You are on page 1of 26

DEMRE N°O9 Ciencias

6/18/04

11:20

Página 1

Universidad de Chile
VICERRECTORÍA DE ASUNTOS ACADÉMICOS DEMRE

CONSEJO DE RECTORES UNIVERSIDADES CHILENAS

DOCUMENTO OFICIAL
PROCESO DE ADMISIÓN
23 de Junio de 2004

2005
FACSÍMIL CIENCIAS
Serie: DEMRE Publicación 7 de 24

DEMRE N°O9 Ciencias

6/16/04

15:54

Página 5

5

BIOLOGÍA 1. ¿Cuál(es) de las siguientes hormonas se produce(n) en la placenta humana? I) II) III) A) B) C) D) E) Ocitosina. Gonadotrofina coriónica. Progesterona.

4.

En el siguiente cuadro se describen consecuencias del uso de una droga en un consumidor. Acción en el organismo Estimulación del Sistema Nervioso Central y Autónomo. Peligros asociados a su abuso Desorientación espacio-temporal, convulsiones, alucinaciones, inconciencia; muerte por sobredosis.

Sólo I Sólo II Sólo III Sólo II y III I, II y III

Efecto de la droga Euforia; excitación seguida por depresión nerviosa, dilatación pupilar, anestesia local.

A partir de estos datos se infiere que estos efectos se producen por el consumo de A) B) C) D) E) marihuana. efedrina. diazepam. cocaína. cafeína.

2.

Al medir la presión sanguínea de una persona adulta, se le informa que los valores registrados son “120 con 80”. Estos valores se relacionan con eventos del ciclo cardiaco, de modo que I) II) III) A) B) C) D) E) el valor máximo corresponde a la presión generada por una sístole ventricular. el valor mínimo corresponde a la presión generada durante la diástole. en el valor máximo está abierta la válvula mitral o bicúspide. 5.

En un experimento se marcaron radiactivamente varios aminoácidos, los que fueron administrados a un cultivo celular. Luego de un tiempo se encontrará marca en I) II) III) A) B) C) D) E) la membrana plasmática. los cromosomas. el retículo endoplásmico liso.

Sólo I Sólo II Sólo III Sólo I y II I, II y III

Sólo I Sólo II Sólo I y II Sólo I y III I, II y III

3.

Las siguientes reacciones exergónicas 2H2S + O2 H2O + S 4FeCO3 + 6H2O + O2 4Fe(OH)3 + 4CO2 2HNO2 + O2 HNO3 son características de los organismos A) B) C) D) E) heterótrofos. fotosintetizadores. quimiosintetizadores. descomponedores. oxidantes. 6. Mantener la incidencia de una enfermedad dentro de límites aceptables se denomina A) B) C) D) E) control. prevención. erradicación. vigilancia epidemiológica. tratamiento.

II y III 8.DEMRE N°O9 Ciencias 6/16/04 15:55 Página 6 6 7. ¿cuál de ellas describe una función fundamental de la meiosis? A) B) C) D) E) Mantener constante el número cromosómico de una especie. 12. A) B) C) D) E) Sólo I Sólo II Sólo III Sólo I y II I. De las siguientes opciones. ¿Cuál(es) de los siguientes factores favorece(n) la aparición de caries? I) II) III) A) B) C) D) E) Desarrollo de una placa bacteriana. Todos los sistemas vivos están formados por células o por productos de su actividad. II y III Sólo I Sólo II Sólo III Sólo I y II I. Sólo las células son sistemas vivos que están en estrecha relación con el medio. Hemofilia. Úlcera gástrica. Ocurrir exclusivamente en órganos reproductores (gónadas). alcanza en los alvéolos la misma concentración que en la sangre venosa. Susceptibilidad genética. Presentarse en vertebrados. en las heces se encuentran mayores concentraciones de aminoácidos que de las otras moléculas. % 100 9. Tener una larga profase I. La célula es la unidad estructural. a partir de los 50 cm comienza la absorción. Producir células diploides a partir de una haploide. Daltonismo. Sólo I Sólo II Sólo III Sólo I y II I. Consumo de alimentos ricos en azúcar. AMINOACIDOS GLUCOSA LIPIDOS 50 INGESTIÓN 100 150 200 250 300 350 400 10. En este gráfico se muestra la desaparición (tasa de absorción) de los distintos componentes de una dieta normal a lo largo del tracto digestivo. El dióxido de carbono (CO2) proveniente del metabolismo celular I) II) III) A) B) C) D) E) es transportado en grandes cantidades disuelto como CO2 en la sangre. aumenta la disociación del oxígeno (O2) desde la oxihemoglobina. La célula es una unidad organizada que gasta mucha energía para mantenerse como tal. ¿Cuál de las siguientes enfermedades no es heredable en el hombre? A) B) C) D) E) Albinismo. se concluye correctamente que I) II) III) en los primeros 50 cm ocurre sólo digestión. C) D) E) 11. funcional y reproductora de los seres vivos. II y III . distancia desde la boca (cm) ¿Cuál de las siguientes afirmaciones resume de manera más precisa el contenido de la Teoría Celular? A) B) Toda célula Procarionte o Eucarionte proviene de otra célula preexistente. Anemia de células falciformes. De acuerdo a este gráfico.

5 0. . esta molécula correspondería a A) B) C) D) E) un polisacárido. La descendencia de un varón daltónico y una mujer normal que es hija de padre daltónico probablemente será A) B) C) D) E) mujeres y hombres daltónicos. mujeres normales y hombres daltónicos. inhibición de la secreción del factor liberador de las gonadotropinas. H y O. el 50% de sus hijos expresan el carácter. es correcto afirmar que I) II) III) A) B) C) D) E) Sólo Sólo Sólo Sólo Sólo todos sus hijos expresan el carácter. 14. portadoras y hombres daltónicos. la glucosa se cataboliza rápidamente. mujeres daltónicas y hombres normales. se comprueba que I) II) III) en la anafase I se separan cromosomas homólogos. Respecto de la descendencia originada entre una mujer heterocigota y un hombre sano. ARN. en la anafase II se separan cromátidas hermanas. tanto hombres como mujeres normales y daltónicos.7 Glucosa (g/l) en vena hepática 1 1 INDIVIDUO 1 INDIVIDUO 2 En relación a estos resultados se deduce correctamente que I) II) III) A) B) C) D) E) luego de la ingesta. Si se analiza químicamente una molécula de origen biológico y se constata que ésta es insoluble en agua y está constituida exclusivamente por C. de las opciones propuestas. todas sus hijas expresan el carácter. I II III I y II II y III 16. mujeres normales. entonces.II y III 15. I II III I y II II y III 17. Sólo I Sólo II Sólo III Sólo II y III I. II y III 18.DEMRE N°O9 Ciencias 6/17/04 16:46 Página 7 7 13. ADN. en condición de ayuno. La siguiente tabla muestra las concentraciones de glucosa en la vena porta hepática y en la vena hepática en dos condiciones experimentales. una proteína. un fosfolípido. A) B) C) D) E) Sólo I Sólo II Sólo III Sólo I y II I. el hígado participa en la regulación de la glicemia. Al analizar la anafase I y la anafase II de la meiosis. en la anafase I cada uno de los conjuntos de cromosomas que migran a los polos provienen exclusivamente del padre o de la madre. en un individuo luego de ingerir alimento (INDIVIDUO 1) y en otro en ayunas (INDIVIDUO 2). menor proliferación de la mucosa uterina. Al extirpar los ovarios a una mujer en edad fértil se produce I) II) III) A) B) C) D) E) Sólo Sólo Sólo Sólo Sólo aumento de FSH y LH. la glicemia se mantiene por glucogenólisis. Glucosa (g/l) en vena porta hepática 2. para un carácter dominante ligado al cromosoma X.

