Toxicity of human monocytic THP-1 cells and microglia toward SH-SY5Y neuroblastoma cells is reduced by inhibitors of 5-lipoxygenase and

its activating protein FLAP
Andis Klegeris and Patrick L. McGeer Kinsmen Laboratory of Neurological Research, University of British Columbia, Vancouver, Canada

Abstract: To explore whether the proinflammatory products of the 5-lipoxygenase (5-LOX) pathway are involved in microglia-mediated toxicity toward neuronal cells, we evaluated the effects of 5-LOX inhibitors using an in vitro assay system where human neuronal SH-SY5Y cells are exposed to toxic secretions from THP-1 monocytic cells or human microglia. The specific 5-LOX inhibitors, REV 5901, zileuton, and 5-hydroxyeicosatetraenoic acid lactone; the nonselective LOX inhibitors, phenidone and dapsone; the dual 5-LOX/cyclooxygenase inhibitor, tepoxalin; and the selective inhibitor of the 5-LOX-activating protein (FLAP), MK-886, inhibited such toxicity. The toxicity was enhanced by the 5-LOX product leukotriene (LT)D4 and reduced by the selective cysteinyl LT receptor (CysLT1) antagonist MK-571. The mRNAs for 5-LOX and FLAP were detected in THP-1 cells and human microglia but not in SHSY5Y cells. The data suggest that inhibition of proinflammatory LT production by 5-LOX inhibition could selectively reduce toxicity of microglial cells and thus be beneficial in neuroinflammatory diseases. J. Leukoc. Biol. 73: 369 –378; 2003.
Key Words: Alzheimer’s disease cytokines leukotrienes neurodegeneration neuroinflammation neurotoxicity

Lipoxygenases (LOX) are a complex family of enzymes that peroxidize lipid membranes and are involved in the generation of a number of biologically active mediators. The enzyme 5-LOX (EC is responsible for leukotriene (LT) synthesis. It converts arachidonic into 5-hydroxyeicosatetraenoic acid (5-HETE) and LTA4. The latter is further converted into LTB4 or cysteinyl-containing LTC4, LTD4, and LTE4. The cellular effects of LTB4 are mediated by two types of surface receptors (BLT1 and BLT2), and cysteinyl LTs are recognized by at least two different receptors (CysLT1 and CysLT2) [1, 2]. LTs are the active principles in the slow-reacting substance of anaphylaxis. They also have other proinflammatory properties (for reviews, see refs. [3– 6]) as well as possible roles in intracellular and intranuclear signaling [7]. 5-LOX is primarily localized in leukocytes. Studies on leukocytes have also iden-

tified a small nuclear membrane-associated protein, 5-LOXactivating protein (FLAP), which regulates 5-LOX activity [8, 9]. 5-LOX products play an important role in inflammation. They may also be involved in neurodegenerative processes associated with aging [10], ischemia [11–13], stroke [14], and Alzheimer’s disease [15, 16]. The prevalence of Alzheimer’s disease is reduced in leprosy patients treated with dapsone or drugs closely related to dapsone [17]. This observation, taken together with the fact that dapsone inhibits the generation of 5-LOX products [18], also indicates that the 5-LOX pathway could be involved in neurodegenerative processes. Microglial cells represent the mononuclear phagocyte system in the brain [19]. These cells become chronically activated in a variety of neurodegenerative disorders. They are believed to play a crucial role in the evolution of Alzheimer’s disease (for reviews, see refs. [20, 21]). Recent in vivo experiments show that LOX inhibitors (nordihydroguaiaretic acid and CI987) can prevent microglial activation induced by administration of lipopolysaccharide (LPS) or by spreading depression [22, 23]. We showed that nordihydroguaiaretic acid, a nonspecific inhibitor of LOX and phospholipases, reduced toxicity of secretions from THP-1 cells toward neuronal SH-SY5Y cells [24]. This model was developed to simulate the effects of in vitro human microglial activation, which may reflect in vivo damage observed during disease processes. Our previous studies have shown that nonsteroidal, anti-inflammatory drugs and R-(-)-deprenyl, drugs that have been reported to be beneficial in Alzheimer’s disease, are also effective in this model [25, 26]. To explore further involvement of the 5-LOX pathway in microglial toxicity, we studied the effects of two nonspecific LOX inhibitors, three specific 5-LOX inhibitors, and the FLAP inhibitor MK-886, using our standard toxicity assay and THP-1 cells as representatives of human microglial cells. THP-1 cells are transformed human mononuclear cells that have a range of properties similar to microglia and other mononuclear phagocytes, including release of such products as superoxide anion, tumor necrosis factor , interleukin-1 (IL-1 ), prostaglandin E2, and as yet unidentified neurotoxins [24, 27–31]. Another important advantage in using this human cell line instead of

Correspondence: Andis Klegeris, Kinsmen Laboratory of Neurological Research, University of British Columbia, 2255 Wesbrook Mall, Vancouver, British Columbia, V6T 1Z3, Canada. E-mail: Received October 9, 2002; revised December 10, 2002; accepted December 17, 2002; doi: 10.1189/jlb.1002482.

