Purple | Methicillin Resistant Staphylococcus Aureus | Staphylococcus Aureus

ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Apr. 2002, p. 1147–1152 0066-4804/02/$04.00 0 DOI: 10.1128/AAC.46.4.1147–1152.

2002 Copyright © 2002, American Society for Microbiology. All Rights Reserved.

Vol. 46, No. 4

Novel Type of Staphylococcal Cassette Chromosome mec Identified in Community-Acquired Methicillin-Resistant Staphylococcus aureus Strains
Xiao Xue Ma,1 Teruyo Ito,1 Chuntima Tiensasitorn,1 Mantana Jamklang,1 Piriyaporn Chongtrakool,1 Susan Boyle-Vavra,2 Robert S. Daum,2 and Keiichi Hiramatsu1*
Department of Bacteriology, Juntendo University, Tokyo, Japan,1 and Department of Pediatrics, University of Chicago Children’s Hospital, Chicago, Illinois2
Received 25 July 2001/Returned for modification 10 October 2001/Accepted 28 November 2001

We identified a new type of staphylococcal cassette chromosome mec (SCCmec) from two communityacquired methicillin-resistant Staphylococcus aureus (MRSA) strains. The novel element, designated type IV SCCmec, had a unique combination of the class B mec gene complex and the type 2 ccr gene complex and was much smaller in size (21 to 24 kb) than previously identified SCCmec elements of hospital-acquired MRSA. Consistent with the strains’ susceptibilities to various non- -lactam antibiotics, the type IV SCCmec was devoid of any antibiotic resistance genes other than the mecA gene. Since the first discovery of methicillin-resistant Staphylococcus aureus (MRSA) in 1961 in England, MRSA has become one of the most prevalent pathogens that cause nosocomial infections (13). MRSA produces a specific penicillin-binding protein (PBP) called PBP 2 (or PBP 2a) that possesses reduced affinities for binding to -lactam antibiotics (2, 7, 22). PBP 2 is encoded by the mecA gene, which is carried by a large mobile genetic element that is designated staphylococcal cassette chromosome mec (SCCmec) and that is integrated on the chromosomes of MRSA strains isolated from hospitals in various countries throughout the world (11, 12, 14, 15). Recently, MRSA infections have increasingly been reported among groups of patients with no apparent connection to hospitals (4). Those strains, designated community-acquired MRSA (C-MRSA) strains, have been reported in various countries such as Australia (16, 18), New Zealand (19), the United Kingdom (20), Canada (5), and the United States (6, 8). The death of four children caused by C-MRSA strains has alerted us to the threat of latent dissemination of highly virulent C-MRSA strains in the community in the United States (3). In contrast to hospital-acquired MRSA (H-MRSA), C-MRSA is characteristically susceptible to many antibiotics (3, 21), but it remains unclear whether C-MRSA is a descendant of HMRSA or was born and evolved independently of the hospital environment (4). In order to understand the evolutionary relationship between C-MRSA and H-MRSA, we determined the entire nucleotide sequences of the SCCmec elements integrated into the chromosomes of two C-MRSA clinical strains. Strain CA05 (JCSC1968) was isolated from the joint fluid of a patient with septic arthritis and osteomyelitis, and strain 8/6-3P (JCSC1978) was isolated from the perineum of another patient (10).
