You are on page 1of 70
Reunião Reunião de de Avalia Avalia ç ç ão ão de de Projetos Projetos RioRio

ReuniãoReunião dede AvaliaAvaliaççãoão dede ProjetosProjetos

RioRio dede JaneiroJaneiro 1313 dede dezembrodezembro dede 20112011
RioRio dede JaneiroJaneiro
1313 dede dezembrodezembro dede 20112011

RCTRCT--PETROBRASPETROBRAS

ProjetoProjeto ModificaModificaççãoão GenGenééticatica dede FungosFungos FilamentososFilamentosos parapara
ProjetoProjeto
ModificaModificaççãoão GenGenééticatica dede FungosFungos
FilamentososFilamentosos parapara IncrementoIncremento dada
ExpressãoExpressão dede EnzimasEnzimas CelulolCelulolííticasticas
CoordenadorCoordenador:: Prof.Prof. FernandoFernando AraripeAraripe TorresTorres
PerPerííodoodo:: 12/200512/2005 aa 03/200703/2007
EquipeEquipe ExecutoraExecutora UnBUnB –– UFRJUFRJ -- UFAMUFAM
EquipeEquipe ExecutoraExecutora
UnBUnB –– UFRJUFRJ -- UFAMUFAM
EquipeEquipe UnBUnB Prof.Prof. FernandoFernando AraripeAraripe TorresTorres ProfaProfa LLíídiadia MariaMaria PepePepe
EquipeEquipe UnBUnB
Prof.Prof. FernandoFernando AraripeAraripe TorresTorres
ProfaProfa LLíídiadia MariaMaria PepePepe dede MoraesMoraes
JaniceJanice LisboaLisboa DeDe MarcoMarco
BrunoBruno BenolielBenoliel
CamilaCamila MarinhoMarinho SilvaSilva
SauloSaulo SiqueiraSiqueira
EquipeEquipe UFRJUFRJ -- UFAMUFAM Prof.Prof. NeiNei PereiraPereira (UFRJ)(UFRJ) Prof.Prof. SpartacoSpartaco
EquipeEquipe UFRJUFRJ -- UFAMUFAM
Prof.Prof. NeiNei PereiraPereira (UFRJ)(UFRJ)
Prof.Prof. SpartacoSpartaco AstolfiAstolfi FilhoFilho (UFAM)(UFAM)
IntroduIntroduççãoão
IntroduIntroduççãoão
ResResííduosduos LignocelulLignocelulóósicossicos 386386 xx 1010 66 tt bagabagaççoo dede cana/anocana/ano 38%38%
ResResííduosduos LignocelulLignocelulóósicossicos
386386 xx 1010 66 tt bagabagaççoo dede cana/anocana/ano
38%38% dodo conteconteúúdodo energenergééticotico nãonão éé aproveitadoaproveitado
PoderiaPoderia dobrardobrar aa produproduççãoão dede etanoletanol nono BrasilBrasil
““RotaRota PetrobrasPetrobras”” ResResííduosduos LignocelulLignocelulóósicossicos CELULOSECELULOSE
““RotaRota PetrobrasPetrobras””
ResResííduosduos
LignocelulLignocelulóósicossicos
CELULOSECELULOSE
HEMICELULOSEHEMICELULOSE

HidrHidróóliselise

ququíímicamica

HidrHidróóliselise

enzimenzimááticatica

FermentaFermentaççãoão

LIGNINALIGNINA CELULOSECELULOSE SOLSOLÚÚVELVEL GLICOSEGLICOSE XILOSEXILOSE RESRESÍÍDUODUO ETANOLETANOL
LIGNINALIGNINA
CELULOSECELULOSE SOLSOLÚÚVELVEL
GLICOSEGLICOSE
XILOSEXILOSE
RESRESÍÍDUODUO
ETANOLETANOL
SSÓÓLIDOLIDO
EnzimasEnzimas:: sinergismosinergismo
EnzimasEnzimas:: sinergismosinergismo
JustificativasJustificativas PrePreççoo dasdas enzimasenzimas éé umum gargalogargalo ProduProduççãoão
JustificativasJustificativas
PrePreççoo dasdas enzimasenzimas éé umum gargalogargalo
ProduProduççãoão nacionalnacional
FungosFungos filamentososfilamentosos:: óótimostimos produtoresprodutores