la electronegatividad de los iones del agua hace que esta sea más conductora que la piel seca.DEMRE N°O9 Ciencias 6/16/04 15:55 Página 8 8 FÍSICA 19. Una laminilla del electroscopio queda positiva y la otra negativa Ambas laminillas quedan positivas. Si la frecuencia mínima que puede escuchar esta persona es de 20 Hz significa que. 23. Los sonidos más agudos corresponden a las frecuencias más altas. Necesitan de un medio físico para su propagación Son ondas longitudinales. R2 y R3 están en paralelo. el cuerpo queda conectado a tierra y se carga por inducción. Indique cuál de ellas es un buen ejemplo del hecho que las ondas transmiten energía. Se transmiten con mayor rapidez en los medios más densos. A) B) C) D) E) Las partículas del medio adquieren un cierto movimiento al paso de las ondas. R1 y R4 están en serie. A continuación se presentan cinco afirmaciones verdaderas que se relacionan con ondas sonoras. se afirma que I) II) III) R1 y R4 están en paralelo. la piel seca es menos conductora que la piel mojada. al pasar de un medio de propagación a otro de mayor densidad la frecuencia de la onda se mantiene. Se toca la parte superior del electroscopio con la barra cargada. 22. D) E) d E) . al interponer una capa de agua entre el cuerpo y el artefacto. el paso de la corriente descompone al agua en iones hidrógeno y oxígeno los que son absorbidos por la piel provocando reacciones violentas. Una persona se encuentra ubicada frente a un acantilado. Con respecto a las ondas sonoras se afirma que I) II) III) el período de oscilación de las partículas del medio de propagación es igual al doble del período de la onda. Es (son) correcta(s) A) B) C) D) E) sólo I sólo II sólo III sólo I y II I. II y III De las afirmaciones anteriores. al pasar de un medio de propagación a otro de mayor densidad la rapidez de propagación de la onda se mantiene. En el circuito representado en la figura. Al manipular artefactos eléctricos. De las afirmaciones anteriores es(son) correcta(s) A) B) C) D) E) sólo sólo sólo sólo sólo I II III I y III II y III R1 WWW R2 R3 WWW R4 21. Al respecto se afirma que: I) II) III) La parte superior del electroscopio queda positiva. deberá estar ubicada respecto del acantilado a una distancia (d) mínima de A) B) C) 34 m 340 m 340 m 20 20 m 340 20 340 m 24. es más fácil que a uno “le dé la corriente" si lo hace con las manos mojadas que si las tiene secas. para poder escuchar el eco de la onda correspondiente a esta frecuencia. 20. En una experiencia de laboratorio se tiene una barra cargada negativamente y un electroscopio en estado neutro. Se sabe que en esa zona la rapidez de propagación del sonido es de 340 m/s. ¿cuál(es) es(son) correcta(s)? A) B) C) D) E) Sólo I Sólo II Sólo III Sólo I y III Ninguna de ellas. Esto se explica porque A) B) C) D) el agua y el cuerpo humano son buenos conductores.

Las fuerzas que se ejercen mutuamente dos cuerpos que interactúan entre sí son iguales y contrarias. este se moverá hacia la derecha pero después de un rato se detendrá. Un cuerpo que se mueve en línea recta aumenta su rapidez desde 4 m/s hasta 10 m/s en 2 segundos. De acuerdo a esto se afirma. El valor de su aceleración media en estos dos segundos. sólo si los dos cuerpos son de igual masa. El bloque se detiene porque 30. expresada en Ohm. Al aplicar una diferencia de potencial de 6 volt entre sus extremos. En el gráfico de la figura se da la relación entre la corriente eléctrica que pasa por un conductor y la diferencia de potencial aplicada entre sus extremos. su resistencia. Esta afirmación es válida A) B) C) D) E) siempre. permanecen en reposo y se encuentran en el vacío. la fuerza neta sobre el bloque es la fuerza de roce. en m/s2. la fuerza normal es igual al peso. para este. Si sobre un segundo cuerpo de masa M/2 aplica una fuerza 2F medirá. de la fuerza que ejerce la raqueta sobre la pelota es igual que la que ejerce la pelota sobre la raqueta. la fuerza neta sobre él es cero . que en esta interacción la magnitud (módulo) I) II) III) de la variación del momentum es mv. sólo si los dos cuerpos se encuentran en el vacío. A) B) C) D) E) se le acaba la fuerza que inicialmente se le dio en el empujón. del momemtum no cambia en la interacción. Un jugador de tenis recibe una pelota de masa m con una rapidez v y al golpearla la devuelve con una rapidez 2v en sentido contrario. 29. para la pelota. es A) B) C) D) E) 2 3 5 6 7 27. sólo si los dos cuerpos permanecen en reposo.DEMRE N°O9 Ciencias 6/17/04 16:46 Página 9 9 25. una aceleración a. es(son) correcta(s) A) B) C) D) E) sólo sólo sólo sólo sólo I II III I y III II y III 26. una aceleración A) B) C) D) E) 4a 2a a a/2 a/4 . cuando está en movimiento. la fuerza de roce es mayor que la fuerza que se le aplicó. i (Amp) 3 1 2 6 V (Volts) De las afirmaciones anteriores. Si se da un breve empujón hacia la derecha a un bloque situado sobre una superficie horizontal. sólo si los dos cuerpos son de igual masa. para éste segundo cuerpo. cuando está en movimiento. Cuando un alumno aplica una fuerza F sobre un cuerpo de masa M mide. será A) B) C) D) E) 3/6 6/3 18 4/3 3/4 28.

