ŠKOLSKI LEKSIKON BIOLOGIJE s pitanjima za maturu i prijemne

Nakladnik

HINUS Zagreb, Miramarska 13 b tel.: 615 41 96, tel./fax: 611 55 18 e-mail: hinus@zg.hinet.hr
Urednik

Hrvoje Zrnčić
Recenzenti

Prof.dr.sc. Mirjana Kalafatić Mirjana Martek, prof.

ISBN 978-953-6904-26-6

Copyright © Hrvoje Zrnčić

Knjigu možete besplatno preuzeti samo za osobnu upotrebu, a ne smijete je stavljati na druge mrežne stranice, umožavati ili je koristiti za bilo koju komercijalnu svrhu.

Sanda Ilić Lela Zadražil Ljubica Kostanić

BIOLOGIJE
s pitanjima za maturu i prijemne

LEKSIKON

ŠKOLSKI

HINUS

SADRŽAJ

PREDGOVOR ...........................................................................................7 LEKSIKON ...............................................................................................9 PITANJA ...............................................................................................159 ODGOVORI ..........................................................................................253 DODATCI .............................................................................................279 DODATAK 1 ...................................................................................281 DODATAK 2 ...................................................................................289 DODATAK 3 ...................................................................................295 DODATAK 4 ...................................................................................297 DODATAK 5 ...................................................................................299 DODATAK 6 ...................................................................................301

.

Drugi dio sadrži više stotina pitanja s proteklih razredbenih ispita s uputama za njihovo rješenje. . rabe se kratice naziva nukleinskih kiselina. Treći dio čine dodaci koji pojašnjavaju bilo pojmove sadržane u Leksikonu bilo rješenja zadataka s proteklih razredbenih ispita. To su. prije svega kratice naziva različitih kemijskih spojeva. To se postiže tako da se tumačenje ključnog pojma iz pretpostavljenog odgovora također potraži u Leksikonu. Prvi dio je leksikon pojmova iz biologije temeljen na srednjoškolskom gradivu. znači ispitaj i dolazi uz pojam o kojem treba potražiti dodatne informacije. aminokiselina. Kratica isp. nukleotida. Dvije su vrste kratica uporabljene u tekstu koji slijedi. i isp. Uz potrebna pojašnjenja. Upute se prije svega odnose na savjet koji pojam odnosno koje objašnjenje treba pročitati da bi se razjasnilo rješenje zadatka kojega se rješava. ona sadrži leksikon pojmova iz biologije koji će biti korisno štivo još dugo nakon polaganja razredbenih ispita. Zatim su tu i uobičajene kratice koje su vezane uz način uporabe.PREDGOVOR Onome tko se želi brzo i kvalitetno pripremiti za polaganje razredbenog ispita iz biologije. Ova knjiga ne predstavlja samo pomoć za brzo i dobro pripremanje razredbenih ispita već i nešto više od toga. Kratica v. Knjiga se u osnvi sastoji od tri dijela. U tekstu se rabe samo dvije uobičajene kratice: v. Tako se brzo ovladava gradivom i stječe sigurnost neophodna za uspješan izlazak na razredbene ispite. Leksikon podrazumijeva abecedni poredak bioloških pojmova i njihovih sažetih opisa što omogućuje brzo snalaženje prilikom pripreme za polaganje razredbenih ispita. ova se knjiga odlikuje jednostavnim razjašnjenjima zašto je neki odgovor u danom zadatku točan. ali isto tako i zašto neki drugi odgovor nije točan. hormona i dr. na bilo kojem od fakulteta na kojem se polaže biologija. Ovdje treba posebno naglasiti da Leksikon omogućuje i brzo razjašnjenje zbog čega neki pretpostavljeni odgovor na zadatak koji se rješava nije točan. Dakle. Naime. prema engleskom nazivu. ovo će biti izuzetno korisna literatura. znači vidi i redovito dolazi ispred pojma o kojem treba pročitati osnovne informacije.

dubokomorski (oceanski) sloj. pitomi kesten. upozoravajuća obojenost i mimikrija. ADAPTIVNA OBOJENOST. ABIOTIČKI ČIMBENICI. ADAPTACIJA. ACIDOZA. v. v. ACETIL-CoA. ATP. ADH. regulira se puferskim svojstvima tjelesnih tekućina. gonadotropne hormone. jedna od skupina ekoloških čimbenika.BAZNA RAVNOTEŽA. u ATP-u.bazna ravnoteža. To su npr. neurohormon kojeg parasimpatički živac-vagus luči na živčanim okončinama. Život u abisalu ovisi o gornjem osvjetljenom sloju u kojem se odvija primarna organska proizvodnja (bioproizvodnja) procesom fotosinteze. unaprijedio mikroskop povećavši njegovu moć razlučivanja. organski spoj s dušikom iz skupine purinskih baza. v. ravnoteža kiselina i lužina u tijelu. kada spavamo) smanjujući udarni volumen srca. Spoj sadržava tioestersku vezu bogatu energijom. a bubrezi izlučivanjem vodikovih iona mokraćom. v. ABISAL. On se oslobađa kada je smanjena potreba za kisikom (npr. voda odnosno vlaga. plućima i bubrezima. izvan granice prodora svjetla i pod visokim tlakom. prednji režanj žlijezde hipofize koji izlučuje hormon rasta. ADAPTIVNA RADIJACIJA. Normalna koncentracija vodikovih iona (pH) arterijske krvi je oko 7. zaštitna obojenost. kiselica i borovica. Sudjeluje i u izgradnji nukleotida odnosno nukleinskih kiselina. njemački znanstvenik i izumitelj koji je u 19. adenokortikotropni hormon i tireotropni hormon. ADAPTACIJA OKA. 9 . NH2 N C H C N C C N H ADENOHIPOFIZA.4. puferi. prilagodba. Sadržan je u najvažnijem pohranjivaču i prijenosniku energije u živoj stanici. ACIDO .5). ADENOZIN-TRIFOSFAT.st. temperatura. bjeloočnica. acido . svjetlost itd. makroevolucija. rododendron. Sastoji se od acetilne skupine vezane na koenzim A (Co A). ACIDOFILNE (kremene) BILJKE. To su različiti fizikalni i kemijski čimbenici okoliša koji utječu na život nekog organizma. ACETILKOLIN. antidiuretički hormon. stanje sniženih pH vrijednosti tjelesnih tekućina (normalan pH je oko 7. biljke koje rastu na kiselim tlima (pH 4. npr. v. hormon kojega izlučuje prednji N C H režanj hipofize (adenohipofiza).5 - 5. Stimulira koru nadbubrežne žlijezde na izlučivanje kortikosteroidnih hormona kortizona i aldosterona. E. Pluća sudjeluju u održavanju te ravnoteže izdisanjem ugljikovog dioksida. prilagodba oka na svjetlo ili tamu. v. početni spoj Krebsova ciklusa.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE A ABBE.4). Ima bitno značenje u izmjeni tvari jer nije samo produkt razgradnje ugljikohidrata već i masnih kiselina te aminokiselina. v. v. ADENIN. ADENOKORTIKOTROPNI HORMON (ACTH).

jakom uzbuđenju itd. te ženinim mlijekom na dojenče (sisanje). privlačna sila između molekula različitih tvari koje se dotiču. strahu. AKROSOM. Sadrži hidrolitičke enzime i omogućuje prodiranje spermija u jajnu stanicu prilikom oplodnje. stezanje perifernih krvnih žila. živčana stanica. bolu. odnosi se na organizme. korijen.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ ADHEZIJA. šoku. poprečnoprugasti mišić. bolest smanjenog ili zaustavljenog stvaranja granulocita u koštanoj moždini. širenje očnih zjenica. disanje. HIV se najčešće prenosi spolnim kontaktom i krvlju (transfuzijom. pojedini zglobovi i dr. v. Javlja se u odraslo doba. v. ATP. bjelančevinasta molekula koja izgrađuje miofibrile. Povezanost molekula vode s drugim molekulama (npr. v. stezanje mnogih mišića. AKTIN. širenje bronhiola. nenormalan rast pojedinih dijelova tijela kao što su šaka. Virus je nazvan HIV-om (Human Immunodeficiency Virus. AGLUTININ. gljivične bolesti i tumori. krvne skupine. v. Kao posljedica agranulocitoze često se javlja povećana sklonost bakterijskim i gljivičnim infekcijama. npr. pojačani intenzitet i brzinu disanja. Njegovo djelovanje je višestruko i svodi se na podizanje svih važnih funkcija u organizmu na višu razinu kako bi organizam što bolje prebrodio stres. AKOMODACIJA OKA. AGRANULOCITOZA. v. povećani broj limfocita u cirkulaciji itd. AERENHIM. manja količina protutijela (Ig). prilagođavanje oka na gledanje blizu i daleko. humani virus nedostatka imuniteta). AKSON (neurit). v. AIDS (SIDA). prijenos tvari kroz staničnu membranu iz područja manje koncentracije u područje veće koncentracije neke tvari. leća. AKCIJSKI POTENCIJAL. označuje prisutnost kisika. AIDS je za sada neizlječiva bolest imunološkog sustava za vrijeme koje nastaju vidljive promjene: (oportunističke infekcije) upala pluća i moždane ovojnice. ADP (adenozin-difosfat). krvne skupine. v. eritrociti ADVENTIVNO KORIJENJE. zbog povećanog lučenja hormona rasta. uz stijenku kapilara kod biljaka) omogućuje uzlazni tok vode u biljci. vršno tjelešce koje se nalazi na vršnom dijelu glave spermija. pojava sljepljivanja krvnih stanica u slučaju primitka krvi neodgovarajuće krvne grupe. Uzročnik je virus (retrovirus) koji napada i uništava T4 . Za AIDS je to smanjenje broja leukocita u krvi. AEROBNA RESPIRACIJA.limfocite. zatim sa zaražene majke kroz posteljicu na nerođeno dijete. AKTIVAN PRIJENOS (aktivan transport). osnovno staničja. AGLUTINOGEN. v. AGLUTINACIJA. okoliš ili na stanične procese koji zahtijevaju prisustvo kisika. hormon kojega izlučuje srž nadbubrežne žlijezde. Tako adrenalin uzrokuje pojačani intenzitet rada srca. v. električni potencijal. AEROBAN. smanjen broj zrelih T limfocita. injekcijskim iglama). ADRENALIN. engleska odnosno francuska kratica za sindrom stečene imunodeficijencije. Taj 10 . v. Pojačano se izlučuje u različitim stresnim stanjima. AKROMEGALIJA. v. nositelje stanične imunosti. ADULTNI HEMOGLOBIN. smanjen broj limfocita u limfatičnim organima (limfnim čvorovima i slezeni). stopalo.

limfocite T i dr. AKTIVNI TRANSPORT. itd. kemijski spoj iz skupine aminokiselina. druga zametna ovojnica koja obavija zametak. žive u vodi kao saprofiti ili paraziti. ALFA-MEZOSAPROBNE VODE. neki lijekovi. bjelančevina u krvi (oko 34 do 50 g/L) koja sudjeluje u prijenosu različitih hormona. prašina. a predstavlja snažno onečišćene vode. alergija.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE prijenos se može odvijati samo uz pomoć membranskih “prenositelja” i uz utrošak energije iz ATP-a. aktivni prijenos. a određuje ga recesivni gen koji se nalazi na autosomima (nespolni kromosomi). ALANIN. Prokrvljena je mnogim kapilarima te sudjeluje u disanju i hranjenju zametka. ptijalin. klora i kalija u tijelu. tzv. U jednom organizmu za neko fenotipsko svojstvo mogu biti najviše dva različita alela. plazmi). Stanična stijenka im je od hitina. ALBINIZAM. kunića. natrijeva i kalijeva pumpa. Nasljedno svojstvo koje se pojavljuje u čovjeka. ALDOSTERON. a recesivni malim slovima. v. Skupine algi su bičaši. Ovaj oblik aktivnog prijenosa susreće se u membranama gotovo svih animalnih stanica. maline. kod amniota. Tvari koje uzrokuju alergije zovu se alergeni. majmuna. a najčešći su pelud. poput alga. smeđe i crvene alge. sir). ALGE. jedan od stupnjeva onečišćenja voda. gljive koje. kremenjašice. ALANTOIS. za jedno svojstvo A i a. neke vrste hrane (jagode. ALERGENI .). Aldosteron koji je oslobođen u krvi. za drugo B i b. Sintetizira se u jetri odakle se otpušta u krv. različita kemijska sredstva (detergenti. ALFA-AMILAZA. homologni geni) su par gena koji određuju isto svojstvo. autotrofne fotosintetske steljnjače među kojima postoje velike razlike. Klasični primjer aktivnog prijenosa je transport iona natrija (Na+) iz stanice u međustanični prostor i iona kalija (K+) iz međustaničnog prostora u stanicu. nedostatak pigmenta u koži i/ili drugim organima. ALELNI GENI. Od tih skupina samo 11 . zelene. b1 i b2. specifičan oblik imunološke reakcije odnosno preosjetljivost (hipersenzitivnost) na neke tvari. AKTIVNO STEČENA SPECIFIČNA IMUNOST. filtrira se u nefron. ali i nekih životinja. Aktivna imunost može biti stečena prirodnim putom (ljudi koji su preboljeli neku zaraznu bolest imaju gotova specifična protutijela s kojima mogu uništiti isti antigen u slučaju ponovnog unosa u tijelo) ili umjetnim putom (cijepljenjem). v. v. organizam nakon kontakta s određenim antigenom stvara specifične tvari imunološke reakcije (protutijela.). ALERGIJA (alergijska reakcija). Aleli pojedinih svojstava označuju se obično slovima abecede i to dominantni velikim. na primjer u miševa. kozmetički preparati) itd. Njihove hife nemaju poprečnih stijenki pa sliče dugim razgranatim cijevima s puno jezgara. itd. ALGAŠICE. a samo kod najprimitivnijih od celuloze. a nalaze se na paru homolognih kromosoma (isp. Ako dominantnost nije izražena aleli se mogu označavati s a1 i a2. v. npr. Najvažniji podražaj za lučenje hormona je niska koncentracija iona natrija u izvanstaničnoj tekućini (npr. a to pojačava upijanje iona natrija u kapilare uz nefrone. ALBUMIN. Taj hormon održava stalnu razinu iona natrija. aleli. (alelni geni. jedan od hormona kore nadbubrežne žlijezde. ALELI.

aspargin. specijacija kada su populacije odvojene zemljopisnom barijerom. AMEBNA DIZENTERIJA. sintetički procesi u kojima se od malih građevnih elemenata izgrađuju ili polimeriziraju veće molekule. cistein. molekule fosfolipida. glutaminska kiselina. ribe koje žive u moru. specijacija. Pojavili su se u karbonu. To je vrećasta tvorba ispunjena bjelančevinastom tekućinom u kojoj pliva zametak. glutamin. okoliš ili na stanične procese za koje nije potrebna ili je čak štetna prisutnost kisika. fenilalanin. v. AMERIA. v. U molekuli fosfolipida električki nabijen kraj privlači molekule vode (hidrofilan). kvaščeve gljivice. organski spojevi koji izgrađuju bjelančevine. molekule koje na jednom svome kraju privlače vodu. lososi. beskolutićavci. alantois i seroza. izoleucin. ALKAPTONURIJA. AMBULAKRALNI SUSTAV. označuje odsutnost zraka. v. ATP. v. acido . treonin. Ako se ne pojave prve mjesečnice u pubertetu. skupine životinja (gmazovi. ALKOHOLNO VRENJE. nasljedni nedostatak enzima zbog čega se nakuplja homogenetizirana kiselina u mokraći. a električki nenabijen kraj s masnim kiselinama odbija vodu (hidrofoban). Razvoj u novu vrstu zbiva se u prostorno izoliranim populacijama koje potječu od zajedničkog ishodišta.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ crvene alge nemaju pokretne stanice s bičevima niti u jednom razvojnom stadiju. histidin. Isp. AMNIOTA. leucin. izostanak mjesečnice. odnosi se na organizme. stanje povišenih pH vrijednosti tjelesnih tekućina (normalan pH je oko 7. triptofan. alanin.lizin. AMILOPLAST. prva unutarnja zametna ovojnica koja obavija i zaštićuje zametak od trešnje i pritiska. a radi mriještenja zalaze u slatke vode. v. AMP (adenozin-monofosfat). Amfipatske molekule su npr. a ako izostanu mjesečnice kod žena koje su ih imale redovito govori se o sekundarnoj amenoreji. odnosno kisika. leukoplasti.4). metionin. ali žive u raznim sredinama. a međusobno se aminokiseline razlikuju po vrsti radikala. tirozin. AMFIPATSKE MOLEKULE. valin. ALKALOZA.bazna ravnoteža. AMINOKISELINE. ALVEOLE. ALOPATRIJSKA SPECIJACIJA. Amniota nemaju stadij ličinke i njihov razvitak teče bez preobrazbe. v. ANADROMNE SELICE.To su: glicin. a koja na zraku potamni. a na drugom odbijaju vodu. dizenterija AMENOREJA. npr. dodatak 5. kod amniota. H H H O N C C OH R AMNION. vodožilni sustav. v. ANAEROBAN. asparginska kiselina. Poznato je oko 70 različitih aminokiselina. selidba riba. v. v. 12 . v. ali samo 20 dolazi u živim organizmima. serin. plućni mjehurići. prolin i arginin. ptice i sisavci) kod kojih se pojavljuju tri zaštitne zametne ovojnice: amnion. ANABOLIZAM. Razlozi su najčešće u poremećaju ravnoteže spolnih hormona i gonadotropnih hormona. Svaka aminokiselina sadrži dvije karakteristične kemijske skupine: karboksilnu (COOH) i amino (NH2) skupinu. govori se o primarnoj amenoreji.

Ostale mogu biti posljedicom ubrzanog raspada eritrocita ili hemolize . Može doći do gušenja i smrti pri unašanju veće količine specifičnog alergena (npr. Najčešće zahvaća spolne kromosome. ANEUPLOIDIJA. Stanice imunološkog sustava ispuštaju histamin.hemolitička anemija. organi u raznih skupina organizama koji su različitog pod- rijetla. anafaza I. Npr. disanje. krilo ptice i krilo kukca. gubitak daha i lupanje srca. svaki je građen od dvije kromatide. Anafaza završava kada kromosomi stignu na suprotne polove stanice. nedostatka željeza u hrani – sideropenična anemija ili manjka vitamina B perniciozna anemija. Simptomi su: bljedoća. Neke anemije uzrokuju genetski čimbenici. odnosno. nesvjestica. stadij mejoze (isp. koje uglavnom nisu letalne. ANEMIJE. penicilina). je promjena u broju samo jednog ili nekoliko kromosoma. ANDROGENI (muški spolni hormoni). anafaza II. Sjemenici stvaraju i luče nekoliko spolnih hormona od kojih je najvažniji testosteron. uzbuđenje. anafaza II. v. Turnerov sindrom 45xo. velike i nagle temperaturne razlike povećavaju aktivnost srca (broj ot- 13 . teško alergijsko stanje u kojem drastično padne minutni volumen srca i arterijski tlak. anafazni kromosomi su jednostruki odnosno sastoje se od jedne kromatide. U anafazi I razdvajaju se homologni kromosomi i putuju prema suprotnim polovima stanice stezanjem teznih niti diobenog vretena. ANAFAZA PRVE MEJOTIČKE DIOBE. v. 48 xxxy) kod muškaraca izaziva ženske osobine (mliječne žlijezde) i sterilni su. (anafaza prve mejotičke diobe.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE ANAEROBNA RESPIRACIJA. nego se tako nazivaju boli koje nastaju kad srčani mišić ostane privremeno bez kisika. ANAFAZA. srpastu anemiju. Na početku anafaze svaki kromosom razdvoji se na dvije kromatide koje zatim putuju prema suprotnim polovima stanice vučene teznim nitima diobenog vretena. Javljaju se abnormalnosti u razvitku. Takvi su organi prilagodba na slične uvjete života. stadij mitoze (isp. slabost. nije bolest. a funkcija im može biti slična. znanost koja proučava makroskopsku građu tijela svih živih bića.). bolesti pri kojima su tkiva preslabo opskrbljena kisikom zbog smanjene količine hemoglobina i broja eritrocita u krvotoku. v. ANGINA PEKTORIS (stenokardija). Kromosomi u anafazi I su dvostruki. anafaza mejoze I). a u manjoj mjeri i u jajnicima. Povećane fizičke aktivnosti. ANAFAZA MEJOZE I. anafaza mejoze II). stadij mejoze (isp. kao npr. Zbivanja u anafazi II su ista kao i u anafazi mitoze gdje se svaki dvostruki kromosom dijeli na dva jednostruka koji putuju na suprotne polove stanica. v. ANALOGNI ORGANI. ANATOMIJA. hormoni koji se stvaraju u sjemenicima i kori nadbubrežne žlijezde.).). ANAFAZA DRUGE MEJOTIČKE DIOBE. anafaza I. ženska osoba s jednim x-kromosomom. Spolni hormoni koje luči kora nadbubrežne žlijezde zovu se adrenalni androgeni od kojih je najvažniji dehidroepiandrosteron. v. npr. ANAFAZA I. xxy. spolno nerazvijena i nespolna (ima nerazvijene jajnike) ili Klinefelterow sindrom (47. ANAFAZA MEJOZE II. umor. ANAFAZA II (anafaza druge mejotičke diobe. ANAFILAKTIČKI ŠOK. Za razliku od profaze i metafaze u kojima su kromosomi dvostruki.

Apomiksiju nalazimo npr.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ kucaja) i potrebu za kisikom iznad mogućnosti koronarnog optoka. v. ponašanje i dr. vršni meristemi APLASTIČNA ANEMIJA. evoluciju. u maslačka. Anteridija nema kod najprimitivnijih (bakterije. ANTITIJELA. APOMIKSIJA. izlazi iz lijeve klijetke srca. upala crvuljka. Mogu ih proizvoditi čak i neke vrste bakterija. Naprotiv. ADH se transportira krvlju u čahuru nefrona gdje djeluje na stanice stijenki kanalića nefrona da postanu propusnije za vodu. isp. ANTROPOLOGIJA. Kao posljedica javlja se jaka bol u prsima. a zatim se spoji s kodonom (šifrom) na mRNA. ANTIPIRETICI (antipirogene tvari). veliki optok. ako je krvna plazma hipotonična (popili smo previše vode) prestaje se lučiti ADH te se u nefronima voda neće reapsorbirati u krv. U tom se slučaju jajna stanica samo diploidizira (udvostruči se broj kromosoma) bez oplodnje. hormon koji luči stražnji režanj hipofize (neurohipofize) ako u organizmu nedostaje vode. zelene alge. ANTIDIURETIČKI HORMON (ADH). bolest smanjene proizvodnje eritrocita u koštanoj moždini. mikrobiološka metoda kojom se ispituje djelovanje niza različitih antibiotika na izoliranu bakteriju uzročnika bolesti. v. Od nje se razvije zametak. ANTIGEN (imunogen). APOSEMIJA. bakterije roda Streptomyces proizvode streptomicin. ANTERA. povećava se respiracija vode iz filtra natrag u krv. skupina triju baza na molekuli transportne RNA (tRNA) koje su komplementarne bazama na molekuli glasničke RNA (mRNA). i najsavršenijih (kritosjemenjače) biljnih skupina. ANTITETSKA IZMJENA GENERACIJA. v. posebice ljudske rase. sredstva koje snizuju povišenu tjelesnu temperaturu. sjeme i zatim biljka koja je potpuno jednaka kao i roditeljska biljka. neke alge). Dakle. ANTERIDIJI. Antikodon raspoznaje. Većina antitijela stvara se u plazma stanicama i B limfocitima. koja uglavnom prestaje sa smanjenjem aktivnosti tijela. muški rasplodni organi biljaka u kojima nastaju muške spolne stanice. ANTENALNE ŽLIJEZDE. u najširem smislu. razvitak sjemena bez oplodnje (nespolno razmnožavanje). nego će se lučiti iz tijela mokraćom. Ovom metodom utvrđuje se najdjelotvorniji antibiotik za liječenje određene bakterijske bolesti. Ako krvna plazma postane hipertonična. obrambene bjelančevine koje stvara organizam kada u njega uđu antigeni. ticalne žlijezde. znanost koja proučava čovjeka. 14 . ANTIBIOGRAM. a to središte šalje impulse živčanim putem u stražnji režanj hipofize koja počne lučiti ADH. podražuje središte za žeđ u mozgu. ANTIBIOTIK. rakovi. APIKALNA DOMINACIJA. APIKALNI MERISTEMI. v. pojava u kojoj vršni pup djelomično ili potpuno inhibira rast bočnih pupova. npr. prašnik. ANTIKODON (protušifra). kemijska tvar koja spriječava razvitak određenih vrsta bakterija. AORTA. upozoravajuća obojenost. APENDICITIS. v. najveća arterija. svaka tvar koja može izazvati imunološku reakciju organizma. v.

ostatak repa i dr. v. praptica. na tom mjestu se stvara tromb koji se može otrgnuti (embol) i kolati krvlju 15 . ATEROM. Zbog oslobođenog histamina stežu se mišići dišnih putova i disanje je otežano. žile kucavice. ateroskleroza. Ako jastučić pukne. upijanje hrane u probavnom sustavu iz probavila u krvotok i limfotok. kemijski spoj iz skupine aminokiselina. čest oblik alergijske reakcije. ASTMA. Areali se razlikuju po obliku i veličini. tise. a bila su svojstvena davnim precima. biljni hormon koji inhibira rast. AROMORFOZA. endemične vrste imaju vrlo mali areal. v. v. v. ASKOSPORE. v. AREAL. v. ateroskleroza. Glavni uzrok smanjenja elastičnosti jest taloženja masnoća u obliku jastučića (aterom) na unutarnjim stijenkama arterija zbog čega se smanjuje njihov promjer. ASIMILACIJA CO2. bolest arterijskih krvnih žila. ASPARGIN. pojava nekih obilježja koja se rijetko javljaju i to samo kod određenih jedinki neke vrste. a djelomice u debelom crijevu gdje se uz konačnu apsorpciju hrane upijaju voda i minerali. Apsorpcija hrane se najvećim dijelom obavlja u tankom crijevu pomoću epitelnih stanica crijevnih resica. Nalazimo ga u mahovina. ARTERIJE. a time i protok krvi. kemijski spoj iz skupine aminokiselina. Kontrolira završne razvojne stadije biljaka: starenje.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE APSCIZINSKA KISELINA. ali i žile odvodnice. prostor koji nastaje uvrtanjem (invaginacijom) endoderma u šupljinu gastrule. fotosinteza. kemijski spoj iz skupine aminokiselina. preteča je crijeva. ATAVIZAM. Podraživanjem simpatikusa nastaje stezanje (vazokonstrikcija). ARILUS. ATEROSKLEROZA (arterioskleroza. elastično tkivo i unutarnja stijenka (endotel). ARCHAEOPTERYX. v. Sintetizira se u stanicama koje sadržavaju kloroplaste ili amiloplaste. APSORPCIJA HRANE. ARGININ. Nastaje u jednoj od etapa embrionalnog razvoja složenih životinjskih organizama. prostor na kojem je raspoređena neka vrsta organizama ili opseg prostorne rasprostranjenosti neke vrste. ovapnjenje krvnih žila). ASPARGINSKA KISELINA. potiče dormanciju i pomaže biljci da preživi u stresnim uvjetima (regulirajući vodnu ravnotežu). ARHENTERON (pracrijevo). dozrijevanje plodova. ARHEGONIJ. megaevolucija. venuće cvjetova. Povezane su s ograncima autonomnog živčanog sustava. veći broj mliječnih žlijezda. ASKUSI. Atavizmi su važan dokaz evolucijskih procesa. mješinarke. Stijenke arterija građene su od vanjskog elastičnog omotača ispod kojeg se nalazi mišićni sloj. mješinarke. otpadanje listova. npr. Primjeri atavizma u čovjeka su prekomjerna dlakavost cijelog tijela. a podraživanjem parasimpatikusa arterije se šire (vazodilatacija). ženski rasplodni organi biljaka u kojima nastaju ženske spolne stanice. Smještene su u dubini organizma. v. papratnjača i donekle u promijenjenom obliku u golosjemenjača. jer odvode krv iz klijetki srca. ARTERIOSKLEROZA. Starenjem arterije su sklone degenerativnim promjenama i otvrdnuću odnosno gubitku elastičnosti pa se zbog toga teže prilagođavaju održavanju stalnog krvnog tlaka.

priključivanju energijom bogatih veza između fosfatnih skupina u nukleotidima. a sastoji se u tome da se u stanicu unose nestabilni. proizvodnja topline. metoda koja se koristi u znanstvenim istraživanjima. AUTOPURIFIKACIJA VODA. Proces sinteze ATP-a iz AMP-a i ADP-a naziva se fosforilacija: AMP + P + energija → ADP ADP + P + energija → ATP. Prirodni se auksin većinom sintetizira u vršnim meristemima i mladim listovima u razvitku odakle se prenosi u ostale dijelove biljke. To su najstariji nalazi pravih hominida humane faze. dio živčanog sustava koji nije podložan djelovanju naše volje. dodatak 5. v. Najstariji nalazi australopitekusa stari su oko četiri milijuna godina. sekundarni rast i razvoj plodova. te se posebnim postupcima prati njihov položaj i raspored u stanici. Pri tome nastaje energetski siromašniji spoj adenozin-difosfat (ADP). AMP nema niti jednu vezu bogatu energijom. AUTOHTON. samonikao. v. skupina biljnih hormona koji stimuliraju produžni rast stanica. ATP → ADP + P + energija ADP → AMP + P + energija Odvajanjem druge fosfatne skupine opet se oslobađa energija i nastaje spoj adenozin-monofosfat (AMP). Dijelimo ga na simpatikus i parasimpatikus. samoočišćenje voda. (vegetativni živčani sustav). Nadzire rad većine unutarnjih organa. probavnih organa. kretanje i sl. AUTORADIOGRAFIJA. pušača cigareta i predebelih osoba. bubrega i srca. v. npr. Nađeni su u južnoj i sjevernoj Africi. koji od davnina živi u nekom kraju. P O P O P OCH2 O H H H H OH OH AMP ADP ATP Kemijske veze među fosfatnim skupinama sadrže veliku količinu energije. krvnih žila itd. Ova metoda ima važnu ulogu u proučavanju kemijske građe stanice i staničnog metabolizma. npr. AUTONOMNI ŽIVČANI SUSTAV.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ sve dok ne začepi neku užu krvnu žilu. AUKSINI. pluća. Aterosklerotične promjene češće su u ljudi koji jedu masniju hranu. srca. radioaktivni izotopi. ATPaza. Kada je stanici potrebna energija ona se iz ATP-a oslobađa odjeljivanjem treće fosfatne skupine. Ta se energija može osloboditi i koristiti za različite aktivnosti stanica. ATP (adenozin-trifosfat). Posebno su ugrožene krvne žile mozga. Za sintezu ATP-a koristi se energija oslobođena u procesu staničnog disanja u mitohondrijima i svjetlosna energija apsor- 16 . tromboza. katalizator mijene tvari koji sudjeluje u oslobađanju odnosno. NH2 N OH HO O OH O OH O N N N birana molekulama klorofila u procesu fotosinteze. AUSTRALOPITEKUS (Australopithecus. je spoj iz skupine nukleotida koji se sastoji od adenozina (purinska baza adenin + šećer riboza) na koji su vezane tri fosfatne skupine. južni pračovjek). čovjekov predak s djelomice ljudskim osobinama. sintetske aktivnosti.

stafilokoki i sl. polisaharidi). B BABINJE (puerperium). v. razdoblje nakon porođaja koje traje oko 4 do 5 tjedana. a ako potrebnu energiju za stvaranje dobivaju od kemijskih reakcija (kemosinteza) onda su kemoautotrofi. nastanu dvije nove stanice 17 . Bakterijske stanice mogu biti različitog oblika. AVERY. nabore stanične membrane koji su po svojoj funkciji slični mitohondrijima. O. autotrofi. Prema načinu ishrane bakterije mogu biti autotrofi (fotosintetske. Nalaze se na prvom mjestu hranidbenih lanaca u kojima nakon njih dolaze mnogobrojne serije potrošača (konzumenata). utvrđuje i pojašnjava rezultate Griffithovog pokusa dokazavši da je DNA tvar koja uzrokuje pretvorbu (transformaciju) pneumokoka. Njihovim fotosintetskim procesima nikada se ne oslobađa kisik. npr. Neke bakterije imaju i vanjsku ovojnicu polisaharidne građe koja izvana oblaže staničnu stijenku i zove se kapsula. BAKTERIJE. kemosintetske) i heterotrofi (saprofiti. v. a obično razlikujemo četiri glavna: kuglaste (koki). ali su nosioci gena za druga svojstva. jednostanični prokariotski organizmi (najjednostavnije građeni stani- čni organizmi) čija je prosječna veličina 1 μm. Ako se za stvaranje takvih organskih spojeva koristi sunčeva svjetlost (fotosinteza) onda su to fotoautotrofi. oblika zareza (vibrioni) i spiralno savijene (spirili). U citoplazmi se nalaze i ribosomi te pričuvne hranjive tvari (masne kapljice. štapičaste (bacili).T. AUTOTOMIJA. Koki i bacili često stvaraju manje ili veće nakupine (diplokoki. diobom ili cijepanjem pri čemu od jedne bakterijske stanice. kao i svaka prokariotska stanica. zajedno sa suradnicima 1944. paraziti). čija se DNK podijeli uzdužno. bakterije. Najčešće se razmnožavaju vegetativno. To je vrijeme koje je potrebno da se maternica smanji i vrati u normalno stanje.) dok vibrioni i spirili dolaze pojedinačno. organizmi koji su sami sposobni stvarati vlastite organske spojeve. Protoplazma bakterijske stanice obavijena je polupropusnom membranom lipoproteinske strukture. Izvana je obavijena debelom staničnom stijenkom koja sadrži organsku tvar murein. Općenito se dijele na aerobne i anaerobne. AUTOTROFNI PRODUCENTI. BACILI. v. AUTOTROFNI ORGANIZMI. autotrofi. Autotrofni proizvođači (producenti) čine temelj ishrane svake životne zajednice (biocenoze).____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE AUTOSOMI. Nukleoid je građen od molekule DNA koja je zatvorena u prsten i gusto sklupčana. Osnovu protoplazme čini citoplazma u čijem je središtu nukleoid koji po funkciji odgovara jezgri eukariotske stanice jer čini genetički materijal bakterijske stanice. streptokoki. AUTOTROFNI PROIZVOĐAČI. kromosomi koji ne određuju spol. autotrofi. Fotosintetske membrane po funkciji odgovaraju kloroplastima eukariotske stanice. v. Tipična bakterijska stanica. a kod fotosintetskih bakterija i posebne membrane na kojima se odvija fotosinteza. god. nema oblikovanu jezgru ni druge složene stanične organele. v. mitohondrije i kloroplaste. samosakaćenje. Bakterijska stanica sadrži i mezosome. AUTOTROFI (autotrofni organizmi).

vagilni organizmi (rakovi. BEZLATIČNICE. BENTOS. a predstavlja umjereno onečišćene vode. životne zajednice vezane za dno jezera ili mora. ježinci).ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ genetički posve jednake početnoj stanici. Danas živi oko 170000 različitih vrsta. BAZIDIOSPORE. Uglavnom su bilateralno simetrične i pokretne životinje. v. krvotoka. Uz pomoć pipaka fag se prihvati na staničnu stijenku bakterije i stezanjem repa ubaci nukleinsku kiselinu u njenu unutarnjost. mozga itd. Sjedilački ili sesilni organizmi su pričvršćeni za podlogu (alge jadranski bračić i jadranski klobučić). žarnjaci. ribe. U okviru bentoskih biocenoza neke se životinje pokreću vlastitom snagom . kupus. Prema građi tijela dijele se u skupine: plošnjaci. osim žarnjaka. Hemisesilni organizmi se mogu kretati. Najpoznatiji su skokuni i četinaši. skupina suvremenih lijekova koji snizuju krvni tlak smanjenjem snage kontrakcije srca. v. BATALJICA. BAZOFILNI LEUKOCITI. za rad srca. v. stapčarke.5). BAKTERIOLOGIJA. Povećana razina tih hormona u krvi povećava bazalni metabolizam. v. biološka znanost koja se bavi proučavanjem bakterija. BAZALNI METABOLIZAM. hormon prednjeg režnja hipofize (hormon rasta) i spolni hormoni. v. osnovni promet tvari i energije u organizmu koju tijelo troši za održavanje temeljnih životnih funkcija. soja i špinat. BETA-MEZOSAPROBNE VODE. oblenjaci. Nakon 20 do 30 minuta proces razmnožavanja faga je završen. ali uglavnom ostaju na istom mjestu (hobotnica). Pod kontrolom nukleinskih kiselina bakteriofaga stvaraju se u bakterijskoj stanici novi fagi. parapodij. posebna skupina virusa koja napada bakterije. BAZOFILNE (vapnenačke) BILJKE. BENTOSKA BIOCENOZA. U obliku spora bakterije mogu preživjeti i tisuću godina te nakon toga u povoljnim uvjetima opet “proklijati” u aktivni oblik. mekušci. Na dnu repa nalazi se pločica sa pipcima. tj. BEZKRILCI. To su npr. bubrega. beskralježnjaci jednostavnog. bakteriofagi. v. a bakterijska stanica se raspada te iz nje izlaze novonastali fagi. biljke koje rastu na tlima s relativno visokom pH vrijednošću (pH 6. BESKOLUTIĆAVCI (Ameria).7. Neke bakterije imaju sposobnost da u nepovoljnim uvjetima iz aktivnog oblika prijeđu u trajne oblike ili spore koje su obavijene čvrstom ovojnicom.5 . stapčarke. Prema zoologu Hadžiju razvili su se iz trepetljikavih mnogojezgrenih jednostaničnih oblika. BETA-BLOKATORI. dišnog sustava. BAZIDIJ. BEZGREBENKE. Važnu ulogu u bazalnom metabolizmu imaju hormoni štitnjače (tiroksin i trijodtironin). luk.. cvjetača. životna zajednica raznovrsnih organizama koji žive na morskom dnu. staročeljuske. BAKTERIOFAGI (bakterijski virusi. BAKTERIJSKI VIRUSI. Na glavicu se nastavlja kontraktilni rep čiji je središnji dio poput šupljeg štapića izvana obavijenog stezljivim ovojem. leukociti. fagi). repa. skupina kukaca koja ni u jednom stadiju života nemaju krila niti su ih imali tijekom evolucije. šira skupina dvosupnica koja obuhvaća porodice drvenastih biljaka značajnih u izgradnji šumske listo- 18 . nekolutićavog tijela. jedan od stupnjeva onečišćenja voda. Tipični bakteriofag građen je od glavice u kojoj se nalazi DNA ili RNA obavijena proteinskim ovojem.

lužnjak. više biljke. životinjama i gljivama pa se pretpostavlja da imaju važnu ulogu i u njihovoj evoluciji. BILJKE SLANIH STANIŠTA. BEZREPCI. v. Žive u tropima. v. imaju najčešće 1 ili 2 biča koji im služe za pokretanje u vodi.mnoge trave i žitarice). a mnogi su i nametnici na čovjeku i životinjama. a njegovo mjesto ispunja vezivno tkivo te ostavlja ožiljak. kritično razdoblje tame. krastače i zelene žabe. BILATERALNA SIMETRIJA. Preobrazba teče preko ličinke (v. v. Kao prvi stanični organizmi s jezgrom. a razdoblje tame je kraće od kritičnog (npr. Stražnji par nogu duži je od prednjih. Mnogi žive kao plankton slatkovodnih stajačica i u toplim morima. najčešće kukcima. žive slobodno u vodama ili zadružno. višestanična tvorevina koja nastaje u jajniku 10 do 14 dana nakon ovulacije u slučaju kada nije došlo do oplodnje jajne stanice.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE padne vegetacije. krizantema). v. Poznatije su žabe u našim krajevima: mukači. BIJELE KRVNE STANICE. BILJNA STANIČJA. u jesen ili zimi kada su dani kratki. Druga velika skupina su životinjski bičaši. skupljene u rese. BIČAŠI. BEZLUBANJCI. Bezlatičnicama pripadaju i porodica breze i lijeske s predstavnicima johe i graba. leukociti i krvna tjelešca. imaju neke osobine slične biljakama. BILJKE DUGOG DANA (kratke noći). Razmnožavaju se najčešće nespolno. (biljna tkiva). niže biljke i stablašice. Te biljke trebaju dan kraći od 12 sati. BILJNA STANICA (fitocelula). pitomi kesten i različite vrste hrastova: kitnjak. skupina vodozemaca bez nogu. BILJKE. dvobočna simetrija. gatalinke. BEZNOŠCI. Posebno je uočljiv organel očna pjega ili stigma. eritrociti. a razdoblje tame je dulje od kritičnog (npr. stanica. BIG BANG. v. Glavni predstavnici su žabe. Dijele se na steljnjače. autotrofni fotosintetski eukarioti. v. Poznata porodica su rijači. svitkovci. BILO. halofiti. ili početkom ljeta kada su dani dugi. dub. veliki prasak. v. razvila su se u skladu s preuzimanjem najraz- 19 . medunac i vazdazeleni hrast crnika ili česmina. biljke koje cvjetaju krajem proljeća. Žive na kopnu i u slatkoj vodi. cer. a trihomonas je čest nametnik u spolnom sustavu čovjeka. v. skupina vodozemaca čije je obilježje da odrasli oblici nemaju repa. Bičaši imaju posebno značajnu ulogu primarnih proizvođača hrane. BIJELO TIJELO (corpus albicans). BILJKE KRATKOG DANA (duge noći). praživotinje. Tijelo im pokriva pelikula. v. Te biljke trebaju dan duži od 12 sati. Heterotrofni su organizmi. kritično razdoblje tame. Prilagođeni su oprašivanju vjetrom. biljke koje cvjetaju krajem ljeta. U porodicu bukve pripadaju bukva. prilagođen za skakanje. Bičaši koji pripadaju skupini biljnih bičaša su autotrofni jer u protoplazmi imaju kloroplaste. puls. Spolno razmnožavanje je rijetko. Na nogama imaju razvijene plivaće kožice. uzdužnom diobom. stanica. U idućih nekoliko tjedana propada i bijelo tijelo. Imaju neugledne cvjetove bez latica. BILIRUBIN. v. Isp. punoglavac). Hrane se sitnim životinjama. Bijelo tijelo nastaje propadanjem žutog tijela. Tipičan predstavnik je euglena (Euglena viridis). Bičaš tripanosoma je uzročnik spavanja u tropskim krajevima. gdje gmižu kroz vlažno tlo.

v. etilen). Binarnu nomenklaturu uveo je u upotrebu u 18. tvari koje apsorbiraju sunčevu svjetlosnu energiju i pretvaraju je u kemijsku energiju. genetika. murva). biljna staničja. vodika. kožna staničja.evolucija. Od svih pigmenata u biljnom tkivu jedino klorofil a može neposredno sudjelovati u pretvorbi sunčeve energije u kemijsku. enzimi. BILJOJEDI. BIOLOŠKA RAZNOLIKOST (biodiverzitet). kisika i dušika. znanost o biocenozama. kemijska tvar koja se u ratarstvu i šumarstvu primjenjuje za uništenje populacije različitih “štetnika”. gospodarsku. Prvo ime uvijek označava ime roda. BILJNO BOJILO (pigment). v. virusi. BILJNI HORMONI (regulatori rasta). društvenu. životna zajednica. disanje. st. tj znanost koja se bavi prou- čavanjem odnosa članova u biocenozi i odnosima biocenoze i uvjeta okoliša. To su herbicidi. histologija. Sintetiziraju se u vrlo malim količinama. ekologija. biljna geografija) i životinja (zoogeografija) na Zemlji i uzroke te rasprostranjenosti. biološka raznolikost. v. BIOKATALIZATORI. v. BIODIVERZITET. v. Različiti pigmenti apsorbiraju različite valne duljine svjetlosti. kulturnu. 20 . fitofagi. BIOLOŠKA OKSIDACIJA. znanstveno nazivlje za biljke i životinje koje se sastoji od dva latinska imena. insekticidi i fungicidi. koja je značajna za održavanje biološke ravnoteže svih živih sustava na Zemlji. paleontologija. zoologija. BILJNA TKIVA. BIOGEOKEMIJSKI CIKLUSI. v. npr. BIOCENOLOGIJA. giberelini) i dvije vrste koji inhibiraju rast (apscizinska kiselina. fitogeografija. Postoje tri skupine koji stimuliraju rast i druge procese (auksini. herbivori. potporna staničja. spojevi koji utječu na rast i diferencijaciju tkiva i organa. karotenoidi (žuti i narančasti) i ksantofil (žuti pigment). znanstvenu. poznati švedski prirodoslovac Carl Linné. v. fiziologija. BIOCID. Dodatak 3. provodna staničja. anatomija. BINOMNA NOMENKLATURA (dvojno nazivlje). embriologija. Biološka raznolikost ima ekološku. Najvažniji su: zeleni klorofili (klorofil a i klorofil b).ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ ličitijih uloga u prilagodbi kopnenom načinu života. rekreacijsku i estetsku vrijednost. tijek kruženja različitih kemijskih elemenata u biosferi.. BIOLOŠKA EVOLUCIJA. žljezdana staničja i osnovno staničja. se odnosi na raznolikost svih živih bića. biljnih i životinjskih organizama. v. znanost koja proučava živa bića. znanost koja proučava rasprostranjenost biljaka (geobotanika. obrazovnu. isp. citokinini. v. BILJNI VIRUSI. BIOCENOZA. sistematika ili taksonomija i dr. BIOLOGIJA. Tako. a drugo ime vrste. Najvažniji biogeokemijski ciklusi su ciklusi ugljika. biljku bijeli dud ili bijela murva nazivamo Morus alba gdje Morus označuje rod (dud. Učinci pojedinih biljnih hormona nisu specifični (za razliku od animalnih hormona). znanost o evoluciji. molekulska biologija. a alba vrstu (bijeli). koja se pohranjuje u kemijskim vezama šećera i drugih organskih molekula koje nastaju u procesu fotosinteze. a mogu se uglavnom svesti na sljedeće oblike: tvorna staničja. citologija. BIOGENI ELEMENTI. Predmet proučavanja biologije veoma je širok pa se ona dijeli na veliki broj užih biologijskih znanosti: botanika. BIOGEOGRAFIJA.

pupilarni refleks odnosno prilagodba (adaptacija) oka na svjetlo ili tamu. a nalazimo ga isključivo u embrionalnom razvoju sisavaca (čovjeka). i time povećava ili smanjuje prolaz zraka svjetlosti u oko. npr. Razlikujemo primarnu i sekundarnu organsku proizvodnju. npr. biljne i životinjske vrste koje su osobito osjetljive na različite oblike onečišćenja. tanak površinski dio Zemlje u kojem su prisutne zajednice svih živih bića i u kojem je moguć njihov opstanak. BLASTOMERE.zjenicom (pupilla). To su uzajamni odnosi jedinki istih vrsta i jedinki različitih vrsta. zatim pojas listopadnih šuma itd. Biosfera obuhvaća litosferu (površinski sloj Zemlje). Njihov nestanak s određenog područja ukazuje na određen stupanj onečišćenja tog područja. v. površinski sloj embrionalnih stanica koji okružuje šupljinu blastule. a unutarnja masa stanica embrioblast. BLASTOCISTA. prosinca.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE Međunarodni dan biološke raznolikosti je 29. simbioza. npr. embrionalne stanice koje nastaju brazdanjem zigote.troposferu. Blastocista ima oblik mjehurića sastavljenog od većeg broja stanica. endoderm i mezoderm. v. blastoderm. parazitizam. Na prednjoj strani je prozirna rožnica (cornea). Ispod rožnice je šarenica (iris) s otvorom na sredini . blastula. Čine je svi ekosustavi. zatim tajge. isp. To je tzv. BLASTODERMA. Vanjski sloj stanica zove se trofoblast. proteini. BIOTIČKI ČIMBENICI. biomase kod autotrofa i heterotrofa. Postoji određena pravilnost u redoslijedu bioma od sjevernog pola pa do ekvatora. najprije pojas tundre. sfaira = lopta). broj jedinki neke vrste ili njihova ukupna masa u suhom ili svježem stanju na nekom prostoru. 21 . BIOSFERA (grč. jedna od skupina ekoloških čimbenika. BIOTOP. stanište. BIOLOŠKI INDIKATORI ONEČIŠĆENJA. Blastocista čovjeka i drugih sisavaca odgovara blastuli nekih beskralježnjaka. ježinaca i blastuli nižih kralježnjaka. BIOMI. O količini pigmenta melanina u šarenici ovisi boja očiju. odnos predatora i plijena itd. npr. U vodozemaca nastaje na početku jednog od stadija embrionalnog ravoja nazvanog gastrulacija i to na taj način da se stanice animalnog pola utiskuju između ekvatora i vegetativnog pola blastule. Te stanice izgrađuju površinski sloj blastule. BJELANČEVINE. Biomasa je mjerilo gustoće svake populacije. proizvodnja organskih spojeva tj. hidrosferu (sve vode na Zemlji) i prizemni sloj atmosfere . oblik zametka nastao na kraju procesa brazdanja zigote. BIOMASA. Biljke koje su poznati biološki indikatori onečišćenja su lišajevi i većina četinjača. bijela ovojnica koja obavija gotovo svu očnu jabučicu. Nastaje za vrijeme brazdanja zigote. a u kasnijem stadiju embrionalnog razvitka iz njega će se razviti zametni listići: ektoderm. BIOPROIZVODNJA. otvor (uvrnuće) na površini gastrule vodozemaca koji vodi u šupljinu arhenterona ili pracrijeva. npr. BLASTOCEL. v. posebne skupine ekosustava koje se nalaze u većem pojasu kopna gdje su obilježja podneblja prilično izjednačena. vodozemaca (žaba). borovi. bios = život. BJELOOČNICA (sclera). Šarenica refleksno stezanjem ili opuštanjem pupilarnih mišića otvara ili zatvara zjenicu. BLASTOPORUS.

na grančicama poredane u dva reda. znanstvena disciplina koja se bavi proučavanjem biljnog svijeta. Kod trpova su u koži (tjelesnoj stijenci) osikule. skupina meristemskih stanice raspoređenih u obliku valjaka u stabljici i korijenu pomoću kojih biljka raste u širinu (sekundarni rast). BOROVI. Ispod epiderme je unutarnji kostur od vapnenih pločica na kojem su često bodlje (npr. morske životinje iz skupine malokolutićavaca. Ariš je jedina europska listopadna četinjača. Na blastuli razlikujemo animalni pol gdje je smješten veći broj manjih stanica i nasuprot njemu vegetativni pol gdje je smješten manji broj većih stanica. v. a nastaje njihovim miješanjem. smreka. najčešće po dva. Većina ima peterozrakastu (pentaradijalnu) simetriju. porodica drvenastih biljaka iz skupine četinjača (golosjemenjače). Najpoznatiji su ježinci. vršna ili apikalna strana na kojoj je crijevni otvor. Živčani i optjecajni sustavi su zrakasto raspoređeni. BODLJIKAŠI. 22 . a češeri su uspravni. Dišu škrgama. je vrsta bojanja heterotrofnih bezbojnih patogenih bakterija na temelju čega se dijele na grampozitivne i gram-negativne bakterije. Dobro je razvijen vodožilni ili ambulakralni sustav. žaba. BOTANIKA. U ježinaca se blastocel nalazi u centru blastule. a sastoji se od površinskog sloja stanica (blastoderma) koji okružuje šupljinu ispunjenu tekućinom (blastocel). Oplodnja je vanjska. te po češerima koji vise prema dolje. ježinaca. kojim završava proces brazdanja oplođene jajne stanice. a u vodozemaca (žabe) na animalnoj polovici blastule. ariš i cedar. zvjezdače i zmijače. One različito podnose tretman antibioticima. Bodljikaši imaju veliku sposobnost regeneracije: zvjezdača može obnoviti krakove. Blastula ima oblik šuplje kugle. vrlo teška zarazna bolest uzrokovana jednim iz skupine animalnih (životinjskih) virusa koji se širi dodirom ili kapljično. trpovi. BOGINJE (variola. Preko mnogih otvora u vezi je s okolnom vodom. npr. Listovi bora su također igličasti ali su. ispod ljusaka. bor. voda slanosti (saliniteta) između slatke i morske vode. Primaju podražaje od strujanja vode i prenose živcima u mozak.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ U embrionalnom razvoju ježinaca blastoporus također nastaje na početku gastrulacije ali na vegetativnom polu blastule. crne boginje. zigote. oštro igličastim listovima koji su u poprečnom prerezu četverobridasti i poredani okolo čitave grančice. ježinca). šešva). To je cjevčica koja se pruža duž strana tijela. rani oblik zametka mnogih višestaničnih životinja. Iz oplođenog jajeta razvija se dvobočno simetrična slobodno plutajuća ličinka pluteus. velike boginje. BORDOŠKA JUHA. BOČNA PRUGA. Polusjedilački su oblici. BLASTULA. BOČNI (lateralni) MERISTEMI. Najpoznatiji su rodovi: jela. isp. Na tijelu se razlikuje usna ili oralna strana (uz podlogu) i suprotna. Jela ima plosnate igličaste listove s dvije bijele pruge s donje strane. Sastoje se od okoždrijelnog prstena i 5 zrakastih žila po tijelu. kod. BOĆATA (brakična) VODA. Smreku prepoznajemo po pravilnoj piramidalnoj krošnji. peronospora. osjetilni organ kojim ribe osjećaju strujanje vode. U cjevčici su osjetni pupoljci sastavljeni od osjetnih stanica. a ježinac čahuru. Između bodlji nalaze se štipaljke ili pedicelarije. BOJENJE PO GRAMU. Spolovi su razdvojeni. smješteni na kratkim ograncima. Listovi su igličasti.

a posredno i u proizvodnji eritrocita. BRONHIOLI. pa tijelo pri povećanom opterećenju ne dobiva dovoljne količine krvi. Na kraju procesa brazdanja zametak ima oblik šuplje kugle ispunjene tekućinom. malokolutićavci. stanje usporenog rada srca. postavio temelje razvoju biologije u nas. manji je minutni volumen srca. a zadaća je bubrega regulirati i održavati stalnim koncentracijske odnose ione i vode u krvnoj plazmi. dok novorođenčad imaju smanjenu. BRZINA SEDIMENTACIJE krvnih stanica ovisi o omjeru specifične težine krvnih stanica i specifičnoj težini plazme. žaba. otkrio staničnu jezgru. v. morus) pa se taj oblik zametka naziva morula. Povećanu sedimentaciju izazivaju upale i trudnoća. BRAZDANJE. a nazivamo ga blastula. upala sluznice glavnih dišnih putova (bronha i bronhiola).-1908). Od jedne početne oplođene jajne stanice nastanu dvije stanice. u kojem se oplođena jajna stanica. kraća je njihova valna duljina. nefron. (ren). Osnivač Hrvatskog prirodoslovnog društva. Služi i za održavanje homeostaze. zigota dijeli brzim uzastopnim mitotičkim diobama čime se broj novonastalih stanica povećava geometrijskom progresijom.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE BOTULIZAM. hrvatski zoolog. Bronhioli završavaju proširenim plućnim mjehurićima ili alveolama. Normalna brzina sedimentacije je od 2 do 10 mm na sat. Bubrezi sudjeluju i u održavanju konstantnoga krvnoga tlaka.). francuski fizičar koji je 1924 god. nasljedni poremećaj izrazito kratih prstiju u ljudi. početno razdoblje embrionalnog razvitka mnogih višestaničnih životinja. (1773. BRONHITIS. boćata voda. Označuje ga pretjerano lučenje sluzi u bronhima. parni žljezdani organ koji izlučuje mokraću. sluznice bronha i bronhiola odebljaju . od četiri osam. BRUSINA S. Što je brzina gibanja čestica veća. BRADIKARDIJA. odnosno oko 720 mL krvne plazme. onečišćen zrak). BRAKIČNA VODA. BROGLIE. BOWMANOVA ČAHURA. BRADNJACI. v. BUBREG. BROWN. Frekvencija pada ispod 60 otkucaja u minuti. Kašalj i iskašljavanje kod kroničnog bronhitisa traje najmanje tri mjeseca u godini i to dvije uzastopne godine. Leže ispod ošita (dijafragme) s obiju strana kralježnice. smrtno opasno trovanje otrovnim produktom koji luči bakterija Clostridium botulinum u loše konzerviranoj hrani ili mesu. Bubrezima se izlučuju i sve suvišne i štetne tvari produkta metabolizma (ureja. od dvije stanice četiri. Tijekom brazdanja zametak najprije poprima izgled ploda duda (lat. od osam šesnaest stanica itd. Njegovo otkriće posebno je bilo važno za izgradnju elektronskog mikroskopa. bilirubin i drugi toksini). britanski znanstvenik koji je 1831. v. završni dijelovi sustava dušnica (bronha) u plućima. Kroz oba bubrega protječe u svakoj minuti oko 1200 mL krvi. a dišne cijevi se začepe od stalne produkcije sluzi. Posebno je proučavao recentne i izumrle mekušce. dušnik. otkrio da čestice koje se gibaju velikom brzinom imaju svojstvo vala. tako što luče hormon 23 . ježinaca. L. BRAHIDAKTILIJA. v. de. – 1858. tanke cijevčice. god. (1845. Kronični bronhitis uzrokovan je učestalim podraživanjem dišnih putova ili infektom ili drugim irititavnim čimbenicima (pušenje. R. npr. Kod akutnog bronhitisa upala je uzrokovana najčešće virusima i bolest načešće traje samo nekoliko dana.