* Corresponding author. Mailing address: Department of Bacteriology, Juntendo University, 2-1-1 Hongo, Bunkyo-ku, Tokyo, Japan 1138421. Phone: 81-3-5802-1040. Fax: 81-3-5684-7830. E-mail: hiram @med.juntendo.ac.jp. 1147

We amplified DNAs encompassing the entire SCCmec sequence by long-range PCR with several sets of primers, as follows. The region from the left extremity to the ccr genes (L-C region) was covered by primer sets 5 and cLs1 (CA05) or CL2b (8/6-3P) (Fig. 1). Primers 6 and mcR8 were used to cover the middle part (from the region just upstream of ccrA to mecR1; the C-M region). Two overlapping primer sets (primers is4 and mA2 and primers mA3 and cR1) were used to cover the right extremities (from IS431mec to orfX; the I-R region) (Fig. 1) (11, 12, 14). The rest of the element was amplified and sequenced with primers as described previously (11, 12, 14). The PCR products were purified with a High Pure PCR product purification kit (Roche Diagnostics GmbH, Mannheim, Germany), and their nucleotide sequences were determined as described previously (9). Figure 1 illustrates the genomic organizations of the SCCmec elements identified from the two C-MRSA strains in comparison with the three extant types of SCCmec. The SCCmec elements of strains CA05 and 8/6-3P were 24,248 and 20,920 bp, respectively, and were much smaller (34 to 67 kb) than three types of SCCmec elements identified from H-MRSA strains (12). Both elements were found to be integrated at the integration site for SCCmec, attBscc, which is found inside orfX, which has an unknown function and is located near the origin of replication of the S. aureus chromosome (12, 15). The SCCmec elements shared a pair of 15-bp direct repeat sequences: one (DRscc-R) at the right extremities and the other (DRsccL) on the chromosome region abutting the left termini of the elements (shown as thick arrows in Fig. 2). Degenerate inverted repeats were also found in the extremities of the two SCCmec elements (shown by thin arrows in Fig. 2). The authenticity of the SCCmec boundaries was vindicated by using a previously described method (14); i.e., by confirming that the element was precisely cut out from the chromosomes of the two C-MRSA strains, regenerating attBscc in the chromosomes of the cell populations from which it was excised. The nucleotide sequences of the L-C regions of the two SCCmec elements differed from each other, but otherwise,

1148 NOTES NOTES .

Structure of the SCCmec elements identified from C-MRSA strains in comparison with the three types of SCCmec elements. mA2. green. and CL2b (ATAT TCCCGATAGAAAAACAGGACTTGAACTTGCA) and previously described primers is4. and cR1 (11. (E) Type III SCCmec carried by 85/2082. ORFs or the parts of ORFs that are unique to type III SCCmec. 14). light green. (C) Type IV SCCmec carried by strain 8/6-3P (subtype b). X. ORFs or the parts of ORFs that are conserved in all four types of SCCmec elements with greater than 99% amino acid identities. The nucleotide sequences around the left and right boundaries of the SCCmec elements of CA05 and 8/6-3P are aligned with those of type II SCCmec. XbaI. and orange. Color codes are as follows: white. 1. ORFs or the parts of ORFs that are common to type II and type III SCCmec elements. NOTES 1149 . ORFs or the parts of ORFs that are unique to type IVa SCCmec. 12. (B) Type IV SCCmec carried by strain CA05 (subtype a). gray. mA3. cLs1 (5 -TGCCAATCACAGTTCAATCAATT-3 ). 6 (5 -ATTAGCCGATTTGGTAATTGAA-3 ). mCR8 (5 -ATATTCCCGTATGAAAAACAGGACTTGAACTTGCA-3 ). 2. FIG. blue. red. P. ORFs or the parts of ORFs that are unique to type II SCCmec. The locations of primers used for amplification of the type IV SCCmec are indicated by arrows: they are primers 5 (5 -TGTTAAGTATATTGCACTTTATGATTCAATGCCT-3 ). ORFs or the parts of ORFs that are common to type I and type II SCCmec elements. Thin arrows indicate inverted repeats IR-L and IR-R at both extremities of SCCmec elements. HindIII. The ORFs of greater than 200 nucleotides in six possible reading frames of type IV SCCmec elements are illustrated in the squares under the bars that represent essential genes and restriction sites for HindIII and XbaI. Differences in coloration correspond to differences in the nucleotide sequences. EcoRI. The entire nucleotide sequences of the type IV SCCmec elements are available in the DDBJ/EMBL/GenBank databases under accession no. E. ORFs or the parts of ORFs that are unique to type I SCCmec. Chromosome-SCCmec junction sequences of type IV SCCmec. (D) Type II SCCmec carried by N315. yellow.VOL. (A) Type I SCCmec carried by NCTC 10442. Thick arrows indicate direct repeats DRscc-L and DRscc-R. ORFs or the parts of ORFs that are conserved in four types of SCCmec with amino acid identities of 46 to 98%. Pst1. 46. AB063172 (subtype a) and AB063173 (subtype b). magenta. 2002 FIG. ORFs or the parts of ORFs that are unique to type IVb SCCmec. H.

