TEHNOLOGIA ADN RECOMBINANT

CAPITOLUL II

TEHNOLOGIA ADN RECOMBINANT

Tehnologia ADN recombinant se referă la metodologia obţinerii moleculelor de ADN recombinant, adică de realizare "in vitro" a unor molecule de ADN noi prin îmbinarea de fragmente provenite fie din genomul unor specii biologice diferite, fie de la aceeaşi specie. Imbinarea respectivelor fragmente se realizează într-o ordine diferită de cea naturală, astfel încât elementele genetice utilizate capătă o structură aparte, conferind organismului în care sunt introduse proprietăţi noi pe care nu le-ar dobândi pe cale naturală. Aşa cum s-a prezentat anterior (fig.1), pentru a obţine moleculele de ADN recombinant este necesar să se parcurgă mai multe etape care pot fi sintetizate astfel: 1. izolarea genelor naturale sau sinteza chimică a unor molecule de ADN ce codifică proteinele dorite; 2. selecţia unui vehicul sau vector adecvat care să transporte genele respective şi apt să se replice autonom în celula receptoare; 3. inserţia genelor străine în structura genetică a moleculei vector şi obţinerea unei himere moleculare; 4. introducerea acesteia într-o gazdă specifică şi transformarea ei; 5. asigurarea condiţiilor care permit exprimarea informaţiei străine în celula acceptoare; 6. selectarea celulelor modificate genetic din populaţia celulară rezultată prin multiplicare; 7. evidenţierea produsului genei în celulele modificate sau în mediul de cultură al acestora şi purificarea lui pentru a fi folosit în scopurile pentru care s-au realizat tehnicile respective.

35

TEHNOLOGIA ADN RECOMBINANT

2.1. Etapele de lucru pentru obţinerea şi selecţia moleculelor recombinate de ADN Scopul experimentelor de inginerie genetică este acela al obţinerii moleculelor de ADN prelucrate “in vitro” astfel încât ele să conţină genele de interes şi să poată fi transferate în gazde corespunzătoare. Etapele de lucru ce au ca rezultat obţinerea acestor molecule presupun elaborarea unor metode de izolare şi purificare a acizilor nucleici, a utilizării unor enzime specifice şi selectarea unor vectori de clonare adecvaţi. 2.1.1. Izolarea şi purificarea acizilor nucleici Realizarea experimentelor de clonare a genelor presupune ca etapă de bază purificarea unor diferite tipuri de molecule de acizi nucleici: ADN celular total (din celule vegetale, animale, bacteriene sau din levuri), ADN plasmidial, ADN viral sau ARN. In funcţie de tipul de molecule de acizi nucleici şi de organismul de origine au fost elaborate numeroase metode de izolare şi purificare. Indiferent de metoda utilizată este necesară parcurgerea mai multor etape: obţinerea (cultivarea) materialului biologic; liza celulelor pentru eliberarea acizilor nucleici; îndepărtarea componentelor celulare nedorite (resturi celulare, proteine etc); purificarea acizilor nucleici de interes; concentrarea acizilor nucleici obţinuţi anterior. 2.1.1.1. Izolarea ADN total Pentru izolarea ADN total se utilizează fie fragmente de ţesuturi (vegetale sau animale), culturi celulare sau suspensii celulare. Indiferent de tipul de celule utilizate în experimente este necesară liza acestora, proces realizat prin metode variate (liza chimică în prezenţa unor soluţii alcaline şi/sau a unor detergenţi; liza enzimatică cu ajutorul unor enzime specifice; liza produsă prin procedee fizice: ultrasonicare, îngheţarea celulelor în azot lichid, metode mecanice etc). Protejarea de acţiunea nucleazelor endogene a ADN liberat prin spargerea celulelor se realizează, de regulă, prin folosirea unor soluţii tampon ce conţin EDTA (reactiv ce leagă ionii de magneziu făcându-i inaccesibili DN-azelor, ai căror cofactori sunt). De asemenea, după îndepărtarea prin centrifugare a resturilor celulare, soluţia apoasă obţinută este supusă unor tratamente suplimentare ce au drept scop degradarea ARN (prin adăugarea RN-azei) sau a proteinelor contaminante (prin folosirea unor proteaze sau prin extracţie cu fenol). ADN este apoi recuperat prin precipitare cu etanol (2-2,5 volume), în
36

TEHNOLOGIA ADN RECOMBINANT

prezenţa unor cationi monovalenţi (de exemplu, ioni de sodiu în concentraţie de 0,3M) şi apoi prin centrifugare. Deseori, ADN obţinut este redizolvat în tampon, proces urmat de o nouă rundă de deproteinizare, ceea ce asigură o puritate mai bună preparatului. Dacă este însă necesar un grad foarte ridicat de puritate, soluţia de ADN este supusă ultracentrifugării (în gradient de clorură de cesiu). 2.1.1.2. Izolarea ADN plasmidial Pentru purificarea ADN plasmidial au fost elaborate numeroase metode dar utilizarea uneia sau a alteia depinde de scopul urmărit: evidenţierea prezenţei plasmidelor în celulele bacteriene sau purificarea plasmidelor şi utilizarea lor în diferite experimente (transformarea genetică, clivare cu enzime de restricţie, clonări de gene etc). Toate metodele elaborate până în prezent pentru izolarea plasmidelor bacteriene implică trei etape de bază: cultivarea bacteriilor; depunerea şi liza celulară; purificarea ADN plasmidial (Mazza, 1986). Posibilitatea de a izola selectiv ADN plasmidial şi de a îndepărta ADN cromosomal se datorează unor diferenţe importante dintre cele două tipuri de molecule. Astfel, ADN cromosomal este reprezentat de molecule de dimensiuni mari, legate de membrana plasmatică, el rămânând fixat de resturile celulare rezultate după spargerea celulelor. Având dimensiuni mari, moleculele de ADN cromosomal sunt linearizate şi fragmentate în cursul procesului de extracţie, în timp ce ADN plasmidial este obţinut, în cea mai mare parte, sub forma unor molecule circulare închise covalent (CIC). De asemenea, cele două tipuri de molecule se comportă diferit în prezenţa unor detergenţi (SDS) sau la concentraţii mari de săruri. Expunerea la temperaturi ridicate sau tratarea cu soluţii cu pH puternic alcalin (12,0 12,4) determină ruperea legăturilor de hidrogen dintre cele două catene ale moleculelor de ADN, ducând la denaturarea acestora. Datorită conformaţiei moleculare speciale (CIC), catenele de ADN plasmidial denaturat se menţin alăturate, astfel că după răcire, respectiv neutralizare, aceste molecule redobândesc configuraţia iniţială. In schimb, ADN cromosomal rămâne în stare denaturată fiind eliminat în cea mai mare parte după centrifugare. Moleculele ce contaminează soluţia de ADN (ARN sau proteine) sunt eliminate prin tratamente similare celor menţionate pentru ADN total, iar recuperarea ADN plasmidial se face tot prin centrifugare după precipitarea cu alcooli (alcool izopropilic sau alcool etilic). Pentru o purificare înaltă a ADN plasmidial se poate utiliza ultracentrifugarea în gradient în clorură de cesiu, metodă ce permite separarea nu

37

astfel încât particulele virale sunt obţinute din lizatul celular prin precipitare (de exemplu. Pentru purificarea unui anumit tip de ARN se folosesc metode specifice ce ţin cont de anumite 38 . prin reverstranscriere. Izolarea moleculelor de ARN In anumite tipuri de experimente în care izolarea genelor direct din moleculele de ADN nu este posibilă. Izolarea ADN viral Pentru obţinerea ADN viral este necesar mai întâi să se obţină celulele ce reprezintă gazda specifică a virusului de interes.20. Îndepărtarea capsidei virale se realizează prin tratament cu fenol sau prin folosirea unor proteaze.1. proteine ADN linearizat sau crestat (conformaţia CD) ADN de tip CIC Sediment reprezentat de molecule de ARN Fig.TEHNOLOGIA ADN RECOMBINANT numai a tipurilor diferite de molecule ci şi a moleculelor de ADN plasmidial cu conformaţii moleculare diferite (fig. prin precipitare cu polietilenglicol) urmată de centrifugare. Separarea moleculelor de ADN prin ultracentrifugare 2. pentru fragmentelor de interes este necesară utilizarea unor molecule de ARN care sunt apoi convertite. 2. Inactivarea acestei enzime termostabile şi rezistente la acţiunea EDTA sau a detergenţilor este realizată prin folosirea unui inhibitor specific: dietilpirocarbonat.4.1. după precipitare.20). multiplicarea virală este însoţită de liza celulelor gazdă (aşa cum este cazul bacteriofagilor litici).1. metodele de izolare ale ARN permit obţinerea de ARN total. De regulă. la molecule de ADN corespunzătoare. ADN viral este recuperat.3.1. De cele mai multe ori. Izolarea moleculelor de ARN este relativ complicată de faptul că RN-aza endogenă este capabilă să degradeze cea mai mare parte a ARN celular. prin centrifugare sau ultracentrifugare în gradient de CsCl.

coli o astfel de contaminare este foarte rară dar pentru preparatele obţinute de la alte organisme. În cazul acizilor nucleici izolaţi de la E. prezintă la capătul 3’ o “coadă” monocatenară poliA. indică prezenţa altor tipuri de molecule în soluţie. 39 . Odată cu trecerea de la forma dublu catenară la forma monocatenară. Pentru determinarea tipului de molecule cu care proba este contaminată se citesc extincţiile soluţiilor la două lungimi de undă diferite: 260 nm – lungimea de undă la care acizii nucleici au absorbţia maximă şi 280 nm – lungimea de undă la care proteinele au absorbţia maximă.1. absorbţia soluţiilor de ADN creşte cu până la 40% (efect hipercromic). iar apoi ARNm este concentrat prin precipitare cu etanol şi recuperat prin centrifugare.5. mai mare cu câteva procente decât cea corespunzătoare lungimii de undă de 260 nm. Secvenţele poliT sau poliU interacţionează specific.1. Pe baza proprietăţilor de absorbţie a soluţiilor de acizi nucleici. O extincţie. variaţie care depinde de procentul bazelor G-C. Spre exemplu. pentru purificarea ARNm se utilizează metoda cromatografiei de afinitate pe o coloană cromatografică ce conţine o umplutură specifică la care sunt legate “resturi” de poliT sau poliU. absorbţia la 320 nm poate fi cu până la 10% mai ridicată decât la 260 nm. legând moleculele respective. Eluarea moleculelor de interes se realizează cu ajutorul unor soluţii tampon specifice. Variaţia absorbţiei în ultraviolet a soluţiilor de ADN permite studiul denaturării acestuia. pe bază de complementaritate.TEHNOLOGIA ADN RECOMBINANT particularităţi ale moleculelor de interes. pentru obţinerea ARNm se ţine cont de faptul că acest tip de ARN. Concentraţia de acizi nucleici din diferite probe se poate determina pe baza absorbţiei radiaţiilor ultraviolete. izolat din celule eucariote. Acizii nucleici au un spectru de absorbţie între 250 – 320 nm. se poate evalua puritatea acestora. la 320 nm. 2. Determinările efectuate asupra unor probe cunoscute (în cuve cu grosimea de 1 cm) au stabilit că valoarea 1. Determinarea purităţii şi concentraţiei de acizi nucleici Utilizarea acizilor nucleici în diferite experimente este condiţionată de un anumit grad de puritate şi o cantitate corespunzătoare. Pornind de la această caracteristică.00 a absorbanţei la 260 nm corespunde unei concentraţii de 50 µ g/ml ADN dublu catenar sau 40μg/ml ARN. ştiut fiind faptul că absorbanţa radiaţiilor UV cu lungimea de undă de 260nm este direct proporţională cu cantitatea de ADN din soluţie. cu coada poliA a ARNm.

pentru separarea electroforetică se preferă gelul de poliacrilamidă.65 indică o contaminare cu proteine sau fenol a probei analizate.000 pb. înainte de utilizarea probelor de ADN în experimente de inginerie genetică este necesar să existe. informaţii legate de conformaţia moleculară a ADN. Dacă puritatea probei de ADN de interes se poate stabili spectrofotometric.21).65 şi 1. 2.o valoare a raportului A260 / A280 între 1. dacă ADN plasmidial este contaminat cu ADN cromosomal sau dacă ADN cromosomal este puternic fragmentat.85 ar indica prezenţa în soluţie a unei cantităţi mari de ARN. prin aceste tehnici se poate realiza prelucrarea şi transferul unor secvenţe relativ mici. dacă procentul bazelor G – C este unul obişnuit. În prezent. acizii nucleici au sarcină negativă şi. a cărui concentraţie este aleasă în funcţie de mărimea moleculelor.000-20. în plus. De asemenea. Metoda electroforezei în gel de agaroză permite stabilirea dimensiunilor moleculelor de ADN precum şi conformaţia moleculară a acestora. fie prin sinteza chimică a unor molecule de ADN ce codifică proteinele dorite. Aceasta se poate realiza fie prin izolarea genelor naturale. Metoda standard de separare şi identificare a moleculelor de ADN izolate dintr-un anumit organism este electroforeza în gel de agaroză.TEHNOLOGIA ADN RECOMBINANT Rezultatele obţinute până în prezent au permis stabilirea unor. la pH alcalin sau neutru. Principiul general al metodei constă în faptul că.valori mai mari de 1. cum sunt cele electroforetice.1. pentru ca acestea să poată fi vizualizate.2. Metode de izolare a fragmentelor de ADN utile pentru clonare Tehnicile care urmăresc manipularea directă a ADN prin clonare moleculară se desfăşoară în etape succesive. una dintre acestea fiind obţinerea genelor de interes. 40 . ei vor migra spre anod (+). criterii de puritate: .valori sub 1. de dimensiuni cuprinse între 1. Colorarea se realizează cu bromură de etidiu iar vizualizarea benzilor de ADN se face prin expunerea gelului la radiaţii UV (pe un transluminator). Atunci când dimensiunea fragmentelor de ADN este foarte mică (sub 1000 pb). celelalte informaţii se pot obţine prin utilizarea altor tehnici. prin urmare. aşa numite.85 indică o puritate ridicată a soluţiei de acizi nucleici. . este necesar ca mai întâi ele să fie colorate. Indiferent de tipul de gel utilizat pentru separarea moleculelor de ADN. ele prezentând o fluorescenţă roz (fig. . dacă sunt plasaţi într-un câmp electric.

reverstranscriptaza.53 kb 5.41 kb ADN. 2. ligaza.54 kb 4. sinteza enzimatică a ADN dublu catenar complementar (ADNc). după "recunoaşterea" unei secvenţe nucleotidice specifice. izolarea şi amplificarea genelor prin tehnologia PCR.1. nucleazele (DNaze. hidrolizează moleculele de ADN dublu catenar.21.TEHNOLOGIA ADN RECOMBINANT Godeurile unde sunt introduse probele 49. Obţinerea ADN de interes prin utilizarea endonucleazelor de restricţie Enzimele restricţie cunoscute şi sub numele de endonucleaze de restricţie sunt produse de către bacterii şi sunt răspunzătoare de fenomenul de degradare a moleculelor de ADN străin ce pătrund în interiorul celulelor bacteriene. În celulele producătoare. situate câte una pe fiecare catenă a moleculei de ADN. inutil pentru buna funcţionare a genei de interes. protejează ADN propriu faţă de acţiunea 41 . cum ar fi: enzimele de restricţie (endonucleaze de restricţie). Hidroliza ADN se realizează prin clivarea a două legături fosfodiesterice. Metodele prezentate mai sus presupun utilizarea unei game variate de enzime.0 kb 21. conformaţia CIC Fig. Separarea electroforetică a unor molecule de ADN (după Boffey. determinând formarea unui număr limitat de fragmente per moleculă.2. Aceste enzime. "Modificarea". fosfataza alcalină. conformaţia CD ADN linearizat ADN parţial relaxat ADN. metilazele.80 kb 3. ADN polimeraze dependente de ADN.8 kb 7. 1983) Reuşita experimentelor în urma intervenţiilor prin diverse procedee este condiţionată de prezenţa integrală a genei dorite şi a unei cât mai mici cantităţi de ADN “contaminant”. alcătuit dintr-o restrictază şi o enzimă de modificare. realizată în special prin metilare. Obţinerea fragmentelor de ADN ce servesc pentru clonare se poate realiza pe mai multe căi: sinteza chimică a genei. RN-aze).1. polinucleotid kinaza. izolarea genelor din ADN natural cu ajutorul enzimelor de restricţie.93 kb+ 5. endonucleazele de restricţie fac parte integrantă dintrun sistem de restricţie şi modificare.

este sensibil la distrugerea cu endonucleaze de restricţie (Nathans şi Smith 1975.TEHNOLOGIA ADN RECOMBINANT restrictazelor specifice. Astfel. In cazul în care respectivele particule fagice infectează bacterii aparţinând altor tulpini. s-a observat că particulele fagice ce au fost eliberate prin liza celulelor bacteriene aparţinând unei anumite tulpini determină infectarea eficientă a altor bacterii aparţinând aceleiaşi tulpini deoarece acestea au acelaşi tip de modificare ca şi gazda iniţială. Smith. pătruns în celulă. Sistemele de restricţie şi modificare au fost descoperite prin efectul lor asupra bacteriofagilor ce infectează celulele bacteriene. Această enzimă a fost apoi utilizată de Dana şi Nathans (1971) pentru clivarea genomului circular al virusului SV40 reuşind obţinerea a 11 fragmente distincte. în timp ce ADN străin. Metilaza adaugă grupări metil la resturile de adenină sau citozină de la nivelul situsurilor ţintă ale enzimei de restricţie corespunzătoare. Zarnea 1986). ceea ce 42 . dovedeşte că sistemul de restricţie nu este absolut. Faptul că totuşi. ele “tăind” ADN în mod întâmplător. Arber şi Linn au demonstrat activitatea restrictazică a enzimei Eco B. la nivelul unor situsuri localizate departe de situsul de recunoaştere. Există astfel posibilitatea ca ADN exogen să scape fenomenului de restricţie fie datorită unor mutaţii spontane apărute la nivelul situsurilor ţintă pentru enzimele de restricţie. fie acţiunii ineficiente a acestora. iar Meselson şi Yuan (1968) au purificat o enzimă cu acţiune similară sintetizată de tulpina E.coli K. Old şi Primrose 1980. în anumite situaţii apar plaje de liză. fiind lipsit de o modificare adecvată. Wilcox şi Kelly au reuşit purificarea şi caracterizarea unei alte enzime de restricţie.coli. numărul de plaje de liză (dovada eficienţei infecţiei cu bacteriofagi virulenţi) este foarte mic sau chiar nu se produc plaje de liză deoarece ADN fagic infectant a fost atacat şi distrus în cea mai mare parte de către enzimele de restricţie ale noii gazde. Hind II. In 1968. Aceste enzime au fost capabile de a degrada ADN izolat din alte surse dar nu şi pe cel al tulpinii producătoare. enzimă care “taie” macromolecula de ADN la nivelul situsului de recunoaştere. Trăsătura de bază a unui sistem de restricţie şi modificare este aceea că tulpina bacteriană prezintă o activitate de metilare a ADN propriu cu aceeaşi specificitate de secvenţă ca şi activitatea restrictazică. particulele fagice din noile plaje de liză sunt capabile să infecteze eficient noua tulpină bacteriană. dar nu şi cea de origine. Mai mult. produsă de o tulpină de E. Acest experiment a însemnat realizarea primei hărţi de restricţie. In 1970. Aceasta dovedeşte că ADN din aceste particule fagice a suferit tipul de modificare specific noii gazde şi nu mai este recunoscut de gazda de origine.

ADN este metilat pe ambele catene însă. care nu prezintă modelul de metilare al respectivei gazde. El este implicat în controlul procesului de replicare. Au fost identificate bacterii ce prezintă mutaţii la nivelul sistemelor de metilare. respectiv restricţia. moleculele fiice conţin doar una dintre catene metilată (cea matriţă). In cazul ADN al tulpinilor de E.sistemul dcm care metilează citozina dar al cărui mecanism de acţiune nu este cunoscut. astfel încât devine imun la acţiunea enzimei de restricţie corespunzătoare. secvenţe ce reprezintă situsurile de recunoaştere şi legare. . el este rapid recunoscut de enzimele de restricţie şi degradat.sistemul dam care este capabil să deosebească noile catene de ADN replicate prin metilarea adeninei. . în timp ce sistemele de tip I şi II grupează enzime ce prezintă atât proprietăţi de metilare cât şi de restricţie.TEHNOLOGIA ADN RECOMBINANT conferă respectivelor molecule de ADN rezistenţă la acţiunea restrictazei (protejează ADN propriu de “autodigestia” pe care ar produce-o enzima de restricţie sintetizată). în cursul procesului de replicare. Enzimele ce alcătuiesc aceste sisteme au 2-3 subunităţi heterologe cu proprietăţi 43 . Toate endonucleazele de restricţie recunosc scurte secvenţe de nucleotide de la nivelul macromoleculelor de ADN. aceasta dovedeşte că totuşi metilarea nu este un eveniment esenţial pentru supravieţuirea bacteriilor. ADN genomic al bacteriei ce produce o anumită enzimă de restricţie este metilat la nivelul situsurilor ţintă. Sistemele enzimatice de restricţie/modificare au fost împărţite în trei categorii: tipul I. în marcarea catenelor de ADN în vederea reparării sau influenţează activitatea altor elemente cromosomale la E. Diferenţa principală dintre cele trei categorii este aceea că sistemele enzimatice de tipul II conţin enzime diferite ce realizează metilarea. se poate spune în acest fel că ele sunt hemimetilate.coli. ele fiind incapabile de metilare dar capabile de supravieţuire.coli s-a evidenţiat faptul că acesta conţine mici cantităţi de 6-metiladenină şi 5-metilcitozină. Atunci când în celulă pătrunde însă o moleculă de ADN străin. Legarea este urmată de clivarea legăturilor fosfodiesterice fie la nivelul situsului de recunoaştere fie la depărtare de acesta. în funcţie de enzimă. In acest moment întră în acţiune enzimele ce catalizează procesul de metilare şi introduc grupări metil la nivelul bazelor azotate corespunzătoare. tipul II şi tipul III.sistemul hsd care acţionează pentru a genera un model specific de metilare a adeninei (sau uneori a citozinei). Aceste baze azotate sunt generate prin acţiunea a trei tipuri diferite de metilaze care au fost încadrate în trei sisteme de modificare specifice: .