CAM biljke su sukulentne biljke prilagođene životu na suhim staništima (puči su danju zatvorene kako bi smanjile transpiraciju.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ eritropoetin koji stimulira koštanu moždinu. npr. Bubrenjem stanice mogu samo ograničeno primati vodu jer su obavijene čvrstom celuloznom stijenkom. M. Bubrezi su sastavljeni od vanjske kore i srži raspoređene u piramide. Izgrađuje glavninu staničnih stijenki biljnih stanica. filogenetski sustav. BUBREŽNI KAMENCI. BULBILI. Neki biljni dijelovi (npr. noću otvorene). CELOM (sekundarna tjelesna šupljina). biljke i životinje. turgor. Dolaze u paru. CELULOZA. stručni latinski naziv za vuka. kemijski spoj koji nastaje međusobnim spajanjem 8 do 12 tisuća molekula šećera (saharida) glukoze pa stoga spada u skupinu polisaharida. CANIS LUPUS. Osnovna jedinica građe je nefron. člankonožaca. gmazova. mikrotubula. Ulaženje vode povećava unutarnji tlak stanice. isp. Isp. najviša i najšira jedinica u raspoređivanju živih organizama. CENTROMERA. u bodljikaša. otkrio puteve ugljika tijekom fotosinteze. C C 3 BILJKE.. npr. Neki biolozi razvrstavaju organizme u dva osnovna carstva: biljno i životinjsko. C 4 BILJKE. CALVINOV CIKLUS. vodozemaca. ptica i sisavaca).). stanični organeli valjkastog oblika građeni od tankih proteinskih cjevčica tzv. sposobnost krutih tvari da upijaju vodu i pritom povećavaju volumen. odnosno sinteze ugljikohidrata. CALVIN. a neki prema suvremenijim shvaćanjima u pet carstva: monera. biljke u kojih sekundarne reakcije fotosinteze (Calvinov ciklus). fotosinteza 24 . lišajevi) primaju vodu pretežno ili isključivo bubrenjem. tzv. oblik tjelesne šupljine koja se razvija za vrijeme embrionalnog života. smješteni jedan u odnosu na drugi pod pravim kutom izgrađujući centrosom (isp. npr. rasplodni pupovi koji nastaju u pazušcu ili na rubu lista. Postigao rezultate koji su potvrdili rezultate Millera. fizički proces. počinju se razvijati iz sitne krute čestice koja se istaloži u bubrežnoj nakapnici uz koju se nakupljaju različiti minerali. a obavijena je stanicama mezoderma. američki biokemičar. kolutićavaca. Isp. biljke u kojih prvi stabilni spoj koji nastaje u sekundarnim reakcijama fotosinteze (Calvinov ciklus) sadržava tri atoma ugljika. 1911. Nalaze se u citoplazmi svih životinjskih stanica i nekih alga. BUBRENJE. pa kamenac postaje sve veći. kaktusi. Kao pojedinačna valjkasta tjelešca vidljivi su tek elektronskim mikroskopom. djelomice i u mekušaca te u svih kralježnjaka (riba. pričvrsnica. spojevi kalcija. a danju ga otpuštaju i upotrebljavaju u Calvinovom ciklusu. Opća formula celuloze je (C6H10O5)n. CENTRIOLI. v. sjemenke) ili čitavi biljni organizmi (npr. v. protisti. biljke koje noću primaju CO2 i ugrađuju ga u organske kiseline. gljive. CARSTVO.). Celom postoji u razvijenih beskralježnjaka. vegetativno razmnožavanje. CAM BILJKE (biljke s dnevnim kiselinskim ritmom). (rođ. počinju sa spojem koji ima četiri atoma ugljika.

CIKAS.) Nalazi se u citoplazmi svih životinjskih stanica i stanica nekih alga. On daje stanici mehaničku strukturu. Pod svjetlosnim mikroskopom centrosom se vidi kao svijetlo zrnce. mučnina. difterije. pravilni fiziološki ciklusi koji se ponavljaju u periodima od oko 24 sata. kultura stanica i tkiva i dr. CITOLOGIJA. loša probava i nadutost. periodično gibanje listova (danji i noćni položaj). odgađaju starenje. Javljaju se izostanak apetita. spermatozoidima. CIROZA JETRE. dlečje paralize i ospica. embriji i plodovi. stara i razvojno primitivna golosjemenjača. ali su zadržali svoju antigeničnost (sposobnost imunizacije). osnovna tekuća faza stanice u kojoj se nalaze organeli. dies = dan). CIJEPLJENJE. CITOPLAZMATSKO NASLJEĐIVANJE. Prisutni u svih eukariota. bjelančevine koje sadržavaju željezo. znanstvene metode koje se primjenjuju u istraživanjima građe i funkcije stanica. povraćanje. gubitak težine. Svojim velikim perastim listovima sliči palmi. rubeole. CIJANOBAKTERIJE. stanični organel izgrađen od dva centriola (isp. Kod biljaka npr. elektronska mikroskopija. tetanusa. aktivnost određenih enzima. autoradiografija. unašanje u organizam uzročnika bolesti ili njihovih produkata koji su izgubili patogeničnost (ne uzrokuju pojavu bolesti). CITOKINEZA. odvijanje procesa fotosinteze i disanja. CERKARIJE. znanost koja proučava građu i funkciju stanice. CIRKUMNUTACIJA. Oplodnja se zbiva pokretnim muškim gametama. Podrijetlom je iz istočne Azije. CITOLOŠKE METODE. sustav tankih proteinskih vlakana i cjevčica u citoplazmi. Kod osoba koje se ne mogu odreći alkohola. CISTEIN. pojava obavijanja mladih vitica oko podloge zbog nejednakog rasta gornje i donje strane vitica. CITOPLAZMA. v. CIRKADIJSKI RITMOVI (lat circa = približno. dioba stanične plazme koja uslijedi nakon diobe jezgre u mitozi i mejozi. CIKLUS LIMUNSKE KISELINE. To su: svjetlosna mikroskopija. CITOSKELET. v. puči i latica. skupina biljnih hormona koji stimuliraju diobu stanica. dio transportnog lanca elektrona u mitohondrijima i kloroplastima. CITOKININI. CITOKROMI. Sintetiziraju se u tkivima koja aktivno rastu kao što su vrškovi korijena. Krebsov ciklus. hripavca. modrozelene alge. Najvažnije spoznaje s područja citologije dobijene su upotrebom svjetlosnog i elektronskog mikroskopa. djeluju na sazrijevanje kloroplasta i sudjeluju u kontroli apikalne dominacije. nasljeđivanje osobina koje su determinirane izvankromosomskim genima koji se nalaze u citoplazmatskim organelima kao što su mitohondriji i kloroplasti. kemijski spoj iz skupine aminokiselina. Ima važnu ulogu u procesu diobe stanice gdje sudjeluje u formiranju diobenog vretena. Najčešći uzrok ciroze u razvijenim zamljama je alkoholizam. utječu na diferencijaciju. omogućuje 25 . opća slabost. ovčji metilj. bolest postupnog propadanja funkcionalnog tkiva jetre. može potpuno zatajiti funkcija jetre sa smrtnim ishodom.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE CENTROSOM. Obvezno cijepljenje se u Hrvatskoj provodi već godinama protiv tuberkuloze. v.

Kod selagine u izmjeni generacija sudjeluju dvovrsne spore i dva različita gametofita (muški i ženski). Cvijet se nalazi na zadebljanom kraju cvjetne stapke. C C H H 26 . CVAT. CRNE BOGINJE. da ga mijenja. NH2 N O C C N H CORPUS ALBICANS. U tankom crijevu. CRIJEVNI NAMETNICI. CRVENE KRVNE STANICE. Sudjeluje u izgradnji nukleotida odnosno nukleinskih kiselina. a selagina ispod grmova u primorskim krajevima. opisao strukturu molekule DNA. osobito djece. žuto tijelo. posebno crveni pigment. shematski crtež češćih cvatova). klas. fikoeritrin. Najčešće su goveđa (Taenia sagata) i svinjska (Taenia solium) trakavica. generativni organ biljke kritosjemenjače. britanski fizičar koji je zajedno s američkim biologom Watsonom 1953. v. Trakavice nastanjuju pretežno tanko crijevo. tj. Vrijeme cvatnje je produženo jer svi cvjetovi jednog cvata ne cvatu istovremeno. resu.). Te im boje omogućuju kromatsku adaptaciju. CRVENE ALGE. eritrociti i krvna tjelešca CRVOTOČINE. Sastoji se od cvjetne stapke. CORPUS LUTEUM. krosingover. god. 1916. F. spolnog gametama i nespolnog sporama pri čemu su rasplodne stanice uvijek nepokretne. Crvene alge roda Lithothamnion talože u svoje stijenke vapnenac pa je kao rezultat nagomilavanja u slojeve nastao litotamnijski vapnenac. Osim puzajućih stabljika imaju uspravne ogranke koji završavaju češerićima sa sporangijima i sporama. Čaška se najčešće sastoji od zelenih listova (lapovi) koji prvenstveno štite cvjetni pup. nametnici koji mogu s hranom dospijeti u čovjekovo probavilo u obliku jaja ili ličinke. U crnogoričnim šumama raste prava crvotočina. Uzrokuju slabokrvnost. v. štitac i gronju itd. Ocvijeće čiji listovi izgledaju jednako zove se perigon. cvjetištu. Iz crvenih alga dobiva se agar. cvjetišta.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ joj da zadrži svoj oblik. Može biti razlučeno u čašku i vjenčić. insekticid (zamjena za DDT). Listovi vjenčića su latice. Odlikuju se posebnim oblikom razmnožavanja. lijekovi kemijske proizvodnje koji se koriste u liječenju zloćudnih bolesti (kemoterapiji).. CRICK. bijelo tijelo. Nametnici mogu biti oblići (Nematodes) i trakavice (Cestodes). floridejski škrob (produkt fotosinteze) itd. boginje. CITOZIN. v. povraćanje. mučninu i grčeve crijeva. bez bičeva. da se pomiče itd. biljke iz skupine papratnjača. To upućuje na srodnost s modrozelenim algama. može živjeti nametnik obična ili dječja glista (Ascaris lumbricoides). prašnika i tučka. (rođ. Ocvijeće zaštićuje tučak i prašnike te primamljuje kukce oprašivače. v. grozd. skupina cvjetova na zajedničkoj cvjetnoj stapci. v. Oblik cvata često karakterizira cijele porodice cvjetnica. isp. isp. CVIJET. CROSSING OVER. ocvijeća. CITOSTATICI. Po obliku razlikujemo: glavicu. osnovna vodena koloidna otopina stanice koja preostane nakon odvajanja organela centrifugiranjem. (v. CITOSOL. organski spoj s dušikom iz skupine pirimidinskih baza. sadrže i druge boje osim klorofila.

Ženski je dio cvijeta tučak. 8sastavljeni štitac. Cvjetovi su jednospolni. 6-klip. Među četinjače pripadaju i najstarija drveća na svijetu (mamutovci. To su stabla ili grmovi s igličastim ili ljuskavim listovima. a sastoje se od prašničkih listova s peludnicama (mikrosporangijima). porodica biljaka iz skupine četinjača (golosjemenjače). jaju vodozemaca. sočne češeriće koje sliče na bobu i zovu se pupuljice. Najčešće dolaze u okviru šumske vegetacije sjeverne polutke. 5-sastavljeni klas. čempresi i tise. Češeri čempresa i tuje su tvrdi. Perigon i vjenčić mogu biti različito obojeni (ako se oprašuju kukcima) ili neugledni ako se oprašuju vjetrom. 2-sastavljeni grozd. Vjenčić je mnogih cvjetova prostolatičan. Biljke na kojima se razvijaju i ženski i muški cvjetovi nazivaju se jednodomne biljke. Ženski cvjetovi sastoje se od plodnih (sjemenih) ljusaka sa "golim" sjemenim zamecima jer nisu zatvoreni unutar plodnice. a u drugih su skupljeni u cvat. većina sadrži smolu. a drugih sulatičan (od sraslih latica). Listovi su uglavnom tvrdi. a građene su od DNA. obično maleni i mekani. s nekoliko stotina vrsta najzastupljenija skupina golosjemenjača. U nekih kritosjemenjača cvjetovi dolaze pojedinačno. 3-gronja.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE a listovi tepala. 7. kromosomi s petljama). kao stabla (ponekad vrlo visoka) ili grmovi. a ženski češer postaje tvrd i drvenast. Poslije oplodnje razvija se sjemenka. borovicu i tuju. a muški su prašnici. Cvjetovi su po izgledu višesimetrični ili jednosimetrični. U hrvatskoj flori zastupljene su s oko dvadesetak vrsta unutar porodica: borovi. drvenasti i okruglasti. Č ČEMPRESI. Borovica ima mesnate. Cvjetovi mogu biti dvospolni (imaju i tučak i prašnike) ili jednospolni (imaju ili tučak ili prašnike). 9-glavica 27 . Drvenaste biljke. više od 80 m). ČIR DVANAESNIKA. Najčešći uzrok nastanka čira na dvanaesniku je djelovanje kloridne kiseline koja 1 2 3 4 6 5 7 8 9 Shematski crteži češćih cvatova: 1-grozd. Muški su u obliku resa. Dvodomne su biljke one koje imaju samo muške ili samo ženske cvjetove. S takvih kromosoma protežu se bočno niti koje se šire u petlje. duodenalni ulkus. ČETKASTI KROMOSOMI (lump brush kromosomi. do 4000 godina) te najviša stabla (sekvoje. npr. u pravilu vazdazeleni. 4-klas. ČETINJAČE. Ovamo ubrajamo: čempres. kromosomi specifičnog izgleda koji se vide za vrijeme diobe stanice i to u profazi mejoze I u mnogih organizama.štitac. ozlijeđeno mjesto na sluznici dvanaesnika. igličasti ili ljuskavi.

Poznate su posljedice pogrešnog broja spolnih kromosoma: individue sa samo 1 x spolnim kromosomom bez para (xo) su ženske. ČIR ŽELUCA. v. Da- 28 . prsa i zadak. Tako ženske gamete ili jajne stanice sadrže 22 autosoma i 1 x spolni kromosom. Javljaju se boli i grčevi u trbušnoj šupljini. Broj kromosoma može biti i nenormalan. ali nerazvijene i neplodne. Osnovno obilježje su člankovite noge. ČLANKONOŠCI (Arthropoda). Živčani sustav je ljestvičav. svi kromosomi pojedine stanice čovječjeg organizma. Takvi se slučajevi pojavljuju gotovo isključivo u biljaka. Najvažnija osjetila su ticala i oči. tj. korijen. odnosno vanjskim kosturom ili egzoskeletom (npr. ČUPAVO KORIJENJE. ČISTA LINIJA. Optjecajni sustav je otvoren. kukavica. D DALEKOVIDNOST (hipermetropija. a 2 spolni kromosomi. mladunci nekih vrsta ptica (npr. ČOVJEK. ptica pjevica. često pojačanom vapnencem. bez perja i nesposobni za samostalni život. beskralješnjaci iz skupine malokolutićavaca. teže ozlijeđeno mjesto u sluznici želuca. ČUČAVCI. a muškarci 44 autosoma. Zbog stalnog boravka u mraku. poremećaj vida u kojem je očna jabučica prekratka. KROMOSOMSKA GARNITURA. veći ili manji od navedenog što uzrokuje pojavu različitih anomalija pa i smrti. U gametama ili spolnim stanicama čovjeka nalaze se 23 kromosoma (haploidan broj) od čega su 22 autosoma i 1 spolni kromosom. Čir dvanaesnika češći je u pušača cigareta. Pri akomodaciji leće. a oči zakržljale. rakovi i uzdušnjaci (stonoge i kukci). Tijelo je pokriveno hitinskom kutikulom. Dišu škrgama i uzdušnicama (trahejama). kod rakova). Za izlučivanje služe ticalne žlijezde (preobraženi metanefridiji) ili Malpighijeve cjevčice. Njih roditelji moraju hraniti sve dok ne napuste gnijezdo. ČOVJEČJA RIBICA. U tjelesnim stanicama čovjeka ima 46 kromosoma (diploidan broj) od kojih su 44 autosomi (ne određuju spol). a muške gamete ili spermiji sadrže 22 autosoma i 1 y spolni kromosom ili 22 autosoma i 1 x spolni kromosom. peptički ulkus. Živi u podzemnim vodama krškog područja i poznati je naš endem. 1 x i 1 y spolni kromosom. kao i u osoba s pojačanim izlučivanjem kiseline u želucu (hiperaciditet). Kod čira želuca javlja se tupa žareća bol u gornjem dijelu trbušne šupljine. Razdvojenog su spola. Uzroci su uglavnom isti kao oni koji dovode do gastritisa. v. Individue s xxy spolnim kromosomima su muške. U staništima s temperaturom ispod 15 oC rađa žive mlade dok u toplijoj vodi odlaže jaja. skup genetičkih vrlo sličnih jedinki koje su nastale samooplodnjom jednog roditeljskog organizma. vodozemac iz skupine repaša. golubova. hiperopija). Žene imaju 44 autosoma i 2 x spolna kromosoma. slika pada iza mrežnice.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ himusom prelazi iz želuca u duodenum. repaši. Najbrojnija životinjska skupina kojoj pripadaju: klještari. sokolovki) koji se izlegu slijepi. Imaju vanjske škrge koje se zadrže tijekom čitava života. U težim slučajevima može nastati krvarenje iz čira. Dišni pigment je hemocijanin. Nastanjuju sva moguća staništa. te je neoštra. koža joj je blijeda. ali neplodne i s nešto ženskih osobina. Kolutići su se stopili u (dvije ili tri) cjeline: glavu.

J.F. DAVSON. H. DNA. nastavak tankog crijeva. Proces se odvija djelovanjem bakterija. v. 29 . utemeljitelj selekcijske teorije evolucije. dezoksiriboza.). Danielli. DARWIN.F. engleski prirodoslovac. v. znanstvenici koji su 1936.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE lekovidnost se ispravlja konveksnim lećama (pozitivna dioptrija).).. DEPLAZMOLIZA. zatim na kolon (colon) i završava završnim crijevom (rectum) i čmarom (anus). pojava povećavanja obujma vakuole te potiskivanje protoplasta prema staničnoj stijenci. DEOKSIGENIRANA KRV (reducirana krv). inaktiviranje štetnih produkata probave (indol. god. živčana stanica. repaši. tj. DEOKSIRIBOZA. Stijenke debelog crijeva građene su poput stijenki tankog crijeva. DDT. lučenja sluzi. a strukturne: HOCH2 H H O H OH OH H H Izgrađuje nukleotide dezoksiribonukleinske kiseline (DNA). diklor-difenil-trikloretan. a najveća količina se prenosi u obliku karbonatne kiseline. Suprotan proces je plazmoliza. koji se rodiou SAD. sinteze vitamina. krv koja transportira ugljikov dioksid prema plućima. DEMOGRAFIJA. v. stanice vanjskog sloja sluznice maternice koje sadrže hranjive tvari potrebne za razvitak zametka u ranim stadijima embrionalnog razvitka. DALTONIZAM. hrvatski genetičar. DELECIJA. vrsta. skatol). Ugljikov dioksid se transportira na tri načina: mala količina je otopljena u krvnoj plazmi. i DAVSON. mutacija nastala gubitkom dijela kromosoma. J. v. te oba plina odlaze u zrak (atmosferu). insekticid. te refleksnog i kontroliranog pražnjenja crijeva (defekacija). predložili model membrane prema kojem se dvosloj lipida nalazi između dva sloja bjelančevina. DEMEREC. DANIELLI. reapsorpcije vode i minerala. (1809. v. ali bez crijevnih resica i s manje žljezdanih stanica. DENDRITI.A. H.u muljevitom i u vodom natopljenom tlu.5 do 2 metra. Aktivnost debelog crijeva sastoji se od primanja himusa iz tankog crijeva. DEZOKSIRIBONUKLEINSKA KISELINA. npr. v. (1895. cjevasti organ probavnog sustava.A. DEBELO CRIJEVO. v. proces kojim se amonijak (koji nije pretvoren u nitrate procesom nitrifikacije) cijepa na slobodni dušik i vodik. fenol. – 1966. mjesto niže koncentracije vode. DENITRIFIKACIJA.. nitrifikacija. Kada je stanica u hipotonočnoj otopini. DAŽDEVNJACI. DECIDUA STANICE. dio je vezan na globinski dio molekule hemoglobina kao karbaminohemoglobin. Ch. formiranje i nakupljanje stolice (feces). te bakterijskog truljenja ostataka neprobavljene hrane. kemijski spoj iz skupine monosaharida (jednostavnih šećera) pentoza opće formule C5H10O4. naročito nekih anaerobnih. – 1882. zaslužan za industrijsku proizvodnju antibiotika. v. voda ulazi u stanicu i vakuolu. znanost o kretanju broja stanovnika na Zemlji. DEM. dugačko je 1. Dijeli se na početni dio ili slijepo crijevo (caecum) na kojem se nalazi crvuljak (apendix).. DENITRIFIKACIJA. DEZOKSIRIBOZA. M. sljepoća na boje.

Ab.. Dobivamo 9 crnih i jednobojnih jedinki. Naime. stanice zapornice itd. a njihovim međusobnim križanjem u F2 generaciji (tablični prikaz) nastaje 4 različita fenotipa u omjeru 9:3:3:1. a generacije potomaka (filijal- ne) prema redoslijedu s F1. F3 itd. 30 . Njezinu praktičnu primjenu nalazimo pri liječenju teških bubrežnih bolesnika kojima se kroz umjetne probirne membrane u hemodijalizatoru (umjetni bubreg) iz krvi izdvajaju samo relativno male molekule štetne uree. broj fenotipova se ne povećava. Epitelna. leukociti.) u kojem se prati nasljeđivanje dvaju svojstava. a recesivni samo ponekad (u slučaju homozigotnosti). Ova pojava tumači na koji način stanice koje u sebi imaju iste gene mogu biti po svom obliku i funkciji potpuno različite. mišićna. Tako. korijenove dlačice. a za drugo svojstvo B i b. a jedinke u oba svojstva homozigotne (isp. DIJALIZA. za jedno svojstvo A i a. kost. DIJAFIZA. U F3 generaciji. v. pojava aktivnosti samo male specifične skupine gena u nekoj stanici. DIHIBRIDNO KRIŽANJE S DOMINACIJOM. krvne i druge stanice. živčana i druge diferencirane stanice nose iste gene kao i stanica (zigota) od koje su nastale mitotičkim diobama. sastav različitih vrsta leukocita u krvi. sitaste stanice. postupak razdvajanja tvari kada molekule jedne otopljene tvari iz područja veće koncentracije prelaze u područje manje koncentracije kroz polupropusnu membranu kroz koju ne mogu proći molekule druge tvari. Primjer: Dihibridno križanje pjegavog crnog i jednobojnog smeđeg goveda gdje su aleli za crnu boju i za jednobojnost dominantni. U F1 generaciji stvaraju se 4 vrste gameta (AB. Za svako svojstvo postoje dominantni i recesivni aleli. funkciji i molekulskom sastavu) koje se tako specijaliziraju za točno određenu funkciju u složenom biljnom i životinjskom organizmu. proces usvajanja raznolikosti među identičnim stanicama. 3 crne i pjegave jedinke. npr. Ab i aB. 3 smeđe i jednobojne jedinke i 1 jedinka potpuno novog fenotipa. ali različitu skupinu gena koja određuje njezinu specifičnu građu i funkciju. aB. razdoblje kada je srce u relaksiranom stanju pa se klijetke pune krvlju. DIJASTOLA.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ DIFERENCIJACIJA STANICA. Aleli pojedinih svojstava označuju se slovima i to dominantni velikim slovima. unatoč velikom broju gameta. koštane. Isp. U prikazima križanja početna roditeljska (parentalna) generacija označuje se uvijek s P. ab). šećerna bolest. svaka od diferenciranih stanica ima u sebi aktivnu samo malu. F2. a recesivni malim. DIFERENCIJALNA KRVNA SLIKA (DKS). v. (v. shemu u Dodatku 1) DIJABETES. smeđe pjegavo govedo. a u životinja diferencijacijom nastaju epitelne. živčane. proces gibanja čestica neke tvari iz područja njihove veće koncentracije u područje manje koncentracije do izjednačavanja koncentracije. odnosno proces kada se od istih početnih stanica postupno razvijaju različite vrste stanica (po obliku. U ovom slučaju u P generaciji stvaraju se dvije vrste gameta. DIFUZIJA. u biljaka iz meristemskih (embrionalnih) stanica nastaju stanice epiderma.). a sve jedinke F1 generacije su crne i jednobojne (AaBb) jer se geni za vrstu i raspored boje nasljeđuju nezavisno jedan o drugome. DIFERENCIJALNA AKTIVNOST GENA. jedna od vrsta križanja (isp. Dominantni dolaze uvijek do izražaja u fenotipu.

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

DIJASTOLIČKI TLAK, tlak koji preostaje nakon prolaska sistoličkog tlaka (isp.) kroz arterije. DIJATOMEJSKA ZEMLJA, v. kremenjašice. DIKTIOSOMI (grč. diktyion – mreža i soma – tijelo), sastavni dijelovi Golgijeva tijela. Građeni su od plosnatih šupljina (Golgijevih cisterni) naslaganih jedna iznad druge, a odvojenih membranama. Promjer im je oko 1 μm. Na rubovima su šupljine proširene i od njih se odvajaju Golgijevi mjehurići obavijeni membranom. DIOBENO VRETENO, organizirani niz mikrotubula (sitnih proteinskih cjevčica) koje svaraju centrioli za vrijeme diobe stanice (mitoze, mejoze). Njegova je uloga da veže kromosome i omogući njihovo razdvajanje i kretanje prema suprotnim polovima stanice. DIPLOIDNA GENERACIJA, v. haploidna generacija. DIPLOIDNE STANICE, stanice koje imaju dvostruki broj ili diploidan broj (2n) kromosoma. Kromosomi u takvim stanicama smješteni su u homologne parove gdje je svaki član para nasljeđen od jednog roditelja. Diploidne stanice su sve tjelesne stanice onih organizama koji su nastali od dvaju roditelja oplodnjom. Takve stanice dijele se mitozom odnosno staničnom diobom koja omogućuje stvaranje novih stanica s jednakim, konstantnim brojem kromosoma koji je karakterističan za svaku vrstu. DIPLOIDNI BROJ KROMOSOMA (dvostruki broj kromosoma), se javlja u stanicama biljaka i životinja i to tako da kromosomi uvijek dolaze u parovima, tzv. homolognim parovima. Jedan član para podrijetlom od oca, a drugi član para od majke, npr. tjelesne stanice čovjeka imaju

23 para, tj. 46 kromosoma, 23 od oca, 23 od majke (2n=46, n=23); stanice vinske mušice imaju 8 kromosoma (2n=8, n=4), psa 78 (2n=78, n=39), konja 60 (2n=60, n=30), čimpanze 48 (2n=48, n=24), kukuruza 20 (2n=20, n=10), rajčice 24 (2n=24, n=12), kruške 34 (2n=34, n=17) itd. DIPLOKOKI, v. bakterije. DISAHARIDI, v. ugljikohidrati. DISANJE (respiracija), Postoje dva oblika disanja, stanično i vanjsko disanje. Stanično disanje (biološka oksidacija) je proces koji se odvija u biljnim i životinjskim stanicama, a u kojem se organski spojevi, uz prisutnost enzima disanja, postupno oksidiraju do ugljik(IV) oksida (ugljikovog dioksida) i vode pri čemu se oslobađa velika količina energije. 56 % energije se oslobodi u obliku topline, 46 % se pohranjuje u molekulama ATP-a. Energija oslobođena staničnim disanjem koristi se za sve životne aktivnosti stanice. Najčešći i najvažniji organski spojevi koji su

Stanično aerobno disanje

31

ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

izvori energije u stanici su ugljikohidrati, zatim masti, a u manjoj mjeri i proteini. Disanje možemo grubo predočiti kemijskom jednadžbom:

C6H12O6 + 6O2 → 6CO2 + 6H2O + + energija
Stanično disanje je vrlo složen proces koji se u većine organizama može podijeliti na anaerobnu i aerobnu fazu. Anaerobnu fazu disanja čini glikoliza, a aerobnu fazu Krebsov ciklus ili ciklus limunske kiseline i oksidativna fosforilacija. Vanjsko disanje je proces izmjene plinova (O2 i CO2) između vanjske sredine, zraka ili vode, i organizma. Ovaj oblik disanja odvija se u različitim organima za disanje, npr. plućima, škrgama, koži itd. DIŠNI (respiratorni) SUSTAV, zajedno s krvožilnim omogućuje svim stanicama tijela izmjenu plinova, dobivanje potrebnih količina kisika i odstranjivanje ugljikova dioksida. Sastoji se od gornjih dišnih putova (nosa, ždrijela i grkljana) i donjih dišnih putova (dušnika, dušnica i pluća). DIURETICI, sredstva koja ubrzavaju i povećavaju odstranjivanje mokraćom viška vode iz tijela. Smanjujući volumen vode u krvi, snizuju krvni tlak. Diuretici inhibiraju lučenje antidiuretskog hormona (ADH), isp. DIUREZA, povećano lučenje vode tj. odstranjivanje viška vode iz tijela mokrenjem. DIURNALNE ŽIVOTINJE, v. dnevne životinje. DIVERGENTNA EVOLUCIJA (račvasta, specijacija u užem smislu riječi), evolucijski razvoj koji vodi k nastajanju nekoliko novih vrsta u kojih su populacije prostorno odvojene jedna od druge. U svakoj odvojenoj populaciji može se događati sukcesivna evolucija.

DIZENTERIJA (srdobolja, griža) je crijevna zarazna bolest praćena proljevom (dijarea) i bolovima u trbušnoj šupljini s inkubacijom 2 do 7 dana. Najčešći uzročnik je bacil roda Shigellae koji napada sluznicu debelog crijeva. Ako je dizenterija uzrokovana amebama tada govorimo o amebnoj dizenteriji. DJEČJA GLISTA, nametnik u crijevu čovjeka. Pripada oblićima, skupina oblenjaci, isp. Anaerobionti su. Tijelo je dužine i do 50 cm. Razdvojenog su spola. Tijelo mužjaka je manje i zavinuto na stražnjem dijelu. Rasplodni su im organi neparni cjevasti sjemenik i sjemenovod. Ženke imaju parne cjevaste jajnike, jajovode i plodnice (maternica ili uterus) i oplodnja je unutarnja. Oplođena jaja ženka izbacuje u crijevo domadara. Čovjek se zarazi prljavim rukama te jedući neoprano voće i povrće. DJEČJA PARALIZA (polio, poliomyelitis, poliomijelitis), zarazna bolest koju uzrokuje životinjski (animalni) virus, poliovirus koji napada središnji živčani sustav i izaziva klijenut (paralizu) udova. DJEVIČANSKI ZALISTAK, v. himen. DLAKE, rožnate tvorevine kože koje pokrivaju tijelo sisavaca i štite ih od gubitka topline. Većina sisavaca ima pokrivne dlake ili osje koje su čvršće i veće, a ispod su manje i slabije dlake tzv. malje. Dlake su građene od dlačnog korijena sastavljenog od dlačnog stručka i dlačne glavice. Uložene su u dlačne mješčiće t.j. uvrate pousmine u usminu. Svaka dlaka ima svoj dlačni mišić tako da se sisavci mogu nakostriješiti. Dlake mogu biti preobražene u čvrste četine (kod npr. svinje) ili u bodlje (kod npr. ježa i dikobraza). DNA (DNK, dezoksiribonukleinska kiselina), organska makromolekula koja se nalazi u jezgri stanice, u mitohondrijima i

32

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

plastidima. DNA se sastoji od dva polinukleotidna lanca koji su nastali povezivanjem velikog broja nukleotida kao osnovnih građevnih jedinica nukleinskih kiselina. Svaki nukleotid DNA građen je od triju vrsta molekula: šećera dezoksiriboze, fosfata i jedne purinske baze (adenin ili gvanin) ili pirimidinske baze (timin ili citozin). Nukleotidi u jednom lancu međusobno se vežu tako da se fosfat jednog veže sa šećerom drugog nukleotida, a dva polinukleotidna lanca se vežu međusobno preko dušičnih baza vodikovim vezama. Purinska baza jednog lanca uvijek se veže s odgovarajućom pirimidinskom bazom drugog lanca. Polinukleotidni lanci su spiralno zavijeni oko zamišljene središnje osi tako da molekula DNA izgleda poput dvostruke zavojnice (heliksa) čiji je promjer 2 nm. DNA je jedina organska molekula koja ima sposobnost umnožavanja ili replikacije i to na taj način da od jedne ishodišne molekule DNA nastanu dvije potpuno jednake molekule. Način umnožavanja DNA zovemo polukonzervativno udvostručavanje, zbog toga što je u sastavu novonastalih molekula DNA jedan lanac “stari”, odnosno potječe od ishodišne molekule, a drugi lanac je novoizgrađen i to prema kalupu starog.
p
HN H O H N N H 2COH N

nositelj nasljeđivanja, a odgovorna je i za sintezu proteina. DNEVNE (diurnalne) ŽIVOTINJE (diurna, lat. dies = dan), životinje koje su danju aktivne. To je većina životinja, npr. većina kukaca, ptica i sisavaca. DNEVNO NEUTRALNE BILJKE, biljke na čije cvjetanje ne utječe fotoperiod (npr. krastavac i kukuruz). DNK, v. DNA DOJENJE, izlučivanje mlijeka iz žljezdanih stanica dojke kao reakcija na podražaj djeteta pri sisanju. Hormoni koji omogućuju dojenje su prolaktin i oksitocin. Prolaktin se izlučuje u velikim količinama u adenohipofizi (prednjem režnju hipofize) kao reakcija na smanjenu količinu estrogena i progesterona u krvi majke, a koja se smanjuje zbog gubitka posteljice nakon rođenja djeteta. Pri sisanju dijete podražuje osjetilna tjelešca u bradavici dojke i ti podražaji dolaze do hipotalamusa koji luči specifične neurohormone koji pak neurohipofizu potiču na lučenje oksitocina. Oksitocin u dojkama uzrokuje stezanje mjehurića punih mlijeka i potiskivanje mlijeka u kanaliće dojki do bradavica. U prvih nekoliko mjeseci dojenja obično izostaje menstrualni ciklus. DOMINANTNE VRSTE u biocenozi, vrste koje prevladavaju brojnošću ili biomasom. Te su vrste najbolje prilagođene uvjetima biotopa, kao npr. hrast u hrastovoj šumi. DOMINANTNO SVOJSTVO (prevladavajuće svojstvo), svojstvo koje u nasljeđivanju uvijek dolazi do izražaja. U literaturi, dominantna svojstva se označavaju velikim slovima. DORMANCIJA (stanje mirovanja), razdoblje u kojem je rast biljaka ili nekih

D
p

N

CN
O H

G
N

D
p

O H N H H NH N

C H3

D

N

TN
O

A
N

N

D
p

D = dezoksiriboza, C = citozin, G = gvanin, T = timin, A = adenin, P = fosfatni ostatak

DNA je jedna od najvažnijih staničnih makromolekula jer izgrađuje gene te je

33

ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

njezinih dijelova privremeno prekinut ili jako usporen. Razlikujemo nametnutu ili prisilnu dormanciju (izravno ovisi o nepovoljnim okolišnim uvjetima) i prirođenu ili endogenu dormanciju (uzroci su u samoj sjemenci ili pupu; npr.stvaranje zimskih pupova). DOWNOV SINDROM (mongolizam), poremećaj izazvan trisomijom (na 21. kromosomu tri kopije kromosoma). DRIFT (genska snaga, genska slučajnost), jedna od pokretačkih sila evolucije. To je pojava kada neki mutirani recesivni gen u populaciji može doći do izražaja u potomstvu ili se može izgubiti ne pojavivši se više u potomstvu. Genska snaga učestala je pojava u malim populacijama. DRIOPITEKUS (Dryopithecus), šumskog pramajmuna čiji su ostaci na više mjesta u Europi, Aziji i Predstavlja ishodišnu skupinu za čovjekolikih majmuna (čimpanza, orangutana). oblik nađeni Africi. razvoj gorila,

ili Mullerova cijev koja u ženke preuzima ulogu jajovoda, a kod mužjaka zakržlja. DUCTUS DEFERENS, v.sjemenovod. DUODENUM, v. dvanaesnik. DUŠIČNE BAKTERIJE, v. dušikove bakterije. DUŠIČNE BAZE, organski dušikovi spojevi koji sudjeluju prvenstveno u izgradnji nukleotida odnosno nukleinskih kiselina i ATP-a. Postoje purinske (adenin i gvanin) i pirimidinske (timin, citozin, uracil) dušične baze. DUŠIKOVE (dušične, nitrificirajuće) BAKTERIJE, fiksatori atmosferskog dušika. Različite autotrofne kemosintetske bakterije koje žive slobodno u tlu. (Azotobacter) ili u simbiozi s višim biljkama. U korijenskim gomoljićima mahunarki nalaze se simbiotske bakterije roda Rhizobium. Bakterije uzimaju dušik iz zraka i pretvaraju ga u amonijeve ili nitratne spojeve koje biljke mogu koristiti za izgradnju svojih aminokiselina, proteina i nukleinskih kiselina. Imaju i sposobnost pretvaranja amonijaka, koji nastaje raspadanjem uginulih organizama, do nitrata. DUŠNICA, v. uzdušnice. DUŠNIK (trachea), cijev koja je u u čovjeka duga oko 12 cm, a u stijenci ima hrskavične prstenove. Grana se u lijevu i desnu dušnicu (bronhi) koje ulaze u lijevo odnosno desno plućno krilo. Dušnice se u plućima granaju u bronhiole koje završavaju plućnim mjehurićima. DVANAESNIK (duodenum), početni dio tankog crijeva, isp. U njega se ulijevaju izvodni kanali jetre i gušterače kojima se u crijevo dovode žuč i gušteračin sok. DVOBOČNA (bilateralna) SIMETRIJA, simetrija kod koje se tijelo može podijeliti jednom ravninom na lijevu i desnu po-

DROSOPHILA MELANOGASTER, v. vinska mušica. DRUGA MEJOTIČKA DIOBA, v. mejoza II. DRUGI BUBREG (prabubreg ili mezonefros), parni organ tamnocrvene boje, služi za izlučivanje kod riba i vodozemaca. Kod riba je smješten uz kralježnicu iznad plivaćeg mjehura, a kod vodozemaca na leđnoj strani stražnjeg dijela tjelesne šupljine. Klupka krvnih kapilara (glomeruli) se spuštaju u lijevke koje zovemo Bowmanova čahura. Predbubrežna cijev (v. prvi bubreg) se podijeli po dužini u dvije. Jedna od njih postaje prabubrežna ili Wolfova cijev, koja u mužjaka služi kao mokraćovod i sjemenovod, a u ženke samo kao mokraćovod. Druga ostaje predbubrežna

34

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

lovicu. Bilateralno simetrične životinje su pokretne. DVODIHALICE, stara skupina riba (iz devona), živi fosili. Pripadaju skupini nosnoprolaznica, isp. Plivaći se mjehur razvio u pluća, kao prilagodba na sušna razdoblja. Dvodihalice inače dišu škrgama. Poznate su vrste: afrička, australska i južnoamerička dvodihalica. DVODOMNE BILJKE, v. cvijet. DVOIMENO NAZIVLJE, v. binomna nomenklatura. DVOJNA DIOBA, oblik nespolnog razmnožavanja u kojem se matična jedinka dijeli na dva dijela pri čemu ona sama nestaje kao jedinka. Dvojnom diobom se razmnožavaju uglavnom jednostanični organizmi: neke jednostanične alge, neke vrste bakterija i mnoge praživotinje. DVOJNO NAZIVLJE, v. binomna nomenklatura. DVOSPOLAC (hermafrodit), kod životinja organizam koji ima i muške i ženske spolne žlijezde (sjemenike i jajnike) u kojima se proizvode spermiji i jaja. Česta pojava kod bezkralježnjaka, npr. spužve, plošnjaka, nekih puževa i kolutićavaca. DVOSTRUKA DIOBA, v. dvojna dioba. DVOSTRUKA MEMBRANA, građena od vanjske i unutarnje membrane, a imaju je jezgra, mitohondriji i plastidi. DVOSTRUKI BROJ KROMOSOMA, v. diploidni broj kromosoma. DVOSTRUKI KROMOSOMI, građeni su od dvije kromatide. DVOSUPNICE, razred kritosjemenjača. Najčešće porodice i njihovi predstavnici: žabnjaci, ruže, bukve, breze i lijeske, krstašice, lepirnjače, štitarke, usnače i glavočike.

Osobine dvosupnica Dvije supke u sjemenci; Embrio centralno (u sredini) smješten u sjemenci; Žile u stabljici smještene u krugu; Žile otvorene, tj. s kambijem; Imaju sekundarni rast u debljinu; Nervatura lista perasta ili dlanasta, među ograncima žila međusobno mrežasto povezane žilice; Ocvijeće razlučeno u čašku i vijenčić; Ocvijeće i prašnici većinom s 4 ili 5 članova u krugu.

E
EGZOCITOZA, proces u kojem se čestice izbacuju iz stanice u međustanični prostor, tj. oblik masovnog transporta tvari kroz membranu stanice pomoću membranskih mjehurića koji se stapaju sa staničnom membranom. Suprotan proces je endocitoza. EGZOKONJUGANTI, v. konjugacija. EGZOSKELET, v. kostur. EHINOKOK, v. pasja trakavica. EIGEN, M. postavio genetičku hipotezu o izgledu i funkcioniranju prvih organizama (praorganizama) na Zemlji. EJAKULACIJA, refleksno izbacivanje sperme za vrijeme muškarčeva orgazma. EKOFIZIOLOGIJA, znanost koja proučava djelovanje različitih ekoloških čimbenika na funkciju stanica, tkiva, organa i organskih sustava. EKOLOGIJA (grč. oikos = dom, stanište, logos = riječ, govor), znanost koja proučava odnose živih bića i okoliša; znanost o

35

ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

proizvodnji i raspodjeli organske tvari u prirodi te o gustoći naselja biljnih i životinjskih vrsta. EKOLOŠKA NIŠA, obilježava mjesto i ulogu jedne vrste u životnoj zajednici. Niša nekog živog organizma određena je čimbenicima kao što su stanište, hrana i temperatura. Iako dvije vrste mogu dijeliti isto stanište, one nikada ne dijele istu nišu. EKOLOŠKA VALENCIJA, je razmak između donje i gornje granice vrijednosti nekog ekološkog čimbenika (temperatura, svjetlo, voda itd) u okviru kojega je moguć život organizma; različita je za svaki čimbenik i za svaku vrstu, v. ekološki maksimum, ekološki optimum i ekološki minimum. EKOLOŠKI ČIMBENICI, v. abiotički čimbenici i biotički čimbenici. EKOLOŠKI MAKSIMUM, najveći intenzitet nekog čimbenika koji može neki organizam podnijeti, v. ekološka valencija. EKOLOŠKI MINIMUM, najmanji intenzitet nekog čimbenika koji mora postojati da organizam živi, v. ekološka valencija. Poznato je Liebigovo pravilo ekološkog minimuma koje upozorava da je ograničavajući čimbenik onaj koji je najmanje zastupljen u staništu, tj. ona tvar kojom organizam najmanje raspolaže. EKOLOŠKI OPTIMUM, optimalna vrijednost djelovanja nekog čimbenika na organizam, v. ekološka valencija. EKOSUSTAV, sustav bioloških, kemijskih i fizičkih zbivanja koji obuhvaća biotop i biocenozu. Produktivnost ekosustava izražava se proizvodnjom organskog ugljika. Od kopnenih ekosustava najproduktivnija je šuma, a od slatkovodnih jezero s tvrdom vodom.

EKOTIP, nasljedno izmijenjen oblik neke biljke ili životinje uslijed prilagodbe na specifičnost okoliša, npr. poljski miš. EKOTOKSIKOLOGIJA, znanost koja proučava posredni ili neposredni učinak stranih tvari (ksenobiotika) na prirodu, na sve živuće organizme i njihovu organizaciju, odnos prema neživoj tvari, međuodnose i odnos prema čovjeku. EKSKRECIJA, izlučivanje (bubrezima ili kroz kožu) nekorisnih i štetnih tvari. EKSPERIMENT (pokus), promatranje pojave koja se ispituje po točno određenim uvjetima koji dozvoljavaju da se prati tijek pojave te da se ona svaki put uz ponavljanje istih uvjeta ponovo izazove. EKSTRACELULARNA (izvanstanična) PROBAVA, hranjive se tvari probavljaju u probavnoj šupljini mnogostaničnih životinja. Npr. to je gastrovaskularna šupljina kod žarnjaka, isp. EKTODERM, vanjski zametni sloj stanica gastrule iz kojega se razvijaju kod kralježnjaka živčani sustav i osjetila, epitelno tkivo i njegovi derivati. EKTOPLAZMA, vanjski, periferni dio protoplazme. ELEKTRIČNI POTENCIJAL, nastaje na razini receptora direktnim podraživanjem, odnosno na razini sinapse podraživanjem idućeg neurona neurohormonima. Stanica se depolarizira kada u nju difundiraju ioni natrija kroz otvorene ionske kanale. Potencijal stanice se sa –90 mV promijeni na +50 mV. Promijenjeni električni potencijal receptora prenosi se dalje dendritom u tijelo neurona, a odatle aksonom do završnih nožica. Ubrzo nakon depolarizacije nastupa brza repolarizacija tj. stanica se vraća sa +50 mV ponovno na –90 mV. Repolarizacija stanice ostvaruje se izbacivanjem kalija i natrija iz stanice u

36

EMBOLUS. grafički prikaz moždanih valova. to su kisik. endoplazmatska mrežica. životinjski i čovječji organizam u ranim stadijima razvitka nakon oplodnje. genesis = postanak. Iz njega će se gastrulacijom razviti zametni listići. Normalan EKG sastoji se od: P-vala. Na/K pumpe. Embrionalne ovojnice u čovjeka su: korion. EMBRIONALNE OVOJNICE. razvoj zametaka većine životinjskih organizama. sumpor. alantois i placenta (posteljica). EMBRIOLOGIJA. EMBRIO. krivulja električnih potencijala srčanog mišića. klor. embrijem se naziva organizam star do dva mjeseca trudnoće. Mikroelementi izgrađuju preostalih 1 %. EMBRIOGENEZA (grč. Stadiji embrionalnog razvitka su najprije brazdanje i gastrulacija. v. EM. ELEKTRO-KARDIOGRAM (EKG). ELEKTROENCEFALOGRAM (EEG). Dodatak 3. ELEKTRONSKI MIKROSKOP. dušika oko 4 % i različitih minerala oko 6 %.kompleks koji pokazuje mjerenje depolarizacije klijetki i repolarizacije pretklijetki. QRS . ELEKTROENCEFALOGRAFIJA (EEG). Makroelementi izgrađuju oko 99 % težine našeg tijela. zatim ugljika oko 20 %. koje se postave na određena mjesta na glavi. Pločaste elektrode. Ultramikroelemenata ili oligoelemenata ima samo u tragovima. to su fosfor. klica. Mijenja se ovisno o aktivnosti pojedinih područja mozga. v. mangan i aluminij. željezo. tromboza. v. a razvijaju se tijekom embrionalnog razvitka razvijenijih životinja i čovjeka. skupina embrionalnih stanica sisavaca koja se nalazi u unutarnjosti blastociste. Tijelo dobiva 37 . koji pokazuje mjerenje depolarizacije pretklijetki. kalcij. EMFIZEM PLUĆA. EMBRIONALNI RAZVITAK. bolest dišnog sustava u kojoj dolazi do oštećenja i smanjenja broja alveola u plućima. embryon = zametak. neurohormoni. vodik. to su npr. snimanje moždanih valova. biljni. EMBRIJ (zametak). selen. bilježe moždanu (električnu) aktivnost kore velikog mozga. a zatim organogeneza i histogeneza. Daljnjim diobama tih stanica razvija se embrio (klica). razvitak). v. Postupak je značajan za otkrivanje živčanih i duševnih bolesti. radij itd. ugljik. endoderm i mezoderm. ELEMENTI. mikroskop. posebne strukture koje imaju važnu ulogu u zaštiti i prehrani zametka.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE okolinu uz utrošak energije procesom tzv. a iz njih daljnjim razvojem pojedini organi i organski sustavi. v. Najviše je kisika i to oko 60 %. amnion (vodenjak). vodika oko 10 %. U ljudskom tijelu više je od 70 kemijskih elemenata. U čovjeka. isp. znanost o razvoju živih bića iz oplođene jajne stanice. ektoderm. proces diferencijacije stanica u različita tkiva i organe. ELEMENTARNI SASTAV govori od kojih se kemijskih elemenata sastoji nešto. natrij. Kod biljaka započinje inekvalnom (asimetričnom) diobom zigote kojom nastaju bazalna i vršna stanica. žumanjčana vreća. rutenij. EMBRIOBLAST. cink. a bilježe se elektrokardiografom. dušik i kalij. klica. magnezij. jer se s aktivnošću mijenja i ukupna količina električnih potencijala podraženih neurona. titan. te T-vala koji pokazuje rezultat mjerenja klijetki za vrijeme njihove repolarizacije.

nadbubrežne žlijezde. unutarnji zametni sloj stanica gastrule iz kojega se razvijaju kod kralježnjaka probavilo i probavne žlijezde. organski spojevi (proteini. ENDOCITOZA. stvori se hranidbeni mjehurić ili probavna vakuola koja se spoji s lizosomima. a bičaši produkte fotosinteze. U toj zajednici oba organizma imaju korist. fagocitozu. spolne žlijezde (sjemenici i jajnici) te gušterača koja ima osim endokrine i egzokrinu ulogu. unošenje tvari u stanicu uvrtanjem stanične membrane oko njih. v. u pećinama i sl. sustav kanalića omeđenih membranom koji prožima citoplazmu eukariotskih stanica. Omogućuje transport tvari između stanice i okoliša te povezuje staničnu membranu s ovojnicom jezgre. steroidni hormoni. ENDODERMA. su specijalizirane stanice sjemenika koje leže između sjemenih kanalića. nuzštitne žlijezde. Obzirom na veličinu čestica tvari razlikujemo unošenje sitnih čestica. Nastaje spajanjem spermalne stanice sa sekundarnom jezgrom embrionske vreće. EM. U brojnim vrstama bezbojnih bičaša žive modrozelene alge koje obavljaju ulogu kloroplasta (fotosinteza). škrge te drugi unutarnji organi. epifiza. sinteza antitjela itd. ENDOPLAZMA. Hrapava EM ima važnu ulogu u sintezi proteina. središnji. tvorevina koja se sastoji od jezgre i pripadajuće citoplazme kojom ta jezgra upravlja. pluća. EM koja sadrži ribosome je hrapava. Iz podzemlja našeg krša poznati su endemi vodozemac čovječja ribica i pijavica iz Lukine jame na Velebitu. štitna žlijezda. ENDOSPERM. sinteza inzulina. a bez ribosoma glatka. ENDOKRINE INTERSTICIJSKE STANICE (Leydigove stanice). prsna žlijezda (timus). endoplazmatska mrežica. biokatalizatori). ENDOSKELET. Glatka EM se nadovezuje na hrapavu i u njoj nastaju proizvodi neproteinske prirode. unutarnji dio protoplazme. a CO2 zaostaje u tijelu (plave usne). ENZIMI (fermenti. Neki naši otoci (npr. ENDOPLAZMATSKA MREŽICA (endoplazmatski retikulum.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ sve manje kisika. kostur. pinocitozu i unošenje krupnih čestica. ENDOKRINE ŽLIJEZDE (žlijezde s unutarnjim izlučivanjem). ENDODERM. Tada alge koriste neke produkte metabolizma bičaša. ENDEM. biljna i životinjska vrsta koja je rasprostranjena samo na nekom užem području ili arealu. Endokrine žlijezde u čovjeka su hipofiza. Brusnik. Česti su endemi na udaljenim otocima. praživotinje. polipeptidi) koji upravljaju kemijskim reakcijama organizma kvalitativno i kvantitativno. ENDOSIMBIOZA. ENERGIDA. sloj stanica koji odvaja vanjski dio korijena od provodnih elemenata ksilema u središnjem cilindru korijena. v. a luče hormon testosteron. Jabuka i Palagruža) imaju endemične vrste gušterica. Stanice endoderme aktivno izlučuju vodu i tvari u provodne žile i tako se stvara korijenov tlak. hranjivo staničje koje služi prehrani klice (embrija) prilikom klijanja sjemenke. a pri tom 38 . ENDOPLAZMATSKI RETIKULUM. npr. npr. način zajedničkog života kada jedan organizam živi u drugome. ER). žlijezde koje svoje produkte (hormone) izlučuju u krv. Kada hrana uđe u stanicu ili tijelo npr. izlučivanje probavnih enzima u početni dio tankog crijeva.

v. ženski spolni hormoni koje luče jajnici. isp.epi = na. Prosječan životni vijek zdravog eritrocita u krvi je oko 4 mjeseca nakon čega se razgrađuju najvećim dijelom u slezeni. Utječu 39 . hormon koji stimulira razvoj i sazrijevanje eritrocita u koštanoj moždini. ESTROGENI. javlja kao posljedica smanjene koncentracije kisika u atmosferi na velikim visinama. EPIDEMIJA. pasjemenik. Razlikujemo fetalni (HbF) i adultni (HbA) hemoglobin koji se međusobno razlikuju po sastavu polipeptidnih lanaca globina što za posljedicu ima da fetalni hemoglobin ima veću sposobnost vezivanja kisika kod nižih koncentracija kisika od adultnog hemoglobina. pousmina. Za djelovanje većine enzima napovoljniji pH je 7. Razgradnjom hemoglobina nastaje žuti pigment bilirubin koji se izlučuje iz krvi i iz jetre putem žuči u crijevo gdje se uz pomoć bakterijskih enzima pretvara u smeđi sterkobilin B i žuti urobilin B.8⋅1012. Najvažniji im je sastojak hemoglobin koji se sintetizira u koštanoj srži u stanicama prethodnicama eritrocita koje još imaju jezgru. naglo proširenje neke zarazne bolesti u nekom kraju pri čemu u ograničenom vremenu oboli veći broj stanovnika. EPIFIT (grč. npr. hormon koji sudjeluje u pigmentaciji. ERITROPOETIN. biljka koja živi na drugoj biljci.9⋅1012. Temeljna im je uloga prijenos kisika i ugljikovog dioksida između plućnih alveola i tkiva. najbrojnije krvne stanice (u litri krvi muškaraca ih ima oko 4. v. EPIFIZA. vremensko razdoblje od milijardu godina. ESCHERICHIA COLI (ešerihija). ERITROCITI (crvene krvne stanice). pokrovno tkivo na nježnim dijelovima biljke (listu. mladojj stabljici). ali ne kao nametnik. npr. kod muškaraca nabreknuće i ukrućenje spolnog uda. EPITELNO TKIVO (pokrovno tkivo). kožno staničje. razaračko djelovanje voda na tlo. za proizvodnju inzulina. EPIDERMA. pokožica. EPIDIDYMIS.8 do 4. kost. a drugo je pod nadzorom središta u mozgu. endoplazmatska mrežica. EREKCIJA. EOZINOFILNI leukociti LEUKOCITI. Zreli eritrociti su jedine žive stanice u čovjeka koje nemaju jezgru. Ulaskom u krv izaziva sepsu. žlijezda s unutarnjim izlučivanjem smještena sa stražnje strane između velikog i malog mozga.4 do 5. ERGOT. Erekciju nadziru dva erekcijska središta u leđnoj moždini. Izlučuje melatonin. Odgovara epidermi biljaka. Najčešće su epidemije uzrokovane bakterijama i virusima. EPIFIZA. v. mnogi lišaji. Po kemijskom sastavu su steroidi kao i ostali spolni hormoni. koža. Jedno je autonomno središte. kod. a u žena 3. Odatle smeđa boja stolice i žuta boja mokraće. bakterija iz sastava crijevne flore čovjeka. v. Izlučuju ga bubrezi pri smanjenoj koncentraciji kisika u organizmu što se npr. Isp. luči potrebne sekrete iz žljezdanih epitelnih stanica. phyton = biljka). ali može uzrokovati infekcije mokraćnog sustava i proljeve u male djece. ražova gljivica. tropske orhideje i paprati u krošnji tropskih šuma. ER.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE se sami ne mijenjaju. meningitis i druga oboljenja. pokriva tijelo i unutarnje organe životinja. v. EROZIJA. Koristi se u genetičkom inženjerstvu. EON. krvna tjelešca.

v. euglena uzima organsku hranu. odlaganje masnih tvari u potkožnom sloju. mitohondriji. Najvažnije razlike stanica Prokariotska nema oblikovanu jezgru. kloroplaste itd. Stvara se u većini biljnih organa. Stanice eukariota dijele se mitozom. jezgrice. Reguliraju zbivanja u menstrualnom ciklusu. npr. eukariotske stanice. Escherichia coli. jedini plinoviti biljni hormon. EVOLUCIJA (biološka evolucija). inhibira rast te potiče otpadanje listova i proces starenja. dana smanjena količina estrogena uzrokuje ljuštenje odebljale sluznice maternice. svi jednostanični ili višestanični organizmi čije je tijelo građeno od eukariotskih stanica. eu = pravi. Biološkoj evoluciji je prethodila kemijska evolucija odnosno postanak i razvoj organskih spojeva na Zemlji. krayon = jezgra) ili euciti. savršenijim i raznolikijim oblicima na Zemlji.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ na rast i razvoj ženskih spolnih organa kao primarnih spolnih značajki. a to su sve životinje i biljke osim bakterija i modrozelenih algi (cijanobakterija). Postoje dva oblika eutrofizacije: prirodni i antropogeni (uzrokovan djelovanjem čovjeka). Eukariotske stanice su veće i složenije od prokariotskih stanica i imaju sposobnost izgradnje višestaničnog organizma. Stanični organeli eukariotskih stanica su jezgra. rast i razvoj kostiju. Golgijevo tijelo i plastidi (kod biljaka). EŠERIHIJA. Utječu i na formiranje niza sekundarnih spolnih značajki. EUGLENA (Euglena viridis). Produkt fotosinteze je polisaharid paramilum. EUKARIOTI. postupni povijesni razvoj najjednostavnijih oblika živog svijeta k sve složenijim. crvenu očnu pjegu i kontraktilnu vakuolu (tipično za životinje). razvoj dojki. ali pokatkad i životinjom. Također su odgovorni za normalan tijek trudnoće i poroda. Eukariotske stanice sadr- že i manje stanične strukture.) stanična stijenka sadrži celulozu EUTROFIKACIJA. Kada nema svjetla. Zato se euglena može smatrati biljkom. v. ribosome. centriole (kod životinja) koji nisu obavijeni membranom te ih ne smatramo organelima u užem smislu. endoplazmatska mrežica. centrosom. raspored dlaka i drugo. v. bičaš vretenastog tijela bez čvrste stijenke. nego nukleoid jedan kromosom dioba cjepanjem nema staničnih organela stanična stijenka sadrži murein Eukariotska ima potpuno oblikovanu jezgru više kromosoma dioba mitozom ima stanične organele (mitohondrije. Grana biologije koja proučava taj razvoj zove se znanost o evoluciji. Ima plastide. ETILEN. stanice koje sadrže jezgru obavijenu membranom i u citoplazmi ostale stanične organele obavijene membranom. povećanje primarne organske proizvodnje u vodenim ekosustavima nakon obogaćivanja vode hranjivim tvarima koje potiču razvoj alga i višeg vodenog bilja. eutrofizacija. EUKARIOTSKE STANICE (grč. Tako 28. Neki eukarioti imaju i bičeve za pokretanje. lizosomi. Stimulira sazrijevanje plodova. npr. EUCITI. vakuole. kromosome. 40 . kloroplaste. EUTROFIZACIJA (eutrofikacija).