431 1. the class B mec gene complexes (IS1272.629 (ccrB2.659 987 ( mecR1) 2. However. the ccr gene complexes of the novel SCCmec elements were more similar to the type 2 gene complex than to the type 1 ccr gene complex: the amino acid identities between the novel CcrA proteins and the type 2 CcrA (CcrA2) and type 1 CcrA (CcrA1) proteins were about 98 and 75%.350 (ccrA2. The nucleotide position in the nucleotide sequences deposited under DDBJ/EMBL/GenBank accession no. and those between the novel CcrB proteins and the CcrB2 and CcrB1 proteins were 97 to 99 and 72 to 81%. That is.491 1. or a frameshift mutation. the class B mec gene complex has been found to be in close linkage with the type 1 ccr gene complex in type I SCCmec (12). we . the predicted proteins encoded by the open reading frames (ORFs) surrounding the ccrA and ccrB genes also had significantly higher degrees of similarity to those of the type 2 gene complex than to those of the type 1 ccr gene complex. On the basis of this unique combination of the two complexes.1) 351 312 510 1.791 1.mecR1-mecA-IS431).007 (mecA) 429 744 (ugpQ) 675 tnp 240 1. ORFs in SCCmec’s of CA05 and 8/6-3P ANTIMICROB.122 771 1. As shown in Table 1. Accordingly.1 and ccrA2. respectively. 1).2 genes and the ccrB2. respectively (Table 1).032 375 480 Hypothetical protein Hypothetical protein Hypothetical protein Conserved hypothetical protein Conserved hypothetical protein Conserved hypothetical protein Cassette chromosome recombinase A Cassette chromosome recombinase B Conserved hypothetical protein Conserved hypothetical protein Conserved hypothetical protein Putative transposase of IS 1272 Truncated signal transducer protein MecR1 PBP 2 Conserved hypothetical protein Glycerophosphoryldiester phosphodiesterase Transposase for insertion sequence-like element IS431mec Conserved hypothetical protein Truncated conserved hypothetical protein Truncated conserved hypothetical protein OrfX Complement Complement 2311–3741 3861–5651 5885–7234 7256–8884 9406–9756 9843–10154 10166–10675 10676–12334 Complement 13643–15649 Complement Complement 18265–18939 Complement Complement Complement Complement (325–1446) (1424–2194) (12557–13543) (15695–16123) (16220–16963) (18971–19210) (19625–20656) (20506–20880) (21204–21683) 1.1 and ccrB2.2) 351 312 510 1. d Incomplete ORFs that are potentially defective genes or pseudogenes containing either a deletion. we classified the genes as variants of ccrA2 and ccrB2 by designating them the ccrA2.350 (ccrA2.050 291 1. they shared the same features: type 2 ccr gene complexes.629 (ccrB2.2 genes. a nonsense mutation.1150 NOTES TABLE 1. This combination of ccr and mec gene complexes was a novel one.032 375 480 Hypothetical protein Hypothetical protein Hypothetical protein Conserved hypothetical protein Cassette chromosome recombinase A Cassette chromosome recombinase B Conserved hypothetical protein Conserved hypothetical protein Conserved hypothetical protein Putative transposase of IS1272 Truncated signal transducer protein MecR1 PBP 2 Conserved hypothetical protein Glycerophosphoryldiester phosphodiesterase Transposase for insertion sequence-like element IS431mec Conserved hypothetical protein Truncated conserved hypothetical