GENETIC TESTING AND MOLECULAR BIOMARKERS Volume 13, Number 6, 2009 ª Mary Ann Liebert, Inc. Pp. 729–734 DOI: 10.

1089=gtmb.2009.0045

Single-Nucleotide Polymorphisms in Genes Encoding Toll-Like Receptor -2, -3, -4, and -9 in Case–Control Study with Breast Cancer
1, ˇ ´ 1,3,4,* Jasminka Pavelic,2 ´ Godfrey E. Etokebe, * Jelena Knezevic,2,* Branka Petricevic, ˇ ´ 3 ´ Damir Vrbanec, and Zlatko Dembic1

Background: Genetic susceptibility to cancer is multifactorial, and it is known that impairment of the immune system could contribute to risk for getting cancer. Aim of the Study: Single-nucleotide polymorphisms (SNPs) of Toll-like receptor (TLR) 2, TLR3, TLR4, and TLR9 genes, which are important for innate immunity, were analyzed for the association with breast cancer. Methods: The SNPs comprised TLR2 (c.597T>C), TLR2 (c.1350T>C), TLR3 (c.1377C>T), TLR4 (c.896A>G), and TLR9 (c.1635A>G). The allelic and genotypic frequencies of these TLR SNPs were compared between patients (n ¼ 130) and controls (n ¼ 101) in a case–control study from Croatia. Results: TLR SNPs were not significantly different. From the population genetics viewpoint, we found that a hypomorphic variant of TLR4 (p.Asp299Gly) allele has no specific allelic frequency (8.4%) in the Croatian population (n ¼ 496) compared to other Caucasians (6.5–10%). Conclusion: These results suggest that polymorphisms in tested TLR genes are not likely to be associated with increased risk for developing breast cancer.

Introduction t is well known that persons with mutations in oncogenes and tumor-suppressor genes are at increased risk of developing cancer. In the immunosurveillance hypothesis, the immune system is regarded as a guardian of tissues protecting their integrity from undesired mutant cells (Zitvogel et al., 2006). A dwindling immune system has been shown to increase the risk of getting cancer in animal models and humans with immunodeficiencies or undergoing posttransplantation immunosuppressive therapy (Smyth et al., 2000; Girardi et al., 2001; Street et al., 2002; Smyth et al., 2004). The genetic susceptibility to cancer is multifactorial, with some factors known to function in the cell cycle, apoptosis, or cell differentiation. However, the risk may also comprise additional factors that are related to the activation of the immune system and chronic inflammation, as, recently, gene polymorphisms in Toll-like receptor 4 (TLR4) and the TLR6TLR1-TLR10 gene cluster have been associated with prostate cancer (Zheng et al., 2004; Chen et al., 2005; Sun et al., 2005) and gastric lymphoma (Hellmig et al., 2005). Under selective pressure from infectious microorganisms, multicellular organisms have evolved immunological defense mechanisms,

I

generally categorized as innate or adaptive. Recent insights into the complex mechanisms of human innate immunity suggest that genetic variability in genes encoding its components may play a role in the development of infectious and related diseases including cancer (Lazarus et al., 2002; Chen et al., 2005; Schroder and Schumann, 2005). It is not known to what extent innate immunity can contribute to immunosurveillance. TLRs in mammals represent phylogenetically conserved transmembrane proteins known to bind conserved molecular patterns usually present in distantly related species like bacteria, viruses, and parasites. They are therefore pattern recognition receptors. TLRs can signal to T-cells via dendritic cells (DCs) that such molecular patterns are present within the damaged body tissues. These include peptidoglycan, bacterial lipopolysaccharide, double-stranded RNA, and unmethylated DNA as ligands for TLR2, 4, 3, and 9, respectively. Signals provided by DCs can then initiate the adaptive immune responses against microbial infections. Activation of DCs by TLRs are essential for T-cell activation, up-regulation of costimulatory molecules, inhibition of regulatory T-cell activity, and also for activation and maturation of B-cells (Rakoff-Nahoum and Medzhitov, 2009).