FENILALANIN. Međutim. FAGOCITOZA (grč. FIKSIZAM. mliječno i octeno. (hemolitička bolest novorođenčadi). U nasljeđivanju dominantnih i recesivnih svojstava. AABb. neutrofila da proždiru i. v. shvaćanje da su vrste nepromijenjive. neutrofilni leukociti. dipeptid. AaBB. v. Koštana srž djeteta nastoji nadoknaditi razorene eritrocite pa intenzivno stvara i u krv otpušta nezrele eritrocite (eritroblaste) koji po funkciji ne mogu u potpunosti zamijeniti eritrocite. organizmi različitih genotipova (homozigoti. gljvice) i na taj način dolaze do energije koja je potrebna za njihove životne aktivnosti. npr. pri svakoj narednoj trudnoći. selidba životinja i dr. heterozigoti) mogu imati jednak fenotip. monociti i tkivni makrofagi. Također i način uzimanja hrane u praživotinja. FERMENTACIJA (vrenje). proces u kojem se anaerobno (bez prisutnosti kisika) razgrađuju organski spojevi pri čemu se oslobađa dio energije. Produkti vrenja su obično alkoholi i organske kiseline. cvatnje.majka nosi ponovo Rh+ dijete. FETALNA ERITROBLASTOZA. FAGOSOMI. a dio ostaje u produktima. FENOTIP. a osim toga u djeteta se javlja i žutilo kože jer se hemoglobin iz raspadnutih eritrocita pretvara u žučne boje koje su žute. razgrađuju mikroorganizme i čestice sličnih veličina. FERMENTI.) u koje spadaju neutrofilni leukociti. fagein = jesti. padanja lišća u bilja. Tako. mikroskop. Vrenja uzrokuju različiti mikroorganizmi (bakterije. kemijski spoj iz skupine aminokiselina. FETUS (plod). Prema konačnim produktima vrenja razlikujemo: alkoholno. sposobnost stanica. dominantni su za oba svojstva. FIBRINOGEN. FENILALANILSERIN. a imaju Rh. 41 . gutati. kada ista Rh. AaBb imaju isti fenotip.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE F FAGOCITI. On je ovisan o nasljednim faktorima ili genima (genotipu). uz pomoć lizosoma. tj. npr.majku. eritrociti. ali i o djelovanju okoliša. vrijeme listanja. stvara se veća količina antiRh aglutinina pa se u djeteta pojavljuju simptomi bolesti. Tijekom prve trudnoće u djeteta nema znakova fetalne eritroblastoze jer se u krvi majke nije stvorila veća količina anti-Rh aglutinina koji bi uzrokovali razaranje (hemolizu) djetetovih eritrocita. oblik endocitoze. stanice sa sposobnošću fagocitoze (isp. v. zametak čovjeka starosti od dva mjeseca pa do rođenja. skup svih životinjskih vrsta nekog određenog područja. FENOLOŠKE POJAVE. proces kojim neki prokarionti prevode atmosferski dušik u amonijeve ili nitratne spojeve iskoristive za biljku. bolest koja se pojavljuje u trudnoći u djece koja su Rh+. FIKSACIJA DUŠIKA. bjelančevina u krvi koja je jedan od sudionika u zgrušavanju krvi. kod dihibridnog križanja s dominacijom jedinke različitih genotipova: AABB. enzimi. kytos = šupljina). FAUNA. FETALNI HEMOGLOBIN. isp. genetički izraz kojim se označava zbroj morfoloških i fizioloških svojstava nekog organizma. A i B. v. Posljedica hemolize eritrocita je anemija (slabokrvnost). kemijski spoj nastao vezivanjem dviju aminokiselina: fenilalanina i serina. dušikove bakterije. periodičke sezonske promjene organizama. v. FAZNI MIKROSKOP. npr.

FITOCENOLOGIJA. Prva složenija sustavska jedinica je rod. a nastaju otapanjem nekih organskih spojeva u vodi uz dodatak različitih soli. FILOKADIJE. stanica. po sastavu su bjelančevine. fyton = biljka. Još složeniji je odjeljak/koljeno te najsloženija temeljna sustavska jedinica carstvo. fitocenoza. Unutar sustava živa bića se svrstavaju u sustavske (sistematske) jedinice. Isp. FILETIČKA EVOLUCIJA. Potiču brojne reakcije biljaka na svjetlost. plankton. FITOFAGI. Osim temeljnih sustavskih jedinica neki autori rabe i druge. isp. ali u osnovi su to izotonične otopine koje imaju sastav sličan sastavu tjelesnih tekućina pojedinog organizma. nadcarstvo itd. a obuhvaća usko srodne organizme. preobraženi. genesis = postanak). hipoteza čiji je zastupnik ruski biokemičar A. npr. a obuhvaća srodne vrste. potkoljeno. Što je dan dulji stvara se više aktivnog fitokroma pod utjecajem bijele i crvene svjetlosti. v. specifični biljni fotoreceptori. taksonomija. (rodbinsko sustavoslovlje). fiziološka otopina NaCl koja 42 . prirodna biljna zajednica u kojoj zajedno žive određene biljke na određenom staništu. Koacervati su koloidne kapljice s opnama.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ FILAMENT. Npr. To su pigmenti koji maksimalno apsorbiraju u crvenom i tamnocrvenom dijelu spektra. fylon = pleme. FILOGENETSKI NIZOVI. a koljeno kada se radi o životinjama. FILOGENETSKI (prirodni) SUSTAV ukazuje na srodstvene odnose između pojedinih razvojnih skupina živih bića i unutar njih. FITOCENOLOGIJA. drugi naziv za biljojede. Prema toj hipotezi praorganizam je mogao izgledati poput nekog složenijeg koacervata koji je imao sposobnost jednostavne izmjene tvari i samoobnavljanja. razvrstavanje živih bića u filogenetski (prirodni) sustav. Oparin. FITOCID. prašnik. FIZIOLOŠKA OTOPINA. a tumači postanak prvih organizama (praorganizama) na Zemlji. FIZIOLOGIJA. Postoje različite fiziološke otopine. J. Temeljna sustavska jedinica je vrsta. v. v. razvojni nizovi. otrovni kojima se uništavaju nepoželjne biljke. Fitokrom postoji u aktivnom i inaktivnom obliku. FITOCENOZA (grč. Nalaze se u plazmi stanica listova u vrlo malim količinama. v. biljna stanica. FITOCELULA. FILOGENIJA (grč. koljeno. rod. FILOGENETSKA SISTEMATIKA. vrsta. FITOKROMI. Ovu biljnu komponentu biocenoze proučava znanost fitocenologija. znanost o biljnim zajednicama. takve organizme koji se međusobno mogu spolno razmnožavati. Odjeljak i koljeno su jednake složenosti s tim da se naziv odjeljak uobičajeno rabi kada se govori o biljkama. posebna otopina različitih soli i glukoze. v. Daljnje temeljne jedinice su red i razred. znanstveno područje biologije koje se bavi proučavanjem podrijetla organizama na Zemlji i njihovim razvrstavanjem u rodoslovno stablo. sukcesivna evolucija. tj. prošireni dijelovi stabljike u obliku listova koji preuzimaju ulogu fotosinteze. fitocenoza. FITOPLANKTON. v. FIZIOLOŠKA HIPOTEZA. koine = zajednica). Srodni rodovi obuhvaćeni su jednom porodicom. znanost koja proučava životne procese živih bića.

Građeni su od trovalentnog alkohola glicerola na kojem su esterski vezane dvije više masne kiseline. v. Isp. FOSILIZACIJA. prvi antibiotik. isp. organski spojevi iz grupe lipida koji sadrže fosfatnu skupinu (ostatak fosfatne kiseline). FOSILI (okamine. 1929. hormon cvjetanja. FSH. v. FLORIGEN. fotoperiodizam. FLORISTIKA . FOTOMORFOGENEZA. FOSFATNA KISELINA (fosforna kiselina). FLEMING. britanski mikrobiolog. provodno staničje. FOTOBIOLOŠKO PODRUČJE. v. Homo sapiens. FLOEM. mikroskop. Sintetizira se u listovima u povoljnim uvjetima i prenosi se u vegetacijske vrškove gdje potiče cvjetanje. Kontrolirane su specifičnim fotoreceptorima. fosfatna kiselina. valne duljine ovog dijela spektra uzrokuju i fototropizme. fitokromima. otkrio penicilin. skup svih biljnih vrsta nekog određenog područja. pougljenjivanjem ili konzerviranjem. v. planine. FOSILNI PRIJELAZNI OBLICI. lat. a preko treće OH skupine vezana je fosfatna kiselina. fossus = iskopan). svjetlost valnih duljina koje odgovaraju vidljivom dijelu spektra (380-760 nm).9 % NaCl (0. države i sl. FLUID. znanost o flori. A. FOSFORNA KISELINA. nukleinske kiseline i ATP. vrsta provodnog tkiva u biljaka koja služi za provođenje asimilata (produkata fotosinteze) od listova prema ostalim dijelovima biljke. npr. proces nastajanja fosila. FOSILNI ČOVJEK. FOTOPERIOD (relativna duljina dana i noći). Njeni kiselinski ostaci izgrađuju izuzetno važne spojeve. Eritrociti u takvoj otopini ostaju neoštećeni. nastije. promjena oblika kod biljaka koje se događaju pod utjecajem svjetlosti. kemijski spoj empirijske formule H3PO4.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE se koristi za infuziju sadrži 0. v. dio spektra Sunčevog zračenja. ostaci biljnih i životinjskih organizama iz davnih razdoblja Zemljine prošlosti. Floem je građen od sitastih cijevi i stanica pratilica. prijelazni oblici. flora nekog otoka. FOLIKUL STIMULIRAJUĆI HORMON. Važan su paleontološki dokaz evolucije. Imaju važnu strukturnu ulogu u stanici jer se nalaze u sastavu svih membrana stanice. a u drvenastih biljaka redovito se nalazi u kori. god. v. Preko fosfatne skupine vezan je obično neki aminoalkohol.15 mola po litri otopine) te je izotonična (iste koncentracije) prema eritrocitima. FOTONASTIJA. – 1955. Osim fotosinteze. Fosili nastaju: okamenjivanjem. unutarnja želja ili potreba za promjenom određenih karakteristika (po Lamarcku). isp. fototaksije i fotomorfogeneze (promjene oblika djelovanjem svjetlosti). FLORA. npr. glavni okolišni čimbenik pomoću kojeg biljke određuju godišnje doba. O HO P OH OH 43 . FLUORESCENIJSKI MIKROSKOP. v. Struktura florigena još nije poznata. (1881. FOSFOLIPIDI.).

mrežnica. Korijen pokazuje negativni fototropizam jer raste u suprotnom smjeru od izvora svjetlosti. Pojavu uzrokuje auksin (hormon rasta) koji djelovanjem svjetlosti prelazi u zasjenjenu stranu klice ili stabljike gdje uzrokuje pojačan rast. Sastoji se od antenskog kompleksa. vidne stanice. početak cvjetanja. otpušta CO2 i ne nastaje ATP. FOX.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ FOTOPERIODIZAM. Biljke reagiraju različitim fiziološkim procesima na duljinu dana tj trajanje dnevnog svjetla (npr. otpadanje listova u jesen). v. metabolički put kojim se smanjuje učinak fotosinteze: troši se kisik. Shema fotosinteze 44 . štapići i čunjići. gibanje biljke rastom tj. v. Fotosintezu možemo predočiti jednadžbom: 6CO2 + 12H2O + svjetlosna energija → → C6H12O6 + 6O2 + H2O Fotosinteza se sastoji od dva stadija: 1. FOTORECEPTORI. FOTOTAKSIJE. američki znanstvenik koji je u svojim pokusima dobio mikrosfere. vedrih i suhih dana kada su puči zatvorene a koncentracija kisika u listu viša od koncentracije CO2. FOTOSINTEZA (asimilacija CO2). savijanje organa prema izvoru svjetlosti (pozitivni fototropizam). FOTOSINTETSKA FOSFORILACIJA proces sinteze ATP-a uz pomoć svjetlosne energije Sunca koji se odvija za vrijeme transporta elektrona u kloroplastima. FOTOSISTEM. Obično se zbiva za toplih. proces koji se odvija u kloroplastima biljnih stanica u kojem biljka iz anorganskh spojeva (vode i CO2) izgrađuje ugljikohidrate i druge organske spojeve koristeći svjetlosnu energiju Sunca. reakcije u tami (sekundarne reakcije ili Calvinov ciklus) koje se zbivaju u stromi kloroplasta u kojima se reducira ugljikov dioksid i sintetiziraju ugljikohidrati. okrugla tjelešca proteinskog sastava slična jednostavnim živim stanicama čime je pridonio razumijevaju razvoja živog svijeta na Zemlji. taksija. fotosintetska jedinica koja je smještena u tilakoidnoj membrani kloroplasta. FOTORESPIRACIJA. S. pravilna izmjena dana i noći. FOTOTROPIZAM. reakcijskog središta klorofila a i primarnog akceptora elektrona. svjetlosne (primarne) reakcije koje se zbivaju u tilakoidnim membranama kloroplasta u kojima se Sunčeva energija pretvara u kemijsku energiju (ATP i NADPH) i oslobađa kisik i 2.

a muške gamete su spermiji koji nastaju u sjemenicima (testisi). npr. katkad i povraćanje. GANGLIJ. GAMETANGIOGAMIJA. G1-FAZA. najčešće uzrokovana agresivnim djelovanjem žestokih alkoholnih pića. GASTROENTERITIS (pokvareni želudac. konzumiranjem jako začinjene hrane ili djelovanjem nekih lijekova (npr. spolne rasplodne stanice. hormon stimulacije folikula). interfaza. Luče ga želučane žljezdane stanice podražene hranom u želucu. Najčešći je uzročnik virus koji se lako prenosi dodirom. Odvija se u spolnim žlijezdama muškaraca (sjemenici) i žena (jajnici) pod djelovanjem istih gonadotropnih hormona: FSH i LH. G2. probavni hormon. Najslađi je od svih šećera. organski spoj. medu i kao sastavni dio nekih složenih šećera ili oligosaharida. GASTRIN.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE FREON. jednostavni šećer ili monosaharid. stvaranje muških i ženskih spolnih stanica (gameta). FSH (folikul stimulirajući hormon. a ne samo hranom ili pićem. sintetizirani spoj iz skupine spojeva klorfluorugljika koji se rabi kao potisni plin. Gastrin potiče i glavne stanice želučanih žlijezda da luče pepsinogen. crijevna gripa) je opći naziv za manju infekciju želuca i tankoga crijeva praćenu mučninom. Fruktoza se u organizmu lako prevodi u glukozu. zajednički naziv za spermatogenezu i oogenezu. spajanje cijelih spolnih organa prilikom razmnožavanja. povraćanjem i/ili proljevom što obično traje 1 do 2 dana.FAZA. v. U čovjeka ženska gameta je jajna stanica koja nastaje u jajnicima (ovariji). a uništava ozonsku ovojnicu. acetilsalicilna kiselina). Dolazi u voću. GASTRULACIJA. GARIG. v. jaka mučnina. U žene stimulira rast folikula jajnika.FAZA. Apsorbira se u krv i krvlju se prenosi do obložnih stanica. GAMETOGENEZA. zajednica niskog bilja koje nastaje sječom vazdazelene šikare. saharoze. interfaza. GASTRITIS. GAMETOFIT. a u muškarca spermatogenezu. FRUKTOZA (voćni šećer). Njezina empirijska formula ista je kao i formula monosaharida glukoze i galaktoze (C6H12O6) iz skupine aldoheksoza (šećera sa šest atoma ugljika i aldehidnom funkcionalnom skupinom) dok ona spada u ketoheksoze (šećere sa šest atoma ugljika i keto funkcionalnom skupinom). Gastritis prate napadaji boli želuca. haploidna generacija. druga etapa embrionalnog razvitka mnogih višestaničnih životinja u kojoj dolazi do gibanja embrional- G G0. upala želučane sluznice. v. pušenjem. GAMETE. GASTRULA. spolna generacija u biljaka koja sadrži muške i ženske rasplodne organe. FUNGICID. interfaza. gastrulacija. v. Isp. bolovima (grčevima) u trbuhu. nakupina živčanih stanica. hormon iz skupine gonadotropnih hormona koje luči prednji režanj hipofize (adenohipofiza). 45 . Tijekom evolucije biljnog svijeta došlo je do redukcije gametofita u odnosu na nespolnu generaciju (sporofit). biocid. v.

) geni za ista svojstva nalaze se na homolognim kromosomima.leucin kiselina Ile . kodon. crvenu od zelene. organi koji služe isljučivo za razmnožavanje. gen CB. U diploidnim stanicama (isp.metionin kiselina Val . genetička uputa. Kratice imaju značenje: Tyr . III.lizin Phe .histidin C . spužve.glicin Ala . informacija o rasporedu dušičnih baza u molekulama DNA. Oblik zametka koji nastaje kao rezultat gastrulacije sastoji se od tri zametna listića (ektoderm. materijalna osnova ili čimbenik nekog nasljednog svojstva. žene su normalnog vida ali su prijenosnici tog gena na potomstvo. GEN CB (CB = colour-blindness. GEMULA.arginin Thr . sljepoća za boje. pri čemu nastaju zametni listići.cistein Ser . gen koji se nalazi u spolnom x-kromosomu.triptofan Pro . U C A G 46 . v. endoderm. GEL .gvanin Lys .izoleucin Glu . GEN DALTONIZMA. npr.fenilalanin Asp . dio molekule DNA koji djeluje kao određena funkcionalna jedinica.asparginska Leu . gastrulacija u vodozemaca započinje gibanjem stanica blastoderma.treonin Gly . Ako su muškarci nositelji takvog gena ne mogu razlikovati boje. GENETIČKA UPUTA (genetička šifra). gušći.aspargin G .glutamin A .prolin Arg . Vrijedi i obrnuto. gen CB.valin Cys .serin Trp .glutaminska Met .adenin Asn . v. GEN SLJEPOĆE ZA BOJE. slijed triju nukleotida u mRNA. Jedan gen ne mora uvijek biti odgovoran samo za jedno svojstvo nego može biti odgovoran i za više njih. daltonizam). mezoderm) i zovemo ga gastrula. Genetička uputa. uputa. GENETIČKA ŠIFRA. U C A G Phe Ser Tyr Cys U Phe Ser Tyr Cys C Leu Ser stop stop A Leu Ser stop Trp G Leu Pro His Arg U Leu Pro His Arg C Leu Pro Gln Arg A Leu Pro Gln Arg G Ile Thr Asn Ser U Ile Thr Asn Ser C Ile Thr Lys Arg A Met Thr Lys Arg G Val Ala Asp Gly U Val Ala Asp Gly C Val Ala Glu Gly A Val Ala Glu Gly G I. v. Tablica 1. npr. U žena se sljepoća za boje pojavljuje samo ako se tako promijenjeni geni nalaze u oba x-kromosoma. Tako.citozin Gln . a u sisavaca gibanjem stanica embrioblasta.alanin Mjesto u kodonu II. više gena mogu biti odgovorni za samo jedno svojstvo. v. Ako se takav gen nalazi samo u jednom od x-kromosoma. U daljnjem tijeku embrionalnog razvitka iz zametnih listića postupno će se diferencirati organi i tkiva (organogeneza i histogeneza).stanje. GEN.uracil His . GENERATIVNI ORGANI.tirozin U . odnosno informacija o naravi pojedinih gena. skrutnuti oblik koloidnih otopina.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ nih stanica u unutarnjost zametka.

Svaki kodon odgovara pojedinoj aminokiselini (vidi tablicu 1. GENETIČKO INŽENJERSTVO. taksija. bakterija. GENSKA SLUČAJNOST. GENETIKA (znanost o nasljeđivanju). Na primjer. a svaka trojka prepisana s DNA na mRNA naziva se kodon ili kod.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE Tri nukleotida (dušične baze) koje nazivamo trojka ili triplet čine osnovu takve upute. genetička uputa.). citogenetske (citološke) karte kod kojih je raspored gena utvrđen genetičkim i citološkim istraživanjima. uzimanje pojedinih stanica iz nekog organizma i stvaranje potpune kopije tog organizma te još neke druge slične metode. Genetske karte su izrađene za mnoge vrste biljaka (ječam. GEOTROPIZAM. v. GENETIČKE KARTE (kromosomske karte). rajčica itd. GENOFOND. karte koje prikazuju smještaj i međusobnu udaljenost gena u kromosomima. prijenos gena između populacija uz pomoć kretanja gameta. kokoš itd. U područje genetičkog inženjerstva ubrajamo i kloniranje. kukuruz. šifra AUG znači ugradnju aminokiseline metionina u polipeptidni lanac i to je ujedno šifra za početak polipeptidnog lanca. jedinki ili skupine jedinki iz jedne populacije u drugu. drift. haploidna garnitura kromosoma koja se nalazi u gametama. genetički izraz kojim se označuje ukupna materijalna osnova nasljeđa odnosno zbroj svih nasljednih faktora ili gena koji određuju nasljedna svojstva nekog organizma. GENSKA SNAGA. Genetičke upute UUU i UUC znače ugradnju aminokiseline fenilalanina itd. v. v. Postoje dvije vrste genetskih karti: 1. relativni omjeri alela gena prisutnih u populaciji. GENSKA UČESTALOST. Genetička uputa otkrivena je pokusima s genetičkim materijalom crijevne bakterije ešerihije (Escherichia coli). postupci prenošenja određenih gena iz jedne vrste organizama u drugi. dodatak 5. GENETIČKI KOD. UAG i UGA znače kraj polipeptidnog lanca jer ne određuju ugradnju niti jedne od aminokiselina (nonsense code). Način označavanja genotipova prikazan je u primjerima monohibridnog i dihibridnog križanja s dominacijom. H. GENSKO STRUJANJE. znanost koja proučava pojave i uzroke međusobne sličnosti i nasljeđivanja svojstava u živih bića. GEOTAKSIJA. GENOTIP.) te na taj način DNA preko mRNA određuje ugradnju pojedinih aminokiselina u specifičnu vrstu proteina. Morgana. GENOM. Genetičkim se inženjerstvom umjetno stvaraju hibridne molekule DNA kakvih do sada nije bilo u prirodi. Genetičke šifre UAA. cjelokupni kompleks gena koji neka populacija sadržava u nekom vremenu. v. v. drift. Pojam genetska karta potječe iz znanstvenog rada američkog genetičara T. a djelomice i za čovjeka. Važno je naglasiti da isti kodon (triplet) kodira istu aminokiselinu bez obzira da li se to događa kod virusa. 2. tropizmi 47 . tj.) i životinja (kunić. GEOLOŠKA DOBA. biljki ili pak čovjeka. crossing-over genetske karte koje su izrađene samo na temelju postotaka izmjena dijelova homolognih kromosoma (crossing-overa) između određenih gena koji su vrlo blizu jedan drugoga. v.

dendrita i aksona. a u žena u jajnicima. Prirodno raste u istočnoj Aziji. GLAVONOŠCI. ljekovite su kamilica. GINKO. "živi fosil". kasnije sjemenke. Stablo je snažno. gorostasni kromosomi. Sjemeni su zameci. U sjemenkama žitarica giberelini stimuliraju stvaranje enzima (α-amilaze) koji razgrađuju pričuvni škrob. znanost o biološkim procesima starenja. prekomjeran rast svih dijelova tijela zbog povećane razine hormona rasta u krvi koje luči hipofiza. Često se sadi u gradovima jer dobro podnosi onečišćeni zrak. Svi su morski organizmi i grabežljivci: hobotnice. GIGANTIZAM. giberelini. Spermiji su nepokretni. prekidaju dormanciju i potiču klijanje sjemenki. podbjel i pelin. GERONTOLOGIJA. Sintetiziraju se u mladim listovima i korijenju te u embrijima. Navedene su biljke samo neke od oko 11000 poznatih vrsta. GLICIN. stara i razvojno primitivna vrsta golosjemenjača. npr. Oči su im dobro razvijene. okruglasti i po dva na zajedničkom dršku. GLATKO MIŠIĆNO TKIVO. GIBERELINI (giberelinske kiseline). GLAVOČIKE. Svojim stezanjem omogućuje njihovu funkciju. Plod je roška. skupina najrazvijenijih dvosupnica. fizičkim i psihičkim svojstvima ostarjelih organizama te sociološkim problemima starijih ljudi. U čahuri u glavi je "mozak" (nakupina svih živčanih ganglija). najčešće s papusom kao prilagodba na rasprostranjivanje vjetrom. pokretni spermatozoidi. Stopalo je pretvoreno u krakove (8 ili 10) i lijevak koji vodi u plaštenu šupljinu u kojoj se nalaze škrge. a u žena jajne stanice. probavnih. GIBERELINSKE KISELINE. Pokreću se izbacivanjem vode kroz lijevak. Dolazi u sastavu unutarnjih organa. tratinčica i ivančica. lignje i indijska lađica koja jedina ima vanjsku kućicu. GIGANTSKI KROMOSOMI. mokraćnih i spolnih. skupina biljnih hormona koji stimuliraju rast stabljike i listova. v. a oplodnja unutarnja. Uloga tih stanica je da štite živčane stanice. Javlja se u razvojno doba. vrsta epitelnog tkiva sastavljenog od zametnih stanica iz kojih se u muškaraca razvijaju spermiji. a poznate su livadne biljke maslačak. kemijski spoj iz skupine aminokiselina. isp. GLIJA-STANICE. izoliraju živčana 48 . GERMINATIVNI EPITEL (zametni epitel). visoko i razgranato. v. vrsta mišićnog tkiva kojega izgrađuju stanice vre- tenastog oblika s jezgrom u sredini. Cvjetovi su s cjevastim ili jezičastim vjenčićem. Obuhvaća zeljaste biljke s glavičastim cvatovima koji sliče velikim cvjetovima. Imaju trenicu. Uz probavilo imaju vrećicu s crnilom koje sadrži tamni pigment melanin. Među glavočikama su mnoge biljke koje se uzgajaju kao povrće: salata i artičoka. Rad glatkog mišićnog tkiva nije pod utjecajem naše volje već njime upravlja autonomni ili vegetativni živčani sustav. sipe. Zadržavaju sposobnost dijeljenja kroz cijeli život. U muškaraca se germinativni epitel nalazi u sjemenicima. Glavočike su najbrojnija porodica dvosupnica. mreža potpornih i pomoćnih stanica živčanog tkiva koje se nalazi oko živčanih stanica. Spolovi su razdvojeni. medicinska struka koja se bavi liječenjem i sprečavanjem staračkih bolesti. ima lepezaste listove s viličastom nervaturom. muške su gamete još s bičevima.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ GERIJATRIJA. pripadaju skupini mekušaca.

Prema potrebi razgrađuje se u glukozu koja putem krvi dolazi do svih stanica gdje se koristi kao izvor energije. GLODAVCI. organski spojevi koji nastaju povezivanjem kraćih molekula šećera (oligosaharida) s lipidima. Prema broju od šest ugljikovih atoma u svojoj molekuli glukoza je heksoza. glikogen. U glikolizi se šećer glukoza razgrađuje do dvije molekule pirogrožđane kiseline uz oslobađanje dvaju atoma vodika i dvije molekule ATP-a. v. Kemijska formula spoja glikogena je (C6H10O5)n. Dolazi u slobodnom obliku u raznom voću. štakori i miševi. GLIKOGENSKA ZRNCA. škroba. Stvara ga aferentna (dovodna) arteriola (ogranci bubrežne arterije) koja ulazi u početni dio nefrona . GLOMERUL (kapilarno klupko).____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE vlakna i kontroliraju izvanstanični prostor. GLOBALNO ZAGRIJAVANJE ZEMLJE. GLUKOZA (grožđani šećer). maltoze. hormon kojega izlučuje gušterača. Hrane se glođući prednjim parom dugačkih sjekutića koji rastu cijelog života. U slučaju kad u stanici nema dovoljno kisika pirogrožđana kiselina može se dalje razgraditi do ugljik(IV)-oksida i alkohola ili dvije molekule mliječne kiseline što ovisi o tipu stanice. organski spojevi koji nastaju povezivanjem kraćih molekula šećera (oligosaharida) s bjelančevinama. GLIKOLIPIDI. GLIKOGEN. laktoze. imunoglobulin. Sastoji se od nekoliko stotina kemijski vezanih molekula glukoze. kao zaliha energije u stanicama viših životinja i čovjeka. v. Ako u stanici ima dovoljno kisika tada se pirogrožđana kiselina nizom biokemijskih reakcija dalje razgrađuje u mitohondrijima sve do ugljik(IV)oksida i vode. GLUKOKORTIKOIDI. Kroz glomerul se ne filtriraju krvne stanice i velike molekule bjelančevina iz krvne plazme (selektivna filtracija). splet kapilara u obliku klupka koji je sastavni dio nefrona. ali i kao sastavni dio složenih šećera: saharoze. 49 . Najviše se sintetizira i pohranjuje u jetri i mišićnom tkivu u obliku glikogenskih zrnaca. kemijski spoj. Zajednički naziv te skupine reakcija jest aerobna respiracija (aerobno disanje). početna faza disanja koja se odvija u citoplazmi biljnih i životinjskih stanica neovisno o prisutnosti kisika pa se još naziva i anaerobna respiracija (anaerobno disanje). najbrojnija skupina sisavaca. medu. Biljojedi su. dikobraz. Glodavcima pripadaju: vjeverice i puhovi. Služi kao neposredan izvor energije u stanici. dabrovi. zečevi.Bowmanovu čahuru. Česti su građevni dijelovi bioloških membrana. održavajući sastav iona stalnim. Žive u svim staništima. učinak staklenika. kortikosteroidi. a prema aldehidnoj funkcionalnoj skupini aldoza (aldoheksoza). γ-GLOBULIN. Česti su građevni dijelovi bioloških membrana. v. GLIKOLIZA (anaerobna respiracija). kemijski spoj. Služi kao pričuvna tvar tj. Iz čahure izlazi odvodna (eferentna) arteriola. GLIKOZURIJA. a stimulira razgradnju glikogena do glukoze u slučaju snižene razine glukoze u krvi (hipoglikemije).v. pojava glukoze u mokraći kod nekih bubrežnih bolesti. Kroz glomerul se filtrira krvna plazma u silazni krak nefrona. ugljikohidrat iz skupine monosaharida ili jednostavnih šećera kemijske formule C6H12O6. ugljikohidrat iz skupine polisaharida ili složenih šećera. glikogena i celuloze. GLIKOPROTEINI. GLUKAGON. osnovne građevne jedinice bubrega.

Imaju sličnosti sa životinjama i biljkama. Srce je trodjelno ali je klijetka djelomično podijeljena na dva dijela. krokodili i ljuskaši (gušteri i zmije). stanični organel koji se nalazi u citoplazmi svih vrsta eukariotskih stanica. skupina kralježnjaka koja se prva u biosferi sasvim prilagodila životu na kopnu. Dobro je razvijen prednji mozak. Koža gmazova je suha i pokrivena rožnatim ljuskama ili pločama (zaštita od isparavanja). Grubo ih dijelimo na: sluznjače. Kod gmazova je razvijena briga za potomstvo. talijanski liječnik histolog. lizosomi. C. Gmazovi su hladnokrvne životinje jer se staničnim disanjem ne stvara dovoljno topline. neke se primitivne gljive hrane tako da uzimaju i probavljaju krute komade hrane. GLUTAMINSKA KISELINA. otkriva mjehuraste strukture u živčanim stanicama. opip. a sam je zametak obavijen zametnim ovojima (v. GOJAZNOST. Po svojim osobinama su izdvojena evolucijska cjelina. tzv. GOLGIJEV APARAT. Jaja. Dišu samo plućima. Za sakupljanje gljiva potrebno ih je pojedinačno dobro poznavati jer među njima ima i smrtno otrovnih. Neki od mjehurića ostaju u citoplazmi kao tjelešca za razgradnju. velika i raznolika skupina heterotrofnih eukariotskih organizama. S krajeva tih kanalića odvajaju se mjehurići čiji je sadržaj najčešće proteinske prirode. algašice. Gmazovi na rašljastom jeziku imaju više osjetila (za miris. Sastavljeno je od niza uskih i plosnatih kanalića koji su omeđeni membranama i poredani koncentrično. gdje ih grije sunce. Većina mjehurića spaja se sa staničnom membranom i oslobađa svoj sadržaj procesom egzocitoze. pretilost. Tijelo gljiva nazivamo micelij koji je sastavljen od isprepletenih niti ili hifa. u razmnožavanju postoji jasna izmjena generacija. kornjače. njuh i sluh. Osobine slične biljnima su: micelij je sličan steljci nižih biljaka i nerazlučen u tkiva. kemijski spoj iz skupine aminokiselina. treći bubreg). GOLGI. zaštićena su ljuskom i sadržavaju žumanjak potreban za razvitak embrija. U jajovodu se oko oplođenog jaja stvara čvrsta ovojnica. v. GMAZOVI (Reptilia). čiji je vanjski sloj izgrađen od sive moždane tvari. Saprofiti su ili paraziti. v. zelena pupavka (Amanita phalloides) koja izaziva najviše trovanja oštećujući jetru i koštanu srž.-1926. Jaja polažu u zemlju ili pijesak. Za izlučivanje služe pravi bubrezi (v. Oplodnja je unutarnja. razvio metodu bojanja živaca i potkraj 19. kemijski spoj iz skupine aminokiselina. Oči imaju pokretljive očne kapke i prozirnu migavicu. Po njemu su te strukture dobile ime Golgijevo tijelo. Danas živi oko 6000 vrsta koje su podijeljene u skupine: premosnici. GOLGIJEVO TIJELO (Golgijev aparat). Posebno je dobro razvijen u žljezdanim stanicama.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ GLUTAMIN. Golgijevo tijelo. hranu uzimaju vanjskom površinom. mješinarke i stapčarke. kod zmija koje nemaju bubnjić). Uzrok je nedovoljna količina kisika zbog malog broja eritrocita i male dišne površine u plućima. Mokraćovodi ulaze u nečisnicu. pričuvna hrana je glikogen. Žive u tropskim i suptropskim krajevima jer toplinu tijela održavaju sunčanjem.). Ispred srca je venski zaton (proširenje vene). koja legu na kopnu. katkad i neke masti – nikada škrob. Oni sadrže enzime koji mogu 50 . amniota). neke niže gljive imaju celuloznu staničnu stijenku. npr. GLJIVE (Fungi). (1844.st. Neki gmazovi kote žive mlade. Osobine slične životinjskima su: stijenka hifa u većine gljiva je od hitina. DNK je sličnija životinjskoj nego biljnoj.

D. GTH potiču gonade na lučenje spolnih hormona i gametogenezu. luteinizirajući hormon (LH) i luteotropni hormon (LTH). a kada sazrije. (1859. v. mikrospore).. i GRENDEL. koji je otkrio.. GRAAFOV FOLIKUL (Graafov mjehurić). npr.). žlijezdama slinovnicama vinske mušice. Oprašuju se vjetrom. U njemu sazrijeva jajna stanica. Muški gametofit s dvije muške gamete razvija se unutar polenovog ili peludnog zrna (muške spore. U kralježnjaka muške spolne žlijezde su sjemenici (testisi). GORJANOVIĆ-KRAMBERGER. zajednički naziv za skupinu hormona koje izlučuje prednji režanj hipofize (adenohipofiza). 20. Ženski gametofit (embrionska vreća) ne napušta sjemeni zametak. nukleinske kiseline i lipide. Simptomi bolesti su peckanje u mokraćovodu i gnojni iscjedak za vrijeme i nakon mokrenja. F. Sjemeni zameci. evolucijski starija i primitivnija skupina sjemenjača. GRAAFOV MJEHURIĆ. Graafov folikul puca i zrela se jajna stanica zajedno s tekućinom mjehurića izbacuje u trbušnu šupljinu od kuda dospijeva u jajovod. obradio i objasnio fosilne ostatke Krapinskog pračovjeka.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE razgrađivati proteine. politeni kromosomi). veliki kromosomi dužine nekoliko stotina μm (neki i 1000 μm) i promjera oko 50 μm.-1936. E. Nakon ovulacije (sazrijevanja jajašca) sadržaj Graafovog folikula se mijenja te se od njega razvije žuto tijelo (corpus luteum). v. U muškaraca i žena adenohipofiza izlučuje tri gonadotropna hormona: folikul-stimulirajući hormon (FSH). hortikulturi. Golemi su u usporedbi s tipičnim kromosomima veličine samo nekoliko μm. tartufi. farmaciji. drvenaste biljke (stabla ili grmovi). GOROSTASNI KROMOSOMI (gigantski kromosomi. mjehurić koji se stvara u jajnicima sisavaca oko jajne stanice. a ženske jajnici (ovariji). nizozemski biokemičari koji su 20-ih god. Među danas živućim golosjemenjačama razvojno su najprimitivnije ginko i cikas koji se oplođuju pomoću pokretnih muških gameta. GONADE. spolna zarazna bolest čovjeka čiji je uzročnik bakterija gonokok. a ako ne dođe do oplodnje i bijelo tijelo (corpus albicans). Nastaju višestrukom replikacijom kromosomskih niti sastavljenih od DNA i proteina. a mogu se naći u nekim tkivima kukaca. GORTER. Gametofit je jako reduciran i prehrambeno ovisan o matičnoj biljci. Golosjemenjače su značajne: u izgradnji biljnog pokrova sjeverne polutke. zajednički naziv za muške i ženske spolne žlijezde u viših životinja. Golosjemenjače su se razvile od predaka današnjih papratnjača. Graafov folikul. a kasnije i sjemenke nalaze se bez zaštitnog pokrova “goli” na sjemenim (plodnim) ljuskama ili listovima. Obavijen je stanicama i ispunjen tekućinom. Neliječena gonoreja uzrokuje oštećenja srca i zglobova. v. u građevinarstvu. Dijele se na nekoliko skupina od kojih su najzastupljenije četinjače. 51 . pa se unutar njega razvija i embrio mlade biljke. Izmjena generacija (gametofita i sporofita) je pravilna. hrvatski geolog. stoljeća na temelju pokusa s eritrocitima utvrdili da fosfolipidi u biološkim membranama čine dvosloj. GONOREJA (kapavac). pteridosperme. GOLOSJEMENJAČE. GOMOLJAČE. GONADOTROPNI HORMONI (GTH). a često uzrokuje i neplodnost. paleozoolog i paleoantropolog. Među izumrlim golosjemenjačama nalaze se i predci kritosjemenjača.

eksperimentirao s bakterijama reda Pneumococcus i 1928. primjenjuje se približna procjena gustoće koja se izražava brojkama.. Za utvrđivanje gustoće populacije danas se primjenjuju različite metode. F. Hrana su im uglavnom kukci i male životinje. Najčešće skupine guštera su: macaklini. te alfa .3. predatori. na dan se proizvodi u količini od 500 do 1500 mL. viroza. novočeljuske. isp. U uhu je bubnjić. GRANULOPOEZA. siva i krška gušterica s mnogim endemičnim podvrstama na Jadranskim otocima. paučnjaci. jer probavni enzimi u crijevu djeluju na neutralnom odnosno na blago alkaličnom pH području.1 do 8. E. egzokrina i endokrina žlijezda. opća slabost i bolovi u mišićima. U unutarnjosti susrećemo zelembaće. GRIFFITH. v. GUTACIJA (lat. a broj 5 veoma brojnu vrstu. GRAM. tzv. glukoza. Sadržava vodu.stanica i beta – stanica Langerhansovih otočića koji luče hormone glukagon i inzulin (unutarnje lučenje). izražava se brojem jedinki neke vrste na nekom prostoru ili njihovom ukupnom masom u suhom ili svježem stanju (biomasom). god.-1938. a jedna od metoda je prebrojavanje ili vaganje jedinki skupljenih s prostora određene veličine. npr. v. gonadotropni hormoni. Tijelo im je pokriveno rožnatim ljuskama. v. Gušterača je smještena ispod želuca. GRENDEL. isp. H. od 1 do 5. Noge su im dobro razvijene.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ GRABLJIVCI. GRIPA (influenca). Većina ima tjemeno oko i pokretne očne kapke. te najstariji i najprimitivniji ljuskaši. primorska. Usta se mogu široko otvoriti. GRINJE. 52 . GUSTOĆA POPULACIJE. danski bakteriolog. najbrojnija skupina današnjih gmazova. gušterice i sljepići. samoamputacija. GREBENKE. hidrogen . Građena je od dvije vrste tkiva: žlijezdanog parenhima (acinusi) koji luči probavne enzime (vanjsko lučenje). isp. GUŠTERAČA (pancreas). Gorter. U slučajevima kada je prebrojavanje jedinki teško. v. To se zove samosakaćenje ili autotomija. krvotvorni organi. gutta = kapljica). Na lubanji imaju kvadratnu kost za koju se drži donja čeljust. GUŠTERAČIN SOK. Funkcija hidrogen karbonatnih iona je neutralizacija sadržaja himusa prispjelog iz želuca. (1853. a pH mu iznosi između 7. a koncentracija vlage zraka velika. v. GROŽĐANI ŠEĆER. U našoj zemlji poznate su npr. v. lepra. v. GUBA. GUŠTERI.. pri čemu broj 1 označuje veoma rijetku vrstu. zarazna bolest dišnih organa koju prati povišena temperatura. F. To je danas jedna od najčešćih bolesti koju uzrokuju virusi. kameleoni.). Kapljice vode izlaze kroz hidatode ili puči vodenice. v. Gripa može izazvati i upalu pluća. što omogućava gutanje većeg plijena. koji je otkrio Gram bojenje bakterija prema kojem se bakterije mogu podijeliti u dvije skupine: Gram-pozitivne i Gram-negativne bakterije. sljepiće i blavore. GTH. pojava izlučivanja vode u obliku kapljica kod nekih biljaka. dokazao mogućnost pretvorbe jednog tipa bakterije (bez sluzavog omotača) u drugi tip (sa sluzavim omotačem).kahrbonatne ione i različite probavne enzime. Pojavljuje se kada je transpiracija vrlo slaba. Mnogi gušteri mogu u slučaju opasnosti otkinuti rep.

odnosno oplodnje. Ovakav broj kromosoma rezultat je mejoze. Razvili su različite prilagodbe koje im omogućuju preživljavanje kao. – 1919. (1834. sporofit (nespolna generacija) koji je diploidan i proizvodi spore. HALOFITI (biljke slanih staništa) biljke koje žive na tlu u kojem je prisutna veća količina soli.. O H H2N N C C N C C N H N C H H HADŽI. opojnim drogama ili dr. HALUCINACIJE.). koje žive na drugim biljkama. tj. diploidan broj kromosoma i on iznosi 46 (2n=46). Nakon stapanja gameta. tj. dvije duge prekrižene vrpce koje služe pri raznošenju spora vjetrom. v. v. hemoglobin. gametama i označuje se s n. HAUSTORIJ. Nakon oplodnje novonastala zigota sadrži potpun. Haptere se smotaju ako se spora spusti na vlažno i pogodno tlo. v. najčešće natrijevog klorida. HAPLOIDAN BROJ KROMOSOMA. Spore se razvijaju u spolnu generaciju koja ponovo proizvodi gamete. uspostavlja se ponovo diploidan broj kromosoma. izlučivanje soli pomoću žlijezda (kod vrste Avicennia). posebne sisaljke kojima se parazitske i poluparazitske biljke. J. E. nja središnjeg živčanog sustava alkoholom. HADŽIJEVA HIPOTEZA POSTANKA METAZOA. HAPLOIDNA GENERACIJA.. U muškaraca haploidan broj kromosoma imaju spermiji. opažanja koja nastaju bez podraživanja osjetila. pokusima na jednostaničnoj algi roda Acetabularia dokazao da jezgra određuje građu i oblik alge. Pojavljuju se u umno poremećenih osoba ili zbog otrova- 53 . eritrociti. eritrociti..). Hb. kod preslica. HAECKELOVA HIPOTEZA POSTANKA METAZOA. Ona se razvija u biljku. Uveo naziv “ekologija”. HbA. njemački biolog koji je 1866. a u žena jajna stanica i on iznosi 23 (n=23). npr. v. spolna generacija. HAPTERE. pričvršćuju u tkivo domodara i sišu hranjive tvari. Stapanjem muške i ženske gamete nastaje zigota. hipoteze o postanku mnogostaničnih životinja. specifičnog oblika diobe stanice pri kojoj nastaju gamete. predložio naziv protisti za jednostanične organizme. tvorac plazmodijalne teorije postanka višestaničnih životinja (metazoa). zoolog. organski spoj s dušikom iz skupine purinskih baza.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE GVANIN. Sudjeluje u izgradnji nukleotida odnosno nukleinskih kiselina. a broj kromosoma se od početnog broja smanjuje na polovicu. hipoteze o postanku mnogostaničnih životinja. HbF. god. polovičan broj kromosoma koji se nalazi u spolnim rasplodnim stanicama. v. HAMMERLING. J. prizvodi gamete ili spolne rasplodne stanice u biljaka pa se zove gametofit (isp. HAECKEL.

granulocitni red). biljna vrsta koja živi na drugoj biljci ali sadrži klorofil i može fotosintezom sintetizirati ugljikohidrate. jednostavni šećeri ili monosaharidi koji sadrže šest ugljikovih atoma u svojoj molekuli. HELICERE. To je krvni ili dišni pigment kod mekušaca te služi za vezanje i prijenos kisika. HEMATOPOETSKI REDOVI STANICA. imela). Te matične (pluripotentne) stanice mogu se diferencirati u usmjerene krvotvorne stanice (eritrocitne. limfatični red. HEMOCIJANIN. eritrocita. krvotvorni organi. Najvažniji je dio crvenih krvnih stanica. organizmi koji imaju samo jedan alel za jedno svojstvo. limfocitne. razvojni slijed. ali umjesto željeza sadrži bakar. kliješta na prednjem tijelu (uz usta) kod klještara. Kod nekih su povezana s otrovnom žlijezdom kojom usmrćuju plijen. Daljnji tijek diferencijacije je različit za pojedine redove stanica (eritrocitni red. stanice koje čine jedan morfološki. trombocitne i granulocitne). Sudjeluje u izmjeni plinova (kisika i ugljikovog dioksida) u tijelu. HEMOGLOBIN (Hb). a vrlo mala količina kisika se prenosi otopljena u krvnoj plazmi. a prenose je žene. Najčešće nedostaje antihemofilijski globulin -faktor VIII. Zbog stvaranja veće količine bilirubina javlja se i žutica. odnosno krvi. a kasnije se odvija u ostalim hematopoetskim tkivima i organima. HEMIPARAZIT (grč. v. v. volumni udio krvnih stanica i trombocita u krvi.45). plazmatske. HEMATOKRIT. HEMISESILNI ORGANIZMI. Hematopoeza počinje već prvih tjedana zametnog razvoja u žumanjčanoj vrećici. trombocitni red. krvni pigment koji daje crvenu boju eritrocitima. plazmatski red. nasljedna bolest koja se očituje u nesposobnosti zgrušavanja krvi. stvaranje krvnih stanica. kemijski spoj sličan hemoglobinu. fruktoza i galaktoza. Određuje se centrifugiranjem krvi u tankoj baždarnoj kapilari. hemisis = polovica. HEMIZIGOTI. HEMATOPOETSKI ORGANI. Sastoji se od međusobno vezanih bjelančevine globina i organometalnog spoja hema. bolest koja se javlja kada se eritrociti raspadaju brže nego što se stvaraju. poluparazit. monocitni red. Gen koji je odgovoran za nastanak ove bolesti nalazi se u spolnom x kromosomu. Služe za hvatanje plijena i obranu. Heksoze su glukoza. 54 . pojava eritrocita u mokraći kod nekih bubrežnih bolesti. eritrociti do 120 dana a neke vrste leukocita nekoliko dana do oko 100 dana. Hematokrit zdrave osobe je 45 % (indeks 0. monocitne. HEMOLITIČKA ANEMIJA. HEMATOPOEZA. Odlikuje se nedostatkom jednog od brojnih kemijskih tvari nužnih u procesu zgrušavanja krvi. Nakon difuzije u krv. a mineralne tvari i vodu crpi iz ksilema domadara u koji prodire pomoću sisulja. bentos. Pigment hem se sastoji od protoporfirinskog dijela i iona željeza za koji se veže kisik. Oboljevaju uglavnom muškarci. glavnina se kisika veže na hemoglobin eritrocita. HEMATURIJA. Krvne stanice žive u opticaju krvi ograničeno dugo: npr. haustorija (npr. Osnovne matične krvotvorne stanice nalaze se u koštanoj moždini i mogu se neograničeno reproducirati. parasiteo = jedem zajedno s nekim). HEMOFILIJA.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ HEKSOZE.

v. HIDATODE. krocanj). virusna bolest koja obično uzrokuje promjene na koži u obliku mjehurića. heterotrofi. U heterotrofe se ubrajaju sve životinje i čovjek. pojedini polipi u zadruzi kod žarnjaka. amini itd. HERMAFRODIT. šuljevi. HETEROZIGOTNI ORGANIZMI v. HIBERNACIJA .). v. HIDROFILNOST. lipaze koje kataliziraju hidrolizu lipida na glicerol i masne kiseline. HIDROFILNE TVARI. svojstvo odbijanja vode. gušteračin sok. Neke su posve u vodi (vodena kuga. Primjerice. HEMOROIDI v. v. drugi naziv za biljojede.). HERBIVORI. (A). v. zimski san. HIBRIDIZACIJA. a najčešći je herpes febrilis koji se manifestira na usnama i okolnoj koži. HIDROFITI. Hidrolazama pripadaju proteaze koje proteine razgrađuju na peptide i aminokiseline. HERPES. v. alkoholi. žlijezde za izlučivanje vode procesom gutacije kod nekih biljaka. v. skupina enzima koji sudjeluju u razgradnji različitih molekula u manje sastavne dijelove uz ugradnju molekule vode. lopoč). biljke koje žive u vodenim ekosustavima. v. ali ipak u sebi nosi i prikriveni recesivni gen (a). križanci. HETEROTROFNI ORGANIZMI. ispod puči vodenica. hibridi). Hidrofobne su neke nepolarne molekule (različiti ugljikovodici itd. hidrolitički enzimi. Nalaze se na rubovima listova. HIDROGEN KARBONATNI IONI. križanje. već ih moraju uzimati hranom. heterozigoti. HIDROFOBNOST. v. dvospolac. esteraze koje pospješuju hidrolizu estera na njihove alkohole i kiseline te nukleaze koje ubrzava- HETEROZIGOTI (heterozigotni organizmi. HETEROTROFI (heterotrofni organizmi). heterozigot Aa u svojem vanjskom izrazu (fenotipu) nosi izgled dominantnog gena 55 . v. v. Aa (heterozigot za jedno svojstvo.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE HEMOLITIČKA BOLEST NOVOROĐENČADI. Hidrofilne su neke molekule koje se odlikuju polarnošću (kiseline. a drugima samo cvjetovi i neki listovi plivaju površinom ili se izdižu iznad nje (lokvanj. v. HEMOLIZA. Postoji nekoliko različitih tipova herpesa. U opisima primjera križanja heterozigoti se označuju npr. dihibridno križanje s dominacijom). raspadanje eritrocita. organizmi koji nemaju sposobnost stvarati vlastite organske spojeve. fetalna eritroblastoza. HERBICIDI. HIDRANTI. monohibridno križanje s dominacijom) ili a1a2 (heterozigot za jedno svojsvo. kemijska sredstva za uništenje korovnih biljaka. HENLEOVA PETLJA. HIDROLITIČKI ENZIMI (hidrolaze). a od biljaka heterotrofne bakterije i gljive. svojstvo privlačenja vode. organizmi koji nose različite alele za neko svojstvo jer su nastali spajanjem gameta koje su bile različite za dotično svojstvo. nefron. v. dihibridno križanje s dominacijom) ili AaBB (heterozigot za jedno od dva svojstva. HIBRID. HIDROLAZE. hidrofilnost. hemolitička anemija i transfuzijska reakcija. križanac. monohibridno intermedijarno križanje) ili AaBb (heterozigot za oba svojstva. obrubnjaci.

posebni stanični organeli.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ ju razgradnju nukleinskih kiselina i oslobađanje nukleotida. jedna od najvažnijih žlijezda s unutarnjim izlučivanjem. Npr. Zemljina vodena ovojnica. HIMENIJ. filos = prijatelj). stanje snižene razine šećera glukoze u krvi. oboljenje krvnih žila. v. a veličine je zrna graška. vodozemci. biljke koje žive u vlažnim šumama i livadama. HIDROSFERA. HIJAZMA. hipertenzija. HIFE. HIPERTENZIJA (hipertonija). v. hygros = vlažan. koja remeti tjelesni metabolizam. HIPERTONIČNA OTOPINA je otopina koja ima veću koncentraciju otopljenih tvari od normalne. životinje koje mogu živjeti samo u izrazito vlažnoj atmosferi ili u vlažnom tlu. puževi golaći i gujavice. guša (gušavost). ako živu stanicu stavimo u hipertoničnu otopinu voda će osmozom izlaziti iz nje. Povećani su frekvencija disanja i rad srca. stanje povišenog krvnog tlaka koje najčešće prati aterosklerozu. tj. HIPOFIZA. tanka opna u predvorju rodnice. HIPERPARATIREODIZAM. HIGROFILNE ŽIVOTINJE (grč. lizosomi obiluju tim enzimima. želudac. srednji režanj (pars intermedia) i stražnji režanj (neurohipofiza). Suprotno od hipoglikemije je hiperglikemija ili stanje povišene koncentracije glukoze u krvi. HIPOGLIKEMIJA. HIPERTONIČAN. on raste s koncentracijom otopljene tvari). v. Higrofiti često imaju velike listove s tankom epidermom i mnogim pučima. vode tekućice i stajaćice. Građena je od tri režnja: prednji režanj (adenohipofiza). nitaste tvorevine koje izgrađuju micelij.5 mmol/L. hygros = vlažan. neki šaševi i žabnjaci. v. manjih ili većih otvora kroz koje može istjecati menstruacijska krv. U nekih osoba se može pojaviti oteklina na vratu. HIGROFITI (grč. HIDROTAKSIJA. HIPERTONIJA. pretjerana aktivnost štitnjače. stanje povišene razine glukoze u krvi. a povećan promet kalcija kroz bubrege može uzrokovati pojavu bubrežnih kamenaca. taksija. Nalazi se na bazi mozga. U stanici. Dolazi do prekomjernog lučenja hormona tiroksina koji povećava bazalni metabolizam. koje postaju krhke i lako lomljive. mjesto “prekopčavanja” dijelova pojedinih kromatida homolognih kromosoma u crossing overu. Normalna koncentracija glukoze u krvi (GUK) iznosi oko 5. 56 . kao npr. HIPERGLIKEMIJA. onaj koji ima veći potencijalni osmotski tlak (π*. mora i oceani. Izlučuje veliki broj hormona od kojih neki utječu na izlučivanje hormona ostalih žlijezda s unutarnjim izlučivanjem. Kalcij se gubi iz kostiju. HIMEN (djevičanski zalistak). Dolazi do povećane razine kalcija u krvi. tjelesna tekućina može biti hipertonična gubitkom dijela (otapala) vode ili unošenjem u tijelo većih količina otopljenih tvari. Na primjer. fyton = biljka). HIPERTIREOZA. mješinarke. Svi probavni enzimi su hidrolaze. HIMUS. metabolički poremećaj zbog prekomjerna lučenja paratireoidnog hormaona (parathormona). kao npr. tj veći potencijalni osmotski tlak od normalnog. Može sadržavati jedan ili više. Ako živu stanicu stavimo u hipertoničnu otopinu voda će osmozom izlaziti iz nje. vegetativno tijelo gljiva.

