BIO152: Sample Midterm Exam Questions Dr. F.

Rawle

1. In the Linnaean classification system, which taxon would generally include the largest number of species? A. family B. order C. genus D. phylum E. population 2. Which of the following is not a property of liquid water? A. Its density is greater than ice. B. Its specific heat is higher than that for most other substances. C. It is polar. D. Its heat of vaporization is lower than that for most other substances. E. All of the above statements are properties of water 3. A solution with a pH of 5 has how many more protons in it than a solution with a pH of 7? A. 2 times B. 5 times C. 10 times D. 100 times E. 1000 times 5. What is the difference between a ribonucleotide and a deoxyribonucleotide? A. Ribonucleotides contain a phosphate group B. Ribonucleotides contain a sugar with 5 carbon atoms C. Ribonucleotides have a hydroxyl group on the 2 carbon of their sugar subunit D. Ribonucleotides have a hydrogen atom on the 1 carbon of their sugar subunit E. All of the above 6. Why do many researchers consider RNA to be the best candidate for the first life-form? A. It is simple in structure. B. It carries more information than any other molecule. C. It is capable of self-replication and catalysis. D. All of its nucleotide components have been created under laboratory conditions that mimic early Earth. E. All of the above. 7. Dairy cattle were unknown in Thai culture until recently, and 97% of Thai people are lactose intolerant as adults. Which explanation for such a widespread lactose intolerance is most likely correct? A. Allergies are becoming more common in humans as more chemicals are being encountered during longer lifetimes. B. Evolutionarily, producing an enzyme to break down a sugar that will never be encountered is wasteful. C. The ability to digest sugar in milk is determined by environment, and most humans are not exposed to milk as a good source beyond childhood years. D. There is no good explanation for this situation in humans.

BIO152: Sample Midterm Exam Questions Dr. F. Rawle

12. Which would be the most accurate endomembrane route through which a protein is secreted from a cell? A. Golgi apparatuslysosomevesiclesplasma membrane B. plasmidplasma membranenuclear envelopesmooth endoplasmic reticulum C. nuclear envelopevesiclesGolgi apparatusplasma membrane D. rough endoplasmic reticulumlysosomesvesiclescell membrane E. rough endoplasmic reticulum Golgi apparatusvesicles plasma membrane 13. How is the structure of kinesin related to its function? A. Kinesin has two intertwined polypeptides that make up the stalk and enable it to contract and shorten. B. The kinesin tail has an ATP binding site to fuel its activities. C. Kinesin has a tail region that binds to vesicles and two heads that can attach to microtubules. D. Kinesin has two heads to attach to the vesicle being moved, and a tail region that attaches to microtubules. E. None of the above. 16. A parent cell divides to form two genetically identical daughter cells in the process of mitosis. For mitosis to take place ______________. A. The parent cell must first be fertilized. B. The parent cell must reproduce its DNA during telophase. C. The parent cell must replicate its entire genome prior to mitosis. D. The parent cell must divide its DNA in half so each daughter cell gets only the genes needed to carry out its functions. In this way, differentiation occurs. 17. Following the attachment of spindle microtubules to kinetochores, chromosomes are moved around by ___________. A. myosin motor proteins B. histones C. motor activity taking place in the centrosomes D. elongation and shortening of microtubules E. none of the above