Faculty of Dentistry, Institute for Oral Biology, University of Oslo, Oslo, Norway. Division of Molecular Medicine, Laboratory of Molecular Oncology, Rudjer Boskovic Institute, Zagreb, Croatia. ˇ Departments of 3Medical Oncology and 4Oncology, Clinical Hospital Center ‘‘Zagreb,’’ University of Zagreb, Zagreb, Croatia. *These authors contributed equally to this work.
2

1

729

and TLR9 gene primers and probes for reporter dyes (FAM=VIC) had the following sequences: ETOKEBE ET AL.8 Æ 11. we first chose candidate genes from those that are important for the maintenance of the innate immunity.1 (Æstandard deviation) years. As a part of systematic investigation of susceptibility to cancer within its relationship to the immune system.597T>C) were as follows (50 -30 ): Forward: 50 -CAGATCTACAGAGCTATGAGCCAAAA Reverse: 50 -TCTCCAGCAGTAAAATATGCTGCTT Reporter 1: VIC-TCAGATGACTTACATTCTGA Reporter 2: FAM-CAGATGACTTACGTTCTGA The primers and reporter probes for TLR2 (c. TLR3. as allelic or genotypic frequencies of each TLR SNP in healthy women did not differ much from the whole population (data not shown). for comparisons with patients. and 101 healthy women (Department of Transfusiology.’’ Zagreb. malignant tumor cells. TLR4 (NM_138554) c. Discussion Association of inherited polymorphisms of the innate immune gene TLR4 with the risk of prostate cancer was the first .1635A>G) were as follows (50 -30 ): Forward: TCTACCACGAGCACTCATTCAC Reverse: GGGCTGGCTGTTGTAGCT Reporter 1: VIC-TCCAGTCGTGGTAGCT Reporter 2: FAM-CAGTCGCGGTAGCT Statistical analysis For statistical significance. Switzerland). This too indicated no correlation with breast cancer. TLR2. Materials and Methods Patients and controls Blood samples were collected from 130 breast cancer patients at the Department of Medical Oncology. The primers and probes for TLR2. possibly by having an inherent ability to constantly change genotypic and phenotypic characteristics. CA). TLR3 and TLR9 SNPs were additionally mapped by restriction enzyme digestions.1350T>C) were as follows (50 -30 ): Forward: GAAATATTTGAACTTATCCAGCACACGAA Reverse: GTTGCTAACATCTAAAATTTCCAGTGTCTT Reporter 1: VIC-CAGCCTGTTACACTGTGT Reporter 2: FAM-AGCCTGTTACGCTGTGT The primers and reporter probes for TLR3 (c. and TLR9 (NM_017442) c. and TLR9 genes with the incidence of breast cancer. and 9 were purchased from ABI. The latter result could have been predicted. The ethics committee of the Medical Research Council at the School of Medicine. 4. Diagnosis was made by medical.0 software (Genetics and Biometry Laboratory. The primers and reporter probes for TLR2 (c.. Most patients presented at early stages of breast cancer and the initial treatment was started at the Department. analyses were done with the use of a chi-square test using the computer software program Statcalc (2Â2 or 3Â3 tables) (Acastat software). Geneva. The polymorphisms of TLR2 (NM_003264) c.1635A>G (rs352140) (Noguchi et al. TLR4 (c. Foster City.730 Malignant cancers can express tumor-specific or tumorassociated markers (antigens) that could be used as targets for immune attack during immunosurveillance (Bogen et al.896A>G) primers and 6-carboxyfluorescein (FAM) and VICTK (proprietary)-labeled probes were as previously published (Schmitt et al. Croatia). The DNA analysis DNA was isolated from frozen blood by salting out method. we first selected the most prevalent form of malignancy in women—breast cancer. were selected out of the 496 healthy individuals who were also typed for indicated TLR SNPs. Results TLR SNPs and breast cancer Genotypic frequencies of TLR2–4 and TLR9 SNPs are listed in Table 1. Clinical Hospital Center ‘‘Zagreb. Comparisons between patients and all healthy controls similarly showed no significant differences in allelic and genotypic frequencies of TLR SNPs (data not shown).5 Æ 11. Universities of Zagreb and Rijeka approved the studies. We designed a case–control study with individuals from Croatia and analyzed associations of some single-nucleotide polymorphisms (SNPs) of the TLR2.. However. radiological. 2000). CA) and Applied Biosystems (ABI) 7000 (ABI.. Patients’ ages ranged from 30 to 85 years at the time of taking a sample with a mean of 62. Hardy– Weinberg and linkage disequilibrium analyses were performed using Arlequin versus 2. and biochemical assessment of patients. indicating a lack of association with the disease. The allelic frequencies of TLR2–4 and TLR9 alleles at various SNPs are presented in Table 2. 2006). which turn out to be identical. TLR3. All loci were in Hardy–Weinberg equilibrium.1377C>T (rs3775290). the repeated onset of exactly the same cancer could be prevented. University of Geneva. 2002). TLR3 (NM_003265) c. By having the immune system recognize such tumor antigens.1377C>T) were as follows (50 -30 ): Forward: GCCAGGAATGGAGAGGTCTAGAAA Reverse: TCAGCTGCAGGTACTTGTTGTAG Reporter 1: VIC-AAAGATAGATTTCGAAAATA Reporter 2: FAM-AAAGATAGATTTCAAAAATA The primers and reporter probes for TLR9 (c. San Diego.0 (Æstandard deviation). Allelic frequencies of selected TLR SNPs were not significantly different between breast cancer patients and healthy women controls. 3.. 2004) were done by TaqMan allele-specific polymerase chain reaction assay using two different polymerase chain reaction machines with their own corresponding software: MX4000 and MX3005 (Stratagene. The statistical analyses showed no significant differences in frequencies between breast cancer patients and controls. The DNA samples used as controls (n ¼ 101 women). Likewise.597C>T (rs3804099) and c. Department of Oncology. are able to escape immunity and=or inhibit the specific (adaptive) immune system defenses by establishing peripheral and sometimes also central tolerance to such antigens (de Visser et al. All study participants provided oral and written informed consent. TLR4. Rijeka. Controls were with a mean age of 42.896A>G (rs4986790).1350C>T (rs3804100).