De las opciones anteriores. 34. están suspendidos por cuerdas en la forma representada en la figura. El calor generado en un proceso se puede expresar en I) II) III) joule. es(son) correcta(s) A) B) C) D) E) sólo sólo sólo sólo sólo I II III I y II I y III . en la cuerda que sostiene al bloque Q se ejerce una fuerza de A) B) C) D) E) 100 150 200 300 350 N N N N N La construcción de puentes. Con este dato se infiere que a esta presión A) B) C) D) E) la energía necesaria para evaporar 1 gr de agua a 100 oC es 540 cal. Los bloques P. las estructuras sufren deformaciones o rupturas por efecto del calor. ¿cuál de las siguientes afirmaciones. Se lanza una piedra verticalmente hacia arriba. al evaporar 1 gr de agua a 100 oC se liberan 540 cal. es(son) correcta(s) A) B) C) D) E) sólo sólo sólo sólo sólo I II III I y III II y III 35. respectivamente. El calor de vaporización del agua a 100 oC y a una presión de 1 atm es 540 cal/gr. Los bloques permanecen en reposo. 36. es FALSA? A) B) C) D) E) La energía cinética de la piedra alcanza su valor mínimo. cuyos pesos son de 50 N. ¿cuál(es) es(son) correcta(s)? A) B) C) D) E) Sólo I Sólo II Sólo III Sólo II y III I. La fuerza neta sobre la piedra es igual a su peso. tendidos eléctricos. para condensar 1 gr de agua a 100 oC se requieren 540 cal. 200 N y 100 N. calles. La fuerza neta (resultante) que actúa sobre un cuerpo pequeño está dirigida verticalmente hacia abajo. watt. El trabajo neto (total) realizado por esta fuerza sobre el cuerpo es igual a cero si este se mueve I) II) III) horizontalmente. En estas condiciones. La energía potencial de la piedra alcanza su valor máximo. requiere estudios de ingeniería en el uso de materiales porque I) II) III) estos se contraen. la energía de 1 gr de vapor de agua a 100 oC es 540 cal. líneas férreas. calorías. 32. De las opciones anteriores. sólo verticalmente hacia abajo. sólo verticalmente hacia arriba. Q y R. II y III 33. En el punto en que la piedra alcanza su máxima altura. De las afirmaciones anteriores. El momentum (cantidad de movimiento) de la piedra es nulo La aceleración de la piedra es nula.DEMRE N°O9 Ciencias 6/17/04 16:47 Página 10 10 31. estos se dilatan. la energía de 1 gr de agua a 100 oC es 540 cal.

0 14.1 Número atómico Masa Atómica 4 5 6 7 Be B C N 9.0 8 O 16.0 17 Cl 35.8 12. cloración(2).9 11 Na 23.0 10. se adjunta una parte del Sistema Periódico hasta el elemento Nº 20. decantación(4).2 18 Ar 39. ¿Cuál es el orden correcto de los procesos para obtener agua potable? A) B) C) D) E) 1 3 1 2 4 – – – – – 2 4 3 1 3 – – – – – 3 1 4 4 1 – – – – – 4 2 2 3 2 38. Es(son)correcta(s) A) B) C) D) E) sólo sólo sólo sólo sólo I II III II y III I y III 40. disminuir la inversión térmica. 39. regenerar el oxígeno atmosférico.0 10 Ne 20. QUÍMICA 37.0 12 13 14 15 Mg Al Si P 24. 1 H 1. absorber la luz ultravioleta de la radiación solar.0 28. La lluvia ácida es dañina porque I) II) III) contribuye al efecto invernadero.1 31. de la madera.0 9 F 19.3 27. Es(son)correcta(s) A) B) C) D) E) sólo I sólo II sólo III sólo I y II I. El asfalto que se utiliza en la pavimentación de las calles se obtiene normalmente I) II) III) del petróleo.0 16 S 32. corroe monumentos y edificios. disminuir el efecto invernadero.9 Los principales procesos utilizados en la purificación de aguas naturales son: filtración(1).5 2 He 4.0 20 Ca 40. II y III . del carbón vegetal. La principal función del ozono(O3) en la estratósfera es A) B) C) D) E) disminuir la temperatura de los rayos solares a niveles tolerables. altera la composición de los suelos agrícolas. floculación(3).0 3 Li 6.0 19 K 39.DEMRE N°O9 Ciencias 6/16/04 15:56 Página 11 11 Para la solución de algunos de los ejercicios propuestos en esta prueba.

la razón entre los valores M g/mol moléculas/ mol NA corresponde a 43. electrones.5 1. De acuerdo con la siguiente reacción: MnO2 + 4 HCl MnCl2 + Cl2 + 2 H2O 44.. En el ion Ca2+. los mismos estados de oxidación. Sales minerales.. el número de moléculas contenidos en 1 gramo de la especie. electrones. en otras palabras. la cantidad de moléculas contenidas en un mol. la masa en gramos que corresponde a un mol. ¿Cuál (es) de los siguientes productos de uso cotidiano se obtiene(n) a partir de materias primas derivadas del petróleo? I) II) III) A) B) C) D) E) Plásticos y diluyentes.. . hay A) B) C) D) E) 18 20 20 20 22 protones protones protones protones protones y y y y y 20 18 20 22 20 electrones. Con esta información se puede afirmar que dicho elemento I) II) III) tiene 4 electrones de valencia. cuyo número atómico es 20. II y III Es(son) correcta(s) A) B) C) D) E) sólo I sólo II sólo III sólo I y II I. Fertilizantes. 45. electrones. Sólo I Sólo II Sólo I y III Sólo I y II I. II y III 47.) permite predecir que tendrán I) II) III) A) B) C) D) E) fórmulas similares para sus compuestos.0 8.0 4. niveles externos con igual distribución de electrones. La gasolina de 97 octanos equivale a una mezcla de A) B) C) D) E) 97% 97% 97% 97% 97% de de de de de isooctano octano heptano octano isooctano y 3% de heptano y 3% de isooctano y 3% de isooctano y 3% de heptano y 3% de octano 46. A) B) C) D) E) la masa en gramos de una sola molécula.0 2. se ubica en el grupo cuarto de la tabla periódica.DEMRE N°O9 Ciencias 6/16/04 15:56 Página 12 12 41.0 mol mol mol mol mol . Sólo I Sólo II Sólo III Sólo II y III I. La relación entre la masa molar de una especie y la constante de Avogadro o. tiene incompleto el segundo nivel. electrones. ¿Cuántos moles de MnO2 reaccionan con 2 moles de HCl? A) B) C) D) E) 0. II y III 42. halógenos. el número de moles que contiene un gramo de la especie. La configuración electrónica de un elemento es 1s22s22p2. El hecho de que algunos elementos pertenezcan al mismo “grupo” o familia (por ejemplo: alcalinos.