Journal of Leukocyte Biology Volume 73, March 2003 369

Life Technologies). 42] were used with minor modifications. Canada). but in human tissues. and rabbit polyclonal anti-5-LOX antibodies (from Cayman Chemical). Microglial cells were cultured for 5–7 days and were then detached from the plates by trypsinization (0. obtained from Dr. (St. MATERIALS AND METHODS Reagents The 5-LOX inhibitors and their sources were as follows: REV 5901 and 5-HETE lactone were from Cayman Chemical (Ann Arbor.1.: bacterial LPS (from Escherichia coli 055:B5). Wallace (Department of Pharmacology and Therapeutics. The latter two assays were performed after 24 h incubation with the drug.5% (N 5) microglial cells.5% (5-LOX) or 15% (FLAP) polyacrylamide gels and transferred to Immobilon-P membranes (Millipore. 5 ACTTGCCTTTGAGCGGGTCTACACT 3 . 5 GATGCTCAAGGGGAAGCCAGGGTTC 3 . followed by incubation for 10 min in 4% paraformaldehyde in 370 Journal of Leukocyte Biology Volume 73. reverse. and Alzheimer -amyloid peptide. Vancouver General Hospital. which stains microglia as well as macrophages. Antibodies used for Western blotting were from Cayman Chemical (rabbit polyclonal anti-5-LOX. Antibodies used for immunocytochemistry included rabbit polyclonal antiglial fibrillary acidic protein (GFAP). Membranes were incubated with the primary antibodies overnight at 4°C. H4 TB4. and passed through a 100. neurotoxicity is likely a result of other actors. ICN Biomedicals. PQ. Bronx. a rabbit polyclonal (1:1000.8 Units mg-1 solid). PharMingen. Robert Ross (Department of Biological Sciences. for IL-1 detection. RT-PCR analyses were performed essentially as described before [26]. hrIL-1 and hrIL-6 used for ELISA calibrations were from Bachem California. Immunocytochemistry Human microglial cell cultures were plated on glass coverslips and fixed by air-drying. the cell pellet was resuspended in the serum-containing medium. and the selective FLAP inhibitor MK-886 was from Biomol (Plymouth Meeting. The PCR primers used to detect FLAP (GenBank accession X52195) were: forward. Nonadherent cells with myelin debris were discarded by replacing the cell medium in the plates. 40] was from Biomol. MI). and phosphatase substrate Sigma 104. Membranes were dried. Life Technologies). a rat monoclonal (1:500 dilution. for IL-6 detection. and visible blood vessels were removed. zileuton (N-{1-[benzo-(b)-thien-2-yl]ethyl}-N-hydroxyurea) [38] and the mixed 5-LOX/ cyclooxygenase inhibitor tepoxalin [39] were a kind gift from Dr. according to the manufacturer’s instructions.5-diphenyl tetrazolium bromide (MTT). 1:300) [9]. respectively. Rockford. Hermann Ziltener. Therefore. 37] models.4. Fordham University.jleukbio. LTD4 was purchased from Cayman Chemical. After centrifugation at 275 g for 10 min. rabbit polyclonal anti-FLAP. do not readily express inducible nitric oxide (NO) synthase [32. Both cell lines were used without initial differentiation. After amplification.5 h at room temperature. They were designed to produce specific fragments of 299 base pairs (bp. Immunoblot analyses Immunoblot analysis for 5-LOX and FLAP was performed according to standard protocols. 5 CTGTGGACGAGGAACTGGGCGAGAT 3 .25% trypsin EDTA solution from Gibco-BRL. 5. p-iodonitrotetrazolium violet. BC. resuspended into DMEM-F12 medium containing 5% FBS. 3-(4. nicotinamide adenine dinucleotide (NAD) . AB. Berger. mouse monoclonal (1:50. The human neuroblastoma SH-SY5Y cell line was a gift from Dr. High NO concentrations are known to be toxic to neurons and are secreted by rodent macrophages/ microglia in response to a variety of standard macrophage stimulants such as LPS. Polaroid photographs of the gels were taken. The cell suspension was diluted with 10 ml DMEM-F12 with 10% FBS and was gently triturated by using a 10-ml pipette with a wide mouth. from Gibco-BRL. MO).). Bedford. Pharmacia Biotech. University of Calgary. Life Technologies (Burlington.000 dilution. CA). which was extended to 9 min to activate AmpliTaq Gold enzyme. by release of lactate dehydrogenase (LDH). Protocols described by De Groot et al. The PCR primers used to detect 5-LOX (GenBank accession NM_000698) were: forward. Costa Mesa. and peroxidase-labeled anti-rabbit antibodies (1:5000) were purchased from Sigma Chemical Co. The Upjohn Co. Foster City. The cell suspension was then centrifuged once more (275 g for 10 min). tissues were chopped into small ( 2 mm3) pieces by using a sterile scalpel. VA). 35] and in vivo [36.. Tissues were placed in a sterile Petri dish and rinsed with Hanks’ balanced salt solution (HBSS). MI). Kalamazoo.(IFN. and immunostaining was performed after 2 h pretreatment with 5% skimmed milk in tris-buffered saline. CA). John L. Up to 1 h exposure time was required. The alkaline phosphatase-labeled anti-mouse and anti-rabbit antibodies (1:3000) were supplied by Gibco-BRL. triturated several times. Baie d’Urfe. Canada). PA). followed by the secondary peroxidase-labeled antibodies for 1. ON. CA). Plates were placed in a humidified 5% CO2. After an extensive (2 h) wash with tris-buffered saline containing 0. Ann E. PCR products were separated in a 6% polyacrylamide gel and visualized by ethidium bromide staining.. and SH-SY5Y neuronal cell cultures was isolated by using the Trizol reagent (Gibco-BRL. Louis. Reverse transcriptase-polymerase chain reaction (RT-PCR) Total RNA from THP-1. and GFAP. and plated onto uncoated 10 cm tissue-culture plates (Becton Dickinson). Canada) was added to reach a ´ final concentration of 50 g ml-1. interferon. Equivalent amounts of protein (40 g per lane) were separated through 7. Antibodies used in enzyme-linked immunosorbent assay (ELISA) were as follows: for IL-1 capture. MA).the rodent primary microglial cells is the fact that these cells. resuspended into 10 ml DMEM-F12 with 10% FBS containing gentamicin (50 g ml-1). March 2003 http://www. phenidone (1-phenyl-3-pyrazolidinone) was from Aldrich (Milwaukee. The Biomedical Research Centre. The number of cycles performed was 30 for FLAP and 33 for 5-LOX. PCR amplification was performed using AmpliTaq Gold DNA polymerase (Perkin Elmer.was purchased from Bachem California (Torrance). and the selective CysLT1 antagonist MK-571 [1. WI). Life Technologies). from Clostridium kluyveri. John Maguire (Department of Pathology and Laboratory Medicine. 95% air atmosphere at 37°C for 2 h to achieve adherence of microglial cells. BC.5-dimethylthiazol-2-yl)-2. NJ). a rabbit polyclonal (1:2000. diaphorase (EC 1. 5-LOX) and 325 bp (FLAP) spanning two and three introns. After washing tissues two more times with HBSS. [41. for IL-6 capture. and used for cytotoxicity experiments. NY). The fragments were transferred into a 50-ml centrifuge tube containing 10 ml 0. used at 1:400 (both from Dako. These cells were grown in Dulbecco’s modified Eagle’s medium–nutrient mixture F12 ham (DMEM-F12) supplemented with 10% fetal bovine serum (FBS. Human recombinant (hr) . Immunostaining (see below) with antibodies against CD68.05% Tween-20. used at 1:400. 30 s at 55°C. The remaining cycles were 1 min at 94°C. Subsequently. Human microglial cells were isolated from surgically resected temporal lobe tissue.6 0. used at 1:20. Canada). 5 GGAGATGGTGGTGGAGATCGTCTTT 3 . a gift from Dr. The amplification program consisted of an initial denaturation step at 94°C.4 -diaminodiphenyl sulfone) was from Sigma Chemical Co. NO dominates among rodent microglial neurotoxic secretions in in vitro [34. 33]. showed that the isolated cultures contained 96. Tissues were incubated for an additional 10 min at 37°C. mouse monoclonal anti-CD68. We thank Dr.8. IL). San Diego. The following substances used in various assays were obtained from Sigma Chemical Co. DNase I (from bovine pancreas. human microglial. This was followed by an annealing step at 55°C for 30 s and an initial synthesis step at 72°C for 3 min. The viability of monocytic cells and microglia in the presence of various inhibitors was monitored visually with a phase-contrast microscope.m nylon cell strainer (Becton Dickinson. It was extended to 42 cycles for those samples where no product could be observed after the initial amplification. and 1 min at 72°C. and by the MTT assay that detects live cells (see below). CA). PQ. Cell culture The human monocytic THP-1 cell line was obtained from the American Type Culture Collection (Manassas. dapsone (4. dimethyl sulfoxide. Vancouver. Carpinteria.25% trypsin solution and were incubated at 37°C for 20 min. which is a marker of astrocytes. like most of the human mononuclear phagocytes including microglia. reverse. 1:1000 dilution) and from Merck Frosst Canada (Kirkland. Canada) for providing the surgical specimens. the specific bands were visualized by a chemiluminescence assay (Pierce Chemical Co. Franklin Lakes.