BiodiversidadeBiodiversidade brasileirabrasileira
MelhoramentoMelhoramento gengenééticotico éé necessnecessááriorio
FaltamFaltam ferramentasferramentas molecularesmoleculares
ObjetivoObjetivo geralgeral Desenvolvimento de linhagens de fungos filamentosos hiperprodutoras de enzimas
ObjetivoObjetivo geralgeral
Desenvolvimento
de
linhagens
de
fungos
filamentosos
hiperprodutoras
de
enzimas
celulolíticas
ObjetivosObjetivos especespecííficosficos ScreeningScreening dede fungosfungos produtoresprodutores dede
ObjetivosObjetivos especespecííficosficos
ScreeningScreening dede fungosfungos produtoresprodutores dede celulasescelulases
ConstruConstruççãoão dede vetorvetor dede expressãoexpressão parapara fungosfungos filamentososfilamentosos
ClonagemClonagem nono vetorvetor construconstruíídodo dosdos genesgenes dede HumicolaHumicola griseagrisea parapara asas
enzimasenzimas endoglucanaseendoglucanase ((egl2egl2),), celobiohidrolasecelobiohidrolase 1.21.2 ((cbh1.2cbh1.2)) ee ββ--
glicosidaseglicosidase ((bgl4bgl4))
TransformaTransformaççãoão dede umauma linhagemlinhagem selecionadaselecionada dede fungofungo filamentosofilamentoso
comcom osos vetoresvetores dede expressãoexpressão
AnAnááliselise dosdos transformantestransformantes quantoquanto àà produproduççãoão dede celulasescelulases
MetodologiaMetodologia
MetodologiaMetodologia
Screening de fungos celulolíticos (UFRJ/UFAM) Caracterização enizmática (UFRJ/UFAM) Seleção de um isolado
Screening de fungos celulolíticos (UFRJ/UFAM)
Caracterização enizmática (UFRJ/UFAM)
Seleção de um isolado (UFRJ/UFAM/UnB)
Desenvolvimento de vetores de transformação (UnB)
Transformação genética (UnB)
Análise dos transformantes (UnB)
ResultadosResultados
ResultadosResultados
FungosFungos CelulolCelulolííticosticos (UFRJ)(UFRJ) TrichodermaTrichoderma reeseireesei RUTRUT C30C30
FungosFungos CelulolCelulolííticosticos (UFRJ)(UFRJ)
TrichodermaTrichoderma reeseireesei RUTRUT C30C30
HumicolaHumicola griseagrisea var.var.thermoideathermoidea
AspergillusAspergillus nigerniger ATCCATCC 1640416404
PenicilliumPenicillium funiculosumfuniculosum ATCCATCC 1179711797
TrichodermaTrichoderma harzianumharzianum IOCIOC--38443844
TrichodermaTrichoderma harzianumharzianum IOCIOC--40384038
AtividadesAtividades EnzimEnzimááticasticas AtividadeAtividade (UI/L)(UI/L) LinhagemLinhagem CelobioseCelobiose
AtividadesAtividades EnzimEnzimááticasticas
AtividadeAtividade (UI/L)(UI/L)
LinhagemLinhagem
CelobioseCelobiose
PapelPapel dede filtrofiltro
CMCCMC (EG)(EG)
AvicelAvicel (CHB)(CHB)
(BG)(BG)
T.T. reeseireesei RUTRUT
17,817,8 ±± 6,16,1
103,0103,0 ±± 9,39,3
84,284,2 ±± 4,44,4
35,635,6 ±± 1,41,4
C30C30
H.H. griseagrisea varvar
thermoideathermoidea
45,745,7 ±± 0,90,9
317,0317,0 ±± 1,01,0
73,973,9 ±± 1,51,5
153,3153,3 ±± 9,79,7
A.A. nigerniger ATCCATCC
36,236,2 ±± 4,64,6
386,2386,2 ±± 16,916,9
1627,31627,3 ±± 10,810,8
88,488,4 ±± 3,03,0
1640416404
P.P.