¿Cuál de los siguientes compuestos es el tolueno? A) Cl Sólo I Sólo II Sólo I y II Sólo I y III I. 2. II. iónico debe ser SCl6. III y IV 49. ¿Cuántos moles de N2 hay en 44. 2. ¿cuál(es) de las siguientes características es(son) común(es) a los dos compuestos? I) II) III) A) B) C) D) E) El número de átomos de carbono. covalente debe ser NaCl. E) C2H5 . 2. Un hidrocarburo de fórmula empírica C4H6 podría corresponder a I) II) III) IV) 1.0 1. Escribiendo y observando las fórmulas desarrolladas del n-butano y del 2-metilpropano.DEMRE N°O9 Ciencias 6/17/04 16:47 Página 13 13 48. 2-butadieno 3-butadieno 1-butino 2-butino Es (son) correcta(s) A) B) C) D) E) sólo I sólo III sólo I y II sólo III y IV I.0 mol mol mol mol mol 51.0 4.8 litros de N2 medidos a 0 oC y 1 atmósfera de presión? A) B) C) D) E) 0.5 2. Por lo tanto. La ordenación de los átomos de carbono. II y III B) NO2 C) CH3 53. el compuesto más perfectamente A) B) C) D) E) iónico debe ser NaCl.5 1. El número de átomos de hidrógeno. En los siguientes compuestos: NaCl SiCl4 PCl5 SCl6 D) OH formados por el cloro y algunos átomos del tercer período de la tabla periódica. 5 moles de este elemento corresponden a A) B) C) D) E) 5/23 g 23/5 g 23 g (23 + 5) g 23 5 g 52. 50. La masa molar del sodio es 23 g/mol. ionico debe ser PCl5. iónico debe ser SiCl4.

El átomo de nitrógeno tiene configuración electrónica 1s22s22p3. Mediante la notación de Lewis.DEMRE N°O9 Ciencias 6/19/04 09:01 Página 14 14 54. la molécula de nitrógeno N2 se representa correctamente por A) B) C) D) E) N N N N N N N N PRUEBA OPTATIVA DE CIENCIAS MÓDULO ELECTIVO N N .

un estímulo para la secreción de gastrina. existen más tipos de ARNt que los 20 aminoácidos utilizados para sintetizar las proteínas. Sólo I Sólo II Sólo I y II Sólo II y III I. una barrera innata de defensa. II y III 3. ARNm. descomponedores. Si durante la transcripción se incorpora adenina marcada radioactivamente. la proteína formada. II y III . una proteína siempre posee menos aminoácidos que los tripletes de nucleótidos del ARNm a partir del cual fue traducida. El ácido clorhídrico presente en el estómago es I) II) III) A) B) C) D) E) un activador de zimógeno o proenzima. ¿En cuál de las siguientes actividades del organismo humano el sistema nervioso autónomo cumple su función principal? A) En la coordinación de los músculos esqueléticos.DEMRE N°O9 Ciencias 6/16/04 16:00 Página 15 15 BIOLOGÍA 1. 2. entonces ¿cuál es el correcto orden de anticodones de los ARNt que participaron en la síntesis de esta proteína? Gen = ATGCTTAGCGGTATAGGCCATGCT A) B) C) D) E) Anticodones Anticodones Anticodones Anticodones Anticodones = = = = = AUG-CUU-AGC-GGU-AUA-GGC-CAU-GCU UAC-GAA-UCG-CCA-UAU-CCG-GUA-CGA ATG-CTT-AGC-GGT-ATA-GGC-CAT-GCT TAC-GAA-TCG-CCA-TAT-CCG-GTA-CGA TUG-CUU-TGC-GGA-UAU-GGC-CUA 7. En el mantenimiento del estado de conciencia. se constatará que la primera tendrá una menor cantidad de I) II) III) A) B) C) D) E) ARNt. el ARN mensajero. entonces esta marca se encontrará en I) II) III) A) B) C) D) E) Sólo Sólo Sólo Sólo I . I II III I y II y III Sólo I Sólo II Sólo III Sólo II y III I. En la inhibición de los movimientos automáticos. II los ribosomas. 4. En la respuesta a los cambios sonoros del medio ambiente. II y III Sólo I Sólo II Sólo III Sólo I y II I. A) B) C) D) E) Sólo I Sólo II Sólo III Sólo I y III I. herbívoros. Si la información contenida en el siguiente gen es completamente leída y traducida en una proteína. Respecto al flujo de información génica en eucariontes es correcto afirmar que I) II) el gen que codifica para una proteína posee más nucleótidos que el ARNm transcrito a partir de él. proteínas. Si en una célula se inhibe la transcripción y al cabo de unas horas. II y III 5. sus componentes moleculares se comparan con los de una célula intacta. B) C) D) E) III) 6. En el mantenimiento de la constancia del medio interno. Los procesos de biosíntesis tienen lugar en I) II) III) A) B) C) D) E) plantas.

15. los antígenos del complejo de histocompatibilidad mayor (CHM) del dador son reconocidos como ajenos por el receptor. Vía aferente. son por conducción saltatoria. la mutación de un gen ubicado en un cromosoma sexual. En las siguientes opciones se muestran secuencias de un gen de cinco especies de animales actuales. Receptor sensorial. 10. II III I y III II y III y III 13. las proteínas del injerto inducen la formación de anticuerpos. ¿cuál más? A) B) C) D) E) Placa motora. III) La patología humana denominada Sindrome de Turner. provocar la abstinencia de consumo en el bebedor excesivo. ahorran energía. Algunos insecticidas. la carencia de un cromosoma X. la generación de impulsos que elevan el umbral de las motoneuronas. De acuerdo con esto. A) B) C) D) E) Sólo I Sólo II Sólo III Sólo I y II I. la degradación de los neurotransmisores que generan potenciales excitatorios. II y III . Enfermedades respiratorias crónicas. Su eficacia como insecticida se debe a que promueve A) B) C) D) E) la disminución en la actividad de cualquier neurotransmisor. De acuerdo con esta información ¿cuál de las siguientes secuencias pertenece a la especie que mantiene en la actualidad características evolutivas ancestrales? A) B) C) D) E) AGTTC AGTAC AGTAT TGTAC ACTAG 11. como los órganofosforados. ejercen su efecto inhibiendo el funcionamiento de la enzima colinesterasa. Sólo I Sólo II Sólo III Sólo I y II I. el estado diploide del cromosoma X. la detección precoz de los daños hepáticos (cirrosis) para hacer un tratamiento.DEMRE N°O9 Ciencias 6/17/04 16:47 Página 16 16 8. De los siguientes términos. ¿cuál(es) de los siguientes trastornos presentarán los pacientes de este sindrome? I) II) III) A) B) C) D) E) Esterilidad masculina. es una enfermedad debida a A) B) C) D) E) la ausencia de los cromosomas sexuales. 9. El rechazo que produce un injerto de piel se debe a que I) II) las células del receptor destruyen las células del injerto. infertilidad y aspecto femenino del individuo. La secuencia de este gen en el ancestro común era AGAAC. los potenciales de acción I) II) III) A) B) C) D) E) Sólo Sólo Sólo Sólo I . evitar el inicio de una conducta que resultará perjudicial. Infertilidad femenina. En una célula nerviosa mielinizada. II viajan más rápido. El consumo de alcohol constituye un grave problema de salud pública. Arco reflejo. caracterizada por estatura baja. Centro elaborador. La prevención primaria de éste tiene como propósito A) B) C) D) E) modificar la conducta del bebedor moderado. incluye a los de- 12. La patología humana conocida como Sindrome de Kartagener se debe a la ausencia de una proteína del citoesqueleto que causa inmovilidad de cilios y flagelos. disminuir el consumo de alcohol para llevarlo a niveles de consumo social. por parte del receptor. la acción sostenida del neutrotransmisor acetilcolina. la presencia de varias copias del cromosoma X. II y III 14. la activación de los neurotransmisores que generan potenciales inhibitorios.