Arg753Gln and p.Arg753Gln heterozygosity seems to impart protection to Lyme disease (Schroder and Schumann.8) (15. Total number (n) of tested controls was 101.3) (92.8 1 0. To get a clearer picture of the associations reported in literature thus far.2) 731 pb 0.6) (43. single-nucleotide polymorphism. 2005).TLR-GENE SNPS AND BREAST CANCER Table 1. The TLR2. because this field is one of the less actively investigated areas of cancer research. The latter was not associated with susceptibility to tuberculosis in Tunisian population. Genotypic Frequencies of Various Toll-Like Receptor Single-Nucleotide Polymorphisms in Patients with Breast Cancer (Mostly Ca.9) (84. it is important to review the current state of disease associations and polymorphisms in TLR family of genes used in this study.Arg753Gln was also associated with coronary restenosis (Hamerman et al.7) Patients n (%)a var 76 13 84 20 110 (42.5) var=var 15 0 8 0 12 (16. respectively (Schroder et al. 2004).2) (69. b 2 degrees of freedom (df)-analysis.8) (92.2) (88. TLR3 (n ¼ 96).1350T>C). Garantziotis et al.5) (34. but distributed differently: TLR2þ597 (n ¼ 89). In Table 2. TLR4 (n ¼ 99). and TLR9 (n ¼ 97). 2005.9) (11. 2004).8) (5.. modulate the course of cancer.3) (32.3) (57. but p. 2005) and increased incidence of tuberculosis in Turkish population (Ogus et al. evidence that a putative weakness in innate immunity could predispose for cancer (Chen et al.7) (7. 2005).Asp299Gly SNP is the best studied SNP thus far. Polymorphisms found in TLRs have the potential to be associated with complex human disease (for a review see Lazarus et al.4) (14.4) wt=wt 29 76 58 110 45 (32. it is possible that various populations have different combinations of genes comprising susceptibility for this type of cancer. it is well known that viruses can predispose for cancer (human papilloma viruses). and especially chronic inflammatory states that can probably predispose to development of cancer.4) (47.9) (0) (8.7) (67.2) var=var 16 0 14 0 25 (18.25 a Wild-type alleles (wt.1) wt=var 48 11 42 15 49 (53.2) (92. However. The TLR4 p.. However. 2000. The TLR2 (c. Mammae Ductale Invasivum and Lobulare) and Controls Controls n (%)a SNP TLR2 TLR2 TLR3 TLR4 TLR9 (597 C=T)b (1350 T=C) (1377 C=T) (896 A=G) (1635 A=G) wt=wt 26 84 46 84 36 (29.7) (42.4) 78 11 58 15 73 var (43. Other TLR2 SNPs were correlated with several diseases.. common allele) and variant forms (var. Association studies using polymorphic genome tags such as microsatellite repeats and SNPs could impart knowledge whether inherent weakness in the innate immune system might influence the risk of getting the disease in the first place.6) (37. and whether this can.2) (7. controls versus patients.8) (30.8) (37. TLR. toll-like receptor.2) (94. 2004). suggesting that the frequency of this variant in Croatian population is in concordance with other Caucasians (6. 2002).4) (62.6) (43.6) (85. TLR2 p. 2004).. they might in the future. so it is reasonable to suggest that some other cancers might be linked to hereditary traits in the immune system. apart from TLR2 (n ¼ 89) and TLR3 (n ¼ 128). 2003). Total number (n) of tested patients was 130.6) 102 165 172 240 150 wt (57.Arg677Trp correlated with the incidence of sepsis in a white population and with the incidence of lepromatous leprosy in an Asian population.9 0. due to inherent complexity of a multigenetic risk.23 a Wild type (wt. rare allele) of listed SNPs.Arg677Trp was (Ben-Ali et al.2) (50. The hypomorphic variants TLR2 p. common alleles) and their variant forms (var). in addition.6 0.. 2008).8) (7.3) (84.8) (15. Schmitt et al. Schroder and Schumann. TLR2þ1350 (n ¼ 95).. and TLR9 SNPs used in the present study were first identified in a healthy Japanese population (Noguchi et al. perhaps.7 0. as the rare 299Gly allele has only 5–10% of the common allele’s signaling activity in transfection experiments in vitro (Arbour et al. Others were not associated with any disease.6) Patients n (%)a wt=var 44 13 56 20 60 (49.5–10%). We found that there were no associations between breast cancer and selected TLR polymorphisms.3) (0) (12. Interestingly. patients). Allelic Frequencies of Various Toll-Like Receptor Single-Nucleotide Polymorphisms in Breast Cancer Patients and Controls Controls n (%)a SNP TLR2 TLR2 TLR3 TLR4 TLR9 (597 T=C)b (1350 T=C) (1377 C=T) (896 A=G) (1635 A=G) 100 179 134 183 121 wt (56.4) (46. 2002. .3) pb 0. which has numerous disease associations.. b 2Â2 tables (w2) statistical analysis (controls vs.4) (45. TLR3.9) (0) (19. Here we showed that frequency of rare TLR4 hypomorphic allele 299Gly is 8.0) (0) (10... The TLR4 (c.8 1 0..1350T>C) rare variant (C) was associated with protection for developing type I diabetes mellitus (Park et al. Total numbers of tested patients and controls were the same as in Table 1.4% (n ¼ 496). TLR2 p. SNP.6 0. Although no known virus has ever been linked to breast cancer.896A>G) (p. We hypothesized that predisposition to develop cancer might be due to faults in innate immunity as a part of a multigenetic risk for cancer..Asp299Gly) mutation directly affects the TLR4 function. except for TLR2 (c.