2263,32263,3 ±±
1835,51835,5 ±±
funiculosumfuniculosum
353,8353,8 ±± 29,429,4
727,0727,0 ±± 28,028,0
104,8104,8
110,7110,7
ATCCATCC 1179711797
T.T. harzianumharzianum
6358,16358,1 ±±
494,3494,3 ±± 22,022,0
752,3752,3 ±± 36,036,0
512,0512,0 ±± 28,528,5
IOCIOC--38443844
219,8219,8
T.T. harzianumharzianum
100,0100,0 ±± 4,14,1
558,5558,5 ±± 31,831,8
744,7744,7 ±± 18,018,0
134,7134,7 ±± 8,48,4
IOCIOC--40384038
Atividades em papel de filtro, CMC e celobiose: melhores valores obtidos durante os experimentos;
Atividades em avicel: Valores obtidos nos extratos finais.
Experimentos em frascos de 1L contendo celulignina semi-deslignificada em meio Mandels.
Fermentação após etapa de pré-inóculo.
SeleSeleççãoão AtividadeAtividade especespecííficafica (UI/(UI/mgmg proteproteíína)na) LinhagemLinhagem
SeleSeleççãoão
AtividadeAtividade especespecííficafica
(UI/(UI/mgmg proteproteíína)na)
LinhagemLinhagem
FPasesFPases
EGEG
BGBG
T.T. reeseireesei
0,280,28
1,641,64
1,341,34
H.H. griseagrisea
1,331,33
14,9114,91
3,603,60
A.A. nigerniger ATCCATCC 1640416404
0,580,58
5,705,70
52,9152,91
T.T. harzianumharzianum IOCIOC--40384038
1,011,01
6,426,42
7,467,46
T.T. harzianumharzianum IOCIOC--38443844
14,0014,00
67,1467,14
5,305,30
P.P. funiculosumfuniculosum
7,987,98
43,1443,14
19,0619,06
FungosFungos CelulolCelulolííticosticos (UFAM)(UFAM) MicrorganismoMicrorganismo OrigemOrigem AspergillusAspergillus
FungosFungos CelulolCelulolííticosticos (UFAM)(UFAM)
MicrorganismoMicrorganismo
OrigemOrigem
AspergillusAspergillus nigerniger
FermentadoFermentado dede canacana--dede--aaçúçúcarcar dada UsinaUsina JayoroJayoro S/AS/A
AspergillusAspergillus ochraceusochraceus
VinhotoVinhoto dede canacana--dede--aaçúçúcarcar dada UsinaUsina JayoroJayoro S/AS/A
AspergillusAspergillus flavusflavus
CEFETCEFET
AspergillusAspergillus spsp
FermentadoFermentado dede canacana--dede--aaçúçúcarcar dada UsinaUsina JayoroJayoro S/AS/A
AspergillusAspergillus ustusustus
BagaBagaççoo dede canacana--dede--aaçúçúcarcar dada UsinaUsina JayoroJayoro S/AS/A
PenicilliumPenicillium funiculosumfuniculosum
UFRJUFRJ
PenicilliumPenicillium versicolorversicolor
VinhotoVinhoto dede canacana--dede--aaçúçúcarcar dada UsinaUsina JayoroJayoro S/AS/A
PenicilliumPenicillium furcatumfurcatum
FermentadoFermentado dede canacana--dede--aaçúçúcarcar dada UsinaUsina JayoroJayoro S/AS/A
PenicilliumPenicillium steckistecki
VinhotoVinhoto dede canacana--dede--aaçúçúcarcar dada UsinaUsina JayoroJayoro S/AS/A
AtividadesAtividades EnzimEnzimááticasticas MicrorganismoMicrorganismo AtividadeAtividade CMCaseCMCase (U/mL)(U/mL)
AtividadesAtividades EnzimEnzimááticasticas
MicrorganismoMicrorganismo
AtividadeAtividade CMCaseCMCase (U/mL)(U/mL)
AtividadeAtividade ββ--glucosidaseglucosidase
(U/mL)(U/mL)
AtividadeAtividade FPaseFPase (U/mL)(U/mL)
A.A. nigerniger
0,1240,124 ±± 0,00350,0035
0,82160,8216 ±± 0,01110,0111
0,05950,0595 ±± 0,02660,0266
A.A. ochraceusochraceus
0,14910,1491 ±± 0,01270,0127
0,11120,1112 ±± 0,00860,0086
0,07180,0718 ±± 0,00170,0017
A.A. flavusflavus
0,11600,1160 ±± 0,00090,0009
1,24061,2406 ±± 0,01840,0184
0,06260,0626 ±± 0,00040,0004
AspergillusAspergillus spsp
0,08890,0889 ±± 0,00490,0049
0,32060,3206 ±± 0,0120,012
0,02480,0248 ±± 0,00210,0021
A.A. ustusustus
0,17990,1799 ±± 0,00600,0060
1,3091,309 ±± 0,0300,030