Macreadie şi colab. Caracteristicile unor enzime de restricţie Tulpina bacteriană Anabaena variabilis Bacillus amyloliquefaciens Bacillus globigii Escherichia coli Haemophilus aegyptius H.influenzae Rd Moraxella bovis Providencia stuartii Serratia marcescens Streptomyces stanford Thermus aquaticus Xanthomonas malvacearum Denumirea enzimei Ava I Bam HI Bgl II Eco RI Hae III Hha I Hpa II Hind III Mbo I Pst I Sma I Sst I Taq I Xma I Situs de recunoaştere şi clivare CCGGAG GGATCC AGATCT GAATTC GGCC GCGC CCGG AAGCTT GATC CTGCAG CCCGGG GAGCTC TCGA CCCGGG Relativ recent (Jacquier şi Dujon. în timp ce Bacillus globigii sintetizează două enzime de restricţie. Bgl I şi Bgl II (tabelul 2). tulpina Escherichia coli R produce mai multe enzime de restricţie notate Eco RI. Tabelul 2. Au mai fost descrise şi alte tipuri de enzime de restricţie care acţionează asupra ADN doar dacă acesta este metilat. îşi exercită acţiunea doar asupra situsurilor de recunoaştere GATC nemetilate.TEHNOLOGIA ADN RECOMBINANT funcţionale distincte. Sistemele enzimatice de tip I şi II sunt mai puţin cunoscute şi mai puţin folosite în practică deşi sunt interesante din punct de vedere biologic. ce combină denumirea speciei şi a tulpinii de la care s-a izolat enzima (abreviere) şi numărul de enzime pe care aceasta le produce (cifre romane). ele fiind utilizate în numeroase experimente de biologie moleculară. enzima DpnII. In ceea ce priveşte nomenclatura enzimelor de restricţie. haemolyticus H. Aceste nucleaze determină clivări 44 . De exemplu. cloroplastice sau chiar nucleare de la unele organisme eucariote conţin introni ce codifică nucleaze specifice. produsă de alte tulpini de streptococi. a fost propus un model original. Eco RV. Eco RII.parainfluenzae H. 1985) au evidenţiat faptul că anumite gene mitocondriale. Acesta este cazul enzimei de restricţie Dpn I produsă de unele tulpini de Streptococcus pneumoniae: ea clivează situsul de recunoaştere GATC doar dacă acesta este metilat. 1985. Din contră.. Sistemul de tip II include o serie de enzime de restricţie foarte bine cunoscute.

conţinutul în G+C al ADN ar fi 50%. la nivelul unor situsuri specifice. enzima Eco RI recunoaşte o secvenţă specifică formată din 6 nucleotide. aceasta ar însemna că un situs de restricţie format din patru nucleotide s-ar regăsi la nivelul acelui ADN la fiecare 256 perechi de baze (44). spre capătul 5’ sau 3’. ADN poate fi scindat în fragmente de dimensiuni mici (ca în cazul experimentelor de amprentare genetică = „DNA fingerprinting”) 45 . palindromul este întrerupt de o serie de 1 până la 9 nucleotide nespecifice. enzima de restricţie Sfi I recunoaşte secvenţa GGCCNNNNNGGCC. se pare că sunt implicate în eliminarea intronilor din anumite gene. situsurile fiind plasate pe ambele catene ale ADN. secvenţele de recunoaştere nu sunt protejate prin metilare ci ele. In funcţie de enzima de restricţie utilizată şi de scopul urmărit în experiment. Uneori. generând gene alele fără introni. astfel că ele ar putea fi utilizate în experimentele în care se doreşte obţinerea unor fragmente de ADN de dimensiuni mai mari (ca în cazul “construirii” băncilor genomice). într-un mod similar acţiunii enzimelor de restricţie produse de bacterii. fiind format dintr-un număr limitat de nucleotide (4. In cazul multor enzime de restricţie. 6. situsul de recunoaştere al unei enzime de restricţie nu coincide cu cel de clivare. 7 sau 8 perechi de nucleotide). 5.TEHNOLOGIA ADN RECOMBINANT dublu-catenare ale ADN. Una dintre caracteristicile enzimelor de restricţie este aceea că ele recunosc anumite secvenţe de nucleotide (situsul de recunoaştere) şi clivează în mod specific legăturile fosfodiesterice dintre anumite nucleotide (situsul de clivare). Presupunând că. Numărul şi mărimea fragmentelor de ADN generate prin acţiunea enzimelor de restricţie depinde de frecvenţa apariţiei situsurilor de recunoaştere la nivelul ADN supus clivării. acesta din urmă fiind localizat la o anumită depărtare de situsul de recunoaştere. Spre deosebire de acestea însă. formate din 1012 perechi de baze. Deseori. unde N poate fi orice bază azotată. în medie. De exemplu. în timp ce un situs de restricţie format din opt nucleotide ar putea apărea la fiecare 65. cu structură de palindrom.536 perechi de baze (48). el s-ar regăsi la fiecare 4096 perechi de baze (46). Dacă situsul de restricţie este format din şase nucleotide. dar locul de clivare este situat la o distanţă de 8 nucleotide de la capătul 3’ al situsului de recunoaştere pe o catenă şi la o distanţă de 7 nucleotide spre capătul 5’ pe cealaltă catenă. situsul de recunoaştere coincide cu cel de clivare (mai ales la enzimele de restricţie de tip II). Endonucleazele eucariote recunosc secvenţe mai lungi de nucleotide. Un exemplu de acest tip este enzima Mbo II care recunoaşte situsul GAAGA. De exemplu. GAATTC.

Dintre acestea. între ele stabilindu-se legături de hidrogen. Pentru testarea acţiunii enzimelor de restricţie se pot utiliza diferite tipuri de ADN la care se cunoaşte numărul de situsuri de recunoaştere (stabilit prin studii anterioare). ele se pot reasocia pe baza complementarităţii. Se cunoaşte faptul că enzimele de restricţie ce recunosc secvenţe de tip palindrom rup legăturile fosfodiesterice la nivelul acestor secvenţe. Tabelul 3. Gme = indică starea metilată a bazei respective 46 . legarea este mai stabilă atunci când extremităţile respective conţin mai multe baze azotate de tip GC. bacteriofagul Φ X174.TEHNOLOGIA ADN RECOMBINANT sau mai mari. Un alt aspect de care se ţine seama atunci când se alege o enzimă de restricţie pentru un anumit tip de experiment este acela al tipului de extremităţi pe care le generează enzima după clivarea macromoleculei de ADN. mai ales atunci când sunt folosite enzime al căror situs de recunoaştere este format din 8 nucleotide (ca în cazul experimentelor de clonare a unor fragmente genomice sau în cele de cartare genetică). In cazul fragmentelor de restricţie cu extremităţi monocatenare. fie extremităţi drepte (atunci când clivarea se face în aceeaşi poziţie pe ambele catene ale ADN). cele mai utilizate molecule de ADN provin de la bacteriofagul λ. Acţiunea unor enzime de restricţie pe diferite tipuri de molecule de ADN Enzima Bam HI Bgl II Dpn I Eco RI Eco RV Hind III Hinf I Mbo I Pst I Pvu I Sma I Taq I Situs de recunoaştere şi clivare G↓ GATCC A↓ GATCT GmeA↓ TC G↓ AATTC GAT↓ ATC A↓ AGCTT G↓ ANTC ↓ GATC CTGCA↓ G CGAT↓ CG CCC↓ GGG T↓ CGA Număr de situsuri λ Ad2 Φ X174 pUC18 pBR322 5 6 116 5 21 7 148 116 28 3 3 121 3 11 87 5 9 12 72 87 30 7 12 50 0 0 0 0 0 0 21 0 1 0 0 10 1 0 15 1 0 1 6 15 1 2 1 4 1 0 22 1 1 1 10 22 1 1 0 7 ↓ = indică locul clivării. N = reprezintă orice nucleotidă. de la adenovirusul Ad2. generând fie extremităţi monocatenare complementare 3’ sau 5’ (atunci când clivarea se face decalat în raport cu axul de simetrie al secvenţei palindromice). plasmida pUC18 sau pBR322 (tabelul 3).

. harta sa de restricţie. în funcţie de enzima folosită)(Cornea şi colab. 47 . Hind III. Cu toate avantajele sale. rezultând fragmente de dimensiuni mai mici Experimentul se reia prin inversarea ordinii de acţiune a celor două enzime de restricţie. mai întâi Hind III şi apoi Pst I. fapt care asigură legarea lor eficientă. metoda se poate aplica numai dacă genomul organismului de la care se doreşte izolarea unei gene se poate purifica. câte una pe fiecare catenă. urmată de selecţia şi purificarea fragmentului dorit. producând fie extremităţi drepte fie extremităţi decalate (ce determină prelungiri monocatenare lungi de 3. iar informaţiile obţinute sunt prelucrate astfel încât să permită stabilirea ordinii situsurilor de restricţie şi apoi a identificării prezenţei genei (genelor) de interes la nivelul fragmentelor selectate. Acestea clivează ADN dublu catenar prin ruperea a două legături fosfodiesterice. Cele mai multe situsuri de recunoaştere ale enzimelor de restricţie sunt palindromice. aşa cum este cazul endonucleazelor de tipul II.TEHNOLOGIA ADN RECOMBINANT Izolarea genelor din ADN genomic cu ajutorul enzimelor de restricţie constituie cea mai simplă metodă de obţinere a unor fragmente de ADN ce pot conţine gena dorită. Etapele unor asemenea teste sunt următoarele: • • • ADN de interes este clivat mai întâi cu o anumită enzimă de restricţie. astfel încât funcţia acesteia să rămână nealterată. astfel că prelungirile monocatenare formate de o anumită enzimă la extremităţile moleculei de ADN sunt complementare. de exemplu. Atunci când nu există informaţii asupra localizării genelor. Fragmentarea a ADN cu ajutorul endonucleazelor de restricţie se bazează pe proprietatea acestor enzime de a cliva moleculele de ADN la nivelul situsului de recunoaştere. obţinându-se mai multe fragmente de restricţie de dimensiuni diferite Fragmentele obţinute cu prima enzimă sunt supune acţiunii unei alte enzime de restricţie. 4 sau 5 baze. 1998). indiferent de provenienţa moleculelor de ADN. coezive ("lipicioase"). dacă i se cunoaşte harta genetică sau. Pst I. şi mai bine. Pentru determinarea poziţiei situsurilor la nivelul moleculei de ADN analizate se aplică teste suplimentare (fig. de exemplu.22). Condiţia esenţială este ca enzima de restricţie folosită să cliveze gena. Metoda constă în fragmentarea specifică a genomului unui organism cu ajutorul enzimelor de restricţie. Trebuie precizat faptul că examinarea exclusivă a mărimii fragmentelor de restricţie nu oferă informaţii asupra localizării situsurilor de recunoaştere. pe bază de complementaritate. clivarea se face la întâmplare.

situsurile de restricţie sunt determinate la nivelul fiecărui fragment conform metodei prezentate anterior.22. B. după care rezultatele obţinute pentru fiecare fragment în parte sunt alăturate obţinându-se în acest fel cartarea întregii molecule de ADN supuse analizei. Clonele sunt apoi analizate prin folosirea hibridizării moleculare („Southern-blot hybridization”). determinându-se în acest fel care dintre fragmentele de restricţie se suprapun unele cu altele. O altă metodă de stabilire a hărţii fizice este aceea a realizării unei „biblioteci” de fragmente de restricţie de ADN provenit de la organismul analizat.6 kb este clivat separat cu enzimele Hind III şi PstI. 48 . Stabilirea localizării situsurilor de restricţie la nivelul unui fragment de ADN. Pe baza dimensiunii fragmentelor obţinute prin simpla şi dubla clivare s-a stabilit ordinea situsurilor de restricţie (după Snyder şi Champness. acestea sunt denaturate iar ADN monocatenar este transferat pe o membrană de nitroceluloză. Astfel. fragmentele rezultate sunt introduse într-un vector de clonare şi apoi întro gazdă caracteristice. Fragmentul originar de 6. după separarea electroforetică a fragmentelor de restricţie. iar fragmentele obţinute sunt digerate cu cealaltă enzimă de restricţie.TEHNOLOGIA ADN RECOMBINANT În final se compară dimensiunea fragmentelor finale şi se stabileşte ordinea situsurilor de restricţie pentru Pst I şi Hind III. Fragmentele respective sunt supuse apoi interacţiunii cu o probă de ADN marcată radioactiv. obţinându-se un număr mare de clone. 1997). Fig. După clivarea ADN cu o enzimă de restricţie. A. Odată ce clonele au fost identificate şi ordonate.

fenomenul putând fi evidenţiat electroforetic după migrarea fragmentele de ADN obţinute prin clivarea cu o enzimă de restricţie. apar dificultăţi suplimentare în ceea ce priveşte obţinerea genelor prin metoda descrisă. nu sunt localizate grupat pe cromosomi. ea fiind cuplată. gene complexe pentru proteine multimere. 1995). cu performanţe îmbunătăţite. Aceste gene sunt cel mai uşor de izolat. ARNt. dar între indivizi există unele diferenţe la nivelul secvenţei de nucleotide din ADN. In acest caz. ordonate la fel la nivelul hărţii genetice. reglonii multipli.TEHNOLOGIA ADN RECOMBINANT Uşurinţa cu care genele de interes pot fi izolate depinde de localizarea lor pe cromosomi. Deoarece diferitele forme ale unei gene se datorează variaţiilor în secvenţa de nucleotide ce le alcătuieşte. una dintre ele presupunând localizarea anumitor mutaţii luând ca referinţă situsuri de restricţie cunoscute. pentru ameliorarea organismelor: prin încrucişarea a doi indivizi diferiţi aparţinând aceleiaşi specii sau obţinut organisme noi. de obicei. cu tehnica Southern blot pentru caracterizarea unei regiuni de ADN (prin utilizarea unei probe de ADN specifică regiunii de analizat)(fig. regloni sau minioperoni dispersaţi pe cromosom. prin utilizarea enzimelor de 49 . Polimorfismul genetic a fost utilizat din cele mai vechi timpuri. deseori. Pentru a stabili localizarea anumitor gene la nivelul unei molecule de ADN. Pe baza efectelor lor fenotipice. ARNr. pot fi utilizate diferite metode. operoni pentru diferite căi metabolice. unde harta genetică este departe de a fi cunoscută. genele de la procariote pot fi clasificate în mai multe categorii: • • • • • gene simple care codifică enzime monomere. constituite din subunităţi diferite care. deci pe o hartă fizică.23) La eucariote. Aceste diferenţe asigură polimorfismul individual. Tehnica a primit denumirea de RFLP („restriction fragment lenght polymorphism”). cum sunt cei ce controlează sinteza antibioticelor din precursori ai mai multor căi metabolice diferite (Vătafu. Organismele aparţinând unei anumite specii conţin aceleaşi gene. poziţia situsurilor de restricţie pentru anumite enzime poate varia. la început în mod empiric. având rol în controlul funcţiilor de biosinteză. a organizării la nivelul cromosomilor şi a gradului de dificultate al izolării lor. deoarece nu există informaţii suficiente asupra localizării genei de interes.

se obţine o populaţie heterogenă (ca dimensiuni) de fragmente de restricţie.TEHNOLOGIA ADN RECOMBINANT restricţie pentru clivarea ADN genomic. 50 .

2000) Clonarea ulterioară a tuturor acestor fragmente (separate pe baza dimensiunii lor) în vectori de clonare specifici şi apoi introducerea lor în E. Aşa cum s-a precizat deja. Ulterior.TEHNOLOGIA ADN RECOMBINANT Fig.coli ce trebuie analizate pentru a găsi fragmentul ce conţine gena dorită (în funcţie de dimensiunea sa) este dată de ecuaţia: N = ln(1-p)/ln(1-x/y) unde N = numărul de clone ce trebuie analizate pentru a obţine secvenţa dorită cu o probabilitate de 95% sau 99% p = probabilitatea de obţinere a genei de interes (de obicei se alege 99%) x = dimensiunea în kb a secvenţei integrate y = dimensiunea în kb a genomului haploid al organismului analizat ln = logaritm natural Pentru analiza genomului celulelor eucariote se preferă folosirea unor enzime de restricţie ce recunosc secvenţe mai lungi de nucleotide.coli permite obţinerea. selecţia genei de interes se poate realiza prin diferite metode. cu ajutorul enzimelor de restricţie care generează extremităţi monocatenare complementare. Numărul de clone recombinate de E. pe două probe de ADN (1 şi 2) (după Bougaize şi colab. clonarea acestora se face în vectori speciali. în această categorie intră enzimele Bam HI. de obicei.. după care.(1977) pentru izolarea genei ce codifică sinteza ARNr 5S de la drojdii. adică să formeze acelaşi tip de extremităţi monocatenare. ce codifică funcţii specifice. cu condiţia ca cele două enzime să fie „compatibile”. aşa numitelor "bănci genomice" ("biblioteci de gene"). astfel încât fragmentele rezultate să aibă dimensiuni mai mari. Bgl II.23. Tehnologia ADN recombinant presupune combinarea unor fragmente de ADN de origini diferite astfel încât să se obţină o moleculă nouă. ce permit inserarea unor secvenţe de dimensiuni mai mari. Sau 3A şi Bcl I care formează extremităţi monocatenare de tip GATC. Reprezentarea schematică a etapelor tehnicii RFLP. O astfel de tehnică a fost folosită de Maxam şi colab. fragmentele de ADN sunt obţinute. 51 . De exemplu. aplicate în scopul identificării localizării unei gene la nivelul unui fragment de restricţie. Deseori se pot folosi fragmente de ADN obţinute prin utilizarea a două tipuri de enzime de restricţie.

Sma I) care. Avantajul unor asemenea extremităţi este că indiferent de enzima folosită. ele au nevoie de o secvenţă de tip primer care să prezinte capătul 3’OH liber. pentru a acţiona. fie prin sinteza unei catene complementare utilizându-se ADN-polimeraza I (fragmentul Klenow). Eco RV.coli) manifestă nu numai activitate polimerazică ci şi exonucleazică în sensul 5’ → 3’ şi/sau 3’ → 5’ (eliminarea pe rând a nucleotidelor fie de la capătul 3’ fie 5’). sinteza de ADN nu este posibilă. datorită activităţii exonucleazice 5'→ 3' a ADN polimerazei I. Eficienţa legării fragmentelor cu extremităţi drepte este însă cu mult mai mică decât cea înregistrată prin folosirea fragmentelor cu extremităţi monocatenare complementare.TEHNOLOGIA ADN RECOMBINANT Există şi enzime de restricţie (Hpa I.2. ADN polimerazele catalizează formarea de legături fosfodiesterice între nucleotidele de la capătul 3’OH al catenelor de ADN şi grupul α fosfat de la nivelul dNTP libere. formează extremităţi drepte (extremităţi „oarbe” = „blunt ends”). Obţinerea ADN de interes prin utilizarea ADN polimerazelor ADN polimerazele sunt enzimele necesare pentru sinteza ADN în timpul replicării cromosomale sau a procesului reparator. Totuşi. 2. situaţie în care acestea sunt convertite la extremităţi drepte.2. Deseori însă. Aceasta se realizează fie prin îndepărtarea extremităţilor monocatenare în urma tratamentului cu nucleaza S1. în anumite experimente este necesară legarea unor fragmente cu extremităţi necompatibile. In absenţa primerului. Activitatea exonucleazică în sensul 3’ → 5’ este asociată in vivo cu rolul reparator al polimerazei respective: recunoaşterea şi apoi eliminarea nucleotidei incorect adăugată (necomplementară).1. prin acţiunea asupra ADN ţintă. apar probleme ce ţin de degradarea capătului 5' al primerilor şi eliminarea grupărilor 5' fosfat de la capetele fragmentelor de ADN utilizate că 52 . Unele ADN polimeraze (cum este ADN polimeraza I produsă de E. extremităţile formate sunt compatibile putând fi utilizate pentru legare şi formarea moleculelor de ADN recombinant. cu liberarea unei molecule de pirofosfat: ADN polimeraza (dNMP) n + dNTP → (dNMP)n+1 + PPi cationi bivalenţi (Mg2+) Caracteristic acestor enzime este faptul că. alungirea catenei de ADN realizându-se în direcţia 5’ → 3’ prin utilizarea unei alte catene de ADN drept matriţă.

necesar pentru iniţierea reacţiei de polimerizare catalizată de ADNpolimerază. 2. spre exemplu.2. amestecul este încălzit pentru a se desface catenele nou sintetizate de cele vechi şi ciclul este reluat (Benedetto. astfel încât cele două catene complementare rămân despărţite (denaturate). estimându-se că. pentru aceasta. ea poate fi aplicată şi pentru amplificarea ARN dar. Pentru a realiza amplificarea unei anumite secvenţe de ADN este necesar să fie cunoscute două mici secvenţe de ADN. complementară.824 molecule de ADN dublu catenar. mai întâi. pornind de la o unică moleculă iniţială. activitatea exonucleazică 5'→ 3' poate fi eliminată prin tratament proteolitic. obţinându-se un fragment de dimensiuni mari. 53 . care flanchează regiunea dorită. precum şi nucleotide.073. De aceea. După un ciclu de replicare. de aproximativ 10kb.2. se sintetizează o moleculă de ADNc şi apoi aceasta este multiplicată. de până la 106 ori. capabil de activitate ADN polimerazică şi exonucleazică 3'→ 5'. după 32 cicluri de replicare se pot obţine 1. numărul de molecule de ADN nou sintetizate creşte în progresie geometrică după fiecare ciclu de replicare. Tehnica PCR utilizează unele trăsături fundamentale ale replicării ADN: ADNpolimeraza foloseşte ca matriţă ADN monocatenar pentru a determina sinteza unei catene noi. eventual termorezistente. În tehnica de multiplicare "in vitro". 1993).TEHNOLOGIA ADN RECOMBINANT substrat pentru ligare.741. În acest fel. Matriţa de ADN monocatenar este obţinută prin încălzirea unei soluţii de ADN dublu catenar la o temperatură apropiată celei de fierbere şi apoi răcire bruscă. Aceste secvenţe sunt apoi utilizate ca bază pentru sinteza chimică a doi primeri oligonucleotidici de aproximativ 20 baze.1. numit fragment Klenow. ambele catene ale unui fragment de ADN pot servi ca matriţă pentru sinteza catenelor complementare. cu condiţia adăugării unor primeri oligonucleotidici pentru fiecare dintre cele două catene. care sunt complementari cu regiunile corespunzătoare de pe ambele catene ale genei de interes (fig.1. Metoda permite amplificarea "in vitro" a unei secvenţe de ADN.24). ADN polimeraze termostabile şi tehnologia PCR Elaborarea şi apoi perfecţionarea tehnologiei PCR (“Polymerase Chain Reaction”) a determinat găsirea unor noi ADN polimeraze cu acţiune mai eficientă şi. La acest ADN denaturat se adaugă un primer specific.