and 30 -flanking regions of the genes (Noguchi et al. The other TLR SNPs investigated in the present work were found in 50 . 2004. 2005). reduced atherosclerosis (Kiechl et al. 2005).. reduced vascular inflammation and clinical diabetes (Kolek et al.2642C>A. Schutte BC. and methodological problems. However. 2004. This should invite multicenter-based design and analysis of disease association studies. patient selection.2593C>T. 2005).. 2005. Braat et al. and perhaps such population stratification might be one of the causes for the differences. 2004). it is still possible that various populations may have different combinations of immunologically important genes comprising susceptibility for breast cancer. some researchers were not able to confirm some favorable and some disadvantageous effects of TLR4 Asp299Gly polymorphism as pointed out by a recent study (van der Graaf et al. 2004). because TLR4 (p. Int Arch Allergy Immunol 138:251–256. (2005) Epistatic effect of TLR4 and IL4 genes on the risk of asthma in females.. Lorenz E.. However.. Disclosure Statement No competing financial interests exist. allelic and genotypic frequencies of the TLR4 (p. reduced neuropathy in type 2 diabetes (Rudofsky et al. The authors hypothesized that increased risk of chronic infection and chronic inflammation (provided by the variant TLR4 allele at 11381) in prostate might also increase the susceptibility to developing prostate cancer. and longevity (Balistreri et al. 2004). increased risk for myocardial infarction in carriers of TLR4 299Gly variant (Edfeldt et al. increased risk of premature birth (Lorenz et al.. diminished severity of the systemic inflammatory response syndrome (Child et al. atherosclerosis (Netea et al. 2004)..732 contrast. et al.. We thank technical assistance of medical staff at the Clinical Hospital Centre ‘‘Rebro. or antimicrobial effects was found ex vivo in peripheral blood mononuclear cells (Imahara et al. van der Graaf et al. Medical Faculty. The Chinese population has almost nonexistent TLR4 299Gly allele (Hang et al.. 2004). Pessi T..11381G>C) was associated with modest risk of developing prostate cancer. as intronic (119 C=A) SNP was recently correlated with ischemic stroke (Lin et al. 2005). Similar conflicts were reported for the involvement of TLR4 Asp299Gly in inflammatory bowel disease (Torok et al.. So far. and c.. 2004). Further. JAMA 292:2339–2340.. 2004). Education and Sports. lower incidence of myocardial infarction (Balistreri et al. 2004). 2002b). 2000).’’ Zagreb.. Such polymorphisms might be helpful as markers to other more functionally relevant allelic variants within these loci.. that is. immune-related syndromes. 2005).... 2004). Arbour NC. Adjers et al. c. (2000) TLR4 mutations are associated with endotoxin hyporesponsiveness in humans.Asp299Gly) SNP showed almost no differences between patients and controls (Table 1). Oostenbrug et al. Importantly. provided they are in linkage disequilibrium. periodontitis (Folwaczny et al.. 2002). 2005). in Swedish (Zheng et al. 2004). We thank Sanja Balen. inflammatory cytokine production. 2005. and autoimmunity.. severe respiratory syncytial virus disease (Tal et al. brucellosis (Rezazadeh et al.. The TLR9 gene polymorphism was associated with hyperimmunoglobulin M in primary billiary cirrhosis (Kikuchi et al. Hellmig et al. 2004). 