moore, M.J. 1995. Ribozymes: Exploration by lamplight. Nature 374:766767. Szostak, J.W. 1993. In vitro genetics. Trenas Biochem. Sci. 17:89-93. von Ahsen, U. y Schroeder, R. 1993. RNA as a catalyst: Natural designed ribozymes. Bioess. 15:299-307. Yu, H. y cois. 1993. A hairpin ribozymes inhibits expression of diverse strains of human immunodeficiency virus type I. Proc. Nati. Acad. Sci. U.S.A. 90:6340-6344. Procesamiento de RNA y evolucin de los intrones Cavalier-Smith, T. 1991. Intron phylogeny: A new hypothesis. Trenas Genetics 7:145-148. Dreyfuss, G. y cois. 1993. hnRNP proteins and the biognesis of mRNA. Ann. Rev. Biochem. 62:289-321. Gesteland, R.F. y Atkins, J.F. eds. 1993. The RNA World. Cold Spring Harbor Lab. Press.

CAPITULO 11 Utilizacin de la informacin gentica: de la transcripcin a la traduccin Kurland, C.G. 1992. Translational accuracy and the fitness of bacteria. Ann. Rev. Genetics 26:29-50. Lake, J.A. 1981. The ribosome. Sci. Am. 245:84-97 (ago.). Lewin, B. 1994. Genes V. Oxford University Press. Linder, P. y Prat, A. 1990. Baker's yeast, the new workhorse in protein synthesis studies: Analyzing eukaryotic translation initiation. Bioess. 12:519-526. Maden, T. 1993. The translational apparatus, from Berln. Trends Biochem. Sci. 18:155-157. Merrick, W.C. 1992. Mechanisms and regulation of eukaryotic protein synthesis. Microbiol. Revs. 56:291-315. Moldave, K. 1985. Eukaryotic protein synthesis. Ann. Rev. Biochem. 54:1109-1149. Noller, H.F. 1991. Ribosomal RNA and translation. Ann. Rev. Biochem. 60:191-227.

487

Noller, H.F. 1993. tRNA-rRNA interactions and peptidyl transferase. FASEB ]. 7:87-89. Schimmel, P. 1993. GTP hydrolysis in protein synthesis: Two for Tu? Science 259:1264-1265. Schroeder, R. 1994. Dissecting RNA function. Nature 370:597-598. Sprinzl, M. 1994. Elongation factor Tu: a regulatory GTPase with an integrated effector. Trends Biochem. Sci. 19:245-250. Weijland, A. y Parmeggiani, A. 1994. Why do hvo EF-Tu molecules act in the elongation cycle of protein biosynthesis? Trends Biochem. Sci. 19:188-193. Yonath, A. y Wittman, H.G. 1989. Challenging the three-dimensional structure of ribosomes. Trends Biochem. Sci. 14:329-335.