…TTCCACTTGCACCTACTTCAACCAC…. dar se poate amplifica o secvenţă de ADN pornind chiar de la o singură moleculă.TEHNOLOGIA ADN RECOMBINANT O etapă critică a acestei tehnici este alegerea primerilor specifici.AAGGTGAACGTGGATGAAGTTGGTG…3’ 3’….CTGACACAACTGTGTTCACTAGCAA……………. pentru a rupe legăturile de hidrogen. 5’….AAGGTGAACGTGGATGAAGTTGGTG…3’ 3’ TTCCACTTGCACCTACTTCAACC 5’ 5’ACACAACTGTGTTCACTAGCAA 3’ 3’…. în aşa fel încât ambele catene complementare separate să poată servi ca matriţă pentru ADN-polimerază. dar utilizarea lor nu mai face necesară izolarea prin alte metode a secvenţei dorite de ADN dintr-o populaţie heterogenă de molecule de ADN. Prima etapă a procesului de amplificare presupune încălzirea soluţiei de ADN la 94oC..GACTGTGTTGACACAAGTGATCCTT………………TTCCACTTGCACCTACTTCAACCAC….5 adăugarea unor secvenţe complementare (primeri) 5’….5’ încălzire (denaturare) 5’….GACTGTGTTGACACAAGTGATCCTT…………. La acest ADN se adaugă primerii oligonucleotidici ce vor fi folosiţi drept amorsă pentru ADN-polimerază. Reprezentarea schematică a primerilor utilizaţi pentru amplificarea genei pentru β -globină (după Watson şi colab.AAGGTGAACGTGGATGAAGTTGGTG…3’ 3’ CCACTTGCACCTACTTCAACC 5’ 5’ACACAACTGTGTTCACTAGG 3’ 3’….5 Fig.5’ începerea sintezei de ADN pornind de la capătul 3’ al primerilor 5’…. timp de 5 minute.. ca şi amestecul celor patru dezoxiribonucleotide. Cantitatea de ADN necesară ca material de start a reacţiei este foarte mică.GACTGTGTTGACACAAGTGATCCTT……………TTCCACTTGCACCTACTTCAACCAC….GACTGTGTTGACACAAGTGATCCTT………………TTCCACTTGCACCTACTTCAACCAC…. Secvenţele de 20 nucleotide marcate sunt folosite ca primeri pentru ca ADN-polimeraza să-şi poată exercita funcţia de sinteză.CTGACACAACTGTGTTCACTAGCAA…………….CTGACACAACTGTGTTCACTAGCAA……………. sub 1 μg de ADN genomic total.CTGACACAACTGTGTTCACTAGCAA…………….24. Temperatura este apoi scăzută la 30-65 oC pentru a asigura prinderea primerilor la secvenţele complementare din catena de ADN 54 . 1992).AAGGTGAACGTGGATGAAGTTGGTG…3’ 3’….

4 – nouă rundă de sinteză a ADN. În fazele de început ale elaborării tehnicii PCR era necesar să se adauge. în sensul găsirii şi utilizării unor ADN polimeraze capabile să reziste la variaţiile mari de temperatură pe care le presupune tehnica menţionată au condus la izolarea şi caracterizarea Taq polimerazei. Enzima a fost izolată de la o bacterie termofilă (Thermus aquaticus). această temperatură se menţine timp de 2-5 minute. ci necesită pentru acţiune prezenţa unei secvenţe de nucleotide care să funcţioneze ca primer. Săgeata indică sensul sintezei ADN. fiind termosensibilă. Continuarea experimentului depinde de valoarea temperaturii la care se desfăşoară acest eveniment (fig. temperatura este crescută la 94oC pentru 20 secunde. Din nou.25. 3 – separarea celor două catene şi adăugarea unor noi cantităţi de primeri. 6 – nouă rundă de sinteză. pentru a se realiza procesul de polimerizare a ADN.TEHNOLOGIA ADN RECOMBINANT corespunzătoare. ciclurile putându-se repeta. Cercetările realizate pentru optimizarea procesului de polimerizare. pentru ca noile catene sintetizate să se desfacă de cele vechi.. după fiecare ciclu de sinteză.25). 2 – sinteza catenelor complementare pornind de la primerii P1 şi P2. ea nu poate iniţia "de novo" sinteza de ADN. Următoarea etapă constă în creşterea temperaturii la 72oC. Aceasta este o ADN polimerază termostabilă. Fig. era denaturată în momentul creşterii temperaturii.coli. ce acţionează eficient la temperaturi de 75-80oC. 1998) 1 – separarea catenelor originare şi adăugarea primerilor (P1 şi P2). deoarece polimeraza de E. 5 – separarea catenelor şi adăugarea de noi primeri. Ca orice ADN polimerază. O acţiune similară are şi enzima 55 . cantităţi noi de ADN polimerază. Schema realizării reacţiei de polimerizare în lanţ (PCR)(după Cornea şi colab. după care procesul se reia pentru 30-60 cicluri de sinteză.

ea manifestând în plus şi o activitate exonucleazică 3’→ 5’. ceea ce îi măreşte fidelitatea. poate fi utilizat ADNc obţinut prin reverstranscrierea ARNm şi introdus într-un vector de clonare.coli a unei gene modificate ce codifică una dintre ADN polimerazele de la T. In primul rând. care asigură sinteza unor molecule de ADNc. Condiţia ca reacţia de polimerizare să se desfăşoare este existenţa primerilor oligonucleotidici complementari pentru anumite secvenţe din vector (de obicei. Studierea bacteriilor din genul Thermus a permis izolarea de la specia T.thermophilus a cinci ADN polimeraze termostabile. enzima recombinată Tth manifestă activitate de reverstranscriere. Avantajele constau în faptul că se utilizează o singură enzimă ce manifestă. în ultimii ani au fost obţinute ADN polimeraze înalt termostabile prin modificarea controlată a genelor ce codifică asemenea enzime la bacterii termofile cum sunt Thermus thermophilus. Spre exemplu. la nivelul situsului corespunzător (cu secvenţa cunoscută). În privinţa surselor de ADN ce pot fi multiplicate prin PCR există mai multe posibilităţi de obţinere a acestora. metoda numindu-se în acest caz revers-PCR (RT-PCR). ADN polimeraza recombinată notată Tth. Utilizarea unei asemenea enzime pentru sinteza ADN asigură o fidelitate de 12 ori mai mare decât cea obţinută prin folosirea Taq polimerazei. dintre care două sau dovedit eficiente în tehnologia PCR. Thermotoga maritima sau Thermococcus litoralis (Newton şi Graham. În această situaţie se pot studia mai multe tipuri de fragmente de ADN clonate într-un anumit vector. ceea ce permite utilizarea acestei enzime în experimentele de amplificare a ADN pornind de la molecule matriţă de ARN (molecule bogate în secvenţe G-C sau care prezintă structuri secundare). s-a dovedit extrem de eficientă în sinteza ADN în anumite condiţii: adăugarea ionilor de magneziu şi chelarea cationilor de mangan. iar apoi se utilizează o polimerază termostabilă pentru amplificarea fragmentului dorit). secvenţele ce flanchează situsurile de clonare). Metoda poate fi aplicată şi pentru identificarea secvenţelor de ADN ai căror primeri nu sunt stabiliţi: selecţia fragmentelor obţinute prin clonare şi apoi 56 . la temperaturi de aproximativ 70oC. Utilizarea Tth polimerazei pentru ARN-PCR prezintă unele avantaje faţă de procedeul convenţional în care sunt folosite două enzime distincte (mai întâi se foloseşte o reverstranscripază. Dacă însă ionii de mangan sunt prezenţi. 1997). De asemenea. obţinută prin clonarea în E. în funcţie de condiţiile de reacţie.TEHNOLOGIA ADN RECOMBINANT Pfu polimeraza izolată de la o altă bacterie termofilă. fie activitate reverstranscriptazică fie de ADN polimerază. Pyrococcus furiosus.thermophilus.

acest ADN poate servi pentru subclonare în diverse gazde sau se poate realiza secvenţierea sa. de exemplu a fenilcetonuriei. AFLP („amplified 57 . 1997) Originea probei de ADN Lupul marsupial Oase umane Creier uman Mamut siberian Frunze fosile de magnolie Viespi fosilizate în chihlimbar Termite fosilizate în chihlimbar Gena amplificată ADNmt (cyt b) ADNmt (ARNr 12S) ADNmt (NADH dehidrogenaza) ADNmt (cyt b2) ADNmt (cyt b) Gene cloroplastice (rbc L) ARNr 18S ADNmt (ARNr 16S) ADN nuclear (ARNr 18S) Mărimea ampliconului (pb) 116 94 205 471 375 820 555. În acest caz se folosesc primeri pentru anumite secvenţe de ADN. O altă utilizare este legată de determinarea sexului fătului înainte de naştere. Asemenea analize s-au făcut. metoda PCR a căpătat o largă utilizare în diverse domenii ale biologiei moleculare. Aplicarea tehnicii PCR pentru analiza unor probe de ADN străvechi (după Newton şi Graham. De asemenea. Tabelul 4. Pornind de la această aplicaţie iniţială.000 17-20.000. Tehnica PCR este utilizată şi pentru studii moleculare asupra înrudirii filogenetice a unor specii. conţinute doar de cromosomul Y. dispersate în întreg genomul uman). pornind de la resturi fosilizate ale acestora (tabelul 4). Tot cu ajutorul tehnicii PCR se pot amplifica secvenţe specifice din genom. Astfel. 195 sau 597 150 225 Vârsta probei (ani) ~100 300-5500 7000 47.000. Ulterior. testul PCR permiţând să se stabilească dacă celulele maligne au fost sau nu distruse.000 In ultimii ani. cum este cazul secvenţelor Alu din genomul uman (regiuni ce conţin aproximativ 106 copii ale unei secvenţe de 300 pb.000 30. se poate determina eficienţa tratamentului unor tipuri de cancer cu citostatice sau radiaţii. Prin acurateţe şi sensibilitate. metoda a putut fi folosită chiar şi pentru multiplicarea unor probe de ADN aparţinând unor organisme care au dispărut. în special la familii cu risc mare de a avea urmaşi cu boli genetice X linkate.000.TEHNOLOGIA ADN RECOMBINANT amplificare se face cu ajutorul unor metode variate (de exemplu.000 30. Southern blotting). tehnica PCR a servit ca punct de start pentru dezvoltarea unor tehnici speciale de caracterizare a fragmentelor de ADN: tehnica RAPD („randomic amplified polymorphic DNA”=„amplificare randomizată a ADN polimorfic”). prin utilizarea unor celule fetale. prin intermediul ei se poate stabili existenţa unor boli ereditare la nou-născuţi.

Metoda este utilizată frecvent în experimentele de amprentare genetică deoarece este rapidă. Tehnica AFLP se bazează pe amplificarea selectivă a unor fragmente de restricţie provenite prin clivarea ADN genomic cu o anumită enzimă de restricţie. metoda este utilizată pentru caracterizarea tulpinilor bacteriene aparţinând aceluiaşi serotip sau pentru studiile de ameliorare a plantelor (la căpşun.Profilul soiului Gros Sauvignon.3. soia. 2002) M. Profilul electroforetic al fragmentelor de ADN de la diferite soiri de viţă-de vie. la fragmentele rezultate. orz. chiar dacă nu perfectă.Profilul soiului Coarna alba.. stabilirea microsateliţilor (secvenţe de TG sau CA repetate de 10-60 ori) sau VNTR („variable number tandem repeats” = numărul variabil al repetiţiilor în tandem”). M 1 2 3 4 5 6 7 8 9 Fig. necesită cantităţi scăzute de material şi este simplă din punct de vedere tehnic. 6. ceea ce poate ilustra.Profilul soiului Feteasca neagra. 1.26. existenţa unor mutaţii la unele linii consangvine (fig.Profilul soiului Feteasca alba.. după clivarea ADN de analizat cu una sau două endonucleaze. metoda nu este aplicată în situaţiile în care este necesară o acurateţe ridicată.. deoarece complementaritatea primerilor nu este întotdeauna perfectă cu fragmentele amplificate. aşa cum este cazul testelor de paternitate sau analizele de pedigree. grâu.. ovăz. 9.Profilul soiului Furmint.. se adaugă adaptori 58 . tomate.. Tehnica RAPD presupune utilizarea unor secvenţe scurte de nucleotide (de aproximativ 10 nucleotide) drept primeri arbitrari pentru amplificarea unor fragmente de ADN faţă de care manifestă complementaritate. de exemplu.26).Profilul soiului Grasa de Cotnari. Dintre aceste metode. 2. acelaşi primer folosit pentru amplificarea unor fragmente de ADN provenite de la linii înrudite de plante poate determina apariţia unui profil electroforetic diferit. In schimb.-ADNmarker (1 Kb).Profilul soiului Coarna neagra. amplificate prin utilizarea primerului GTGATCGCAG (tehnica RAPD)(după Mutulescu. Astfel. Cu toate acestea. prin folosirea unor seturi de primeri arbitrari. cartof sau porumb). 8. 4.Profilul soiului Feteasca regala.TEHNOLOGIA ADN RECOMBINANT fragment lenght polymorphisms” = polimorfismul lungimii fragmentelor amplificate”).Profilul soiului Petit Sauvignon. 5. 7. cea mai mare utilizare o au tehnicile RAPD şi AFLP. Astfel.

reverstranscriptazele realizează sinteza de ADN pornind de la o matriţă ARN (sunt ADN polimeraze dependente de ARN). situsurile de recunoaştere pentru enzimele folosite (fig. Reacţia de polimerizare depinde de existenţa celor patru deoxiribonucleotide trifosforilate în 59 . Fig. obţinându-se molecule de ADNc (complementar). africane şi europene. în acest fel. prin folosirea unei polinucleotid kinaze şi a [γ-33P] ATP.27. De remarcat că. rezultând o populaţie de fragmente amplificate.2. doar primerii complementari cu extremitatea 3’ a fragmentului de restricţie vor realiza amplificarea. prin utilizarea unor primeri cu o mai mare specificitate (conţin atât nucleotidele corespunzătoare situsului de restricţie cât şi un număr de alte nucleotide. Se refac. complementari cu extremităţile monocatenare generate de enzime.2. Spre deosebire de acestea. obţinute prin aplicarea tehnicii AFLP (după Suazo şi Hall. Amplificarea se realizează prin utilizarea a 1-2 categorii de primeri a căror secvenţă de nucleotide corespunde situsurilor de recunoaştere pentru enzimele de restricţie folosite (fig 27). Comparare a profilului electroforetic al fragmentelor de ADN genomic de la două tipuri de albine. fragmentele amplificate sunt identificate prin autoradiografie. la extremităţile fragmentelor.27). primerii utilizaţi pot fi marcaţi radioactiv la extremitatea 5’.2. iar după separarea electroforetică în gel de poliacrilamidă 6% (care permite evidenţierea şi a fragmentelor foarte mici). Din această populaţie de fragmente amplificate. în acest caz. ADN-polimeraze dependente de ARN Tipurile de ADN polimeraze menţionate mai sus utilizează drept matriţă o altă moleculă de ADN (sunt dependente de ADN). alese de experimentator) sunt apoi selectate o serie de fragmente care pot avea valoare de markeri moleculari.TEHNOLOGIA ADN RECOMBINANT specifici.1. 1999) 2. Ca urmare.

Obţinerea şi clonarea directă a ADN genomic mai ales la eucariote este tehnic mai dificilă şi. un anumit tip de ARNm poate reprezenta între 0. de Fig. în consecinţă. Reprezentarea schematică a etapelor procesului de sinteză a ADNc prin procesul de reverstranscriere 60 . În alte cazuri el este prezent în cantităţi foarte mici.28).28. alegerea unui anumit tip de ARNm se poate face prin determinarea capacităţii de a controla sinteza unei proteine specifice în sisteme acelulare sau prin hibridare cu oligonucleotide sintetice. Omiterea unui dNTP din amestecul de reacţie duce la oprirea polimerizării. origine virală. pentru a se iniţia sinteza ADN complementar se foloseşte o secvenţă sintetică oligo dT.1 şi 10% din cantitatea de ARNm celular total. Această secvenţă constituie de fapt primerul de la care va începe polimerizarea nucleotidelor de către reverstranscriptază (fig. In acest scop. s-a recurs la o tehnică indirectă de sinteză a genei sub forma de ADN complementar. reverstranscriptază. În general. ARNm este izolat din celulele ţesutului în care gena dorită se exprimă la maximum. În anumite condiţii fiziologice favorabile.TEHNOLOGIA ADN RECOMBINANT concentraţie mare pentru a obţine un ADN complementar cu lungime mare. pornind de la ARNm corespunzător. care va fi cuplată cu extremitatea poliadenilată. Deoarece la eucariote ARNm matur prezintă la capătul 3' OH o extremitate lungă de până la 150 nucleotide = capăt poliadenilat. Izolarea ARNm şi identificarea tipului dorit presupune anumite dificultăţi. Tehnica a fost denumită reverstranscriere şi se bazează pe utilizarea unei enzime specifice. lungă de aproximativ 10 nucleotide (resturi de timină).

Obţinerea bibliotecii complete sau parţiale de molecule de ADNc de la un anumit organism se face prin convertirea întregii populaţii de ARNm.99) n = proporţia reprezentată de ARNm corespunzător genei de interes din totalul populaţiei de ARNm ln = logaritm natural.TEHNOLOGIA ADN RECOMBINANT Toate variantele de clonare a ADN complementar dublu catenar pornesc de la sinteza unei copii ADN pe matriţa de ARNm cu ajutorul reverstrancriptazei. După încheierea sintezei catenei complementare (legată covalent de catena matriţă) se elimină bucla monocatenară prin folosirea unei nucleaze (nucleaza S1). Pentru a alege celulele în care gena de interes s-a integrat. Pornind de la acest capăt. ADN complementar monocatenar obţinut prin reverstranscriere are la capătul 3' o buclă în "ac de păr". formată prin interacţiunea intramoleculară a bazelor componente. izolat din anumite tipuri de celule. folosite ulterior pentru purificarea de ARNm specific. Teoretic. după ce mai întâi se îndepărtează ARNm matriţă prin tratament cu RN-aza H (enzimă ce degradează în mod specific ARN din duplexul ARN-ADN). Deseori nu este posibil să se separe un anumit tip de ARNm. pornind de la ARNm total. reprezintă şi o sursă pentru obţinerea unor probe în vederea hibridizării. în acelaşi timp. Această copie monocatenară de ADN este convertită la forma dublu catenară cu ajutorul unei ADNpolimeraze "normale". în ADN complementar (ADNc). este necesar să se analizeze un număr foarte mare de clone recombinate. cu ajutorul unei ADN polimeraze. 61 . sau doar a unei porţiuni din ea.95 sau 0. în aceste situaţii fiind preferată varianta obţinerii bibliotecilor de ADN complementar. Moleculele de ADNc prezintă importanţă pentru clonarea genelor dar. numărul de colonii ce trebuie analizate poate fi calculat pe baza următoarei ecuaţii: N = ln(1-p)/(1-n) unde N = numărul de clone de trebuie analizate p = probabilitatea de izolare a clonei dorite (de obicei 0. se iniţiază sinteza catenei complementare (bucla funcţionând ca "primer").

iar alta a fost izolată din celule de E.2. ADN dublu catenar sau chiar al ARN. ce conţin clonată gena corespunzătoare de la virusul leucemiei murine. pornind de la molecule lungi de ARNm. Se constituie astfel secvenţa primer necesară ADN polimerazei pentru a-şi începe acţiunea. Ulterior. cât şi o puternică activitate de RN-ază H. prin complementaritate la capătul 3' al ARNm (la nivelul secvenţei poliA). Enzima murină este alcătuită dintr-o singură catenă polipeptidică cu puternică activitate polimerazică şi o mai slabă activitate de RN-ază H.000 tipuri diferite de ARNm. pentru a identifica o anumită secvenţă ADNc trebuie analizate 106 clone. prin folosirea unei ADN-polimeraze corespunzătoare (ADN-polimeraza I) se sintetizează catena complementară a ADNc. Procesul începe prin adăugarea la amestecul de reacţie a unor oligonucleotide dT care se leagă. Terminal-transferaza Un tip special de ADN polimerază este terminal transferaza (TT) care adaugă mononucleotide la capătul 3’ OH liber al ADN monocatenar.coli (tulpini modificate genetic). pentru a identifica o clonă ce conţine ADNc de interes. Enzima aviană este alcătuită din două catene polipeptidice care prezintă atât activitate polimerazică.2.1. ştiind că n = 1000 (deci ARNm de la care s-a pornit pentru sinteza genei este relativ rar în celulele utilizate pentru purificare).TEHNOLOGIA ADN RECOMBINANT Spre exemplu. în anumite situaţii. eliberând catena de ADNc. În cazul celulelor mamaliene ce pot conţine aproximativ 20. acţiunea enzimatică nefiind dependentă de existenţa unei matriţe ADN. În prezent există două forme comerciale ale enzimei reverstranscriptază: una ce provine de la virusul mieloblastozei aviare (din culturi celulare infectate cu acest virus). pentru adăugarea unei singure nucleotide modificate de tipul dideoxinucleotidelor (in cazul experimentelor de secvenţiere). de obicei la nivelul unor fragmente de ADN sau. 2.3. Această slabă activitate RN-azică este considerată ca avantaj atunci când se doreşte sinteza de ADNc. obţinându-se o moleculă de ADN dublu-catenară ce poate fi inserată într-un vector adecvat. Hibrizi ARN-ADN obţinuţi sunt supuşi acţiunii RN-azei (de tip RN-aza H) a reverstranscriptazei: aceasta începe să degradeze matriţa de ARN. Activitatea enzimatică este condiţionată de prezenţa în amestecul de reacţie a ionilor de Co2+ 62 . este necesar să se analizeze 5000 de clone recombinate. Terminal transferaza este folosită în practică pentru adăugarea de extremităţi homopolimere.