2003). susceptibility to inflammatory bowel disease (Franchimont et al. rheumatoid arthritis (Kilding et al.. protection against late-onset Alzheimer disease (Minoretti et al. The TLR3 gene polymorphisms (c. Acknowledgments This work was financially supported by the Croatian Ministry of Science. 2003). Candore G.. However. There might be several reasons why case–control studies can yield false-positive or false-negative. Nat Genet 25:187–191. for help with patients.. susceptibility to periodontitis (Schroder et al. grant number 0980982464-2394. and it is not known whether they influence the transcriptional activity of these genes.. 2005) study groups another TLR4 polymorphism (c. et al. case–control studies have indicated that various TLR SNPs are perhaps detrimentally associated with some infectious diseases... Karjalainen J.. and asthma (Fageras Bottcher et al.Asp299Gly) is associated with hyporesponsiveness to inhaled lipopolysaccharide in humans (Arbour et al. It was reported that 299Gly mutation confers beneficial effects at the population level... 2006).. for collecting control samples. 2005). Recently. Lakatos et al. there were no associations between breast cancer and selected TLR polymorphisms. severe sepsis after burn injury (Barber et al. 2005). and therefore not reproducible results (Kathiresan et al. (2005) found a lower frequency of heterozygotes with the rare 299Gly allele in patients with gastric lymphomas. it has also detrimental effects.. (2004) Role of Toll-like receptor 4 in acute myocardial infarction and longevity. and asthma (Noguchi et al. Colonna-Romano G. in the present study. 2005). University of Rijeka. 2004). as the role of innate and adaptive immunity in predisposition to breast cancer should be addressed in the future.. et al. 2005)... 2004) and Chinese (Chen et al.. Possibly other factors that can affect the expression of antiinflammatory cytokine genes like interleukin-10 and interleukin-4 need to be stratified before we could fully assess the in vivo influence of this mutant.. 2004). References Adjers K.2690A>G) were associated with diabetes mellitus type I in South African Blacks (Pirie et al. it is well known that differences in population history have produced characteristic patterns of SNP allele frequencies when ethnic groups are compared. . However. Holloway et al. 2005. since it correlates with predisposition to developing septic shock with Gram-negative bacteria (Lorenz et al.. 2006). Apart from possible variations in diagnostic procedures. decreased susceptibility of rheumatoid arthritis (Radstake et al. ETOKEBE ET AL. Department of Transfusiology... To conclude.. By contrast. 2005). For instance. no reduction in sensitivity to endotoxin (lipopolysaccharide [LPS]). 2005). 2005) especially its colonic localization (Ouburg et al. 2004). preterm delivery (Hartel et al.. 2004).. 2004. a large study in France revealed neither beneficial nor detrimental influence of TLR4 299Gly SNP on coronary heart disease (myocardial infarction) (Morange et al. Balistreri CR. another TLR4 polymorphism seems to play a role in disease association. while being beneficial in some other conditions and diseases (Schroder and Schumann. some studies even found the opposite. 2004. 2002a).. resistance to Legionnaire’s disease (Hawn et al. Brand et al.