Na primjer. HISTIDIN. svrbež i otežano disanje. stanice su se specijalizirale za različite zadaće: hranjenje. otežani su disanje i rad srca uz slab razvitak koštanog tkiva i zuba. HIPOTALAMUS. HIPOTONIČAN. termoregulaciji. v. nedostatak vitamina u organizmu koji može izazvati različite poremećaje. onaj koji ima manji potencijalni osmotski tlak (π*). razmnožavanje. Haeckelu mnogostaničari su se razvili iz zadružnih kolonijalnih prabičaša od nekoliko tisuća bičastih združenih stanica (kolonijalna teorija). S vremenom su se pojedine jezgre okružile s nešto citoplazme. tkivni hormon. slične primitivnim virnjacima i razvile su se iz mnogojezgrenih trepetljikavih oblika praživotinja. jedna od etapa embrionalnog razvitka većine višestaničnih životinja u kojoj se formiraju tkiva. a središnji sloj hranidbenu zadaću. mrlje. hipotenzija. HIPOTEZE O POSTANKU MNOGOSTANIČNIH ŽIVOTINJA U suvremenoj filogeniji iskristalizirale su se dvije hipoteze o postanku mnogostaničnih životinja (metazoa). Može uzrokovati endemsku gušavost ili kretenizam. gubitkom mineralnih tvari ili uzimanjem hrane s premalo (otpljenih) mineralnih tvari. srpasta anemija). HISTAMIN. npr. Hipotireoza se javlja zbog nedostatka joda u hrani ili vodi za piće. Dolazi do smanjenja razine kalcija u krvi. javljaju se grčevi mišića. Prvobitne su metazoe bile zrakasto simetrični oblici. HIPOTENZIJA (hipotonija). Ako živu stanicu stavimo u hipotoničnu otopinu voda će osmozom ulaziti u nju. produkt stanica imunološkog sustava za vrijeme alergijske reakcije. kemijski spoj iz skupine aminokiselina. Na primjer. npr.j. slične današnjim žarnjacima. zaštita. crvenilo. tj manji potencijalni osmotski tlak od normalnog. ako živu stanicu stavimo u hipotoničnu otopinu voda će osmozom ulaziti u nju. Npr. zaštitnu i osjetilnu. HIPOTONIČNA OTOPINA je otopina koja ima manju koncentraciju otopljenih tvari od normalne.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE HIPOPARATIREODIZAM. obavile staničnom membranom i preuzimale različite funkcije: površinski sloj stanica pokrovnu. Dolazilo je do više mitotskih dioba jezgara bez podjele tijela praživotinje. smanjeno lučenje parathormona. tjelesna tekućina može biti hipotonična razrjeđenjem većim količinama vode. U njemu se stvaraju i različite tvari koje reguliraju rad hipofize. stanje sniženog krvnog tlaka. a nedostatak vitamina D poremećaj u metabolizmu kalcija koji dovodi do rahitisa. u hipotalamusu se stvaraju faktori za oslobađanje gonadotropnih hormona koji dolaze u hipofizu i potiču je na lučenje gonadotropnih hormona. Unutar takve zadruge postojala je podjela rada. nedostatak vitamina B kompleksa uzrokuje različite metaboličke bolesti i promjene (dermatitis. HISTOGENEZA. Prema E. Prema J. nedostatak vitamina A uzrokuje noćnu sljepoću. Teorija se naziva i plazmodijalna jer se masa citoplazme s mnogo jezgara obično zove plazmodij. Histamin izaziva simptome kao što je prekomjerno izlučivanje sluzi. sastavni dio međumozga koji ima važnu ulogu u regulaciji različitih vegetativnih funkcija organizma. 57 . t. HIPOTONIJA. HIPOTIREOZA. HIPOVITAMINOZA. nedostatak vitamina C uzrokuje skorbut. biogeni amin. Hadžiju prve mnogostanične životinje bile su bilateralno simetrične i pokretne. promjene na koži. stanje smanjenog lučenja tiroksina.

spužve. znanost o biljnim i životinjskim tkivima. a funkcija im može biti različita. HITIN. kod spužve bičaste stanice koje okružuju spongocel. HOMO ERECTUS (uspravni pračovjek). a drugi član od oca. unutarnji nosni otvori kod nosnoprolaznica. aleli. glavni sastojak oklopa člankonožaca i stijenki hifa u većine gljiva. nego sve hranjive tvari crpi od domadara (npr. HOLOPARAZIT (grč. vrsta kojoj pripadaju današnji ljudi. riječ). oni su posve jedinstveno građeni. gotovo uspravan hod i upotrebljavala su dobro isklesano oruđe i vatru. isp. v. kromosomi koji su po vanjskim osobinama međusobno slični. v. Kod biljaka su bodlja kaktusa i list neke druge biljke istog podrijetla. s AA (dominantan homozigot. parasiteo = jedem zajedno s nekim). monohibridno 58 . HOMOLOGNI KROMOSOMI. Smatra se da su i neandertalski i krapinski pračovjek izumrle rase ove vrste. Bića koja su pripadala ovoj vrsti imala su volumen mozga oko 1000 cm3. organizmi koji su u stanju održavati stalnu tjelesnu temperaturu neovisno o vanjskim ili unutarnjim čimbenicima. Iako su naizgled vrlo različiti. U probavnim mjehurićima bičastih stanica hrana se djelomično ili potpuno probavi. HIV (Human Immunodeficiency Virus). AIDS. dodatak 5. organi u raznih skupina organizama koji imaju isto evolucijsko podrijetlo. holos = potpun. organizmi koji nose iste alele za neko svojstvo jer su gamete iz kojih su ti organizmi nastali sadržavale iste alele za dotično svojstvo. a gotovo se nije razlikovao od današnjeg čovjeka. polimer glukozamina. homoios = isti. U tjelesnim stanicama čovjeka nalazi se 46 kromosoma od kojih su 22 para autosoma (kromosomi koji ne određuju spol) i 1 par spolnih kromosoma tipa xx (u žena) ili xy (u muškaraca). logos = govor. odnosno kromosome. HISTONI. potpuni parazit. volovod i potajnica). U opisima primjera križanja homozigote označujemo npr. isp. v. isp. HOANE (choane). skupina bjelančevina bazične naravi koje vezane s DNA i nekim drugim bjelančevinama izgrađuju kromatin. U svim tjelesnim stanicama onih organizama koji su nastali oplodnjom od dvaju roditelja. HOMOLOGNI ORGANI (grč. Starost nalaza ove vrste je između 300 tisuća i 2 milijuna godina. nepromijenjenih optimalnih životnih uvjeta u tijelu. noga vodozemca. homologni kromosomi dolaze u parovima gdje jedan član svakog para potječe od majke.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ HISTOLOGIJA. HOMEOSTAZA je održavanje stalnih. Homeotermni organizmi su ptice i sisavci. HOMO SAPIENS (umni čovjek). npr. HOMOLOGNI GENI. Hoanociti stvaraju struju vode iz koje uzimaju hranu i kisik. HOANOCITI. biljna vrsta koja živi parazitski na drugoj biljci i ne sadrži klorofil te ne može stvarati organske spojeve fotosintezom. Ovoj vrsti pripada i kromanjonski ili fosilni čovjek koji je živio prije 30 do 40 tisuća godina. vilina kosa. Najpoznatiji nalazi ove vrste su javanski pračovjek ili pitekantropus s otoka Jave i kineski pračovjek ili sinantropus iz blizine Pekinga u Kini. HOMEOTERMNI ORGANIZMI. vrsta iz roda Homo (čovjek) s vidljivim ljudskim obilježjima. ruka čovjeka i krilo šišmiša. HOMOZIGOTI (homozigotni organizmi).

hrskavično tkivo. HORMONI (grč. djeluje na sve stanice tijela i stimulira u njima anabolitičke reakcije (reakcije sinteze). Primjer hranidbenog lanca jezera: planktonska alga. kao i ukupna energija. HRSKAVIČNJAČE.) sa hrskavičnim kosturom. v. v. HONDROKLAST. IV. v. svitak. AABB (dominantan homozigot za oba svojsva. v. hrskavično tkivo. isp. član. kemijske tvari koje u krv luče žlijezde s unutarnjim izlučivanjem ili endokrine žlijezde. a nalazimo je i u vanjskom uhu. Na primjer. morske ribe (isp. član. čija brojnost mora biti manja. HOOKE. HONDROBLAST. Građena je od hrskavičnog tkiva. član. v. proizvođač → planktonski račić. potrošač-mesojed 2 → ptica kormoran. monohibridno križanje s dominacijom). U svakom hranidbenom lancu svaki prethodni član mesojed je manji od slijedećeg člana u lancu. STH). homozigoti. hormao . (1635. Također.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE križanje s dominacijom) ili s aa (recesivan homozigot. engleski mikroskopičar koji je prvi spomenuo stanicu 1665. grkljanu i dušniku. Hrskavično se tkivo umnožava djelovanjem stanica hondroblasta. On je pod svojim jednostavnim mikroskopom promatrao tanke prereze pluta i ugledao strukturu poput pčelinjeg saća te njezine sastavne dijelove nazvao stanicama. V. HORMON STIMULACIJE INTERSTICIJSKIH STANICA. HRANIDBENI LANAC. v. isp. HRANJIVE PODLOGE. HOMOZIGOTNI ORGANIZMI. – 1703. HORMON STIMULACIJE FOLIKULA. a razara s pomoću hondroklasta. FSH. Po kemijskom sastavu djelimo ih na bjelančevinaste i steroidne hormone. Kod nasljeđivanja dominantnih i recesivnih obilježja recesivni gen može doći do izražaja samo u slučaju homozigotnosti (aa) jer ga onda ne nadjačava njegov dominantni alel. Tako je i ukupna biomasa svakog idućeg člana hranidbenog lanca sve manja. god. dihibridno križanje s dominacijom) i sl. HORMON RASTA (somatotropni hormon. Dolazi u zglobovima i na mjestima gdje se kosti povezuju međusobno. a samim tim i rast organizma.potičem). član. potrošač-mesojed 3.). Nakon njih dolaze mnogobrojne serije potrošača (konzumenata). najpoznatija hranjiva podloga za uzgoj bakterija je agar. dihibridno križanje s dominacijom) ili AABb (dominantan homozigot za samo jedno od dva svojstva. Različite oblike hranidbenih lanaca susrećemo u svakoj biocenozi. podloge koje sadrže sve potrebne tvari za uzgoj i razvitak stanica. mekši dio kostura. vrhu nosa. lanac čiji su članovi povezani odnosima ishrane. I. član. Koristimo također oznake a1a1 (intermedijarni homozigot. II. R. HRSKAVIČNO TKIVO. tvar koja se dobiva od nekih vrsta crvenih alga. hormon kojega luči prednji režanj hipofize (adenohipofiza). Na prvom mjestu hranidbenih lanaca redovito su autotrofni proizvođači. HRSKAVICA. ICSH. U hrskavičnoj 59 . svaki prethodni član u lancu svojom brojnošću osigurava opstanak slijedećem članu. potrošač-biljojed → riba ukljeva. potrošač-mesojed 1 → riba pastrva. III. monohibridno intermedijarno križanje). sastoji se od hrskavičnih stanica povezanih elastinom i hijalinom. Većinom je završni član veličinom tijela najkrupniji. HORDA. tkiva i organizama u laboratorijskim uvjetima.

Na pojavi imune memorije temelji se zaštita od različitih bolesti aktivnom. a čija je uloga da kao antitijela štite orga- I ICSH (engl. raže i drhtulje. Razlikujemo dva osnovna tipa imuniteta: prirođeni (nespecifični) i stečeni (specifični) imunitet. postupak kojim organizam na umjetni način stječe imunitet. a neki su morski psi i živorodni. limfni čvorovi. Nemaju plivaći mjehur. proces “ukopavanja” jajne stanice u sluznicu maternice koji se događa nakon oplodnje u 60 . ali i u drugim organima. tanko crijevo. morske mačke. γ-globulini). v. ili pasivnom imunizacijom. IKRICA. a pasivna najčešće ubrizgavanjem protutijela proizvedenih u nekoj drugoj jedinki. timus). IMUNITET. otpornost organizma prema različitim uzročnicima bolesti kao i prema svim organizmu stranim tvarima. Taj je poremećaj uzrokovan najčešće bolešću pojedinih organa imunohematopoetskog sustava (koštana srž. IMPLANTACIJA JAJAŠCA. Oplodnja je unutarnja. začahurene ličinke trakavice. Taj tip imunološke reakcije nazivamo sekundarnom reakcijom.stanice jer se one duže zadržavaju u organizmu. limfociti B.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ kralježnici imaju i svitak. sisavaca. U žena se taj proces zbiva 7. Ikrica se razvija u mišićima. jedan od tri gonadotropna hormona koje izlučuje prednji režanj hipofize. poput mjehurića i veličine oko 1 cm. za razliku od primarne reakcije koja nastaje pri prvom ulasku antigena u organizam. Najpoznatije hrskavičnjače su morski psi. v. Nositelji imune memorije su plazma . Prirođeni imunitet postoji od samog rođenja i štiti organizam od svih antigena. zavojiti zalistak. IMUNIZACIJA. oblik stečene imunosti u kojoj organizam nakon podražaja antigenom stvara cirkulirujuća protutijela. Najbrojnija skupina su prečnouste. Usta su im s donje strane glave položena poprečno na uzdužnu os. nesposobnost organizma da se brani od infekcije zbog nedostatne funkcionalne sposobnosti imunološkog susutava. dana nakon oplodnje. proces pri kojem se u opetovanoj zarazi javlja brža i burnija reakcija protiv tog istog antigena. IMUNODEFICIJENCIJA (imunoinkompetencija). IMUNA MEMORIJA (imunološko pamćenje). hormon za stimulaciju intersticijskih stanica). Morske mačke i psi legu jaja. proteini koji se nalaze u krvnoj plazmi. Interstitial Cell Stimulating Hormone. i 8. Može biti prirođena ili stečena (AIDS) imunodeficijencija. Tanko crijevo ima nabor. ICSH u muškaraca isto je što i LH u žena. v. U ikrici nespolnim razmnožavanjem nastane mnogo nepotpuno razvijenih mladih trakavica. kojim se povećava površina za uzimanje hrane. Mužjakove podrepne peraje služe za parenje. imunoglobulin. Koža im je prekrivena romboidnim ljuskama sa zubićima (plakoidne ljuske). Stečeni imunitet stječe se tijekom života prema točno određenim antigenima kada oni dospiju u organizam. HUMORALNA IMUNOST. ILEUM. Ig. Aktivna imunizacija postiže se cijepljenjem. Djeluje na intersticijske stanice sjemenika koje izlučuju spolne hormone. IMUNOGLOBULINI (Ig. Dišu preko škržnih pukotina na površini tijela.

Dijelimo je na tri faze: G1. slezena i limni čvorovi. INKRUSTACIJA (lat. U G0-fazi su stanice koje se ne dijele. pesticidi). Otkriveno je da su glavnu ulogu u povećanju postotka tamnih leptira imale mutacije i predatori. otrovi koji dovode do slabljenja imunološke reakcije na različite mikrobe (npr. kemijska sredstva protiv kukaca nametnika i štetnika. INFLUENCA. gripa. INSEKTICIDI. koštana moždina. proces fosilizacije pri kojemu se na površini organizama istaloži mineralna tvar i tako sačuva vanjski oblik organizma. razdoblje u životu stanice između dviju jezgrinih dioba. S. IMUNOSNI (imunološki) SUSTAV. IMUNOLOŠKO PAMĆENJE. G2 i G0. te stanice u funkciji obrane tijela od infekcije: fagociti (mikrofagi i makrofagi) i limfociti. IgE. U njemu se stvara osnovni ritam disanja. Traje najdulje. Nastaju u plazma – stanicama. imunoglobulina. lijekovi. IMUNOTOKSIČNI OTROVI. to su slezena. mutacije. Poznato je pet vrsta imunoglobulina: IgA. imunološki specifični odgovor organizma nakon ulaska antigena . IgD. gap = prekid. Čine ga imunosna tkiva i organi: timus. INFARKT SRČANI. leptira brezove grbe) u industrijskim područjima. oplodnja jajne stanice u laboratorijskim uvjetima izvan tijela žene. tromboza i ateroskleroza. IMUNOST. pa se brojnost tamnih oblika povećava. INDUSTRIJSKI MELANIZAM. a ostvaruje se slanjem spontano nastalih električnih impulsa do ošita i ostalih inspiracijskih mišića. v. Imunosna tkiva i organe djelimo na središnje (imaju prvu ulogu u proizvodnji i raseljavanju stanica značajnih za obranu tijela. S-faza (od engl. čeljusti i prvenstveno u lijevu ruku. v. vrsta prirodnog odabira gdje se povećava broj tamnih organizama (npr. IgG i IgM. Svijetle oblike leptira ptice lakše uočavaju na tamnoj podlozi i uzimaju ih za hranu. G2-faza je (najkraće) razdoblje kada se stanica priprema za diobu. synthesis = sinteza) karakterizirana je udvostručavanjem DNA što je osnova za udvostručenje svakog pojedinog kromosoma. INTERFAZA. imunitet. Glavni simptom srčanog infarkta je jaka bol u sredini prsnog koša koja se širi u područje vrata. imuna memorija. Sastoji se od prepoznavanja antigena i reakcije protiv tog istog antigena stvaranjem antitijela (protutijela) tj. U različitih vrsta stanica traje različito. to su timus i koštana moždina) i periferne (razvili su se pod kontrolom primarnih organa. stečena imunost. INDUCIRANE MUTACIJE. osigurava tijelu imunitet. crusta = kora). v. jaz) karakterizirana je sintetiziranjem RNA i bjelančevina u stanici što znači da stanica raste i da se njezin volumen povećava. G1-faza (od engl. nalazi se u produženoj moždini. INSPIRACIJSKO SREDIŠTE. odumiranje dijela srčanog mišića zbog neprokrvljenosti koja može nastupiti ako se smanji ili obustavi protok krvi kroz koronarne arterije. 61 . v. limfni čvorovi te limfatičko tkivo) organe. IMUNOLOŠKA REAKCIJA.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE nizam od zaraze. Primjenjuje se u liječenju bračne neplodnosti. Imunoglobulini se specifično vežu za stranu česticu (antigen) u antigen – protutijelo kompleks te tako učine antigene nedjelotvornim. v. v. IN VITRO FERTILIZACIJA (izvantjelesna oplodnja). in = u. već obavljaju određenu funkciju.

IZOLACIJA (tal. ograničenje izmjene gena između jedinki zasebnih populacija. IZVANSTANIČNA TEKUĆINA nalazi se u tijelu izvan stanica.. Međustanična tekućina čini najveći dio izvanstanične tekućine. paprati i preslica. IZOLEUCIN. stabljika s listovima u kopnenih biljaka. hormon kojega izlučuje gušterača. osobito u stanicama jetre i u mišićima. imaju endokrinu ulogu. IZOLACIJSKI MEHANIZMI. D. Ako živu stanicu stavimo u izotoničnu otopinu voda neće osmozom ni ulaziti u nju ni izlaziti iz nje. među populacijama ili dijelovima populacija raznih vrsta tako da se međusobno ne dodiruju (geografska ili prostorna izolacija) ili se ne miješaju zbog npr. međusobno jednake nespolne rasplodne stanice (spore). v. IZVANTJELESNA OPLODNJA. kromosomska promijena. specijalizirane stanice sjemenika koje leže između sjemenih kanalića. IZOTONIČNA OTOPINA je otopina koja ima isti osmotski tlak kao stanična tekućina. odnosno krvna plazma kada su koncentracije njihovih otopljenih tvari normalne.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ INTERFERONI. IZDANAK. etoloških ili spolnih (morfoloških. IVANOVSKI.J. INZULIN. isos = isti. INTERSTICIJSKE STANICE (Leydigove stanice). tj. 62 . ekoloških. IZOSPORE (grč. globulina i fibrinogena koje imaju značajnu ulogu u raznolikoj funkciji krvi. Izolacijski mehanizmi se dijele na vanjske ili mehanizme prije parenja i unutarnje ili mehanizme poslije parenja. INVERZIJA. bjelančevinaste tvari koje stvara imuni sustav. mehaničkih) izola- cijskih mehanizama. in vitro fertilizacija. Tako omogućuje oksidativnu razgradnju ili pospremanje glukoze u glikogen. Rezultat djelovanja inzulina je sniženje razine glukoze u krvi. tj. žućkasta tekućina koja se bitno ne razlikuje od međustanične tekućine osim što plazma sadrži veću količinu specifičnih bjelančevina albumina. natrijev kation (Na+) i kloridni ion (Cl–). god. One luče spolne hormone. Sprečavaju razmnožavanje virusa u organizmu. osamiti).4. prvi upozorio na postojanje virusa. obrnuti poredak gena jednog kromosomskog segmenta. isp. ruski znanstvenik koji je istražujući mozaičnu bolest duhana 1892. oko 13 litara. Glavni sastojci su voda. jednak). Na taj se način zaštićuje genetička cjelovitost vrste. a pomaže pri transportu glukoze iz krvi u stanice. Ljudska izvanstanična tekućina ima pH 7. mehanizmi očuvanja genoma pojedinih vrsta. Krvna plazma zajedno s krvnim stanicama čini punu krv. U ljudskom tijelu je ima oko 15 litara. hranjive se tvari probavljaju u probavnim vakuolama praživotinja. Izolacija predstavlja jednu od pokretačkih sila evolucije. tj. isolare = odijeliti. izmjena haploidne i diploidne generacije u biljaka. Smanjeno izlučivanje inzulina ili potpuni prestanak izlučivanja zbog oštećenja gušterače uzrokuje šećernu bolest (dijabetes). IZMJENA GENERACIJA. kemijski spoj iz skupine aminokiselina. Nalazimo ih kod npr. INTRACELULARNA (unutarstanična ) PROBAVA. odijeljenost među životnim skupinama biljaka ili životinja. Ostatak je krvna plazma.

Nervatura lista prugasta. nizozemski optičar koji je u 16. Z. kukuruz) i ljiljani (npr. v. Najčešće su porodice i njihovi predstavnici: trave (npr. Žile zatvorene. Nemaju sekundarni rast u debljinu. ali i neke stanične organele: lizosome i endoplazmatsku mrežicu. Iz žljezdanih se stanica luče sekreti koji hrane jajnu stanicu i zigotu te održavaju blagu lužnatost sredine.st. mitohondrije i kloroplaste. Ovalnog su oblika. v. Izgleda poput cijevi ili kanala. v. čvrste građe. otoku Javi. JEDNOSTAVNI ŠEĆERI. tulipan. JEDNOSUPNICE. JEDNOOTVORI. razred kritosjemenjača. progesteron). Bio je visine oko 145 cm s volumenom mozga do 900 cm3 i imao je gotovo uspravan hod. Nalazimo je i u biljaka i životinja. ugljikohidrati. JANSSEN. imaju i endokrinu ulogu odnosno lučenje ženskih spolnih hormona (estrogen. u odraslih žena veličine badema mase između 10 i 20 g. bez kambija. JEDNOSTRUKA MEMBRANA. Ime je dobio po svom nalazištu. U njemu se u normalnim uvjetima zbiva oplodnja jajne stanice. JEDNJAK. Progutana hrana putuje prema želucu. Žive u Australiji. Ocvijeće i prašnici većinom s 3 člana u krugu. JAJNA STANICA (jajašce. Najpoznatija je vrsta čudnovati kljunaš.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE J JAJAŠCE. postavivši dvije leće na određenu međusobnu udaljenost dobio povećanu sliku promatranih predmeta. Osim jednostruke membrane u eukariotskim stanicama se nalazi i dvostruka membrana koja obavija jezgru. dio ženskog spolnog sustava mnogih beskralježnjaka i svih kralježnjaka. Osim što se u njima odvija proces stvaranja ženskih spolnih stanica (oogeneza). jaje). Ocvijeće nerazlučeno u čašku i vijenčić. U žena. Građena je od proteina i lipida pa se naziva i lipoproteinska ovojnica. JAJE. tanka ovojnica (7-10 nm) koja obavija stanicu. tj. v. Embrio lateralno (postrance) smješten u sjemenci. između žila nema međusobno mrežasto povezanih žilica. JAJNICI (ovariji). U žena su to parni organi koji leže s lijeve i s desne strane trbušne šupljine. mišićna cijev između ždrijela i želuca. ženska spolna rasplodna stanica ili ženska gameta koja se redovito razlikuje od muške po tome što je veća i nepokretna.To su jedini sisavci koji nesu jaja i imaju nečisnicu koja se otvara van jednim otvorom (ime!). pšenica. Osobine jednosupnica Jedna supka u sjemenci. jajna stanica. JEDNODOMNE BILJKE. Iz mliječnih polja na trbuhu izlazi mlijeko koje mladi ližu. jajna stanica. razne vrste luka). Žile u stabljici nepravilno raspoređene. uzastopnim steza- 63 . JAJOVOD (tuba uterina). JAVANSKI PRAČOVJEK (pitekantropus). cvijet. jedan od izumrlih oblika čovjekovih predaka koji se danas ubraja u vrstu uspravnog pračovjeka (Homo erectus). U žena je to parni organ čija je uloga prihvaćanje jajne stanice iz trbušne šupljine i provođenje do maternice. ženski spolni organi ili žlijezde višestaničnih životinja u kojima se razvijaju ženske spolne stanice. riža. dio je probavila. najprimitivniji današnji sisavci. jajna stanica se razvija i sazrijeva u jajniku (ovariju) unutar Graafovog folikula.

objavio matematički dokaz abiotičkog nastanka prvih organizama. reakcije u tami. Takav način zarašćivanja rana kalusom bitan je u postupcima cijepljenja biljaka. nalazi se između kore i drva stabljike. inaktivira i izlučuje štetne i nepotrebne tvari. v. tanko crijevo. KAPLAN. Na početku želuca nalazi se prstenasti – kardijalni mišić (sfinkter). K KALORIMETAR. dok se jezgrica i jezgrina ovojnica razgrađuju i gube. Omogućena je svojstvima molekula vode: kohezije i adhezije. KANCEROGEN (karcinogen). JEZGRA (stanična jezgra. Planinska je ševa karakteristična u planinskim travnjacima. KAPSIDA.J (džule) osnovne jedinice za energiju. profaza I i II) u jezgri nastaju posebne strukture – kromosomi. pretvara ih jedne u druge. uništava.. ali je malobrojna pa nije dominantna. vrste koje su tamo zastupane s velikim postotkom stalnosti. v. JETRA. One ne moraju biti i dominantne vrste. Neke se stanice kalusa diferenciraju i izgrade ono tkivo koje je oštećeno ozljedom. Toplina koja se oslobađa spaljivanjem uzorka hrane preračunava se u Joule . najveći i najvažniji stanični organel eukariotskih stanica jer sadrži informaciju za sintezu proteina stanice. KAMBIJ. U vrijeme diobe stanice (profaza mitoze. Za vrijeme interfaze ili razdoblja između dvije diobe stanice u jezgri se nalazi: kromatin. Osušeni (dehidrirani) uzorak usitnjene hrane spaljuje se uz prisutnost kisika (oksidira) do pepela. Izgrađuje. razgrađuje i pohranjuje ugljikohidrate. U njoj se sintetiziraju ribosomska ribonukleinska kiselina (rRNA). kod biljaka pojava dizanja vode u kapilari. ali ima i niz drugih uloga. tvar što izaziva nastanak raka. tj. KAPILARNOST. KALVINOV CIKLUS. sprava kojom se mjeri energetska vrijednost hrane tzv. v. KAPILARNO KLUPKO BUBREGA. peristaltikom. proteinska ovojnica nukleinske kiseline kod virusa. JEJUNUM. australopitekus. jezgrin sok. R. KARAKTERISTIČNE VRSTE u biocenozi. najveća žlijezda u tijelu. JUŽNI PRAČOVJEK. stvara činitelje zgrušavanja. U čovjeka. ovojnicom. skupina nediferenciranih stanica u biljaka koja nastaje pri ozljedama zeljastih i drvenastih biljaka. izlučuje žuč. KALUS. kalorimetrijska bomba. jedna ili više jezgrica i svi su skupa obavijeni jednom dvostrukom membranom. koji se opušta kako bi propustio hranu u želudac odnosno steže da bi spriječio povrat hrane u jednjak.5 kg. karion). Kambij omogućuje rast stabljike u debljinu i sudjeluje u formiranju provodnih tkiva (floema i ksilema). JEZGRICA (nukleolus). Jetra je ključni organ metabolizma i probave u organizmu. nukleus. jezgru nalazimo u svim stanicama osim u crvenim krvnim stanicama ili eritrocitima. a ti proteini određuju sve strukture i funkcije u stanici. proizvodi globuline pa igra važnu ulogu u obrambenom sustavu organizma. stanična struktura koja se nalazi unutar jezgre. v. glomerul. 64 . vrsta tvornog staničja u drvenastih biljaka.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ njem mišićne stijenke. Teška je oko 1. masti i bjelančevine.

6. 19 i 20 F skupini. To je npr: rosika. KARBAAMINOHEMOGLOBIN. a 1 par čine spolni kromosomi. kemijska reakcija ubrzana utjecajem (bio)katalizatora (enzima). U svim tjelesnim stanicama čovjeka nalazi se potpuna kromosomska garnitura (diploidna garnitura) od 46 kromosoma koji su prema dogovoru znanstvenika raspoređeni po obliku i veličini i označeni brojkama. a 21 i 22 G skupini. biljke koje se povremeno hrane sitnim životinjama. KARION. štetnog spoja koji nastaje u stanici prilikom metabolizma masti. kod gljiva. v. KEMIJSKA ENERGIJA. KEMOAUTOTROFI. carbo = ugljen). formirajući kemijske spojeve bogate energijom. 16. najčešće kukcima (kukcojedne ili insektivorne biljke) čijom probavom dobivaju potrebne mineralne tvari. KATALIZA. 11 i 12 C skupini. započeo je otprilike prije 275 milijuna godina i trajao je 50 milijuna godina. v. stanica u stvari pohranjuje višak energije koji se javlja u procesima staničnog disanja. KARNIVORI. 10. energija pohranjena u kemijskim vezama različitih kemijskih spojeva. 17 i 18 E skupini. S druge strane. KARBONIZACIJA. 8. v. Sve te biljke imaju posebne žlijezde koje luče probavne enzime. podjela jezgre u vrijeme diobe stanice (mitoze. KARBON (lat. 9. KATALAZA.kancerogen. enzim koji ubrzava razgradnju vodikovog peroksida. molekula hemoglobina koja prenosi vezani ugljikov dioksid. skup kemijskih i biokemijskih procesa razgradnje većih molekula u manje jedinice. citološki prikaz potpune kromosomske garniture (svih kromosoma) pojedine stanice nekog organizma. KATABOLIZAM. ugljeno doba. KATADROMNE SELICE. provodni fosili. jedno od geoloških razdoblja nazvano po bogatim naslagama ugljena. a od životinja prvi gmazovi. mejoze) koja prethodi citokinezi. stapanje muške i ženske jezgre u jednu jezgru. Za sve životne aktivnosti i biljne i životinjske stanice potrebna je energija. posebice dušik. pougljenjivanje. KARIOKINEZA. 14 i 15 D skupini. selidbe riba. Upoznavanje kariotipa čovjeka pomoglo je znanstvenicima da otkriju mnoge genetski uvjetovane anomalije i bolesti. KARIOTIP. v. 4 i 5 B skupini. posebno drvenastih papratnjača od kojih je i nastala najveća količina kamenog ugljena. Kemijski procesi kojima se formiraju i kojima se razgrađuju energetski bogati spojevi su procesi oksidacije i redukcije. Parovi autosoma grupiraju se u 7 skupina na taj način da parovi 1. podjeli citoplazme. Žive na siromašnim tlima. Stanica do te energije dolazi razgradnjom energetski bogatih organskih spojeva u procesu staničnog disanja. 7.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE KARAKTERISTIČNI FOSILI. KARIOGAMIJA. 13. U vrijeme karbona vlažna i topla klima omogućila je razvoj biljnog svijeta. drugi naziv za mesojede. ribe koje žive u slatkoj vodi.2 i 3 pripadaju A skupini. jezgra. KARCINOGEN. npr. jegulje. organizmi koji energiju potrebnu za život dobivaju od kemijskih reakcija. isp. a radi mriještenja zalaze u more. Autosomi ili nespolni kromosomi raspoređeni su prema sličnosti u 22 para. U vrijeme karbona pojavljuju se prve golosjemenjače. oksidacijom anorgan- 65 . KARNIVORNE (mesojedne) BILJKE.

razdoblje u životu čovjeka u kojem se događaju različite fiziološke i psihičke promjene koje su rezultat hormonskih promjena u organizmu.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ skih tvari: amonijaka. KLAMIDOMONAS. ugljikovim dioksidom i ugljikovim monoksidom. KEMOTAKSIJE. KLICA (embrio). o oslobađa se procesom fotosinteze. nitrificirajuće bakterije. KISTAC. KINETIČKI APARAT. Naziv je dobio po nalazištu. soma = tijelo). mangana i dr. Iz tih će se dijelova klijanjem formirati mlada biljka. najstariji oblik fosila kemijskog podrijetla. KEMOFOSILI. v. v. tropizmi KERATIN. padaline koje su zakiseljene zagađivačima atmosfere: sumpornim dioksidom. netopljive organske tvari koje nastaju u stijenama u obliku kemofosila. pleistocena. Stijenka spore gljive sluznjače također je od keratina. Ispod kože imaju debeli sloj masnoće. U ranom stadiju klica ima oblik kugle. pelikula. Zameci imaju dlačice koje se kod odraslih izgube. Kitovi se dijele na zubane i usane. elementarni sastav). Volumen mozga iznosio mu je oko 1000 cm3. KINESKI PRAČOVJEK (sinantropus). Udišu kisik iz zraka. Kisele kiše djeluju štetno na sve ekosustave. v. skupina sisavaca prilagođenih životu u moru. sumpornih spojeva. pelikula. Kitovi usani filtriraju vodu kroz usi (rožnate ploče) i hrane se planktonom. Najveće količine kisika potječu od velikog broja fitoplanktonskih organizama mora i oceana. KINETODEZMA. dušikovim oksidom. v. Kini. kemijski element. željezovih iona. v. KLIMAKTERIJ. Ta je svestrana bjelančevina lagana. pelikula. KISIK. KINETOSOM (grč. KEROGEN. jedan od izumrlih oblika čovjekovih predaka koji se smatra pripadnikom vrste uspravnog čovjeka (Homo erectus). Pripadaju najvećim životinjama u biosferi. zelene alge. penicilijum. dio sjemenke koji se razvija nizom mitoza iz oplođene jajne stanice (zigote). npr. dopunsko respiracijsko središte koje se nalazi u produženoj moždini i djeluje na inspiracijsko središte. KEMONASTIJE. Prednji su se udovi preobrazili u peraje. U mu- 66 . Kemoautotrofni organizmi su prokarioti. v. Starost nalaza iznosi 300 do 500 tisuća godina što znači da datira iz perioda srednjeg kvartara. Ti se plinovi otapaju u vodi kiša i pod utjecejem Sunčeva svjetla i atmosferskog kisika nastaju kiseline. savitljiva i jaka. kosu. KEMOTROPIZAM. v. Organizmi ga troše u procesu disanja. v. nokte i perje. delfin i plavetni kit. zelene alge. KIŠNA ALGA. pliskavica. O2. Smatra se da je sav kisik u atmosferi nastao kao rezultat fotosintetske aktivnosti zelenih biljaka. KEMOTERAPIJA. nastije. poznavao je vatru i koristio primitivno kameno oruđe. Poznatiji su: ulješura. citostatici. Kitovi zubani se hrane ribom i drugim životinjama. strukturalna bjelančevina koja izgrađuje npr. v. KISELE KIŠE. KEMOSENZITIVNO PODRUČJE. kinein = pokretati. isp. v. To se područje aktivira porastom razine ugljikovog dioksida u krvi i šalje preko inspiracijskog središta dopunske impulse prema dišnim mišićima. neophodan za život svih organizama (isp. Zrela klica sastoji se od korijenka. KITOVI. Rađaju žive mlade koji sišu. pupoljka i supki. taksija.

luče ju obložne stanice u sluznici želuca podražene progutanom hranom. Zajedno s Pasteurom smatra se osnivačem eksperimentalne bakteriologije.tilakoide. Obavijen je dvostrukom membranom. žarne stanice. v. a mjesta gdje su rjeđe raspoređene zovu se stromatilakoide. Pripadaju im paučnjaci: pauci. a zatim ga isisavaju. Nemaju ticala. Plijen savladavaju otrovnim žlijezdama. U stanici se nalazi uz druge pigmente u grana tilakoidnim membranama kloroplasta. U žena se obično javlja u dobi od četrdeset i pete do pedesete godine života. isp. nepravilni menstruacijski ciklusi te njihov konačan izostanak. umor i tjeskoba. KLITELUM. status kada oba alela istoga gena u heterozigotu daju jednaku izražajnost. v. skupina genetički jednakih stanica ili organizama nastalih mitozom od jedne stanice ili zajedničkog podrijetla tj. KOD. KOCH. grinje. KLORIDNA KISELINA (HCl). KLOAKA. proizvodnja klonova. svojta. Kloroplasti i mitohondriji su specifični stanični organeli po tome što sadrže vlastitu DNA i vlastite ribosome. Tijelo je podijeljeno na glavopršnjak (prosoma) i zadak (opistoma). jednootvori. Većina ih živi na kopnu. KNIDOCITI. isp. KOACERVATI. pripada skupini organela (plastida) koji sadrže pigmente. kodon KODOMINANTNOST. a karakterizira ga smanjeno lučenje hormona estrogena i progesterona. KLJEŠTARI. pigmenta koji je neophodan za odvijanje fotosinteze. napadaji vrućine. Imaju sposobnost rasta i izmjenjivanja tvari s okolišem pa time pokazuju sličnosti s protoplazmom. Isp. KLOROPLAST. U stromi se nalaze: DNA. R. isp. nastalih nespolnim i vegetativnim razmnožavanjem te partenogenezom i apomiksijom. Probavu počinju izvan organizma ispuštanjem probavnih sokova u plijen. RNA. Unutarnjost kloroplasta je po- dijeljena membranama na plosnate vrećice . U membranama tilakoida nalaze se molekule klorofila. a unutarnjost mu je ispunjena otopinom koja se zove stroma. Nalazi se samo u biljnim stanicama eukariota. v. nečisnica. maločetinaši. Sintetizirao ih je ruski biokemičar Oparin prikazavši time jedan od mogućih stupnjeva evolucije žive tvari. zajedničku dominan- 67 . autonomnim parasimpatičkim živčanim sustavom (i živac vagus) te probavnim hormonom gastrinom. tj. navažniji biljni pigment za apsorpciju svjetlosne energije u procesu fotosinteze. ribosomi. razdražljivost. KLON. kemijski spoj. Zelene su boje. v. – 1910. koloidne kapljice s opnama koje nastaju ako se određeni organski spojevi otapaju u vodi uz dodatak različitih soli. stanični organel. KLONIRANJE. Mjesta gdje su te membrane gusto raspoređene u više ili manje visoke stupce zovu se grana-tilakoide.. štipavci ili škorpioni i dr. (1843. supstrati i enzimi koji su potrebni za odvijanje fotosinteze.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE škaraca započinje obično između pedesete i šezdesete godine života smanjenjem lučenja hormona testosterona zbog čega se postupno smanjuje i spermatogeneza. Uz usta imaju kliješta ili helicere. a mogu se dijeliti neovisno o diobi stanice. KLOROFIL. njemački bakteriolog koji je identificirao bacil koji uzrokuje tuberkulozu. Kiselina je važna za aktiviranje pepsina. v.). životinje iz skupine člankonožaca. KLJUNAŠI. Postoje klorofili a i b.

Značajan je i kao ishodišna molekula u sintezi nekih hormona. probavni hormon koji se luči iz stanica sluznice dvanaesnika kada je prisutna masna hrana u dvanaesniku. itd. suparništvo u istom okolišu među prekobrojnim jedinkama za hranom. u nizovima (streptokoki). u grozdastim nakupinama (stafilokoki) i dr. životnim skloništem ili/i spolnim partnerom. a kopneni (gujavica) površinom vlažne kože. krvnu grupu AB određuju aleli A + B. privlačna sila između molekula ili atoma iste tvari. Nadmetanje je često i među jedinkama različitih vrsta (interspecijska kompeticija). Najviše ih živi u moru. Optjecajni sustav je zatvoren. v. nukleinskih kiselina. slijed triju nukleotida na molekuli mRNA koji određuje položaj određene aminokiseline pri sintezi proteina (isp. Vodeni kolutićavci dišu pomoću škrga. KOHEZIJA. v. v. Stanična otopina je koloidna otopina čije su koloidne čestice molekule proteina. KOLONIJALNA TEORIJA O POSTANKU METAZOA. Oblikom mogu biti nitaste. krvlju dospijeva do jetre odnosno žučnog mjehura koji se pod utjecajem kolecistokinina steže. u živčanom tkivu i krvnoj plazmi. organski spoj iz skupine steroida (isp.). otopine koje sadrže otopljene tvari čiji je promjer čestica između 1 i 100 nm. Nalazi se u membranama životinjskih stanica. te protiskuje nakupljenu žuč žučnim vodovima u dvanaesnik. KOLECISTOKININ. Međusobna privlačnost molekula vode je važna za uzlazni tok vode u biljci. Pokreću se stezanjem prstenastih i uzdužnih mišića.maločetinaši i paučnjaci. U krvi se nalazi hemoglobin. npr. filogenetski sustav. Dolaze pojedinačno (monokoki). Neke od ovih bakterija uzročnici su teških bolesti. maločetinaši i pijavice. genetička uputa). KOLOIDNE OTOPINE. Kompeticija je najjači biotički čimbenik unutar jedinki iste vrste (intraspecijska kompeticija). KODON (kod). Na površini je kutikula i jednoslojni epiderm bogat žljezdanim i osjetnim stanicama. Tijelo im je ravnomjerno kolutićavo. Morski su kolutićavci razdvojena spola i razvijaju se preko ličinke trohofora. Nasuprot jedne purinske baze iz jednog polinukleotidnog lanca dolazi pirimidinska baza drugog polinukleotidnog lanca. a manje u kopnenim vodama ili na vlažnim staništima. U svakom se kolutiću ponavljaju isti organi. nakupine jednostaničnih organizama među kojima nema podjele rada. hipoteze o postanku mnogostaničnih životinja. KOMENZALIZAM. KOMPLEMENTARNE BAZE. Prema tjelesnoj građi dijele se u tri skupine: mnogočetinaši. KOKI. KOMPETICIJA (nadmetanje). KOLONIJA. v.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ tnost. KOLESTEROL. KOLUTIĆAVCI (Annelida). simbioza. Hormon se apsorbira iz crijeva u krv. Slatkovodni i kopneni kolitićavci su dvospolci. Dipolarne molekule vode su povezane slabim vodikovim vezama. bakterije kuglastog oblika. Živčani sustav je ljestvičav. KOLENHIM. KOKON. odgovarajuće dušične baze koje u molekuli DNA dolaze uvijek jedna nasuprot drugoj. Tako nasu- 68 . već svaka stanica samostalno obavlja sve životne funkcije. Takve čestice nazivamo koloidnim česticama. Za izlučivanje imaju po jedan par metanefridija u svakom kolutiću. bezkralješnjaci iz skupine mnogokolutićavaca. pločaste ili kuglaste. u paru (diplokoki). KOLJENO. potporno staničje. v.