protein Truncated conserved hypothetical protein OrfX ORFs shown in parentheses were located outside of SCC mec.9% identical to that of type II SCCmec elements (Fig. and the I-R region that was 99.659 987 ( mecR1) 2.007 (mecA) 429 744 (ugpQ) 675 tnp 240 1. c Identity to amino acid sequences of each ORF.2) 1.788 1. respectively (Table 1). AGENTS CHEMOTHER.1) 1. Strain (element) and ORFa Location (position)b Size (bp) of gene Description of gene product CA05 (JCSC1968) (type IV SCCmec subtype a) CQ001 Q001 CQ002 CQ003 Q002 Q003 Q005 Q006 Q007 Q008 Q009 Q010 CQ004 Q011 CQ005 CQ007 Q012 CQ008 CQ009 CQ010 (CQ011) 8/6-3P (JCSC1978) (type IV SCCmec subtype b) CM001 CM002 M001 M002 M004 M005 M006 M007 M008 M009 CM003 M010 CM004 CM006 M011 CM007 CM008 CM009 CM010 a b Complement 2653–3657 Complement Complement 7577–7867 7867–9654 9888–11237 11259–12887 13409–13759 13846–14157 14169–14678 14679–16337 Complement 17646–19652 Complement Complement 22268–22942 Complement Complement Complement Complement (1280–1900) (4281–5771) (6389–7438) (16560–17546) (19698–20126) (20223–20966) (22974–23213) (23628–24659) (24509–24883) (25205–25684) 621 1. AB063172 (type IV subtype a) and AB063173 (type IV subtype b).005 1.

many of them are mutated or .1 73.296) orfX (480) 72.7 100 100 100.350) ccrB3 (1. The lack of function of type IV SCCmec other than those for the movement of the element (ccr genes) and methicillin resistance (mecA). its susceptibility to various antibiotics except -lactams (3.4 100 E024 (1329) E025 (297) E026 (1. 99.007) CN038 (429) CN039 (744) N062 and N070 (675) CN050 (1. 17).758) mecAN315 (2. Z041.3 75.2 92.629) N041 (351) N042 (312) N043 (318) mecR1N315 (1. aureus in the community than any other type of SCCmec.3 4. 99.1.6 100 100 99.2 92. together with its small size.3 75 72.3 72. 99.6 85.6. A number of ORFs carried by type I and type II SCCmec elements in their long L-C regions are considered unnecessary for the benefit of the host cells that carry the elements (11.1.068) Z003 (288) Z004 (1.1 Z025d (861) CZ002 (1.4 77.4 46.629) Z011 (351) Z013 (396) Z014 (522) mecR185/2082 (114) mecA85/2082 (2007) CZ029 (429) CZ030 (744) Z035.569) ccrA3 (1. The BLAST and MOTIF programs failed to assign any biological functions to the hypothetical ORFs in the L-C regions of type IV SCCmec elements (1. Z046.4 100 E026 (1. Z046.3 100 100 100 100 98.770) ccrA1 (1.296) orfX (480) 80. neither a virulence factor nor antibiotic resistance other than that encoded by mecA was found to be encoded by the entire regions of the novel SCCmec elements.9 99. 99.296) CN050 (1. Actually.2 77.2 61.4 87.794) ccrA2 (1.007) CN038 (429) CN039 (744) N062 and N070 (675) CN050 (1.3 100 100 100 100 100 100 100 100 100 100 100 100 100 M002 M004 M005 M006 M007 M008 M009 (1791) (1350) (1629) (351) (312) (510) (1659) CM004 (429) 100 orfX (480) CM007 CM008 CM009 CM010 (240) (1032) (375) (480) 70.152) E031 (351) E032 (327) E033 (510) E034 (1.1 Z004 (1.9 99. as shown in Table 2.5 51. In fact. respectively.3 100 100 100 100 100 100 98. for the following reasons.629) N041 (351) N042 (312) N043 (318) mecR1N315 (1.3 100 99. on the basis of their unique nucleotide sequences in the L-C region (Fig.7 66.296) orfX (480) 72.4 88.296) CN050 (1.350) ccrB3 (1.6 100 100 99.4 97.VOL.3 47.8 45. 