(2005) Association between Toll-like receptor 4 and inflammatory bowel disease. J Med Genet 41:808–813. Frees KL. Arch Intern Med 162:1028–1032. (2004) An association study of asthma and total serum immunoglobin E levels for Toll-like receptor polymorphisms in a Japanese population. (2002a) Association between the Asp299Gly polymorphisms in the Toll-like receptor 4 and premature births in the Finnish population. Finas D. et al. Lorenz E. Vercelli D. (2004) TLR4 Asp299Gly and Thr399Ile polymorphisms are very rare in the Chinese population. Minoretti P. Lian ZX. Folwaczny M. Annu Rev Med 59:343–359. Immunol Rev 190:9–25. Glas J. (2005) A stop codon polymorphism of Toll-like receptor 5 is associated with resistance to systemic lupus erythematosus. Gazzaruso C. et al. Stokkers P. Franchimont D. Bogen B. Eur J Clin Invest 34:94–99. Lakatos L. Yoldas B. et al. Pulletz MC. Pharmacogenet Genomics 15:15–21. 733 Holloway JW. Schwartz DA (2002b) Relevance of mutations in the TLR4 receptor in patients with gram-negative septic shock. Lakatos PL. Eur J Hum Genet 12:1041–1049. Munthe LA. Girardi M. and clinical diabetes. Hellmig S. Eichten A. N Engl J Med 347:185–192. Saut N. Gerszten RE (2004) On the interpretation of genetic association studies. Hang J. Mol Hum Reprod 10:911–915. Fageras Bottcher M. Science 294: 605–609. (2004) TLR4=Asp299Gly. Grossman JM. (2004) Association of hypo-responsive toll-like receptor 4 variants with risk of myocardial infarction. (2005) Consequence of functional Nod2 and Tlr4 mutations on gene transcription in Crohn’s disease patients. Dembic Z (2000) Deletion of idiotype (Id)-specific T cells in multiple myeloma. Nishimura F. de Jong DJ. Ogus AC. Oostenbrug LE. et al. et al. Child NJ. et al. Eur Heart J 25:1378– 1381. Lazarus R. Giovannucci E. Ye S (2005) Variation in the toll-like receptor 4 gene and susceptibility to myocardial infarction. Hommes T. et al. Cancer Res 65:11771–11778. Inflamm Bowel Dis 11:567–575. Kolek MJ. Aragaki CC. (2004) Toll-like receptor (TLR) 2 and 4 mutations in periodontal disease. Jelacic S. et al. Vermeire S. Hallman M. et al. Rivera-Chavez FA. Staudinger T. Ozdemir T. Kiechl S. Ben-Ali M. Eriksson P. Zhou W. Wu H. (2005) Genetic polymorphisms of toll-like receptor 9 influence the immune response to CpG and contribute to hyper-IgM in primary biliary cirrhosis. Lorenz E. Palmer LJ. Genes Immun 6:37–43. Morange PE. Kathiresan S. et al. Curr Opin Immunol 17:29–35. Ogasawara K. J Endotoxin Res 10:238–240. J Allergy Clin Immunol 114:561–567. et al. et al. et al. Yu JM. Fukai H. de Visser KE. (2005) Toll-like receptor 4 and NOD2=CARD15 mutations in Hungarian patients with Crohn’s disease: phenotype-genotype correlations. Eur Respir J 23:219–223. Clin Diagn Lab Immunol 11:625–626. Kimura Y. Schwartz DA (2008) The effect of toll-like receptors and toll-like receptor genetics in human disease. Proc Natl Acad Sci USA 102:10593–10597. et al. Lorenz E. Chang YM. Coussens LM (2006) Paradoxical roles of the immune system during cancer development. (2003) A biologically important single nucleotide polymorphism within the toll-like receptor-4 gene is not associated with rheumatoid arthritis. Imahara SD. (2004) Toll-like receptor 2 Arg677Trp polymorphism is associated with susceptibility to tuberculosis in Tunisian patients. (2004) Toll-like receptor 4 gene