a un sistema interactivo que comprende una comunidad y su ambiente físico. que lo protegen de la deshidratación. Sólo I Sólo II Sólo III Sólo I y II I. Si el esquema siguiente representa el área de distribución de cuatro especies. Las mutaciones somáticas. Zorro. El aumento del número de glóbulos rojos en personas después de pasar un tiempo en el altiplano. 19. a la asociación de diferentes especies que coexisten en un hábitat determinado con algún grado de interdependencia. ¿Cuál(es) de los siguientes procesos aumenta(n) dicha variabilidad? I) II) III) A) B) C) D) E) La recombinación o crossing-over. cada uno de ellos correspondiente a una clase diferente. ESPECIE 4 Comunidad Población Familia Ecosistema Bioma ESPECIE 3 A) B) C) D) E) Sólo I Sólo II Sólo III Sólo I y II I. A) B) C) D) E) 21. un ave.DEMRE N°O9 Ciencias 6/17/04 16:48 Página 17 17 16. encontrado en una capa más antigua. Águila. un pez. una serpiente. La permutación cromosómica. II y III 18. En un yacimiento de fósiles se encontraron dos vertebrados. Las aletas de los lobos marinos. La tabla siguiente muestra a cuatro especies de depredadores silvestres de Chile y tres de sus características más importantes. ¿cómo se llama la superposición de las áreas geográficas que está representada por el área rellena del dibujo? ESPECIE 1 ESPECIE 2 17. El concepto de ecosistema se refiere A) B) C) D) E) al número de individuos de una especie que habita un área determinada. Uno de los fósiles es representante de los anfibios primitivos y el otro. al número de especies que habita un área determinada. ¿Cuál(es) de las siguientes estructuras o funciones se ha(n) desarrollado como adaptaciones en tiempo evolutivo? I) II) III) Las espinas de los cactos. Una de las principales causas de la evolución biológica es la variabilidad genética. De acuerdo a esta tabla. ubicada debajo de donde se encuentra el anfibio. un mamífero carnívoro. Búho. ¿cuál es la especie que tiene un nicho ecológico más divergente de las demás? Puma roedores conejos ovejas diurna y nocturna terrestre Zorro roedores conejos insectos diurna y nocturna terrestre Águila roedores conejos diurna volador Buho roedores nocturna volador Dieta Actividad Hábitos A) B) C) D) E) Puma. una comunidad que habita un área determinada. Todas son igualmente divergentes. II y III 20. . podría corresponder a A) B) C) D) E) un mamífero insectívoro. que le permiten nadar a gran velocidad en el mar.

activa el sistema nervioso autónomo simpático. La existencia de depredadores en los ambientes a los que escapan. presentan aromas característicos que permiten diferenciarlos. III y IV . 26.DEMRE N°O9 Ciencias 6/16/04 16:01 Página 18 18 22. Un individuo es capaz de sobrevivir cuando I) II) III) IV) A) B) C) D) E) mantiene un intercambio de materia y energía con el medio circundante. son necesarios para proveer cantidades adecuadas de energía. II y III Sólo I. ¿Cuál de las siguientes hormonas no es secretada por la hipófisis anterior (adenohipofisis)? A) B) C) D) E) ADH ACTH LH GH (STH) FSH 25. 23. III) A) B) C) D) E) Sólo I Sólo II Sólo III Sólo I y II I. aumenta la secreción de hormonas antidiurética. II y III Sólo I Sólo II Sólo III Sólo II y III I. II y III 24. Para ello I) II) III) A) B) C) D) E) activa el sistema renina–angiotensina– aldosterona. III y IV I. deben ser proporcionados por la dieta. La amplitud de dieta que presentan en el ecosistema al que escapan. Un sujeto que sufre una hemorragia aguda perdiendo más de un 10% de su volumen sanguíneo. mantiene la homeostasis de su medio interno. Sólo I y II Sólo II y III Sólo I. son formados por el organismo. hace ajustes automáticos para restituir la volemia a su nivel normal. la Trucha Arcoiris y el Salmón del Atlántico son peces de cultivo que han presentado masivos escapes desde los centros de cultivos en los mares del interior de Chile. El Salmón Coho. se autoperpetúa en el proceso de reproducción. responde a cambios del medio circundante. Los aminoácidos esenciales A) B) C) D) E) están presentes en todas las proteínas. II. ¿Cuál(es) de las siguientes variables biológicas se debe(n) determinar para conocer el efecto que estas especies tienen sobre el ecosistema? I) II) El potencial reproductivo de las especies introducidas.

Respecto a esta información. La frecuencia ( ) de la onda aumenta al salir del agua. 2 2 g L En los vértices R. La carga ubicada en el vértice T es positiva. se propagan con una rapidez constante e igual a 1 cm/s hacia un obstáculo rígido donde se produce una reflexión total de ellos. al propagarse por el aire. 1 2 3 1 cm ¿Cuál es el esquema que representa la situación correcta en el instante t = 4 s? 3 1 cm A) 2 2 3 1 1 1 cm B) C) 2 2 1 cm 3 1 1 1 cm D) 2. Tres pulsos iguales. aumenta al salir del agua. La longitud de onda ( ). Si el período T de un péndulo simple es 2 L . su freg 3 3 E) 1 cm cuencia será A) B) C) D) E) 1 2 1 2 g L L g g L 4. es mayor que cuando se propagó por el agua.DEMRE N°O9 Ciencias 6/16/04 16:01 Página 19 19 FÍSICA 3. S y T de un triángulo equilátero se colocan tres cargas puntuales de igual magnitud. 1. La figura muestra la posición de los pulsos en el instante t0 = 0 s. ¿cuál de las opciones siguientes es correcta? A) B) C) D) E) La rapidez de propagación (v) de la onda aumenta al salir del agua. Una onda sonora sale del agua al aire. La rapidez de propagación (v) de la onda disminuye al salir del agua. Las cargas en los vértices R y S son negativas. ¿cuál de los siguientes vectores representa mejor la fuerza electroestática neta sobre la carga en el vértice T? T A) B) C) D) E) R S . El periodo (T) de la onda. Al respecto.