Migrirajući mikronukleus iz svakog konjuganta preko citoplazmatskog mosta prelazi u suprotnu jedinku. pojava kada pripadnici različitih skupina organizama u evoluciji steknu slične specijalne prilagodbe za život u određenim uvjetima. konvergentna evolucija. Po principu komplementarnosti sintetizira se i molekula RNA na matičnoj polumolekuli (jednom lancu) DNA. Od svih 8 nastalih mikronukleusa ostaju samo 2. ali se pri tome u molekulu RNA umjesto timina uvijek ugrađuje uracil. a druga nepokretna ili stacionarna. a nasuprot gvanina citozin i time čine komplementarne parove AT i GC. Proces konjugacije započinje spajanjem dvije jedinke i stvaranjem citoplazmatskog mostića. Manji su se organizmi. Tako spojene jedinke nazivaju se konjuganti. KONJUGACIJA (lat. potrošači (isp. KONZUMENTI. conservatio = čuvanje). U pustinjskoj su se klimi organizmi isušivali i mumificirali. KONVERGENTNA EVOLUCIJA. srodstveno udaljenih grupa organizama. Nakon Komplementarne baze Purinske adenin gvanin Pirimidinske timin citozin Simbol A-T G-C Pojednostavljeni prikaz sinteze RNA prema kalupu jednog lanca DNA: Komplementarne baze Purinske adenin gvanin Pirimidinske uracil citozin Simbol A-U G-C KOMPOSTIRANJE. proizvodnja komposta iz organskog otpada truljenjem uz pomoć bakterija razlagača. v.) hrane u prirodi.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE prot adenina uvijek stoji timin. v. način “spolnog razmnožavanja” u nekih bakterija. KONZERVIRANJE (lat. tj. očuvali u jantaru. pojava morfološke sličnosti filogenetski. životinje. kao npr. ribe i pliskavica. Od 2 haploidne jezgrice koje su ostale jedna je pokretna ili migrirajuća jezgrica. primjerice kukci. tj. drugi se razgrade i nestaju. Aljaska) nađeni su ostaci mamuta. isp. KONTRAKTILNA VAKUOLA. upavši u smolu crnogorice koja se skrutnula. trepetljikaši). KONVERGENCIJA. 69 . Jedna od dioba je mejotička. coniunctio = spajanje). stežljivi mjehurić. U svakoj se jedinki mikronukleus podijeli 3 puta. U ledu i smrznutoj zemlji (Sibir. KONIDIOSPORE. Taj se proces naziva prepisivanje (transkripcija) DNA u RNA. proces nastajanja fosila isušivanjem. Spoji se sa stacionarnom jezgrom u zigotu. alga i praživotinja (v. izmjena genetičkog materijala sadržanog u mikronukleusu. penicilijum. Tako se između dvije jedinke izmijeni nasljedna tvar. smrzavanjem ili čuvanjem u smoli.

konjugacija. Na površini protoplazme izlučuju ljušturicu od vapnenca ili silicija. bivoli). Poznati su numulitski vapnenci nastali taloženjem ljušturica krednjaka numulita. KORALJI. Većina ih živi u moru: krednjaci. adventivno) korijenje u papratnjača i jednosupnica izrasta naknadno jer njihov korijen ubrzo propada zbog nemogućnosti rasta u debljinu. koze. pozitivan hidrostatski tlak koji vodu iz korijena tjera prema gore. KORJENONOŠCI (sluzavci). sir. U zubalu nemaju gornjih sjekutića ni očnjaka. KOPITARI NEPARNOPRSTAŠI. Nježno tvorno staničje štiti korijenova kapa. Dijele se na nepreživače (svinje i vodenkonji) i preživače (deve. čupavo (pridošlo. v. praživotinje koje se kreću uz pomoć pseudopodija. Pojavljuje se kao mali crvenkasti otoci na koži koji svrbe. životinje iz skupine žarnjaka. Hranu može uzimati cijelom površinom 70 . višegodišnje stabljike i višegodišnjeg korijena. Većina ima čvrsti vanjski i unutarnji kostur od kalcijeva karbonata. Srednji je prst najjači i nosi masu čitavog tijela. Poznatiji su npr. ali može biti izazvana i fizičkim faktorima. Učvršćuje izdanak. Raste u dužinu uz pomoć tvornog staničja na svome vrhu. Žive u morima. do otprilike 1 m. posebno u proljeće prije listanja. veliki biljojedi iz skupine sisavaca. U Jadranskom moru poznati su crveni koralj. v. crvena moruzgva i smeđa vlasulja. KORIJENOV TLAK (tlak korijena). Mnogi imaju rogovlje. a imaju ga sve golosjemenjače i dvosupnice. jagode. nabreknuća (kvržice) na korijenu mahunarki. Preživači žive u stadima. KOPLJAČA. antilope. Želudac im je prilagođen na preživanje. opskrbljuje biljku vodom i mineralima koje upija korijenovim dlačicama. pojedinačno ili u zadrugama. U kopnenim vodama živi ameba. kožno staničje odrvenjelih biljnih organa. Amoeba proteus. zebra i nosorog. Temelji se na procesu aktivnog izlučivanja vode i tvari stanica endoderma u provodne žile ksilema. hladnoćom i toplinom kao i ujedima i ubodima insekata. KORIJENOVA KAPA. Kopita su građena od keratina. Iznosi približno 0. jeleni. KORIJEN. sve biljke koje rastu i u debljinu. (urtikarija).ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ toga se jedinke razdvoje i tada se nazivaju egzokonjuganti. Stvaraju koraljne grebene i otoke .1 MPa i važan je za dizanje vode u biljci. KONJUGANTI. korijen. Građeni su od biljnih stanica u kojima se nalaze simbiotske dušikove bakterije (u obliku bakteroida) koje obavljaju fiksaciju dušika iz zraka. tj. svitkoglavci. oblik alergijske reakcije koji se javlja kao preosjetljivost na neke vrste hrane (maline. Razlikujemo: pravi korijen koji se razvija iz klicinog korijenka. rakovi). ovce. v. biljojedi iz skupine sisavaca. magarac. Na nogama imaju 1 ili 3 prsta obložena rožnatim kopitom. npr. Obično hodaju na 2 prsta: treći i četvrti su veći od ostalih i nose čitavo tijelo. Svi su polipi. KOPITARI PARNOPRSTAŠI (papkari). KOPRIVNJAČA. Odumiranjem organizama ljušturice se talože na morsko dno tvoreći debele naslage. konj. sunašca i zrakaši. žirafe. KORA. jedan od tri temeljna organa kopnenih biljaka.atole. npr. sloj obamrlih stanica omogućujući tako prodor korijena i u tvrda tla. Površinu tijela pokriva joj dvoslojna lipoproteinska stanična membrana. KORIJENSKI GOMOLJIĆI (noduli).

kortikosteron) koji reguliraju promet ugljikohidrata i mineralokortikoidi (aldosteron) koji reuguliraju promet iona u organizmu. KOSTUR. a u Jadranu je česta glavata želva. obična čančara u Dalmaciji i na otocima. KOŠTANA MOŽDINA. One nemaju korijen. Na dugim kostima razlikujemo dva kraja ili epifize i srednji dio dijafizu koja je ispunjena do spolne zrelosti crvenom koštanom moždinom. megakariociti (trombociti) i leukociti granulociti. Disanje je aerobno. Kod vrsta koje žive u vodi noge su se modificirale u peraje. Razlikujemo vanjski (egzoskelet) i unutarnji (endoskelet) kostur. a plinovi prolaze procesom difuzije kroz membranu. Rast kostiju omogućuju koštane stanice – osteoblasti. kao npr. U crvenoj moždini nastaju eritrociti. KORTIZON (kortizol).) i oko 30 posto organskih tvari (osein). Građena je od koštanog tkiva: vanjskog kompaktnog i središnjeg spužvastog sloja. Sve biljke s razvijenim kormusom zovemo stablašice ili Cormophyta. Poznatije kornjače naših krajeva: barska kornjača. stanice ovalnog oblika koje izgrađuju koštano 71 . srdoboljna ameba. biljno tijelo koje ima razvijene osnovne prehrambene (vegetativne) organe: korijen. najčvršći dio kostura. U kostima se nalaze i stanice koje razgrađuju koštanu tvar . isp. KOŠTANE STANICE (osteociti). KOST. tkivo koje ispunjava moždinsku šupljinu kosti i prostore među gredicama spužvastog koštanog tkiva. KORTIKOSTEROIDI (kortikosteroidni hormoni). srčane arterije. fosfora i dr. Među stablašicama posebno mjesto imaju i mahovine koje osim obilježja stablašica nose i obilježja steljnjača ili Talophyta. v. Razlikujemo crvenu. stablo). glukokortikoidni hormon koji se oslobađa u stresu pospješujući opći metabolizam. hrskavice i ligamenata. KORMUS (cormus. Sastoji se od kosti. Nametničke amebe žive u unutarnjim organima životinja i čovjeka. taloženje masnih naslaga (aterona) u koronarnim arterijama što smanjuje protok krvi pa je srčani mišić slabije opskrbljen kisikom i hranidbenim tvarima. a danas im pripadaju papratnjače i sjemenjače. Oklop je nastao stapanjem kožnog i unutarnjeg kostura. hormoni koje izlučuje kora nadbubrežne žlijezde. krvotok srčanog mišića. stabljiku i list. Suvišnu tekućinu izbacuje pomoću stežljivih mjehurića (kontraktilne vakuole). isp. kao npr.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE tijela. U ustima nemaju zube. Razmnožava se običnim dvojnim ili binarnim dijeljenjem. oblik i omogućuje kretanje. Najrazvijeniji je mišić za uvlačenje glave. Nakon spolne zrelosti koštana moždina se u dugim kostima zamjenjuje masnim tkivom. KORNJAČE. Egzoskelet i zaštićuje organizam. Izlučivanje kortikosteroida je pod kontrolom adenokortikotropnih hormona (ACTH) iz adenohipofize. KORONARNE ARTERIJE. Kosti sadržavaju oko 70 posto anorganskih tvari (kalcija. Kralježnjaci imaju endoskelet. procesom endocitoze. U uhu imaju bubnjić. Danas živi oko 250 vrsta. niti su im u potpunosti razvijeni stabljika i listovi. potporanj tijela koji mu daje čvrstoću. Osnovna jedinica je osteon. dajući oslonac mišićima. skupina gmazova s oklopom na kojem se nalaze otvori za noge i glavu. Kostur čovjeka ima oko 208 kostiju. žutu i želatinoznu moždinu. kod mekušaca i člankonožaca. kortikosteroidi. Najznačajniji kortikosteroidi su glukokortikoidi (kortizon. KORONARNA SKLEROZA. a ženke izlaze na kopno samo da izlegu jaja.osteoklasti. nego su im čeljusti pokrivene rožnatim pločicama. Izvana je obavijena pokosnicom (periost).

KOTILEDONI. ima prije svega zaštitnu ulogu. usminu ili dermu. KREBSOV CIKLUS (ciklus limunske kiseline). H. u odstranjivanju štetnih produkata tvarne izmjene iz tijela. v. Na mrežnicu pada neoštra slika. skupina životinja čije tijelo podupire kralježnica. isp. krvne i limfne žile. Prvi kralježnjaci pojavili su se početkom paleozoika. Pripada tipu neandertalskog pračovjeka koji se danas smatra samo jednom od izumrlih vrsta umnog čovjeka (Homo sapiens). najbrojnija skupina riba (isp. KREBS. poremećaj vida u kojem je očna jabučica izdužena. KRAPINSKI PRAČOVJEK. protumačio ciklus limunske kiseline koji je nazvan i Krebsov ciklus. Formira se u tijeku embrionalnog razvoja kralježnjaka oko svitka. Oplodnja je vanjska. list. kovač. Živio je u većim skupinama.). Može sadržavati žlijezde znojnice i lojnice. najčešće kalcijev fosfat i kalcijev karbonat) dijela. KRALJEŽNJACI (Vertebrata). Imaju koštani kostur. klen. KRALJEŽNIČKI ŽIVCI. te se zrake svjetla pri akomodaciji oka na daleke predmete lome već ispred mrežnice. Važna je u održavanju stalne tjelesne temperature kod homeotermnih životinja. vrsta epitelnog ili pokrovnog tkiva. Poznatije su koštunjače u kopnenim vodama: šaran. – 1981. u primanju vanjskih podražaja pomoću osjetilnih tjelešaca. KOŠTUNJAČE. a omogućuje izmjenu plinova između biljke i okoliša. ali ima vrsta i s golom kožom. ribe. Rasprostranjeni su u vodi i na kopnu. Od morskih riba u Jadranu žive: skuša. sastavljen od većeg broja kralježaka. glavni potporanj tijela svih kralježnjaka. Potkoljeno kralježnjaka sadrži oko 40000 vrsta. zubatac. moždinski živci. u vodozemaca je gola. Izlučuju krutu međustaničnu tvar koja se sastoji od organskog (protein osein) i anorganskog (minerali. jedna od aerobnih faza stanične 72 . u gmazova je pokrivena ljuskama ili pločama. v. Koža kralježnjaka građena je od više slojeva koji izgrađuju površinski dio. a nastaje od zametnog listića mezoderma kao i sve ostale kosti. Kratkovidnost se ispravlja konkavnim lećama (negativna dioptrija). grgeč.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ tkivo. Imaju plivaći mjehur. oslić.). list i dr. Tri su vrste kožnog staničja: epiderma. KRATKOVIDNOST (miopija). različita osjetilna tjelešca. Škrge su pokrivene škržnim poklopcem. srdela. pastrva. štuka. Pripadaju lubanjcima iz koljena svitkovci. pousminu ili epidermu i unutarnji dio. Nemaju zavojiti zalistak u crijevu. Njena osnovna uloga je zaštititi organizam od negativnih učinaka okoliša. izumrli čovjekov predak čiji su nalazi pronađeni u jednoj poluspilji u Krapini (Hrvatsko Zagorje). vodozemce. Dijele se na kružnouste. u ptica perjem. hranio se mesom divljih životinja. rizoderma i kora. gmazove. ogranke živaca i masne stanice. Ljuske na koži su okruglaste (cikloidne) i češljaste (ktenoidne). KOŽA. Starost tih nalaza procjenjuje se na 70 tisuća godina. ptice i sisavce. u staklovini. u izmjeni plinova i dr. Bio je relativno niskog rasta (do 160 cm) s jakim nadočnim lukovima i izbočenim čeljustima bez izrazite brade. KRALJEŽNICA (columna vertebralis). njemački biokemičar. som. a u sisavaca dlakom. bavio se lovom. organ koji pokriva vanjsku površinu tijela čovjeka i životinja. a koristio je kameno oruđe i vatru. (1900. KOŽNO STANIČJE. Razmnožavaju se jajima. U riba je pokrivena ljuskama.

odakle se dva mjeseca prije rođenja spuste u mošnju djelovanjem fetalnog testosterona. KREMENE BILJKE. acidofilne biljke KREMENJAŠICE (Diatomeae). KRIŽANAC. KROKODILI. opnokrilci (ose. žoharaši (bogomoljke. KRIŽANJE (hibridizacija). biljke kratkog dana i biljke dugog dana KRITOSJEMENJAČE. korjenonošci. a njihovi su preci živjeli na kopnu. bumbari). Plodnica se razvija u cvijetu kao dio tučka. Veliki značaj imaju u primarnoj produkciji hrane. leptiri. Poznato je više od 250 000 vrsta. strizibube. kornjaši (hruštevi. ravnokrilci (skakavci. v. dvokrilci (muhe. Produkti fotosinteze su masna ulja i poneki polisaharid. pravilno struktuiranom stijenkom uglavnom (95 %) izgrađenom od kremena (SiO2). KREDNJACI. tekuti). ose i pčele. kremenjašice. Cvjetanje je prvenstveno određeno trajanjem razdoblja tame. jednostanične alge s čvrstom. Koža je pokrivena velikim rožnatim pločama. potkornjaci). mravi. Ne mogu gutati plijen. Žive na čvrstoj (vlažnoj) podlozi ili kao plankton slatkih voda i mora. žohari. jelenci. KRIPTORHIZAM.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE respiracije ili staničnog disanja koja se odvija u mitohondrijima. obolčari). grizlice (uši. termiti. Ima osobine oba genetički različita roditelja (isp. v. a u životinjskom različite pasmine. vodencvjetovi. dvodijelnom. pčele. KREMENA ZEMLJA. U biljnom svijetu križaju se različite sorte biljaka. komarci. Sjemenici nastaju u trbušnoj šupljini. Razvijena je briga za potomstvo. Cvijet. minimalno razdoblje tame koje zahtijevaju biljke kratkog dana da bi mogle cvjetati. Čovjek primjenjuje umjetno križanje da bi dobio potomke koji imaju neka. zaštitna obojenost. KRIPTIČNA OBOJENOST. Svi su krokodili grabežljivci. skupina kukaca koji imaju 1 ili 2 para krila ili su im nestala tijekom evolucije. Prilagođene su životu na svim područjima na Zemlji. potomak nastao križanjem (hibridizacijom). nikada škrob. KRILAŠI. Žive u vodama tropskog i suptropskog pojasa. termiti). KRITIČNO RAZDOBLJE TAME. U prošlosti su sudjelovale u izgradnji naslaga zemlje koja se zove dijatomejska ili kremena zemlja. proces miješanja nasljeđa dvaju različitih roditelja. plodnica i plod su generativni organi svojstveni kritosjemenjačama. Poznatije su skupine: vretenca (vilin konjic). Poznatije 73 . evolucijski naprednije sjemenjače. Prema broju supki razlikujemo jednosupnice i dvosupnice. već ga komadaju snažnim zubima smještenim u jako izbočenoj njušci. bilo prirodnim bilo umjetnim putem. obadi). šturci. Sjemeni su zameci zatvoreni ("sakriveni") u plodnici. Naziva se ciklusom jer se sastoji od kružne serije biokemijskih reakcija u kojima se pirogrožđana kiselina razlaže na molekule ugljik(IV)-oksida i atome vodika pri čemu se oslobodi energija za sintezu ATP-a. buhe. Sjemenici koji zaostanu najčešće zakržljaju. v. Krokodili su dugi do 6 m. (hibrid). U oko 5 % muške djece jedan se testis (rjeđe oba) zadržavaju u trbušnoj šupljini. nakaznici. Napredak se očituje u građi srca gdje je klijetka gotovo potpuno podijeljena na desnu i lijevu stranu. najrazvijeniji i najveći živi gmazovi. za njega potrebna i korisna svojstva. isp. Zadružni kukci su: mravi. prirođena mana da se sjemenici ne nalaze u mošnjama. božje ovčice. Masivno tijelo nose kratke noge. pa se smanjuje rasplodna moć muškarca. v. heterozigot). Obuhvaća oko 30 različitih skupina. v.

KROMOPLASTI. eukromatin građen od vlakana rjeđe raspoređenih nego u heterokromatinu. Svaka vrsta ima spe- spojnice histona Građa kromosoma: DNA nit (kromonema) dijelom omotana oko nukleosoma KROMOSOMSKE KARTE. koja je dijelom ravna a dijelom namotana oko malih grudica bjelančevine (histona). U njima su smješteni geni. KROMATIN. ubrajamo ih u skupinu organela čiji je zajednički naziv plastidi. četkasti kromosomi. KROMOSOMI. Kromoplasti daju boju mnogim cvjetovima (maćuhica. obični kajman. cjelokupna genetička informacija organizma. v. Izgrađena je od jedne molekule DNA i bjelančevina. žuta perunika i dr. KROMATSKA ADAPTACIJA. DNA U vrijeme diobe stanice iz kromatina se formiraju posebne strukture. mrežica vlakana koju čine DNA i proteini. Glavni dio kromosoma je dvostruka nit (kromonema) sastavljena od molekula DNA. cifičan broj i građu kromosoma. crvene karotene i žučkaste ksantofile. šipak) i korijenu nekih biljaka (mrkva). gangeski gavijal. KROMOSOMI S PETLJAMA. KROMONEMA. koje se nazivaju nukleosomi. misisipski aligator. posebne strukture koje postaju vidljive u jezgri eukariotskih stanica u vrijeme mejoze i mitoze.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ su vrste: nilski krokodil. Građeni su od DNA i bjelančevina. kromatide konjugirani homologni kromosomi profaza I izmjena dijelova kromatida profaza I odvajanje kromosoma anafaza I 74 . kromosomi. mogućnost organizama da mijenjaju boju i tako koriste različite dijelove Sunčevog spektra. kromosom. stanični organeli. KROMANJONAC. Razlikujemo dva tipa kromatina: 1. KROMOMERA. a nalazi se u jezgri eukariota u vrijeme interfaze. polovica udvostručenog kromosoma. v. te utanjeno i neobojeno mjesto pričvrsnica (centromera). isp. v.). nukleosom (s 8 histonskih molekula) 2. v. biljnim plodovima (rajčica. tj. KROSINGOVER (crossing over). Homo sapiens. Ne sadrže klorofil te nemaju sposobnost fotosinteze. Također se zamjećuju i jače obojena mjesta kromomere. heterokromatin koji je građen od gusto zbijenih vlakana i obično se raspoređuje uz jezgrinu ovojnicu. genetičke karte. Sadrže biljna bojila. KROMATIDA. kromosom. pojava izmjene dijelova kromatida između dva homologna kromosoma. v.

pripadnici krvne skupine B aglutinogen B. prijenosu hranjivih i drugih tvari (hormona. a posebna skupina globulina. U krvne stanice spadaju eritrociti ili crvene krvne stanice i leukociti ili bijele krvne stanice. nitrati itd. Nešto kasnije otkrio je i prirodu tzv. obrani tijela od infekcija itd. KRSTAŠICE. protječe kroz srčano-žilni sustav. Nazivaju se i bezčeljusti jer nemaju izgrađenih čeljusti. zajednički naziv za krvne stanice i krvne pločice ili trombocite. Žive u moru ili kopnenim vodama. Iz oplođenih se jaja razvija ličinka pokača. Razdvojena su spola. KRVNE PLOČICE. Proizvedenu hranu ne koriste samo producenti za sebe. Za izlučivanje imaju prvi bubreg. i oogeneza i spermatogeneza). Pripadnici krvne skupine A nose na membranama svojih eritrocita aglutinogen A. KRVNA PLAZMA. leukocita i trombocita. Albumini i globulini sudjeluju u prijenosu hormona. Paraziti su na ribama.krvne plazme i triju osnovnih skupina krvnih stanica: eritrocita. podjela krvi prema bjelančevinama – antigenima koji se nalaze na membranama eritrocita. održavanju tjelesne temperature. Cvjetovi imaju četiri lapa i četiri unakrsne latice (ime!). I producente (biljke) i konzumente (životinje) i druge reducente nakon prestanka njihova života razlažu reducenti (gljive i bakterije) na anorganske tvari. najprimitivnija skupina kralježnjaka i najstariji lubanjci. Dijele se na paklare (imaju leđnu i repnu peraju) i sljepulje (imaju samo repnu peraju). a značajan je jer doprinosi genetičkoj raznolikosti rasplodnih stanica (gameta) koje će nastati diobom (isp. Krvnu plazmu kojoj je odstranjen fibrinogen nazivamo krvni serum. Na temelju tih antigena utvrđen je AB0 sustav krvnih skupina u kojem se razlikuju 4 osnovne krvne skupine: A. kelj. izlučivanju štetnih tvari. Na hrskavičnoj lubanji nalaze se okrugla i lijevkasta usta sa rožnatim "zubićima" ili kvržicama. a za proizvodnju ulja uljena repica. AB i 0 (nula). skupina zeljastih biljaka dvosupnica čiji su mnogi pripadnici važne gospodarske biljke. Kao povrće rabe se npr. vitamina itd). jedna od tjelesnih tekućina. CO2. koraba i rotkva. Rh-faktora. KRV. tekući dio krvi. tekuće vezivno tkivo. cvjetača. pripadnici krvne skupine AB oba aglu- 75 . dio krvi. Ukupni volumen krvi u odrasle osobe je oko 5 litara. trombociti KRVNE SKUPINE. Prve antigene otkrio je 1900. Fibrinogeni su važni u procesima zgrušavanja krvi. KRUŽNOUSTE (Cyclostomata). Korovna je biljka rusomača. Svitak imaju cijeli život. nego ih konzumenti troše jedući biljnu hranu. Ima važnu ulogu u izmjeni plinova. Bočna pruga im služi kao ravnotežni organ pri plivanju. Isp. KRVNA TJELEŠCA. tzv. Krvna plazma sadrži tri vrste bjelančevina: albumine. godine austrijski znanstvenik Karl Landsteiner i to A i B aglutinogene. v. održanju količine vode u tijelu. Krv se sastoji od tekućeg dijela . tzv. Žućkasta tekućina sastavljena od 90 % vode. izvanstanična tekućina. γ-globulini ili imunoglobulini imaju važnu ulogu u obrani organizma protiv uzročnika bolesti. B. komušku ili komuščicu. isp. KRUŽENJE TVARI U PRIRODI počinje proizvodnjom hrane iz anorganskih tvari (H2O. šest prašnika (četiri dulja i dva kraća) i plod suhi pucavac. 2 % anorganskih tvari (najviše iona natrija i klora) i 8 % organskih spojeva (najviše bjelančevina).) što rade producenti. Naš endem velebitska degenija je također krstašica. različiti kultivari kupusa: glavati kupus. globuline i fibrinogene.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE Crossing over se zbiva za vrijeme diobe stanice i to u profazi mejoze I.

timusu. Prilagođeni su na štednju vode smanjenim izlučivanjem. vrsta provodnog tkiva u biljaka čija je funkcija provođenje vode i mineralnih tvari iz korijena prema ostalim dijelovima biljke. Te arterije izlaze iz početnog dijela aorte i dovode srcu krv obogaćenu kisikom (oksigeniranu krv). strana tvar. Tijelo je podijeljeno 76 . KRVNI SERUM. protiv krvne skupine B. dio slezene i jetra. a pripadnik krvne skupine 0 ima i anti A i anti B (beta) aglutinine. Megakariociti su velike stanice koje nastaju u koštanoj moždini. kao npr. prehrane. Po obliku su lističave ili nitaste. Pripadnik krvne skupine B ima anti A (alfa) aglutinine. v. dok je protok kroz desnu koronarnu arteriju jednak u sistoli i dijastoli. otrov ili toksikant. a njihovim raspadanjem nastaju trombociti ili krvne pločice.7 kPa (stara mjera 120/80 mmHg). xenos = stran). kukaca zaštićena je hitinom. a gmazova rožnatim slojem. Protok krvi kroz lijevu koronarnu arteriju odvija se u dijastoli. KRVNI TLAK. a štetne tvari izlučuju u dehidriranoj formi (npr. kaktusi. KSILEM. Površina tijela npr. Normalni krvni tlak u velikim arterijama iznosi oko 16/10. tj.To su: koštana moždina. Limfopoeza je stvaranje limfocita. Dobro su prokrvljene. pritisak krvi na stijenke krvnih žila. antitijela koja neće reagirati protiv vlastitih eritrocita. organi specijalizirani u stvaranju pojedinih oblika krvnih stanica. srčanog mišića. Krvni tlak izražavamo razlomkom. hrast crnika i medunac.traheja ili traheida. fyton = biljka). xeros = suh. Poznato oko 800 000 vrsta. KUGA. KRVOTVORNI (hematopoetski) ORGANI. tj. Tako pripadnik krvne skupine A ima anti B aglutinine. xeros = suh. biljke s organima prilagođenim za preživljavanje u sušnim ili pustinjskim uvjetima. U brojniku je sistolički. Prilagođeni su na različite načine života. pripadnik krvne skupine AB nema aglutinine. isp. KTENIDIJE. u slučaju transfuzije (davanja) krvi kada se ne slažu krvna skupina davatelja i primatelja.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ tinogena. a odgovorni su za reakciju aglutinacije (sljepljivanja) eritrocita što izaziva zdravstvene poteškoće pa i smrt. organi (škrge) za disanje kod većine mekušaca. KSEROFITI (grč. Mnogi sisavci nemaju žlijezde znojnice. KSENOBIOTIK (grč. poseban hranidbeni ili nutritivni krvotok miokarda tj. Voda ih oplakuje a kisik difuzijom prelazi u kapilarni sustav i dalje se raznosi po tijelu. Odvija se u slezeni i koštanoj moždini. kretanja i razmnožavanja. teška zarazna bolest uzrokovana bakterijama. koja je nepotrebna ili štetna za organizam. a u nazivniku dijastolički tlak. sukulenti. pripadnici krvne skupine 0 nemaju na svojim membranama eritrocita te aglutionogene. Osim aglutinogena. pripadnici pojedinih krvnih skupina sadrže u svojoj krvnoj plazmi i specifična antitijela koja se zovu aglutinini. KSEROFILNE ŽIVOTINJE (grč. i dijelu slezene. Odvija se u limfnim čvorovima. ali će reagirati protiv eritrocita koji sadrže aglutinogen B. životinje sušnih područja. ne samo unutar člankonožaca. filos = prijatelj). Sastoji se od dvije male srčane arterije (lijeve i desne) i dvije male srčane vene (koronarne arterije i vene). Eritropoetski organi su organi s izrazitom proizvodnjom eritrocita. pustinjski miš). KRVOTOK SRČANOG MIŠIĆA. npr. krvna plazma. Granulopoeza je stvaranje granulocita. KUKCI (Insecta). Građen je od provodnih elemenata . najbrojnija skupina životinja.

KULTIVAR. KUKCOJEDI. svojta. Za izlučivanje imaju Malpighijeve cjevčice. v. Tijelo pokriva hitinska kutikula. plivanje ili skakanje). kopanje. ravnotežu. Krvni optok je otvoren i jednostavan. Dobro su razvijena osjetila za opip. Kod bezkralježnjaka vanjski rožnati. v. Neki spavaju zimski san. Razmnožavaju se jajima. bodenje (komarac). Postoje i kukci bez krila. Prsa čine 3 kolutića i nose 1 ili 2 para krila te 3 para nogu (za trčanje. prsa i zadak. Razvojni stadiji kod potpune preobrazbe su: jaje. Kutikula štiti tijelo. Mnogi su nametnici i prenosnici uzročnika bolesti (komarac malaričar malarije. kultura tkiva. krtice i rovke. Oplodnja je unutarnja. U glavi je trodjelni mozak. kukuljica i odrasli kukac. složenih šećera građenih od dvije molekule jednostavnih šećera. procesa u kojem se anaerobno razgrađuje šećer glukoza do alkohola etanola uz oslobađanje ugljikovog dioksida i energije: C6H12O6 ⎯⎯ ⎯ → 2C2H5OH + 2CO2 + ⎯ + energija Pivski ili pekarski kvasac (Sacharomyces cerevisiae) jedna je te ista vrsta koja također razgrađuje glukozu na etanol i ugljikov dioksid. Sistematski se kukci dijele na bezkrilce i krilaše. muha ce-ce bolesti spavanja. gušteri i zmije. sluh. deminutiv od kutis = koža). uš pjegavog tifusa. Njima pripadaju ježevi. tzv. Vrsta vinski kvasac (Sacharomyces ellipsoideus) uzročnik je alkoholnog vrenja. ličinka. KULTURA TKIVA. KUTIKULA (grč. bezkrilci. Na glavi imaju 1 par ticala i 1 par složenih očiju. kemijski spoj ugljikohidrat iz skupine disaharida. Imaju slab vid. voštana prevlaka epidermalnih stanica koja zaštićuje biljku od prevelikog gubitka vlage. Ženke odlažu oplođena jaja na različita mjesta prema načinu života. lizanje (pčela). rakovi. Na njega se nastavlja ljestvičava živčana vrpca trbušnom stranom tijela. da ga ne razgrade probavni enzimi. v. v. uzgoj stanica i tkiva izvan organizma na posebnim hranjivim podlogama u strerilnim uvjetima. jednostanične gljivice mješinarke koje stvaraju kolonije u obliku razgranatih lanaca. sisanje (leptir). Na leđnoj je strani žila koja čini srce. metilja. Kod nepotpune preobrazbe nema stadija kukuljice. njuh. skupina primitivnih kopnenih sisavaca s kratkim oštrim zubima. Oko usta su 3 para usnih organa koja mogu biti za: grizenje (hrušt). Kukci su razdvojenog spola. Krv ne prenosi kisik. Neki uzrokuju štete u poljoprivredi i šumarstvu. Dišu uzdušnicama koje se otvaraju parnim odušcima na zatku. Laktoza se sastoji od jedne molekule glukoze spojene s jednom molekulom galaktoze. bjelančevinasti zaštitni sloj. KULTURA STANICA. 77 . isp. KVAŠČEVE GLJIVICE (saharomiceti). toplinu. npr. enzimi L LAKTOZA (mliječni šećer). buha kuge).____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE na glavu. KVADRATNA KOST. Zvučne signale primaju pomoću timpanalnih organa. Razmnožavaju se pupanjem. rijetko askosporama. Oči se sastoje od velikog broja okašaca. pa kukce i male životinje love uglavnom pomoću osjetila njuha. okus i vid. Kod vodenih biljaka ne postoji. Ličinke se presvlače nekoliko puta i tada mogu rasti.

Cvjetovi su dvospolni. resoperke. 78 . LEĐNA MOŽDINA. pore na oplutjelim tkivima čiji se otvor ne može regulirati. v.. LEPRA (guba). Van LEEUWENHOEK A. To su osjetilna i motorička vlakna refleksnih lukova. prvi ugledao živi jednostanični organizam. su monociti i limfociti. (kralježnična moždina. Mnoge se vrste uzgajaju za ishranu domaćih životinja. Kroz sredinu sive tvari prolazi središnji kanal ispunjen moždano – kralježničkom tekućinom (cerebrospinalni likvor) koji povezuje leđnu moždinu sve do šupljih komora unutar velikog mozga ispunjenih tekućinom (likvorom). Lepirnjače su važne i zbog simbioze s bakterijama.ispunjen je očnom vodicom. djetelina i lucerna. pa se zovu i mahunarke. pore na kori bazge. su segmentirani granulociti. Lepirnjačama pripada naše poznato povrće. cvijet. LEUKOCITI (bijele krvne stanice) se dijele po obliku jezgre na segmentirane i nesegmentirane te da li imaju zrnca (granule) u citoplazmi nekih stanica (granulociti) ili ne (agranulociti). LANDSTEINER. v. bakterijama uzrokovana bolest. LENTICELE. LATERALNI MERISTEMI. agranulociti. – 1829. god.. otkrio prve antigene. U leđnu moždinu ulaze i izlaze živčana vlakna na prednjim i stražnjim rogovima. K.). bazofilni i neutrofilni leukociti. god. sastavni dio središnjeg živčanog sustava svih kralje-žnjaka.). koji su dobili imena prema afinitetu na kisele i lužnate boje. LEUCIN. npr. teška i dugotrajna. kemijski spoj iz skupine aminokiselina.. LETALITET. LAP. rak bijelih krvnih stanica. a unutarnji dio siva tvar (u obliku leptira). nitrogene bakterije. Plod je mahuna. nalazi se odmah iza šarenice i zjenice. konstruiravši mikroskop s jed- nom lećom. a 1940. smrtnost. god. Karakterizira je nenormalan rast i razvoj limfocita (limfatična leukemija) ili neutrofilnih leukocita (mijeloična leukemija). LEPIRNJAČE. Prostor između rožnice i leće . v. bob i leća. grah. (1632. Eozinofilni. LEĆA (lens). medulla spinalis). bočni meristemi LATIMERIJA. J. Vanjski dio čini bijela. (1868. LETALNE ILI SMRTONOSNE MUTACIJE. – 1943. Karakterizira je smanjena otpornost na infekcije. v.prednja očna komorica . Nesegmentirani leukociti. Pričvršćena je naokolo tankim nitima cilijarnog tijela koje mijenja sferni oblik leće i tako je prilagođava (akomodira) za gledanje blizu odnosno daleko. (1744. Kao i mozak građena je od sive tvari koju čine tijela živčanih stanica i bijele tvari koju čine živčana vlakna. U čovjeka je smještena u gornje dvije trećine kralježničnog kanala. austrijski istraživač koji je 1900. Vjenčić ima leptirast oblik (ime!) i sastoji se od pet latica.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ LAMARCK. Listovi su im perasto sastavljeni. LEUKEMIJA. npr. skupina pretežno zeljastih biljaka dvosupnica. zajedno s Winerom otkrio Rhesus faktor. – 1723.). Iza leće je stražnja očna komora ispunjena staklovinom. nizozemski prirodoslovac koji je 1674. grašak. povećanost limfnih čvorova i slezene i opća slabost.. francuski zoolog tvorac prve potpune teorije evolucije nazvane lamarkizam. čirevi u ustima. mutacije koje obično dovode do smrti organizma.

stanice koje proizvode različite vrste specifičnih protutijela (antitijela). Limbični sustav ulazi u sastav moždanog debla. v. leukemija. stanje smanjenog broja leukocita u krvi. LIMFOCITI B. Isp. a u čvoru je više limfatičnih čvorića (folikula) u čijim središtima se nalaze matične stanice za stvaranje limfocita. LEUKOCITURIJA. nositelji tzv. LIMFNI ČVOROVI. LEUKOPENIJA. bjelančevina nazvanih imunoglobulini (Ig). sudjeluju u specifičnoj i nespecifičnoj staničnoj imunosti. različitim otrovima. LIMBIČNI SUSTAV. vrsta leukocita. ubrajamo ih u skupinu organela čiji je zajednički naziv plastidi (isp. Dolaze u svim biljnim dijelovima (bezbojna primarna kožna tkiva listova i stabljika). LIMFATIČNE STANICE. srca. v. a glavna joj je uloga donošenje suvišne tkivne tekućine u krv. Neutrofili imaju sposobnost fagocitoze (isp. stanične imunosti organizma jer je posredovana stanicama (limfocitima).____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE Neutrofili i limfociti igraju važnu ulogu u zaštiti tijela. LIMFATIČNA LEUKEMIJA. korijen) biljaka. a po sastavu se razlikuje od krvi jer ne sadrži eritrocite. LIKOVNICE. lijekovima i dr. v. LIMFOCITI T. jer nakon što su bili u kontaktu s nekim antigenom (npr. vrsta leukocita. Mnogo ih je na mjestima gdje je moguć prodor zaraznih klica (u plućima. LIMFA. Njihov broj je kod pojedinih ljudi različit (na crijevu čovjeka ih ima oko 30 000). stanični organeli. U muškaraca je hormon LH nazvan hormon za stimulaciju intersticijskih stanica (ICSH). najmekši dio kostura.). a limfociti protutijelima štite tijela od zaraze. npr. crijeva i žučne vrećice. limfociti T i limfociti 0. Teče u jednom smjeru. LEYDIGOVE STANICE. Ne sadrže biljna bojila. Raz- 79 . To su limfociti B.). potporno staničje. intersticijske stanice. dio velikog mozga u kojem se procjenjuju doživljaji i osloba- đaju emocionalne reakcije. LIMFOCITI 0. specifične imunosti. mikrobom) sazrijevaju u plazma . krvna tjelešca. tjelesna tekućina koja teče limfnim žilama. gomolji. Leukoplaste u kojima se šećer pretvara u škrob u obliku velikih škrobnih zrnaca nazivamo amiloplasti. Građeni su od čvrstog vezivnog tkiva u kojem ima elastičnih niti. "stanice ubojice" (limfociti K i NK). bijes i veselje. isp. LH (luteinizirajući hormon). stanica nositelja tzv. vrsta leukocita. nakupine limfnoga tkiva u vezivnoj čahuri razmještene po čitavom tijelu. jedan od tri gonadotropna hormona kojega izlučuje prednji režanj hipofize (adenohipofiza). a pretežito se nalaze u spremišnim tkivima i organima (sjemenke. humoralne imunosti. Uzrok može biti u infekciji odnosno u povećanoj obrambenoj aktivnosti zaraženog tijela. crijevu te ispod površine kože). Sudjeluje i u prijenosu probavljenih masti iz crijevnih resica u krvotok. LEUKOPLASTI. stanje povećanog broja leukocita u krvi. LEUKOCITOZA. od tkiva prema srcu. stanice u koje su uključeni svi razvojni oblici limfocita. Pojedini limfni čvor sastoji se od kore i srži. nositelji tzv. Ligamenti omogućuju pokretljivost zglobova upravljanu kontrakcijom mišića. LIGAMENTI (sveze). a impulsi utječu i na rad npr. pojava leukocita u mokraći kod nekih bubrežnih bolesti. Može biti uzrokovana zračenjem.

v. Najčešće se razmnožavaju soredijima. Alge pribavljaju organsku hranu za oboje. Udružuju se u spužvasto tijelo koje također zovemo micelij. U jesen postupno gube tanku ljetnu dlaku i raste im debela sa zimskom poddlakom. v. prebacujući ga u mišiće i jetru. LIPOPROTEIN MALE GUSTOĆE (LDL). LINJANJE. LIŠAJEVI (Lichenes).). vodik i kisik. LIMFOPENIJA. LIST.Neki lišajevi imaju plodišta poput trubica u kojima je himenij s askusima. LINIJA. Dio prenesenog kolesterola taloži se u stijenkama krvnih žila i pridonosi nastanku ateroskleroze. LIPIDI. LIMFOCITI. LIPAZE. kada nestaje debele dlake. enzimi iz skupine hidrolitičkih enzima koji sudjeluju u razgradnji lipida na njihove sastavne dijelove. linearno. Listovi se mogu preobraziti u trnove. U lipide ubrajamo i masti koje su po svom kemijskom sastavu esteri trovalentnog alkohola glicerola i viših masnih kiselina. LINEARNI POREDAK GENA. Drugo linjanje je u proljeće.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ likujemo regulacijske (pomagačke i supresijske) i izvršne (efektorske) limfocite. geni su u kromosomima pravilno poredani u nizu. zeleni organ u kojem se odvija fotosinteza. stanje smanjenog broja limfocita u krvi. LIPOPROTEIN VELIKE GUSTOĆE (HDL) uklanja kolesterol iz krvi. vitice. netopljivi su vodi. u hladnim područjima imaju debelo krzno i linjaju se dva put godišnje. to su supke ili kotiledoni (dijelovi embrija ili klica). prebacujući ga u mišiće i jetru. LITOSFERA. Ima sisavaca koji mijenjaju dlaku postupno čitave godine bez obzira na godišnja doba. što je dokazao Morgan na temelju krosingovera (isp. životni oblici. primjer simbioze dvaju različitih organizama gljive i alge. U lipide ubrajamo i fosfolipide koji izgrađuju stanične membrane te steroide u koje ubrajamo spolne hormone. Životinje koje žive npr. Gljive su mješinarke ili stapčarke. LIMFOCITOZA. C. Prvi se listovi razlikuju od pravih. Pioniri su vegetacije na Zemlji. vitamin D.). Mogu biti vrlo različitih oblika. svojta. ali su topljivi u organskim otapalima. LINNE. (1707. prenosi kolesterol iz jetre u ostale dijelove tijela. Zaslužan za uvođenje binarne nomenklature.-1778. švedski prirodoslovac. LIPOPROTEIN VRLO MALE GUSTOĆE (HLDL). osnivač taksonomije ili sistematike. Tri su glavna dijela lista: plojka. Alge su zadržale sposobnost samostalnog života. krvotvorni organi. a gljive pružaju algama zaštitu. LITORAL. čvrsti dio Zemlje. leukociti. mijenjanje dlake kod sisavaca. uklanja kolesterol iz krvi. čestice različitih masti i bjelančevina. 80 . Nalaze se na stabljici. lisnate i grmaste lišajeve. vodu i minerale. najčešće kao prilagodba na promjene temperature u okolišu. kolesterol itd.. peteljka i podina ili lisna baza. v. Dijele se prema obliku na koraste. LIMFOPOEZA. stanje porasta broja limfocita u krvi. organski spojevi koji sadrže ugljik. zaštitne i pricvjetne listove te cvijetne dijelove. a alge su jednostanične zelene ili modrozelene. obalni pojas razine vode za vrijeme plime i oseke. hormone kore nadbubrežne žlijezde.

Pioniri su vegetacije. Pomoću enzima razgrađuju složene organske spojeve i zbog toga imaju funkciju staničnog probavila. v. gonadotropni hormoni. voće i dr. pokretljivim prstima na dugačkim rukama i nogama te plosnatim noktima. Služi za dokazivanje škroba s kojim daje ljubičastomodru boju.66 %) i joda (0. elementarni sastav. orangutan. LUTEOTROPNI HORMON. Razvili su se vjerojatno od primitivnih kukcojeda. Žive u toplim dijelovima Azije. kopnene biljke kojima se gametofit (steljka ili talus) prilagodio životu na kopnu. v. a sadrže hidrolitičke enzime. LUGOLOVA OTOPINA. LTH (luteotropni hormon). afrički mandril) i čovjekolike majmune (npr. sastoji se od. uskonosce (npr. Ošteti li se njihova membrana počinju razgrađivati vlastitu stanicu. ptice. Afrike i Amerike. gorila). Dijele se na polumajmune i prave majmune. Palac mogu primicati svim ostalim prstima i tako dobro obuhvaćati grane. u vodi otopljenih.v. LH. čimpanza.svitkovci. prava stabljika ili pravi listići. v. Majmuni jedu gotovo sve. kemijski spoj iz skupine aminokiselina. Polumajmuni su primitivniji i žive na drveću.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE LIZIN. Danas sudjeluju u stvaranju sedrenih barijera u vodotocima. LUTEINIZIRAJUĆI HORMON. Većinom se zadržavaju na drveću. M MAHOVINE. Od njih je nastao tresetni ugljen u prošlosti. MAKROELEMENTI. skupina sisavaca s najrazvijenijim mozgom. kalijevog jodida (0. očima usmjerenim prema naprijed. LIZOSOMI. To nisu pravi korijen. stanični organeli obavijeni jednostrukom membranom. sifilis. MAKIJA. U određenom dobu godine na vrhu stabalca mahovine (nakon oplodnje) razvije se sporofit (sporogon) koji se sastoji od drška i tobolca za spore. Na gametofitu razaznajemo korjenčiće ili rizoide. LUES. v. plodove biljaka.33 %). stabalce i listiće. Pravi majmuni se dijele na širokonosce (na pr. LUBANJCI. makaki. sporangij mejoza sporogon spore zigota klijanje spore oplodnja arhegonij (jaje) prokličnica odrasla mahovina anteridij (muška gameta) sporofit (2n) gametofit (n) MAJMUNI. v. šikara. 81 . v. Najrasprostranjenija je skupina lemura. gonadotropni hormoni. To su mjehurići koji se odvajaju od Golgijeva tijela. gusta teško prohodna šuma karakteristična za Sredozemlje. kukce. četkasti kromosomi. kapucini). LUMP BRUSH KROMOSOMI.

MALPIGHIJEVE CJEVČICE. Nemaju parapodije. Na pojedinim su susjednim kolutićima jako razvijene žljezdane stanice koje luče sluz i stvaraju zadebljanje . Žive na kopnu i u slatkim vodama. u veliki optok krvi. Nukleinske kiseline izgrađuje veći broj nukleotida.-1694.) i bradnjaci su bilateralno simetrične pokretne životinje koje ruju po morskom dnu. Kontrolira mišićni tonus. koljena). Građen je od vanjske sive i unutarnje bijele tvari. ali i fermentacije različitih sireva (rupice!). MALI (plućni) OPTOK KRVI. te opisao živce. mutacije u genu koji kontrolira bitne metaboličke procese u organizmu. a odatle snažnom kontrakcijom u aortu tj. osigurava ravnotežu. Najpoznatiji su lovkaši. sjemeni zametak. koja živi u tlu. velike molekule građene od većeg broja manjih podjedinica. Po njemu je nazvano Malpighijevo tjelešce u nefronu bubrega i Malpighijev sloj kože. životinje iz skupine bezkralježnjaka. MALARIJA. sjemeni zametak. Duž tijela su poredane četine. stoji u temelju kvarenja maslaca. ježinac. To su cjevasta izbočenja crijeva u tjelesnu šupljinu. isp. leži u stražnjem dijelu lubanje. žiroglavci. Najpoznatija vrsta je gujavica. bradnjaci i streličari. a jedna se razvija u embrijsku vrećicu. koordinira mišićne kretnje. v. a simetrija tijela je kod nekih oblika prešla iz dvobočne u zrakastu simetriju. ispod velikog mozga. MAKROSPORA. MALOČETINAŠI. Postepeno se smanjio broj kolutića. M. porodica. talijanski biolog. Time je ona jedina preživjela makrospora iz koje će se razviti ženski gametofit (haploidna generacija). kožu i bubreg. Tijekom sistole lijeve pretklijetke krv se potiskuje u lijevu klijetku. Preci su im davni kolutićavci koji su prešli na sjedilački ili polusjedilački način života. Ima dvije hemisfere. MALOKOLUTIĆAVCI (Oligomeria).). a bjelančevine veći broj aminokiselina. mikroskopom proučavao građu životnja i prvi vidio kapilare. MAKROSPOROGENEZA. redova.. deoksigenirana (venska) krv se iz srca sistolom (kontrakcijom) desne klijetke izbacuje u plućnu arteriju odnosno u pluća. Temeljna reakcija je: 82 . plazmodij. organi za izlučivanje i osmoregulaciju tjelesnih tekućina kod većine člankonožaca: klještara i uzdušnjaka. MALPIGHI. proces kojim se matična stanica embrijske vrećice u biljaka dijeli mejozom dajući četiri haploidne stanice od kojih tri propadaju. MALI MOZAK (cerebellum). životinje iz skupine kolutićavaca. Produkti izmjene tvari filtriraju se u cjevčice i pražnjenjem crijeva izlaze van. Žiroglavci (isp. MAKROMUTACIJE.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ MAKROEVOLUCIJA (adaptivna radijacija). Najvažnije makromolekule živih organizama su nukleinske kiseline i bjelančevine. zvjezdača i zmijača). ticala ni oči. Tu će se hemoglobin iz krvi osloboditi viška ugljikovog dioksida i obogatiti kisikom (oksigenirati). razreda. MAKROSPORANGIJ. bodljikaši (trp. Iz pluća se oksigenirana (arterijska) krv vraća u lijevu pretklijetku kroz dvije plućne vene. MASLAČNO VRENJE. MAKROMOLEKULE. evolucijski procesi iznad razine vrste koji vode nastajanju viših sistemskih grupa odnosno velikih skupina (rodova. (1628. v. v. Klitelum služi pri razmnožavanju i stvara ovojnicu (kokon) oko oplođenih jaja koja ostavlja u zemlji.pas ili klitelum.

anafaza I i telofaza I. benzenu. Ne otapaju se u vodi. Time će se ponovno uspostaviti potrebna koncentracija testosterona u krvi. MEJOZA I (prva mejotička dioba). a druga je slična mitozi. dioba kojom počinje nastanak spolnih stanica. Mejoza se sastoji od dvije uzastopne diobe od kojih je prva redukcijska (mejoza I). ateroskleroza. tijela i vrata (cervix) maternice. spermiji. Ako nastaju ženske gamete. krosingover). v. metafaza I. redukcijska dioba). njemački znanstvenik koji je istraživao mozaičnu bolest duhana. v. MASTI. Najvažnija zbivanja u mejozi I su redukcija broja kromosoma te rekombinacija homolognih kromosoma (isp. a u trudnoći stvara posteljicu. MAYER. a lovke su na rubu zvona. a nastaju li muške gamete. Vrat maternice vodi u rodnicu. govorimo o oogenezi. MEGAKARIOCITI. Unutarnja je stijenka maternice obložena sluznicom (endometrijom) koja se u vrijeme menstruacije oljušti. v. Osnovna značajka mejoze je da u njoj dolazi do redukcije broja kromosoma. MEDUZA. A. U sastavu masnih kiselina dominiraju zasićene masne kiseline. Sastoji se od 4 uzastopne faze: profaza I. v. mehanizam povratne sprege. složeni organski spojevi sastavljeni od trovalentnog alkohola glicerola i masnih kiselina. Meduza je slobodno plivajući oblik. stanična dioba kojom nastaju spolne stanice. MEDICINSKA MIKROBIOLOGIJA. Prema tom principu svaka promjena koncentracije nekog hormona u krvi utječe na rad hipotalamusa i hipofize koji će normalizirati koncentraciju tog hormona. evolucija osnovnih i najviših sistematskih skupina živoga svijeta prilikom prijelaza živog svijeta iz jednog medija u drugi primjerice iz vode na kopno. Na primjer. jedan od morfoloških oblika kod žarnjaka. MEJOZA (zoridbena dioba. Proces nastajanja gameta mejozom naziva se gametogeneza. Kroz taj kanal izlazi menstruacijska krv.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE C6H12O6 → 2CO2 + 2H2 + energija + + 2CH3CH2CH2COOH maslačna kiselina MASNE NASLAGE (aterom). princip na kojem se temelji rad svih žlijezda s unutarnjim izlučivanjem. organ u kojem se razvija plod (kod većine sisavaca). MEHANIZAM POVRATNE SPREGE (mehanizam povratne veze). Sastoji se od dna. gamete.. 83 . Stanice (gamete) koje nastaju mejozom su genetički različite zbog pojave crossing overa. a u maternicu ulaze spermiji. ali se dobro otapaju u eteru. jajne stanice. Usna (oralna) strana je u unutarnjosti. Ti faktori potaknut će izlučivanje gonadotropnih hormona iz adenohipofize koji će zatim povećati izlučivanje testosterona iz testisa. mišićni organ smješten u donjem trbuhu. krvotvorni organi i koštana moždina. MEGAEVOLUCIJA (aromorfoza). smanjena količina muškog spolnog hormona testosterona u krvi potaknut će izlučivanje faktora oslobađanja gonadotropnih hormona iz hipotalamusa. Tako iz jedne stanice s diploidnim brojem kromosoma (2n) nastaju 4 stanice s haploidnim brojem kromosoma (n). kloroformu i sl. Izgledom je slična zvonu ili klobuku. U stanici služe kao pričuva energije. MEHANIZAM POVRATNE VEZE. Pretpostavlja da je uzročnik te bolesti sitna bakterija. Kod žena je to kruškoliki. tada govorimo o spermatogenezi. MATERNICA (uterus). mikrobiologija.