46..8 89.152) E031 (351) E032 (327) E033 (510) E034 (1.3 100 100 100 100 98.e. 12). With their simple genetic organizations.2 99.8 89.3 97.296) orfX (480) 72.5 87. Z041.4 97.2 98.770) ccrA1 (1. 99.350) ccrB2 (1.1 5.4 85.7 100 100 100 100 100 100 98.3 100 99.007) CE025 (429) CE026 (744) E040 (675) CE029 (240) CE030 (1.629) Z011 (351) Z013 (396) Z014 (522) mecR185/2082 (114) mecA85/2082 (2. Furthermore.007) CZ029 (429) CZ030 (744) Z035.-lactam antibiotics in the type IV SCCmec was consistent with the notable characteristic of C-MRSA. 99.2 88.659) mecR1NCTC10442 (987) mecANCTC10442 (2.4 98. may lead to the view that the element has gone through evolutionary refinement as a specific carrier of DNA for methicillin resistance.-lactam antibiotics tested.659) mecR1NCTC10442 (987) mecANCTC10442 (2.2 61.7 100 100 100. 1).4 100 N053d (861) N030 (297) N031 (1. This lack of genes encoding resistance to non. i.4 100 N031 (1. the two strains were susceptible to all the non.350) ccrB1 (1. and Z058 (675) 82. 6).2 80.6 97. 2002 TABLE 1—Continued Homology to ORFs of type I SCCmec % Identity c Corresponding ORF(s) (size [bp]) Homology to ORFs of type II SCCmec % Identity c Corresponding ORF(s) (size [bp]) Homology to ORFs of type III SCCmec % Identity c Corresponding ORF(s) (size [bp]) NOTES 1151 Homology to ORFs of type IV SCCmec subtype b % Identity c Corresponding ORF(s) (size [bp]) 96.758) mecAN315 (2.350) ccrB2 (1.007) CE025 (429) CE026 (744) E040 (675) CE029 (240) CE030 (1.3 85.296) CE030 (1.3 85.569) ccrA3 (1.7 96.296) CE030 (1.350) ccrB1 (1. and Z058 (675) 100 orfX (480) named the novel SCCmec elements type IV SCCmec and assigned the designations subtypes IVa and IVb to the individual elements of CA05 and 8/6-3P. the lack of superfluous functions may make the element more fit as a mobile genetic element for S.4 46 85.6.794) ccrA2 (1.

Anaya. M. Miller. H. P. Yokota. and A. Taylor. R. aureus without greatly compromising their competitiveness among the natural flora of humans. 298:133–136. Lian. Moreover. Takahashi. Tomasz. Bethel. J. J. F. D. Y. Tiensasitorn. 14. Yoshino. Y. but their large sizes and potentially hazardous arrays of exogenous genes may not be suited to MRSA strains in the community. 215:403–410. Agents Chemother. Gross-Schulman. K. coordinated by the University of Tokyo Graduate School of Medicine and Mahidol University. Hiramatsu. D. Aoki. Hosp. 19:1163–1166. C. Okonogi. 38:273–281.125 128 0. Microbiol. P. Stacey. PSORT: a program for detecting sorting signals in proteins and predicting their subcellular localization. 1991. Hattori. K. Mascola.. N. 23. Ito. J. P. Rings Terry. Endersby. Methicillin-resistant Staphylococcus aureus in tertiary care institutions on the Canadian prairies 1990–1992.and cephem-resistant Staphylococcus aureus. Infect. Low-affinity penicillin-binding protein associated with beta-lactam resistance in Staphylococcus aureus. Hiramatsu. Alfa.125 512 8 0. 5. and P. Yamashita. 7:178–182. Horton. Infect. 8. and R.. Rep. . AB063172 and AB063173. 