0,07330,0733 ±± 0,00970,0097
A.A. funiculosumfuniculosum
0,15590,1559 ±± 0,00910,0091
0,9370,937 ±± 0,01020,0102
0,09220,0922 ±± 0,00250,0025
P.P. versicolorversicolor
0,13160,1316 ±± 0,01570,0157
0,36830,3683 ±± 0,00360,0036
0,13800,1380 ±± 0,00890,0089
P.P. furcatumfurcatum
0,11490,1149 ±± 0,0910,091
0,16360,1636 ±± 0,00,0
0,071840,07184 ±± 0,00170,0017
P.P. steckistecki
NdNd
NdNd
NdNd
ConstruConstruççãoão dede vetorvetor dede expressãoexpressão parapara fungosfungos filamentososfilamentosos
ConstruConstruççãoão dede vetorvetor dede
expressãoexpressão parapara
fungosfungos filamentososfilamentosos
ConstruConstruççãoão dosdos VetoresVetores dede ExpressãoExpressão parapara FungosFungos FilamentososFilamentosos
ConstruConstruççãoão dosdos VetoresVetores dede ExpressãoExpressão
parapara FungosFungos FilamentososFilamentosos
Objetivo:Objetivo: construconstruççãoão dede vetoresvetores dede expressãoexpressão parapara fungosfungos
filamentososfilamentosos queque possampossam serser utilizadosutilizados parapara aa expreexpressãossão
heterheteróólogaloga dede genesgenes dede celulasescelulases
ElementosElementos principaisprincipais SequênciasSequências parapara seleseleççãoão ee replicareplicaççãoão
ElementosElementos principaisprincipais
SequênciasSequências parapara seleseleççãoão ee replicareplicaççãoão emem bactbactéériaria
((OriOri ee marcamarca dede seleseleçção)ão)
MarcaMarca dede seleseleççãoão parapara fungosfungos filamentososfilamentosos
RegiãoRegião promotorapromotora dede fungosfungos filamentososfilamentosos
SSíítiotio parapara clonagemclonagem dosdos genesgenes
RegiãoRegião terminadoraterminadora dada transcritranscriççãoão (TT)(TT)
VetorVetor desejadodesejado
VetorVetor desejadodesejado
ClonagemClonagem dede ElementosElementos RegulatRegulatóóriosrios PromotoresPromotores gpdAgpdA
ClonagemClonagem dede ElementosElementos
RegulatRegulatóóriosrios
PromotoresPromotores
gpdAgpdA ((AspergillusAspergillus nidulansnidulans))
cbh1.1cbh1.1 ((HumicolaHumicola griseagrisea))
cbh1.2cbh1.2 ((HumicolaHumicola griseagrisea))
RegiãoRegião TerminadoraTerminadora dada TranscriTranscriççãoão (TT)(TT)
TTTT dodo genegene trptrpCC ((AspergillusAspergillus nidulansnidulans))
1)1) AdiAdiççãoão dodo PolilinkerPolilinker ee RegiãoRegião TerminadoraTerminadora dada TranscriTranscriççãoão
1)1) AdiAdiççãoão dodo PolilinkerPolilinker ee RegiãoRegião
TerminadoraTerminadora dada TranscriTranscriççãoão (TT)(TT)
FF1-UP
5´-AATTCTGCAGGATCCGATATCGC
FF1-DOWN
5´-GGCCGCGATATCGGATCCTGCAG
EcoRI PstI BamHI EcoRV
NotI
5´-AATTCTGCAGGATCCGATATCGC
GACGTCCTAGGCTATAGCGCCGG-5´
voltar
voltar
1) Marcador 1Kb Plus DNA Ladder (Invitrogen); 2) pPE1/BamHI; 3) pPE1/SmaI; 4) pPE1/XbaI; 5) pPE1
1) Marcador 1Kb Plus
DNA
Ladder
(Invitrogen); 2) pPE1/BamHI; 3)
pPE1/SmaI; 4) pPE1/XbaI; 5) pPE1 intacto
RegiãoRegião TerminadoraTerminadora dada TranscriTranscriççãoão (TT)(TT) Ter-1
RegiãoRegião TerminadoraTerminadora dada TranscriTranscriççãoão (TT)(TT)
Ter-1
5´-TCCGCGGACTTAACGTTACTGAAATCATCAAAC (SacII)
Ter-2
5´-AGAGCTCAGAAAGAAGGATTACCTCTAAAC (SacI)
} Polilinker
} Polilinker
pPE2 foi digerido com SacII e SacI para confirmar a presença da região TT Análise
pPE2 foi digerido com SacII e SacI para confirmar a presença da
região TT
Análise
de
restrição
do
vetor
pPE2.