U njima se iz aminokiseline tirozina uz pomoć enzima fenol . ticala i osfradiji.j. MELIORACIJE. dio plašta kod kopnenih puževa. prvo menstrualno krvarenje iz spolovila u djevojčica u pubertetu. proteini koji dolaze u sastavu stanične membrane. – 1884. opsežni zahvati isušivanja močvarnih terena. Najrasprostranjeniji mekušci su: puževi.smeđi ili žuti) koji koži daju boju. Optjecajni sustav je otvoren t. Pigment se u melanocitu nalazi u melanosomima koji štite kožu od štetnog djelovanja ultraljubičastih zraka.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ MEJOZA II (druga mejotička dioba). Srce je građeno od klijetke i jedne ili više pretklijetki. MELANOM. beskralježnjaci. a rjeđe u mrežnici oka. melanociti. objasnio mehanizme prenošenja nasljeđa s roditelja na potomstvo. Mekušci su bogati bjelančevinama i vitaminima pa se rabe za hranu. Probavilo je prohodno. Neki od njih su i enzimski aktivni. MEKUŠCI (Mollusca). stanice koje se nalaze između bazalnih stanica epiderme kože. MELANOCIT STIMULACIJSKI HORON (MSH). Mekušci su razdvojena spola. (1822. Organi za disanje su škrge (ktenidije) ili "pluća" t. U ustima je trenica ili radula. Živčani sustav se sastoji od više parnih ganglija međusobno povezanih živčanim vrpcama. maligni tumor koji se najčešće javlja u koži. kopnenim vodama i na kopnu. Pretjerano izlaganje kože ultraljubičastim zrakama može dovesti do pojave tumora –melanoma. MENDEL. luči ga srednji režanj hipofize. melas = crn). Zbivanja tijekom mejoze II slična su zbivanjima tijekom mitoze (isp. najrazvijenija i vrstama najbogatija skupina beskolutićavaca. Na tijelu se mogu razlikovati: glava. dioba kojom završava nastanak spolnih stanica. školjkaši i glavonošci. v. melanociti. v. a služi za raspodjelu kožnog pigmenta melanina. Poznati su Mendelovi zakoni u kojima je iznio osnovne zakonitosti nasljeđivanja. krv istječe iz krvnih žila i oplakuje tkiva i organe. Mekušci su većinom bilateralno simetrični. melanociti.MSH (melanocit stimulacijski hormon) iz srednjeg režnja hipofize. MENARHA. v. MELANOCITI.oksidaze i drugih sintetizira pigment melanin (crni) i feomelanin (crveno . zakoni nasljeđivanja koje je postavio Mendel radeći 84 . MEMBRANSKI PROTEINI. mišićavo stopalo i utrobna vreća s unutarnjim organima. Tumorske stanice sadrže različite količine melanina. anafaza II i telofaza II. Proizvodnja pigmenta u koži pod kontrolom je hormona .). Tijelo je mekano i obavijeno plaštem. češki znanstvenik koji je godine 1865. Žive u moru. G. MENDELOVI ZAKONI. Za izlučivanje imaju metanefridije. Sastoji se od 4 uzastopne faze: profaza II. Poznato je više od 100 000 vrsta. MELANIN (grč. Neki su proteini samo djelomično uronjeni u dvosloj fosfolipida dok se drugi protežu kroz čitavu debljinu lipidnog dvosloja tvoreći proteinske “kanaliće”. dijelova mora i reguliranje tekućih voda u svrhu dobivanja plodnog i obradivog tla. pigment crne boje koji se stvara u koži kao zaštita od štetnog djelovanja UV zraka. metafaza II. Oplodnja je vanjska ili unutarnja. Osjetni organi su oči. Ličinački stadiji su trohofora i velinger-ličinka. ali ima i dvospolaca. Probava je izvanstanična (u želucu) i unutarstanična (u probavnoj žlijezdi).). Plašt izlučuje vapnenu ljušturu: kod puževa jednodjelnu (kućicu) a kod školjkaša dvodjelnu (školjku).j. statocisti. Krvni ili dišni pigment se naziva hemocijanin.

tj. mjesečnica. 2. Druga faza je ovulacijska faza.plodnih i neplodnih dana. svi potomci F1 generacije su međusobno jednaki. a započinju u pubertetu.bazalne temperature. MENINGITIS. benignim tumorm maternice. D . C . kao npr. maternica se priprema za prihvat zametka ako dođe do oplodnje. miomom. Mogu biti uzrokovane hormonalnim poremećajem ili različitim patološkim razlozima. Zakon jednoličnosti (uniformnosti) F1 generacije: križaju li se homozigotni roditelji. upala mozgovnih ovojnica i leđne moždine mikroorganizmima iz krvotoka ili onima koji su dospjeli u tijelo ozljedom glave. faza s povećanom sek- 85 . Postoje tri Mendelova zakona: 1. Prva je folikularna faza koja počinje mjesečnicom. uz izbacivanje većih ugrušaka krvi.količine gonadotropnih hormona. Zakoni vrijede kod biljaka.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE pokuse s biljkama. Istovremeno. v. U toj fazi u jednom mjehuriću započinje sazrijevanje jajne stanice (traje oko 12 dana). MENSTRUACIJA. obično svakih 28 dana. Zakon nezavisnosti nasljednih faktora: kada se križaju jedinke s više svojstava pojedina se svojstva nasljeđuju nezavisno. životinja i čovjeka. Menstrualni ciklus se dijeli u tri uzastopne faze. MENSTRUALNI CIKLUS (menstruacijski ciklus). Zakon cijepanja (segregacije) svojstava u F2 generaciji po stalnim brojčanim odnosima: međusobnim križanjem jedinki F1 generacije nastaju potomci s različitim svojstvima i to: a) kod monohibridnog križanja s dominacijom u omjeru 3:1 u korist dominantnog oblika. Prikaz promjena tijekom menstrualnog ciklusa: A . b) kod monohibridnog intermedijarnog križanja u omjeru 1:2:1. B – količine estrogena i progesterona. a završava se ovulacijom i traje 2 do 3 dana. obilne menstruacije koje traju dulje od sedam dana. MENORAGIJE. menstruacijskim krvarenjem (3 do 5 dana). tj. 3. u kojoj jajna stanica konačno dozre. Tada iz spolnih centara u mozgu dolaze impulsi do hipofize u kojoj se počinju izlučivati gonadotropni hormoni koji pak u jajnicima potiču sazrijevanje jajnih stanica i izlučivanje žen- skih spolnih hormona. U slučaju da jajašce nije oplođeno sluznica maternice se ljušti i ta se pojava naziva menstruacija ili mjesečnica koja se ponavlja u pravilnim razmacima. Treća je sekrecijska faza. što znači da se aleli u zigoti ne spajaju nego samo mozaično kombiniraju. ženski spolni ciklus karakteriziran periodičkim promjenama koje se odvijaju u jajnicima i maternici.

preobrazba. METANEFROS. MERISTEM. karnivorne biljke. jedna od etapa stanične diobe . METABOLIZAM MASTI. beskolutićave životinje koje pripadaju koljenu plošnjaka. U metafazi II broj kromosoma u svakoj stanici je polovičan (haploidan) s obzirom na broj kromosoma na početku mejoze I. v. isp. masti i bjelančevina iz hrane. jedna od etapa mejoze II u kojoj su jednostruki kromosomi smje-šteni u središnjoj ili ekvatorijalnoj ravnini. skup svih biokemijskih reakcija u organizmu kojima se iz masti dobiva energija. MESOJEDI. v. Polipi mnogih obrubnjaka i režnjaka pupanjem stvaraju meduze koje se otkidaju i kada postanu spolno zrele proizvode jaja i spermije. a najčešće je to puž. jedna od etapa redukcijske diobe mejoze I u kojoj su konjugirani kromosomi (spareni homologni kromosomi) smješteni u središnjoj ili ekvatorijalnoj ravnini. kemijski spoj iz skupine aminokiselina. isp. METANEFRIDIJI. U cjevčicama se stvara mokraća i izbacuje kroz otvore metanefridija van. METIONIN. kromosom koji ima svoju pričvrsnicu u sredini. Nakon oplodnje razvija se trepetljikava ličinka planula koja se pričvrsti za dno i razvije u polip. (metafaza prve mejotičke diobe). v. metafaza I. METABOLIZAM PROTEINA. zoofagi. v. v. METAFAZA PRVE MEJOTIČKE DIOBE. METAMORFOZA. v. organi za izlučivanje kod mekušaca i kolutićavaca. Traje 13 do 14 dana. treći bubreg. v. MESOJEDNE BILJKE. METAFAZA DRUGE MEJOTIČKE DIOBE. mnogostanične životinje. Anaerobni su organizmi kao i drugi crijevni nametnici. Najprepoznatljivija vrsta je ovčji metilj. metafaza II. METAFAZA I. S padom koncentracije estrogena i progesterona nastupa opet mjesečnica. METILJAVOST. To su otvorene cjevčice koje na vrhu imaju trepetljikavi lijevak koji skuplja izlučevine iz tjelesne šupljine.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ recijom hormona progesterona i estrogena. tvorno staničje. v. skup svih biokemijskih reakcija u organizmu kojima se iz ugljikohidrata dobiva energija. Metabolizmom proteina upravljaju hormoni iz kore nadbubrežne žlijezde. MEROZOITI. METACENTRIČAN KROMOSOM. 86 . Tijelo im je prekriveno kutikulom i imaju prianjalke na prednjem dijelu tijela. Dvospolci su i za razvitak im je potreban barem jedan međudomadar. (metafaza druge mejotičke diobe). METAZOA. v. karnivori. METAFAZA II. METAGENEZA. skup svih biokemijskih reakcija u organizmu kojima se iz proteina dobiva energija. ovčji metilj. plazmodij. METILJI. METABOLIČNA VODA je voda koja nastaje tijekom metabolične razgradnje ugljikohidrata. Opisano je oko 11000 vrsta metilja koji su nametnici u probavilu sisavaca. METABOLIZAM UGLJIKOHIDRATA. izmjena nespolne generacije sjedilačkih polipa i spolne generacije meduza u životnom ciklusu žarnjaka. v.mitoze u kojoj su kromosomi pravilno smješteni u sredini stanice u središnjoj ili ekvatorijalnoj ravnini pričvršćeni za niti diobenog vretena. isp. METAFAZA.

specijalizirano za obavljanje procesa fotosinteze.). leukemija.). MIKROSFERE. fyllon = list). v. v. MIKOPLAZME (mikopazmodiji). stolić. fyton = biljka). a obavijene su plazmatskom membranom. bolest prekomjernog umnožavanja plazma . okrugla tjelešca proteinskog sastava slična jednostavnim živim stanicama.3 μm) i najjednostavniji prokarioti (isp. MEZOFIL (grč. Zbog velikog područja istraživanja i široke primjene mikrobiologija se dijeli na mnogo grana. gastrulacija. industrijska mikrobiologija itd. stalak. najmanji (0. tubus. limfatički organi itd. v. veliki i mali vijak. U kralježnjaka. srce i krvne žile. gastrulacije u nekih bezkralježnjaka (npr. Optički 87 . kosti. MIKROSKOP. MIKOPAZMODIJI. v.stanica u koštanoj moždini. Isp. v. MIKROPILA. MICELIJ. MIKROBIOCENOZA. Svjetlosni mikroskop građen je od mehaničkih i optičkih dijelova. elementarni sastav. mikoplazme. procesi evolucije u kraćim razdobljima koji se zbivaju na razini postanka vrste. Njegovi pokusi pridonijeli su razumijevanju razvoja živog svijeta na Zemlji. prehrambena mikrobiologija. hrskavica. združivanje gljiva i viših biljaka pri čemu hife gljiva obavijaju korjenje biljaka preuzimajući ulogu korijenovih dlačica od kojih su djelotvornije. MIJELOIČNA LEUKEMIJA. spolne žlijezde. iz mezoderma se razvijaju: mišići. Tu pripada većina kopnenih organizama. selidbe riba. Također i spužvasto tijelo lišajeva (isp. životinje prilagođene životu na umjereno vlažnim staništima. drugi bubreg. v. MEZONEFROS. MIGRACIJA RIBA. MIKROBIOLOGIJA. ježinaca) i svih kralježnjaka.1 – 0. MIKROMUTACIJE. Tu pripada većina našeg listopadnog drveća i kulturnih biljaka. MEZOSOMI. filos = prijatelj). Mehanički dijelovi su podnožje. mesos = srednji. tkivo lista koje se nalazi između gornje i donje epiderme. životinja i biljaka. ali za razliku od većine osta- lih prokariota ne sadrže staničnu stijenku. Njihove stanice sadrže i DNA i RNA. MIKROELEMENTI. MEZOFILNE ŽIVOTINJE (grč. medicinska mikrobiologija. MEZOFITI (grč. biljke prilagođene životu na umjereno vlažnim staništima. Neke mikoplazme uzrokuju bolesti čovjeka. mesos = srednji. tučak. biocenoza mikroorganizama. vegetativno tijelo gljiva izgrađeno od nitastih tvorevina zvanih hife. mesos = srednji. znanost koja se bavi proučavanjem mikroskopski sitnih organizama. instrument pomoću kojeg se mogu promatrati predmeti nevidljivi ljudskom oku. MIKORIZA. odnosno populacije. Mikrosfere je u svojim pokusima dobio američki biokemičar Fox. v. srednji zametni listić koji se formira tijekom druge etape embrionalnog razvoja. Nastaje iz dijela endoderma koji se useljava u prostor blastocela. a za uzvrat biljke gljive opskrbljuju organskom hranom. MIJELOM. otvor na sjemenom zametku.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE MEZODERM. bakterije. npr. mutacije gdje se teško uspostavi međuodnos između promjene genotipa i neke fenotipske karakteristike. MIKROEVOLUCIJA.

poprečnoprugasti mišić. a normalna frekvencija disanja oko 12 puta u minuti. MIKROSPOROGENEZA. mimeomai = oponašam). Na primjer. MIOKARD. Različiti mikroskopi imaju različitu moć razlučivanja (isp. Školski mikroskopi povećavaju 400-600 puta. prašnik. v. u laboratorijskim uvjetima dobio aminokiseline i neke druge organske spojeve. mineralne tvari. Mijenja se tijekom različitih aktivnosti tijela. cink (Zn) itd. S. Mg. proces kojim nastaju peludna zrnca (mikrospore). Pojedini elementi koji izgrađuju minerale su sastavni dio mnogih. MINERALNE TVARI (minerali). jod (I) je potreban za stvaranje hormona štitnjače. MINUTNI VOLUMEN DISANJA. Polarizacijskim mikroskopom vidljiva je fina građa i kristalna struktura preparata na osnovi pojave dvoloma svjetlosti pri prolazu kroz preparat. objektivi. v. volumen krvi koje srce utisne u krvotok u minuti. obilježje nekih životinja da bojom i oblikom tijela oponašaju druge životinje ili predmete iz svojeg okoliša u svrhu zaštite od neprijatelja. predatora. Fluorescencijski mikroskop omogućuje otkrivanje sitnih struktura preparata (stanične bjelančevine i dr. Jednak je umnošku dišnog volumena i frekvencije disanja. anorganski prirodni spojevi.). Normalni dišni volumen iznosi oko 500 ml. američki znanstvenik koji je. Optički dijelovi omogućuju osvjetljavanje i povećavanje promatranog predmeta. 70 x 70 mL = 4900 mL/min). MIMIKRIJA (grč. 88 . magnezij (Mg) je sastavni dio klorofila. (rođ. MINERALI. U biološkim istraživanjima koriste se i neki posebni tipovi mikroskopa: fazni mikroskop. 1930. imitirajući uvjete koji su vladali u prvom razdoblju postanka Zem- lje. bjelančevinasta molekula koja izgrađuje miofibrile. prašnik. a primjenom posebnih objektiva (imerzija) do 1000 puta. prašnik. isp. Miller. Fe. Elektronskim mikroskopom možemo vidjeti predmete promjera manjeg od 1 nm. minutni volumen disanja iznosi oko 6000 ml ili 6 litara u minuti (u mirovanju). Faznim mikroskopom mogu se istraživati neobojene stanične strukture koje se razlikuju samo u indeksu loma svjetlosti. Prema tome. je ukupna količina novog zraka koji svake minute dospije u dišne putove. npr.. MINUTNI VOLUMEN SRCA.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ dijelovi su kondenzor s iris-zaslonom. poprečno-prugasti mišić. polarizacijski i fluorescencijski mikroskop. MIOZIN. Umjesto staklenih leća koje ima svjetlosni mikroskop elektronski mikroskop ima prstenaste elektromagnete (elektronske leće). Mehanički dijelovi nose optičke dijelove i služe za njihovo pomicanje i namještanje predmeta promatranja. tanka proteinska vlakna koja izgrađuju mišićno tkivo. molekule) na osnovi fluorescencije. isp. MIKROSPORANGIJ. Umnožak je broja otkucaja srca u minuti i udarnog volumena srca (npr. v. MIOFIBRILE. Elektronski mikroskop umjesto vidljive svjetlosti koristi snop elektrona koji prolazi kroz tanki prerez mikroskopskog preparata čija slika postaje vidljiva na fluorescentnom zaslonu. okulari i kod nekih koji nemaju ugrađenu rasvjetu zrcalo. MILLEROV POKUS. bakar (Cu).). tiroksina. MIKROSPORA. srčani mišić. željezo (Fe) hemoglobina. MILLER. za život važnih spojeva. kalcij (Ca) kostiju i zubi. a mnogi su sastavni dijelovi enzima. v. v.

ovčji metilj. a unutarnjost im je ispunjena žitkom masom koja se zove matriks (matrix). Mješinice stručno zovemo askusima. postupak kojim se dolazi do kislog mlijeka i kupusa. kefira i sl. povećava se i ukupni broj miofibrila u vlaknu. Predstavnici mješinarki su kvaščeve gljivice. Temeljna značajka mitoze je da ovom diobom nastaju dvije stanice koje imaju isti. U mitohondrijima se odvija proces staničnog disanja pri kojem se dobiva energija potrebana za stanične aktivnosti. dojenju i klimakteriju. a uzrokovano je anaerobnim bakterijama. a spore askosporama. smrčci. v. Zbog toga se mitohondriji još nazivaju i “energetskim centralama” stanice. v. svakih 28 dana. Postoje tri vrste mišića: poprečnoprugasti mišići. MIŠIĆNA ATROFIJA. tartufi (gomoljače) itd. Menstruacijska krv je razgrađena sluznica maternice (endometrij) pomiješana sa krvi iz kapilarne mreže koja je hranila endometrij. laktoza. dioba somatskih (tjelesnih) stanica. poprečnoprugasti mišić. MIŠIĆNA HIPERTROFIJA. povećanje mišićne mase uzrokovano povećanom mišićnom aktivnošću. Mitarenje kontrolira štitna žlijezda. jogurta. ono otpada. npr. U osnovi je proces: C6H12O6 → 2CH3CHOHCOOH mliječna kiselina MNOGOČETINAŠI. mijenjanje perja kod ptica. v. Askusi se razvijaju na posebno građenom jednoslojnom plodištu. osim u trudnoći. MIŠIĆI. Promjeri pojedinih mišićnih vlakana postaju veći.. Imaju izraženu izmjenu generacija gametangiogamijom i kariogamijom. Budući da pero nije živa struktura. isp. mjesečno krvarenje kod žena koje se pojavljuje redovito.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE MIRACIDIJ. Obavijeni su dvostrukom membranom. Sastoji se od četiri glavne faze: profaze. menstrualni ciklus. MITARENJE. stanični organeli koji se nalaze u citoplazmi eukariotskih stanica. Mišići energiju dobivaju razgradnjom glukoze (reakcija glikolize) i glikogena. ribosomi. MJEŠČIĆNICE. kopnene gljive s micelijem građenim od vrlo dugih hifa s poprečnim stijenkama. Unutarnja membrana tvori mnogostruke nabore koji mogu biti u obliku grebena i pregrada (kriste) ili poput cjevčica. Imaju sposobnost umnožavanja neovisno od diobe stanice. U matriksu se nalazi DNA. Ptice se mitare jedanput ili dva put godišnje. dvostruki (2n) broj kromosoma kao i stanica od koje su nastale. većinom nakon sezone parenja. Povećava se kapilarna mreža i opskrba kisikom i hranidbenim tvarima. Lactobacillus bulgaricus i Streptococus lactis. U njima se nalaze dišni enzimi. isp. zelene plijesni. omogućuju pokretanje tijela i njegovih pojedinih dijelova. v. RNA. metafaze. MLIJEČNO-KISELO VRENJE. glatki mišići i srčani mišić koji se sastoji od poprečnoprugastih međusobno spojenih vlakana. kržljanje mišića uslijed slabe mišićne aktivnosti ili prestanka upotrebe pojedine skupine mišića. Mišić postaje tanji i slabih kontraktilnih sposobnosti. plaštenjaci. MJESEČNICA (menstruacija). Žive u moru kao pokret- 89 . životinje iz skupine kolutićavaca. skraćivanjem (kontrakcijom) i opuštanjem (relaksacijom). MLIJEČNI ŠEĆER. v. Prijenos podražaja sa živca na mišićno vlakno odvija se na živčano mišićnoj vezi. anafaze i telofaze. MITOZA. Spore im se razvijaju u mješinicama. himeniju. a staro se perje zamjenjuje novim. MITOHONDRIJI. MJEŠINARKE.

završni dio mokraćnog sustava. spore. pretpostavlja se da su odigrale odlučujuću ulogu u stvaranju atmosferskog kisika. Cjevaši izlučuju oko tijela cijev od vapnenca. Kao prvi pravi fotosintetski organizmi. Tijelo im je bilateralno simetrično i podijeljeno na kolutiće. mnogostaničari). modrozelene alge sadrže klorofil. Razlikujemo pet organizacijskih tipova: spužve. mnogokolutićavce. mokraćovod (ureter). MOKRAĆNI MJEHUR. Nicolson. ticala i pipala (palpi). U Jadranu su poznati: afroditin palolo i morska gusjenica. a služi za 90 . MNOGOKOLUTIĆAVCI (Polymeria). mokraćni mjehur i mokraćna cijev (uretra). Kod čovjeka se sastoji od nekoliko organa koji su smješteni u trbušnoj šupljini iza potrbušnice. izlučevina bubrega kojom se iz organizma odstranjuju čovjeku suvišne i štetne tvari topljive u vodi. sobni jaglac pri temperaturi od 10 °C cvate crveno. također prokariotskim organizmima. MOĆ RAZLUČIVANJA. MOKRAĆNI (urinarni) SUSTAV. Kod člankonožaca kolutićavost nije jasno izražena. MOKRAĆA (urin). neparni šuplji organ smješten u maloj zdjelici.Singer i G. a u žena samo mokraće. Mnogi ruju po dnu praveći hodnike. Na svakom kolutiću imaju parapodije na kojima su četine (hete). MNOGOSTANIČARI. Na primjer. Nikad nemaju bičeva. jednostanične biljke koje nemaju potpuno izgrađenu jezgru i zbog toga ih ubrajamo u prokariote. ali za razliku od bakterija koje sadrže bakterioklorofil. Mogu prijeći i u trajni oblik. Nemaju plastide.L. sustav organa koji mokraćom izlučuje štetne tvari iz organizma. To su bubreg. Negativni utjecaj ima njihovo naglo vegetativno razmnožavanje u moru poznato pod nazivom “cvjetanje mora”. nenasljedne promjene organizma nastale pod utjecajem okoliša. Prema tom modelu neke membranske bjelančevine su na površini (periferni proteini). Mogu se kromatski adaptirati. pripadaju im: kolutićavci i člankonošci. a time i u razvoju života na Zemlji. mnogostanične životinje. Njihova biomasa na kraju životnog ciklusa se i raspada uzrokujući onečišćenje. Najčešće se razmnožavaju vegetativno. Također provode fiksaciju dušika iz zraka. a druge su djelomice ili potpuno uronjene (integralni proteini) u dvosloj lipida. najbrojnija skupina beskralješnjaka. To su autotrofni fotosintetski organizmi. se sastoje od velikog broja specijaliziranih stanica različitih oblika. Svi imaju celom ili sekundarnu tjelesnu šupljinu. a pri 25 °C bijelo. MOKRAĆNA CIJEV (uretra). Svjetlosnim mikroskopom u najboljem slučaju mogu se razlučivati točke udaljene jedna od druge 0. malokolutićavce i svitkovce. sposobnost mikroskopa da dvije bliske točke prikaže razdvojeno. Unutarnji organi uglavnom prate vanjski kolutićavi raspored. U muškaraca služi provođenju i mokraće i sperme.2-0.4 μm. Na glavi su usta. MODIFIKACIJE (somatske varijacije). U osnovnoj građi su slične bakterijama. a elektronskim mikroskopom može se postići razlučivanje od 0. Raspored bjelančevina u membrani nije stalan već se mijenja ovisno o stanju stanice. mitohondrije ni golgijeva tjelešca. v. beskolutićavce.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ ni ili sjedilački oblici. oči.5 nm.J. model membrane koji su zamislili S. MODROZELENE ALGE (cijanobakterije). Po građi i funkciji različita je u muškaraca i žena.2-0. MNOGOSTANIČNE ŽIVOTINJE (metazoa. MODEL TEKUĆEG MOZAIKA.

MONOSAHARIDI. Sudjeluju u imunološkim reakcijama obradom antigena ili fagocitiraju raličite čestice. RNA i proteina. MOKRAĆOVOD (ureter). Ako se želi saznati da li je jedinka homozigotna (AA) za dominantno svojstvo ili heterozigotna (Aa) tada se provodi test križanje. F2. Dodatak 1. (V. građevne podjedinice polimera. ružičasti (genotip a1a2) i bijeli (genotip a2a2) u omjeru 1:2:1. tanka cijev dužine oko 25 cm koja se obostrano iz bubrežne nakapnice spušta u mokraćni mjehur s njegove gornje strane. MONONUKLEOTIDI. I u ovom primjeru križanja kao i u primjerima križanja s dominacijom. Razlika postoji u označavanju alela jer su ovdje aleli podjednako vrijedni te ih sve označujemo malim slovima (a1. jedan oblik križanja u kojem se prati nasljeđivanje jednog svojstva. a 25 % jedinki niskog rasta (aa) što znači da je omjer fenotipa 3:1. a recesivni malim. početna roditeljska generacija i generacije potomaka označuju se odgovarajućim slovima. Downov sindrom MONOCITI. v. shemu u Dodatku 1. isto što i nukleotidi. U F2 generaciji. npr. U prikazima križanja početna roditeljska (parentalna) generacija označuje se uvijek s P. Aa. a2). MONOHIBRIDNO INTERMEDIJARNO KRIŽANJE.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE skupljanje mokraće nastale u bubrezima. Posebice se bavi proučavanjem odnosa između makromolekula DNA. aA). znanost koja proučava životne procese u stanici na razini molekula. prokarioti. MONERE. nukleotidi nukleinskih kiselina. Međusobnim križanjem jedinki F1 generacije dobiva se potomstvo F2 generacije u kojem je 75 % jedinki visokog rasta (AA. uključujući mikroorganizme. v. pojavljuju se tri fenotipa: crveni (genotip a1a1). u ovom primjeru to je visina stabljike graška. Na izlasku iz mjehura je prstenasti mišić (sfinkter) koji je pod nadzorom simpatikusa i parasimpatikusa. MOLEKULARNA BIOLOGIJA. a nizak rast je recesivno svojstvo te ga označujemo malim slovom (a). ugljikohidrati. Aleli pojedinih svojstava označuju se slovima i to dominantni velikim slojevima.) MONOHIBRIDNO KRIŽANJE S DOMINACIJOM. oštećene ili mrtve stanice i nepotrebne bjelančevine. F3 itd. 91 . Mokraću iz mokraćnog mjehura odvodi izvan tijela neparna mokraćna cijev (uretra). pokretni leukociti. a jednostavni šećeri polisaharida. U sljedećem primjeru križanja početnu roditeljsku P (parentalnu) generaciju čine homozigotna crvena zijevalica (a1a1) i homozigotna bijela zijevalica (a2a2). spadaju u velike fagocite .) MONOMERI. Sfinkter se otvara refleksno kada tlak mokraće podraži receptore u stijenci mokraćnog mjehura. MONGOLIZAM. v. (V.makrofage. jedan tip križanja u kojem se prati nasljeđivanje jednog svojstva i u kojem nema dominantnog alela za takvo svojstvo. Prosječno može u odrasle osobe primiti oko 500 mL mokraće. aminokiseline su podjedinice proteina. Njihovim križanjem dobit ćemo u F1 generaciji sve ružičaste jedinke (a1a2) jer nema dominantnog alela pa se pojavljuje srednji (intermedijarni) fenotip. Visok rast je dominantno svojstvo te ga označujemo velikim slovom (A). P generaciju predstavljaju: homozigotni visoki grašak (AA) i homozigotni niski grašak (aa). koju dobijemo međusobnim križanjem jedinki F1 generacije. Njihovim križanjem dobit će se svi visoki potomci (Aa) koji predstavljaju F1 generaciju. a generacije potomaka (filijalne) prema redoslijedu s F1.

između kralježaka. Slika predmeta koja se stvara na "žutoj pjegi" je realna. v. MOŽDINSKI (kralježnički) ŽIVCI. moždani most i produžena moždina. tj. MUKOZA. Mjesto na kojem vidni živac izlazi iz mrežnice naziva se "slijepa pjega". vrat i unutarnje organe u prsnoj i trbušnoj šupljini. broj smrtnih slučajeva nekog područja u odnosu na cjelokupno stanovništvo. pokretački živčani sustav. Sastoji se od fotoreceptora: štapića i čunjića. brazdanje. Inerviraju glavu. Tijekom razvitka iz zigote višestanični životinjski organizmi mitotičkim diobama povećavaju broj stanica koje se pomiču zauzimajući nove položaje (morfogenetska kretanja) i tako stvaraju nove oblike zametka. izlaze iz baze velikog mozga ili ulaze u njega. MOŽDANI (mozgovni) ŽIVCI (nervi craniales). 5 pari slabinskih. MULTIPLI ALELI. nalazi se na prijelazu srednjeg mozga u produženu moždinu. Ima ih 12 pari. kožna vrećica u kojoj se nalaze testisi. čine ga međumozak. messenger RNA). izlaze iz leđne moždine. Mukoza oblaže želučanu stijenku kao obrana od razgradnje stijenke želuca pepsinom i kloridnom kiselinom. MORFOLOGIJA. Kroz njega prolaze živčani putovi koji povezuju produženu leđnu moždinu s velikim mozgom. krvne grupe čovjeka određene su s tri alela . MORFOGENEZA. mRNA (glasnička RNK ili gRNK. osjetilna i pokretačka živčana vlakna spajaju se u mješoviti živac koji ide prema periferiji tijela. tip ribonukleinske kiseline čija je uloga da na ribosom donosi informaciju o rasporedu dušičnih baza u molekulama DNA. informacijska RNK ili iRNK. MOŽDANI MOST (pons). motoričke i mješovite živce. a prema funkcionalnim značajkama mogu se podijeliti na: osjetilne. Nakon izlaska iz kralježnice. 12 pari prsnih. morfogeneza. v. iRNA. 5 pari križnih i 2 para trtičnih. proces koji omogućuje stvaranje specifičnih razvojnih struktura i oblika kojima se odlikuje svaki organizam. gastrulu. srednji mozak. hodanje i sjedenje. U jednom organizmu za jedno fenotipsko svojstvo 92 . sluz koju luče sporedne (mukozne) stanice gastričnih žlijezda. npr. umanjena i obrnuta. MORULA. v. MOŠNJA (scrotum). te velike motoričke jezgre koje imaju važnu ulogu u mišićnim radnjama kao što su: stajanje. MOŽDANO DEBLO. Podijeljeni su u pet skupina: 8 pari vratnih.A. a njihovim podraživanjem doživljavamo sve boje u vidljivom dijelu spektra. v. MOTORIČKI ŽIVČANI SUSTAV. B i 0. znanost koja proučava izvanjsku građu tijela svih živih bića. zelenu i crvenu). treći unutarnji sloj očne jabučice. MORSKA SALATA. U mrežnici se svjetlosni podražaj (elektromagnetski valovi svjetla) fotokemijskim procesima u štapićima i čunjićima pretvara u živčani podražaj i očnim živcem odvodi u središte za vid u stražnjem režnju velikog mozga. U njemu se nalaze živčana vlakna koja povezuju veliki i mali mozak. MREŽNICA (retina). neurulu.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ MORFOGENETSKA KRETANJA. a u vidnom središtu slika se uspravlja i usklađuje. Označuju se rimskim brojevima od I do XII. blastulu. moždani živci. zelene alge. Na primjer. v. MOZGOVNI ŽIVCI. Štapići su osjetljivi na intenzitet svjetlosti. MORTALITET (smrtnost). a čunjići na tri osnovne boje (modru. više od dva alela gena.

3. Činitelji koji izazivaju mutacije nazivaju se mutageni faktori. MUTAGENI FAKTORI. organizam ili stanica koja nosi mutaciju. v. NASLJEDNA TVAR ili DNA. dosjemenika ili pasjemenika. nitriti. proces prenošenja svojstava roditelja na potomke putem gena. S obzirom na uzroke mutacija razlikujemo spontane mutacije. Mogu biti pozitivne i negativne. NASLJEDNA UPUTA. mutacije građe kromosoma. radijacije. Prenose se spolnim načinom razmnožavanja. Mutacija osigurava nasljednu promjenljivost (varijabilnost). sjemenovoda i pomoćne spolne žlijezde prostate. sastoje se od unutarnjih organa: sjemenika. MUTACIJE (lat. Mutacije su stečene promjene koje je organizam stekao promjenom DNK. Ona se prenosi s generacije na generaciju. manganovi spojevi. 2. MUŠKI SPOLNI HORMONI. v. proflavin itd). a među životinjama metilji. nenamjerno izazvane nekim prirodnim fizičkim ili kemijskim faktorima i inducirane mutacije koje se namjerno izazivaju umjetnim putem. funkcije i razvoja stanice i cijelog organizma. v. NADMETANJE.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE mogu biti najviše dva različita alela. Na osnovi morfoloških ili kemijskih promjena kromosoma i gena razlikujemo tri vrste mutacija: 1. mutare = mijenjati). v. mutacije broja kromosoma. patuljasti rast. formaldehid. NAMETNICI (paraziti). Među biljkama poznati je parazit potajnica. filogenetski sustav. Pozitivne su mutacije one koje će pomoći potomcima bolje snalaženje u okolišu od svojih roditelja nasuprot negativnih mutacija. a to su različita zračenja dovoljne energije koja mogu izazvati promjene (npr. NANOSOMIJA. N NADCARSTVO. Ako do promjena dođe u tjelesnim stanicama tada ih nazivamo somatske mutacije i one se ne nasljeđuju. MUTUALIZAM. androgeni. v. NADP (nikotinamid-adenin-dinukleotidfosfat). Dođe li do promjena u rasplodnim stanicama ili u samoj zigoti tada se one prenose dalje na potomke. odnosno gena. trakavice itd. te vanjskih organa: spolnog uda i mošnje. v. v. kemijskih tvari itd. čime se zapravo omogućuje evolucija. 93 . MUŠKI SPOLNI ORGANI. organski spoj koji ima važnu ulogu u procesu fotosinteze kao prenosilac elektrona. MUREIN. No broj različitih alela u nekoj populaciji ili vrsti može biti veći. zapisana je redosljedom nukleotida u molekuli DNA. biljni ili životinjski organizmi koji žive na ili u drugom organizmu (domadaru) hraneći se tvarima iz njihova tijela i to na štetu domadara. simbioza. mutacije. To je uputa koja sadrži plan građe. bakterije. MUTANTNI TIP. akridinske boje. kompeticija. mutacije gena. Mutacije se uvijek zbivaju pod određenim utjecajima. NASLJEĐIVANJE. npr. UV i γ zrake) te različite tvari koje različitim mehanizmima također mogu izazvati promjene (peroksidi. a ostvaruje se putem sinteze proteina. nasljedne iznenadne promjene u genomu.

v. Uzlazni krak ulijeva se u zajedničke sabirne kanaliće. Neotenija omogućuje tim životinjama da nastave živjeti u vodi. termonastije (uzrokovane razlikom u temperaturi). Razvija se međusobnom suradnjom dvaju zametnih listića: mezoderma i ektoderma. NEOTENIJA. npr. NESPOLNA GENERACIJA (diploidna generacija). Kroz silazni krak i petlju prolazi filtrat pod tlakom u uzlazni krak nefrona. životinjski organizmi sposobni da se samostalno i aktivno kreću u vodi. vodozemaca. 94 . kao npr. reapsorbiraju u krvnožilni sustav sve potrebite tvari iz filtrata. NEKTAR. haploidna generacija. izumrli čovjekov predak čiji su prvi ostaci otkriveni u dolini Neandertalu blizu Dizeldorfa u Njemačkoj. ribe.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ NASTIJE. Živio je prije 100 do 150 tisuća godina u razdoblju gornjeg pleistocena. ureja). žljezdano staničje. Svaki bubreg sadrži milijun nefrona. Većinom su uzrokovana reverzibilnim promjenama turgora. Upijene tvari ulaze u kapilare. koji se ulijevaju u bubrežnu čašicu. Stanice koje čine stijenku nefrona upijaju (reapsorbiraju) veći dio tvari potrebnih tijelu iz filtrata (sva količina glukoze te znatne količine iona natrija. mutacija. isp. osnovna građevna i funkcionalna jedinica bubrega. NEURIT. organomotorno gibanje biljnih organa čiji je smjer određen građom organa. klora. NATALITET. zbog promjena turgora) i tigmonastije (savijanje vitica rezultat je promjene turgora). a smatraju da su selekcija. a temelje se na rastu. žljezdano staničje. a ne smjerom iz kojeg dolazi podražaj. vodika. ptica i sisavaca koji legu jaja. NEANDERTALAC. gmazova. NEKTON. kod riba hrskavičnjača. zajednički otvor kroz koji izlaze fekalije. repaši. izolacija i aktivni izbor staništa glavni čimbenici evolucije. NEANDERTALSKI PRAČOVJEK (neandertalac). v. NEODARVINIZAM. NEFRON. novije evolucijske teorije koje su nastale poslije Darwina. otvaranje cvjetova). v. neki mekušci itd. npr. mozga i leđne moždine. fosfata zatim aminokiseline i vode). mokraća i spolni produkti kod nekih životinja. seizmonastije (potaknute mahaničkim podražajima. NEČISNICA (kloaka). broj rođenih (okoćenih) jedinki u jedinici vremena prema sveukupnom broju jedinki u populaciji. a sekrecijom se oslobađaju iz tijela nepotrebne i štetna tvari (npr. shvaćanje da vrste evoluiraju pod učinkom raznih čimbenika sredine u kojoj organizmi žive. silaznog i uzlaznog kraka koji su međusobno povezani suženom tzv. koje su ogranci bubrežne odvodne arterije te kroz stijenke tih kapilara prebacuju se iz nefrona ponovno u krvotok. Oživljavanje pretpostavki što je dao Lamarck. neandertalski pračovjek. Kod beskralježnjaka nečisnicu imaju mužjaci nekih oblića. dodatak 5. kao na pr. v. Sastoji se od Bowmanove čahure. NEURALNA PLOČA. glomerul. Uz neuralni žlijeb i neuralnu cijev predstavlja osnovu živčanog sustava. pojava nastupanja spolne zrelosti i sposobnosti razmnožavanja prije završetka preobrazbe ličinke u odraslu jedinku. u sramežljive mimoze. Razlikujemo: fotonastije (uzrokovano svjetlošću. v. isp. Dakle. NEOLAMARKIZAM. živčana stanica. kalija. kemonastije (izazvane kemijskim tvarima). nefroni obavljaju selektivnu filtraciju krvi. a dijelom rastenjem. Henleovom petljom. struktura koja nastaje tijekom embrionalnog razvoja kralježnjaka. v. NEKTARIJ.

NEUTRALNE MASTI. živčana stanica.J.. nastao na prijemnom dijelu receptora stigne do završnih nožica. Oni uzrokuju otvaranje ionskih kanala za klor. glavna su obrana protiv infekcije bakterijama. AcH). stanice hipotalamusa izlučuju faktore za oslobađanje gonadotropnih hormona koji potiču hipofizu na izlučivanje gonadotropnih hormona. koji uzrokuju prijenos podražaja podraživanjem postsinaptičkog neurona i inhibicijski (kočnički) neurohormoni (gama-aminomaslačna kiselina). NICOLSON. koji mogu zakočiti prijenos informacije kroz sinapsu. Neurohormon se veže na specifične membranske neurohormonske receptore sljedećeg neurona.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE NEUROHORMONI (neurotransmiteri). v. NADP. dopamin itd. tvari koje izlučuju stanice hipotalamusa i koje živčanim putem podražuju hipofizu te kontroliraju izlučivanje njenih hormona. v. inhibicijski neuroni iz završnih nožica. leukociti. G. NEUROSEKRECIJSKI FAKTORI. NEUTROFILNI LEUKOCITI. v. Neurohormon koji se vezao na receptore postsinaptičkog neurona biva razgrađen enzimom koji se oslobađa 95 . Sinapsa Najučestaliji neurohormoni su acetil-holin. a vežu se na specifične receptore narednog neurona i kemijski ga podražuju. npr. Inhibicijske neurohormone luče tzv. v. noradrenalin. NEUTROFILI. tvari koje se izlučuju iz završnih dijelova aksona. Oni se neprestalno sintetiziraju u neuronima te se pohranjuju u mjehurićima završnih nožica (presinaptički neuron). S. NEUROSEKRECIJSKE STANICE. v. NEURON. neurohormoni. NA. te ioni natrija ulaze iz izvanstanične tekućine u postsinaptički neuron. v. uzrokuje naglo oslobađanje neurohormona iz mjehurića u sinaptičku pukotinu. jer ih fagocitiraju i razgrađuju u svojim vakuolama (fagosomima) pomoću probavnih enzima lizosoma fagocita. te će uz katione natrija u postsinaptički neuron ulaziti i anioni klora koji će poništiti pozitivan naboj uzrokovan ulaskom samo natrijskih kationa. Razlikujemo eksitacijske (podraživačke) neurohormone (noradrenalin. neurosekrecijski faktori. acetil-kolin. Kada električni potencijal. Otvaraju se Na-kanali. NEUROTRANSMITERI. Tako. iz presinaptičkog neurona (enzim za acetilkolin je acetil-kolin esteraza). živčane stanice koje na podražaj reagiraju stvaranjem i izlučivanjem hormona. isto što i masti. NIKOTINAMID-ADENIN-DINUKLEOTID-FOSFAT. Singer.L.

nucleus = jezgra). vodika (H). NUKLEINSKE KISELINE. ždralovke. zbog povećanja tjelesne aktivnosti te povećava udarni volumen srca. stara skupina riba važna za evoluciju kralježnjaka jer upućuju na prijelaz tih životinja iz vode na kopno. osim u tim staničnim dijelovima. ribe) otvorile unutarnjim nosnim otvorima (hoane) u usnu šupljinu. Dijele se na dvadesetak skupina. On se oslobađa pri porastu tjelesnih potreba za kisikom. guščarice. NONSENSE CODE. Temeljne građevne jedinice nukleinskih kiselina su nukleotidi. Danas živi samo oko 10 vrsta nosnoprolaznica. svojstvo vezivanja atmosferskog dušika i prevođenje u nitrate i amonijak kojega imaju neke bakterije i modrozelene alge. v. golubovke. v. Neke od njih su: pingvinke. sove i šišmiši. kokoške. Kasnije je otkriveno da su prisutne i u drugim dijelovima stanice. v. hormon kojeg luči srž nadbubrežne žlijezde. nocturnus = noćni). NOSITELJ. NITROFIKSACIJA (nitrogena fiksacija). NODULI. v. dušikove bakterije. NORADRENALIN. lat. složeni organski spojevi građeni od: ugljika (C). Nitrificirajuće bakterije oksidacijom prevode (oksidiraju) amonijak u nitrite. NUKLEIN.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ NITRIFICIRAJUĆE BAKTERIJE. v. a oslobađa se i na živčanim završecima simpatičkih živčanih vlakana. DNA se nalazi u jezgri. a RNA se. a nazvao ih je nukleinske kiseline jer ih je uočio u jezgrama stanica (lat. Dijele se na resoperke i dvodihalice. Tako je otvoren nosni put za udisanje zraka do pluća koja su se razvila od plivaćeg mjehura. proces obogaćivanja tla nitratima. NOKTURALNE ŽIVOTINJE. nalazi i u citoplazmi. Razlika koja se uočava već u imenima nukleinskih kiselina je u tome što u sastavu DNA nalazimo šećer dezoksiribozu. kisika (O) i dušika (N). v. ptice koje mogu letjeti jer imaju greben na prsnoj kosti. v. a nitrite u nitrate dobivajući pri tom energiju potrebnu za sintezu organskih spojeva: 2NH3 + 3O2 → 2HNO2 + 2H2O + energija (bakterija Nitrosomonas) 2HNO2 → 2HNO3 + energija (bakterija Nitrobacter) Djelovanjem nekih anaerobnih bakterija moguć je i suprotan proces. NOVOČELJUSKE (grebenke). šećera dez- 96 . životinje koje su noću aktivne. steljnjače. dušikove bakterije. sokolovke. denitrifikacija. NOSNOPROLAZNICE. NIŽE BILJKE. NOĆNE (nokturalne) ŽIVOTINJE (nokturna. NITROGENA FIKSACIJA. To su npr. npr. djetlovke i vrapčarke. mitohondrijima i plastidima. noćne životinje. papigovke. Poznate su dvije vrste nukleinskih kiselina: dezoksiribonukleinska kiselina (DNA) i ribonukleinska kiselina (RNA). rodarice. Otkrio ih je švicarski znanstvenik Miescher 1869. dušikove bakterije. god. korijenski gomoljići. nitrofiksacija. NITROGENE BAKTERIJE. Nukleotidi DNA ili dezoksiribonukleotidi se sastoje od fosfatne skupine. jedinka s mutantnim alelom koji nije izražen u fenotipu jer je uz njega prisutan dominantni alel. NITRIFIKACIJA. naziv za kiselu tvar u staničnim jezgrama koju je otkrio znanstvenik Miescher čime je doprinio definiranju nukleinskih kiselina. Nosne su se šupljine (v. a u RNA šećer ribozu. genetička uputa.

složeni organski spojevi građeni od nukleinskih kiselina (DNA ili RNA) i proteina. Izgrađen je od dugačke molekule DNA zatvorene u prsten i gusto sklupčane. NUKLEOTID. a mogu izmjenjivati generacije. osnovna građevna jedinica nukleinskih kiselina. Molekulu DNA tvore dva polinukleotidna lanca obično spiralno uvijena. je kuglasto tijelo promjera oko 25 mm. Nukleoproteini s DNA dolaze u sastavu jezgre (u kromosomima). jednostavne oči. postupak je pretvaranja alkohola u ocat uzrokovan aerobnim bakterijama. životinje iz skupine žarnjaka. osnovna je jedinica kromatina. životinje iz skupine oblenjaka. ATP. OCELE. Većinom stvaraju zadruge. žilnice i mrežnice. Nukleotidi RNA ili ribonukleotidi sadrže fosfatnu skupinu. struktura koja se nalazi u sastavu prokariota. 97 . Probavilo je prohodno: imaju usni i crijevni (izmetni ili analni otvor). beskralješnjaci iz skupine beskolutićavaca. gvanina. NUKLEOID. u sastavu ribosoma. Nemaju sustav za optjecanje ni disanje (dišu preko kože). O OBLENJACI (Aschelminthes). Uglavnom su razdvojenog spola. Organi za izlučivanje su protonefridiji. Tijelo je pokriveno kutikulom. npr. okruglo tjelešce. Obrubnjaci žive kao polipi. npr. Sastavljen je od osam histonskih molekula koje su obavijene dvostrukom zavojnicom DNA. v. a molekulu RNA jednostruki lanac koji sadrži manji broj nukleotida. NUKLEOLUS. isp. a u temelju je reakcija: C2H5OH + O2 → CH3COOH + H2O + + energija OČNA JABUČICA. ili meduze. Nastanjuju mora i kopnene vode ili su nametnici. Poznato je više od 10000 vrsta. timina ili citozina). šećer ribozu te također jednu od navedenih dušičnih baza s razlikom da se uvijek umjesto timina pojavljuje uracil. Najrasprostranjeni su oblići. NUKLEUS. šećera pentoze (šećer s pet C atoma) i fosforne kiseline. a nukleoproteini s RNA dolaze uglavnom u citoplazmi. jezgrica.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE oksiriboze i jedne od četiriju dušičnih baza (adenina. Spajanjem dvaju nukleotida nastaje dinukleotid. jezgra. Imaju živčani sustav i osjetne organe. Tjelesna šupljina (pseudocel) je dobro razvijena. Svi obrubnjaci osim hidra su morski organizmi. Pojedini polipi u zadruzi nazivaju se hidranti. a više nukleotida polinukleotid. Po funkciji odgovara jezgri odnosno kromosomu eukariotskih stanica jer predstavlja nasljednu tvar stanice. NUKLEOSOM. Najpoznatiji nametnički oblici su dječja glista i zavojita trihina. OBRUBNJACI. v. NUKLEOZIDI. OCTENO VRENJE. triju trinukleotid. isp. NUKLEOPROTEINI. spoj triju molekula: purinskih ili pirimidinskih dušičnih baza. Vanjski dio očne jabučice sastoji se od tri koncentrična sloja tkiva: bjeloočnice. virnjaci. organske tvari nastale spajanjem purinskih ili pirimidinskih baza sa šećerima i to C-N vezom. adenozin (adenin + riboza) i gvanozin (gvanin + riboza) kao derivati purinskih baza te citidin (citozin + riboza) i uridin (uracil + riboza) kao derivati pirimidinskih baza. OBLIĆI. To su npr.

ODABIR. ODRŽIVI RAZVOJ. To je uleknuće na pelikuli ispunjeno crvenim pigmentom karotinom. Rastom koštanog tkiva upravlja parathormon kojeg luči doštitna žlijezda uz djelovanje vitamina D te iona kalcija i fosfata. organel za primanje svjetlosnih podražaja kod praživotinja. prirodno i kulturno okružje odnosno sve što čovjeka okružuje. jedna od aerobnih faza staničnog disanja ili stanične respiracije koja se odvija u mitohondrijima. OKAMENJIVANJE (petrifikacija). OKSIHEMOGLOBIN. karbonatima i dr. minerali. razgradnja hranjivih tvari (ugljikohidrata. atom ili ion otpušta ili gubi jedan ili više elektrona. To su. kemijska reakcija u kojoj neka molekula. suzno nosni kanal i mišići pokretači oka. euglene. Receptorski potencijal koji je nastao u fotoreceptorima prenosi se vidnim živcem iz oba oka u vidnu regiju mozga. krv koja transportira kisik. biljke. te tako ograničava rasprostranjenost vrste. To su mikroorganizmi. trepavice. OKOLIŠ. v.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ Unutarnjost je ispunjena staklastim tijelom (staklovinom). inkrustacija. v. molekula hemoglobina koja prenosi vezani kisik. Izlučivanje ovog hormona. proces nastajanja fosila zamjenom organske tvari (istrunulih dijelova organizma) anorganskom tvari: silikatima. OKO. Konačni produkti oksidacije hrane su ugljik(IV)-oksid i voda (isp. OKOŠTAVANJE. mora. oceani. OKSIDACIJA. filogenetski sustav. proteina) u stanici uz pomoć kisika pri čemu se oslobađa energija potrebna za životne aktivnosti stanice. ODUŠAK. a može uzrokovati smanjenje ili propadanje populacije organizama. hormon koji izlučuje stražnji režanj hipofize (neurohipofiza). Glavni dijelovi oka su očna jabučica i očni živac. stvaranje koštane mase tj. disanje). lipida. abiotički ili biotički čimbenik koji se snažnije udaljuje od ekološkog optimuma ili pak prelazi granice ekološke valencije. vežu s kisikom pri čemu nastaje voda i velika količina energije. v. u zatiljni dio mozga. proizvodnja s minimalno štetnim učincima na biosferu. Uzrokuje kontrakcije maternice pri porodu. OČNA PJEGA (stigma). OKSITOCIN. ODJELJAK. Minerali se mogu taložiti unutar skeleta ili na površini organizma. reakcije spajanja s kisikom. OKSIGENIRANA KRV. npr. isto što i prirodni odabir. životinje i ljudi kao predstavnici žive prirode. Oslobođeni atomi vodika se ne vežu izravno s kisikom nego atomi vodika postupno predaju elektrone nizu prenositelja (dišnih enzima) što omogućava i postupno oslobađanje energije koja se koristi za sintezu ATP-a. Sastoji se od pomoćnih dijelova: gornji i donji kapci ili vjeđe. Na taj se način energija pohranjuje u energetski bogatim vezama ATP-a. OKSIDACIJA HRANE. a nakon poroda potiče sekreciju mlijeka iz dojke. U toj fazi se atomi vodika. Neživu prirodu čine tlo. kopnene i podzemne vode. OKSIDACIJSKA FOSFORILACIJA. OGRANIČAVAJUĆI EKOLOŠKI ČIMBENIK. osjetilo za vid. suzne žlijezde. uzdušnice. kao i os- 98 . npr. mali i veliki optok krvi. obrve. v. postupni prelazak hrskavičnog tkiva u koštano. reakcije oduzimanja vodika itd. oslobođeni u prethodnim reakcijama.

OOGENEZA. OLIGOPEPTIDI. prilikom naseljavanja kopna razvijala su se pluća. ugljikohidrati. npr.. ONEČIŠĆENJE OKOLIŠA. npr. OLIGOSAHARIDI. (1894. i jedna jajna stanica s haploidnim brojem kromosoma. Nastao stapanjem 12 tjelesnih kolutića. v. u sisavaca događa u jajovodu. rakovi. u riba i vodozemaca u vodi. proces stapanja dviju različitih spolnih stanica. Sve tri polocite II propadaju čime je osigurana pohrana dovoljne količine hranjivih pričuvnih tvari u citoplazmi jedne jajne stanice. oogeneza. Ne nosi udove za hodanje. elementarni sastav. fizioloških i biokemijskih osobina određenih skupina. Nakon mejoze I. OLAKŠANA DIFUZIJA. v. Oocite II i polocita I sadrže haploidan broj kromosoma. OPLODNJA (fertilizacija) KOD ČOVJEKA. OPISTOMA. OLIGOELEMENTI. v. A. Te tvari su potrebne za razvitak zametka u slučaju oplodnje jajne stanice. OPLODNJA.J. OPARIN. OOGONIJE. proces nastajanja jajne stanice u jajnicima. organizmi koji uzimaju biljnu i životinjsku hranu. OLIGOSAPROBNE VODE.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE talih hormona hipofize. Unutarnja se oplodnja (u tijelu ženke). gameta (spermija i jajne stanice) u zajedničku stanicu.). dijelovi složenih očiju kod kukaca i rakova. a označuje čiste vode. Nakon prodora prvog spermija zona pellucida zadeblja te onemogućuje ulazak ostalim spermijima 99 . peptidi. – 1980. OPĆA ADAPTACIJA (prilagodba). v. Oplodnja može biti vanjska (izvan tijela ženke). temeljenih na samoregulaciji. zigotu. zametne stanice u jajnicima s kojima započinje oogeneza (isp). Npr. je pod kontrolom podražaja iz hipotalamusa. ruski biokemičar koji je eksperimentirao s koacervatima. Dijele se mitozom pa imaju diploidan broj kromosoma. OOCITE. Dolazi do promjena u sastavu biocenoza i poremećaja svih metaboličkih procesa. jedan od stupnjeva onečišćenja voda. OMATIDIJE (okašca). unos većih količina otpadnih razgradivih organskih tvari u jezerski ekosustav izazvati će bujniji razvoj alga i povećanje koncentracije kisika u površinskim slojevima te nedostatak kisika u pridnenim slojevima. v. udovi za hodanje i pokrov tijela. v. iz svake pojedine oocite I nastaju dvije stanice: jedna sekundarna oocita (oocita II) i jedna primarna polocita (polocita I). Od jedne oogonije tijekom oogeneze nastaje. Iz oocite II u procesu mejoze II nastaje jedna zrela jajna stanica i jedna sekundar- na polocita (polocita II). I jajna stanica i polocite II sadrže haploidan broj kromosoma. skup morfoloških. Tako npr. unošenje štetnih tvari (ksenobiotika. a iz polocite I nastaju dvije polocite II. Spermij nosi u akrosomskoj kapi enzime (akrozin) za razgradnju obložnih stanica (Corona radiata) jajne stanice. otrova) u okoliš što dovodi do narušavanja ekosustava. između ostalog. počinje stapanjem spermija i jajne stanice u prvoj trećini jajovoda. pasivni prijenos. Započinje u doba puberteta kada iz zametnih stanica – oogonija nastaju velike nezrele stanice – primarne oocite (oocite I) koje sadrže diploidan broj kromosoma. stražnji dio tijela (zadak) klještara iz skupine člankonožaca. OMNIVORI (raznojedni organizmi).

Podjelu vidi u tablici PODJELA RECEPTORA. ORGANSKI SPOJEVI. Postoji pet skupina osjetnih receptora: mehanoreceptori. Slijedi nakon gastrulacije kada se uzajamnim djelovanjem stanica triju zametnih listića (ektoderma. Osfradijem mekušci ispituju vodu koju koriste za disanje. OSIKULE. odnosno višestanični organizmi. ORGANELI. U stanicama sluznice maternice nakupljaju se hranjive tvari. a u pravilu i vodik. nocireceptori. spojevi koji izvorno nastaju u organizmima djelatnošću protoplazme. isto što i stanični organeli. zigotu. OPRAŠIVANJE. Najvažniji organski spojevi u sastavu živih organizama su: ugljikohidrati. etapa embrionalnog razvitka koju karakterizira postanak organa i organskih sustava. Na primjer. dana nakon implantacije postupno se razvija posteljica (placenta). Svi organski spojevi obavezno sadrže ugljik. mezoderma i endoderma) počinju oblikovati budući organi. Većinom se nalazi uz škrge. OPTOK KRVI. Podražaj primaju specijalizirani osjetilni neuroni koji na dendritima imaju posebna osjetilna tjelešca (receptore ili senzore). te nakon nje organogeneza. ORGANIZAM. znanstvenik . koji su na nižem stupnju ustroja i populacije koja je na višem stupnju. Kod golosjemenjača se prenosi polen na mikropilu sjemenog zametka gotovo isključivo pomoću vjetra. lipidi. receptori za njuh smješteni su u mirisnoj (olfaktornoj) regiji nosa u sluznici krovnog dijela gornjeg nosnog hodnika. uzajamnim djelovanjem ektoderma i mezoderma u kralježnjaka nastaje živčani sustav. odnosno organa. proteini i nukleinske kiseline. ORGANOGENEZA. Građeni su od potpornih i receptorskih stanica iz kojih izlaze živčana vlakna koja se stapaju u živce što vode podražaje u 100 . Nakon brazdanja slijedi druga faza zametnog razvoja . termoreceptori. elektromagnetski receptori i kemoreceptori. OSJETILO ZA MIRIS (njuh).ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ odnosno sprečava poliploidiju. OSJETILNI ŽIVČANI SUSTAV (senzorički ili receptivni). Mogu se dobiti i u laboratoriju. Nakon mnogobrojnih brazdanja zigote nastaje blastocista koja se ugnježđuje (implantira) duboko u sluznicu maternice. prenošenje polena od muških na ženske dijelove cvijeta. Oko 7. Osjetni organi za okus su okusni pupoljci.zoolog koji proučava ptice. To su decidua stanice. mali i veliki optok krvi. v. U organizacijskoj ljestvici živih bića organizam se nalazi između stanica. a polenova zrna počinju klijati kada dospiju na njušku tučka. nalazi se na jeziku. OSJETILO ZA OKUS. služi za primanje i prenošenje informacija. ORNITOLOG. OSFRADIJ. diploidnu jezgru oplođene stanice. osjetilo za njuh kod mekušaca. Oprašivanje kritosjemenjača zbiva se najčešće uz pomoć kukaca i vjetra. Sluznica je puna žljezdanih stanica koje izlučuju sluz između kojih se nalazi od 10 milijuna do 20 milijuna mirisnih (olfaktornih) stanica s mirisnim dlačicama okrenutima prema nosnoj šupljini.gastrulacija. Danas je poznato oko dva milijuna različitih biljnih i životinjskih organizama. sitne vapnene pločice različitih oblika kod trpova (bodljikaši) uložene u tjelesnu stijenku (kožu) i čine unutarnji kostur. U jajnoj stanici udružuju se haploidne predjezgre jajašca i spermija u zajedničku. životna cjelina koju može izgraditi jedna ili više stanica pa ih stoga nazivamo jednostanični.