¿Cuál es el número mínimo de amperímetros que se deben conectar simultáneamente para determinar la intensidad de corriente que circula por cada una de las resistencias? R2 R5 9. ambos salieron con igual energía luego de impulsarse. De las afirmaciones anteriores es(son) correcta(s) K A) B) C) D) E) sólo sólo sólo sólo sólo I II III I y II I y III . Un adulto de 70 kg y un niño de 35 kg yacen de espalda y boca arriba sobre una pista de hielo. En una vereda rectilínea una niña se mueve a 0. y permanecen inmóviles mientras son tirados en sentidos opuestos con fuerzas de 10 N. Entonces. Sus cargas respectivas son –3 C y +1 C. En cierto instante la cuerda se desprende del bloque y la pesa cae por gravedad. el movimiento del bloque va a depender de la aceleración de gravedad del lugar. se apoyan en soportes no conductores. Entonces. la cual corre en sentido opuesto a 1. 10. La separación inicial entre ambas es de 30 m. el camino recorrido por la niña hasta encontrarse con su mascota es A) B) C) D) E) 27. entonces las cargas respectivas de cada esfera son A) B) C) D) E) –2 2 1 –3 –1 C C C C C y –2 y 2 y –3 y 1 y –1 C C C C C 8. ambos salieron con momentum de igual magnitud luego de impulsarse. el bloque comienza a alejarse del canto K. el movimiento del bloque va a depender de las masas involucradas.5 m/s. Si ambas esferas se ponen en contacto y luego son separadas.5 m/s al encuentro de su mascota. la tensión de la cuerda es A) B) C) D) E) 10 20 30 60 90 N N N N N R 10 N 3 kg S 6 kg 10 N R3 R1 R4 R6 V R7 7.5 m m m m m 6. Los bloques posan sobre una superficie horizontal pulida. En la figura se ilustra un bloque sólido posando sobre un piso firme horizontal pulido. A) B) C) D) E) 2 3 4 5 7 Los bloques R y S de la figura. de masas 3 kg y 6 kg respectivamente.5 10 15 20 22.DEMRE N°O9 Ciencias 6/17/04 16:48 Página 20 20 5. El bloque es arrimado hacia el canto recto K por una cuerda de cuyo extremo inferior cuelga una pesa. mutua y simultáneamente. A) B) C) D) E) el bloque permanece inmóvil. se unen mediante una cuerda. La figura muestra un circuito de corriente continua. En relación a este juego se afirma que I) II) III) las piernas del adulto ejercieron mayor fuerza que las del niño. Dos esferas conductoras. el bloque se vuelca. en sentidos opuestos. Ambos juntan la planta de sus botas y se impulsan. cargadas y de igual radio. Entonces.

12. negativo. En invierno. Entonces la temperatura final de la mezcla. Esta situación es posible debido a que A) B) C) D) E) la energía aportada por los calefactores al interior de la casa compensa el calor que la casa entrega al exterior. g X C) D) E) D) E) . positivo. La partícula P. Un recipiente tiene 3 kg de agua a 20 oC. El calor latente de fusión para el agua es 80 kcal/kg y para el plomo 5. el interior de una casa se mantiene templada mientras que en el exterior la temperatura es menor que 0 oC. con un sentido de giro como el mostrado en la figura. la energía necesaria para producir la fusión no depende de la masa.DEMRE N°O9 Ciencias 6/19/04 09:03 Página 21 21 11. La rapidez de ambas naves es de 4 m/s. En presencia de la gravedad Chicago rota uniformemente vector aceleración de una asiento X a nivel con el eje representado por A) B) terrestre g. Entonces el persona ubicada en el de la rueda queda mejor 13. la fusión de un gramo de agua requiere más energía que la de un kilógramo de plomo. La longitud de las naves son 3m y 5m respectivamente. es A) B) C) D) E) 30 40 50 60 70 o o B) C) D) E) 3 4 5 4 1 8 3 8 5 s s s s s C C o C o C o C 15. si se mantiene en un ambiente aislado.z) con una frecuencia constante a una distancia r respecto del origen de un sistema de coordenadas. gira en el plano (y. la temperatura interior se compensa con la exterior. una rueda de (ver figura). positivo. Frente a un niño se cruzan dos naves que van por un canal (ver figura). en ambos casos la fusión se produce a la misma temperatura. z P r y x 16. es decir sin que se vean superpuestas.9 kcal/kg. el calor que sale por la casa cancela el frío que proviene del exterior. la temperatura de fusión del agua es mayor que la del plomo. el vector velocidad angular que nace del origen del sistema de coordenadas se encuentra en el eje A) B) C) D) E) y y x x z sentido sentido sentido sentido sentido positivo. el frío que proviene del exterior se cancela con la temperatura interior. estando ambas sustancias en sus respectivas temperaturas de fusión. el frío no es transferido al interior de la casa. Entonces el lapso en que el niño ve las naves cruzarse completamente. negativo. es A) 14. De acuerdo a lo anterior. A partir de esta información se puede afirmar correctamente que A) B) C) se requiere más energía para elevar la temperatura en un grado kelvin de un kilógramo de agua que de un kilógramo de plomo. se vierte sobre éste 1 kg de agua a 100 oC.

posan sobre la superficie de una mesa horizontal. La relación correcta entre las presiones que se ejercen sobre la mesa es A) B) C) D) E) P3>P1>P2 P2>P1>P3 P3 >P2>P1 P1>P2>P3 P1>P3>P2 S S/2 Q P1 r Polea 1 Polea 2 2r P2 3S 2M P1 4M P2 M P3 . 4M y M. el trabajo efectuado por la fuerza aplicada en el pistón pequeño es 10 veces menor que el trabajo efectuado por la fuerza aplicada en o por el pistón grande. Si el punto Q de la correa se mueve con rapidez V. ¿Cuál de las siguientes opciones representa correctamente la rapidez en los puntos periféricos P1 y P2. 19. ejerciendo presiones P1. de las poleas? P1 V P2 V V 2 A) B) C) D) E) V V 2 2V V 2 V V 2 2V 20.DEMRE N°O9 Ciencias 6/17/04 16:49 Página 22 22 17. Dos cuerpos están en equilibrio térmico cuando I) II) III) sus temperaturas son iguales. S/2 y 3S. Como se muestra en la figura. 3 bloques diferentes. De las afirmaciones anteriores. ¿cuál(es) es(son) correcta(s)? A) B) C) D) E) Sólo Sólo Sólo Sólo Sólo I II III I y II I y III II) III) De las afirmaciones anteriores ¿cuál(es) es(son) correcta(s)? A) B) C) D) E) Sólo Sólo Sólo Sólo Sólo I II III I y II I y III 1 cm 1cm2 2 10 cm 10 cm2 2 18. de masas 2M. En la figura la polea 1 y la polea 2 están conectadas por una correa inextensible que no resbala. el pistón grande subirá 1 cm. El pistón más pequeño de una prensa hidráulica tiene 1 cm2 de sección transversal y el segundo pistón tiene una sección transversal de 10 cm2 tal como se muestra en la figura. tienen la misma energía calórica. las áreas respectivas de sus bases son S. ninguno transfiere calor al otro. P2 y P3 respectivamente. verá multiplicada su magnitud por 10 en el pistón grande. si el pistón pequeño desciende 10 cm. Al respecto se afirma que I) cualquier fuerza F distinta de cero aplicada perpendicularmente en el pistón pequeño.