1. Randamentul de obţinere a fragmentelor de ADN scade pe măsură ce lungimea catenei creşte. pe drept cuvânt. pornind de la fosfodiesteri.2. Sinteza s-a făcut sub forma unor mici fragmente oligonucleotidice. 2. Strategia adoptată pentru sinteza chimică a unor gene a implicat realizarea a două etape fundamentale. Obţinerea ADN de interes prin sinteză chimică Sinteza moleculelor mari de ADN pe cale pur chimică prezintă serie de dificultăţi care apar. şi anume: • • sinteza chimică a unor segmente oligodeoxinucleotidice cu lungimea medie de 8-12 unităţi. cu metodele biochimice ce asigură legarea oligonucleotidelor între ele. cu ajutorul ADN-ligazei. (1970). ca marcând debutul ingineriei genelor ca domeniu de activitate.TEHNOLOGIA ADN RECOMBINANT (preferaţi în cazul în care se doreşte adăugarea purinelor) sau Mg2+ (preferaţi pentru adăugarea pirimidinelor)(Cornea şi colab. Condensarea succesivă a blocurilor oligonucleotidice a determinat formarea unor secvenţe mai mari de oligonucleotide. Segmentele obţinute în acest mod sunt monocatenare. În aceste cazuri se combină metodele chimice care permit doar sinteza unor oligonucleotide cu o secvenţă dorită. cea care codifică sinteza ARNt pentru alanină. legarea „cap-coadă” a segmentelor respective. Aceste dificultăţi au determinat ca sinteza totală a unei gene să nu fie realizată numai prin metodele chimiei organice. Fiecare etapă de condensare este controlată şi însoţită de purificarea produsului obţinut. 1998). în principal.. efectuată de Khorana şi colab. 63 . În timpul reacţiilor de condensare are loc blocarea selectivă a grupărilor funcţionale ale nucleotidelor cu grupări chimice protectoare şi păstrarea liberă numai a acelor grupări care intră în reacţie în momentul dorit.3. într-o ordine identică celei din gena naturală. fiind apoi fosforilate la capătul 5' cu ajutorul kinazei de fag T4 după care se face legarea ordonată a segmentelor obţinute cu ajutorul ligazei. astfel că produşii finali se obţin în cantităţi mici. la asamblarea nucleotidelor pentru obţinerea catenelor polinucleotidice lungi. Prima sinteză chimică a unei gene. a fost considerată.

Sinteza chimică a ADN are o serie de avantaje: • permite producerea de gene funcţionale. lungă de aproximativ 40 nucleotide. 64 . pentru sinteza de ADN.TEHNOLOGIA ADN RECOMBINANT Itakura şi colab.coli. 2. Alte enzime utilizate în tehnologia ADN recombinant Pentru obţinerea moleculelor de ADN recombinant este necesară utilizarea unor enzime ce catalizează formarea legăturilor fosfodiesterice dintre extremităţile 3' OH şi 5' P ale fragmentelor de ADN participante la realizarea respectivelor molecule hibride. ca de altfel şi ADNc sintetizat pe baza ARNm matur. prin tehnologia PCR sau prin folosirea altei ADN polimeraze). Deoarece prezenţa intronilor blochează exprimarea unei gene de tip eucariot în E. se obţin primerii necesari proceselor de sinteză enzimatică a genelor (prin reverstranscriere. pentru a obţine genele de interes. (1970) au realizat o altă metodă. în sinteza chimică pot fi utilizaţi codonii cei mai potriviţi pentru gazda în care se doreşte exprimarea genei. • deoarece bacteriile şi celulele animale tind să utilizeze anumiţi codoni în mod preferenţial pentru un anumit aminoacid. Aceste enzime au fost denumite ADN-ligaze. legarea oligonucleotidelor între ele cu ajutorul ADN-ligazei. cuplarea trimerilor între ei pentru obţinerea de oligonucleotide cu secvenţa bazelor dorită. asigurând legarea unei nucleotide la fiecare 30 minute. Sinteza se realizează pe baza secvenţei de aminoacizi din proteina dorită. prin sinteză chimică s-au obţinut unele gene de dimensiuni mai mici (de exemplu. care este mai uşor de determinat. funcţională în E. secvenţele codificatoare ale insulinei umane) şi. asistate de un microprocesor.2.1. de asemenea. sunt capabile să sintetizeze ADN monocatenar pe baza unei secvenţe date (introdusă în computer). • în cursul sintezei chimice pot fi introduse substituiri de aminoacizi care modifică avantajos proprietăţile biologice ale proteinelor codificate de gena sintetică. sinteza chimică.coli. Aceasta presupune parcurgerea mai multor etape: • • • sinteza unor trimeri cu secvenţa bazelor prestabilită.4. mai rapidă. In prezent. În prezent există adevărate "maşini de fabricat gene" care. chiar dacă nu se cunoaşte secvenţa bazelor din ADN natural. furnizează o versiune scurtată a genei respective (ce conţine doar secvenţe exonice).

prin fragmente scurte care sunt unite ulterior într-o catenă continuă. Prin aceasta s-a definit şi rolul major al ADN-ligazelor ca parte integrantă a mecanismelor de replicare a ADN. Pentru a se putea realiza legarea fragmentelor de ADN. ADN fagic pătruns în celula bacteriană trece din forma lineară într-o formă circulară.). Pentru obţinerea sa se porneşte de la o cultură bacteriană de E. Pentru îmbunătăţirea randamentului de obţinere a enzimei a fost creat în mod artificial un bacteriofag λ în care a fost inclusă gena 34 provenită de la fagul T4 (gena răspunzătoare de sinteza ligazei). Aceste fapte au sugerat existenţa în celulele bacteriene a unor mecanisme de legare enzimatică a moleculelor lineare de ADN. In experimentele de inginerie genetică este preferată ADN-ligaza de fag T4.TEHNOLOGIA ADN RECOMBINANT Studiul ligazelor a început în urma observaţiilor experimentale efectuate asupra proceselor de recombinare. din care apoi se separă enzima activă. în procesul de infectare a E. la scăderea cu 60% a activităţii enzimei. Cu ajutorul acestei metode cantitatea de enzimă obţinută pornind de la 65 . activităţi similare acestei ligaze au fost observate şi într-o mare varietate de ţesuturi provenite de la organisme eucariote (în splina şi măduva osoasă de iepure. Pentru obţinerea ligazei se face inducţia fagului cu ajutorul temperaturii (42oC) şi apoi se procedează la purificarea enzimei.coli infectate cu bacteriofagul T4 cât şi în cele neinfectate. Cu acest bacteriofag a fost lizogenizată o tulpină de E.coli. procese în care au loc ruperi şi apoi reuniri ale moleculelor de ADN. în concentraţie optimă de 10mM ditiotreitol. de asemenea. datorită proprietăţilor sale. infectată cu bacteriofagul T4. După descoperirea ligazelor din E. Identificarea acestor enzime a coincis cu ipoteza enunţată de Okazaki privind mecanismul de replicare segmentară a ADN. în mieloame murine etc. Înlocuirea ditiotreitolului cu β -mercaptoetanol duce. în microsporocitele de crin că şi în celulele infectate cu virusul sarcomului Rous.coli cu bacteriofagul λ . este necesar că în amestecul de reacţie să existe o serie de elemente: • • • cofactorii specifici ai ligazei (NAD pentru ligaza de E. în absenţa sa activitatea enzimei se reduce la 25% (fig.28). ca şi prin constatarea faptului că. In anul 1967 a avut loc descoperirea enzimelor implicate în procesele amintite mai sus atât în celulele de E.coli B.coli neinfectate cu bacteriofagi. Aceste date demonstrează existenţa ADN ligazelor la toate organismele vii.coli şi ATP pentru ligaza de fag T4) ioni de magneziu. ele fiind esenţiale pentru replicarea materialului genetic şi pentru menţinerea integrităţii sale.

TEHNOLOGIA ADN RECOMBINANT acelaşi volum de cultură bacteriană este de 500 ori mai mare. Fosfataza alcalină bacteriană este mai activă decât cea eucariotă. ceea ce determină defosforilarea fragmentelor respective. folosirea EDTA sau încălzirea la 75oC.29. se poate recunoaşte şi activitatea ligazei. este termostabilă şi rezistă la acţiunea unor detergenţi. acţiunea enzimei este inhibată prin diferite metode: tratament cu proteinază K. în scopul prevenirii autocircularizării plasmidelor sau „autolegarea” 66 . Cele două forme. Enzima poate fi de origine bacteriană sau poate fi izolată din intestin de viţel. fosfataza alcalină este utilizată pentru îndepărtarea grupării fosfat de la capătul 5' al ADN. Ligaza de fag T4 este capabilă de a lega atât fragmentele de ADN cu extremităţi coezive cât şi fragmente cu extremităţi drepte (fig. în consecinţă. Modalităţile de acţiune ale ADN ligazei de fag T4 Fosfataza alcalină este o enzimă care catalizează îndepărtarea grupării fosfat de la capătul 5' al ADN sau ARN. Cel mai adesea. circulară şi lineară migrează diferit în gel de agaroză şi. Testarea activităţii enzimatice în procesul de purificare se realizează prin mai multe procedee dintre care. cel mai rapid presupune reconvertirea ADN plasmidial linearizat la forma circulară.29). Pentru blocarea reacţiei de defosforilare. a) legarea fragmentelor de ADN cu extremităţi coezive 5’ … pApCpG-OH pGpApTpCpCpGpT … 3’ 3’ … TpGpCpCpTpApGp OH-GpCpAp …5’ ATP Mg2+ 5’ … pApCpGpGpApTpCpCpGpT … 3’ 3’ … TpGpCpCpTpApGpGpCpAp …5’ b) legarea fragmentelor de ADN cu capete drepte 5’ … pApCpGpG-OH pApTpCpCpGpT … 3’ 3’ … TpGpCpCp OH-TpApGpGpCpAp …5’ ATP Mg2+ ↓ 5’ … pApCpGpGpApTpCpCpGpT … 3’ 3’ … TpGpCpCpTpApGpGpCpAp …5’ Fig.

Reprezentarea schematică a utilizării fosfatazei alcaline în experimentele de clonare moleculară Polinucleotid-kinaza de fag T4 este utilizată pentru transferul unui grup fosfat de la ATP la capătul 5' al ADN sau ARN.TEHNOLOGIA ADN RECOMBINANT fragmentelor obţinute prin acţiunea unor enzime de restricţie care generează capete coezive (fig.30). Datorită acestei acţiuni. Fig. Atunci când plasmidele linearizate defosforilate sunt utilizate pentru clonare (pentru introducerea la nivelul lor a unor fragmente de ADN şi apoi tratare cu ligaza) ele sunt supuse unor tratamente specifice care inhibă acţiunea fosfatazei alcaline.30. enzima poate fi utilizată pentru marcarea radioactivă a capetelor 5' ale ADN în experimentele de secvenţiere prin metoda Maxam şi Gilbert sau pentru analiză cu nucleaza S1 67 . ea având o acţiune inversă fosfatazei alcaline.

68 . generând fragmente de dimensiuni mari. să i se cunoască secvenţa de nucleotide. Pentru a putea fi utilizat în experimentele de clonare. acizii nucleici dublu-catenari sunt digeraţi complet în prezenţa unor cantităţi mari de nuclează S1. pentru îndepărtarea cozilor monocatenare de la nivelul fragmentelor de ADN determinând formarea de extremităţi drepte. iar replicarea să fie sensibilă la temperatura corpului mamiferelor). De regulă.TEHNOLOGIA ADN RECOMBINANT şi pentru fosforilarea linkerilor sintetici sau a altor fragmente de ADN la care lipsesc grupările 5' fosfat necesare pentru legare. să fie uşor de purificat. să prezinte siguranţă în folosire (să aibă o transmisibilitate redusă în prezenţa unor plasmide conjugative. 2.3. Utilizarea în experimente a unor cantităţi moderate de enzimă determină clivarea acizilor nucleici dublu-catenari doar la nivelul unor crestături. Această enzimă poate fi utilizată pentru: analizarea structurii hibrizilor ADN–ARN. Nucleaza S1 este o enzimă izolată din Aspergillus oryzae. ADN sau ARN dublu-catenar precum şi hibrizii ADN-ARN prezintă rezistenţă la acţiunea acestei enzime. la nivelul unor regiuni neesenţiale ale vectorului. Vectori de clonare Un vector de clonare reprezintă o moleculă de ADN în care este integrat fragmentul de ADN de interes obţinându-se molecule recombinate. Cu toate acestea. suficiente pentru experimentele de clonare. fi rezistenţa la antibiotice). care determină degradarea ADN sau ARN monocatenar generând mono.1. să aibă mai multe situsuri unice de clivare cu enzime de restricţie.sau oligonucleotide 5’ fosfat. • • să aibă o greutate moleculară mică şi să prezinte cât mai multe copii per celulă (eventual să fie amplificabil prin tratament cu cloramfenicol). Acestea sunt apoi introduse într-o gazdă specifică pentru exprimarea informaţiei genetice noi. pentru crestarea buclei de tip “ac de păr” formată în cursul procesului de reverstranscriere. să permită obţinerea unor cantităţi mari. un vector trebuie să îndeplinească mai multe condiţii: • • • • să prezinte markeri genetici selectabili (cum ar.

este amplificabilă prin tratament cu cloramfenicol. s-a preferat prelucrarea lor "in vitro". pentru mult timp. • să conţină secvenţe specifice de ADN ce permit selecţia rapidă a clonelor recombinate (selecţie directă pe medii specifice sau selecţie prin teste histochimice). terminatori. activatori (enhanceri) ce asigură transcrierea "in vitro" a ADN clonat. este uşor de purificat. denumită pBR322. să conţină secvenţe specifice de tip promotori.coli. • • să prezinte secvenţe care să asigure generarea de molecule monocatenare necesare tehnicilor de secvenţiere sau pentru construirea de sonde de ADN. care asigură exprimarea mai eficientă a genelor clonate (de exemplu. să conţină un număr crescut de situsuri unice de restricţie grupate la nivelul unei regiuni specifice numită situs multiplu de clonare ("multiple cloning site"). care să permită obţinerea unei eficienţe mari în experimentele de clonare de gene. Deşi multe dintre plasmidele naturale îndeplinesc o parte dintre caracteristicile unui vector ideal. 69 . Această plasmidă. Boyer şi colab. prezintă o replicare relaxată. pMB1 (derivat de la ColE1) şi RSF2124.TEHNOLOGIA ADN RECOMBINANT Cercetările efectuate până în prezent asupra particularităţilor vectorilor de clonare au determinat completarea caracteristicilor deja menţionate cu altele noi pe care ar trebui să le îndeplinească vectorii ideali: • • să prezinte dimensiuni din ce în ce mai reduse dar să permită clonarea unor fragmente mari de ADN heterolog. vectorul cel mai frecvent utilizat în clonarea de gene în E. în sensul eliminării sau adăugării anumitor secvenţe. au "construit" în laborator o plasmidă hibridă. pornind de la trei plasmide naturale: pSC101. vectorii de exprimare). Cei mai cunoscuţi şi mai utilizaţi vectori de clonare sunt cei derivaţi de la plasmidele bacteriene.9 MDa). conţinând 4362pb (2. Dintre particularităţile plasmidei pBR322 menţionăm: • • • • are dimensiuni mici. Perfecţionarea tehnicilor de prelucrare „in vitro” a materialului genetic a permis înlocuirea acestui vector (şi a derivaţilor săi) cu vectori noi. În acest fel. având un număr mare de copii/celulă (conţine secvenţa ori de la plasmida ColE1). a reprezentat.

Sal I etc. Fig.TEHNOLOGIA ADN RECOMBINANT • conţine doi markeri genetici de selecţie: gena de rezistenţă la tetraciclină (derivată de la plasmida pSC101) şi gena de rezistenţă la ampicilină (derivată din plasmida RSF2124). Hind III. în funcţie de posibilitatea studierii exprimării fragmentelor de ADN clonate: • vectori de clonare (permit doar clonarea unei anumite secvenţe de ADN. pot fi: vectori plasmidiali. vectorii hibrizi pot fi fagimide (cu structură hibridă.coli. de plasmidă şi de fag filamentos) sau cosmide (cu structură hibridă. permite clonarea inserţională deoarece conţine situsuri unice de restricţie în genele marker: Bam HI în gena de rezistenţă la tetraciclină şi Pst I în gena de rezistenţă la ampicilină (fig. în funcţie de structură şi mod de funcţionare. • • are mai multe situsuri unice de restricţie pentru diferite enzime de restricţie: EcoRI. deoarece nu conţin secvenţe promotor) 70 . vectori de clonare mai pot fi clasificaţi şi în funcţie de alte criterii (Stoica. pentru clonarea de gene în celulele de E.31. 1997): 1. de genom de fag λ şi de plasmidă). nu şi analiza exprimării sale. au fost construiţi vectori specifici pentru acestea. Pst I. Vom prezenta în continuare principalele tipuri de vectori de clonare pentru E.31). Pe lângă aceste categorii corespunzătoare originii lor. Bam HI.coli se pot folosi mai multe tipuri de vectori care. vectori virali şi vectori hibrizi.coli dar. ori = originea replicării plasmidei În general. Majoritatea vectorilor de clonare obţinuţi până în prezent sunt specifici pentru E. Tetr =gena de rezistenţă la tetraciclină. Harta genetică a plasmidei pBR322 Ampr = gena de rezistenţă la ampicilină. La rândul lor. pentru că în experimentele de clonare sunt utilizate gazde foarte variate. ei fiind prezentaţi într-un capitol următor.

inclusiv exprimarea fragmentului de ADN clonat. obţinerea de proteine de fuziune) 2. în funcţie de tehnica folosită pentru clonarea fragmentului de ADN de interes: • • vectori de clonare inserţională (ADN de interes este introdus la nivelul unui situs unic de restricţie din vector) vector de clonare prin înlocuire (ADN străin înlocuieşte un fragment din vector.TEHNOLOGIA ADN RECOMBINANT • vectori de exprimare (au în structura lor secvenţe promotor. pUC19). determinând. denumirea vectorilor reprezentând locul unde aceştia au fost obţinuţi (plasmid of University of California). Ei sunt derivaţi de la pBR322. după fragmentarea acestuia cu două enzime de restricţie). 71 . Aceşti vectori au fost construiţi între anii 1982-1985 de către grupul de cercetători conduşi de Messing.32). Un grup modern de vectori plasmidiali este reprezentat de vectorii de tip pUC (pUC 18. 3. prin includerea genei lacZ' (partea din gena pentru β -galactozidază ce codifică secvenţa NH2-terminală a proteinei = peptidul α ce conţine primii 145 de aminoacizi din cei 1023 câţi are fiecare dintre catenele tetramerului β -galactozidaza) şi a unei secvenţe sintetice (polilinker de 54 perechi de baze) ce conţine situsuri unice de recunoaştere pentru mai multe enzime de restricţie (13 enzime de restricţie)(fig. în anumite situaţii. astfel că permit. în funcţie de spectrul de gazde (posibilitatea replicării şi menţinerii stabile a vectorului): • • vectori congenerici (pot fi folosiţi doar la organisme aparţinând aceluiaşi gen taxonomic) vectori de tip "shuttle" (naveta) (se replică şi se menţin stabil în două gazde microbiene diferite).

la nivelul polilinkerului): aceste colonii manifestă rezistenţă la ampicilină şi sunt albe. X-gal (substrat cromogen). o asemenea tulpină este capabilă să degradeze analogul lactozei.33). Vector de clonare H2N 1 145 Bacteria mutantă care nu produce β-galactozidază COOH 41 1023 x Bacterie transformată capabilă să sintetizeze β-galactozidază Fig.33. prezenţa acestei gene permite selectarea clonelor recombinate (a celor care conţin plasmide în care a fost integrat un fragment de ADN străin. Reprezentarea schematică a procesului de complementaţie genică Sub acţiunea IPTG (inductor al genei lacZ).TEHNOLOGIA ADN RECOMBINANT Fig.32. 72 . În urma procesului de complementaţie genică. coloniile formate fiind albastre. tulpina defectivă dar purtătoare a vectorului nerecombinat este capabilă să refacă integral enzima β-galactozidaza.Reprezentarea schematică a vectorilor de tip pUC (pUC 18 şi pUC 19) Prezenţa fragmentului din gena lacZ permite complementaţie intraalelică de tip α cu o altă formă defectivă a genei lacZ' (ce codifică regiunea COOH-terminală a β galactozidazei – formei respective de peptid îi lipsesc aminoacizii din poziţiile 11-41 existenţi în β -galactozidază) dintr-o gazdă bacteriană adecvată (fig. De asemenea. în timp ce coloniile nerecombinate sunt albastre (în prezenţa X-gal şi a inductorului specific = IPTG).

