You are on page 1of 11

Universidad de Puerto Rico en Humacao Facultad de Ciencias Naturales Departamento de Biología

Simulación de la Prueba de Huella Digital de DNA

Sharon M. Boschetti-Medina 801-01-0907 BIOL 3306 Sec. 00 Prof. Baerga

Introducción
El ácido desoxirribonucleico (DNA) es una substancia química encontrada en todos los seres vivientes. Contiene el código para todos nuestros atributos físicos así como las instrucciones para todas las funciones del cuerpo, incluyendo crecimiento, desarrollo, y replicación. Gracias a esto cada persona es diferente tanto físicamente como genéticamente. En términos generales se puede decir que el genoma es muy parecido entre los individuos de la especie humana, esto es que 99.99% es común en todos. Este genoma esta compuesto por tres mil millones de nucleótidos de los cuales se han identificado alrededor de 1.4 millones en los cuales se han encontrado diferencias de un individuo a otro. La técnica de la huella digital del DNA (DNA fingerprinting) en términos generales permite detectar las diferencias en el DNA en diferentes personas. Los métodos para utilizar esta técnica se basan en el análisis de fragmentos dados por el corte de ciertas regiones variables con enzimas de restricción. Esto envuelve cuatro pasos básicos: 1) aislar el DNA del individuo; 2) Corte del DNA en secciones mas pequeñas y manejables; 3) Separación de los pedazos por tamaño e identificar los que corresponden a las regiones variables y; 4) Analizar el perfil de pedazos de cada individuo. Ese análisis es lo que generalmente se conoce como DNA fingerprinting. Este método es utilizado en una variedad de procesos tales como determinación de paternidad, casos legales (asesinato, violaciones y otros delitos menores), identificación de cadáveres, en las ciencias entre otros. A pesar de ser un método técnicamente infalible, cabe la posibilidad de hallarse errores, como por ejemplo si la muestra utilizada se contamina, si el método de cálculo para la determinación del porcentaje varía entre otros. Simpson. En lo antes dicho cabe mencionar el caso de O.J. Para este caso, la prueba se aplicó para determinar su culpabilidad o

inocencia en el asesinato de su ex esposa y un amigo de esta. Pero debido a que la evidencia expuesta supuestamente se hallaba contaminada la prueba realizada fue descartada. Este ejercicio de laboratorio tiene como objetivo familiarizarnos con la técnica de DNA fingerprinting y de sus aplicaciones en el estudio de la biología. También tiene como objetivos familiarizarnos con el análisis de perfiles de restricción en diferentes individuos y como la prueba es aplicable a cada uno de estos casos.

Materiales y Métodos

Para la realización de esta simulación se utilizaron una serie de ejercicios en los cuales se aplicaron los siguientes pasos: Aislamiento del DNA genómico, corte de DNA genómico con enzimas de restricción, separación, y el análisis de los pedazos de DNA. Para el primero se explicó que los métodos de rompimiento de tejidos, las envolturas que rodean la célula y la membrana plasmática son los utilizados y que mayormente para romper los mismos se utilizan detergentes. Una vez rota la pared celular y separado el DNA genómico se procedió al siguiente paso. El corte del DNA genómico con enzimas de restricción. Estas enzimas de restricción son endonucleasas de reconocimiento de secuencias específicas dentro del DNA. Estas catalizan la ruptura del enlace fosfodiester entre dos nucleótidos dentro de esa secuencia conocida como RE palindromica (en dirección 5’a 3’ en cada cadena, la secuencia es la misma). Una vez cortado el DNA, los pedazos son separados por tamaño en una gelatina de agarosa por el método conocido como electroforesis. La electroforesis es una técnica para

la separación de moléculas (proteínas o ácidos nucleicos) sobre la base de su tamaño molecular y carga eléctrica. Los ácidos nucleicos ya disponen de una carga eléctrica negativa, que los dirigirá al polo positivo, mientras que las proteínas se cargan con sustancias como el SDS (detergente) que incorpora cargas negativas de una manera dependiente del peso molecular. Para la separación se usa un gel de agarosa o poliacrilamida (fibras cruzadas, como una malla). Al poner la mezcla de moléculas y aplicar un campo eléctrico, éstas se moverán y deberán ir pasando por la membrana a través de los poros, por la que las pequeñas se moverán mejor y más rápidamente. partida. Así, las más pequeñas avanzarán más y las más grandes quedarán cerca del lugar de Finalmente se inicia el análisis de los pedazos de DNA ya separados y de ahí se determina lo que compone la huella genética del individuo.

Resultados e Interpretación

Ejercicio 1: Enzimas de restricción
1. Localiza la secuencia que reconoce la enzima Hae III (5’GGCC 3’).

Corte cada pedazo de DNA (Hae III corta entre G y C).
José a. Cromosoma materno: 5’ ATCTTGACCAATGTGAAAGGCCAATATAGCATTGGCCAAGCTCTC 3’ 3’ TAGAACTGGTTACACTTTCCGGTTATATCGTAACCGGTTCGAGAG 5’

b. Cromosoma paterno: 5’ATCTTGGCCAATGTGAAGGCCAATATAGCATTGGTCAAGTTCTC 3’ 3’TAGAACCGGTTACACTTCCCGGTTATATCGTAACCAGTTCAAGAG 5’

María a. Cromosoma materno 5’ ATGTTGGCCAATGTGAGGACCAATATAGCATTGGCAAAGCTCTCG 3’ 3’ TACAACCGGTTACACTCCTGGTTATATCGTAACCGTTTCGAGAGC 5’

b. Cromosoma paterno 5’ATCTTGGCCAATATCAAAGACCAATATAGCATTGGCCAAGCTCTC 3’ 3’TAGAACCGGTTATAGTTTCTGGTTATATCGTAACCGGTTCGAGAG 5’

2. ¿Cuantos fragmentos se producen al cortar el cromosoma materno de José y María; de qué tamaño son estos? a. José: 3 fragmentos; sus tamaños son de 20, 15, y 10 bp. b. María: 2 fragmentos; sus tamaños son de 7 y 38 bp.