The viable cell value was calculated as a fraction of the value obtained from cells incubated with fresh medium only. diluted in 2% skim milk powder in PBS. Values obtained in the presence of various inhibitors were normalized against values obtained with comparably stimulated THP-1 cells in the absence of inhibitors. As an alternative.6 0. pH 4. sections were washed. 3B). Aliquots (50 l) were added to each well of 96-well plates (Easy Wash.5% Tween in PBS. Briefly. Samples and recombinant cytokine standards diluted in PBS/3% BSA were added at 100 l per well. The enzymatic reaction was started by addition of 15 l NAD /diaphorase solution (3 mg ml-1 NAD . The alkaline phosphatase-labeled antibody was added (1:3000 dilution) in PBS/3% BSA at 100 l per well. 1) and immunoblotting (Fig. immunocytochemistry was performed on microglial cell cultures obtained from surgical specimens.5 g ml-1 LPS with 150 Units ml-1 IFN.5 ml DMEM-F12 medium containing 5% FBS. and human microglial cells were used at a 5x lower concentration. the dark crystals formed were dissolved by adding to the wells an equal volume of sodium dodecyl sulfate/dimethylformamide (SDS/DMF) extraction buffer (20% SDS. the corresponding secondary biotinylated antibody was added at 1:1000.001% hydrogen peroxide in 0.8. 2. The cells had been plated 24 h earlier at a concentration of 2 x 105 ml-1 in 0. ON. Nonspecific binding sites were blocked by incubation for 1.7).2. Various drugs were added to THP-1 cell cultures 30 min before their stimulation or directly to SH-SY5Y cells at the time when THP-1 cell supernates were transferred to wells with neuronal cells. Canada). cell membranes were permeabilized with an 0. OD at 405 nm was read by a microplate reader after 120 min incubation of wells with substrate buffer containing 1 mg ml-1 Sigma 104 phosphate substrate in 0. 26]. After several PBS washes. N 5) were of microglial lineage (Fig. Following a 1-h incubation at 37°C. which corresponded well with the previously reported molecular sizes for 5-LOX (75– 80 kDa) and FLAP (18 kDa) [4. CA). RESULTS Expression of 5-LOX and FLAP in the various cell types was studied first.3-diaminobenzidine containing 1% nickel ammonium sulfate. Briefly.4 U ml-1 for IL-6. This was followed by PBS washes and 30 min incubation with the avidin-biotinylated horseradish peroxidase complex (1:1000.N-DMF. where the remaining cells were totally lysed by 1% Triton X-100.5%. PCR products yielded single bands of the predicted sizes of 299 bp for 5-LOX and 325 bp for FLAP.3% 3. standard curves were run. Nonspecific binding sites were blocked by incubation of the wells with 200 l 3% bovine serum albumin (BSA) in PBS for 2 h at room temperature. the concentration of cytokines in cell-free supernatants was measured as follows.6 mg ml-1).05 M tris-HCl buffer. Cell viability assays: LDH release Cell death was evaluated by LDH release. After 24 h incubation. Statistical analyses were performed before transformation of data to percent values. where concentrations of cytokines were reduced to levels that were indistinguishable from readings obtained with media alone. followed by addition of 15 l lactate solution (36 mg ml-1 in PBS) and 15 l p-iodonitrotetrazolium violet solution (2 mg ml-1 in PBS). Cytotoxicity of THP-1 cells and microglia toward SH-SY5Y neuroblastoma cells The cytotoxicity experiments were performed as described previously [24. For each set of experiments. After 15 min incubation. and coverslipped with Entellan (BDH.1 M diethanolamine buffer. Staining was performed by incubating cells overnight at room temperature with a primary antibody (see Reagents above).). Subsequently.4 0.2% solution of Triton X-100 in PBS (5 min). but insufficient protein was available to permit immunoblotting analysis of these cells. LDH activity in cell-culture supernatants was measured by an enzymatic test as described by Decker and Lohmann-Matthes [43]. Burlingame. When a dark-blue color developed. cells with the same morphology 371 Cell viability assays: reduction of formazan dye (MTT) The MTT assay was performed as described by Mosmann [44] and by Hansen et al. 50 mM imidazole. The concentration-dependent effects of various drugs were evaluated statistically by the randomized blocks design ANOVA. human monocytic THP-1 cells were seeded into 24-well plates at a concentration of 4 x 105 cells per well in 0. 3A). Optical densities (OD) were measured by a microplate reader with a 490 nm filter. Toronto. The cells were incubated in the presence or absence of various drugs for 30 min before the addition of an activating stimulus (0. cells were seeded into 24-well culture plates (0. Measurement of IL-1 and IL-6 The concentrations of IL-1 and IL-6 in cell-free supernates were measured after 48 h incubation by an ELISA as described previously for IL-1 [46]. NY) and were incubated overnight at 4°C. and 0. These blank values were subtracted from readings of experimental samples. pH 7. Corning. and evaluation of surviving cells was performed by the MTT assay.4 ml cell-free supernatant was transferred to each well containing SH-SY5Y cells. 9]. After several washes with PBS. Plates were incubated for 1 h at room temperature.8 ml DMEM-F12 medium containing 5% FBS. Statistical analysis Data are presented as means SEM. 2) indicated that the mRNA for 5-LOX and its activating protein FLAP are expressed at high levels in THP-1 cells but not in SH-SY5Y cells.6 ml. They were exposed to a combination of 0. pH 8. plates were washed two to eight times with 0. After each of the above experimental steps. plates were placed overnight at 37°C. Corning.5% hydrogen peroxide in PBS. in which formation of the formazan product of iodonitrotetrazolium dye was followed colorimetrically. 0. 50% N. ABC Elite from Vector Laboratories.0. The viability of SH-SY5Y cells was determined by adding MTT to the SH-SY5Y cell cultures to reach a final concentration of 1 mg ml-1. This method is based on the ability of viable but not dead cells to convert the tetrazolium salt (MTT) to colored formazan. Subsequently. The detection limits. pH 9.4 3. Values obtained in the presence of various inhibitors were normalized against values obtained with comparably stimulated THP-1 cells in the absence of inhibitors.. and after 48 h incubation.3 mg solid ml-1 diaphorase). Capture antibodies were diluted in 0. and cells were incubated for 1 h at room temperature. After 72 h of incubation. Controls without the primary antibody showed no significant staining. and OD at 570 nm were measured by transferring 100 l aliquots to 96-well plates and using the platereader with a corresponding filter Klegeris and McGeer 5-LOX inhibition reduces monocytic cell toxicity . followed by 45 min incubation at room temperature. Endogenous peroxidase was inactivated by incubation for 30 min with 0. 100 l cell culture supernatants were pipetted into the wells of 96-well plates. Briefly. Detection antibodies were diluted in PBS/3% BSA and added at 100 l to each well. Concentrations of cytokines in the experimental samples were calculated according to the OD obtained from wells containing standards of recombinant cytokine. When cell cultures were stained by antibodies recognizing 5-LOX (Fig. and plates were incubated overnight at 4°C. peroxidase labeling was visualized by incubation in 0. Staining of such cultures with antibodies against CD68 showed that the majority of cells (96. pH 7. which correspond to media alone 2 SD were 10.5 h with 5% skim milk powder in PBS containing 1% of normal serum from the animal in which the secondary antibody was raised. Immunoblots from THP-1 cells but not SH-SY5Y cells showed the presence of single bands. [45].phosphate-buffered saline (PBS).5 g ml-1 LPS and 150 Units ml-1 IFN.4 mU ml-1 for IL-1 and 2. 5x105 cells ml-1). and the amount of LDH that had been released was expressed as a fraction of the value obtained in comparative wells. RT-PCR experiments (Fig.1 M bicarbonate-coating buffer. mounted on glass slides. the reaction was terminated by addition of 15 l oxamate (16. to record values.6. The mRNAs for 5-LOX and FLAP were detected in each of four postmortem microglial cell cultures that had been prepared according to our previously published procedure [25]. the neuronal culture media were sampled for LDH to determine release from dead cells.