OSMOZA. Labirint se sastoji od: predvorja (vestibulum) s dva proširenja (utriculus i sacculus) i tri polukružna kanala. OSKULUM. Osmotski se tlak stanice. Tablica PODJELA RECEPTORA Skupina Osjet Receptori živčani završeci. smješteno je u unutarnjem uhu u labirintu. T i konstanti jednakoj plinskoj konstanti R. dodir. Iz bazalnog dijela osjetilnih stanica izlaze ogranci vestibularnog živca koji prenosi receptorske potencijale u primozak. Razlikujemo četiri osnovna okusa: slatko (na vrhu jezika).0 MPa (0. mali i veliki mozak. difuzija kroz polupropusnu membranu (opnu). kiselo (duž rubova jezika) i gorko (na korijenu jezika). spužve. v. slano (prednji dio iza područja za slatko). odnosno iz područja više koncentracije vode (niža koncentracija otopljenih tvari) prema području niže koncentracije vode (viša koncentracija otopljenih tvari). Cortijeve slluh stanice ravnopolukružni teža kanalići hladživčani noća završeci Termoreceptori živčani toplina završeci Nociživčani bol receptori završeci Elektroštapići i magnetski vid čunjići receptori okusni okus pupoljci mirisni miris receptori ugljikov produžena Kemodioksid moždina receptori aortna i kisik karotidna tjelešca alfa i beta st. disocira na Na+ i Cl– što daje 2 mola/L čestica o kojima ovisi osmotski tlak.5 do 3. Matemtički π = cRT Otopine koncentracije 1 mol/L šećera i 1 mol/L NaCl uz jednake uvjete nemaju isti osmostski tlak iako im je koncentracija ista jer NaCl. Molekule vode se u otopini kreću niz gradijent kemijskog potencijala vode (koncentracijski gradijent ili vodni potencijal). Pacinijevo. a sa- 101 . U dva proširenja predvorja nalaze se nakupina osjetilnih stanica s dlačicama . tlak Meissnerovo Mehanoi Krauseovo receptori tjelešce i dr. za razliku od šećera.makula. Na površini jezika nalaze se brojne okusne bradavice (papile).____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE koru velikog mozga. glukoza gušterače OSJETILO ZA RAVNOTEŽU. OSMOTSKI TLAK (π ). koja je za otapalo propusna (permeabilna). a za otopljenu tvar nepropusna. tlak u otopini ili stanici koji raste s porastom množine (množinske koncentracije) otopljenih čestica. koje su najizraženije na korijenu jezika. Pojava osmoze vrlo je važna za funkcioniranje stanica jer se njihove stijenke sastoje od približno polupropusne mebrane. Ampule su proširenja polukružnih kanala i u njima se nalaze osjetilne stanice s dlačicama. Tako će i tlak biti dvostruko veći u otopini NaCl nego u otopini šećera iste koncentracije.1 MPa = 1 bar). mijenja od 0. Osmoza se zbiva bez utroška energije. a ovisan je o apsolutnoj temperaturi. ovisno o organu.

F2. Ako se prati 102 . isp. kost. Ako nađe međudomadara puža malog barnjaka. Bolest se naziva metiljavost. OSTEOBLASTI. Povezuje i učvrščuje sva ostala staničja. OSTEOCITI. šećere itd. OVČJI METILJ. OVARIJI. a generacije potomaka (filijalne) prema redoslijedu s F1. Bolest se može usporiti terapijom tableta kalcija. u njemu se nespolno razmnožava. OSTEOKLASTI. a suvremena genetika je većim dijelom zadržala to označavanje. koštane stanice koje razaraju koštanu tvar stvorenu od osteoblasta. v. Češ- ća je u žena (u postmenopauzi). OTROVNOST (toksičnost).ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ ma stanica sadrži otopljnene tvari. a iz njih se razvijaju nove ličinke sa repićem (cerkarije). a u žena i spolnim hormonima. npr. Karakteristična je za sisavce. soli. jajnici. trpetljikava ličinka. Osteoklasti su višejezgrene stanice koje se mogu ameboidalno pokretati. a u čovjeka se obično događa četrnaestog dana menstrualnog ciklusa. OSTEON. osnovno staničje. Voda može osmozom i ulaziti i izlaziti iz stanice. U prikazima križanja početna roditeljska (parentalna) generacija označuje se uvijek s P. poredane su u krugu koštane stanice ili osteociti. Iz oplođenih jaja u vodi se razvija miracidij. Rahlo osnovno staničje. vrsta trajnog tkiva u biljaka koje čini najveći dio mase biljnog tijela. provodi se radi lakšeg snalaženja u praćenju nasljeđivanja svojstava. OSRČJE. Životni ciklus se sastoji od nespolne i spolne faze. OSNOVNO TKIVO. smanjenje gustoće koštanog tkiva (česta u starosti) zbog narušenog stvaranja organskog dijela kostiju. OSTEOPOROZA. vitamina D. u probavilu se razvije u odrasli oblik. v. a nerijetko se stanice osnovnog tkiva preoblikuju u druga staničja. OTROVNI ELEMENTI. toksični elementi. kroz koji prolaze krvne žile i živci. srce. Osnovno staničje služi i kao spremište pričuvne hrane pa ga zovemo spremišni parenhim. OSNOVNO STANIČJE (biljni parenhim). koštane stanice. transpiracijski parenhim služi izmjeni plinova. toksične učinke u organizmu. osnovna funkcionalna jedinica u kompaktnom sloju kosti. tvorne stanice koštanog tkiva. Nastaje mnogo ličinki (redije). pojava izbacivanja zrele jajne stanice (jajašca) iz Graafovog folikula u trbušnu šupljinu. Kada ovca (prvi domadar) pojede travu s čahurom. Stvaraju veliki broj jaja (hiperprodukcija potomaka). U fiziologiji bilja se umjesto kemijskog potencijala vode često upotrebljava naziv: vodni potencijal. Oko Haversovog kanalića. Ovulacija se periodički ponavlja najčešće u razmacima od 28 dana. nametnik u žućovodu i jetri ovce (v. v. F3 itd. Već je Mendel uveo označavanje nasljednih faktora i generacija simbolima (slovima). OZNAČAVANJE NASLJEDNIH FAKTORA I GENERACIJA. Vrlo rahlo raspoređene parenhimske stanice s velikim pravilnim međustaničnim prostorom koji osim prozračivanju služe i lakšem plutanju biljnih organa nazivamo aerenhim. metilji). Cerkarije napuštaju puža i začahure se na barskoj biljci. osobina neke kemijske tvari da može izazvati štetne. v. OVULACIJA. Javlja se sa smanjenjem razine spolnih hormona. v. proizvode koštanu tvar. Kosti postaju slabe i lomljive. Parenhimske stanice u listovima ispunjene su kloroplastima pa se zovu asimilacijski parenhim. v.

u monohibridnom križanju s dominacijom jedinka genotipa AA dat će jednu vrstu gameta: A. b1 i b2 itd. aB i ab. S donje strane nose soruse. a najčešće se označuju slovima i to za dominantni faktor (svojstvo) velikim. probavni enzimi gušterače. a jedinka genotipa Aa dat će dvije vrste: A i a. PALEONTOLOGIJA. v. a za drugo svojstvo B i b itd. Test je negativan ako su sve stanice normalne. PANKREASNA LIPAZA. primarno halogeniranih ugljikovodika (freona). Ozon štiti Zemlju od štetnog ultraljubičastog zračenja. PALP. Ono može biti trenutačno (samo nekoliko sekundi). a za praćenje više svojstava o polihibridnom križanju. aBc i abc. sloj plinovitog ozona na visini oko 40 km iznad površine tla. a za recesivni faktor malim. upala gušterače. npr. kružnouste.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE samo jedno svojstvo govori se o monohibridnom križanju. Iz izospora izraste protalij (haploidni gametofit). PANKREATITIS. Rastu iz podzemne stabljike (podanka). U trihibridnom križanju s dominacijom jedinka genotipa AABB CC dati će samo jednu vrstu gameta ABC. prate se sve moguće kombinacije njihovih gameta. Ako dominantnost nije izražena obično se svojstva označuju s a1 i a2. Listovi su im redovito veliki. P PACEMAKER. pipalo. OZONSKA OVOJNICA. Dugotrajno se pamćenje temelji na kemijskim promjenama koje nastaju nakon ponovljenog podraživanja skupine neurona mozga. Aleli pojedinih svojstava mogu se označavati na više načina. a pozitivan ako su među stanicama grla maternice nalaze tumorske stanice. prizemni. PAKLARE. v. Ako se prate dva svojstva govori se o dihibridnom križanju. kratkotrajno (do 3 dana) i dugotrajno (doživotno). stanjenje zemljine ozonske ovojnice tj. sposobnost kore velikog mozga da pohranjuje neke podatke ili doživljaje. v. Ab. OZONSKE RUPE. Tako. v. a nakon oplodnje 103 . biljke iz skupine papratnjača. Za praćenje triju svojstava govori se o trihibridnom. PANCREAS. umjetni elektrostimulator srca. Abc. različitih oblika. Koristi se za otkrivanje raka grla maternice i njegovih predstadija. v. Razmnožavaju se izmjenom spolne i nespolne generacije. gušterača. v. smanjenje ozona u ozonosferi uglavnom zbog kemijskih spojeva koje proizvode ljudi. ispitivanje stanica grla maternice bojenjem prema metodi Papanicolau. U dihibridnom križanju s dominacijom jedinka genotipa AAbb dat će samo jednu vrstu gameta: Ab. a jedinka genotipa AaBb dat će četiri vrste: AB. za jedno svojstvo A i a. znanost koja se bavi proučavanjem ostataka izumrlih organizama (fosila). Dodatak 1. Fiziološka osnova trenutačne i kratkotrajne memorije jest električna aktivnost skupine neurona mozga. PAMĆENJE. a jedinka genotipa AaBbcc dat će četiri vrste: ABc. PANKREASNA AMILAZA. U primjerima križanja. probavni enzimi gušterače. PAPA TEST. PAPRATI. v. Na primjer. da bi se jednostavnije i preglednije pokazalo koja svojstva roditelja nasljeđuju potomci.

PARAZITI. jelenak). Na njima su i škrge. Do danas su se pojedine drvenaste papratnjače sačuvale kao fosili koje nalazimo u naslagama kamenog ugljena (geološko razdoblje karbon). npr. hormon kojega izlučuju nuzštitne žlijezde. Ljekovite paprati su oslad i slezenica. PARENTALNO KRIŽANJE. Djelovanje parasimpatikusa je suprotno djelovanju simpatikusa. prehrambeno neovisna o sporofitu.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ razvije se iz embrija mlada paprat (diploidni sporofit). Naša najveća paprat je bujad (listovi dosegnu visinu i preko 2 m). PARENHIM. vodozemaca te nekih guštera. npr. razvitak zametka iz neoplođene jajne stanice. PARENHIMULA. Današnje papratnjače su zeljaste biljke. Samo su neke papratnjače s različitim sporama te imaju dvodomni gametofit. nametnici. Iz njih izlaze četine ili hete. selaginela. Spore su većinom istovrsne (izospore) pa im je gametofit jednodoman. PARATHORMON. dio autonomnog ili vegetativnog živčanog sustava čija živčana vlakna nadziru rad većine unutarnjih organa. Paprati većinom žive u vlažnim tropskim krajevima ili kao epifiti. prve prave kopnene biljke jer imaju korijen. PARAPODIJ (bataljica). PAPUČICA (Paramecium caudatum). specijacija kada se dvije populacije samo dotiču i tako imaju nepreklapajući prostorni kontakt. PARAPATRIJSKA SPECIJACIJA. PARTENOGENEZA. koje su imale dvojake spore. odrasla paprat mlada paprat sorusi sa sporangijama mejoza preslice. stabljiku i list. Služe pri pokretanju. v. crvotočine i paprati. embrio spore oplodnja arhegonij (jaje) anteridij (muška gameta) klijanje spore protalij sporofit (2n) gametofit (n) PAPRATNJAČE. Dijele se na 104 . Za vrijeme oplodnje pokretnim spermatozoidima potrebna je voda. PARASIMPATIKUS. v. Isp. v. Vegetativno tijelo je snažni sporofit. trajnice s podzemnom stabljikom (podankom) i s adventivnim korijenjem. Rastu u sjenovitim i vlažnim šumama (oslad. osnovno staničje. specijacija. a važan je za regulaciju prometa kalcija u tijelu. v. ali i kod nekih riba.j. preci golosjemenjača. trepetljikaši i praživotinje. križanje početne roditeljske (parentalne) generacije kojim nastaje prva generacija potomaka (filijalna) F1 generacija. t. simpatikus ubrzava rad srca dok ga parasimpatikus usporava. Izumrle su drvenaste paprati. polušpiljama (gospin vlasak). ali je samostalna. Partenogenezu susrećemo kod mnogih kukaca i drugih bezkralježnjaka. izdanak sa strane svakog kolutića kod mnogočetinaša. U hrvatskoj flori ima svega oko 50 vrsta paprati. dok je gametofit nježna i mala biljčica. spužve.

PAUČNJACI. dio muškog spolnog sustava u kojem spermiji dozrijevaju i stječu sposobnost samostalnog kretanja. francuski mikrobiolog koji je otkrivajući cjepivo protiv bjesnoće (1881 . aminokiselina itd. najopasnija trakavica za čovjeka. pasivni prijenos. tetanus. PATOGENE BAKTERIJE.). v. Čovjek se može zaraziti dirajući zaraženog psa. grabežljive životinje iz skupine klještari. urea itd. upala pluća. Ovaj prijenos se zasniva na procesu difuzije. prijenos tvari kroz staničnu membranu iz područja veće koncentracije u područje manje koncentracije bez utroška energije s ili bez pomoći prenositelja. glukoze. zagrijavanje supstrata na temperaturu oko 60 do 70 oC što dovodi do uništenja bakterija. čovjeka ili životinje. PASJEMENIK (dosjemenik. isp. kisik. PASTERIZACIJA. v.). PAVLOV. Škorpioni na kraju tijela imaju otrovnu bodlju. guba. Ikrice se razvijaju u jetri. Pauci imaju 2 -6 predljivih žlijezda na trbušnoj strani opistome. Teške bolesti koje uzrokuju bakterije u čovjeka su kuga. Ženka rađa žive mlade. U njima se stvara bjelančevinasta predljiva tvar koja izlazi kroz predljive bradavice. PATULJASTI RAST (nanosomija).____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE PASJA TRAKAVICA (ehinokok). PASIVNI TRANSPORT. tzv. PASIVNO STEČENA SPECIFIČNA IMUNOST. Ženka paučinom zaprede oplođena jaja u kokon iz kojeg izlaze mladi slični odraslima. Razdvojenog su spola. I. ruski psiholog. ali ne i njihovih spora. tuberkuloza. npr. epididymis). voda. v. uvjetovani refleksi nazivaju Pavlovljevim refleksima. štipaljke. Obični krpelj može biti prijenosnik virusnog encefalitisa i nekih nametničkih piroplazmi. Pauci izlučuju produkte izmjene tvari pomoću Malpighijevih cjevčica. PASTEUR. toksine. Umjetno izazvana imunost postiže se davanjem već gotovih protutijela. a na zraku se stvrdne. Kroz membranu se pasivno prenose manje molekule. Po njemu se tzv. štipavci ili škorpioni i grinje. otkrio da se refleksi mogu izmijeniti učenjem. npr. difterija itd. kasnije u djetinjstvu ili adolescenciji. PASIVNI PRIJENOS (pasivni transport). Prirodnim putom protutijela prolaze kroz posteljicu iz majke u zametak. nastaje kad hipofiza ne stvara dovoljne količine hormona rasta. Uz pomoć prenositelja prolaze veće molekule.-1936. bakterije koje uzrokuju bolesti čovjeka. životne zajednica koje žive u slobodnoj vodi i kreću se pasivno. Živi u crijevu psa. 105 . Nametnički oblici grinja su npr. PEKARSKI KVASAC. omogućena je unašanjem u organizam gotovih protutijela. paučnjaci. nastalih imunizacijom druge jedinke. Za disanje imaju lepezaste uzdušnice.1885) prvi uporabio naziv virus označivši njime uzročnika te bolesti. PELAGIJAL. gonoreja. člankonošci. čovječji svrabac iz skupine šugaraca koji buši hodnike u pousmini kože i krpelji. Paučinaste niti pauk plete stopalnim češljićem u mrežu. kolera. Velika je oko 5 mm i ima samo nekoliko proglotida. – 1895. Poznati su: pauk krstaš (križar) i crna udovica. (1822. kvaščeve gljivice. L. lebde (plankton) ili aktivno (nekton).. (1848. plućima ili mozgu čovjeka. sifilis. PAUCI. gangrena. Može biti vidljivo kod rođenja. PEDICELARIJE. životinja i biljaka izlučujući u organizam domaćina otrovne spojeve. Njima pripadaju pauci. ugljik(IV)-oksid.

prašnik. PERIGON. za što je dobio Nobelovu nagradu 1945. Na osnovici je svake trepetljike bazalno. v. PEPSIN. v. PENICILIN.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ PELIKULA (lat. pokrovnu i potpornu funkciju. pellicula. najpoznatija zelena plijesan sa sporangijskim nositeljima raspoređenih poput kista na čijim se ograncima razvijaju spore u nizovima. Udovi su se razvili u peraje. skupina sisavaca prilagođenih životu u vodi. tj. Sastoji se od dvije skupine živaca: moždani i moždinski živci. PELUDNA ZRNA. vezanjem 10 i manje aminokiselina nastaju oligopeptidi. Dijeli se na osjetilni i pokretački.U papučice je sastavljena od niza alveolarnih mjehurića. Penicillium notatum). kemijski spojevi građeni od dvije do 20-40 vezanih aminokiselina. deoksiriboza i riboza. Imaju obilježja zvijeri. Ima antibiotsko djelovanje. PELUD. papučice i bičaša. a vezanjem više od 10 aminokiselina nastaju polipeptidi. v. cvijet. U Jadranu živi sredozemna medvjedica. v. djeluje antibakterijski. (kistac. To djelovanje prvi je otkrio A. nastaje kada karboksilna skupina jedne aminokiseline reagira s amino skupinom druge aminokiseline pri čemu se izdvaja molekula vode. Perajarima pripadaju tuljani i morski lavovi. triju tripeptid. 106 . Općenito. kloridna kiselina. tanka elastična opna koja obavija tijelo mnogih praživotinja. v. osnovno tijelo – kinetosom. PENICILIJUM. Aminokiseline se međusobno vežu peptidnim vezama. spolni ud. najvažniji probavni enzim želuca. Hrane se najčešće ribama. tj. PERIFERNI ŽIVČANI SUSTAV. PERINUKLEARNI PROSTOR. penicilijum. ukupne molekulske mase manje od 5000. H H R O N C C N H H H O C C OH R1 PERAJARI. kost. odnosno baktericidno zahvaljujući izlučivanju tvari penicilin. pepsin. a najaktivniji je u jako kiseloj sredini (pH oko 2). PERIKARD. oprašivanje. Pentoze su npr. v. Međusobno su kinetosomi povezani bjelančevinastim nitima – kinetodezmama koje provode podražaje. Vezanjem dviju aminokiselina nastaje nastaje dipeptid. Kinetodezme i kinetosomi čine kinetički aparat. jednostavni šećeri ili monosaharidi s pet ugljikovih atoma u molekuli. PEPTIDI. a površinu pelikule prekrivaju trepetljike. Kasnije se otkrilo da antibiotsko djelovanje imaju i druge tvari pa otuda i postojanje različitih antibiotika. četiriju tetrapeptid itd. prašnik. Fleming 1929. PENTOZE. prostor između dviju membrana jezgrine ovojnice. v.ektoplazme. godine. konidiospore. Glavne stanice fundusnih i piloričkih žliježda že- luca luče inaktivni oblik enzima pepsinogen koji se aktivira uz prisutnost kloridne kiseline u pepsin. PEPSINOGEN. srce. provodi živčane impulse (informacije) u središte ili iz središta u izvršni organ. Pelikula je nastala spajanjem dvoslojne membrane i površinskog sloja tijela. To je proteolitični enzim. npr. PENIS. PEPTIDNA VEZA. v. Ima zaštitnu. oprašivanje. PERIOST (pokosnica). grč. tj. enzim koji probavlja bjelančevine. Također sudjeluje u kretanju i uzimanju hrane te primanju podražaja iz okoliša. v. pelis = kožica).

Razlikuju se velika pokrovna pera i nježna perca pahuljice. embrionalni organ u većine sisavaca čija je uloga prehrana zametka odnosno ploda. PJEVALO. životinje iz skupine kolutićavaca. Uloga im je da sprečavaju propadanje žutog tijela nakon ovulacije te da ga potiču na izlučivanje povećane količine hormona estrogena i progesterona. tekuće hrane: otopljenih makromolekula kao što su bjelančevine ili aminokiseline. Smješteno je na prijelazu iz dušnika u dušnice. oznaka za negativan logaritam koncentracije vodikovih iona. PLACENTA (posteljica). Sišu krv mno- gim kralješnjacima i beskralješnjacima. proizvod kože koji pokriva tijelo ptica i štiti od gubitka topline. a u sastavu RNA citozin i umjesto timina uracil. Poznata vrsta je liječnička pijavica. v. 107 . kvaščeve gljivice. PGTH. Kroz posteljičnu opnu izmjenjuju se kisik. Što je viša koncentracija vodikovih iona to je niža vrijednost pH. PITEKANTROPUS. odnosno 7. potrebne za proces fotosinteze. hranjive i otpadne tvari između krvotoka majke i krvotoka ploda. pH = – log [H+]. Plasmopara viticola). peronospora. PIRIMIDINSKE BAZE.pinosis = piti. a kasnije iz posteljice. Žive uglavnom u slatkim vodama. tvari koje povisuju tjelesnu temperaturu (mnogi toksini patogenih mikroorganizama). kytos = šupljina). Svako pero ima badrljicu i zastavicu sastavljenu od isperaka. dana nakon njenog “ukopavanja” (implantacije) u sluznicu maternice. a na krilima su letna pera. Da se krv ne bi zgrušala slinske žlijezde izlučuju enzim hirudin. v. smjesom vode. u ljudskom želucu gdje je izrazito kisela sredina pH = 1. pigmentum = boja). tvar koja daje boju tkivima ljudi. a baze snizuju koncentraciju H+. PIRETICI (pirogene tvari). hormoni koji se u ranoj fazi trudnoće izlučuju iz stanica trofoblasta. isp. Isperci su međusobno povezani resicama. U žena se placenta formira iz stanica trofoblasta i decidua stanica (stanice sluznice maternice) oko 16 dana nakon oplodnje jajne stanice. javanski pračovjek. modre galice i gašenog vapna. PLACENTARNI GONADOTROPNI HORMONI. a ti hormoni spriječavaju menstruaciju koja bi uzrokovala gubitak ploda. U živom organizmu pH – vrijednosti se uglavnom kreću u rasponu pH = 6 – 8 iako ima i izuzetaka npr. Suzbija se bordoškom juhom. v. endocitoza. biljaka i nekim bakterijama. PIVSKI KVASAC. PIGMENT (lat. Biljke stvaraju pigmente za apsorpciju sunčeve svjetlosne energije.5. U sastavu DNA uvijek dolaze pirimidinske baze timin i citozin. Sastavljeno je od sustava hrskavičnih i koštanih potpora i opni. pH. biljna bojila. PINOCITOZA (grč.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE PERJE. PERONOSPORA (plamenjača. Krvne i druge stanice ne mogu prolaziti kroz placentnu opnu. Kiseline povisuju. PIJAVICE. ugljikov dioksid. npr. v. v. gljiva algašica. vrsta dušičnih baza koje izgrađuju molekule DNA i RNA. nametnik na vinovoj lozi nanoseći velike štete. Sastoji se od rožnate tvari keratina. Kasnije u trudnoći estrogene i progesterone izlučuje sama posteljica. način uzimanja hranjivih tvari u praživotinja. osobito kod ptica pjevica. organ kod ptica za proizvodnju glasova. PGTH (placentarni gonadotropni hormoni). PLAMENJAČA. Nemaju parapodija ni četina ali imaju prednju i stražnju prijanjalku. životinja.

a u sastav zooplanktona neki račići i različite ličinke i praživotinje. Merozoiti se hrane hemoglobinom te uzrokuju raspadanje crvenih krvnih stanica popraćeno groznicom i visokom temperaturom. PLAZMODIJ. a neke bakterije imaju plazmide koji im omogućuju korištenje dodatnih izvora hrane. Uzastopnim dijeljenjem zigote nastaju truske koje putuju do žlijezda slinovnica komarca. isto što i stanična membrana. tercijarnu i kvartarnu malariju. Prenosnik plazmodija je komarac malaričar. spore (truske ili sporozoiti) se slinom komarca prenesu u krv čovjeka. PLASTIDI. PLAZMODEZMIJE. PLAZMATSKA MEMBRANA. PLAZMA-STANICE. PLAZMALEMA. Plazmidi imaju sposobnost samoumnožavanja i mogu se konjugacijom prenositi na druge bakterije. Ovisno o vrsti plazmodija razlikujemo tropsku. koštanoj moždini. Mješčićnice su dvospolci. Odrasli oblici su sjedilački. U sastav fitoplanktona ulaze najčešće bičaši i alge kremenjašice. bezlubanjci. Razmnožavaju se nespolno (pupanjem) i spolno. "golu" dvolančanu DNA . Imaju veliku sposobnost regeneracije.molekulu koja predstavlja male nizove gena (od 2 do 300) i pripadaju genomu stanice u kojoj se nalaze. Zajedno s krvlju truske se raznesu kroz tijelo.gametociti. Tijelo im je obavijeno plaštem ili tunikom koji je izgrađen od tunicina. živčana cijev je s leđne strane. PLAZMIDI. biljni i životinjski organizmi koji lebde u morskoj vodi ili kopnenim vodama jer nemaju sposobnost samostalnog. Neke bakterije sadrže plazmide koji im daju otpornost na antibiotike. najčešće jednostaničnom tijelu. zreli oblici limfocita B u kojima se stvaraju protutijela. Kada čovjeka ubode zaraženi komarac. Svaki plazmid sadržava jednu kratku. PLAŠTENJACI (Tunicata). Preventivne mjere suzbijanja razvoja komarca malaričara su: isušivanje močvara. stanični organeli biljnih stanica koji najčešće sadrže biljne boje (pigmente). Dio planktona kojega čine biljni organizmi nazivamo fitoplankton.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ PLANKTON. Sličnosti s njima: imaju svitak (iako samo u zametnom i ličinačkom stadiju). najprimitivniji svitkovci. Lebdenje u vodi im omogućuju razne izrasline i nastavci na njihovom. Nalazimo ih u limfnim čvorovima. u biljnoj stanici vanjski granični sloj plazme prema staničnoj stijenci. PLANULA. Uzročnik malarije u čovjeka. Nakon uboda komarca sporozoiti ponovo zaraze zdravog čovjeka. a dio kojega čine životinje zooplankton. a nespolno se razmnožavaju diobom u stanicama jetre i eritrocitima stvarajući truske koje se nazivaju merozoiti. Umjesto merozoita mogu se u eritrocitima razviti spolni oblici . Te su izvankromosomske čestice DNA pronađene kod prokariota i eukariota. kod žarnjaka ličinka obavijena trepetljikavim stanicama. insekticidi te biološka metoda 108 . Najvažnija vrsta plastida su kloroplasti koji sadrže zeleni pigment klorofil. nametnička praživotinja iz skupine truskovaca. Žive u moru. citoplazmatski izdanci pomoću kojih se održava veza između dvije biljne stanice. aktivnog kretanja. a ličinka je plankton. slezeni i jetri. krvožilni sustav je na trbušnoj strani. Kada komarac usiše krv zaraženog čovjeka. Najpoznatiji plaštenjaci su mješčićnice. male kružne molekule DNA koje mogu biti prisutne u citoplazmi stanice uz bakterijski "kromosom". prednji dio probavila (ždrijelo) prorezan je škržnim pukotinama te ima ulogu i organa za disanje. gametociti dospiju u probavilo komarca i spoje se u pokretnu zigotu.

Živčani sustav je mrežast ili u obliku vrpci. Tijelo im je splošteno s leđne i trbušne strane. zatvarajući tako mali optok krvi. mali optok.ptice. Pluća su građena od plućnih mjehurića ili alveola koje su okružene mrežom krvnih kapilara. izmjenjuju preko kože. POIKILOTERMNI ORGANIZMI. Lijevo se sastoji od dva režnja. stanice koje se mogu neograničeno reproducirati. koja povremeno preuzimaju funkciju pluća. služi ribama iz skupine koštunjača kao hidrostatski organ. v. Sastoje se od dva plućna krila. Kada je stanica u hipertoničnoj otopini soli. pravi sisavci. pojava smanjenja obujma vakuole i odvajanje protoplasta od stanične stijenke. Plinove. lat. stabljika. PLAZMODIJALNA TEORIJA O POSTANKU METAZOA. Također i fetus. v.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE unašanja ribe gambuzije u močvare jer se ona hrani ličinkama komaraca. životinjski organizmi čija temperatura tijela ovisi uglavnom o temperaturi okoliša. koji ima ulogu u disanju. Vakuola postaje sve manja i povlači okolni protoplast. Za izlučivanje imaju protonefridije.. PNEUMONIJA. ribe postaju lakše i dižu se prema površini. Na tu se kapilarnu mrežu nadovezuju venule i plućne vene koje oksigeniranu krv dovode u lijevu pretklijetku. Ispod pluća nalazi se ošit ili dijafragma. krvne žile koje ulazi u lijevu pretklijetku srca. slobodno plivajuća dvobočno simetrična ličinka kod bodljikaša. PLIVAĆI MJEHUR. lysis = razrješavanje). PLURIPOTENTNE STANICE. PLAZMOLIZA (grč. Razvija se kao šuplji izdanak stijenke jednjaka. desno od tri režnja. PLUĆNA ARTERIJA. v. upala pluća. v. isp. v. Kada je napunjen plinom. isp. tučak. PNEUMATIČNE KOSTI. ribe postaju teže od vode i tonu. Usplođe štiti sjemenku i služi njihovu rasprostranjivanju. Poikilotermni organizmi su svi beskralje- 109 . obavijeni su kapilarnom mrežom ogranaka plućne arterije. v. Nemaju nikakva kostura ni tjelesnih šupljina. PLUTEUS. generativni organ svojstven kritosjemenjačama. tromboza. kisik i ugljikov dioksid. Suprotan proces naziva se deplazmoliza. PLOŠNJACI (Platodes). v. PLODVAŠI. alveolus = korito). PLUĆA. bilateralno simetrični beskolutićavci. PLOD. krvna žila. voda izlazi iz vakuole (mjesta veće koncentracije vode) u okolnu otopinu. Tijelo im je ispod pokrovnog sustava ispunjeno parenhimom. Oko 18500 vrsta ploš- njaka uključuje virnjake. Sastoji se od sjemenki i usplođa koje se razvija iz plodnice. izlazi iz desne klijetke srca. PLUĆNI OPTOK KRVI. isp. metilje i trakavice. Razlikujemo sočne i suhe plodove. PLUĆNI MJEHURIĆI (alveole. PLUĆNE VENE. v. Kada se iz njega istisne plin. Kod dvodihalica plivaći se mjehur razvio u pluća. isp. šećera ili sl. koja je krvlju dopremila iz tijela ugljikov dioksid radi izmjene s kisikom. PODANAK. plasma = tvorevina. Svako plućno krilo obavijeno je poplućnicom ili pleurom.hipoteze o postanku mnogostaničnih životinja. v. Žive slobodno ili kao nametnici. mali optok krvi. PLODNICA. organi za disanje kod čovjeka i drugih kopnenih kralježnjaka. PLUĆNA EMBOLIJA. mali optok. v.

v. su velike molekule. skraćenica za poliuridilnu kiselinu. v. jedan od morfoloških oblika kod žarnjaka. ali se ne dijeli citoplazma ili ne funkcionira diobeno vreteno u mitozi. Nastaje tijekom sinteze proteina. POLIFENILALANIN. 2. proteini su izgrađeni od aminokiselina. epitelno tkivo. Mnogi polipi žive u zadrugama ili kolonijama. pojava kada se čitava garnitura kromosoma povišestručuje. enzim koji kontrolira pravilnu ugradnju DNA nukleotida na matricu starog lanca DNA. tetraploidi (4n). POLIMERAZA. POLICITEMIJA. kost. v. dječja paraliza. dio je perifernog živčanog sustava. a polisaharidi od jednostavnih šećera. izolacija. a vrlo je rijetka u životinja. v. vodozemci i gmazovi. POLIPLOIDIJA. genetska uputa koja nosi veliki broj uracil dušičnih baza i određuje ugradnju više molekula aminokiseline fenilalanina u proteinski lanac. gorostasni kromosomi. dječja paraliza. POLINUKLEOTIDI. polimeri i ugljikohidrati. makromolekule izgrađene od manjih podjedinica monomera. POLENOVA ZRNA. POKOSNICA. nukleinske kiseline od nuk- leotida. npr. nukleotidi. Tako umjesto diploidne 2ngarniture nastaju triploidi (3n). a udvostručiti se može i samo pola garniture. mutacije i genska snaga. nego svi kromosomi ostanu nagomilani u istoj stanici. POLIP. POKROVNO TKIVO. Živi sjedilački pričvršćen za dno. POLISAHARIDI. nakupine ribosoma. a po funkciji se dijeli na voljni i autonomni. eksperiment. v. mikroskop. oprašivanje. POLISAPROBNE VODE. POKRETAČKI (motorički) ŽIVČANI SUSTAV. POLI-U.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ žnjaci. Na gornjoj strani valjkastog tijela je usni (oralni) otvor okružen lovkama. v. POKUS. To su prirodna selekcija (odabiranje). organski spoj iz skupine polinukleotida 110 . prašnik. Poliploidne stanice nastaju tako da se udvostruče kromosomi. pentaploidi (5n) itd. jedan od stupnjeva onečišćenja voda. v. POLIO. POLIMERI. v. Jedan od uzroka je poremećaj regulacijskih mehanizama proizvodnje eritrocita u koštanoj moždini. pojave koje su omogućile razvoj i usavršavanje živih bića na Zemlji. bolest povećanja broja crvenih krvnih stanica u perifernoj krvi. oprašivanje. peptidi. a od kralježnjaka ribe. POKRETAČKE SILE EVOLUCIJE. v. Ova pojava je česta u biljaka. v. POLIPEPTIDI. v. ličinka kod kružnousta. POLEN. POLISOMI. 1. kemijski spoj građen od većeg broja molekula aminokiseline fenilalanina. POLIURIDILNA KISELINA (poli-U). POKAČA. POLARIZACIJSKI MIKROSKOP. a označava vrlo snažno onečišćene vode. a njegovo nastajanje određuje genetska uputa na mRNA koja se označava UUU UUU UUU ∼. prašnik. POLIOMIJELITIS. 1. POLITENI KROMOSOMI. Ako se ta pojava ponovi broj kromosoma se opet udvostručuje. v.

povremeno. PORODICA.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE nastao polimerizacijom samo jedne vrste nukleotida i to onog koji sadrži uracil. POPREČNO-PRUGASTI MIŠIĆ. a svijetle samo aktinske. 111 . POLOVIČAN BROJ KROMOSOMA. a međusobno su vezane prvenstveno odnosima razmnožavanja. neke od stanica koje su se prilagodile isključivo pružanju mehaničke čvrstoće biljnim organima. POSTANAK VRSTA. skupina jedinki iste vrste. Poprečno prugasto mišićno tkivo izgrađuje mišiće koji su tetivama vezani za kosti pa omogućuju pokretanje dijelova tijela. Tamne pruge sadrže i aktinske i miozinske filamente. haploidan broj kromosoma.). različite životne dobi. tj. Osnovna jedinica poprečno prugastog mišićnog tkiva je mišićno vlakno izduženog cilindričnog oblika. žiroglavci. semipermeabilna ili probirno propusna (selektivno permeabilna) membrana. tanka dvolisna opna koja obavija svako plućno krilo. POPULACIJA. v. POROĐAJ (porod). Razlog tome je raspored proteinskih filamenata (niti) aktina (tanji) i miozina (deblji) u samim miofibrilima. Ovojnica mišićnog vlakna zove se sarkolema. sastoji se od mišićnog tkiva koje promatrano mikroskopom pokazuje poprečnu prugavost. proces u prirodi koji se odvija dugotrajno i polagano. Poseban oblik poprečno prugastog mišićnog tkiva je srčano mišićno tkivo. osmoza.placenta. v. miofibrili su poprečno isprugani. Vanjski list opne (porebrica) oblaže rebra s unutarnje strane prsnog koša. Najčešće se javlja u mladića u pubertetu. CO2). Između obje poplućnice nalazi se malo tjelesne tekućine. a unutarnjost je ispunjena sarkoplazmom u kojoj su pravilno uzdužno smješteni snopovi mišićnih vlakanaca.poplućnica. Rasprostranjenost većine ljudske populacije ovisi o vegetaciji područja. ribozu i fosfatnu kiselinu. koje žive na istom prostoru. stanična membrana. POSTELJICA . stanice koje nastaju za vrijeme oogeneze (isp. a rezultira nastajanjem novih bioloških vrsta. Tijek poroda reguliraju hormoni. miofibrila. posebice one s nabojem. v. Rad ovog tkiva je pod utjecajem naše volje. Porast količine tih hormona uzrokuje stezanje mišića maternice. v. POPLUĆNICA ili pleura. filogenetski sustav. POLUPROPUSNA MEMBRANA. Lako propušta vodu i male nenabijene molekule (npr. recesivno svojstvo. kao i izlučivanje oksitocina. POREBRICA. POTPORNO STANIČJE. Unutarnji list opne oblaže plućna krila. v. Pojedini dijelovi miofibrila nejednako lome svjetlo pa pod mikroskopom vidimo izmjenično poredana svijetla i tamna polja. doba na kraju trudnoće u kojem dolazi do pravilnih ritmičkih stezanja i opuštanja mišića maternice što rezultira potiskivanjem ploda kroz porođajni kanal i izbacivanjem posteljice. POLUCIJA. ali ne i velike molekule. POLUSVITKOVCI. ali njegov rad nije pod utjecajem naše volje. izolacija i genska snaga. pa se neposredno prije poroda pojača izlučivanje hormona estrogena iznad vrijednosti koncentracije progesterona. spontano izbacivanje sperme (naročito noću) zbog nakupljanja veće količine sperme u sjemenicima i sjemenim kanalićima. v. v. Mišićno vlakno ima veći broj jezgara koje su površinski smještene ispod sarkoleme. Potiču ga pokretačke sile evolucije: prirodna selekcija. POTISNUTO SVOJSTVO. POLOCITE.

ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

Dvije su vrste potpornog staničja: kolenhim, izgrađen od živih stanica i sklerenhim, izgrađen od mrtvih stanica. U mnogim biljkama te su stanice vrlo dugačke i elastične, a zovu se likovnice. POTRKUŠCI, mladunci nekih vrsta ptica (npr. kokoši, patke, guske, ždralova) koji se legu dobro razvijeni. Imaju otvorene oči, perje, mogu trčati i snalaziti se u prostoru. POTROŠAČI (konzumenti), heterotrofni organizmi koji se prema vrsti hrane koju troše dijele na: biljojede (fitofage, herbivore), mesojede (zoofage, karnivore) i saprofage. POUGLJENJIVANJE (karbonizacija), proces fosilizacije pod tlakom i bez prisutnosti kisika. Tako su npr.u karbonu procesom karbonizacije u vodama stajačicama (močvare, jezera) od dijelova papratnjača i drugih biljaka nastale velike naslage ugljena. POVEĆANJE MIKROSKOPA, omjer veličine slike promatranog predmeta i samog predmeta. Ukupno povećanje mikroskopa jednako je umnošku povećanja objektiva i okulara. Npr. ako je povećanje objektiva 40 puta, a okulara 10 puta ukupno povećanje bit će 400 puta. Svjetlosni mikroskop povećava najviše 1000 puta, a elektronski 400 000 puta. POVRATNA VEZA, isto što i mehanizam povratne sprege. POVRATNO KRIŽANJE, v. test križanje. PRAATMOSFERA, plinoviti omotač Zemlje u početku njenog nastanka, prije 4.5 do 4 milijarde godina. Smatra se da je praatmosfera sadržavala slobodan vodik (H2) i dušik (N2), metan (CH4), amonijak (NH3), cijanid ion (CN–), vodenu paru, okside ugljika (CO i CO2) i sumporovodik

(H2S). Stoga se smatra da se bitno razlikovala od današnje atmosfere jer nije sadržavala slobodan kisik (O2). PRABUBREG, v.drugi bubreg. PRACRIJEVO, v. arhenteron. PRAORGANIZMI (protobionti), prvi organizmi koji su se pojavili na Zemlji. O njihovom izgledu i načinu života danas postoje samo različite pretpostavke. PRAPTICA (Archaeopteryx), najpoznatiji i najtipičniji prijelazni oblik između gmazova i ptica. Živjela je krajem perioda jura, u mezozoiku. Bila je vrlo slična današnjim pticama (oblik tijela, perje, kljun, krila i dr.), ali je imala i mnogo obilježja gmazova od kojih potječu, kao npr. kralješke u repu, tri prsta s pandžama na repu, zube u kljunu. PRAŠNIK, muški dio cvijeta. Sastoji se od prašničke niti (filamenta) i prašnice (antere). U prašnicama se nalaze peludnice ili polenovnice (mikrosporangiji, muški sporangiji). Unutar polenovnica, iz diploidnih matičnih stanica, mejozom (redukcijskom diobom) nastaju četiri haploidne mikrospore (muške spore) koje zovemo polenova ili peludna zrna. Proces kojim nastaju mikrospore zove se mikrosporogeneza. Unutar polenovog zrna razvija se muški gametofit (haploidna generacija) s dvije muške gamete (spermalne, generativne jezgre tj. stanice) i jedne vegetativne stanice. PRAVI BUBREG, v. treći bubreg. PRAVI SISAVCI (plodvaši, placentalni sisavci), skupina životinja čiji se mladi razvijaju u maternici obavijeni plodvom, posteljicom ili placentom (ime!). Danas se razvrstavaju u dvadesetak skupina. Neke od njih su: šišmiši, kukcojedi, majmuni, glodavci, zvijeri, perajari, kitovi, slonovi, kopitari i papkari.

112

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

PRAŽIVOTINJE (protozoa), jednostanične životinje, eukarioti, članovi carstva protista. Razvili su se tijekom evolucije iz prokariota. Mikroskopske su veličine. Najčešće žive samostalno ili kao zadružni oblici. Većinom su pokretni i heterotrofi. Žive u svim tipovima staništa: u moru i vodama na kopnu, a mnoge od njih su nametnici na drugim životinjama i na čovjeku. Na površini je protoplazmatskog tijela stanična membrana, pelikula ili čvrsta ljušturica. U protoplazmi se nalaze organeli koji obavljaju životne funkcije. Kreću se uz pomoć pseudopodija, bičeva i trepetljika. U nepovoljnim uvjetima često se začahure. Hranu uzimaju endocitozom, a kroz membrane hrana prolazi procesom difuzije. Probava se odvija u hranidbenim mjehurićima koji se kreću unutar organizma strujanjem citoplazme. Izmjena plinova, osmoregulacija i ekskrecija, također se obavljaju difuzijom kroz memebrane. Razmnožavaju se najčešće nespolno (diobom) i spolno. Poznato je oko 30.000 različitih vrsta praživotinja. Najpoznatije skupine su: bičaši, korjenonošci, trepetljikaši i truskovci. PREČNOUSTE, v. hrskavičnjače. PREDATORI (grabljivci), organizmi koji su u specifičnom odnosu ishrane s jedinkama druge vrste (predator-plijen), npr. ris je predator koji se hrani zečevima, lav je predator koji se hrani antilopama itd. PREDBUBREG, v.prvi bubreg. PREDLJIVE BRADAVICE, v. paučnjaci. PREHLADA, najčešća bolest dišnog sustava koju uzrokuju različiti virusi. Najčešće su inficirani gornji dišni putovi: nos i grlo. Simptomi su kihanje, suzenje, grlobolja, promuklost, kašalj i curenje iz nosa. Rijetko traje dulje od tjedan dana.

PREDMENSTRUACIJSKI SINDROM (PMS), skup različitih simptoma (fizičkih i psihičkih) koji se javljaju u mnogih žena prije mjesečnice. Uzrok tim promjenama je stalna izmjena koncentracije estrogena i progesterona za vrijeme menstruacijskog ciklusa. PREMOSNICA (engl. by-pass), dio vene uzet iz bedra s pomoću koje se operativno premošćuju oboljele koronarne arterije radi optimalnog opskrbljivanja srčanog mišića kisikom i hranjivim tvarima. PREMOSNICI, stara skupina gmazova. Jedini živi predstavnik i živi fosil je pilasti premosnik, jer se gotovo ništa nije promijenio već 150 milijuna godina . Danas živi uz obalu Novog Zelanda. Duž leđa ima pilasti greben od trokutastih ljusaka. Na glavi se nalazi tjemeno oko. PREOBRAZBA (metamorfoza) proces promjene oblika tijela. Neke životinje tijekom razvoja i rasta podliježu velikim promjenama, npr. kod beskralježnjaka kukci, isp., a kod kralježnjaka vodozemci, isp. punoglavac. PREPISIVANJE, v. sinteza proteina. PRESLICE, biljke iz skupine papratnjača. Poznata je poljska preslica. Zelena je stabljika člankovita i pršljenasto razgranata. Listovi su sitni i neugledni te obavijaju stabljiku iznad svakog koljenca. U rano proljeće uočavaju se smeđe nerazgranate stabljike koje na vrhu nose češerić sa sporangijima i sporama. Izospore su prilagođene raznošenju vjetrom pomoću haptera. PRETILOST (gojaznost, adipoznost), porast tjelesne mase uvjetovan nakupljanjem masti, koje nastaje zbog viška uzete hrane. Višak masnog tkiva posebno opterećuje srce i krvotok. Povećava se i rizik pojave različitih bolesti (ateroskleroza, hipertenzija, infarkt, bolesti jetre, šećerna bolest i dr.).

113

ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

PRETVORBA ENERGIJE, proces kad se svjetlosna, električna, toplinska, kemijska i mehanička energija pretvaraju jedna u drugu jer se energija ne može ni stvoriti ni razoriti. PREVOĐENJE, v. sinteza proteina. PRIČVRSNICA (centromera), mjesto suženja na kromosomu za koje se prihvaćaju niti diobenog vretena tijekom diobe stanice. PRIDOŠLO KORIJENJE, v. korijen. PRIJELAZNI OBLICI, organizmi koji su po nekim svojim obilježjima na prijelazu između velikih razvojnih skupina. Na primjer, izumrle biljke pteridosperme, napola paprati napola sjemenjače, fosilna praptica s nekim osobinama gmazova, čudnovati kljunaš koji sjedinjuje obilježja gmazova, ptica i sisavaca, štitoglavac sejmurija bio je prijelazni oblik između vodozemaca i gmazova. itd. PRIJENOSNA RNK, v. tRNA. PRILAGODBA (adaptacija), osobina organizma kao konačna posljedica selekcijskog procesa. Oni oblici koji su najbolje prilagođeni uvjetima okoliša imaju izgleda za daljnji razvoj i množenje, a time i za održavanje svoje vrste u tom okolišu. Poznate su opće i specijalne adaptacije, isp. PRIMARNA IMUNOLOŠKA REAKCIJA, v.imuna memorija. PRIMARNA ORGANSKA PROIZVODNJA (primarna bioproizvodnja), proces stvaranja organske tvari iz anorganskih koji se odvija u autotrofnim organizmima, isp. autotrofi. Bioproizvodnost ekosustava ovisi o hranjivim i mineralnim tvarima, Sunčevoj energiji, toplini i dr. Od kopnenih ekosustava najproduktivnije su šume, a od vodenih ekosustava najveća je bioproizvodnja u zapadnom Atlantiku.

PRIMARNE SPERMATOCITE, stanice koje nastaju za vrijeme spermatogeneze (isp.). PRIMARNI RAST BILJAKA, rast biljaka u dužinu pomoću vršnih meristema izdanka i korijena. PRIMATI, najsavršenija skupina sisavaca kojoj pripadaju polumajmuni, majmuni, a sa zoološkog gledišta i čovjek. PRIONI, sitne zarazne čestice (manje od virusa i viroida) koje uzrokuju bolesti u čovjeka i životinja (kravlje ludilo). Otkriveni su 1980. god. Veliki su 2 do 3 nm, a građeni su samo od proteina. PRIRODNI ODABIR (selekcija, selekcijski pritisak), po Darwinu, glavni čimbenik evolucije koji uvjetuje stalno povećavanje prilagođenosti organizama životnoj sredini. Preživljavaju samo najbolje prilagođene jedinke, v. prilagođavanje. Za razliku od prirodnog odabira umjetni odabir nastaje djelovanjem čovjeka pri čemu se korisni oblici održavaju, a nekorisni propadaju. PRIRODNI SUSTAV, v. filogenetski (prirodni) sustav. PRIROĐENA IMUNOST (nespecifična), otpornost organizma na različite antigene, koja je prisutna u tijelu od rođenja bez posebnih oblika pokretanja imunološke reakcije. Nositelji te vrste imunosti su fagociti, neutrofilni leukociti i monociti. PROBAVA, proces razgradnje hrane u sastojke koji se mogu upiti u krv ili limfu ili nekim drugim načinom prenijeti do stanica. Razlikujemo intracelularnu i ekstracelularnu probavu. PROBAVNI ENZIM, v. pepsin. PROBAVNI ENZIMI GUŠTERAČE, probavljaju ugljikohidrate, bjelančevine i masti. Enzim za razlaganje ugljikohidrata

114

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

je pankreasna amilaza koja hidrolizira škrob i glikogen (ne i celulozu!) do disaharida. Proteolitični su enzimi: tripsin, kimotripsin, karboksipolipeptidaze i (deoksi) ribonukleaze. Pankreasna lipaza hidrolizira neutralne masti u glicerol i masne kiseline. Enzimatski učinak lipaze na masti pospješuje se djelovanjem žuči koja uzrokuje raspršivanje masti u male kapljice (hilomikrone). PROBAVNI SUSTAV, proteže se gotovo duž čitave dužine tijela kao probavna cijev - od usta do analnog otvora. Sastavljen je od niza probavnih organa i probavnih žlijezda s izlučivanjem (sekrecijom) probavnih sokova u probavilo. To su npr. kod čovjeka: usna šupljina sa zubima i jezikom, ždrijelo, jednjak, želudac, tanko i debelo crijevo te žlijezde slinovnice, gušterača i jetra. PRODUCENTI, proizvođači hrane u prirodi, zelene biljke. PRODUŽENA MOŽDINA (medulla oblongata), smještena je ispod velikog i ispred malog mozga. Završava kod velikog zatiljnog otvora, odakle se dalje u kralježnicu nastavlja leđna moždina. Produžena moždina je građena od vanjske bijele i unutarnje sive tvari. Regulira vegetativne funkcije, kao što su: disanje, krvni tlak, peristaltika crijeva i dr. Oštećenjem produžena moždine, npr. središta za disanje, nastupa smrt. PROFAZA DRUGE MEJOTIČKE DIOBE, v. profaza II. PROFAZA I (profaza prve mejotičke diobe), početna faza redukcijske diobe, mejoze I. U toj fazi dolazi do sparivanja, tj. konjugacije homolognih kromosoma. Parove tako sparenih kromosoma nazivamo bivalenti, a kako je svaki kromosom dvostruk (sastoji se od dvije kromatide), spareni kromosomi tvore snopove od četiri

kromatide koje nazivamo kromosomske tetrade. Tijekom konjugacije kromosoma česta je pojava ispreplitanja njihovih kromatida, a mjesta ispreplitanja nazivamo hijazme. Na hijazmama može doći do pucanja i izmjenjivanja kromatida homolognih kromosoma. Tu pojavu nazivamo krosingover (crossing over). Ona je važna jer doprinosi genetičkoj raznolikosti stanica koje nastaju mejozom. PROFAZA II, (profaza druge mejotičke diobe), jedna od etapa mejoze II u kojoj su zbivanja slična zbivanjima u profazi mitoze. U profazi II razgrađuje se jezgrina ovojnica i jezgrica, a kromosomi se počinju spiralizirati. Centrosom se podijeli na dva dijela koja putuju na suprotne polove stanice formirajući diobeno vreteno. Za razliku od stanica koje ulaze u profazu mitoze i imaju dvostruki (2n) broj kromosoma, stanice koje ulaze u profazu II imaju jednostruk (n) broj kromosoma. PROFAZA PRVE MEJOTIČKE DIOBE, v. profaza I. PROFAZA, početna faza diobe stanice, mitoze. U njoj se kromosomi počinju spiralizirati i tako postaju vidljivi. U toj fazi gubi se jezgrina ovojnica i jezgrica, a centrosom se podijeli na dva dijela koji putuju na suprotne polove stanice formirajući diobeno vreteno. PROGESTERON, jedan od ženskih spolnih hormona kojega izlučuju ženske spolne žlijezde, jajnici. U pubertetu progesteron utječe na razvoj spolnih karakteristika i pojavu menstruacijskog ciklusa. Tijekom menstruacijskog ciklusa izlučuje ga i tvorba nazvana žuto tijelo. U trudnoći ga izlučuje i posteljica. Uloga progesterona tijekom trudnoće je sprečavanje menstruacije koja bi uzrokovala gubitak ploda. PROGLOTIDI, v. trakavica.