Asp299Gly polymorphism is associated with reductions in vascular inflammation. Bousnina S. (2002) Toll-like receptor 4 polymorphisms and atherogenesis. et al. et al. angiographic coronary artery disease. Noguchi E. O’Keefe GE (2005) The TLR4 þ896 polymorphism is not associated with lipopolysaccharide hypo-responsiveness in leukocytes. Hmani-Aifa M. Goebeler-Kolve ME. Zhang H. Nat Rev Cancer 6:24–37. (2004) Deficient host-bacteria interactions in inflammatory bowel disease? The toll-like receptor (TLR)-4 Asp299gly polymorphism is associated with Crohn’s disease and ulcerative colitis. Drenth JP. Steele CR. Netea MG. Clin Exp Rheumatol 21:340–342. et al. Kikuchi K. Torok HP. Yang IA. (2004) A TLR4 polymorphism is associated with asthma and reduced lipopolysaccharide-induced interleukin-12(p70) responses in Swedish children. (2004) Toll-like receptor-4 Asp299Gly polymorphism does not influence progression of atherosclerosis in patients with familial hypercholesterolaemia. Garantziotis S. Eur Heart J 25:1447–1453. plasma levels of the soluble receptor CD14 and the risk of coronary heart disease: the PRIME study. . Neurosci Lett 391:147–149. World J Gastroenterol 11:1489–1495. Carlquist JF. Hawn TR. et al. Tiret L. Inflamm Bowel Dis 11:645–652. Vito CD. J Autoimmun 24:347–352. Biochem Soc Trans 31:652–653. Edfeldt K. (2001) Regulation of cutaneous malignancy by gammadelta T cells. (2004) TLR4 and TNF-alpha polymorphisms are associated with an increased risk for severe sepsis following burn injury. Oppenheim DE. Lin YC. (2005) The role of Tolllike receptor 4 Asp299Gly and Thr399Ile polymorphisms and CARD15=NOD2 mutations in the susceptibility and phenotype of Crohn’s disease. Zaas AK. Lindstrom A.TLR-GENE SNPS AND BREAST CANCER Barber RC. et al. Akil M. Ahrens P. et al. Fischbach W. et al. (2005) Association study of a functional Toll-like receptor 4 polymorphism with susceptibility to gastric mucosa-associated lymphoid tissue lymphoma. van Wissen S. et al. (2005) Sequence variants of Toll-like receptor 4 and susceptibility to prostate cancer. Clin Exp Immunol 135:330–335. Atherosclerosis 180:305–309. Am Heart J 148:1034–1040. CD14=C-260T. et al. (2004) Polymorphisms of genes involved in innate immunity: association with preterm delivery. et al. (2002) Single nucleotide polymorphisms in innate immunity genes: abundant variation and potential role in complex human disease. (2006) Effect of the functional toll-like receptor 4 Asp299Gly polymorphism on susceptibility to late-onset Alzheimer’s disease. Marttila R. Reindl M. Muhlestein JB. Kilding R. Schnitzler F. Gut 53:987– 992. Junker CE. et al. (2003) Polymorphisms in Toll-like receptor 4 and the systemic inflammatory response syndrome. Braat H. Leuk Lymphoma 46:869–872. et al. Pediatr Res 52:373–376. Bennet AM. El Housni H. Newton-Cheh C. Chen YC. Hamerman JA. Till S. Lazarus R. Clin Exp Allergy 34:177–183. Hijmans A. Lanier LL (2005) NK cells in innate immunity. et al. Szalay F. (2004) The Arg753GLn polymorphism of the human toll-like receptor 2 gene in tuberculosis disease. Hollingsworth JW. Brand S. Acta Oncol 39:783–788. (2005) Toll-like receptor 4 gene C119A but not Asp299Gly polymorphism is associated with ischemic stroke among ethnic Chinese in Taiwan. Barbouche MR. et al. Hartel C. et al. Yang IA. Mira JP. Schenck K. J Mol Med 83:601–609.