org . 1. similar to the death occurring in SH-SY5Y cells cultured in media alone. Lane 1. The reductions varied between 26% and 68% according to the agent. The reduction of LDH released in the presence of inhibitors therefore represents the degree of sparing achieved by each agent. Human THP-1 monocytic cells. it was determined that at zero inhibitor concentration. 2.. all of the above inhibitors reduced the toxicity of these cells toward neuronal SH-SY5Y cells (Fig. respectively. There was good agreement between the two independent methods. medium from stimulated THP-1 cells only).5% (5-LOX) or 15% (FLAP) polyacrylamide gels and visualized by a chemiluminescence assay. 3C). http://www. each set of data was normalized to the zero drug concentration value. Location of molecular size markers in base pairs is shown in the left lane. The few remaining cells were astrocytes. 372 Journal of Leukocyte Biology Volume 73.e. The MTT values (Fig. phenidone and dapsone. Notice that 5-LOX and FLAP mRNA bands are observed in human monocytic THP-1 and microglial cell extracts but not in the extracts of SH-SY5Y neuronal cells.and FLAP-specific bands in extracts of monocytic THP-1 and neuronal SH-SY5Y cells. Location of molecular size markers (kDa) is shown in the left lane. were positive. The order of potency on a molar basis for protecting SH-SY5Y cells (see Fig. In this way. tepoxalin. The fraction of cells surviving at the termination of the experiment was established by measuring LDH. i.5% (N 40) of total cells were dead after 72 h. Reduction of toxicity was assessed in two ways: through measurement of LDH released into the medium by cells dying after being exposed to the toxic medium (Fig. which was again set at a base of 100%. Fig. zileuton. as well as the dual inhibitor of 5-LOX and cyclooxygenases. MK-886. lane 2. One-hour exposure time was required. Polaroid photographs of a typical ethidium bromide-stained gel demonstrating PCR products for 5-LOX and FLAP mRNAs after 33 and 30 amplification cycles. 4B) were also normalized to zero inhibitor concentration. and 5-HETE lactone. the selective FLAP inhibitor. REV 5901. human postmortem microglia (representative of four independent cultures).e. where 100% represents zero concentration of the inhibitor (i. When added to THP-1 cells 30 min before their stimulation. 4A) and through formazan reduction by cells surviving in culture. The following amplification products are shown: Lane 1.4 3. the nonselective LOX inhibitors. In these experiments. lane 2. as evidenced by their astrocytic morphology and positive staining for GFAP (Fig. human THP-1 monocytic cells (representative of five independent cultures).1 1% (N 12) at 72 h. We tested the following 5-LOX and FLAP inhibitors for their ability to reduce the THP-1 cell toxicity toward SH-SY5Y neuroblastoma cells: the specific 5-LOX inhibitors.. Equivalent amounts of protein (40 g per lane) were separated through 7. Culture with unstimulated THP-1 cell supernatants resulted in death of 6. SH-SY5Y neuroblastoma cells. the MTT assay (Fig. and lane 3.Figure 4 shows the relative values of LDH released into the medium during 72 h of SH-SY5Y cultures in the presence or absence of inhibitors. 4A) was 5-HETE lactone MK-886 REV 5901 tepoxalin zileuton phenidone dapsone. An example of immunoblot showing 5-LOX. 4B). SH-SY5Y neuroblastoma cells (representative of seven independent cultures). The scale is in percent. March 2003 Fig. 4).jleukbio. 48.

the MTT assay showed that no drug caused any significant increase in cell viability with one exception. Measurements of the viability of microglia after the 24-h incubation with the drug showed no decrease in microglial viability by MK-886 treatment. inhibitors of 5-LOX were effective at reducing the toxicity of secretions from stimulated microglia or THP-1 cells but not at protecting neuronal cells 373 The mean absolute value of live cells at zero inhibitor concentration was 49. Viability was also examined after the drugs were administered to SH-SY5Y cells concomitantly with stimulated THP-1 cell supernates. LTB4 acts as an intracellular signaling molecule. with the order of potency roughly paralleling the LDH results. which demonstrates that the toxic action of THP-1 cells could be enhanced by LTD4. N 31). 3. which is one of the products of the 5-LOX pathway. The inhibitory effects of MK-886 on microglia were similar to those on THP-1 cells according to both assays used. indicating that these agents were acting only on the THP-1 cells after their activation. Three different inhibitors of 5-LOX. the agents enhanced survival so that the effects were measured as a percent increase over the base value.7 2. Conversely.stimulation. Three of the specific 5-LOX and FLAP inhibitors were also studied for their effect on cytokine secretion by THP-1 cells (Table 1). The increases ranged up to 225%. As addition of exogenous LTB4 restored this function. The inhibitory effect of one of the inhibitors was also confirmed on human microglial cells isolated from surgical specimens. MK-886 effectively inhibited cytotoxic activity of human microglial cells that were isolated from tissues of five cases that had undergone surgical temporal lobe resection. 6A). DISCUSSION The data obtained in this study show that inhibition of the 5-LOX pathway results in reduced toxicity of human mononuclear phagocytes toward human SH-SY5Y neuroblastoma cells. Bailie et al. Immunostaining of cultures from surgically resected human temporal lobe tissue. (B) staining of microglia with an antibody to 5-LOX. 49]. in our experimental model.8 percent. They had no effect on unstimulated THP-1 cells. as well as MK-886.M concentration.out of seven inhibitors including MK-886. Measurement of IL-1 and IL-6 in cell-free supernates of THP-1 cells that had been stimulated with LPS (0. which at a 2. (C) staining of one of a small number of astrocytes that appeared in the cultures with an antisera to GFAP. Similarly. Fisher’s least significant differences test). Figure 6 shows data obtained by using the MTT assay. [50] concluded that in macrophages. Addition of these agents at the time of transfer of supernatants from stimulated THP-1 cells (Fig. 6B) had no effect on SH-SY5Y cell viability. effectively reduced neuronal cell death induced by secretions from human monocytic THP-1 cells.05. These cells. Under these conditions. In this case.5 g ml-1) and IFN. Fig.05. Preliminary results of the protective effects of MK-886 and REV 5901 have been published previously [47]. (A) Microglial cell stained with an antibody to CD68. The values of live cells in this series of experiments were similar to those obtained in the experiments shown in Figure 4 (57.5 (N 40) of total cells after 72 h.0 2. became toxic toward neuronal SHSY5Y cells after LPS and IFN. similar to THP-1 and human postmortem microglial cells [24]. Table 1 shows data obtained with three Klegeris and McGeer 5-LOX inhibition reduces monocytic cell toxicity . increased SH-SY5Y survival by 31% (P 0. randomized blocks ANOVA).(150 Units ml-1) 48 h earlier showed no significant effects of the drugs on these mononuclear cell functions (P 0. These observations fit well with the concept that the 5-LOX pathway leads to generation of substances that are proinflammatory and potentially harmful [48. Original calibration bar (50 m) is for all three panels. The data obtained are also consistent with observations made by using macrophages from 5-LOX gene knockout mice that show an impairment of bacterial phagocytosis [50]. Figure 5 shows that the inhibitory effects of the FLAP inhibitor MK-886 on THP-1 cells were not confined to this particular cell line. It is important to note that none of the drugs had any effect on viability of THP-1 cells as measured by LDH and MTT assays after the 24-h incubation period (data not shown). the selective CysLT1 receptor antagonist MK-571 was able to reduce the toxicity of THP-1 cells (Fig. the inhibitor of FLAP.