Ambas esferas se conectan a través de un conductor muy delgado. La esfera 1 tiene carga Q y la esfera 2 se encuentra descargada. el núcleo del isótopo carbono-14 está formado por A) B) C) D) E) 6 protones y 8 neutrones. se desvía hacia el interior del plano del papel. En la figura se muestran tres cargas puntuales positivas colocadas en los puntos R. y muy distantes entre si. Una vez alcanzado el equilibrio electrostático. la carga de la esfera 1 es A) Q 3 Q 2 0 2Q 3 Q B B) C) D) 23. . 8 protones y 6 neutrones. 6 protones y 14 neutrones.s B) C) D) + R r + S 2r + T 22. S y T. mantiene su velocidad. En la figura se muestra un electrón que ingresa a la zona Z donde existe un campo magnético constante B perpendicular a su dirección de incidencia. la razón entre las cargas en R y S es A) 1 3 3 2 9 4 2 3 2 1 a A) B) C) D) E) Nula Nula F o . colineales. Para que las fuerzas de las cargas ubicadas en R y S sobre la carga ubicada en T sean iguales. Una carga negativa mantiene un movimiento circunferencial uniforme en torno al punto O. 7 protones y 7 neutrones. ¿Cuál de las siguientes alternativas representa mejor el campo eléctrico E en el punto P debido a esas dos cargas eléctricas? +1 C E) A) B) C) D) E) Un vector nulo. disminuye su rapidez. -1 C P 26. Z Se dispone de dos esferas conductoras 1 y 2 aisladas de radios R y 2R respectivamente. E) 25. ¿cuál de los siguientes pares de vectores representa su aceleración a y la fuerza F sobre ella en el punto S de la trayectoria de la carga? 24. Las separaciones entre R y S es r y entre S y T es 2r. Al respecto y en relación a la figura. 14 protones. Si el átomo neutro de carbono tiene 6 electrones.DEMRE N°O9 Ciencias 6/16/04 16:02 Página 23 23 21. en la zona Z el electrón A) B) C) D) E) aumenta su rapidez. Entonces. se desvía hacia fuera del plano del papel. El punto P mostrado en la figura. equidista de dos cuerpos puntuales de cargas +1 C y –1 C. De acuerdo a esto.

0 9 F 19. se puede inferir que el aire encerrado en la jeringa I) II) III) se comprime.0 13 14 15 Al Si P 27.DEMRE N°O9 Ciencias 6/16/04 16:03 Página 24 24 Para la solución de algunos de los ejercicios propuestos en esta prueba. que contiene sólo aire y cuya salida está cerrada. 1 H 1.0 28. Es(son) correcta(s) A) B) C) D) E) sólo I sólo II sólo III sólo I y II I.9 El agua potable se caracteriza porque I) II) III) es conductora de la electricidad. se adjunta una parte del Sistema Periódico hasta el elemento Nº 20.0 Masa Atómica 5 6 7 B C N 10.0 19 K 39.3 20 Ca 40.0 17 Cl 35.0 3 Li 6.8 12.9 11 Na 23.0 14.5 2 He 4.0 16 S 32. contiene aire disuelto. disminuye su volumen. Es(son) correcta(s) A) B) C) D) E) sólo I sólo II sólo I y II sólo II y III I. Si en una jeringa.1 Número atómico 4 Be 9.2 18 Ar 39.1 31. II y III . contiene iones disueltos. aumenta la presión.0 8 O 16. se ejerce presión sobre el émbolo (ver figura) Cerrada Presión Aire entonces. II y III 2. QUÍMICA 1.0 10 Ne 20.0 12 Mg 24.

4 0. la masa de SO2 formada es A) B) C) D) E) 9. II y III 8.0 L L L L L de de de de de solución.1 0.1 molar? A) B) C) D) E) 0.3 0. Fue el primer modelo atómico nuclear propuesto. Es(son) correcta(s) A) B) C) D) E) sólo I sólo II sólo III sólo II y III I.2 0. números atómicos. sólo I sólo II sólo III sólo II y III I. ¿Cuál de las siguientes estructuras de fórmula global C3H6O representa a la función cetona? A) B) C) D) E) Sólo I Sólo II Sólo I y II Sólo I y III I.DEMRE N°O9 Ciencias 6/17/04 16:49 Página 25 25 3. 16 32 40 64 80 g g g g g (Ver Tabla Periódica) 5.2 0. II y III CH3 CH3 CH2 CH3 CH3 CH2 CH CHO CH2 O CH CH2OH CH3 CO O CH CH2 . radios atómicos. Los elementos ubicados en el Grupo I-A de la Tabla Periódica tienen diferentes I) II) III) estados de oxidación.0 2.02 1023 moléculas de NO2 Es(son) correcta(s) A) B) C) D) E) sólo I sólo II sólo III sólo I y II I. ¿Cuál de las siguientes soluciones de ácido clorhídrico tiene una concentración 0.5 1. II y III 4. II y III Es(son) correcta(s) A) B) C) D) E) 7. En la siguiente reacción química 1 N 2 (g) 2 O 2 ( g) NO2(g) la fórmula química NO2 puede representar a I) II) III) una molécula de NO2 un mol de NO2 6. hidrocarburos no volátiles y monóxido de carbono se transforman en I) II) III) N2 CO2 CH4 6. ¿Cuál(es) de las siguientes afirmaciones tiene(n) relación con el modelo atómico de Rutherford? I) II) III) A) B) C) D) E) En el núcleo se concentra la mayor parte de la masa del átomo.0 5. solución. solución. El sulfato ferroso se descompone por calentamiento según la ecuación 2FeSO4(s) Fe2O3(s) + SO2(g) + SO3(g) Si se descompone un mol de FeSO4. solución.5 mol mol mol mol mol de de de de de soluto soluto soluto soluto soluto disuelto disuelto disuelto disuelto disuelto en en en en en 0. En los convertidores catalíticos de los automóviles las emisiones contaminantes formadas por óxidos de nitrógeno. solución. Los electrones giran en órbitas circulares definidas.