7.125 512 512 0. Asada.and fibronectin-binding properties of the host cell (23). J. Francois. Hirakawa.. Molecular cloning and nucleotide sequence determination of the regulator region of mecA gene in methicillin-resistant Staphylococcus aureus (MRSA). K. Introduction of the mec element (methicillin resistance) into Staphylococcus aureus alters in vitro functional activities of fibrinogen and fibronectin adhesins.. Tomance. 38: 3926–3931. E. P. M. 48:707–710. Y. 1985. K.125 0.125 0. C. G. H. 6. 28:397–403. D. Lauderdale. where various antibiotics as well as antiseptics provide selective pressure. Ramotar. G. 32:153–154. Although the type III SCCmec has a short L-C region comparable in size to those of type IV SCCmec elements. 158:513–516. Nimmo. A. and K. Vaudaux. Herold. Centers for Disease Control and Prevention.5 0. 24:34–36. 2001. A methicillin-susceptible S. Med. Hosoyama. F. respectively. Infect. S. K. Four pediatric deaths from community-acquired methicillin-resistant Staphylococcus aureus—Minnesota and North Dakota. 19. C. Y. Chan. T. Daum. Tsutsumimoto. 15. J. Myers. T. Cloning and nucleotide sequence determination of the entire mec DNA of pre-methicillin-resistant Staphylococcus aureus N315. Kanamori. 1990. Z. W. Ito. G. J. Dassey. T. FEBS Lett. Ito. S. 2001. Structural comparison of three types of staphylococcal cassette chromosome mec integrated in the chromosome in methicillin-resistant Staphylococcus aureus. Current trends in community-acquired methicillin-resistant Staphylococcus aureus at a tertiary care pediatric facility. S. K. G. Conly. H. staphylococcus cassette chromosome mec. Infect. 42:564–570. Antimicrob. J. Lancet 357:1225–1240.5 0. S. M. Ogasawara. the type IV SCCmec may be one of the fit SCCmec types that can confer -lactam resistance to community strains of S. T. partially deleted and do not seem to be active. R. 1998. Australia. Nakai. J. C. Inoue. From this viewpoint. Agents Chemother. aureus type strain. 4. J. T. 2. Shiba. A. Hiramatsu. and R.25 2 1 1 512 512 1 0. Lipman. Infect. J. J. Cronk. Ohta. Nucleotide sequence accession numbers.. Nagai. N. D. the size of the element is extremely large (68 kb) because of the accumulation of multiple genes for resistance to various antibiotics and heavy metals (12). Hussain. REFERENCES 1. 43:1449–1458. K. and P. J. Furuya. 1999. S. Antimicrob. Boyle-Vavra. M. Maranan. Katayama. A. The subtype a and b type IV SCCmec elements have been deposited in the DDBJ/ EMBL/GenBank databases under accession no. and D. Mori. H. Pediatr. 45: 1323–1336. 1997–1999. 20. Y. TABLE 2. Kuroda. W. Uchiyama.25 0. 1998. D. Methicillin-resistant and borderline methicillin-resistant asymptomatic Staphylococcus aureus colonization in children without identifiable risk factors. I Kobayashi. E. Vickery. and R. and K.125 0. 1999. Antimicrob. Clin.. T. and K. 2001. C. AGENTS CHEMOTHER. where selective advantage would make strains more inclined to have a higher growth rate and to be better able to colonize humans than to have a multidrug resistance phenotype. A.. JAMA 280:421–422. 122:275–278. J. A. Foster. Ethnicity and methicillin-resistant S. The changing epidemiology of Staphylococcus aureus. an ORF for type I SCCmec encoding plasmin-sensitive surface protein may even be hazardous to the host cell because it interferes with the fibrinogen.25 32 16 256 32 32 0. Boyle-Vavra. Dis. Agents Chemother. The study was also partly supported by a grant for International Health Cooperation Research (grant 11C-4) from the Ministry of Health and Welfare of Japan. Epidemiol. 