8 78.3 (3) 13.4 97. b P 0.5 g ml-1) and IFN. P values obtained for each of the drug treatments are presented in the figure.9 16. Viability of SH-SY5Y cells was assessed after 72 h by measuring the LDH activity in the supernatants (A) and by the MTT assay (B). After 24 h incubation.5 95. The concentration-dependent effects of various drugs were assessed by randomized blocks design ANOVA.05.3 92. % control) 93. Various Inhibitors Are Not Neuroprotective Against Supernates from Stimulated THP-1 Cells When Added Directly to SH-SY5Y Neuroblastoma Cells (A) and Do Not Inhibit IL-1 (B) and IL-6 (C) Secretion by THP-1 Cells (A) Viability of SH-SY5Y cells (MTT. a MK-886 at 5 M was toxic when added to SH-SY5Y cells directly.3 (4) 7.2 107.5 (3) 13.9 (3) 11.7 . THP-1 cells were pretreated with various concentrations ( M) of inhibitors (shown on the ordinate) for 30 min before stimulation with LPS (0.9 (8) (B) IL-1 secretion by THP-1 cells (% control) 11.8 94. where 100% (shown as a dashed line) is the value obtained from supernatants of stimulated THP-1 cells in the absence of drugs. The number of independent experiments for each set of data is also shown. and the dotted lines represent SEM intervals. The number of independent experiments for each set of data is shown in parentheses.5 g ml 1) with IFN.4 130.(150 Units ml 1).6 (3) 14. IL-1 (B) and IL-6 (C) concentrations in cell-free supernates of THP-1 cells were measured after 48 h incubation with a mixture of LPS (0.0 94. 374 Journal of Leukocyte Biology Volume 73.7 (3) 11.Fig.4 12.9 82.jleukbio. ( M) 5 1 1 0.0 1. 4.(150 Units ml-1).4 (3) 25. Decreased toxicity of THP-1 monocytic cell secretions toward SH-SY5Y cells by inhibitors of 5-LOX and its activating protein FLAP. Data (means SEM) are expressed as % change in cell activation parameters.0 (3) nd 81.6 (8)b 1.4 (3) 103. Data (means SEM) are expressed as % control.3 104. TABLE 1.4 (3) Inhibitor REV 5901 5-HETE lactone MK-886 Conc.5 5 2 1 Inhibitors were administered to SH-SY5Y cells concomitantly with stimulated THP-1 cell supernates.4 (5) —a 7.5 (5) 6.1 6. nd. March 2003 http://www.5 105. significantly different between a given concentration of inhibitor and the control sample.8 (3) 3.2 (4) 1. Fisher’s least significant differences test. The dash-dotted line represents the mean value obtained from supernatants of unstimulated THP-1 cells. and neuronal cell viability was assessed after 72 h by the MTT assay (A).5 (3) 8. the cell-free supernatants of THP-1 cells were transferred to the wells containing SH-SY5Y cells.5 (C) IL-6 secretion by THP-1 cells (% control) 105. Not determined.8 106.1 (3) nd 100.

the selective antagonist of CysLT1. neuroprotective agents. (A) THP-1 cells were treated with various concentrations ( M) of drugs (shown on the abscissa) concomitantly with their stimulation by a combination of LPS (0. MK-886 had a small. 6.5 g ml-1) and IFN. Klegeris and McGeer 5-LOX inhibition reduces monocytic cell toxicity 375 . (B) Drugs were added to SH-SY5Y cells at the time of transfer of the supernatants from THP-1 cells that had been stimulated 24 h earlier with LPS (0. F and P values obtained for each of the drug treatments are presented in the figure. in addi- Fig.(150 Units ml-1). The number of independent experiments for each set of data is also shown. The concentrationdependent effects of various drugs were assessed by randomized blocks design ANOVA. Data (means SEM) are expressed as % dead (A) or live (B) cells. The molecules that contribute to the neurotoxicity of secretions from stimulated microglia or mononuclear phagocytes are as yet unidentified (for a review.(150 Units ml-1). This enhancing effect of LTD4 only occurred on stimulated THP-1 cells. However. Data (means SEM) are expressed as % control. Data were obtained from five independent experiments. Viability of SH-SY5Y cells was assessed after 72 h by the MTT assay. The observed inability of 5-LOX inhibitors to protect neuronal cells directly is consistent with the data showing no effect of 5-LOX inhibition on neuronal death induced by such neurotoxic agents as NO [51] and Alzheimer -amyloid peptide [52]. As an exception. it appears that several intracellular signaling cascades. The specific FLAP inhibitor MK-886 in a concentration-dependent manner inhibits toxicity of human microglia derived from surgical specimens. LTD4 enhanced the toxicity of THP-1 cell secretions when added to THP-1 cells at the time of their stimulation by LPS and IFNand failed to increase such toxicity when combined with the toxic supernatants after they had been transferred from THP-1 to SH-SY5Y cells. see ref. THP-1 cell toxicity toward SH-SY5Y neuronal cells is enhanced by LTD4 and inhibited by the selective CysLT1 antagonist MK-571 only when they are added to THP-1 cells at the time of their stimulation. reduced the toxicity of THP-1 secretions when added to THP-1 cells but was also ineffective when applied to SH-SY5Y cells directly. The concentrationdependent effect of MK-886 was assessed by randomized blocks design ANOVA. Note that human microglial cells were used at a 5 lower concentration than THP-1 cells. shown on the abscissa) for 30 min before stimulation with LPS (0. the receptor that recognizes CysLTs [2. The viability of SH-SY5Y cells was assessed after 72 h by measuring the LDH activity in the supernatants (A) and by the MTT assay (B). F and P values obtained for both assays are presented in the figure.5 g ml-1) and IFN. protective effect when added at 2 M. indicating that these agents are acting synergistically with intracellular pathways engaged by the LPS and IFN.5 g ml-1) and IFN. Moreover. 40]. Addition of various inhibitors to SH-SY5Y cells at the time of exposure to stimulated THP-1 cell supernates did not reduce neuronal cell death. when added directly to such secretions. Consistent with these observations. After 24 h incubation. the cell-free supernatants of microglial cells were transferred to the wells containing SH-SY5Y cells.(150 Units ml-1). where 100% is the value obtained from supernatants of stimulated THP-1 cells in the absence of drugs.The 5-LOX inhibitors were ineffective as direct.stimulation. Human microglial cells were pretreated with various concentrations of MK-886 ( M. [53]). 5. which may indicate that this drug exerts other effects not related to 5-LOX inhibition. Fig.