Vectori derivaţi de la fagul λ Aşa cum se cunoaşte. Aceşti vectori au fost obţinuţi prin introducerea unor modificări importante la nivelul genomului fagului λ : deleţii la nivelul regiunii de imunitate. Vectorii λ Charon sunt vectori care permit doar clonarea unui anumit fragment de ADN străin. 73 . fiind folosiţi. bacteriofagul λ are un genom reprezentat de o moleculă lineară de ADN dublu catenar. complementare (coezive) de 12 nucleotide (situsul cos).3. care permit circularizarea ADN fagic în celulele bacteriene infectate (tulpini de E. fagul λ poate prelua. mutaţii la nivelul genelor pentru proteinele capsidale A şi B. nu şi exprimarea sa. pornindu-se de la genomul fagului λ . ea poate fi ori eliminată complet. ştiind că regiunea centrală a genomului viral (aproximativ o treime din genom) nu este esenţială pentru evoluţia litică. numărul mare de situsuri de recunoaştere pentru enzime de restricţie. ca fag transductor. etc. doar scurte secvenţe de ADN din genomul gazdei în care s-a multiplicat (după ce a parcurs ciclul lizogen).coli). dimensiunea acestora fiind limitată de capsida fagică. plasate la nivelul unor regiuni esenţiale pentru evoluţia litică a fagului limitează utilizarea sa ca vector de clonare. Cu toate acestea. pentru obţinerea bibliotecilor de gene (colecţie de vectori recombinaţi ce conţin fragmente de restricţie de ADN genomic de la o anumită specie). La capetele acestei molecule lineare se găsesc secvenţe specifice. de obicei. În forma sa naturală. după ce acesta a fost tratat cu două enzime de restricţie ale căror situsuri de acţiune flanchează respectiva regiune virală. deleţia genelor necesare ataşării şi integrării. prin prelucrări "in vitro" au fost construiţi o serie de vectori de clonare. Mai mult. ori înlocuită cu ADN de interes. Vectorii de înlocuire (substituţie) se caracterizează prin faptul că ADN heterolog înlocuieşte un fragment neesenţial din vector. De asemenea. situsurile de restricţie au fost plasate în poziţiile cele mai favorabile pentru clonare. Din această categorie fac parte vectorii de tip λ Charon şi λ EMBL.1. iar prin folosirea oligonucleotidelor sintetice.1. genomul fagului λ a fost modificat: au fost eliminate situsurile de restricţie din zonele esenţiale. ce conţine 48502 perechi de baze. încadraţi în două categorii: vectori de înlocuire şi vectori de inserţie. Asemenea vectori permit clonarea unor fragmente de ADN de 9-23 kb. mutaţii la nivelul genei cI (vectorul nu poate fi menţinut în stare lizogenă).TEHNOLOGIA ADN RECOMBINANT 2. Pentru a se putea obţine asemenea vectori.

produse la nivelul tulpinii bacteriene sensibile. obţinându-se vectorul recombinat.34). lizogene pentru fagul P2. Din această categorie fac parte vectorii de tip λ gt şi cei de tip λ ZAP. BamHI şi SalI.coli recA-) se realizează selecţia fagilor recombinaţi din plajele de liză. atât vectorul cât şi ADN străin sunt trataţi cu o aceeaşi endonuclează de restricţie (al cărei situs se regăseşte la nivelul MCS din vector). astfel că aceasta poate fi înlocuită de ADN străin.34. Fig. deci nu produc plaje de liză)(fig. Charon 40) prezintă două grupe de situsuri de clonare (MCS) la capetele unei regiuni neesenţiale a ADN viral. fragmentele rezultate se amestecă şi se tratează cu ligază. localizat la nivelul unei gene neesenţiale pentru evoluţia litică a fagului. Genele de interes ce sunt clonate la nivelul unor asemenea vectori înlocuiesc regiunea virală neesenţială. ei fiind analizaţi ulterior pentru determinarea caracteristicilor fragmentului de ADN clonat. Vectorii λ EMBL sunt tot vectori de clonare prin înlocuire. deci formarea de plaje de liză). La nivelul regiunii neesenţiale se găsesc genele red şi gam implicate în recombinare (prezintă deci fenotip Spi+. MCS = situs de policlonare ce conţine secvenţele de recunoaştere pentru enzimele de restricţie EcoRI. fără a afecta funcţionarea vectorului. 74 . Vectorii de inserţie se caracterizează prin faptul că ADN de interes este clonat la nivelul unui situs unic de restricţie. gam = gene fagice. ceea ce înseamnă că în gazde lizogene pentru fagul P2 asemenea vectori nu se pot dezvolta. După introducerea vectorului recombinat într-o gazdă corespunzătoare (E. Pentru a se realiza clonarea. Reprezentarea schematică a vectorului λ EMBL 4: A-R = gene ale bacteriofagului λ. Selecţia vectorilor recombinaţi se realizează în gazde specifice. prin apariţia plajelor de liză (eliminarea genelor red şi gam determină apariţia fenotipului Spi-. red.TEHNOLOGIA ADN RECOMBINANT Vectorii de acest tip (Charon 4A. trp = genă ce codifică sinteza triprofanului. la care regiunea neesenţială a genomului viral este flancată de două situsuri de policlonare (MCS).

2kb) cât şi exprimarea acestuia sub forma unei proteine de fuziune cu β -galactozidaza. Vectorul λ gt 11 permite atât clonarea unui fragment de ADN heterolog (de până la 7.(nu mai are loc complementaţia genetică în gazdele corespunzătoare)(fig. ce permit introducerea unor fragmente mici de ADN străin (de până la 6kb). situsul unic de restricţie (EcoRI) la nivelul căruia se poate clona ADN de interes se găseşte la nivelul regiunii de imunitate. În acest fel. Asemenea vectori pot fi utilizaţi pentru experimente de secvenţializare a ADN şi ARN. Fig. MCS = situs de policlonare. Reprezentarea schematică a vectorului λ gt 11 Vectorii de tip λ ZAP sunt vectori de inserţie complecşi. 36. deci sunt capabili de a lizogeniza în gazdele corespunzătoare.3. ei producând plaje de liză caracteristice. incapabili de lizogenie.36).2.TEHNOLOGIA ADN RECOMBINANT Vectorii λ gt sunt vectori de clonare şi exprimare. la nivelul regiunii centrale neesenţiale. vectorii nerecombinaţi sunt cI+. vectorul pBluescript SK (M13-)(fig. în care se integrează ADN de interes se află localizat la nivelul genei lacZ. deoarece situsul unic de restricţie. În acest fel. sub formă de monocatene + 2. EcoRI.35). În cazul vectorului λ gt 10.35. La nivelul genei lacZ' din pBluescript. T = secvenţe semnal pentru iniţierea/terminarea exciziei fagimidului pBluescript. în situsul multiplu de clonare. în locul genelor virale.1. Din aceasta categorie menţionăm vectorii λ gt 10 şi λ gt 11. Fig. vectorii λ gt 11 recombinaţi determină fenotipul de tip Lac.Vectorii hibrizi de tip cosmide 75 . I. Ei conţin. Reprezentarea schematică a unui vector de tip λ ZAP: A-R = gene fagice. pentru obţinerea de proteine de fuziune cu β -galactozidaza. se poate introduce ADN de interes (până la 10kb). pentru obţinerea de sonde ARN cu ajutorul promotorilor T3 şi T7 ce flanchează ADN clonat. vectorii recombinaţi au fenotip cI-.

formată din 1-23 copii repetate în tandem ale unui fragment de 2kb derivat din pBR322. De asemenea.1. în funcţie de numărul de copii ale secvenţei de 2kb (de la 0 la 23 copii). gena de rezistenţă la ampicilină). O categorie specială de cosmide sunt cele de tip Charomid. o genă marker). conţin: 76 . pe lângă elementele specifice ale unei cosmide (secvenţa cos. cosmidele se pot replica şi menţine ca plasmide (permiţând selecţia coloniilor purtătoare pe mediu ce conţine antibioticul corespunzător) sau. Asemenea vectori permit clonarea la nivelul lor a unor fragmente mari de ADN străin (de până la 45 kb). în condiţii specifice. ce conţin secvenţa cos de la fagul λ necesară împachetării ADN în particulele fagice. Deoarece în cosmide se pot insera fragmente mai mari de ADN. cosmidele prezintă originea replicării de la plasmida ColE1 şi un marker de selecţie (de obicei. ce combină caracteristicile vectorilor de tip plasmidiali cu cele ale fagilor filamentoşi. ele sunt preferate în experimentele de realizare a băncilor genomice la eucariote. Variaţia dimensiunii secvenţei spaţiatoare determină dimensiunea fragmentului de ADN ce poate fi clonat într-un asemenea vector: micşorarea dimensiunii secvenţei spaţiatoare este însoţită de posibilitatea introducerii unui fragment mai mare de ADN de interes.TEHNOLOGIA ADN RECOMBINANT Aceşti vectori reprezintă plasmide modificate. vectorii Charomid trebuie menţinuţi în gazde recA(incapabile de recombinare). Prin transferul lor în gazde recA+ se realizează destabilizarea regiunii spaţiatoare şi apariţia unor molecule Charomid cu dimensiuni variate.3. Fagimidele. Vectorii hibrizi de tip fagimide Fagimidele sau plasmidofagii reprezintă o categorie specială de vectori. Vectorul recombinat rezultat este împachetat în particule fagice λ (2-45 kb). conţin o secvenţă spaţiatoare. prin folosirea unor fagi ajutători. originea replicării.2. În acest fel. Vectorii de tip Charomid sunt mult utilizaţi în experimentele de obţinere a băncilor genomice pentru ADN de origine mamaliană. Datorită prezenţei secvenţei spaţiatoare. fiind propagate prin transducţie sau transfecţie (transformarea celulelor sensibile cu ADN izolat din particule fagice recombinate). flancată de două situsuri de restricţie pentru endonucleaza AvaI. ele se pot împacheta în particule fagice. comparativ cu vectorii derivaţi de la fagul λ . datorită prezenţei situsului cos. în cea mai simplificată formă. Acestea. 2. favorizând în acest fel propagarea unor gene eucariote întregi.

respectiv pUC19.TEHNOLOGIA ADN RECOMBINANT • • • originea replicării de la plasmida ColE1 (asigură menţinerea vectorului în forma plasmidială).37). fagimidele pot fi propagate şi menţinute stabil în forma plasmidială într-o tulpină bacteriană cultivată în condiţii normale de mediu (pe mediu selectiv ce conţine antibioticul corespunzător). la nivelul unui MCS localizat la nivelul unei gene ce permite rapida selecţie a vectorilor recombinaţi. în prezenţa IPTG). copie a unei secvenţe dintr-un fag filamentos (de obicei M13 sau f1). sinteză de β-galactozidază etc). Vectorii de tip pBluescript sunt vectori multifuncţionali. ce conţine informaţia genetică pentru replicarea ADN viral şi pentru morfogeneza particulelor fagice. ADN monocatenar purificat din asemenea particule poate fi utilizat pentru procesele de secvenţiere a fragmentelor de ADN clonate sau pentru obţinerea de sonde moleculare (de ADN monocatenar). iar ADN este împachetat în particule fagice (ca ADN monocatenar circular). Datorită acestor caracteristici. Dintre cele mai cunoscute şi utilizate fagimide menţionăm pUC118/pUC119 şi pBluescript. Atunci când celulele gazdă sunt infectate cu un fag filamentos ajutător ("helper"). genă marker de selecţie (rezistenţă la antibiotice. şi conţin: originea replicării din ColE1. construiţi pentru a simplifica clonarea moleculară şi analiza genetică (fig. gena lacI ce codifică represorul Lac I al operonului lac. sunt activate funcţiile virale. un situs MCS localizat la nivelul genei lacZ'. precedată de secvenţele promotor şi operator proprii. În felul acesta. Clonarea ADN de interes se face la nivelul MCS determinând blocarea sintezei de peptid α. selecţia clonelor recombinate se va face pe baza testelor histochimice (colonii albe/albastre pe mediu cu X-gal. 77 . originea replicării fagului filamentos M13. gena lacZ' (gena lacZ mutantă. Primul grup de fagimide derivă din plasmidele pUC18. ADN heterolog poate fi integrat într-un asemenea vector. ce codifică peptidul α ).

Bam HI. Xho I. Kpn I. Cla I. 78 . Spe I. Eco RV. Hinc II. Comparativ cu celelalte tipuri de vectori.37. Acc I. Xba I. • • selecţia rapidă a clonelor recombinate (teste histochimice: pe mediu cu X-gal şi IPTG coloniile recombinate sunt albe) transcrierea eficientă ”in vitro” a ADN heterolog. excizată. Cei doi promotori se găsesc în orientare inversă unul faţă de celălalt şi. lac I= gena reglatoare a operonului lac. ce conţine 20 situsuri diferite de restricţie (SacI. ADN heterolog clonat poate fi transcris de pe oricare dintre cele două catene. Sal I. Apa I. mediată de promotorii T3 şi T7. ca urmare. Not I. iar întreaga secvenţă este flancată de câte un situs pentru endonucleaza de restricţie Bss H II (situs foarte rar în genomuri). Hind III. Sma I. MCS = situs multiplu de clonare. ori f1 (+) = originea replicării ca fag filamentos. fagimidele pBluescript oferă unele avantaje în procesul de clonare: • clonare la nivelul unui MCS (polilinker). Regiunea este încadrată de promotorii fagici T3 şi T7. în funcţie de orientarea pe care o are în molecula de vector recombinat şi de activarea specifică a unuia sau altuia dintre promotorii fagici.TEHNOLOGIA ADN RECOMBINANT Fig. lac Z’= gena pentru sinteza β galactozidazei. Apr = gena de rezistenţă la ampicilină. Bst XI. cu ajutorul căreia poate fi. T3 şi T7 = promotori specifici derivaţi de la fagii T3 şi T7. deci. ori = originea replicării plasmidei (derivat de la ColE1). Eag I. Dra II. Pst I. Reprezentarea schematică a vectorului pBluescript SK+/-. Eco RI.

ataşarea fagilor la nivelul pililor de sex. facilitându-se în acest fel purificarea sa. Produsul acestei gene virale va acţiona preferenţial asupra secvenţei ori-f1 din fagimid. ceea ce asigură obţinerea unor cantităţi importante de proteine de interes. Vectorii de exprimare Scopurile foarte variate ale experimentelor de inginerie genetică au determinat o permanentă perfecţionare a vectorilor utilizaţi. ADN inserat la nivelul MCS poate fi transcris ”in vitro” atunci ADN plasmidial recombinat linearizat este incubat cu ARN polimeraza corespunzătoare şi cu precursorii de ribonucleotide. astfel încât aceştia să asigure succesul clonării în gazdele corespunzătoare. declanşând replicarea ADN pe modelul fagilor filamentoşi. Pentru a putea infecta gazda bacteriană cu un fag filamentos (cu M13) este necesar ca tulpina bacteriană să fie de tip Hfr. fagimida pBluescript poate fi 79 .1. sau la capătul unei secvenţe semnal.3. astfel încât să prezinte pili de sex la suprafaţa peretelui celular. Din acest punct de vedere. ei permiţând fie obţinerea ARNm pentru gena de clonată. In acest fel. tulpina bacteriană în care se află vectorul recombinat este infectat cu un fag M13 defectiv ce conţine gena II mutantă.TEHNOLOGIA ADN RECOMBINANT • obţinerea de monocatene de ADN datorită existenţei secvenţelor de origine virală (fag filamentos).4. ca primă etapă. • obţinerea de proteine de fuziune formate din proteina codificată de ADN heterolog şi β -galactozidaza). 2. Pentru a obţine ADN monocatenar. T7 şi/sau SP6 alături de situsul multiplu de clonare (MCS). fie sinteza polipeptidului codificat de aceasta. Proteina de fuziune rezultată poate fi apoi transportată în citoplasmă. Unii vectori plasmidiali de exprimare poartă promotori derivaţi de la bacteriofagii T3. ADN monocatenar rezultat va conţine catena sens sau cea antisens a genei lac Z’. Grupul vectorilor de exprimare este foarte heterogen. în urma clonării se obţine o genă hibridă formată din gena de interes fuzionată cu o genă marker. Vectorii de acest tip conţin situsuri de clonare plasate sub controlul unor promotori puternici. Procesul de infectare a unei bacterii de către un fag filamentos presupune. ARNm sintetizat poate fi sens (dacă gena a fost clonată şi citită în sensul corect) sau antisens (dacă gena a fost clonată în poziţie inversă celei normale). În funcţie de orientarea regiunii de origine a replicării virale.

de iniţiere a genelor eucariote.TEHNOLOGIA ADN RECOMBINANT considerată că fiind un vector de exprimare deoarece situsul multiplu de clonare prezintă la un capăt promotorul T3 şi la celălalt promotorul T7 (fig. gfp (pentru “green fluorescence protein”.38). în funcţie de tipul de ARN polimerază utilizată în reacţia de transcriere. situsul de legare la ribosomi şi regiunea aminoterminală sunt reprezentate de secvenţe ale vectorului. De asemenea. În acest fel. gena clonată la nivelul MCS poate fi transcrisă prin folosirea alternativă drept matriţă a ambelor catene de ADN. clonarea ei se face în aşa fel încât să conducă la obţinerea unei proteine de fuziune.37). unii vectori ce conţin această genă mai prezintă la nivelul MCS un situs Nco I (CCATGG) ce cuprinde codonul ATG. la nivelul capătului 3’ al acesteia (deci în regiunea ce codifică extremitatea COOH a proteinei β -galactozidaza) s-a introdus o secvenţă oligonucleotidică sintetică (polilinker) ce conţine situsul de recunoaştere al mai multor enzime de restricţie (secvenţa MCS). Producerea unor asemenea proteine de fuziune conduce la exprimarea unor fragmente scurte de gene şi. În acest fel. De asemenea. astfel încât produsul rezultat în urma traducerii acestei secvenţe de ADN să conţină secvenţe de aminoacizi derivate de la ambele gene. În cazul vectorilor de clonare ce conţin gena lac Z. atunci când se doreşte exprimarea unei gene ce nu conţine nici o secvenţă recunoscută de echipamentul enzimatic procariot.coli şi obţinerea de proteine de fuziune este pGEX 4T1 (fig. Proteinele de fuziune sunt obţinute prin unirea a două secvenţe cu cadru de citire deschis (“open reading frame”). consecutiv. Un vector utilizat foarte frecvent pentru clonarea de gene în E. 80 . Promotorul. ceea ce asigură transcrierea şi traducerea eficientă a produsului de fuziune. Moleculele de ARN sintetizate în acest mod pot reprezenta probe pentru hibridizare sau pot fi traduse la proteinele corespunzătoare în sisteme acelulare. la separarea domeniilor funcţionale din interiorul unor proteine complexe. ceea ce le asigură protecţie faţă de acţiunea proteazelor gazdei şi identificare rapidă (pe baza activităţii enzimei β-galactozidaza). genă izolată de la meduza Aequorea victoria). Dintre genele folosite pentru obţinerea proteinelor de fuziune menţionăm: lac Z. gst (pentru glutation S-transferaza). gena pentru proteina A de la Staphylococcus aureus etc. genele clonate la nivelul MCS sunt exprimate ca proteine de fuziune cu β-galactozidaza.

ce codifică o succesiune de patru aminoacizi. Clonarea la nivelul MCS a unei gene de interes determină sinteza unei proteine de fuziune (GST + proteina codificată de gena clonată). Aşa cum se observă în fig. Eluarea proteinei de fuziune se face în condiţii nedenaturante. gena lacI ce controlează. Purificarea proteinei se realizează prin cromatografie de afinitate. care sub acţiunea GST este convertit la un compus de culoare galbenă ce poate fi detectat şi măsurat colorimetric). prin represorul codificat. în funcţie de varianta de vector) ce asigură separarea produsului de interes de proteina GST (codificată de vector). la începutul căreia a fost introdusă o secvenţă caracteristică. prin trecerea lizatului celular pe o coloană de Sefaroza 4G. La extremitatea 3' a acestei gene se află regiunea MCS. Această proteină de fuziune poate fi detectată prin tehnici imunologice (interacţiune specifică cu anticorpi anti-GST) sau prin tehnici biochimice (incubarea proteinei de fuziune cu un substrat cromogen = 1-cloro2. vectorul pGEX 4T-1 conţine elementele genetice necesare funcţionării în E. diferenţele dintre ei fiind datorate fie situsurilor unice de restricţie de la nivelul MCS. reprezentând situsul de recunoaştere pentru o protează (factorul Xa.dinitrobenzen. fie situsului de recunoaştere pentru o protează specifică (pentru factorul Xa sau pentru trombină) plasat în faţa MCS.TEHNOLOGIA ADN RECOMBINANT Fig. Reprezentarea schematică a plasmidei pGEX 4T-1 Acesta face parte dintr-o familie de vectori de tip GEX. utilizând glutation redus care asigură menţinerea funcţiilor proteinei de interes şi caracterul antigenic al acesteia. pe care s-a imobilizat glutation. După purificare.coli: originea replicării de la pBR322. gena de rezistenţă la ampicilină (Apr). trombină = Tr sau o protează recombinată. proteina de fuziune este tratată cu proteaza corespunzătoare (în exemplul dat este vorba 81 . Gena gst ce codifică enzima glutation S-transferaza a fost izolată de la Schistosoma japonicum şi clonată sub controlul unor elemente genetice ce-i asigură o exprimare foarte eficientă.38. transcrierea genelor plasate sub controlul promotorului inductibil tac şi a operatorului lac.4.38.

care clivează ADN la situsuri specifice palindromice. 1. 2002).1. de obicei de fag T4. prin formarea legăturilor de hidrogen la nivelul capetelor monocatenare. In schimb. datorită extremităţilor monocatenare complementare identice. iar a doua zi. peste noapte. cele mai importante vor fi descrise în continuare. eluatul obţinut este trecut pe o a doua coloană (ce conţine glutation imobilizat). Astfel. 2. Modalitatea cea mai simplă de incorporare este aceea care utilizează fragmentele obţinute cu ajutorul enzimelor de restricţie de tipul II. 82 . Hibridul molecular respectiv este utilizat pentru a transforma celulele bacteriilor receptoare (gazda obişnuită a experimentelor de clonare).coli. producând capete monocatenare complementare. cu proteaza specifică (ea însăşi proteină de fuziune cu gena pentru GST). Pentru integrarea fragmentelor de ADN străin în vector se pot folosi mai multe variante experimentale. după care amestecul se tratează cu ligază.TEHNOLOGIA ADN RECOMBINANT despre trombină) care clivează situsul de recunoaştere şi separă cele două proteine: GST şi proteina de interes. Modalităţi de obţinere a moleculelor de ADN recombinant Clonarea moleculară reprezintă procesul de construire a unor molecule de ADN hibride (himere) prin inserţie de informaţie genetică străină într-un vector (vehicul) adecvat. utilizând aceeaşi enzimă de restricţie atât pentru clivarea ADN exogen cât şi a vectorului de clonare. ea fiind recuperată în fracţiunile corespunzătoare (Sigrell. In ultimii ani sistemul menţionat a fost perfecţionat. proteina de interes nu este reţinută.4.39). care reuneşte covalent moleculele respective (fig. Un asemenea protocol a permis obţinerea unor cantităţi importante de proteine de interes: de exemplu. după care se realizează legarea covalentă a acestor fragmente cu ajutorul ADN-ligazelor. legată de prima. în sensul purificării proteinei de interes într-o singură etapă: după legarea proteinei de fuziune de interes la coloana cromatografică are loc incubarea sa. Pentru obţinerea moleculelor de ADN hibride au fost imaginate mai multe procedee dintre care. a cărei genă a fost clonată într-un vector pGEX şi exprimată în E. a proteinelor de fuziune neclivate şi proteina GST liberă. Unirea iniţială a segmentelor de restricţie se face pe bază de complementaritate. capabil să se replice independent. se pot obţine molecule hibride indiferent de provenienţa ADN de interes. ce presupun sau nu prelucrarea "in vitro" a fragmentului de ADN dorit. se pot obţine 10 mg de proteină umană de legare a calciului (hipocalcin). care asigură legarea proteazei.