16. 1998. The determinants for resistance to multiple antibiotics carried by the previously studied types of SCCmec elements (type II and type III elements) may be suited for the survival of H-MRSA in the hospital environment. 9. JAMA 279:593–598. Goto. Altschul. Kuhara. Leitch. 12. 44:1549– 1555. 18:410–414. Bacteriol. Antimicrob. and T. B. J.. N. 18.. C. 11. Boyle-Vavra. Br. E. M. Maruyama. F. R. T. Matsumaru. 2000. Ito. F. Dis. J. S. B. Yokota.1152 NOTES ANTIMICROB. N. I. Hartman. K. Whole genome sequencing of methicillin-resistant Staphylococcus aureus. E. P. 17. P. K. Marples. Murakami. Morb.125 0. and B.. M. Trends Biochem. Control. Henderson. Dwyer. D. Currie. 22. K. Lang. A. L. L.. Brown.125 The MICs were determined by the agar plate dilution method of the NCCLS. “Celbenin”-resistant staphylococci. Louie. Y. Community acquisition of gentamicin-sensitive methicillin-resistant Staphylococcus aureus in southeast Queensland. L. R. Schooneveldt. and S. and A. O’Kane. aureus in South Auckland. Lew. 1984. Arthur. H. Mizutani-Ui. 1994. A. R. Kaito. Utsui. A new class of genetic element. Yuzawa.. T. and B. Suggs.03 0. S.. T. Communityacquired methicillin-resistant Staphylococcus aureus in children with no identified predisposing risk. Embil. Future analyses of many communityacquired strains will be required to test if this hypothesis holds true... Hiramatsu. Br. and T. Hiramatsu. and K. Antimicrob. H. Immergluck. 1998. Cui. Hosp. V. Berger-Bachi. Antibiotic susceptibility profiles of the two C-MRSA strains in comparison with those of H-MRSA strains Strain Type of SCCmec MIC (mg/liter)a Oxacillin Ampicillin Ceftizoxime Imipenem Erythromycin Tobramycin Kanamycin Tetracycline CA05 8/6-3P NCTC 10442 N315 85/2082 ATCC 29213b a b IV IV I II III 8 8 256 16 32 0. encodes methicillin resistance in Staphylococcus aureus. Mol. Sports Med. S. Chambers. 1998. Biol. Agents Chemother. M.5 128 128 512 16 512 4 0. S. 3. 10. Maranan. Jevons.125 128 0. M. C. 24:151. J.125 0. Asada. Katayama. 15:646–651. Pediatr. Dis. and R. Gish. E. L. 1999. C. B. McCall. Role of an altered penicillin-binding protein in methicillin.. K.. T. P. Sci. Baba. K. Wkly.. R. K. E. An outbreak of methicillin-resistant Staphylococcus aureus infection in a rugby football team. 1961. 1980.. Oshima. Monzillo. C. Clinical experience and outcomes of community-acquired and nosocomial methicillin-resistant Staphylococcus aureus in a northern Australian hospital. W. et al. Reynolds. J.. B. Agents Chemother. 2000. J. Katayama. S. D. Sawano. Intrinsic resistance to beta-lactam antibiotics in Staphylococcus aureus. E. F. J. Boustead. Mortal. Community-acquired methicillin-resistant Staphylococcus aureus. 21. Sekimizu. 1998. Gaskin. Oguchi. This work was supported by the Core University System Exchange Program under the Japan Society for the Promotion of Science. Kanehisa. A. S. Emerg. Sutherland. M. Daum. FEBS Lett. Daum. H. C. Hayashi. 124:124– 125. Basic local alignment search tool. 2000. B. Med. 13. Yabuzaki. and C. 1999. Maguire.125 16 1 0. Suzuki.

Sign up to vote on this title
UsefulNot useful