CO2 y O3 Es(son) correcta(s) A) B) C) D) E) sólo I sólo II sólo III sólo I y II I. II y III 15. La diferencia estructural entre dos alcanos consecutivos es sólo de A) B) C) D) E) un átomo de C un grupo CH un grupo CH2 un grupo CH3 dos átomos de H 13. el enlace es covalente coordinado. 11.DEMRE N°O9 Ciencias 6/16/04 16:04 Página 26 26 10. ¿Cuál(es) lneal(es)? de las siguientes CO2 moléculas O3 es(son) I) II) III) la entalpía de la reacción. el valor de la constante de equilibrio de la reacción. el cloro capta completamente el electrón del átomo de hidrógeno. ¿Cuál(es) de los siguientes compuestos es(son) isómero(s) del 1-butanol? 14. la energía de activación de la reacción. el metano debe tener mayor punto de ebullición que el agua. los electrones del enlace se comparten por igual entre H y Cl. H2 S A) B) C) D) E) Sólo H2S Sólo CO2 Sólo O3 Sólo CO2 y O3 H2S. I) II) III) El conocimiento de las estructuras espaciales de las moléculas de agua (H2O) y la de metano(CH4) permite inferir que I) II) III) el agua es polar y el metano apolar. II y III . El enlace químico en la molécula HCl se caracteriza porque A) B) C) D) E) se comparten electrones a pesar de que sus electronegatividades son diferentes. simbolizada por la ecuación A+B C un catalizador apropiado puede disminuir 12. II y III Es(son) correcta(s) A) B) C) D) E) sólo I sólo II sólo III sólo I y III I. CH3 CH3 CH3 CH2 CO CH2 O CH2 CH OH CH2 CH3 CH3 CH3 Es(son) correcta(s) A) B) C) D) E) sólo I sólo II sólo III sólo I y III I. es covalente pero las electronegatividades de sus átomos no juegan ningún papel. a temperatura y presión ambiente el metano es soluble en agua. En una reacción química.

En la reacción ácido-base CH3COOH + OH– CH3COO– + H2O se puede afirmar que. OH– es el ácido y el H2O su base conjugada. tienen las siguientes constantes de acidez Acido HA HB HC 1 1 1 Ka 10–6 10–5 10–4 18. ¿Cuál de las siguientes reacciones es de oxidación? A) B) C) D) E) Zn2+ Cl2 So Fe2+ Ce4+ Zno 2Cl– S2– Fe3+ Ce2+ disminuye la velocidad de producción de SO3 cambia la constante de equilibrio. 17.DEMRE N°O9 Ciencias 6/16/04 16:05 Página 27 27 16. Si en una reacción química el número de oxidación de un átomo aumenta. OH– es la base y el CH3COO– su ácido conjugado. HA es más fuerte que HC. Al agregar platino como catalizador a la reacción 2SO2(g) + O2(g) I) II) III) 2 SO3(g) 19. HC es más fuerte que HB. CH3COOH es la base y CH3COO– su ácido conjugado. NO N2 O 2 2 2 NO K = N2 O 2 2 21. de acuerdo con la teoría de Brönsted–Lowry. CH3COOH es el ácido y el H2O su base conjugada. La constante de equilibrio (K) correspondiente a la ecuación N2(g) + O2(g) se representa por A) B) C) D) E) K = K = N2 O 2 NO 2 2 A) B) 2NO(g) C) D) E) CH3COOH es el ácido y CH3COO– su base conjugada. C– es una base más fuerte que B– C– es una base más fuerte que A– . 2 N O 2 NO 2 NO K = 2 N2 2 O2 K = Los ácidos hipotéticos que a continuación se indican. La concentración molar del ion hidrógeno en una solución acuosa de pH = 3 es A) B) C) D) E) 3 103 M 1 103 M 3M 3 10–3 M 1 10–3 M En soluciones de igual concentración A) B) C) D) E) HA es más fuerte que HB. el átomo se ha oxidado. aumenta la velocidad de producción de SO3 Es(son) correcta(s) A) B) C) D) E) sólo sólo sólo sólo sólo I II III II y III I y II 20.

explosivos. reacción química. reduce el ion Na+ 25. en la ganga se concentra la mayor parte del mineral.0 10. Si inicial100 mente se dispone de una muestra de 10 miligramos de este isótopo. El siguiente proceso 26. Este no metal es uno de los constituyentes de I) II) III) desinfectantes. Es(son) correcta(s) A) B) C) D) E) sólo I sólo II sólo II y III sólo I y III I. II y III 24.DEMRE N°O9 Ciencias 6/16/04 16:05 Página 28 28 22. Chile posee grandes depósitos de minerales no metálicos. II y III 23. II y III Es(son) correcta(s) A) B) C) D) E) sólo II sólo I y II sólo I y III sólo II y III I. H 3 1 H 4 2 He 1 0 n corresponde a una I) II) III) fusión de isótopos. la trituración y la concentración del mineral son operaciones metalúrgicas. Es(son) correcta(s) A) B) C) D) E) sólo sólo sólo sólo sólo I II III II y III I y III Es(son) correcta(s) A) B) C) D) E) sólo I sólo II sólo III sólo I y III I. como el azufre. genera cloro (Cl 2) en el cátodo. La vida media de 250 Fm es de 30 minutos. En la electrólisis del NaCl fundido se I) II) III) requiere energía eléctrica. 2 1 En la metalurgia es correcto aseverar que I) II) III) la mena es parte del mineral que reúne las condiciones adecuadas para extraer algún metal. después de 30 minutos la masa de 250 100 Fm se reduce a A) B) C) D) E) 12. fisión de isótopos.0 miligramos miligramos miligramos miligramos miligramos .0 15.0 12.5 13. fármacos.

5. 40. 21. 19. 12. 11. 15. 23. 4. 36. 16. 24. 9. 16. 19. 13. 10. 30. 10. 21. 50. 34. 9. 19. 22. 12. 24. 2. CLAVE Nº PREG. 11. C B A D D B B D A B E D A A A E B E A A D E C E C A D 1. 6. 47. 22. QUÍMICA B B D D B D A C C E A D E B C A D A D B D E B C A A A B C B E D A C D A D E D E A A E E B A A A B C A C E E D D C E E B D C D B A 14. 14. 9. 46. 33. 3. 26. 16. 16. 20. 23. 7. 2. 32. D D C D E A E A C D E B C D A D D C B D C E E B C A D 28. 6. 24. 21. 3. 13. 17. 42. 3. 17. 17. 18. 10. 22. 8. 21. 5. 25. 7. 37. 11. 20. 53. NOTA: Para calcular el puntaje corregido se debe sumar el total de correctas del módulo común con el total de correctas del módulo electivo y restarle la cuarta parte de la suma de erradas del módulo común y del módulo electivo. 18. E E A D E D E B E B E B E FÍSICA 14. 44. 8. 2. 3. 14. 4. 38. 25. 20. 18. 15. 45. 26. 49. . 10. 18. 9. 35. 29. 6. 52. 27. 39. 6. 1. 7. 1. 23. 19. 54. 13. 4. 1. 12. 8. 25. 20. 12. 4. 2. 31. 5. 15. 26.DEMRE N°O9 Ciencias 6/16/04 16:05 Página 29 29 CLAVES CLAVES MÓDULO ELECTIVO BIOLOGÍA CLAVE MÓDULO COMÚN Nº PREG. 11. 13. 23. 8. 7. 25. 17. 48. 41. 43. 24. 15. 26. 22. 51. 5.