You are on page 1of 6

Introducción

El método de secuenciación por dideoxinucleótido, mejor conocido como el método Sanger se basa en el proceso biológico de la replicación del DNA. El método de secuenciación ideado por Sanger está basado en el empleo de dideoxinucleótidos que carecen de uno de los grupos hidroxilo, de manera que cuando uno de estos nucleótidos se incorpora a una cadena de DNA en crecimiento, está cadena no va a poder continuar elongándose. Esto es así ya que la DNA polimerasa necesita un terminal 3’ OH para añadir el siguiente nucleótido y el dideoxinucleótido incorporado carece de este grupo hidroxilo. El método comienza una vez se aísla y se clona el DNA que se desea secuenciar. Este DNA se desnaturaliza y se emplea una sola hélice en la secuenciación. En la secuenciación se utiliza un cebador o “primer” que se encarga de suministrar el terminal 3’OH que necesita la DNA polimerasa. Se preparan cuatro tubos de reacción, cada uno con el DNA molde de hélice sencilla que se desea secuenciar, con DNA polimerasa, con el “primer” y con los cuatro nucleótidos trifosfatados. A cada tubo se le añade una pequeña proporción de un dideoxinucleótido trifosfato; un tubo con ddATP, otro con ddTTP, el tercero con ddGTP y el cuarto con ddCTP. En cada uno de estos tubos se producen cadenas de DNA de distintas longitudes, terminando todas en el lugar en el que se incorporó el dideoxinucleótido correspondiente añadido al tubo. Los productos de las 4

reacciones, cada una conteniendo una pequeña cantidad de uno de los cuatro dideoxinucleótidos, son cargados en el gel y sometidos a electroforesis. En este experimento se realizo una simulación de este método con el propósito de conocer los procesos básicos de la replicación del DNA y de familiarizarnos con los procedimientos utilizados para parea la misma.

Materiales y Métodos

Para esta simulación se dividieron los estudiantes en cuatro grupos. A cada grupo le toco una reacción distinta; rojo ATP, amarillo GTP, negro CTP, blanco TTP. Por grupo se repartieron 25 cuentas rojas, 25 cuentas blancas, 25 cuentas negras y 25 cuentas amarillas, 8 cuentas marcadas con sus respectiva reacción y un del DNA, mientras que las cuentas marcadas representan los En el vaso rotulado se añadieron las 25 cuentas más las 8 vaso rotulado con el nombre de la reacción. Cada una de estas representa los nucleótidos nucleótidos dideoxi.

cuentas marcadas. Se comenzó a extraer con la mano y sin mirar una cuenta a la vez. Si la cuenta que se tomó es complementaria a la base luego del “primer” presente en el DNA molde ésta se escribe inmediatamente después del “primer”. Luego de anotar la base correspondiente, la cuenta se devolvió al envase de reacción. Si la cuenta que se tomó del envase de reacción no es complementaria a la base presente en el DNA molde, ésta fue devuelta al mismo y se continuó extrayendo cuentas del envase hasta que se obtuvo una complementaria. Esto simula el proceso por el cual ocurre la complementariedad de bases al azar. Se continúo haciendo esto hasta que se sacara una de las cuentas marcadas. Cuando esto ocurrió la síntesis de la cadena naciente de DNA se detiene. Esta cuenta representa un dideoxinucleótido. Una vez terminada la síntesis se reinicio el proceso de secuenciación repitiendo los pasos dideoxinucleótidos correspondientes. anteriores hasta que se obtuvieron al menos 8 segmentos variados que terminen en cada uno de los Una vez terminadas las 8 secuencias de DNA se procedió a leer la electroforesis de cada grupo y se determinó la secuencia de la cadena de DNA bajo estudio.

Interpretación de los Resultados

1. ¿En la simulación llevada a cabo, qué rol juega su mano? a. La mano juega el rol de endonucleasa, la cual se encarga de formar el enlace entre las bases nitrogenadas. 2. ¿Cuál es la función del primer? a. La función del primer consiste en proveer un terminal OH 3’ a la DNA polimerasa. Esto es así porque el DNA polimerasa no puede replicar el DNA si no tiene un terminal OH 3’ al que añadir nucleótidos. 3. ¿Qué proceso biológico es representado por la devolución de las cuentas no complementarias a la mezcla de reacción (paso 8 del procedimiento)? a. El sacar con la mano las cuentas y devolver las cuentas no complementarias a la mezcla de reacción simula lo que sucedería en el apareamiento al azar que ocurriría de forma natural en la replicación de DNA. 4. Determina la secuencia del DNA sintetizado en la figura 5 a. La secuencia del DNA sintetizado en la figura 5 es: 3’ T G C G G G C T T A T C G G G T C T A A 5’ 5. ¿Cuál es la secuencia que le da la lectura que aparece en la tabla 2? a. La secuencia que da la lectura que aparece en la tabla 2 es:

3’ G G A C G A C T T A T G C A C A T C T G G C A 5’

6. ¿Cuál es la secuencia del DNA molde que se utilizó? a. La secuencia del DNA molde utilizado es: 3’CTGCTGACGAACGTACTGTGAAGGCACTCATTTAATGGCTACGC 5’

Referencias

Manual de Laboratorio Genética 2006. Baerga-Santini, Carmen; Cintrón Isabel; Dávila, Iván. pp. 216-225.

Conceptos de Genética 5ta Edición 1999. Klug, William.; Cummings, Michael. pp. 474- 475.

Universidad de Puerto Rico en Humacao Facultad de Ciencias Naturales Departamento de Biología

SIMULACIÓN DEL MÉTODO DE SECUENCIACIÓN DE SANGER

Sharon M. Boschetti-Medina 801-01-0907 BIOL 3305 Secc. 002 Prof. Baerga