1)
Marcador
1Kb
Plus
DNA
Ladder
(Invitrogen); 2) pPE2 digerido com SacII e
SacI; 3) pPE2 intacto.
2) Clonagem do promotor gpdA - gpdA de A. nidulans, promotor forte e constitutivo -
2) Clonagem do promotor gpdA
- gpdA de A. nidulans, promotor forte e constitutivo
- usar vetor pAN7-1 como template
Gpd-1
5´-CAAGCTTTGTACAGTGACCGGTGACTC (HindIII)
Gpd-4
5´-CGAATTCGGTGATGTCTGCTCAAGCG (EcoRI)
33
Análise de restrição do vetor pPE3. 1) pPE3 intacto; 2) pPE3/ Eco RI + Hind
Análise de restrição do vetor pPE3. 1) pPE3 intacto; 2) pPE3/ Eco RI + Hind
Análise de restrição do vetor pPE3. 1) pPE3 intacto; 2) pPE3/ Eco RI + Hind

Análise de restrição do vetor pPE3. 1) pPE3 intacto; 2) pPE3/EcoRI + HindIII; 3) Marcador 1Kb Plus DNA Ladder (Invitrogen).

3)3) ClonagemClonagem dodo cassetecassete hphhph
3)3) ClonagemClonagem dodo cassetecassete hphhph
} Polilinker
}
Polilinker
AnAnááliselise dede restrirestriççãoão dodo pPE5pPE5
AnAnááliselise dede restrirestriççãoão dodo pPE5pPE5
4)4) ClonagemClonagem dosdos promotorespromotores cbhcbh1.11.1 ee cbhcbh1.21.2 promotorpromotor dodo genegene cbhcbh
4)4) ClonagemClonagem dosdos promotorespromotores cbhcbh1.11.1 ee
cbhcbh1.21.2
promotorpromotor dodo genegene cbhcbh 1.11.1
CBH1.1CBH1.1--FF (24(24 mermer))
55--CCAAGCTTAAGCTTCGTTACACTCGGCGGACCGTTACACTCGGCGGAC ((HindIIIHindIII))
CBH1.1CBH1.1--RR (29(29 mermer))
55´´--GGGAATTCGAATTCTTTGAAGGAGGGTGACTGATGTTTTGAAGGAGGGTGACTGATGT ((EcoRIEcoRI))
promotorpromotor dodo genegene cbhcbh 1.21.2
CBH1.2CBH1.2--FF (26(26 mermer))
55´´--CCAAGCTTAAGCTTCCGGTAAGCGCATACGGGACCGGTAAGCGCATACGGGA ((HindIIIHindIII))
CBH1.2CBH1.2--RR (28(28 mermer))
55´´--GGGAATTCGAATTCTTGAAAGACTGCTGCTGAGATTTGAAAGACTGCTGCTGAGAT ((EcoRIEcoRI))
1) λ EcoRI/HindIII 2) Promotor chh1.1 3) Promotor cbh1.2
1) λ EcoRI/HindIII
2) Promotor chh1.1
3) Promotor cbh1.2
40
5)5) ClonagemClonagem dosdos genesgenes dede celulasescelulases nosnos vetoresvetores dede expressãoexpressão
5)5) ClonagemClonagem dosdos genesgenes dede celulasescelulases nosnos
vetoresvetores dede expressãoexpressão
Objetivo:Objetivo: ClonarClonar osos genesgenes egl2,egl2, bgl4,bgl4, cbh1.2cbh1.2 nono vetorvetor
pPE5pPE5
GenesGenes aa seremserem clonadosclonados ββ--glicosidaseglicosidase ((bgl4bgl4)) endoglicanaseendoglicanase 22
GenesGenes aa seremserem clonadosclonados
ββ--glicosidaseglicosidase ((bgl4bgl4))
endoglicanaseendoglicanase 22 ((egl2egl2))
celobiohidrolasecelobiohidrolase 1.21.2 ((cbh1.2cbh1.2))
celobiohidrolasecelobiohidrolase 1.11.1 ((cbh1.1cbh1.1))