2. Hind II). Realizarea moleculelor de ADN hibrid prin metoda legării capetelor coezive produse de o enzimă de restricţie. În acest sistem de ligare "in vivo" a moleculelor. produse de anumite enzime de restricţie (Hae III. într-un vector de clonare corespunzător. prevenindu-se recircularizarea şi formarea dimerilor plasmidiali. Cu toate acestea.39. proporţia de celule transformate ce conţin molecule hibride este. transformarea bacteriilor gazdă se poate face direct cu amestec de fragmente de restricţie fără a utiliza ligaza de fag T4. În acest caz. 83 .TEHNOLOGIA ADN RECOMBINANT De notat că. circularizarea vectorului se produce numai prin inserţia ADN exogen netratat cu fosfatază alcalină. fără decalaj (fără extremităţi monocatenare). specifică celulei transformate. mai mică comparativ cu sistemul care utilizează ligarea "in vitro". Acest tratament determină îndepărtarea grupărilor 5' P terminale de la nivelul vectorului linearizat. refacerea legăturilor fosfodiesterice fiind realizată în final de sistemele specifice (reparatorii) ale gazdei. Această metodă permite inserţia fragmentelor de ADN tăiate drept. O altă metodă utilizată frecvent în experimentele de clonare moleculară este cea a adăugării de extremităţi homopolimere complementare la secvenţele de ADN de origine diferită. refacerea legăturilor fosfodiesterice fiind produsă de ligaza endogenă. la fiecare joncţiune rămâne câte o catenă nelegată. de aproximativ 1000 ori. care va furniza capătul 5' fosfat necesar ligazei. Eficienţa de obţinere a moleculelor hibride poate fi mărită prin tratarea cu fosfatază alcalină a vectorului linearizat. la nivelul fiecărei legături. Fig.

Tehnica adăugării de capete homopolimere complementare se bazează pe proprietatea unei enzime. palindromice.poli dT. dar eficienţa de legare este scăzută. Enzima poate forma o catenă homopolimeră sau "coadă" cu o lungime definită. O altă metodă.TEHNOLOGIA ADN RECOMBINANT Este drept că. sunt oligonucleotide decamerice cu secvenţe. prin adăugarea progresivă de dezoxiribonucleotide (dNTP). este aceea a folosirii moleculelor linker pentru unirea segmentelor de ADN lipsite de extremităţi coezive. Fig. în cazul unor fragmente diferite de ADN cu capete netede (necoezive). aceasta datorându-se. în general. izolată din timus de viţel. probabil. Linkerii.poli dG. lungi de 10-20 nucleotide. pentru refacerea legăturilor fosfodiesterice se poate utiliza direct ligaza de fag T4 care are capacitatea de a uni asemenea molecule. este de 10-100 ori mai mare decât atunci când se folosesc "cozi" poli dA. Dacă asemenea extremităţi complementare se produc şi la capetele unei plasmide linearizate.poli dT. prin amestecul lor se pot obţine molecule recombinante.40). indiferent de modul cum au fost obţinute. terminal-deoxinucleotidil transferaza. stabile.40. la ambele extremităţi 3'OH ale unui ADN dublu catenar complementar (sintetizat pe baza ARNm). care corespund situsurilor 84 . Eficienţa în clonare a fragmentelor cu cozi poli dC . diferenţelor de lungime.poli dC are marele avantaj ca aceşti hibrizi sunt mai stabili decât cei poli dA . Formarea acestor molecule recombinante nu este dependentă de legarea enzimatică a celor două componente (fig. Reprezentarea schematică a utilizării cozilor homopolimere pentru clonare Folosirea extremităţilor complementare poli dG . lungi de 50-100 nucleotide. 3. larg utilizată în ultimii ani. de a extinde extremităţile 3'OH ale ADN. comercializaţi într-o gamă foarte variată de tipuri.

Este de remarcat că. reizolarea genei (genelor) din molecula de ADN recombinant prin folosirea enzimelor de restricţie ce recunosc situsurile marginale (fig. Schema utilizării linkerilor pentru clonare 1 = secvenţă linker decamerică ce conţine situsul de recunoaştere pentru EcoRI.42). ulterior. este obligatoriu să se cunoască 85 . apărând astfel extremităţi adezive complementare pentru clonare. Acest lucru permite. Prin adăugarea lor la extremităţile moleculelor de ADN se creează situsuri ţintă pentru acţiunea enzimelor de restricţie cu care se tratează atât ADN heterolog cât şi molecula vectorului. 3 = linkeri. care reconstituie situsul de recunoaştere al unei enzime de restricţie. în general decamere.TEHNOLOGIA ADN RECOMBINANT de recunoaştere ale unor enzime de restricţie. ele se reunesc cu ajutorul ligazei de fag T4 în structuri bicatenare. Prezenţa la nivelul adaptorilor a extremităţilor monocatenare 5’OH împiedică „autorecircularizarea” secvenţelor de interes. flancaţi de ambele părţi de situsuri pentru restrictaze. iar celălalt la extremitatea 5' P a celeilalte. operator. Aceştia sunt secvenţe oligonucleotidice. Ei pot face să fuzioneze două situsuri de restricţie diferite: unul se leagă la extremitatea 3'OH a unei molecule. reconstituind ambele secvenţe (fig. fragment de ADN ce prezintă capete coezive rezultate prin clivarea linkerilor cu EcoRI O varietate de linkeri o constituie cea care a primit denumirea de linkeri "adaptativi" (=adaptori). situsuri de legare la ribosomi. În prezent se produc şi se comercializează linkeri-adaptori sintetici care conţin secvenţe promotor. în cazul folosirii linkerilor cu situsuri pentru enzime de restricţie. Fig. de iniţiere şi de terminare a sintezei proteice. După legarea lor la extremităţile moleculelor de ADN tăiate drept. care permit legarea a două molecule de ADN prevăzute cu extremităţi adezive (rezultate însă prin acţiunea unor enzime de restricţie diferite). cu secvenţe simetrice. 2 = fragment de ADN cu capete drepte.41).41.

determinând formarea de capete coezive. 4.TEHNOLOGIA ADN RECOMBINANT faptul că molecula de ADN căreia i se adaugă aceşti linkeri nu conţine acel situs de restricţie în structura sa internă.42. Fig. O modalitate specială de clonare a genelor o reprezintă folosirea ca vectori a cosmidelor (fig. Reprezentarea schematică a utilizării cosmidelor pentru clonarea genelor Aşa cum se poate remarca din fig. Schema utilizării linkerilor adaptativi (adaptorilor) pentru clonare (a) adaptor EcoRI.43). strategia generală de clonare în vectorii de tip cosmide este următoarea: 86 . Un avantaj al metodei în care se utilizează linkerii este şi acela că eficienţa procesului de transformare cu ADN supus acţiunii ligazei este mult mai mare comparativ cu cea produsă de ADN numai circularizat (ca în cazul celui obţinut prin metoda extremităţilor homopolimere complementare).43. (b) utilizarea adaptorilor EcoRI care sunt ataşaţi la nivelul capetelor drepte ale fragmentului de interes. Fig.43.

Metode de introducere a moleculelor de ADN recombinant în celulele gazdă Menţinerea şi multiplicarea moleculelor de ADN recombinant este condiţionată de pătrunderea lor într-o gazdă adecvată. obţinându-se molecule lineare recombinate de tipul cos-ori-Apr-ADN heterolog-cos. Principala metodă utilizată pentru introducerea moleculelor de ADN recombinant într-o celulă gazdă este transformarea genetică. în al cărei sistem genetic să se integreze.5. prin liză celulară şi extracţie chimică. • prin infectarea unei gazde corespunzătoare (E.coli). • vectorul linearizat şi fragmentele de ADN genomic se amestecă.1. 1994):  primul grup cuprinde acele sisteme la care capacitatea celulelor receptoare de a reacţiona cu ADN transformant este strâns legată de o etapă fiziologică importantă. în 1928. cosmida se recircularizează şi funcţionează ca plasmidă. Diplococcus pneumoniae. 87 . realizat prin intermediul unei fracţiuni de ADN eliberată dintr-o celulă donor. Aceeaşi enzimă este folosită pentru obţinerea fragmentelor de ADN de clonat. Această stare apare în timpul creşterii celulelor într-un mediu special şi se menţine o perioadă strict determinată. în care se realizează starea de "competenţă". Fenomenul natural a fost descoperit la bacterii de către Griffith. Sistemele cel mai bine caracterizate din cadrul acestui grup sunt reprezentate de Bacillus subtilis. • moleculele recombinate sunt supuse unui proces de împachetare "in vitro" prin tratarea cu un "extract de împachetare" sau cu un fag λ mutant (helper). Haemophilus influenzae.TEHNOLOGIA ADN RECOMBINANT • se izolează vectorul în forma sa de plasmidă şi se linearizează prin clivare cu o enzimă de restricţie specifică. Selecţia clonelor recombinate se face pe baza rezistenţei la antibiotice conferită de cosmidă. În principiu. Transformarea genetică reprezintă transferul de informaţie genetică. 2. sistemele de transformare bacteriene se împart în două grupe (Lorenz şi Wackernagel. se tratează cu ligază. se obţin în acest fel particule fagice (λ ) ce conţin cosmida recombinată.

pe când la E. iar în final nu se produc plaje de liză (dovada eficienţei infecţiei virale).coli această diferenţiere nu se remarcă. După pătrunderea lor în celula gazdă (prin fenomenul de transformare). In cazul utilizării pentru transformarea celulelor devenite competente în mod artificial a ADN cromosomal linear. eficienţa procesului este în general mică deoarece fragmentele de 88 . adică unei populaţii omogene de plasmide sau fagi (în funcţie de tipul de vector utilizat). în condiţiile infecţiei normale. bacteriile la care competenţa a fost indusă prin tratament cu ioni de calciu sunt capabile să preia atât ADN monocatenar cât şi dublu catenar. Ca urmare a replicării şi prin amplificare. ceea ce suprimă bariera celulară normală faţă de înglobarea ADN. O situaţie specială apare în cazul anumitor virusuri la care simpla transfecţie a bacteriilor cu ADN viral nu conduce la multiplicarea virală. odată cu genomul viral. Aceasta particularitate a celulelor devenite competente prin tratament „in vitro” este de mare importanţă pentru experimentele de clonare moleculară sau pentru alte aplicaţii care necesită introducerea în celule a ADN plasmidial sau fagic. în celulele bacteriene este introdusă şi o ARN-polimerază virală care asigură transcrierea genelor virale timpurii. In absenţa acestei ARN-polimeraze de origine virală nu poate avea loc sinteza proteinelor virale necesare multiplicării fagului.coli cât şi la B.TEHNOLOGIA ADN RECOMBINANT  al doilea grup este reprezentat de acele organisme la care competenţa este indusă artificial. transformarea plasmidială este afectată de sistemul de restricţie al gazdei (ca şi în cazul transfecţiei fagice).coli. Spre deosebire de celulele natural competente. care propagă un segment determinat de ADN. Aceasta se datorează faptului că. procesul este numit transfecţie. atât la E. La B. rezultatul fiind producerea de particule virale (fagi progeni) ce determină apariţia de plaje de liză. De remarcat faptul că atunci când se doreşte introducerea în celule a ADN viral (sau în anumite situaţii a ARN viral). Mecanismul transformării cu ADN plasmidial este analog cu cel al transformării genetice cu ADN cromosomal.subtilis. plasmidele de tip oligomer şi nu cele monomere sunt active în transformare. Procesul se realizează prin permeabilizarea învelişurilor celulare în urma tratării bacteriilor cu CaCl2 70100mM. prin tratamente cu CaCl2 sau RbCl. cel mai bine studiat fiind fenomenul de transformare de la E. dar există şi unele diferenţe. Aceasta înseamnă că ele pot fi transformate nu numai cu ADN cromosomal linear ci şi cu ADN plasmidial circular.subtilis. fiecare moleculă recombinată dă naştere unei clone moleculare. moleculele de ADN exogen se multiplică datorită sistemului propriu de replicare. Astfel.

prin utilizarea unui câmp electric. Procesul de electroporare constă în inducerea unei permeabilizări reversibile a celulelor procariote sau eucariote. Dacă diferenţa de potenţial depăşeşte o valoare prag. Această nuclează atacă fragmentele de ADN de la nivelul extremităţilor. Diferenţele apărute depind de o serie de factori. el variind în funcţie de specie. Pentru a obţine însă o eficienţă crescută a procesului de transformare. Dintre metodele noi de introducere în celulele gazdă a moleculelor de ADN recombinat menţionăm: electrotransformarea. temperatura de lucru. Permeabilitatea indusă este reversibilă cu condiţia ca mărimea sau durata aplicării câmpului electric să nu depăşească o valoare critică limită. la numeroase microorganisme. atunci când o celulă este expusă într-un câmp electric. componentele membranei devin polarizate iar membrana este traversată de un potenţial electric.(Snyder şi Champness. S-a stabilit experimental că diferenţa de potenţial necesară "ruperii" membranei şi formării porilor la eucariote este de 0. astfel încât şi modalităţile de introducere a genelor de interes în acestea au trebuit îmbunătăţite. Electrotransformarea a fost descoperită pe baza studiilor efectuate asupra celulelor animale (hematii) supuse acţiunii câmpurilor electrice (Zimmermann. cum ar fi: compoziţia membranei. s-au diversificat. în timp ce plasmidele circulare sau ADN fagic circularizat sunt rezistente la acţiunea enzimei respective. Experimentele realizate în ultimii ani au evidenţiat faptul că.2-2kV/cm. acceptoare de ADN exogen. microinjectarea. 1981-1986) şi se bazează pe fenomenul electroporării. cum ar fi: • concentraţia ADN transformant (la bacterii eficienţa maximă de transformare fiind atinsă cu 1-5µ g ADN/ml). iar celula devine permeabilă pentru molecule exogene. Mecanismul electroporării nu este pe deplin cunoscut. porii rezultaţi având un diametru de 10 µ m.TEHNOLOGIA ADN RECOMBINANT ADN dublu catenar sunt degradate în interiorul celulei acceptoare de către nucleaza Rec BCD. membrana se "rupe" în anumite zone. tipurile de celule gazdă. "bombardarea" celulelor cu particule acoperite cu ADN etc. Astfel. pentru că altfel celula este afectată ireversibil. metoda transformării genetice "clasice" (prin competenţă naturală sau indusă) nu este posibil de aplicat. specia testată. Electrotransformarea este dependentă de mai mulţi factori. La bacterii valoarea câmpului aplicat este mult mai mare: 2-25kV/cm. De asemenea. 89 . 1997). drept celule acceptoare ale ADN exogen se utilizează mutante recBCD. durata aplicării câmpului electric.

după ce a fost iniţial utilizată în experimente în anii ’40. conformaţia moleculară a ADN (ADN supraîncolăcit este mai eficient decât cel linear). metoda prezintă unele limitări ce ţin de: • • • sensibilitatea celulelor la tratamentul cu curent electric (a celor lipsite de perete celular). De asemenea. selectându-se clone recombinate ce conţin vectori specifici. care sunt lipsite de perete celular. Microinjectarea este o metodă relansată în ultimii ani. ca şi pentru anumite specii de drojdii. O parte dintre aceste probleme au fost rezolvate prin mai multe metode: metilarea ADN exogen. au fost stabilite condiţiile optime de electrotransformare pentru bacteriile Gram negative (E. în scopul obţinerii de animale transgenice. Metoda este aplicabilă doar celulelor eucariote. folosirea unor inhibitori nucleazici. De asemenea. Primele rezultate semnificative de transfer de gene prin utilizarea acestei tehnologii au fost obţinute abia prin anii ‘70. dar numai după ce peretele celular a fost îndepărtat prin tratament enzimatic (deci după convertirea celulelor la protoplaşti).coli. Agrobacterium tumefaciens) (Potter. Primele experimente de electroporare au fost realizate cu celule animale (hematii). posibila prezenţă în mediul de electroporare a unor nucleaze nespecifice. în funcţie de specia testată. în ultima vreme în experimentele de electroporare s-au folosit celule intacte. când s-a reuşit transplantarea unor nuclei din celule diferenţiate de amfibieni în celule ou enucleate.TEHNOLOGIA ADN RECOMBINANT • • dimensiunea moleculelor de ADN (moleculele mai mici au eficienţă mai mare de transformare). Eficienţa obţinerii de animale transgenice prin această metodă este de 5-15%. ea putând fi considerată ca o metodă de rutină în cazul celulelor animale. barierele de restricţie ale celulelor receptoare. la care perete celular nu a mai fost îndepărtat. 90 . cele mai bune rezultate fiind înregistrate la şoareci şi porci şi mai slabe la vaci şi oi. levurilor şi bacteriilor. 1991). promiţătoare de altfel. Modelul experimental utilizat pentru acestea a fost apoi aplicat şi celulelor vegetale. Cele mai multe rezultate. în 1974 s-au obţinut şoareci transformaţi (mozaicaţi) prin injectarea în celule embrionare a ADN viral de SV40 (Jaenisch şi Mintz. prin folosirea unor micromanipulatoare noi. 1974). În cazul microorganismelor. au fost obţinute la plante şi la bacterii. Cu toate acestea. etc. utilizarea unor molecule de ADN cu funcţii de cărăuş ("carrier DNA").

celulele microinjectate pot fi reluate cu uşurinţă. Reprezentarea schematică a procesului de microinjectare a ADN de interes în celulele vegetale Cele mai multe rezultate au fost obţinute cu protoplaşti vegetali evacuolaţi. introducerea ADN poate fi urmărită la microscop. obţinându-se în acest fel clone. deoarece exprimarea acesteia depinde de locul unde s-a realizat integrarea în genomul gazdei şi de eficienţa secvenţelor reglatoare însoţitoare. prin introducerea fie a unor cromosomi de la specii diferite. Principul metodei este următorul: ADN de interes este depus pe suprafaţa unor particule de tungsten sau aur (cu un diametru de aproximativ 1μm). Fig. fie a unor vectori derivaţi de la plasmida Ti de la Agrobacterium tumefaciens. Metoda biolistică constă în "bombardarea" celulelor ţintă cu particule acoperite cu ADN. celulelor vegetale intacte. de obicei. prin această metodă doar o celulă primeşte ADN de interes.TEHNOLOGIA ADN RECOMBINANT Dintre descendenţii organismelor transgenice. cauzate de particularităţile structurale ale celulelor vegetale (prezenţa peretelui celular şi a vacuomului)(fig. (1987) fiind aplicată. din ele regenerându-se organisme întregi. În cazul aplicării metodei microinjectării la plante sunt necesare unele adaptări tehnice. transgenice. prin precipitare cu CaCl2. De remarcat că.44. se poate decide care celulă va primi ADN. Tehnica microinjectării la plante permite obţinerea de clone transgenice din protoplaşti sau himere transgenice din proembrioni derivaţi din microspori. numai aproximativ jumătate primesc şi exprimă gena de interes. Metoda a fost elaborată de Klein şi colab. cultivate şi apoi multiplicate pe medii specifice. 91 .44). Avantajele aplicării acestei metode la plante ar putea fi următoarele: • • • • cantitatea de ADN introdusă într-o celulă poate fi optimizată.