BIO152: Sample Midterm Exam Questions Dr. F. Rawle

1. Which of the following is NOT a criterion for an organism's genetic material? A. The genetic material must contain information necessary to construct a whole organism. B. The genetic material must be transmitted from parent to offspring. C. To transmit information the genetic material must be replicated. D. The genetic material must be dynamic, changing rapidly in response to changes in the environment. E. Genetic material must account for the known variation within each species and among different species. 2. Which of the following statements about the structure or composition of DNA is FALSE? A. DNA is a double helix. B. Complementary base-pairing occurs between pyrimidine and purine bases. C. The amount of thymine closely approximates that of guanine within a particular organism. D. Each nucleotide within a DNA is separated by about 3.4 angstroms. E. Adenine pairs with thymine and guanine with cytosine. 3. Which of the following statements about DNA replication is INCORRECT? A. It begins at multiple origins of replication sites along eukaryotic chromosomes. B. It proceeds with the addition of new nucleotides to the 3 end of a growing DNA strand. C. It is powered by the hydrolysis of ATP. D. Each strand within the DNA double helix is used as a template for synthesis of a new strand. E. It requires that each strand in the double helix be separated from the other. 4. Why is there a need to produce Okazaki fragments on the lagging strand, but not on the leading strand of DNA? A. The two parental strands of DNA are antiparallel and DNA polymerase makes DNA in the 5 to 3 direction only. B. It is substantially more efficient to make several shorter strands rather than one longer strand of DNA. C. There lacks enough cellular DNA ligase for bonding Okazaki fragments together if they were produced from both parental strands. D. By having one leading strand and one lagging strand the cell can limit the amount of DNA polymerase used for chromosomal replication. E. It is faster to make several smaller fragments than one larger fragment. 5. What is the function of the poly A tail? A. The poly A tail is required for the proper exit of mRNA from the nucleus. B. The poly A tail allows mRNA to bind to the ribosome. C. The poly A tail increases mRNA stability in eukaryotes. D. The poly A tail increases mRNA stability in prokaryotes. E. The poly A tail serves as a termination sequence for RNA polymerase III. 6. On which of the following processes would a defective ribosome have the most detrimental effect? A. translation B. replication C. transcription D. replication and transcription E. replication and translation

BIO152: Sample Midterm Exam Questions Dr. F. Rawle

7. Which sequence of events is most CORRECT for the initiation and elongation steps of translation? (1) initiator tRNA binds start codon on mRNA (2) small ribosomal subunit binds to mRNA (3) large ribosomal subunit binds (4) tRNA entry and peptidyl transfer reaction (5) tranlocation of ribosome and release of tRNA A. 1, 2, 3, 4, 5 B. 1, 2, 3, 5, 4 C. 1, 3, 2, 4, 5 D. 2, 3, 1, 5, 4 E. 2, 1, 3, 4, 5 8. What type of regulatory transcription factor binds DNA and increases the transcription of a gene? A. a repressor exerting negative control B. a repressor exerting positive control C. an activator exerting negative control D. an activator exerting positive control E. a combination of both a repressor and activator exerting negative control 9. A researcher determined that a strain of E. coli is producing a shortened version of a protein required for glucose metabolism. What type of mutation could be responsible for this shorter than normal protein? A. nonsense mutation B. missense mutation C. silent mutation D. sense mutation E. chromosomal rearrangement 10. Which of the following is true concerning a somatic cell mutation? A. A small fraction of the gametes carry the mutation. B. Half of the gametes carry the mutation. C. All of the gametes carry the mutation. D. Only a small group of cells within the organism is affected by the mutation. E. All cells within the organism are affected by the mutation. 11. Based on the gene and protein sequences that follow, what type of mutation-polypeptide effect has occurred? Normal gene: ATGGCCGGCCCGAAAGAGACC Mutated gene: ATGGCCGGCACCGAAAGAGACC Normal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp A. base addition-silent B. base addition-none C. base addition-missense D. base addition-nonsense E. base addition-frameshift 12. When cancer cells have the ability to migrate to other parts of the body, they are said to be A. invasive. B. benign. C. metastatic. D. oncogenic. E. genetic.