(1998) Aging-associated up-regulation of neuronal 5-lipoxygenase expression: putative role in neuronal vulnerability. 7. Stocco. 2.. D.. [1. N. this particular quality of SH-SY5Y cells provided us with an experimental advantage in that the effects on microglia-like cells can be distinguished from those on neuron-like cells. F.. M.. N. 23679 –23682. Our data support previous reports showing that 5-LOX and FLAP are present in the THP-1 cell preparations and that THP-1 cells have the capacity to synthesize 5-LOX products. Rev.. Science 220. S. Nature 343. Pesold. D. acting directly on neurons as well as reducing microglial toxicity [15]. there are no other data available on the expression of these proteins by various cell types in human brain. 275. (1999) The diversity of the lipoxygenase family...... W. Coulombe. (1993) 5-Lipoxygenase and 5-lipoxygenase-activating protein are localized in the nuclear envelope of activated human leukocytes. Herrity. 12. Nuthulaganti. Samuelsson. N.. 657– 663. 278 –281. D. 91–109.12 M for REV 5901 [59]. Ma. B. These concentrations are within the range sufficient to inhibit monocytic cell toxicity. J. Y. Chem. Sathe. T. 6.. Miller. Therefore it is likely that a combination of products is responsible for the overall activity. Q. Kuhn. such as 5-HETE and LTB4. Fortin. Lynch. E.. R. 3. Muccitelli. Wetterholm... W. are involved in inducing this effect [24.. http://www. especially as neurons have been reported to be the predominant cell type expressing 5-LOX in rats [10]. (2000) Characterization of the human cysteinyl leukotriene 2 receptor. Nguyen. 15. J.. L. Dixon. expression. Wilson. L. Ford-Hutchinson. (1999) Identification. Charleson. P. J. 27. K. H. P. C. J... Figueroa. Life Sci. Austin. Gillard. concentrations in the range of 1–10 M of these inhibitors have been required to achieve biological effects in various in vitro assays (e. Dytko. J. Zeng. functions. Therefore. J.. A. R.. Uz. such as tepoxalin.3 M and is sufficient to inhibit prostaglandin and LT production by human blood cells [64].. A. D. (1999) The enzymology and pharmacology of 5-lipoxygenase and 5-lipoxygenase activating protein. In summary. Vickers.... 449. S. Schmidt. S. 3. 8. and concentration of tepoxalin reaches 1. K. S. R. Our data suggest that inhibition of the 5-LOX pathway may allow selective control of monocytic cell toxicity without affecting other inflammatory functions such as the secretion of IL-1 and IL-6 (see Table 1). C. P. The data from this study suggest that there may be a role for 5-LOX inhibitors in neuroinflammatory disorders possibly as a part of multitarget therapy. and therefore. A.. Thiele. J. providing that 376 Journal of Leukocyte Biology Volume 73. Harris. P. Med. J.. Vickers..g. This may reflect the need for 100% inhibition of LT synthesis before certain biological effects can be observed [60] or poor access by these inhibitors of their protein targets in intact cells and isolated tissues [59. Clin. W. G. and 0. Foley. Biol. G. B. Hay. Jenkins. The use of 5-LOX inhibitors in aging-associated brain pathology has been proposed on the basis of observations that neuronal 5-LOX is up-regulated in aging brain [10]. Metters. W. 38]).. RT-PCR analysis and immunocytochemistry of human microglial cells as described in this study indicate that human microglia contain these proteins. A. Bell. The concentrations of the specific inhibitors of 5-LOX and FLAP required to inhibit monocytic and microglial toxicity were above their reported inhibitory concentration (IC50) values as inhibitors of 5-LOX enzymatic activity. 568 –575. Hearn. Williams Jr. Charleson.. catalysis. R. Plasma concentration of zileuton has been shown to peak at 15–20 M with 93% being bound to proteins [62. which correlated well with the lack of any direct effect of the specific inhibitors.tion to the 5-LOX pathway... Halsey. S. This may be a special property of the SH-SY5Y cell line. Muir. Elshourbagy. P. R. Z. 59. thus providing direct evidence for the functionality of this pathway in THP-1 cells [55–57]. D. it may be possible to use them to inhibit neuroinflammation.. Sarau. Singer. our data suggest that inhibition of proinflammatory LT production could selectively reduce neurotoxicity of microglial cells and thus be beneficial in diseases where overactivation of microglia may contribute to the pathogenesis. J. FASEB J. 5. and acquisition of substrate. J. 56. M. O. Haeggstrom. R. W. Liu. and characterization of a cysteinyl leukotriene receptor.. Bellefeuille. However our data point to the fact that LT products of this pathway may not be the substances responsible for the mononuclear cell toxicity but rather serve as intracellular stimulants that are used by these cells to up-regulate their secretion of neurotoxins.1 M for MK-886 [60]. H. [58 – 61])... P. Scott. D. 439 – 449. F. Mol. N. [61] demonstrated that the IC50 for REV 5901 in isolated human lung tissue is 10 M and that this inhibitor remains specific toward 5-LOX at concentrations as high as 50 M. Pharmacol.. 30531–30536.. 10. [47– 49]). These values have been reported to be 0. ACKNOWLEDGMENTS This work was supported by a grant from the Jack Brown and Family Alzheimer’s Disease Research Fund and by a grant from the Alzheimer Society of Canada/CIHR/Astra Zeneca Canada. 4. (1990) Identification and isolation of a membrane protein necessary for leukotriene production. Sadowski. L. J. Murdock... Cell. M. FEBS Lett.. Nevertheless. Mancini. Biol. I. G. M. J. S. R. (1999) Lipoxygenases: occurrence. 742–753. Woods. C. O’Dowd. D. this class of inhibitors may offer a double protection. Chambers. Leveille. 1935–1946... P. R.. T. Exp. L. J. Kusner et al. Nevertheless. R... To the best of our knowledge. Nevertheless. Ames. Evans. may provide increased benefits or permit decreased doses of individual drugs with toxic side-effects (see refs. 274. March 2003 these drugs penetrate the blood-brain barrier. Brash. I. H. K. Mol. R. Longone. 178. P. 0. Liu. D. J.. 7–11. Ellis. S. 54]. B. M.jleukbio. B. A... 17. P. I. Evans.. O’Neill.. Im. J.. Cheng. F. Sawyer. N. 63]. However. Ethier. (1983) Leukotrienes: mediators of immediate hypersensitivity reactions and inflammation. (2002) Enzymes and receptors in the leukotriene cascade. Selective 5-LOX inhibitors and CysLT1 antagonists are already available for clinical use and are prescribed for asthma treatment (see refs.. R.. we were unable to detect these mRNAs or proteins in neuroblastoma SH-SY5Y cells. J. K.. C. George. J. The specific 5-LOX inhibitor zileuton and the dual 5-LOX/ cyclooxygenase inhibitor tepoxalin have been used clinically. Abramovitz.... C.. 61].. M.. With respect to neuronal expression of 5-LOX and FLAP. J... T. Buckley. Allergy Immunol.. R. the possibility that the various inhibitors used in this study may affect other cellular targets cannot be ruled out entirely. Chem. this observation needs to be confirmed by in situ studies.7 M for zilueton [3]. refs. A. molecular cloning. For example. 9. Bergsma. J. R... Z. REFERENCES 1. as 5-LOX and FLAP have been detected in human CHP100 neuroblastoma cells [58]. Heise. C. Clements. Manev. simultaneous inhibition of 5-LOX and cyclooxygenases by different drugs or by dual inhibitors. A. .