TodosTodos osos genesgenes sãosão dede HumicolaHumicola griseagrisea ee foramforam
amplificadosamplificados porpor PCRPCR aa partirpartir dosdos cDNAcDNA jjáá
clonadosclonados
EGL2 EGL-F 5´-GGAATTCACCATGAAGCACAGTGTCCTTGC (EcoRI) EGL-R 5´-GGCGGCCGCCTATGGCACGTATTTCTTGAGAAGGGA (NotI) BGL4
EGL2
EGL-F
5´-GGAATTCACCATGAAGCACAGTGTCCTTGC (EcoRI)
EGL-R
5´-GGCGGCCGCCTATGGCACGTATTTCTTGAGAAGGGA (NotI)
BGL4
Bgl4-F
5´-GGAATTCATCATGTCTCTTCCTCCGGA (EcoRI)
Bgl4-R
5´-GGATCCTTACTCCTTGCGAATCAAGCTATC (BamHI)
CBH1.2
1.2cdF2
5´-GGAATTCAAGATGCAGATCCAAGAGC (EcoRI)
1.2cdR2
5´-GGCGGCCGCTTAGACGTTGACGGTCCC (NotI)
ClonagemClonagem dodo genegene dada celobiohidrolasecelobiohidrolase 1.21.2 HumicolaHumicola griseagrisea 1.2cdF2
ClonagemClonagem dodo genegene dada celobiohidrolasecelobiohidrolase 1.21.2
HumicolaHumicola griseagrisea
1.2cdF2
5´-GGAATTCAAGATGCAGATCCAAGAGC (EcoRI)
1.2cdR2
5´-GGCGGCCGCTTAGACGTTGACGGTCCC (NotI)
Amplificado: cDNA; Vent polimerase (alta fidelidade)
1
2
Amplificação do gene cbh1.2.
1)
←←←←
1,4 kb
2)
Marcador λBstEII
PCR com os primers 1.2cdF2/1.2cdR2.
ClonagemClonagem dosdos genesgenes eglegl22 ee bglbgl44 dede HumicolaHumicola griseagrisea Sequência dos
ClonagemClonagem dosdos genesgenes eglegl22 ee bglbgl44 dede
HumicolaHumicola griseagrisea
Sequência dos oligonucleotídeos iniciadores utilizados nas reações de PCR
PRIMERPRIMER
SEQSEQÜÜÊNCIAÊNCIA
TmTm
SSÍÍTIOTIO
EGLEGL--FF
55’’ -- ggaattcaccatgaagcacagtgtccttgcggaattcaccatgaagcacagtgtccttgc
5050°°CC
EcoRIEcoRI
EGLEGL--RR
55’’ -- ggcggccgcctatggcacgtatttcttgagaagggaggcggccgcctatggcacgtatttcttgagaaggga
5050°°CC
NotINotI
Bgl4Bgl4--F1F1
55’’ -- ggaattcgggccgtccatctgggacaggaattcgggccgtccatctgggaca
6262ººCC
EcoRIEcoRI
Bgl4Bgl4--R1R1
55’’ -- agcggccgcttactccttgcgaatcaagctatcagcggccgcttactccttgcgaatcaagctatc
6666ººCC
NotINotI
Bgl4Bgl4--FF
55’’ -- ggaattcatcatgtctcttcctccggaggaattcatcatgtctcttcctccgga
5858°°CC
EcoRIEcoRI
33ββββββββgluglu
55’’ -- ggatccttactccttgcgaatcaagctatcggatccttactccttgcgaatcaagctatc
6868°°CC
BamHIBamHI
cbh1.2 egl2 bgl4 1 2 1 2 1 2 A B C 1,5 kb 1,9
cbh1.2
egl2
bgl4
1
2
1
2
1
2
A
B
C
1,5 kb
1,9 kb
1,5 kb
1,0 kb
1,0 kb
1,3 kb
pP5CBH1.2 pPECBH1.2
pP5CBH1.2
pPECBH1.2
TransformaTransformaççãoão dede FungosFungos FilamentososFilamentosos Objetivo:Objetivo: DesenvolverDesenvolver
TransformaTransformaççãoão dede FungosFungos
FilamentososFilamentosos
Objetivo:Objetivo: DesenvolverDesenvolver protocoloprotocolo dede transformatransformaççãoão dede umauma
linhagemlinhagem hospedeirahospedeira dede fungofungo filamentosofilamentoso parapara aa