3. ¿Cuántos fragmentos se producen al cortar el cromosoma paterno de José y María y de que tamaños son estos? a. José: 3 fragmentos; sus tamaños son de 7,13 y 25 bp. b. María: 3 fragmentos; sus tamaños son 7, 28 y 10 bp.

4. ¿Cuántos fragmentos se producen de la muestra de DNA de José y María y de que tamaño son estos? a. José: 6 fragmentos; sus tamaños son 20, 15, 10, 7, 13 y 25 bp. b. María: 5 fragmentos; sus tamaños son 7, 7, 28, 38 y 10 bp.

5. Separe por tamaño los fragmentos generados del DNA de José y María en una gelatina de agarosa.

Marcador de tamaño 40 39 38 37 36 35 34 33 32 31

Maria

José

30 29 28 27 26 25 24 23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1

6. ¿Identifica esta prueba diferencias genéticas entre José y María? a. Si 7. Explique genéticamente a que se deben esas diferencias. a. Estas diferencias genéticas se deben a que existen regiones

variables dentro del genoma. Las diferencias en el genoma se pueden dar de dos maneras. Uno es el simple cambio de bases o la repetición de secuencias pequeñas de nucleótidos, como en este caso que las diferencias entre ambos genomas consistió en un cambio de bases; en el cromosoma materno de José había ATC

mientras que en el cromosoma materno de María comenzaba con ATG.

Ejercicio 2: Se mezclan tres bebes en un hospital Resumen: Tres familias tuvieron hijos a la misma hora y el mismo día en el mismo hospital. Una alarma de incendios fue activada y los infantes fueron Una vez pasado el peligro el personal del desalojados inmediatamente.

hospital se percató que ninguno de los infantes había sido identificado. Por ello se realizo una prueba de DNA Fingerprinting para determinar que bebe le pertenecía a cada familia. a. ¿Cual es tu interpretación de esos datos? Presenta tus argumentos i. El bebé número 1 pertenece al Sr. y la Sra. Stevenson. Esto es así ya que tanto el patrón como el tamaño de las bandas del bebé concuerdan con la de ambos padres. Por las mismas razones el bebé número 2 pertenece al Sr. y la Sra. Jones y el bebé número 3 pertenece al Sr. y la Sra. Smith.

Ejercicio 3: Un caso de paternidad Resumen: El Sr. Megabucks muere recientemente. Repentinamente aparecen tres mujeres alegando tener un hijo de este hombre. El Sr. Megabucks anticipándose a los eventos antes de morir dejó una muestra de su sangre congelada para que se pudiese realizar una prueba de DNA y así determinar cual de estos es su hijo.

a. ¿Cual es tu interpretación de esos datos? Presenta tus argumentos i. El hijo del Sr. Megabucks es el numero 2. Esto es así ya que tanto el tamaño y la posición en donde se hallan las bandas concuerdan con el marcador obtenido del Sr. Megabucks. A pesar de que los hijos 1 y 3 también tenían bandas compatibles, loa gran mayoría de las bandas las obtuvo el hijo numero 2 porque tenia igual proporción de bandas de la madre que del padre

Ejercicio 4: El caso del cuchillo ensangrentado Resumen: Heinrich Millhouse, un ladrón internacional de joyas es asesinado durante un robo al Museo de Arte Nacional. En la escena del crimen se halló debajo del cuerpo de la victima un cuchillo ensangrentado. Al día siguiente la policía arresto a su compañero de crimen ocasional, Englewood Smink, el cual durante el interrogatorio admitió que había tenido un accidente en la cocina esa mañana debido al cuestionamiento con respecto a una cortadura en al mano. Ante esto el inspector ordeno se realizaran pruebas de DNA a la victima, la sangre en la ropa de la victima, la sangre en el cuchillo encontrado bajo la victima y de Smink.

a. ¿Cual es tu interpretación de esos datos? Presenta tus argumentos i. Pudo haber resultado como una emboscada de parte de Millhouse hacia Smink, donde Millhouse ataco a Smink haciéndole una cortadura en la mano. Como respuesta Smink le dispara a Millhouse, matándolo y huyendo con las joyas. Smink es Culpable. Es por esto que considero de acuerdo a los resultados obtenidos en la prueba de DNA que el señor Las pruebas nos demuestran que la sangre encontrada en el cuchillo era de ambos. Mientras que la sangre en la ropa era solo de Millhouse.

b. ¿Debe ser liberado Smink? ¿Por qué? Smink no deberá ser liberado. Hasta que se pruebe quien mato a

Millhouse y/o tenga una cuartada con la cual justifique su declaración de los hechos por la cortada de su brazo. Esto también lo ayudara en no ser acusado por la muerte de Millhouse.

c. ¿Deben llevarse a cabo otras pruebas? Se pueden y se deberían realizar más pruebas con las cuales se resuelvan los casos de la muerte de Millhouse y el robo de las joyas.

Referencias:

Manual de Laboratorio Genética 2006. Baerga-Santini, Carmen; Cintrón Isabel; Dávila, Iván. pp. 226-235.

Conceptos de Genética 5ta Edición 1999. Klug, William. ; Cummings, Michael. pp. 498-500.

http://www.pruebadepaternidad.info/ http://www.query.nytimes.com/gst/fullpage.html?res=990CE4DE16 3CF935A15755C0A962958260