(1996) Protective effect of the 5-lipoxygenase inhibitor AA-861 on cerebral edema after transient ischemia. (2000) 5-Lipoxygenase gene polymorphism and onset of Alzheimer’s disease. J. 52. M. P. Vila. 342–354. Munsiff.. A. T. Veerhuis. Neurosurg. S. Das. Maggio. N. 40. A. L. Dementia 3. J. 928 –939. A. H. 125–150. P. G. 30. 44. 93–100. Schulzer. Laufer. Chander. Landreth. (2000) Pharmacological characterization of leukotriene receptors. 49. Hu.. 682– 684.. Neurosci. R. Leukoc. H. S. Manev. D. L. Wozel. D. C. E. Exp. Res. M. P. 22. J. Klegeris and McGeer 5-LOX inhibition reduces monocytic cell toxicity 377 . E. G. R. C. Bailie.. Nielsen. 34. P.. 246. D. S.. (2000) Putative role of neuronal 5-lipoxygenase in an aging brain. Baker. G. J. K. W. Rogers. Prasad. A. P. 1017–1025. L. Hum. K. M.. Kirchner. M. M. K. T. Neuroinflammation Working Group (2000) Inflammation and Alzheimer’s disease. 572–577. N.. 383– 421. S. 42. Ichimori. I. H. Rosenthale.11. Janssen. A. 46. Dawson. L... P. Lancet 348. McMillian. 157. M. Klegeris. Baskaya. Giulian. Johnson.. Bing. Bertolini... McGeer. Bigby. K. J-S. Acad. T.. Ghilardi. 146 –149. 31. Cannady. J.. Mandir. N. 51. Y. P. T. 43. H. A. 79. J. Lebeau. Stier Jr.. Strieter. C. Caggiano. J. Sunamoto. T. (2000) Inhibitory action of 1-(2-chlorophenyl)-N-methyl-N-(1 methylpropyl)-3-isoquinolinecarboxamide (PK 11195) on some mononuclear phagocyte functions. Montagne.. McMillian.. (1999) Identification of microglial signal transduction pathways mediating a neurotoxic response to amyloidogenic fragments of -amyloid and prion proteins. R.. P. Comp. J. 14. 112–116. G.. A.. J-M. D. Gilbert. Physiol. A. (1989) Re-examination and further development of a precise and rapid dye method for measuring cell growth/cell kill. 37. McGeer. G.. M... 45.... Care Med. Tuominen. 711–720. J. Res. Esclaire. The dual inhibition concept... Am. Giulian. Kraig. Top. R. M. R. K. W. M. Dahlen. Hauss-Wegrzyniak. L. Van Furth. Zheng. 20. Skin Pharmacol.. Matsuki. Madden. C. 27... Nat. 53. J. and loss of a select population of neurons in the rat CNS in vivo. 5. Piotrkowski. C. 50. Argentieri. Schaefer. B. J. J. Brain Res. O’Hare. Y. T. neurons by microglial activation in basal forebrain mixed neuronal/glial cultures. Ritchie. 65.. 85. W. (1996) Leukotriene-deficient mice manifest enhanced lethality from Klebsiella pneumonia in association with decreased alveolar macrophage phagocytic and bactericidal activities... K.. Embury. Neurol. J... E. K. L-Y. L. 18. J.25-dihydroxyvitamin D3.. 59. L. 555–561. 1017–1025. Arai.. A. T. 55.. B. (2000) The cytotoxicity of chronic neuroinflammation upon basal forebrain cholinergic neurons of rats can be attenuated by glutamatergic antagonism or cyclooxygenase-2 inhibition. Ogawa. F. J. Ring. M. L. D. (2001) Dual acting anti-inflammatory drugs: a reappraisal. J. R. Mantyh. Methods 65.. B. P. D. Matsumoto. 32. Pharmacol. Wachter. Chernyshev. (1996) -Amyloid induces increased release of interleukin-1 from lipopolysaccharide-activated human monocytes.. 215. Celotti. 74. L. (1995) Reperfusion induces 5-lipoxygenase translocation and leukotriene C4 production in ischemic brain. 75–76. Sci. Dijkstra. B. K. Pharmacol. Neurol. M. A. 29. Vaca.. Levine. Yamamoto. E. S. J. 429 – 436. P. Methods 115. T. Immunol... 301–307. N. Qu. Cleary. M. 56 – 63. (1989) Origin and turnover of monocytes and macrophages. Pharmacol. Immunol. J. (1997) Dexamethasone increases expression of 5-lipoxygenase and its activating protein in human monocytes and LOX-1 cells. McGeer. Brain Res. Pharmacol. Anderson. J. Burgess.. J.. B.. 1403–1409. 67. 43... Brain Res. Y. E. M. H.. 58 – 65. 437– 450. Res. G. Neuroreport 12. Busse. H. P... A. P. Klegeris. Biol. Exp. Am. 1593–1596. G. M. Peters-Golden. (1999) Toxicity of human THP-1 monocytic cells towards neuron-like cells is reduced by nonsteroidal anti-inflammatory drugs (NSAIDs). W. Rostene. V. D. L. Wilson. 21–29. A. Combs.. 49. T. B. R. J. McGeer. T. Ferro.. 48. Wenk.. P. 59. R. (1992) The lipoxygenase inhibitor phenidone protects against proteinuria and stroke in stroke-prone spontaneously hypertensive rats.. 13–18. P. Habenicht. F. Pharmacol. 93–108. J. De Groot. S. Am.. 458 – 464. Antal. T. Commun. Kamada. Eur. V. O. Leukoc. Denis. D. D. Science 250. P. Biochem. H1249 –H1257.. Pathol. M. Genet. S. Hansen. D.. K. Y. 55– 63. R.. Schwende. Kocsis. Danysz. Hudson. (2000) Isolation and characterization of adult microglial cells and oligodendrocytes derived from postmortem human brain tissue. D. Vukosavic.. 1399 – 1408..... C. S. 56. W. Kimura. P. S. 16. C. 134. D. 41. Ther. Noonan. Kocsis-Angle. Lorton.. Sugaya. Nishiyama.. Neurochem.. Sandrini. Jackson-Lewis. 24. A. 44. Rao. W.. Vainio. 19. McGeer. Ambs.. M. E. M.. Esler. 38. (1999) Inflammation of the brain in Alzheimer’s disease: implications for therapy. (2002) Cyclooxygenase and 5-lipoxygenase inhibitors protect against mononuclear phagocyte neurotoxicity... W. Hypertens. M. Maley. K. Mosmann.. 56. L. McGeer. 166. (2000) Microglial contribution to oxidative stress in Alzheimer’s disease. P.. FASEB J. J.. R. Pharmacol. L. S. (1997) Establishment of human adult astrocyte cultures derived from postmortem multiple sclerosis and control brain and spinal cord regions: immunophenotypical and functional characterization. 167–172.. Harada. Finke. Neurobiol. 1464 –1469. McGeer. Bastianetto. J. Brain Res. Vitek. (1997) Differential regulation of cyclo-oxygenase-2 and 5-lipoxygenase-activating protein (FLAP) expression by glucocorticoids in monocytic cells. Walker. E. 519 –524. Przedborski. L... A.. 122. Med. A.. R. P... Lehmann. D. J. Protoc.. C. 47. L. Yates. (2000) R-(-)-Deprenyl inhibits monocytic THP-1 cell neurotoxicity independently of monoamine oxidase inhibition. J. K.. J. Neurol. J. Fitzke. Res. 112–118. Donaldson.. Kitagawa. W. M. Klegeris. Br. 33. H. Van Der Valk. G. (1990) Secretion of neurotoxins by mononuclear phagocytes infected with HIV-1. Dempsey. D. 127–133. Exp. Neuropharmacology 38. Jongenelen. A.. L. M. Hodulik. J. 619 – 624. M. 19... McGeer. expression of inducible nitric oxide synthase. N. E. Colton. C. Hypotheses 54. Ann. S..... Van Der Valk. (2001) Anti-inflammatory drugs: new multitarget compounds to face an old problem. Dieter. 369... R. Liberatore. J. Hayashi. 17.. 54. (1992) Prevalence of dementia amongst elderly Japanese with leprosy: apparent effect of chronic drug therapy. M. Respir. P.. Aging 23. Immunol. (1994) Human monocytes/macrophages: NO or no NO? J. K. Ravid. D. 85–94. Immunol.. 161. Br. 904. Exp. J. Biol. 1305–1314. McGill. (1995) Dapsone inhibits the generation of 5-lipoxygenase products in human polymorphonuclear leukocytes. J. J. 13. 203–210. E. Neurosci. 21. D. 8. E. Brunden. M. 25. T. 67. Ii... C. A. A.. Biophys. 26.. Montagne. Lohmann-Matthes. L. De Groot. Willard. L. Am. Lehman. M.. Neurosci. (1999) Inducible nitric oxide synthase stimulates dopaminergic neurodegeneration in the MPTP model of Parkinson disease. Ohnishi.. Coffey. (1983) Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. L. 787. Dawson.. G. 14. (1996) -Amyloid protein-dependent nitric oxide production from microglial cells and neurotoxicity.. 39. J. 15. (2001) Baicalein protects cortical neurons from -amyloid (25-35) induced toxicity. Methods 119. P. J.. 5. Aging 21. Biochem. W. (1996) Eicosanoids and nitric oxide influence induction of reactive gliosis from spreading depression in microglia but not astrocytes. R. Langeveld. Decker. Med. O.. B. L.. Manev. M. (1999) Microglia and the immune pathology of Alzheimer disease... Neurobiol. P. Dority. Hong. K. Biochem. J. K. Leukoc. A. 61– 69. (2000) Amyloid and amylin fibrils induce increases in proinflammatory cytokine and chemokine production by THP-1 cells and murine microglia. 35.. Ottani. 292–307. S. L. 268. Mullis-Savin. Brain Res. 409 – 415.. S41–S45. M. Ohtsuki. S. 23. Klegeris. P.. N.. (1996) Differences in the state of differentiation of THP-1 cells induced by phorbol ester and 1. Quirion.. (1996) Zileuton. K. Biol. Goppelt-Struebe. Weldon.. Laichalk.. S. Uz. Y. Biol. A. G. 2199 –2202.. 12. M. R. V. (1998) Fibrillar -amyloid induces microglial phagocytosis. Curr... 28. Pelaprat. C. M. (2000) Interaction of various intracellular signaling mechanisms involved in mononuclear phagocyte toxicity toward neuronal cells. K. 55. 131. 196 –202. J. McGeer.. King.. B. (2000) Neuroprotective abilities of resveratrol and other red wine constituents against nitric oxiderelated toxicity in cultured hippocampal neurons.. (1988) A quick and simple method for the quantitation of lactate dehydrogenase release in measurements of cellular cytotoxicity and tumor necrosis factor (TNF) activity. 5221–5224. (1994) Tepoxalin: a dual cyclooxygenase/5-lipoxygenase inhibitor of arachidonic acid metabolism with potent anti-inflammatory activity and a favorable gastrointestinal profile.. Leukoc. (1995) Selective killing of cholinergic 36. C. Standiford. A. Riddick. McAuliffe. T. Yamamoto. Klegeris. 5. Ikegaya... 720. Berg. 271. M. T. Crit. P. W. 65.. 18. R. 2161–2173. E. Neuropathol. 899. M. (2001) Neuroprotective effects of lipoxygenase inhibitors against ischemic injury in rat hippocampal slice cultures.. Capetola. McGeer. M. Kong. Neuroimmunol. (1997) Role of protein kinase C in microglia-induced neurotoxicity in mesencephalic cultures. Brunden.