expressãoexpressão heterheteróólogaloga dede genesgenes dede celulases.celulases.
FungosFungos selecionadosselecionados AspergillusAspergillus awamoriawamori AspergillusAspergillus nigerniger
FungosFungos selecionadosselecionados
AspergillusAspergillus awamoriawamori
AspergillusAspergillus nigerniger
PenicilliumPenicillium funiculosumfuniculosum
TrichodermaTrichoderma harzianumharzianum 38443844 ee 40384038
PrimeiraPrimeira EtapaEtapa TesteTeste resistênciaresistência aoao antibiantibióóticotico higromicinahigromicina BB
PrimeiraPrimeira EtapaEtapa
TesteTeste resistênciaresistência aoao antibiantibióóticotico higromicinahigromicina BB
A.A. awamoriawamori a b 1 3 2 a) A. awamori, 10 dias de crescimento b
A.A. awamoriawamori
a
b
1
3
2
a) A. awamori, 10 dias de crescimento
b
4
b,c) Teste de resistência a higromicina
1-
0 µµµµg/mL
2-
10 µµµµg/mL
3- 50 µµµµg/mL
6 4- 100 µµµµg/mL
5- 200µµµµg/mL
6- 300 µµµµg/mL
5
AspergillusAspergillus nigerniger a) A. niger, 7 dias de crescimento a b)Teste de resistência a higromicina
AspergillusAspergillus nigerniger
a) A. niger, 7 dias de crescimento
a
b)Teste de resistência a higromicina
1-
0 µµµµg/mL
2-
10 µµµµg/mL
3-
50 µµµµg/mL
4- 100 µµµµg/mL
5- 200 µµµµg/mL
6- 300 µµµµg/mL
b
1
4
5
2
6
3
5
PenicilliumPenicillium funiculosumfuniculosum a b 1 2 3 c 4 d 7 5 6 9 8
PenicilliumPenicillium funiculosumfuniculosum
a
b
1
2
3
c
4 d
7
5
6
9
8
a) Penicillium funiculosum, 10 dias de crescimento
b,c,d) Teste de resistência a higromicina
1)
0 µµµµg/mL,
2) 10 µµµµg/mL,
3) 50 µµµµg/mL,
4) 100 µµµµg/mL
5) 200 µµµµg/mL
6) 300 µµµµg/mL
7) 500 µµµµg/mL
8) 700 µµµµg/mL
9) 1000 µµµµg/mL
TrichodermaTrichoderma harzianumharzianum 40384038 a 1 a) 1- Trichoderma harzianum 4038, 10 dias de crescimento; 3
TrichodermaTrichoderma harzianumharzianum 40384038
a
1
a) 1- Trichoderma harzianum 4038,
10 dias de crescimento;
3
a e b) Teste de resistência a higromicina:
2
1- 0 µµµµg/mL
2- 10 µµµµg/mL
3- 50 µµµµg/mL
4- 100 µµµµg/mL
5- 200 µµµµg/mL
b
6- 300 µµµµg/mL
4
6
5
TrichodermaTrichoderma harzianumharzianum 38443844 a A) 1- Trichoderma harzianum 3844, 2 1 10 dias de crescimento
TrichodermaTrichoderma harzianumharzianum 38443844
a
A) 1- Trichoderma harzianum 3844,
2 1
10 dias de crescimento
A e B) Teste de resistência a higromicina
1-
0 µµµµg/mL
3
2-
10 g/mL
b
3- 50 µµµµg/mL
4- 100 µµµµg/mL
5- 200 µµµµg/mL
6- 300 µµµµg/mL
4
6
5
SegundaSegunda EtapaEtapa TesteTeste dede transformatransformaççãoão porpor biolbiolíísticastica