BIO152: Sample Midterm Exam Questions Dr. F. Rawle

13. A mutation causes a gene to become overactive, contributing to uncontrolled cell growth. Which term best describes this gene? A. tumor-suppressor gene B. oncogene C. spliced gene D. alternatively spliced gene E. malignant gene 14. Mutations can produce a polypeptide with increased function. A. True B. False 15. Place the following events of mitosis in the correct order. I. Sister chromatids align on the metaphase plate. II. The cleavage furrow forms. III. The nuclear membrane breaks up. IV. Sister chromatids condense. V. Sister chromatids separate. A. I, II, III, IV, V B. III, IV, I, V, II C. IV, III, I, V, II D. III, II, I, IV, V E. IV, I, III, V, II 16. Consider a diploid species where n=5. If an individual of this species was found to have 11 chromosomes, it would be categorized as A. polyploid. B. aneuploid. C. trisomic. D. monosomic. E. both aneuploid and trisomic. 17. Meiosis I produces __________, and meiosis II produces _________ cells. A. two diploid, two haploid B. two diploid, 4 haploid C. two haploid, 4 haploid D. two haploid, two haploid E. two somatic, two gametic 18. The karyotype of a normal human male would show a total of 23 pairs of homologous chromosomes. A. True B. False 19. Color blindness is a recessive X-linked trait. A normal couple has a color-blind child. Who else in this family is probably color blind? A. the child's maternal grandfather B. the child's maternal grandmother C. the child's paternal grandfather D. the child's paternal grandmother E. the child's maternal grandmother or grandfather

BIO152: Sample Midterm Exam Questions Dr. F. Rawle

20. Which of the following inheritance patterns is matched with an inaccurate molecular basis? A. Incomplete dominance; The protein produced by a wild-type allele affects the phenotype in a concentrationdependent manner. B. Codominance; Two proteins are produced in heterozygotes. C. Sex-infuenced; Hormones alter the expression of proteins encoded by dominant and recessive alleles. D. X-linked; Hemizygotes with the recessive allele do not make a functional protein, but heterozygotes do. E. Simple Mendelian inheritance; The protein produced by a single allele cannot produce the dominant phenotype.

1. (__/1) What is the complement DNA strand to 5 -ATTCGGTGA-3 ? ________3-TAAGCCACT-5 ____________________

2. (__/1) A DNA specimen that contains 30% guanine has ___20___% thymine.

3. (__/1) Transcription begins near a site in the DNA called the_______ promoter ________, while the terminator specifies the end of transcription.

4. (__/1) Alternative splicing enables a single gene to encode two or more polypeptides that are different in their amino acid sequence.

5. The DNA coding strand is 5-ACT-TTC-ACT-ATG-TTT-TTA-TCC-TCC-ACT-CCT-TGA-3. (__/1) The mRNA sequence is_______5-ACU-UUC-ACU-AUG-UUU-UUA-UCC-UCC-ACU-CCU-UGA-3 (__/1) The polypeptide sequence is _____5-Met-Phe-Leu-Ser-Ser-Thr-Pro-3______

6. (__/1) Should a genetic abnormality arise, _______ checkpoint _______ proteins prevent a cell from progressing uncontrollably through the cell cycle.

7. (__/1) In cats, the Manx allele (M) causes a short or absent tail, while a recessive allele m confers a normal, long tail. Cats of genotype MM die as embryos. If two Manx cats mate, what is the probability that each surviving kitten has a long tail? Since MM is lethal, the probability that each surviving kitten has a long tail is 1/3.

BIO152: Sample Midterm Exam Questions Dr. F. Rawle

8.

(__/1) a) The inheritance pattern of the disease trait for the above pedigree is ____autosomal dominant_____________________. (__/3) b) Enter the disease genotypes for the following family members, and circle the diseased allele. If you cant determine the genotype from the pedigree, then write UD (undetermined). (Choose from: AA, Aa, aa, xx, xy, or UD). I-1 _Aa__ II-3 aa___ II-7 _Aa__ III-3 _Aa__ III-7 _aa__ I-2 __aa_ II-4 _aa__ II-8 _aa__ III-4 _aa__ II-1 __aa_ II-5 _Aa__ III-1 __aa_ III-5 _Aa__ II-2 __Aa_ II-6 __aa_ III-2 __Aa_ III-6 _aa__