Fig. atât la suprafaţa lor cât şi în profunzime. Metoda are o serie de avantaje şi o aplicabilitate largă în cazul celulelor eucariote: • • • • • • este uşor de realizat. ceea ce înseamnă că se poate asigura o exprimare specifică a ADN transferat. deşi promiţătoare. în ultimii ani au mai fost elaborate şi testate şi tehnici noi. prin utilizarea unei asemenea metode se pot introduce gene nu numai în nucleul celulei ţintă ci chiar şi în organitele celulare (de exemplu. celulele ţintă pot fi foarte variate (polen.. metoda depinde doar de parametri fizici ce pot fi optimizaţi în funcţie de materialul biologic folosit sau de scopul urmărit în experiment. dobândind o viteza mare. meristeme). numit "puşcă" (fig. Printre acestea. trec prin orificiul de la nivelul dispozitivului de reţinere şi lovesc ţinta. permite introducerea de gene la nivelul unor organe. De remarcat că. elaborată iniţial pentru celulele vegetalr dar putând fi aplicată şi celulelor animale.TEHNOLOGIA ADN RECOMBINANT acestea constituind "gloanţele". 1992) Particulele cu ADN sunt apoi împinse de macroproiectil. genele aflate la suprafaţa particulelor îşi menţin activitatea biologică. Reprezentarea schematică a dispozitivului utilizat pentru introducerea unor particule "învelite" cu ADN de interes direct în celula ţintă (după Watson şi colab. ele putând supravieţui după "bombardarea" cu microproiectile. celule de calus. cu condiţia existenţei în laborator a dispozitivului specific. 92 . Particulele astfel pregătite sunt introduse într-un dispozitiv special. printr-o singură "lovitură" se poate asigura transferul genelor de interes în mai multe celule.45. în cloroplaste). necesită studii suplimentare pentru optimizare.45). poate fi menţionată metoda electroforetică. Alături de metodele descrise mai sus care sunt destul de mult utilizate în laboratoare. neconvenţionale care.

6. Catodul este conectat cu o pipetă subţire ce conţine ADN inclus într-o cantitate mică de agar (sau agaroză). prin hibridizare "in situ"). Selecţia şi analiza clonelor recombinate Una dintre etapele esenţiale ale tehnologiei ADN recombinant este reprezentată de detectarea şi selecţia celulelor gazdă transformate. după dorinţă. rezultatele fiind discutabile. Pipeta atinge embrionul vegetal. Electroforeza se realizează timp de o oră. embrionul este atins la extremitatea bazală de o a doua pipetă. ea fiind conectată cu anodul. care constă în introducerea ADN la nivelul unor ţesuturi conducătoare de la baza meristemului floral imatur de secară. utilizarea microlaserului pentru a produce "găuri" în peretele celular şi membrana plasmatică prin care să poată pătrundă moleculele de ADN. Toate aceste tehnici au fost aplicate sporadic.1. la nivelul meristemului apical. ce conţine tampon specific. putându-se menţine stabil la lungul generaţiilor. adică a celor ce conţin fragmentul de ADN dorit.1mA şi 2-10V/cm. a noii informaţii genetice. într-o cameră electroforetică speciala (Songstad şi colab. Aceste noi proprietăţi se transmit descendenţilor. Eficienţa metodei este influenţată de anumiţi factori fizici asociaţi cu ţesutul vegetal. compoziţia tamponului de electroforeză. indiferent de metoda utilizată pentru introducerea ADN de interes în celulele gazdă. Evidenţierea prezenţei genei de interes (a exprimării sale tranzitorii) la nivelul embrionului se realizează după electroforeză. mai ales în cadrul experienţelor de tip "shotgun" prin care se clonează o populaţie mare de fragmente heterogene (a unor fragmente de ADN genomic sau a ADNc).TEHNOLOGIA ADN RECOMBINANT In varianta sa originală. oferindu-se astfel posibilitatea multiplicării. 1995). precum şi de factori chimici cum ar fi: valoarea pH. Selecţia clonelor ce conţin vectorul recombinat se face pe mediu selectiv ce conţine un antibiotic sau prin metode histochimice 93 . metoda electroforetică presupune utilizarea unui sistem special în care embrionul vegetal este plasat între doi electrozi. Această etapă este foarte dificil de realizat dar absolut necesară.. De asemenea. sensul de migrare fiind de la catod la anod. Pe lângă această metodă de transfer direct de gene au mai fost raportate şi altele: • • • transformarea polenului sau introducerea ADN în sacii polinici. macroinjectarea. cationii divalenţi. prin utilizarea unor probe de ADN marcat (de obicei. la un curent de 0. Moleculele de ADN recombinant purtătoare de informaţie genetică nouă vor asigura proprietăţi noi celulelor receptoare. 2.

determinarea secvenţei de nucleotide sau modificarea acesteia prin mutageneza la situs-specific etc. a genelor de interes se poate realiza prin utilizarea unor metode variate care au fost grupate în trei categorii principale: metode microbiologice. clonarea genei de interes la nivelul acestui situs duce la dispariţia culorii caracteristice (albastre) a coloniilor bacteriene apărute pe mediul de cultură ce conţine substratul specific (Xgal).1. ceea ce constituie o "bancă" sau "bibliotecă" de gene. inserată în vector sau a unei necesităţi nutritive. Rezultă astfel o colecţie de fragmente de ADN genomic. astfel că se pune problema selecţiei acelor celule. respectiv colonii. Metode microbiologice Aceste metode sunt dintre cele mai simple deoarece se bazează pe evidenţierea indirectă a ADN recombinant prin detectarea prezenţei unui marker genetic. Se mai poate utiliza şi apariţia unei noi proprietăţi ce este codificată de gena străină. prin urmare. Selecţia clonelor recombinate şi a genelor de interes Selectarea clonelor recombinate şi. 2.6. Aceasta este situaţia vectorilor de clonare din categoria plasmidelor pUC (pUC18.6. Dobândirea capacităţii de a sintetiza o anumită enzimă sau prezenţa produşilor ei de metabolism se poate face prin teste simple. ce vizează modificarea culorii unui indicator specific (teste histochimice). de exemplu. utilizarea unor teste de evidenţiere a activităţii proteinei de interes. ele presupunând: • • • • • utilizarea unor "sonde" de ADN sau ARN complementare secvenţei de interes.1. De remarcat însă că. 2.1. genetice şi imunochimice.1.coli). integrarea într-un vector a genei lacZ ce conţine un situs multiplu de clonare. această bancă de gene conţine o gamă foarte variată de clone. propagate de obicei într-o bacterie (E.TEHNOLOGIA ADN RECOMBINANT (exemplu testul Xgal). Această proprietate presupune. sistemul permiţând diferenţierea coloniilor purtătoare de plasmide recombinate de cele 94 . pUC19).1. cum ar fi dobândirea sau pierderea rezistenţei la un anumit antibiotic. amplificarea prin PCR a secvenţei clonate şi analiza ei prin subclonare. dar şi a unor fagimide (pBluescript). care conţin ADN de interes. selectarea produsului genei clonate prin folosirea anticorpilor anti-proteina respectivă.

au fost realizaţi vectori ce permit selecţia directă a clonelor respective.1. IPTG. marcaţi de obicei radioactiv. derivat din pBR322. ele putând fi rapid selectate prin simpla cultivare pe mediu cu tetraciclină. gena cI conţine o secvenţă MCS. pe baza modificării culorii lor după cultivarea pe mediu de cultură ce conţine substratul X-gal şi a inductorului. În cazul în care scopul experimentelor este obţinerea unei bănci de gene. 95 . al cărui principiu este asemănător celui ce foloseşte anticorpi marcaţi radioactiv (test RIA). Hind III. Clonarea la nivelul MCS a unui fragment de ADN exogen determină inactivarea inserţională a genei cI. deoarece numai pe baza lor se poate stabili succesul sau insuccesul experimentului. numai că se utilizează marcarea biochimică în locul celei radioactive (fig. vectorul conţine gena cI. De asemenea. al cărei produs reglează activitatea promotorului viral. pentru a demonstra existenţa într-o anumită probă a produsului unei gene de interes se poate folosi şi una dintre variantele testului ELISA (“Enzyme Linked Immunosorbent Assay”). este necesară o cale mai rapidă pentru selecţia bacteriilor ce conţin vectori recombinanţi. În acest mod. transcrierea pornind de la promotorul PR este represată de produsul genei reglatoare cI. Prin urmare.2. Pentru a evita manipularea a mii de colonii în scopul detectării celor recombinate. la care gena pentru rezistenţă la tetraciclină a fost clonată sub controlul promotorului PR. ceea are ca efect activarea promotorului PR. izolat din genomul bacteriofagului λ . De asemenea. Bcl I şi Sma I.6.46). Aşa este vectorul pUN121. Identificarea şi analiza produsului sintetizat de clonele recombinate este deosebit de importantă.coli a unor molecule proteice funcţionale. In acest mod.1. La rândul ei. Pentru a simplifica evidenţierea acestora se folosesc anticorpi specifici proteinelor de interes.TEHNOLOGIA ADN RECOMBINANT nerecombinate. celulele care conţin plasmide recombinate vor deveni rezistente şi la tetraciclină. la nivelul căreia se găsesc situsuri unice de recunoaştere pentru enzimele de restricţie Eco RI. Metode imunochimice Pentru identificarea şi izolarea celulelor care conţin vectori cu ADNc de origine eucariotă se poate folosi capacitatea acestora de a determina sinteza în E. 2. celulele ce poartă un asemenea vector vor fi sensibile la tetraciclină şi rezistente numai la ampicilină.

ce recunosc anticorpii anteriori. de care rămân legate 96 . Sondele moleculare marcate cu 32P sunt folosite ca "undiţă" moleculară pentru a identifica acele colonii care poartă ADN corespunzător. se determină activitatea enzimei cuplate folosindu-se un substrat specific (de obicei cromogen). după îndepărtarea anti-anticorpilor nelegaţi. se utilizează probe specifice sau foarte înrudite.6. atunci se imobilizează anticorpii corespunzători şi se tratează cu antigenul. Ei sunt cuplaţi cu o enzimă (fosfatază alcalină. complementar. compus de culoare galbenă. Atunci când secvenţa genei clonate este cunoscută.1. După spălarea complexului format (pentru îndepărtarea anticorpilor nelegaţi. după care se cuplează cu anticorpul specific. sau a antigenului.1. se adaugă un al doilea tip de anticorpi.TEHNOLOGIA ADN RECOMBINANT Fig. acest test utilizează imobilizarea antigenului (sau substanţa pe care vrem să o detectăm) pe un suport solid. folosirea în experiment a conjugatului anti-anticorp . Metode genetice Acestea permit detectarea cu mare sensibilitate şi eficienţă a genelor incorporate în vectorii de clonare.fosfatază alcalină determină transformarea substratului cromogen β -nitrofenolfosfat (incolor) în β nitrofenol. Se utilizează teste de hibridare în care identificarea coloniilor bacteriene sau a plajelor de liză ce poartă genele dorite se face cu ajutorul "sondelor" moleculare.3. In final. Dacă antigenul este solubil. 2. în cazul celei de-a doua variante). intensitatea culorii fiind evaluată colorimetric. Coloniile sau plajele de liză supuse analizei sunt reluate pe filtre de nitroceluloză sau membrane de nylon şi apoi incubate cu proba de ADN sau ARN (sau cu anticorpi specifici) (fig.46.47). Spre exemplu. peroxidază) a cărei activitate poate fi uşor evidenţiată prin teste spectrofotopmetrice. Reprezentarea schematică a detectării produşilor de interes (sintetizaţi de clonele recombinate) prin utilizarea metodei imunochimice În principiu.

TEHNOLOGIA ADN RECOMBINANT şi sunt evidenţiate prin autoradiografie. 5 – developarea filmului. 2’ – adăugarea soluţiei cu sonda marcată. Tehnicile din această categorie folosesc molecule de ARNm marcate radioactiv sau fragmente de ADNc.47. care apoi se leagă de gena de interes la fel de specific ca şi ARNm. 2 – îndepărtarea proteinelor fagice şi legarea ADN fagic la filtru. ARNm se leagă specific de gena corespunzătoare. compararea cu placa originară. se recurge la obţinerea unui ADN complementar faţă de el. cu secvenţa identică sau foarte apropiată de unele regiuni ale ADN căutat. Pentru identificarea coloniilor bacteriene care poartă o plasmidă cu ADNc specific se aplică o folie de nitroceluloză pe suprafaţa mediului de cultură. Deoarece purificarea unui anumit tip de ARNm este dificilă şi niciodată perfectă. Aranjarea coloniilor pe placă şi pe filtru este identică. Selecţia clonelor recombinate (plaje de liză) prin utilizarea "sondelor" moleculare A – placa cu plajele de liză ce vor fi analizate. chiar dacă aceasta este "ascunsă" printre alte sute sau mii de gene. 3 – cuplarea sondei ADN la nivelul zonelor de complementaritate din ADN fagic legat de filtru. 1 – acoperirea plăcii iniţiale (ce conţine plajele de liză de interes) cu filtrul de nitroceluloză.soluţie ce conţine sonda de ADN marcat cu 32P. iar altele rămân pe placă. 4 – expunerea filtrului cu hibrizii ADN-ADN la radiaţii X (autoradiografie). B – filtru de nitroceluloză. o parte dintre celulele din fiecare colonie sunt reluate pe filtru. apoi cu NaOH pentru denaturarea ADN iar în 97 . în aşa fel încât atunci când aceasta este ridicată. D . Filtrul de nitroceluloză este tratat cu soluţii ce determină liza celulară. Fig. C – filtrul de nitroceluloză pe care s-au adsorbit fagii din plajele de liză. lungi de 14 . alegerea plajelor recombinate şi purificarea moleculelor de interes.18 nucleotide.

de obicei. 1983) Tehnica. timp de mai multe zile. Metoda Southern este laborioasă şi foloseşte probe de ADN sau ARNm marcate radioactiv. astfel că proba de ADN folosită este reprezentată de o secvenţă oligonucleotidică sintetică (obţinută "in vitro" pe baza secvenţei de aminoacizi a proteinei de interes). autoradiografia. Secvenţele nucleotidice de interes pot fi identificate prin hibridizare. ce presupune expunerea membranelor de nitroceluloză marcate la un film sensibil la radiaţii X. Moleculele marcate hibridizează cu secvenţele omoloage din structura plasmidei recombinate. urmată de developare şi fotografiere. nu se cunoaşte nimic despre secvenţa de nucleotide a genei. prin clivare cu enzime de restricţie (fig. cu proba de ADN marcată (32P). migrarea electroforetică.TEHNOLOGIA ADN RECOMBINANT final. hibridizare. 98 . De multe ori însă. a genei pentru β -globină (adaptare după Mathew.48). fapt evidenţiat prin autoradiografie. în condiţii speciale. se aplică ADNc marcat.48. dar rezultatele sunt precise (fig. presupune mai multe etape de lucru: • • • • • purificarea moleculelor de ADN. după uscarea filtrelor. Fig. Reprezentarea schematică a etapelor implicate în detectarea unei gene de interes (de exemplu. după separarea electroforetică (în gel de agaroză) a fragmentelor de ADN rezultate. elaborată în 1975 de către Southern. transferul fragmentelor de ADN pe filtre de nitroceluloză.49) .

a celor recombinate sau a celor doficiate de genele clonate). după separare electroforetică. Datorită condiţiilor speciale pe care le necesită folosirea probelor marcate radioactiv. Detectarea unor secvenţe de ADN de interes (de exemplu. care permit identificarea. au fost puse la punct metode de identificare "in situ" a secvenţelor de ADN dorite. sonda moleculară este un fragment de ADN. Combinată cu tehnici de imunocitochimie. în acest caz. B = autoradiografia fragmentelor separate electroforetic prin utilizarea unei probe de ADN marcat.49.TEHNOLOGIA ADN RECOMBINANT Fig. complementar cu ARN căutat. iar hibrizii formaţi să fie vizualizaţi imediat la microscop. efortul cercetătorilor s-a îndreptat spre găsirea unor modalităţi de marcare neradioactivă a "sondelor" moleculare. metoda Western se referă la identificarea unor proteine de interes (de exemplu. În prezent există două categorii de metode de hibridizare neradioactivă: metoda directă şi metoda indirectă. ARNm şi proteine). ele sunt reluate pe filtre de nitroceluloză. Tehnicile de hibridizare "in situ" permit detectarea unor secvenţe specifice de ADN direct în cromosomi. 1983). Există şi variante ale metodei descrise de Southern. metoda Northern constă în identificarea moleculelor de ARN de interes. a unor molecule de ARN sau a unor proteine. A = separarea electroforetică a ADN clivat cu enzime de restricţie. In schimb. Metoda directă presupune ca molecula de ADN marcată să se lege direct la probele de acizi nucleici de studiat. Spre exemplu. în celule sau pe secţiuni de ţesuturi variate. În ultimii ani. prin marcare neradioactivă sau radioactivă. După separarea proteinelor prin electroforeză în gel de poliacrilamidă. iar evidenţierea se face cu ajutorul anticorpilor specifici. gena pentru β -globina umană) prin utilizarea metodei Southern (după Mathew. hibridizarea "in situ" permite obţinerea de informaţii asupra localizării celulare şi a funcţiei genei (la nivel de ADN. Astfel. marcarea terminală cu fluorocromi a unor probe de ARN (prin utilizarea unor 99 . dintr-un amestec supus separării electroforetice.

detectarea realizându-se colorimetric sau histochimic. Nucleotidele astfel marcate sunt apoi incorporate enzimatic într-o probă de acizi nucleici. fie cu streptavidină (sau avidină). ditiotreitol şi albumină serică bovină. prin microscopie cu fluorescenţă. un tampon corespunzător (Tris-HCl. identificarea se face după iluminare specifică. la temperatura de 20oC. UTP-marcat cu digoxigenină. dTTP şi dGTP). conjugaţi cu o enzimă (fosfataza alcalină. dCTP. În cazul folosirii digoxigeninei (steroid izolat de la speciile Digitalis lanata sau D. reverstranscriptaza. identificarea hibrizilor se face prin folosirea unor substraturi cromogene: în prezenţa enzimei are loc modificarea culorii substratului. fluorimetrie (fluorescenţă galbenă. pentru digoxigenină. Aceasta substanţă. peroxidază) sau cu un colorant fluorescent (fluoresceină sau rodamină). ioni de magneziu.TEHNOLOGIA ADN RECOMBINANT nucleotide marcate ce sunt incorporate într-o moleculă de ARN) şi introducerea lor în celulele ţintă va permite. cele patru nucleotide nemarcate (dATP. fie din albuş de ou (avidina). Detectarea probelor hibride (ADN de interes + proba marcată cu digoxigenină) se realizează cu anticorpi anti-digoxigenină. dintre care două sunt mai mult utilizate: sistemul biotină-streptavidină şi sistemul de detectare cu digoxigenină. roşie sau albastră.purpurea). moleculele marcate trebuie să fie accesibile anticorpilor. izolată fie de la anumite tulpini bacteriene (Streptomyces avermectilis produce streptavidină). Detectarea se poate face fie cu anticorpi anti-biotină. aceasta este legată la uridin-trifosfat (UTP). numindu-se şi vitamina H). ulterior identificarea celulară a hibrizilor fluorescenţi. Atunci când se folosesc anticorpi anti-digoxigenina conjugaţi cu fluorocromi. ele fiind acceptate ca substrat atât de ADN polimeraze (ADN-polimeraza de la E. In acest fel. cât şi de ARN-polimerază. Metoda indirectă presupune ca proba ce conţine molecula marcată să fie detectabilă prin citochimie de afinitate. la nivelul carbonului din poziţia 5 a nucleului pirimidinic prin intermediul unui "braţ" spaţiator format din 11 atomi de carbon. În cazul utilizării anticorpilor anti-digoxigenină conjugaţi cu fosfataza alcalină sau peroxidază. pH 7. Taq-polimeraza) şi terminaltransferază. este preferată 100 . Incorporarea nucleotidei marcate se realizează la fiecare a 20-a sau 25-a nucleotidă (înlocuind dTTP al cărei analog este).coli. etapele de lucru sunt asemănătoare celor descrise mai sus. Amestecul de marcare neradioactivă conţine. Pentru atinge acestui scop au fost elaborate mai multe sisteme. pe lângă una dintre enzimele menţionate mai sus. Atunci când se preferă marcarea cu biotină (substanţă ce face parte din grupul vitaminelor B.5). în funcţie de markerul utilizat). ADN-polimeraza de fag T4.

a cărui descifrare aproape completă (94%) a fost comunicată în februarie 2001 (Harry.. Pîână în prezent a fost determinată secvenţa de nucleotide de la peste 800 categorii de genomuri. Trebuie însă precizat faptul că. La lista prezentată în tabelul 5 se adaugă.2. 2002). toate presupunând însă etape de lucru laborioase şi posibilitatea tehnică a separării electroforetice a fragmentelor rezultate (deci aparatură specială de electroforeză). anterior obţinându-se notabile doar în cazul genomurilor unor virusuri (tabelul 5).Determinarea secvenţei de nucleotide a fragmentului de ADN de interes În multe experimente de tehnologia ADN recombinant este necesar ca. aşa cum este cazul genomului uman. fragmentul sau fragmentele de ADN de interes pot fi analizate prin mai multe metode. din 2001. 205 plasmide. Pentru aceasta au fost elaborate mai multe metode de secvenţiere.6.1. descifrare „completă” înseamnă de fapt determinarea a aproape întregii secvenţe de nucleotide. 38 genomuri procariote dintre care 8 sunt arhebacterii. 20 bacteriofagi. 101 . Recent. să se stabilească secvenţa de nucleotide din diferite fragmente de ADN. Primul organism viu la care s-a determinat secvenţa de nucleotide a fost Haemophilus influenzae. 2. dintre care majoritatea sunt virusuri (599). Analiza secvenţelor de ADN clonate După clonare şi selecţia clonelor recombinate. 30 aparţin eubacteriilor.TEHNOLOGIA ADN RECOMBINANT pentru detectarea hibrizilor marcaţi. iar patru sunt eucariote.2. nucleotidele marcate fiind analogi ai celor naturale.japonica)(Goff şi colab. deseori. sau gena poate fi modificată prin mutageneză "in vitro" iar funcţiile sale (modificate) sunt studiate ulterior. 185 organite. după care fragmentele obţinute sunt analizate prin electroforeză în gel de agaroză. De asemenea. secvenţierea genomului de 130Mb al speciei Arabidopsis thaliana. fie chiar a întregului genom al unui organism. în final.1. gama de nucleotide biotinilate s-a lărgit la adenozin şi citidin-trifosfaţi. se pot utiliza diverse enzime de restricţie pentru clivarea ADN clonat. subclonată într-un vector specific şi introdusă într-o gazdă nouă.1.6. iar din aprilie 2002 cea a genomului de orez (Oryza sativa ssp. gena de interes poate fi amplificată prin utilizarea tehnologiei PCR. 2001). 2. Pe de o parte.