SegundaSegunda EtapaEtapa
TesteTeste dede transformatransformaççãoão porpor biolbiolíísticastica
BiolBiolíísticastica Equipamento BIOMICS – Particle Acceleration System
BiolBiolíísticastica
Equipamento BIOMICS – Particle Acceleration System
EsporosEsporos dede T.T. harzianumharzianum 3844:3844: 33 diasdias dede crescimentocrescimento 50µg/mL de higromicina
EsporosEsporos dede T.T. harzianumharzianum 3844:3844: 33 diasdias dede crescimentocrescimento
50µg/mL de higromicina
0µg/mL de higromicina
100100µµg/mLg/mL dede higromicinahigromicina
200µg/mL de higromicina
TransformaTransformaççãoão CotransformaCotransformaççãoão comcom genesgenes egl2egl2 ee cbh1.2cbh1.2
TransformaTransformaççãoão
CotransformaCotransformaççãoão comcom genesgenes egl2egl2 ee cbh1.2cbh1.2
ObtenObtenççãoão dede 66 transformantes:transformantes: THBRTHBR--0101 aa --
0606
AnAnááliselise emem meiomeio contendocontendo CMCCMC ee CeluflokCeluflok
THBR-01
THBR-01
THBR-02
THBR-02
THBR-03
THBR-03
THBR-04
THBR-04
THBR-05
THBR-05
THBR-06
THBR-06
66
67
DiscussãoDiscussão ee ConclusõesConclusões T.T. harzianumharzianum podepode serser usadousado comocomo
DiscussãoDiscussão ee ConclusõesConclusões
T.T. harzianumharzianum podepode serser usadousado comocomo plataformaplataforma
parapara produproduççãoão dede celulasescelulases
33 vetoresvetores dede expressãoexpressão foramforam construconstruíídos:dos:
pPE5,pPE5, pPE6pPE6 ee pPE7pPE7
DadosDados preliminarespreliminares sugeremsugerem queque houvehouve
incrementoincremento dede produproduççãoão dede celulasescelulases nono fungofungo
transformadotransformado
DesdobramentosDesdobramentos ClonagemClonagem dede genesgenes dede amilasesamilases ee lipaseslipases nono vetorvetor
DesdobramentosDesdobramentos
ClonagemClonagem dede genesgenes
dede amilasesamilases ee lipaseslipases
nono vetorvetor pPE5pPE5
MelhoramentoMelhoramento gengenééticotico
dede PenicillumPenicillum funiculosumfuniculosum
PatentePatente ““VETORVETOR MODULARMODULAR PARAPARA EXPRESSÃOEXPRESSÃO DEDE ENZIMASENZIMAS EMEM FUNGOSFUNGOS
PatentePatente
““VETORVETOR MODULARMODULAR PARAPARA EXPRESSÃOEXPRESSÃO DEDE ENZIMASENZIMAS
EMEM FUNGOSFUNGOS FILAMENTOSOS,FILAMENTOSOS, FUNGOFUNGO
FILAMENTOSOFILAMENTOSO TRANSFORMADOTRANSFORMADO COMCOM DITODITO VETORVETOR
MODULARMODULAR EE MMÉÉTODOTODO PARAPARA PRODUZIRPRODUZIR UMAUMA
PROTEPROTEÍÍNANA DEDE INTERESSEINTERESSE NONO INTEROIRINTEROIR DODO DITODITO
FUNGOFUNGO FILAMENTOSOFILAMENTOSO””
DepDepóósitosito emem 28/07/200828/07/2008
PIPI 08037820803782--55