Wong. J. Bjornsson. Wong.. FinazziAgro. Granneman. Locke.. Pharmacokinet. J... D. Awni.. and its metabolites. 265. M. B.. S.. Bigby. Khandwala..jleukbio. 273. Aharony.. D.. (1997) Activated lymphocytes increase expression of 5-lipoxygenase and its activating protein in THP-1 cells. 29 (Suppl. A. Marks. Baker. A. Nistico. 378 Journal of Leukocyte Biology Volume 73. A. J. (1989) Inhibition by REV-5901 of leukotriene release from guinea-pig and human lung tissue in vitro.. T.. H. J. Neiss. 36. 29 (Suppl. A. Cavannaugh. Chem. blocks and reverses the membrane association of 5-lipoxygenase in ionophore-challenged leukocytes.. C.. Am. Rouzer. a potent and specific leukotriene biosynthesis inhibitor. S. C.. Kusner. Awni. Smith. Coutts. H.. 1. Clin. 63. Chakraborty.. J. L. 2)... R. in normal healthy volunteers. C2057– C2064. Krell. J. M. Machinist. (1998) Cytotoxic effect of HIV-1 coat glycoprotein gp120 on human neuroblastoma CHP100 cells involves activation of the arachidonate cascade. Chem. Argentieri.. 64. S. S. W.. D. F. Glass.. 59. Pharmacol. H. T. L. 38. J. L. S. R. 462– 468. Morton. 45– 49. T. R. March 2003 http://www. C. J. K. L.. Van Inwegen. D. 30. Clin. A. (1995) The pharmacokinetics of single oral doses of zileuton 200 to 800 mg.. R. A.57. Pruss. J. J. M. 1436 –1442. R.. L. 4183– 4189.. Gordon. Gillen.. Chow. Gillard. (1987) Substituted arylmethyl phenyl ethers. L. I. Riddick. A novel series of 5-lipoxygenase inhibitors and leukotriene antagonists.. Clin. 58.. Ring. its enantiomers.. J. Misiti. J. 9 –21. H.. Biol. Navarra. 42– 48. Dube. Weinryb. 333. P.. Biochem. U. (1995) The pharmacokinetics of zileuton in healthy young and elderly volunteers.. M. Physiol. Pharmacol. A. J. C. G. Biochem.. M. E. T. .. D. W. J. W. 60. G.. M. M. C. Sciortino. Musser.. (1990) MK886.. Ford-Hutchinson. E. W. R. el-Shourbagy.. A. Locke. 2). Braeckman. W. Med. T. (1996) Pharmacokinetics and pharmacodynamics of tepoxalin after single oral dose administration to healthy volunteers. Cavanaugh. 96 –104. Waldman.. Vitow. 61. C.. C. R. Corasaniti. M. A.. Pharmacokinet. E. T. Maccarrone. 62. S. R. Osborne. I.

Sign up to vote on this title
UsefulNot useful