Immunol Rev 202:275–293. Schroder NW. Zitvogel L. Zheng SL. Hayakawa Y (2004) Cytokines in cancer immunity and immunotherapy. et al. Pegoraro R. Rudofsky G Jr. van der Graaf C. Crusius JB. J Mol Med 81:368–372. (2002) Polymorphisms of TLR4: rapid genotyping and reduced response to lipopolysaccharide of TLR4 mutant alleles. Tesniere A. (2005) Functional consequences of the Asp299Gly Toll-like receptor-4 polymorphism. Trapani JA. Joosten L. (2000) Perforin-mediated cytotoxicity is critical for surveillance of spontaneous lymphoma. et al. Thia KY. Tonenchi L. (2005) Chronic periodontal disease is associated with single-nucleotide polymorphisms of the human TLR-4 gene. Torok HP. (2004) Association of the polymorphism for Toll-like receptor 2 with type 1 diabetes susceptibility. Humeny A. Dalal I.. et al. J Natl Cancer Inst 97:525–532. Rakoff-Nahoum S. Wolff V. J Infect 53:206– 210. Hamann L. MacGregor D. et al. Rafiei A. et al. et al. Address correspondence to: Jelena Knezevic. et al. (2004) Association between common Toll-like receptor 4 mutations and severe respiratory syncytial virus disease. Nat Rev Cancer 9:57–63. Kroemer G (2006) Cancer despite immunosurveillance: immunoselection and immunosubversion. Pirie FJ. Reismann P. et al. et al. Wiklund F. et al. J Infect Dis 189:2057–2063. Genes Immun 6:448– 451. Smyth MJ.Sc. Street SE. Gut 54:439–440. Dr. Meister D. Kullberg BJ. ˇ ´ Division of Molecular Medicine Laboratory of Molecular Oncology ´ Rud er Boskovic Institute ˇ ˇ Bijenicka cesta 54 Zagreb 10 000 Croatia E-mail: jknezev@irb. (2004) Asp299Gly and Thr399Ile genotypes of the TLR4 gene are associated with a reduced prevalence of diabetic neuropathy in patients with type 2 diabetes. Clin Immunol 112:85–91. Street SE. Rezazadeh M. Cytokine 30:264–8 Zheng SL. Hermann C. Sun J. Radstake TR. Lancet Infect Dis 5:156–164. Ann NY Acad Sci 1037:170–174. Cretney E. Diabetes Care 27:179–183.hr . Becker CM. et al. Nat Rev Immunol 6:715–727. Schroder NW. Glas J. Tissue Antigens 66:125–130. et al. Smyth MJ. et al. Augustsson-Balter K. (2004) Polymorphisms of the lipopolysaccharide-signaling complex in inflammatory bowel disease: association of a mutation in the Toll-like receptor 4 gene with ulcerative colitis. Motala AA. (2006) TLR4 polymorphism in Iranian patients with brucellosis. Park S. (2003) High frequency of polymorphism Arg753Gln of the Toll-like receptor-2 gene detected by a novel allele-specific PCR. Franke B. Kershaw MH. Schumann RR (2005) Single nucleotide polymorphisms of Toll-like receptors and susceptibility to infectious disease. (2005) Toll-like receptor 3 gene polymorphisms in South African Blacks with type 1 diabetes. Tal G.734 Ouburg S. Clin Chem 48:1661– 1667. Medzhitov R (2009) Toll-like receptors and cancer. ETOKEBE ET AL. (2004) Sequence variants of toll-like receptor 4 are associated with prostate cancer risk: results from the Cancer Prostate in Sweden Study. Smyth MJ (2002) Suppression of lymphoma and epithelial malignancies effected by interferon gamma. et al. (2004) The Toll-like receptor 4 Asp299Gly functional variant is associated with decreased rheumatoid arthritis disease susceptibility but does not influence disease severity and=or outcome. Chang B. (2005) The toll-like receptor 4 (TLR4) Asp299Gly polymorphism is associated with colonic localisation of Crohn’s disease without a major role for the Saccharomyces cerevisiae mannan-LBP-CD14-TLR4 pathway. (2005) Sequence variants in Toll-like receptor gene cluster (TLR6-TLR1-TLR10) and prostate cancer risk. Cancer Res 64:2918–2922. Hanssen S. Witte S. J Exp Med 192:755–760. J Exp Med 196:129–134. Hajilooi M. Schroder NW. Yoo E. Park Y. Mallant-Hent R. Schmitt C. et al. Arthritis Rheum 50:999–1001. Mandelberg A.

Sign up to vote on this title
UsefulNot useful