În cadrul acestei metode există două variante de lucru: metoda "plus” şi metoda „minus".coli. la amestec fiind adăugate toate cele patru dezoxiribonucleotide (dintre care una marcată radioactiv cu 32 P) precum şi o scurtă secvenţă complementară sintetizată “in vitro”. Deoarece sinteza nu este sincronizată se vor obţine oligonucleotide de diferite lungimi.66 Mb 4. fie prin clonarea fragmentelor de interes în vectori de tip fagimide şi apoi stabilirea condiţiilor de producere a ADN monocatenar (prin inducerea multiplicării ca fag filamentos a vectorului).3 kb 48. ADN monocatenar este folosit ca matriţă pentru acţiunea ADN polimerazei I de la E.4 kb 5. Organisme la care s-a determinat secvenţa de nucleotide din ADN genomic (după Melcher. Acesta poate fi obţinut fie prin denaturarea ADN dublu catenar (izolat printr-o metodă specifică). 2000) Organismul Φ x174 SV40 CaMV VMT Bacteriofagul λ Virusul vaccinei Citomegalovirus Haemophilus influenzae Mycoplasma genitalium Methanococcus jannaschi Escherichia coli Saccharomyces cerevisiae Caenorhabditis elegans Drosophila melanogaster Homo sapies Mărimea genomului secvenţializat 5.TEHNOLOGIA ADN RECOMBINANT Tabelul 5. de la nivelul său începând sinteza enzimatică a unor secvenţe de 15-300 nucleotide.58 Mb 1. Primerul se ataşează specific la regiunea de omologie. ambele metode prezentând primele etape comune (fig.3 Mb 13 Mb 100 Mb 170 Mb 3000 Mb Anul determinării secvenţei 1977 1979 1980 1982 1982 1990 1991 1995 1995 1996 1997 1996 1998 2000 2001 Pentru obţinerea secvenţelor oligonucleotidice din ADN supus analizei pot fi utilizate două metode: metoda propusă de Sanger (1975) sau metoda descrisă de Maxam şi Gilbert (1980). 102 . Indiferent de metoda folosită pentru obţinere.50). Metoda Sanger presupune folosirea ADN monocatenar pentru stabilirea secvenţei de nucleotide. ADN polimeraza este utilizată mai întâi pentru a asigura sinteza unei catene complementare catenei matriţă. ce va fi folosită drept primer.9 Mb 0. ea conţinând însă dNTP marcate.8 kb 8 kb 6.5 kb 192 kb 229 kb 1.

) 3'---------G-C-T-C-G-C-A-T-----5' 5'---------C-G-A-G-C-G 5'---------C-G-A-G-C-G 5'---------C-G-A-G-C-G 5'---------C-G-A-G 5'---------C-G-A-G 5'---------C-G 5'---------C-G Fig. amestecul de oligonucleotide cuplate cu matriţa este reincubat cu ADN polimeraza. Determinarea secvenţei de nucleotide a unui fragment de ADN prin utilizarea metodei "plusminus" (după Gaastra şi Oudega. 1983) În metoda "minus". dar în absenţa uneia dintre cele patru dNTP.) 3'---------G-C-T-C-G-C-A-T-----5' 5'---------C-G-A-G-C-G-T-A----3' 5'---------C-G-A-G-C-G-T-A 5'---------C-G-A-G-C-G-T-A 5'---------C-G-A-G-C 5'---------C-G-A-G-C 5---------C-G-A 5'---------C-G-A 5'---------C Sistemul "plus" (polimerizare în prezenţa G. după îndepărtarea nucleotidelor neutilizate.TEHNOLOGIA ADN RECOMBINANT Catena de ADN utilizată ca matriţă3'---------G-C-T-C-G-C-A-T-----5' Primer 5'---3' ADN polimeraza + amestec de dNTP (dintre care una marcată cu 32P) 3'---------G-C-T-C-G-C-A-T-----5' 5'---------C-G-A-G-C-G-T-A 5'---------C-G-A-G-C-G-T copii complementare marcate 5'---------C-G-A-G-C-G 5'---------C-G-A-G-C 5'---------C-G-A-G 5'---------C-G-A 5'---------C-G 5'---------C Sistemul "minus" (polimerizare în absenţa G.50. de ex. de ex. 103 .

în final detectarea fragmentelor oligonucleotidice monocatenare făcându-se prin autoradiografie. în amestecul de reacţie este introdusă o anumită dNTP. 104 . sinteza se va termina. în prezenţa unei concentraţii foarte mari de uree (8M). la nivelul nucleotidei ce precede nucleotida absentă. Analogii ddNTP nu mai conţin grupări hidroxil la nivelul atomilor de carbon din poziţiile 2' şi 3' ale pentozei. După încheierea sintezei în toate cele patru variante de ddNTP adăugat.50). În cazul metodei "plus". 51). în catena ce se sintetizează. aşa cum sunt analogii de tip 2'-3'-dideoxy (ddNTP): ddATP.51). principiul metodei este următorul: se creează condiţiile sintezei unei catene complementare matriţei de ADN (a cărei secvenţă se doreşte a fi cunoscută). este supus acţiunii ADN polimerazei de fag T4 care. prin utilizarea unei ADN polimeraze I Klenow (lipsită de activitate exonucleazică 5'→3').TEHNOLOGIA ADN RECOMBINANT Sinteza se desfăşoară până când. datorită activităţii sale exonucleazice în sensul 3'-5'. după ce au fost supuse acţiunii unei enzime de restricţie pentru a îndepărta primerul. deoarece pentru alungirea catenei noi de ADN este necesară adăugarea de nucleotide la nivelul capătului 3'-OH. ddTTP. Noile catene sintetizate sunt apoi separate de matriţă lor şi supuse electroforezei în gel de poliacrilamidă. la toate secvenţele nucleotidice din amestec. se poate obţine un set complet de oligonucleotide ce respectă principiul descris mai sus. În privinţa variantei cu dideoxinucleotide (Gaastra şi Oudega. obţinute în prima etapă. degradează ADN dublu catenar. Sinteza este iniţiată de un primer complementar cu o secvenţă specifică de la capătul 3' al matriţei şi continuată în prezenţa celor patru dNTP. dintre care una este marcată cu 32P. la capătul 3' al acestora. sunt denaturate prin încălzire în prezenţa formamidei. se obţin oligonucleotide cu dimensiuni diferite (deoarece sinteza nu este sincronizată) care. În plus. astfel că acţiunea exonucleazică se opreşte la nivelul nucleotidei care este prezentă în amestecul de incubare (fig. ddGTP. Deoarece în experimente se realizează patru variante diferite (de fiecare dată omiţându-se câte o nucleotidă). ar trebui inclusă nucleotida lipsă. ADN monocatenar obţinut este supus electroforezei şi apoi detectării prin autoradiografie. aceasta este blocată în prezenţa ddNTP corespunzător (fig. ddCTP. Încheierea sintezei ADN complementar este determinată de adăugarea la amestecul de reacţie a unor analogi ai dNTP. începând cu capătul 3'. 1983). În acest fel. sau cei de tip β-D-arabinofuranosil) (fig. amestecul de oligonucleotide marcate. În acest fel.

Reprezentarea schematică a metodei de secvenţializare elaborată de Maxam şi Gilbert (1977) 105 . la nivelul unor situsuri cunoscute (sunt „rupte” legăturile fosfodiesterice dintre două nucleotide. Fig. şi polinucleotid-kinază care ataşează 32 P la nucleotida de la capătul 5'.51.52. 1983). Probele marcate astfel obţinute sunt supuse unor tratamente care asigură clivarea specifică a secvenţei de ADN. marcat cu 32 P. 3' ADN-polimeraza + amestec de dNTP (dintre care una marcată) +ddGTP 5' C-G-A-G-C-ddG 5' C-G-A-ddG 5’C-ddG +ddATP +ddTTP +ddCTP 5' C-G-A-G-ddC 5' ddC 5' C-G-A-G-C-G-T-ddA 5' C-G-A-G-C-G-ddT 5' C-G-ddA Fig. dintre una este cunoscută) (fig. Determinarea secvenţei de nucleotide a unui fragment de ADN prin utilizarea metodei dideoxinucleotidelor (după Gaastra şi Oudega. Metoda Maxam şi Gilbert presupune utilizarea unui anumit segment de ADN monocatenar care este mai întâi este tratat cu fosfatază alcalină pentru a elimina radicalul 5’ fosfat.52).TEHNOLOGIA ADN RECOMBINANT Catena de ADN utilizată ca matriţă3'---------G-C-T-C-G-C-A-T-----5' Primer 5-……. apoi se adaugă ATP..

Fig. cu agenţi chimici care distrug guanina. • clivarea timinei-citozinei presupune ca ADN de interes să fie mai întâi supus acţiunii hidrazinei care interacţionează specific cu timina şi citozina. Urmează apoi supunerea moleculei de ADN metilat la acţiunea piperidinei care determină ruperea legăturilor fosfodiesterice alături de poziţia ocupată de guanină. fie. este tratat cu piperidină care clivează legăturile fosfodiesterice din secvenţa de ADN ori de câte ori apar nucleotidele de tip dTTP sau dCTP. cea cu hidrazină. Evidenţierea comparativă a autoradiografiilor unor geluri de secvenţiere obţinute prin tehnica Sanger (gelul din stânga – secvenţa de nucleotide a genei pentru o lipază de la şobolan) sau prin tehnica Maxam şi Gilbert (gelul din dreapta – secvenţa de nucleotide a genomului virusului hepatitei B) (după Etienne şi Clauser. Aceasta face ca tratarea ulterioară cu piperidină să determine clivarea legăturilor fosfodiesterice ori de câte ori în segmentul de ADN apare A sau G. iar apoi. În acest fel. se face în prezenţa NaCl 5M care inhibă acţiunea acesteia la nivelul timinei.TEHNOLOGIA ADN RECOMBINANT Există diferite modalităţi de tratament ale probei de interes care asigură realizarea mai multor variante de clivare: clivarea guaninei presupune ca ADN de studiat să fie tratat. mai rară. cu excepţia faptului că prima reacţie. fie cu dimetilsulfat ce determină metilarea guaninei în poziţia 7 şi a adeninei în poziţia 3. • clivarea citozinei se realizează în aceleaşi condiţii ca şi cele descrise mai sus. 106 . tratarea probei de ADN cu piperidină determină clivarea legăturilor fosfodiesterice doar la nivelul citozinei (fig. 2001).53. • clivarea guaninei-adeninei presupune tratarea ADN metilat cu dimetilsulfat cu piridin-formiat. amestecul obţinut.53).

TEHNOLOGIA ADN RECOMBINANT

În prezent au fost elaborate sisteme automatizate de determinare a secvenţei de nucleotide a genelor şi de analiză computerizată a acesteia. Cunoscând secvenţa de nucleotide dintr-o genă se poate deduce foarte simplu secvenţa de aminoacizi din proteina codificată. De asemenea, perfecţionarea vectorilor de clonare şi a metodelor de amplificare genică prin PCR au permis o mai bună analiză a genelor clonate. Spre exemplu, vectorii derivaţi de la fagul M13 asigură clonarea genei de interes la nivelul unui situs multiplu de clonare aflat în gena lacZ, în apropierea unei secvenţe "primer universal" ("universal sequencing primer" = USP), iar după multiplicarea sa sub formă monocatenară (prin activarea funcţiilor fagului filamentos), gena poate fi folosită pentru secvenţiere (fig.54.).

Fig.54.Utilizarea vectorului M13sup18 pentru clonarea şi apoi secvenţierea genei de interes. 1 – clivarea vectorului de clonare cu EcoRI; 2 – integrarea ADNc la nivelul vectorului linearizat (integrarea se poate face în ambele orientări); 3 – transformarea celulelor competente de E.coli şi cultivarea pe mediu cu Xgal; 4 – plaje albe recombinate; 5 – plaje albastre nerecombinate; 6 – cultivarea fagilor recombinaţi şi utilizarea ADN monocatenar pentru secvenţializare. USP = secvenţa primer universală (“universal primer sequence”); L = polilinker ce conţine situsul de recunoaştere pentru EcoRI; P = promotorul genei lac Z’.
107

TEHNOLOGIA ADN RECOMBINANT

După tratarea vectorului linearizat cu o enzimă de restricţie cu fragmentul de ADN de interes şi adăugarea la acest amestec a ligazei, are loc transformarea celulelor de E.coli. Selecţia se face pe plăci cu X-gal, după inducerea cu IPTG, obţinându-se "spoturi albastre", corespunzătoare celulelor de E.colilizate ce conţineau vectorul nerecombinat, respectiv "spoturi" albe, reprezentate de celulele bacteriene recombinate lizate (transformate cu vector recombinat). Particulele fagice recombinate sunt apoi izolate din plajele de liză corespunzătoare, din ele fiind extras apoi ADN monocatenar ce poate fi utilizat drept matriţă pentru secvenţiere, folosindu-se drept primer o secvenţă oligonucleotidică sintetică, complementară USP din vector. In experimente similare se pot utiliza şi fagimidele care permit multiplicarea genei clonate fie în cadrul plasmidei fie, după adăugarea unui fag ajutător, sub formă de monocatene, ceea ce face ca protocolul de secvenţiere să fie mai simplu. Au mai fost elaborate şi alte metode de obţinere a ADN a cărui secvenţă se doreşte a fi determinată, cum ar fi tehnica PCR-asimetrică ("asymmetric PCR")(Innis şi colab., 1990). Spre deosebire de tehnica PCR "clasică" în urma căreia se obţin fragmente de ADN dublu catenar, varianta sa "asimetrică" presupune utilizarea unor cantităţi diferite din cei doi primeri necesari amplificării secvenţei dorite (în raport de 1/100) astfel că, reacţia de sinteză a fragmentelor de ADN dublucatenar se opreşte în momentul în care unul dintre primer nu mai este accesibil. Din acest moment, sinteza continuă folosindu-se un singur primer, obţinânduse doar una dintre cele două catene ale fragmentului de interes. ADN monocatenar sintetizat prin aceasta metodă este suficient din punct de vedere cantitativ pentru a fi supus secvenţierii (de obicei prin utilizarea metodei Sanger, cu dideoxinucleotide). 2.1.6.2.2. Mutageneza "in vitro" Aşa cum se cunoaşte, mutageneza poate fi definită ca fiind procesul de modificare a structurii ADN (sau a ARN, în cazul ribovirusurilor), care nu este consecinţa recombinării genetice. Cele mai multe mutaţii au consecinţe fenotipice evidente dar, în anumite situaţii, efectele nu sunt vizibile, mutaţiile fiind "tăcute" ("silenţioase"). Mutageneza "în vitro" poate fi utilizată pentru modificarea controlată a secvenţei de nucleotide a unei gene, urmată de introducerea acesteia într-o gazdă corespunzătoare şi apoi studierea funcţiilor acesteia. În acest caz, cercetările experimentale pornesc de la secvenţa genei şi apoi se examinează funcţia acesteia, deci invers faţă de experimentele "clasice" (când
108

TEHNOLOGIA ADN RECOMBINANT

se porneşte de la proteină şi se „caută” gena codificatoare). Din acest motiv, acest tip de abordare permisă de tehnologia ADN recombinant a primit denumirea de "genetică inversă" ("reverse genetics"). Strategia generală pentru experimentele de mutageneză "in vitro" este următoarea: ADN de interes introdus într-un vector de clonare adecvat este supus unui anumit tip de mutageneză şi apoi este transferat într-o gazdă corespunzătoare (de obicei E.coli). Se obţin în acest caz diferite organisme recombinate ce permit studierea funcţiilor modificate (sau nu) ale ADN de interes. Modificarea secvenţei de nucleotide se poate face la întâmplare, prin mutageneză "clasică" cu agenţi mutageni obişnuiţi (fizici sau chimici), sau prin inducerea unor greşeli de incorporare a nucleotidelor cu ajutorul unor enzime (cum ar fi, reverstranscriptaza produsă de virusul mieloblastozei aviare). Consecinţele acestor tratamente pot fi de tipul deleţiilor, adiţiilor, substituţiilor, inversiilor etc. În ultimii ani au fost elaborate metode de mutageneză la situs-specific care asigură modificarea controlată (prin adiţii, deleţii sau substituţii de nucleotide) a unei anumite secvenţe de ADN. Un exemplu de mutageneză la situs-specific este cel al utilizării secvenţelor de recunoaştere pentru anumite enzime de restricţie: la nivelul acestora se pot produce, în mod controlat, deleţii sau adiţii de nucleotide, modificându-le. Spre exemplu, enzima EcoRI recunoaşte secvenţa GAATTC, determinând în urma clivării apariţia unor capete monocatenare complementare. Dacă, la nivelul extremităţilor monocatenare sunt adăugate nucleotidele complementare (sub acţiunea ADN polimerazei şi a dNTP corespunzătoare), astfel încât să se refacă structura dublu-catenară, se obţin fragmente cu capete drepte ce pot fi reunite cu ajutorul ADN-ligazei. In acest fel sunt „create” molecule de ADN reasamblate, de dimensiuni mai mari decât cele de origine (prin inserarea a 4 nucleotide la nivelul fiecărui situs EcoRI iniţial). Aceasta are ca rezultat pierderea secvenţelor de recunoaştere pentru EcoRI, iar consecinţa la nivelul genelor este modificarea cadrului de citire al mesajului genetic. În mod similar, prin tratarea cu nucleaza S1 a secvenţelor lineare de ADN obţinute cu EcoRI, are loc eliminarea extremităţilor monocatenare complementare. Consecinţa finală (după legarea fragmentelor rezultate) este eliminarea din ADN iniţial a unor secvenţe scurte de nucleotide (câte patru nucleotide de la nivelul fiecărui situs EcoRI) şi, deci, modificarea cadrului de citire a mesajului genetic.

109

Fig. se induce obţinerea de ADN monocatenar prin activarea funcţiilor fagice.TEHNOLOGIA ADN RECOMBINANT De asemenea.coli şi selecţia clonelor normale şi a celor mutante (fig.55 ). mutageneza la situs-specific se poate realiza prin diferite metode care depind de utilizarea de oligonucleotide sintetice pentru inducerea unui anumit tip de modificare a secvenţei de nucleotide ţintă. 110 . capabilă să recunoască o zonă omoloagă din ADN ţintă. se alege o secvenţă de oligonucleotide sintetizată "în vitro" (de exemplu un primer mutant).Schemă generală a mutagenezei situs-specifică prin utilizarea oligonucleotidelor • • • secvenţa de ADN de interes (ce va fi supusă mutagenezei) este clonată într-un vector capabil să producă ADN monocatenar (vectori de tip fagimide). mutageneza la situs-specific prin folosirea oligonucleotidelor sintetice se realizează în mai multe etape: • introducerea ADN dublu-catenar în E.55. În principiu.

111 .coli (fig.TEHNOLOGIA ADN RECOMBINANT • amestecarea ADN ţintă cu oligonucleotidele sintetice mutante şi crearea condiţiilor de sinteză a catenei complementare (prin adăugarea de ADN polimerază.56. O altă variantă de mutageneză "in vitro" este aceea a introducerii la nivelul unei molecule de ADN de analizat a unor linkeri. dNTP şi ADNligază). Inserţia linkerilor se face după ce ADN de interes a fost tratat cu DN-aza I (care taie ADN dublu-catenar în mod randomic. Reprezentarea schematică a mutagenezei „in vitro” prin inserţia unui linker.56). ele fiind analizate după introducerea şi multiplicarea în E. Fig. generând molecule lineare). Legarea ulterioară a ADN linearizat cu linkerii respectivi determină obţinerea mai multor tipuri de molecule de ADN modificate.

TEHNOLOGIA ADN RECOMBINANT Mutageneza "in vitro" are numeroase aplicaţii. între care sunt de menţionat următoarele: • • permite caracterizarea unor regiuni ale ADN care controlează exprimarea unei gene. ceea ce poate avea o semnificaţie biotehnologică deosebită. creşterea rezistenţei la acţiunea unor inhibitori etc). a inaugurat domeniul "ingineriei proteice" care presupune realizarea unor modificări în produsul natural al unor gene astfel ca acesta să-şi îndeplinească rolul cât mai bine (stabilitate termică ridicată. 112 . sporirea activităţii specifice.

Sign up to vote on this title
UsefulNot useful