115

ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

PROKARIOTI, (prokariotski organizmi), jednostanični organizmi koji nemaju oblikovanu jezgru ni stanične organele kao što su mitohondriji, plastidi i Golgijevo tijelo, ali imaju ribosome i umjesto jezgre nukleoid. Prokarioti su bakterije i modrozelene alge (cijanobakterije). Pošto su prokarioti jednostanični organizmi, njihov opis ujedno predstavlja i opis prokariotskih stanica. Dio znanstvenika ih ne ubraja ni u biljke ni u životinje, već u zasebno carstvo pod imenom Monere. PROKARIOTSKE STANICE (protocite, grč. pro = prije, karyon = jezgra), prijejezgrene stanice, v. prokarioti. PROKARIOTSKI prokarioti. ORGANIZMI, v.

PROPLIOPITEKUS (Propliopithecus), vrsta pramajmuna koja je živjela u razdoblju oligocena, dakle prije 25 do 30 milijuna godina. PROSOMA, prednji dio tijela (glavopršnjak) klještara iz skupine člankonožaca. Nastao stapanjem 8 tjelesnih kolutića. Na prosomi je pet pari nogu: četiri služe za hodanje, a prvi par je promijenjen u čeljusne nožice za pridržavanje plijena ili kao osjetilo. Uz usta su kliješta ili helicere, isp. PROSTATA, žlijezda koja je dio muškog spolnog sustava. Izlučuje lužnate sekrete koji neutraliziraju kiselost sperme. PROTALIJ, malena višestanična tvorevina krpastog, srcolikog ili gomoljastog oblika koja se razvija iz proklijale spore papratnjača. Na protaliju se razvijaju spolni organi (anteridiji i arhegoniji) pa je prema tome, protalij dio spolne generacije (gametofita). PROTEINI (bjelančevine), složene organske molekule građene od aminokiselina koje su međusobno povezane peptidnim vezama. U građi proteina živih bića dolazi 20 različitih aminokiselina. Proteini u živim bićima imaju strukturnu ulogu, nositelji su biokemijskih procesa u organizmu (npr. hormoni, enzimi), a u manjoj mjeri koriste se kao izvor energije. PROTEINOIDI, tvari slične proteinima koje je zagrijavanjem aminokiselina suhim postupkom dobio znanstvenik Fox. Kada ih je otapao u vrućoj morskoj vodi proteinoidi su se pretvarali u okrugla tjelešca (mikrosfere) slična jednostavnim živim stanicama. PROTEINURIJA, pojava bjelančevina u mokraći kod nekih bubrežnih bolesti. PROTEOLITIČKI ENZIM, v. probavni enzimi gušterače.

PROKLIČNICA (protonema), malena nitasta tvorevina slična steljci koja se razvija u većine mahovina iz proklijale spore. Iz prokličnice se razvije mahovina koja nosi na sebi spolne organe (anteridije i arhegonije) pa je prema tome, prokličnica dio spolne generacije (gametofita). PROLAKTIN, hormon kojega izlučuje prednji režanj hipofize (adenohipofiza), a uloga mu je da dan-dva nakon porođaja izaziva izlučivanje mlijeka iz žljezdanih stanica dojke. PROLIN, kemijski spoj iz skupine aminokiselina. PRONEFROS, v. prvi bubreg. PROPLASTIDI, stanični organeli, ubrajamo ih u skupinu staničnih organela čiji je zajednički naziv plastidi (isp.). Proplastidi su ishodišni oblik plastida iz kojeg se mogu razviti svi ostali tipovi plastida: kloroplasti, kromoplasti, leukoplasti. Nalaze se u embrionalnim stanicama npr. stanice vegetacijskog vrška. Obavijeni su dvostrukom membranom. Iz unutarnje membrane uvrtanjem nastaju tilakoidne membrane.

116

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

PROTISTI, svi jednostanični organizmi od kojih su neki svojim osobinama slični biljkama (fotosintetski autotrofni producenti), neki životinjama (heterotrofni potrošači, konzumenti), a neki gljivama (heterotrofni razgrađivači). PROTOBIONTI, v. praorganizmi. PROTOCITE, v. prokariotske stanice. PROTONEFRIDIJI, organi za izlučivanje i osmoreglaciju kod mnogih beskolutićavaca (npr. plošnjaka i oblića). Sastoje se od sustava cjevčica smještenih u parenhimu. Svaka cjevčica završava tjemenom stanicom kroz čiju se membranu apsorbiraju produkti metabolizma i odvode van. Cjevčice se na površini tijela otvaraju malim otvorom - porom. PROTONEMA, v. prokličnica. PROTOPLAZMA, živa tvar stanice koju čine jezgra i sadržaj citoplazme. PROTOZOA, v. praživotinje. PROTUŠIFRA, v. antikodon. PROTUTIJELA, v. antitijela. PROVODNI (karakteristični) FOSILI, fosilni ostaci organizama koji se smatraju karakterističnim za određeno razdoblje Zemljine prošlosti. Važni su za prosudbu kakav je bio živi svijet pojedinih geoloških razdoblja i za određivanje njihove relativne starosti. Tako su primjerice nalazi trilobita, izumrlih člankonožaca karakteristični za slojeve starog paleozoika; nalazi amonita, izumrlih glavonožaca upućuju na mezozoik; nalazi školjke kongerije karakteristični su za slojeve tercijara. PROVODNO STANIČJE, oblikuje provodne žile koje sežu u sve dijelove biljke. Provođenje vode i otopljenih minerala odvija se putem dijela žile koji se zove ksilem. U golosjemenjača to su vrlo duge

stanice koje se zovu traheide. Ksilem kritosjemenjača čine traheje, duge cijevi nastale od niza produžnih stanica kojima su reducirane poprečne mebrane. Ksilemski su elementi čvrste stanice odebljalih, ligniziranih (odrvenjenih) stijenki koji daju i potrebnu čvrstoću žili što je važno za njezin rad. U jednogodišnjih biljki, ali i višegodišnjih tijekom njihove prve godine ti ksilemski dijelovi žile daju čvrstoću čitavoj biljki. U višegodišnjih drvenastih biljaka ksilemski elementi preuzimaju postupno samo ulogu održanja čvrstoće i izgrađuju dio stabla koji zovemo drvo. Drugim dijelom žile, floemom provode se organske tvari od listova u sve biljne dijelove. PRVA MEJOTIČKA DIOBA, v. mejoza I. PRVI BUBREG (predbubreg ili pronefros), organ za izlučivanje samo kod kružnousta i ličinke riba. Kod ostalih skupina kralježnjaka zakržlja u njihovu zametnom razvitku. Sastavljen je od tri para cjevčica sa trepetljikavim lijevcima ispred kojih je klupko krvnih žila (glomerul). Iz njih se krv filtrira u zajednički izvodni kanal, predbubrežnu cijev. PRVI VIŠESTANIČNI ORGANIZMI, organizmi koji su nastali tijekom biološke evolucije prije 600 do 700 milijuna godina. Njihov razvoj započeo je u vodi. PSEUDOCEL, tjelesna šupljina koja po postanku odgovara primarnoj tjelesnoj šupljini ili blastocelu, isp. blastula. PSEUDOPODIJI (lažne nožice, grč. pseudos = laž, podos = noga), izdanci u praživotinja (npr. amebe) koji služe za pokretanje i uzimanje hrane procesom endocitoze. Nastaju kao posljedica strujanja protoplazme (endoplazme prema ektoplazmi ili egzoplazmi) i mijenjanja fizikalnog stanja citoplazme (sol i gel stanje).

117

Toplokrvnost i sposobnost da lete omogućili su pticama široku rasprostranjenost na Zemlji. Djelovanjem muških spolnih hormona (testosteron). do 13. Ptice su se razvile od pragmazova. Snesena ptičja jaja trebaju za zametni razvitak inkubaciju . briga za podmladak. pneumatične kosti. Razlikuju boje.zagrijavanje ležanjem roditelja na njima. t. Najstarija poznata vrsta je jurska ptica. kroz koje se izmjenjuju plinovi između okoliša i unutarnjosti biljke te izlučuje voda. praptica ili Archaeopteryx. mikroskopski otvori u epidermi. drevne izumrle biljke nalik na papratnjače. godine. a sudjeluje u razgradnji škroba do šećera maltoze i glukoze. i 18. koje su imale samo zelenu. Pojavile su se prije oko 390 milijuna godina (geološko doba devon). "paprati sa sjemenkama". najčešće s 4 prsta. Ptice su važne kako za čovjeka tako i u održavanju prirodne ravnoteže. phiton = biljka). Za vrijeme prolaska kroz jajovod jaja se obavijaju ovojnicama. Naime. Ptice se hrane zrnjem a mnoge su mesojedi. Sve ptice legu jaja. započinje lučenjem GTH iz adenohipofize. Danas u biosferi živi oko 8600. PUBERTET (spolno sazrijevanje). oni su potrkušci ili čučavci. isp. a u Hrvatskoj oko 250 vrsta. Puči se otvaraju kada u njima poraste turgor (u odnosu prema susjedicama) zbog primanja vode u zapornice. Ptice imaju dobar sluh i izvrstan vid. PTERIDOSPERME. Ženke imaju samo lijevi jajnik i jajovod. a završava između 16. Osim fizičkih promjena u pubertetu se pojavljuje niz fizioloških i psihičkih promjena. Ptice pokazuju raznolike oblike pojedinačnog i zadružnog ponašanja kao npr. alantois i seroza. Površinska je ovojnica tvrda lupina ili ljuska. koje su na vrhovima listova umjesto sporangija nosile sjemenke. Oplodnja je unutarnja.j. PTIJALIN (alfa amilaza). U mišićnom se želucu hrana usitnjava mehanički. počevši od puberteta. a stražnji noge za hodanje. Probavu olakšava volja i žljezdani želudac gdje se hrana razgrađuje enzimima. Nemaju mokraćni mjehur. progesteron) iskazuju se primarne i sekundarne spolne oznake. Lučenje GTH nadzire hipotalamus gdje se. Oko zametka se stvaraju zametne ovojnice: amnion. treći bubreg). Na glavi je kljun s ustima bez zuba. Mogu se smatrati prijelaznim oblicima između papratnjača i golosjemenjača. probavni enzim koji se nalazi u sastavu sline. Pluća su povezana sa pet pari zračnih vrećica koja zalaze među organe i u kosti. Današnje se ptice dijele u dvije skupine: staročeljuske ili bezgrebenke i novočeljuske ili grebenke. Srce je sastavljeno od dvije pretklijetke i dvije klijetke. psilos = gol. Puči okružuju dvije stanice zapornice uz koje se nalaze mnogo veće stanice susjedice. odnosno ženskih spolnih hormona (estrogen.dodatak 5. golu i vitičasto razgranatu stabljiku bez listova. Mnoge kosti su šuplje i ispunjene zrakom tzv. v. Kad se iz jajeta izlegu mladunci. Kod djevojčica se javlja menarha.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ PSILOFITI (grč. Dišu plućima. luče neurohormonske tvari za oslobađanje gonadotropnih hormona. godine. a kod dječaka polucija. a fotosin- 118 . Prsna kost ima greben za koji se drže prsni (letni) mišići. Imaju dva para udova: prednji par su krila. Tijelo im je pokriveno perjem. PUČI (stome). PTICE (Aves). prve papratnjače. Pubertat započinje u djevojčica oko 10. skupina kralježnjaka koja se potpuno prilagodila životu na kopnu. gradnja gnijezda. Traje nekoliko godina. leženje na jajima. najčešće na naličju listova. a u dječaka jednu do dvije godina kasnije. Mužjaci prenose sjeme izravno u nečisnicu. kada u stanice zapornice ulaze kalijevi ioni. isp. život u jatima i seobe. Za izlučivanje imaju jedan par pravih bubrega (v.

balavci). RAKOVI (Crustacea). kostur i drugi organi. RADULA. koji se opiru bitnijoj promjeni pH. stražnjoškržnjake i plućnjake.bazna ravnoteža. (1787. v. purinske baze jednog lanca vežu se s komplementarnim bazama drugog lanca. R RAČVASTA EVOLUCIJA. v. neparnu repnu peraju. povisuje se osmotski tlak i voda ulazi u stanice zapornice. Otkrio razgranate neurone u mozgu nazvane Purkinjove stanice. Puževi imaju spiralno zavijenu kućicu ili su bez nje (npr. ploštenjak i ogrc. npr. priljepak. te se one raspadaju uz pojavu ionizirajućeg zračenja. kosti. izotopi elemenata koji imaju nestabilne jezgre. Najpoznatiji puževi na kopnu su: puž vinogradnjak i balavac. Puči se zatvaraju kad se turgor smanji u odnosu prema susjedicama. Vanjskim izgledom punoglavac je sličan mladoj ribici.). Hrani se algama i postupno se preobražava u odrasli oblik. kemijske tvari u krvnoj plazmi. isp. noge. pulsiranje arterija koje se može mjeriti na mjestima koja su bliže površini tijela. PULS (bilo). Budući da srce ubacuje u aortu krv na mahove (oko 70 puta u minuti). v. životinje iz skupine člankonožaca. fosfatni ili proteinski puferi. Živi u vodi. acido . PUFERI. količina energije koju tijelo dnevno utroši na radne aktivnosti. a stražnjoškržnjaci i plućnjaci su dvospolci. organski spojevi iz skupine dušičnih baza koje se nalaze u sastavu nukleinskih kiselina (DNA. Koriste se u istraživanju stanica npr. RAHITIS. Ličinački razvoj žabe naziva se preobrazba ili metamorfoza. RNA). bikarbonatni. v. ličinka žabe. PUNOGLAVAC. J. Asimetrične su životinje jer je tijekom evolucije nastalo zakretanje ili torzija tijela. mokrice ili babure (pokretni 119 . Ima škrge. PURKINJE. PUŽEVI. trenica. neće se ni ispravno ni dovoljno stvarati anorganski dio kostiju što uzrokuje savitljivost i deformaciju. češki citolog koji 1839. zrakasta simetrija.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE tezom nastaje šećer. Tijekom metamorfoze razvijaju se pluća. S obzirom na stupanj torzije tijela dijele se na: prednješkržnjake. Na kopnu uz more žive npr. pomoću radioaktivnog izotopa ugljika dokazano je da se u procesu fotosinteze ugljik(IV)-oksid iz zraka ugrađuje u molekulu šećera. god. a u kopnenim vodama: barnjak. bjeloočnica. RADNI METABOLIZAM. PURINSKE BAZE. krv u arterijama teće pulsirajućim tlakom. v. opisuje protoplazmu. RADIJALNA SIMETRIJA. Ako u hrani nemaju dovoljno kalcija i vitamina D3. Metamorfoza traje oko 3 mjeseca. dječja bolest kostiju koja nastaje zbog slabe kalcifikacije kostiju. Purinske baze su adenin i gvanin. čempresi. v. – 1869. svitak i bočnu prugu. u moru: volak. ogrc i puzlatka. RADIONUKLIDI (radioizotopi). a nestaju škrge i rep. divergentna evolucija. isp. PUPILARNI REFLEKS. U molekuli DNA. dvodjelno vensko srce. Prednjoškržnjaci su razdvojenog spola. najbrojnija skupina mekušaca. PUPULJICA. Princip komplementarnosti vrijedi i pri sintezi RNA.

a njegovi ostaci nađeni su u istočnoj Africi. Spolnim razmnožavanjem nastaju raznolikije jedinke nego nespolnim. proces koji započinje začećem. Indiji i Europi. Oplođuju se pomoću paketića spermija. RAZLAGAČI v. "mozak". početne reakcije fotosinteze koje započinju kada svjetlosna energija Sunca izbija elektrone iz molekule klorofila. mnogostruka (multipla) dioba. odnosno biljci. Dišu škrgama koje su na nogama hodalicama. v. Za izlučivanje imaju ticalne ili antenalne žlijezde . Važan su paleontološki dokaz evolucije. Služi za dobivanje preparata koji se u porodiljstvu rabi za izazivanje grčenja uterusa te kao temelj halucinogene droge LSD. izumrli oblik primata koji je živio već prije 15 milijuna godina. jastog. Iz njih se razvijaju ličinke koje se presvlače nekoliko puta tijekom svog poslijezametnog razvitka. u 99% slučajeva se susreće kod pušača. RAŽOVA GLJIVICA. Druga osjetila su za ravnotežu (statociste). Claviceps purpurea). sklerocij. Spolnim razmnožavanjem se dobivaju potomci s novom kombinacijom gena. uzastopni prijelazni oblici na kojima se mogu pratiti postupne promjene i razvoj neke vrste ili cijele skupine. razvitak novih jedinki. (ergot. Pripadaju skupini deseteronožnih rakova. riječni rak.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ oblici) i vitičari (sjedilački oblici). parazit na plodnici trava gdje se u klasu na mjestu pšena razvija roščić. Glava i prsa najčešće su srasli u glavopršnjak. Dobro su proučeni razvojni nizovi konja. RAZVITAK ČOVJEKA. miris. RAMAPITEKUS (Ramapithecus). U glavi je glavni ganglij. omnivori. Jedinke koje nespolnim načinom daju potomke stvaraju klon. zvanih omatidije. jedan od najčešćih i najteže izlječivih oblika raka. Svako okašce prima dio slike koja se slaže poput mozaika. pupanje i vegetativno razmnožavanje (dijelovima tijela višestaničnih biljaka). filogenetski sustav. opip. a obuhvaća embrionalni. (bronhalni karcinom). a može biti spolno ili nespolno. Oči se sastoje od mnogo malih okašaca. Na zatku su noge za hodanje. Presvlačenje je fiziološki proces koji kontroliraju hormoni iz neurosekretornih stanica živčanog sustava. RAZVOJNI (filogenetski) NIZOVI. Na prsima imaju tri para čeljusnih nogu i pet pari za hodanje. v. fetalni i postnatalni (poslijeporodni) razvitak čovjeka do njegove zrele dobi. slona i barskog puža ogrca. Postoji više oblika nespolnog razmnožavanja: dvojna (binarna) dioba. Ti sklerociji sadrže otrovni alkaloid ergotin koji je ljekovit ako se ispravno primjeni. Ženke nose oplođena jaja prilijepljena na nekom vanjskom organu. kao vodenbuha i ciklop. REAKCIJE NA SVJETLU (reakcije ovisne o svjetlosnoj energiji). a pri tom prijenosu dio energije predaju za 120 . Jednostavnije građeni rakovi su planktonski niži raci. potomaka. Ostali su rakovi vodeni organizmi. isp. Danas se smatra da je u toj skupini kroz vrlo dugo razdoblje došlo do najveće preobrazbe u smjeru nastanka čovjeka. RAZNOJEDNI ORGANIZMI. škamp i hlap. Dim cigarete oštećuje stanice dušnika. Potomci nastali nespolnim načinom razmnožavanja genetički su identični matičnoj stanici. Elektroni putuju preko niza prenosilaca natrag prema klorofilu. RAZMNOŽAVANJE. a te oštećene stanice početni su stupanj razvoja tumora koji raste i širi se na pluća. Na glavi se nalaze dva para ticala i jedan par složenih očiju. Od viših rakova (imaju 20 kolutića) poznati su npr. saprofagi. RAK PLUĆA. RAZRED.

gutanje. tj. reakcije spajanja s vodikom itd. Osim elektrona. zvjezdače. npr. reakcije fotosinteze koje se nadovezuju na reakcije na svjetlosti. kihanje i dr. npr. Isp. ionizacija vode) na H+ i OH. sposobnost obnavljanja izgubljenih dijelova tijela. isp. REDUKCIJA. REDUCENTI. Recesivna svojstva su. međuneuron i motorički neuron). saprofagi. bezkralježnjaka: spužve.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE sintezu molekula ATP-a. reakcije u tami. To je skup vrlo složenih biokemijskih reakcija u kojima se ugljik(IV)-oksid postupno reducira vodikom do šećera glukoze uz utrošak energije. mišića koji će izvršiti radnju. v. Sastoji se od osjetilnog (receptorskog) neurona. REFLEKSNI LUK. virnjaka. npr. Kalvinov ciklus). Recesivno svojstvo do- 121 . REFLEKS. Pojedini refleksi su prirođeni refleksi (npr. atom ili ion prima ili dobiva jedan ili više elektrona. Kao što je rečeno. To je monosinaptički refleksni luk (jedna sinapsa i dva neurona osjetilni i motorički). (potisnuto svojstvo). ovčji metilj. kašljanje. REAKCIJE OVISNE O SVJETLOSNOJ ENERGIJI. RED. mejoza. motorička reakcija na primljeni podražaj bez sudjelovanja kore velikog mozga i bez reakcije svijesti. RECESIVNO SVOJSTVO. smeđa boja dlake goveda. niski rast graška. Jednadžbu reakcija u tami možemo sumarno prikazati ovako: NADPH2 + CO2 + E (ATP) → C6H12O6 (glukoza) lazi u fenotipu do izražaja samo u slučaju homozigotnosti. v. svrsishodna. v.ione. gljive i bakterije. Kod npr. REDUKCIJSKA DIOBA. v. v. motoričkog neurona i izvršitelja (efektora) tj. U primjerima križanja aleli za recesivno svojstvo označuju se malim slovima. aa ili bb itd. kemijska reakcija u kojoj neka molekula. hidre. Dio elektrona koje svjetlosna energija izbija iz klorofila ne vraća se natrag nego prelazi na spoj NADPH. Kao produkt ovih reakcija oslobađa se kisik koji odlazi u atmosferu. Voda se razlaže djelovanjem svjetlosne energije (fotoliza vode. REDIJE. krvna grupa 0 u čovjeka itd. filogenetski sustav. reakcije na svjetlu. Među kralježnjacima to se svojstvo očituje u re- REAKCIJSKO SREDIŠTE. To su. kada organizmi nose iste alele za to svojstvo. Refleks je usmjeren na zaštitu organizma. brza. REGENERACIJA. razlagači organskih tvari. a drugi su stečeni na temelju iskustva. NADPH prima i ione vodika koji nastaju razlaganjem vode te na taj način NADPH prelazi u reducirani oblik NADPH2. koje sudjeluju u odvijanju refleksa. NADPH2 kao izvor vodika i ATP kao izvor energije. položaj jedne molekule ili para molekula klorofila a u fotosistemu. REAKCIJE U TAMI (reakcije neovisne o svjetlosnoj energiji. Za njihovo odvijanje neophodni su ugljikov dioksid. REAKCIJE NEOVISNE O SVJETLOSNOJ ENERGIJI. zatvaraju ga živčane stanice sa svojim živčanim vlaknima. ježinca ili mješčićnice. a hidroksil ioni otpuštaju elektrone koji odlaze preko niza prenosilaca u klorofil nadomještajući mu elektrone koji su mu izbijeni da bi prešli na molekule NADP. Posebnu skupinu čine uvjetovani refleksi. sinapse u leđnoj moždini.). vodikovi ioni se vežu na NADP. Postoje i disinaptički refleksni luk (dvije sinapse i tri neurona osjetilni. Vodik iz vode privremeno vezan u spoj NADPH2 poslužit će u reakcijama u tami za redukciju CO2. reakcije oduzimanja kisika. svojstvo koje ne dolazi u fenotipu uvijek do izražaja. sisanje.

Kostur njihove prsne peraje ima sličnosti s kosturom prednje noge vodozemaca. koji se može nalaziti na membranama eri- 122 . biljni hormoni. kao kod čovječje ribice. a životinjski relikti su čovječja ribica. sredozemna medvjedica itd. gamete stanica ili organizme koji su nastali prirodnom genetičkom rekombinacijom. rhesus faktor). isp. jedan od antigena. RELIKTI. pa čak pluća i gonade. Najpoznatiji su repaši daždevnjaci i vodenjaci. Ličinke su slične odraslima. a sudjeluje u razgradnji bjelančevine kazeina iz mlijeka. Ta se pojava zove neotenija. Imaju dobro razvijene udove za kretanje. a punoglavac žabe rep i noge. enzim kojega izlučuje želudac djeteta u vrijeme sisanja mlijeka. RESTRIKCIJSKI ENZIM (restrikcijska endonukleaza). isp. životinjske i ljudske. fenotip. v. RESPIRACIJA. ali se razmnožavaju u vodi. oči. REGULATORI RASTA. RESPIRATORNI SUSTAV. Odrasli repaši žive uglavnom na vlažnim mjestima. nogu. isp. koje se u nekih vrsta zadrže tijekom čitava života. Sposobnost regeneracije je manja u životinja na višem stupnju razvoja. v. Neki su relikti ujedno i endemi. Daždevnjaci mogu obnoviti stopalo.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ patih vodozemaca. hrvatska sibireja. REPAŠI. DNA proizvedena spajanjem gena od različitih vrsta. Prijelazni su oblik jer prve pokazuju razvoj prema kopnenim životinjama. čine živčane stanice smještene u produženoj moždini koje autonomno određuje frekvenciju disanja. rep. dišni sustav. Neke resoperke iz roda Latimeria žive i danas i nazivaju se živi fosili. v. Rh-sustav. RETROVIRUSI. Rh – FAKTOR. v. REKOMBINACIJE. Dišno središte se dopunski podražuje povećanom razinom ugljikovog dioksida u krvi odnosno smanjenom razinom kisika u krvi. RESPIRACIJSKO (dišno) SREDIŠTE. a posljedica su nezavisnog odvajanja kromosoma i krosingovera. RESOPERKE. REVERZNA TRANSKRIPTAZA. naziv koji se primjenjuje za: genotip. pojava novih kombinacija gena koje se u fenotipu očituju kao nove osobine. Imaju vanjske škrge. retrovirusi. kojih nije bilo u roditelja.tehnologija omogućava prijenos gena iz jedne vrste u genom druge vrste: biljne. Neki se od repaša mogu razmnožavati u ličinačkom stanju. disanje. Rekombinantna DNA . RENIN. v. Biljni relikti u Hrvatskoj su velebitska degenija. biljne i životinjske vrste kojima je areal u prošlosti bio mnogo širi. enzim koji reže dvostruki lanac DNA na specifičnom mjestu na određene dijelove. REKOMBINANTNA DNA. a genetički ih inženjeri upotrebljavaju za stvaranje rekombinantne DNA. Neki kopneni daždevnjaci nemaju pluća. Rh SUSTAV (Rh-faktor. Ti se enzimi izoliraju iz bakterija. pa se plinovi izmjenjuju kroz kožu. u paleozoiku. skupina vodozemaca koji i kao odrasli oblici imaju rep. vučja stopa itd. tzv. REKOMBINANTNI TIP. Koža je bogata žlijezdama koje mogu izlučivati otrovne tvari. podneblja ili drugih obilježja staništa. stara skupina riba koštunjača iz perioda devon. RNK virusi čija se genetička uputa prevodi u DNK uz pomoć vlastitog enzima reverzne transkriptaze. ali se kasnije smanjio zbog promjene klime. Rh-aglutinogen.

v. RIBOSOMSKA RNA. Nosne šupljine su samo mirisne jamice. Strujanje vode osjećaju bočnom prugom. Srce je dvodjelno i vensko. Tijelo je pokriveno ljuskama. B i 0. pokrovno tkivo. šećera riboze i jedne od četiri dušične baze (adenina. prvi kralješnjaci u kojih su razvijene čeljusti i hrskavična ili koštana kralježnica. složeni organski spoj građen od većeg broja ribonukleotida. v. molekula: proteina i RNA. Hladnokrvne su životinje. v. U krvnoj plazmi Rh(+) i Rh(–) osoba nema prirođenih protutijela kao što su uobičajena kod osoba krvne skupine A. Do sinteze stečenih Rh-aglutinina dolazi u imunološkom sustavu samo imunizacijom Rh(–) osobe eritrocitima Rh(+) osobe i to samo u 2 slučaja: nakon pogrešne transfuzije krvi Rh(+) osobe u Rh(–) osobu i tijekom trudnoće Rh(–) majke koja nosi Rh(+) dijete. Oplodnja je uglavnom vanjska. Ribe vide na malu udaljenost. u tzv. podanak. psitakoze. Krvotok je zatvoren. RIBE (Pisces). Nalaze se slobodni u citoplazmi ili su vezani uz membrane zrnate (hrapave) endoplazmatske mrežice. kuglastog ili štapićastog oblika. Svaki ribonukleotid sastoji se od triju vrsta molekula: fosfata. Građeni su od dviju vrsta 123 . Na ribosomima koji se nalaze slobodni u citoplazmi sintetiziraju se proteini koji će ostati u stanici. Ribe dišu škrgama. 7 ili 8 ribosoma. Osjetilni organi su prilagođeni životu u vodi. dok se na ribosomima vezanim uz membrane endoplazmatske mrežice sintetiziraju proteini koji će se izlučiti izvan stanice. Plivaći je mjehur ispunjen plinom i služi kao hidrostatski organ. Imaju 2 para parnih peraja i 3 ili više neparnih. grozdove od 5. Očni su kapci prozirni i srasli. Rh-sustav. gvanina. stabljika. RIZODERMA. kožno staničje posve mladih dijelova korijena. Prema građi tijela ribe dijelimo na: hrskavičnjače i koštunjače (zrakoperke i nosnoprolaznice). 6. podzemna stabljika. Ribosomi koji se u citoplazmi nalaze slobodni mogu biti povezani u skupine. RIZOMA (grč. a neke su i živorodne. KISELINA. trahoma itd. RIKECIJE. RNA (ribonukleinska kiselina. Ribe imaju samo unutarnje uho. trup i rep. Razmnožavaju se jajima. Osobe koje imaju taj antigen su Rh-pozitivne. RNK). bakterije izuzetno malih dimenzija. Na vretenastom tijelu razlikuje se glava. Poznato je oko 20000 vrsta. kod životinja i čovjeka uzročnici su teških oboljenja. rRNA. kemijski spoj iz skupine monosaharida (jednostavnih šećera) pentoza opće formule C5H10O5. Kao obligatni paraziti. Na ribosomima se odvija sinteza proteina. Rh(+).____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE trocita. rhiza = korijen). RIBOZA. a naziv je dobio prema vrsti majmuna (Macacus rhesus) kod koje je prvi put otkriven. v. RHESUS FAKTOR. U koži su žlijezde koje izlučuju sluz. Ženke legu jaja (ikru). a one koje ga nemaju Rh-negativne. Rh(–). poliribosome (polisome). pjegavog tifusa. a mužjaci ih prekrivaju spermom (mliječ). Vidljiva su samo elektronskim mikroskopom. a strukturne: HO CH2 H H O H OH HO OH H Izgrađuje nukleotide ribonukleinske kiseline (RNA). Žive u moru i slatkim vodama. Za izlučivanje im služi drugi bubreg (mezonefros). citozina ili uracila). RIBONUKLEINSKA RNA. Molekula RNA građena je samo od jednog poli- RIBOSOMI. zrnca u citoplazmi svih vrsta stanica.

badem) i jabučnjače (jabuka. SAMOAMPUTACIJA. RUDIMENTI (rudimentarni organi. šumska jagoda). Vanjski otvor rodnice leži ispod vanjskog otvora mokraćne cijevi. S S-FAZA. SAMOOSAKAĆIVANJE. ugljikohidrat iz skupine saharida. enzim koji katalizira prvu reakciju Calvinova ciklusa tijekom fotosinteze. ROŽNICA (cornea). Sastavljen je od dvije molekule jednostavnih šećera i to od jedne molekule glukoze i jedne molekule fruktoze. U predvorju rodnice je djevičanski zalistak (hymen). breskva. zub mudrosti. RUDIMENTARNI ORGANI. SAHAROZA (tršćani šećer). kupina. v. RUBISKO (ribuloza-1. odstranjenje organskih tvari u smislu odvijanja kruženja tvari i protjecanja energije u ekosustavu. lat. ribosomska RNA). ostaci kukovlja u kita i nekih zmija. RNaza. RODNICA (vagina). Razlikujemo tri tipa RNA: glasnička (messenger) RNA (gRNK ili mRNA). v. trtica. kruška. enzim koji ubrzava razgradnju molekula RNA. SAMOSAKAĆENJE (autoamputacija. SAMOOČIŠĆENJE (autopurifikacija) VODA. Na molekule rRNA otpada 60 do 80 % ukupne stanične RNA. RUŽE. v. Dobiva se iz šećerne trske i šećerne repe. disaharid. v. Povezuje vrat maternice s vanjskim spolovilom. Kloroplasti sadržavaju vrlo mnogo tog enzima. interfaza. kod čovjeka su to crvuljak slijepog crijva. autotomija. Molekule RNA sintetiziraju se u jezgri na kalupu molekule DNA. bjeloočnica. npr. kemijski spoj. rudimentum = prvi početak.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ nukleotidnog lanca koji može biti ispružen ili savijen na različite načine. malina. rRNA (rRNK. zakržljali organi koji u organizmu nemaju više nikakve funkcije ili je ona svedena na minimum. dvospolne cvjetove s peteročlanim obojenim vjenčićem i mnogo prašnika. ugljikohidrati. rudimenti. v. samosakaćenje. oskoruša). cjevasta tvorevina duga 7 do 11 cm. pročišćavanje otpadnih voda na osnovu bioloških zakonitosti tj. koštunjače (trešnja. ribosomska RNA (rRNK ili rRNA) i transportna RNA (tRNK ili tRNA). Dijele se na: ružičnjače (divlja ruža. filogenetski sustav. v. v. v. samoosakaći- 124 . samosakaćenje. tip ribonukleinske kiseline koja zajedno s proteinima izgrađuje ribosome. RNA ima važnu ulogu u sintezi proteina. Položaj i broj plodnih listova je promjenljiv. To su. Molekule rRNA sintetiziraju se u jezgrici (nukleolusu). U biosferi ga ima više negoli bilo koje druge bjelančevine. RNK. filogenetska sistematika. RODBINSKO SUSTAVOSLOVLJE. šljiva. Dokaz su evolucije. Stijenke su rodnice vrlo rastezljive. samosakaćenje. v. RNA. dunja. glog. predstavnici ove skupine dvosupnica imaju pravilne. a najviše ih ima u citoplazmi stanice i na ribosomima. ROD. SAHARIDI. pokušaj). tjelesna dlakavost itd.5-difosfat karboksilaza).

60 . a protoplazmu naziva fizičkim temeljem života. SELIDBA (migracija) RIBA. ugljikovog dioksida i mineralnih tvari. stoljeća opisuje stanicu kao nakupinu protoplazme s jezgrom. – 1881. utvrdio da su stanice osnovni građevni elementi svih životinja. poprečnoprugasti mišić. slanoći i količini hrane ili mriještenje. barijere u vodotocima nastale vrlo složenim procesom koji završava taloženjem otopljenog vapnenca na mahovine sedrotvorce. prirodni odabir. (1810. Zajedno s njemačkim zoologom Schwannom utemeljitelj je tzv. imuna memorija. SARKOLEMA. Novi rep kod gušterice se brzo obnovi i naraste. SEKUNDARNI RAST. god. hraneći se organskim tvarima u raspadanju (npr. v. Uzroci putovanja riba na druga mjesta su sezonske promjene u temperaturi. sedrene barijere. god. nastije. Te tvari mogu iskoristiti zelene biljke u procesu fotosinteze. utvrdio da su stanice osnovne strukturne jedinice svih biljaka. Hrane se usitnjenim. v.). ovojnica mišićnog vlakna v. repa kod daždevnjaka ili guštera. povećanje promjera stabljike i korijena mnogih biljaka (posebice drvenastih trajnica) kao rezultat diobe stanica bočnih meristema. “stanične teorije”.ih god. – 1882. oblik ponašanja riba. povećanje mase i volumena tijela te razmnožavanje heterotrofnih organizama. nastali CaCO3 talože na površini mahovina koje odumiru i na koje se slažu nove što uzrokuje “rast” barijera: Ca(HCO3)2 → H2O + CO2 + CaCO3 SEIZMONASTIJE. SEDRA. djelomično razgrađenim i uginulim biljnim dijelovima ili životinjskim izmetom ili životinjskim lešinama. otkinuće u slučaju opasnosti npr. brzina sedimentacije.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE vanje). uz vodu. gljive). J. SEDIMENTACIJA. v. njemački botaničar koji je 1838. SELEKCIJA. a. mošnja. (1804. SAPROFAGI. Posebno važni saprofagi su heterotrofne bakterije koje razlažu organske tvari do anorganskih sastojaka: vode. SCHLEIDEN. njemački zoolog koji je 1839. “staničnu teoriju”. T. SAPROFITI. v. SCHWANN. v. v. Najznačajniji heterotrofi koji ostvaruju sekundarnu organsku produkciju su životinje. proces proizvodnje organskih tvari heterotrofnih organizama. v. SEKUNDARNA IMUNOLOŠKA REAKCIJA. prirodni odabir. odnosno rast. SELEKCIJSKI PRITISAK. 125 . Zbog te svoje uloge heterotrofne bakterije nazivamo i razlagači (reducenti). SCROTUM. SCHULTZ. SEDRENE BARIJERE. ali umjesto kralješaka podupire ga hrskavica. 19. SEKUNDARNA ORGANSKA PROIZVODNJA (sekundarna bioproizvodnja). M. M. Rep se odvaja na posebnome mjestu. S vodom najprije reagira ugljikov dioksid nastao disanjem organizama u vodi pri čemu nastaje ugljična kiselina: CO2 + H2O → H2CO3 Ugljična kiselina otapa vapnenac dajući topljivi kalcijev hidrogenkarbonat: H2CO3 + CaCO3 → Ca(HCO3)2 Cijanobakterije iz bikarbonata otopljenih u vodi uzimaju CO2. Zajedno s njemačkim botaničarem Schleidenom utemeljio tzv. organizmi koje ubrajamo u skupinu heterotrofa.). organizmi koji žive na uginulim organizmima.

isp. Ovim procesom upravlja molekula DNA uz posredovanje nekoliko vrsta RNA (mRNA. bršljan ili slak. Jedinice takve upute čine grupe od po tri dušične baze. mjesto prijenosa živčanog podražaja (impulsa) s aksona na drugu živčanu stanicu.. žljezdanu stanicu ili mišić. a odvija se u jezgri gdje se genska uputa prepisuje s DNA na glasničku RNK (mRNA). SEROZA. SIMBIOGENEZA. Svaki triplet prepisan s DNA na mRNA zove se kodon i 126 . proces koji se odvija na ribosomima u citoplazmi stanice u kojem se iz aminokiselina sintetiziraju proteini. Kroz sinaptičku pukotinu impuls prenose kemijski prijenosnici (neurotransmiteri) tj. ali su reproduktivno izolirane zbog različitog ponašanja ili različitog sazrijevanja gonada. SINTEZA BJELANČEVINA. SIMBIOZA (potpomaganje). SINANTROPUS. živčano . razlikujemo pobuđivačke (eksitacijske) i potiskivačke (inhibicijske) sinapse. trojke ili tripleti. SINDROM. Svaka trojka je šifra za jednu određenu aminokiselinu. odnosno dušičnih baza sadrži uputu za sintezu nekog proteina. kod amniota treća zaštitna zametna ovojnica. npr. SINGER. pravirusa (jezgra) i zavojite bakterije tipa današnje spirohete (bič). protobakterije (mitohondrij). Pri prepisivanju se sintetizira lanac mRNA po principu komplementarnosti. neke alge i gljive žive u simbiozi u obliku lišaja. v. rRNA). god. synapsis = sveza).ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ SERIN. DNA koja se nalazi u jezgri (genska DNA) u redoslijedu svojih nukleotida.mišićna veza. kineski pračovjek. a druga nema niti koristi niti štete. Odnos u kojem jedna vrsta ima koristi. SIDA. slabo pokretni organizmi. mutualizam) itd. Primjer simbiogeneze jednostaničnih alga i gljiva je lišaj. znanstvenici koji su 1972. v. mikoplazmodija (citoplazma). SESILNI ORGANIZMI. nazivamo komenzalizam. kao npr. Djelovanje simpatikusa je suprotno djelovanju parasimpatikusa. razradili i danas prihvatljiv model membrane koji se zove “model tekućeg mozaika”. dio autonomnog ili vegetativnog živčanog sustava čija živčana vlakna nadziru rad većine unutarnjih organa povećavajući ili smanjujući aktivnost tih organa. tzv. Isp. SIMPATRIJSKA SPECIJACIJA. SIMPATIKUS. spolna zarazna bolest čiji je uzročnik bakterija spiroheta. udruživanje pojedinih prokariotskih organizama. specijacija kada se populacije nalaze na istom prostoru. SIFILIS (lues).L. specijacija. AIDS. U ranim stadijima bolest je izlječiva.J. a neliječeni sifilis uzrokuje teška oštećenja gotovo svih organa i na kraju smrt. Smatra se da je prva biljna stanica nastala simbiogenezom: modrozelene alge (plastid). neurohormoni. SINTEZA PROTEINA (sinteza bjelančevina). Početna etapa u procesu sinteze proteina je transkripcija ili prepisivanje. sinteza proteina. isp. tRNA. sjedilački. skupina različitih znakova (simptoma) bolesti koji se javljaju zajedno. Preko sinapse se prenosi impuls samo u jednom smjeru. Prema djelovanju sinapsi na neuron. SINAPSA (grč. odnos između dviju ili više jedinki različitih vrsta iz kojega te jedinke imaju korist. rak samac živi u simbiozi s moruzgvom (tzv. i NICOLSON. v. zrakasta simetrija i bentos. S. isp. v. G. kemijski spoj iz skupine aminokiselina.

kretanju. Prema raznolikosti tjelesne građe dijele se na: jednootvore (kljunaše). Kostur i mišići prilagođeni su četveronožnom. Tako će se npr. Molekule aminokiselina vežu se u molekulu proteina tako da se mRNA pomiče na površini ribosoma i prima redom molekule tRNA koje donose sa sobom aminokiseline. SISTOLIČKI TLAK.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE odgovara pojedinoj vrsti aminokiseline. pa se venska i arterijska krv ne miješaju. isp. lat. To je svojstveno samo sisavcima. sisavci imaju pravi bubreg. dojka). na kodon UAU vezati tRNA s antikodonom AUA i donijeti aminokiselinu triptofan. kao i mliječne žlijezde koje su zapravo promijenjene kožne žlijezde. UGA i UAG. Toplokrvni su organizmi. Udovi su ispod tijela i mogu se okretati. tlak krvi na stijenke arterija u trenutku kada stezanjem (sistolom) srčanog mišića uđe u aortu nov (udarni) volumen krvi. SISTEMATIKA (sustavoslovlje. One služe za provođenje asimilata (produkata fotosinteze). znanost koja se bavi svrstavanjem živih bića u određene sustave koji se temelje na srodstvenim odnosima. Kisik se veže za dišni (krvni) pigment hemoglobin. Svaka tRNA ima posebnu trojku baza. Srce je podijeljeno na lijevu i desnu stranu. Tako sisavci imaju prilagodbe na toplinu i hladnoću (v. odnosno razvrstavanje živih bića u filogenetski prirodni sustav. SISTEMSKI OPTOK KRVI. U procesu translacije veliko značenje imaju molekule transportne ili prijenosne RNK (tRNA) koje na sebe vežu po jednu aminokiselinu i donose je na ribosom. Raznolikom funkcionalnom građom svih organskih sustava prilagodili su se najrazličitijim načinima života i preživljavanju u svim mogućim staništima. veliki optok krvi. Sinteza određenog proteina završava kada mRNA donosi kodon koji ne odgovara niti jednoj vrsti aminokiseline. Nakon rođenja mladi sišu majčino mlijeko. kontrakcija ili stezanje srčanog mišića (klijetke ili pretklijetke). Preci pravih sisavaca bili su prakukcojedi. Sisavci su se razvili od skupina mezozojskih prasisavaca. moraju mnogo jesti i potrebna je velika izmjena O2 i CO2. Za izlučivanje mokraće. provodni elementi u većine biljaka. Čeljusti i zubi im omogućavaju da žvaču hranu. SISTOLA (grč. Taj tlak se prenosi kroz velike i male arterije do arteriola i kapilara. Zameci se razvijaju u maternici obavijeni posteljicom (placentom). Danas u biosferi živi oko 4500 vrsta sisavaca. v. filogenetski sustav. od čega 109 vrsta u našoj zemlji. tj. Prednji dio mozga ili veliki mozak dobro je razvijen i na površini ima sivu koru. zadnja (i najrazvijenija) skupina kralježnjaka koji su se razvili u životinjskom svijetu biosfere. Površina pluća se povećala velikim brojem plućnih alveola. tobolčare i prave sisavce (plodvaši ili placentalni sisavci). mRNA s preuzetom uputom odlazi iz jezgre u citoplazmu i veže se za ribosom. mamma = sisa. antikodon preko kojega se veže na odgovarajući kodon na mRNA. Tijelo sisavaca je pokriveno dlakom koja ih štiti od gubitka topline. taksonomija). SISAVCI (Mammalia. Da bi održali stalnu tjelesnu temperaturu moraju imati brz metabolizam tj. Postoje tri takva kodona: UAA. 127 . SISTEMATSKE JEDINICE. Time započinje druga etapa sinteze proteina koja se zove translacija ili prevođenje zato jer se kodoni na mRNA prevode u točno određene aminokiseline. tzv. systole = stezanje). SITASTE CIJEVI. Resice u tankom crijevu povećavaju probavnu površinu. rijetko dvonožnom. linjanje i zimski san). v. treći bubreg.

Sjemenka se razvija iz sjemenog zametka. Tu se zbiva i oplod- nja. SJEMENICI (testisi). s dvije pomoćnice (sinergide). dio muškog spolnog sustava. U slezenu se pružaju vezivni tračci između kojih se smjestilo specifično tkivo slezene . SJEMENI ZAMETAK. najopsežnija skupina kopnenih biljaka. U sjemenim kanalićima odvija se spermatogeneza. najprimitivnije gljive. Sve biljke koje stvaraju sjemenke nazivamo sjemenjače. U čovjeka su sjemenovodi parni organi. SLONOVI. Jajna se stanica. ženski gametofit) nastala tijekom makrosporogeneze i sastoji se od osam stanica. Slonovi pripadaju skupini polukopitara. Iznutra su ispunjeni stanicama i sjemenim kanalićima. U vrijeme razmnožavanja pokazuju sličnosti s biljkama. 128 . U golosjemenjača leži otvoreno na plodnim listovima. SLUZAVCI. intersticijske stanice izlučuju muške spolne hormone. Prema smještaju sjemenih zametaka sjemenjače se dijele u dvije velike skupine: golosjemenjače i kritosjemenjače. krvotvorni organ smješten ispod lijevog svoda ošita. v. Od sjemenog zametka razvija se sjemenka. Očnjaka nemaju. SLEZENA. a na drugom su tri stanice: antipode. Njihove su spore s bičevima (zoospore) i čvrstom stijenkom od proteinskih tvari ili celuloze. SKLERENHIM. tučak. spermije od spolnih žlijezda do mokraćne cijevi. nalazi na jednom polu. zrak) sjemenka će proklijati i razvit će se mlada biljka. tzv. U vegetativnoj fazi više se osobinama podudaraju sa životinjama (praživotinjama) – nemaju staničnu stijenku time ni stalan oblik. klice (embria) i hranjivog staničja (endosperma). U sredini su dvije središnje stanice embrionske vreće. muške spolne žlijezde koje su u čovjeka smještene u kožnim vrećicama. organ svojstven sjemenjačama. SJEMENJAČE. bentos. temperatura. korjenonošci. isp. nikada od hitina. SLUZNJAČE. ražova gljivica. Crvena pulpa je mješano krvotvorno tkivo gdje se stvaraju eritrociti. ženskom sporangiju).ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ SJEDILAČKI ORGANIZMI. embrionska vreća. Imaju sjemeni zametak unutar kojeg se razvija ženski gametofit (embrionska vreća). Sporangiji se razvijaju u obliku plodišta. Razlikujemo crvenu i bijelu pulpu. a u kritosjemenjača je "sakriven" u plodnici tučka. a hranu skupljaju pomoću dugačke mišićave surle ili rila. Homologan je makrosporangiju (megasporangiju. kreću se plaženjem. v. Prehranom su većinom saprofiti. v. biljni organ koji služi rasprostranjenju nove generacije biljaka. Bijela pulpa su nakupine manjih limfnih čvorića (folikula) u samoj slezeni. SJEMENOVOD (ductus deferens). mošnjama. U obliku sjemenke biljka se nalazi u pritajnom (latentnom) stanju. U njemu se nalazi makrospora (megaspora. Slezena nije uključena u limfni optok. Na nogama imaju tri (afrički slon) ili četiri prsta (azijski slon) koji završavaju kopitastim noktom. Surla je preobražen nos i gornja usna. U sredini svakog čvorića nalazi se središnja arterija kroz koju odlaze u optok krvi nastali limfociti. a sastoji se od sjemene lupine. različite od ostalih vrsta gljiva. ameboidno. monociti i plazma stanice. SJEMENKA.pulpa. potporno staničje. ali ima ih i koje se se hrane poput životinja – uzimaju i probavljaju komadiće čvrste hrane. odvodni kanal koji provodi muške spolne stanice. v. granulociti. Kljove su izmijenjeni sjekutići. U povoljnim uvjetima (vlaga. Specijalizirane stanice sjemenika. najveći kopneni sisavci. nego samo u krvni. Hrane se biljkama. SKLEROCIJ.

žljezdano staničje. v. sadrže i druge boje. Razmnožavaju se vegetativno. Neke sadrže sluzavu tvar algin (alginske kiseline) koja se primjenjuje u tekstilnoj. posebno smeđi fukoksantin. SPECIJACIJA. stapanje vršaka ženskih (+) i muških (–) primarnih hifa u sekundarnu hifu kod razmnožavanja stapčarki. modifikacije. Sekreti sadržavaju fruktozu. v. v. Prosječno se u tijeku spolnog akta muškarca izluči oko 3 mL sperme. evolucijski proces nastajanja novih vrsta. SMRČCI (Morchella). mitohondrija. Većinom se pojavljuje u muškaraca. SPECIJALNA ADAPTACIJA (prilagodba). SOMATSKE VARIJACIJE. tjelešce u lišaja koje sadrži jednu kuglastu stanicu alge obavijenu kratkom hifom odgovarajuće gljive. tjelesna stanica. Poznate su alopatrijska.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE SLJEPOĆA NA BOJE (daltonizam). SOMATOTROPNI HORMON. ribosoma. Na primjer. svojta. SLJEPULJE. višestanični organizmi koji pretežito žive u moru. a u žena samo ako se gen za sljepoću boja (gen cb) nalazi u oba x kromosoma. pojedine aminokiseline i enzime. SOMATSKI ŽIVČANI SUSTAV. SOJ. SPECIJALIZIRANE FUNKCIJE STANICA. te tako prehranjuju spermije. jestive. ali nikada škrob. SOMATSKA STANICA. Kloroplasti im. v. SORUS. Produkti sinteze su različiti. v. membrana. tekući oblik koloidnih otopina. SPERMA. SORTA. B i C. jedinstvena vrsta biljaka i nižih organizama. v. SMEĐE ALGE. određene funkcije koje obavljaju stanice višestaničnih organizama koje su srodne po svojoj građi te formiranju tkiva. Sastoji se od spermija i sekreta prostate i drugih žlijezda. isp. gljive mješinarke s razvijenim plodištem. klorofil u biljnim stanicama omogućuje fotosintezu itd. tjelesni živčani sustav. osim uobičajenih staničnih struktura (jezgre. SPECIFIČNA PROTUTIJELA. izolacija. zakržljale oči kod životinja koje žive u tami. SOREDIJ. U svakom mililitru ima oko 120 milijuna spermija. SOL-stanje. kružnouste. Neke se smeđe alge koriste kao hrana i začini naročito zato jer obiluju vitaminima A. hormon rasta. lizosoma i sl. nakupina sporangija s donje strane lista paprati.) sadrže i specifične strukture koje određuju njihovu funkciju. Predstavnik je jadranski bračić (Fucus virsoides). prehrambenoj i drugim industrijama. isto što i antitijela. SOMATSKE MUTACIJE. v. nesposobnost raspoznavanja boja koja se nasljeđuje kao spolno vezano svojstvo. mišićne niti u mišićnoj stanici omogućuju kontrakcije. Takve stanice. v. SMOLENICE. Specijacija se brže odvija u dobro odijeljenim područjima. sjemena tekućina koju izlučuju muški spolni organi. mutacije. SOMATOGAMIJA. papirnoj. simpatrijska i parapatrijska specijacija. Npr. ukupno oko 360 milijuna. 129 . spolno i nespolno. uz klorofil a i b. Geni koji su odgovorni za to svojstvo nalaze se u x spolnom kromosomu. skup osobina koje se razvijaju u određenim uvjetima.

SPIRILI. međusobno spojenih kemijskih elemenata. Repni dio je vrlo dug i omogućuje aktivno kretanje spermija. SPOLNO VEZANA SVOJSTVA. svojstva vezana za spolne kromosome. građena od brojnih šupljina. jajnici). Prednji dio repa sadrži brojne mitohondrije u kojima se oslobađa energija potrebna za pokretanje spermija. nitasta zelena alga. One sadrže diploidan broj kromosoma i iz njih će nakon mejoze I (prve mejotičke diobe) nastati sekundarne spermatocite (spermatocite II) s haploidnim brojem kromosoma. SPIROGIRA (Spirogyra). SPOLNA ODREĐENOST POTOMAKA. Po svom kemijskom sastavu spolni hormoni su steroidi. sjemenika. u sjemenim kanalićima muških spolnih žlijezda. gameta što dovodi do rekombinacije gena. spermatogeneza. SPERMATOCITE. Spajanjem jajne stanice sa spermijem koji nosi x spolni kromosom nastaje potomak ženskog spola.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ SPERMATIDE. spermija. citoplazmatskim mostićem pre- ko kojeg se potpuno pretoči sadržaj stanice jedne u stanicu druge niti. Kroz ud prolazi mokraćna cijev koja izvodi mokraću i spermu. stanice koje nastaju u procesu spermatogeneze (isp. tzv. a neke. Najbitniji dijelovi za funkciju penisa su tri spužvasta tijela. v. primarne spermatocite (spermatocite I). SPOJEVI. izmjeni genetičkog materijala do kojeg dolazi kada se po dvije stanice susjednih niti spoje kanalićem. u 130 . SPERMIJI. koje kada se napune krvlju iz arterija služe za ukrućenje (erekciju) što omogućavae unošenje sjemena u rodnicu. Glava sadrži jezgru s 23 kromosoma. Iz svake spermatocite II u mejozi II (drugoj mejotičkoj diobi) nastaju po dvije spermatide iz kojih će postupnim izduživanjem nastati zreli spermiji. spužve. SPOLNO SAZRIJEVANJE. procesom spermatogeneze. a na njenom vršnom dijelu nalazi se vršno tjelešce. stapanje spolnih rasplodnih stanica. v. U sjemenicima iz zrelih zametnih stanica. spermatogonija mitotičkim diobama nastaju velike stanice. Sklone su konjugaciji. spužvasto. haploidna generacija. SPOLNI UD (penis). v. SPOLNI HORMONI. Znači. hormoni koji utječu na razvoj spolnih obilježja. muške spolne stanice. cjevasto tijelo dobro opskrbljeno krvnim žilama i živcima. SPERMATOGENEZA. čiste kemijske tvari izgrađene od dva ili više različitih.). izlučuje kora nadbubrežne žlijezde. ovisi o tome koji spolni kromosom donosi spermij pri oplodnji. bakterije. U mnogih životinja i u čovjeka nastaju dvije vrste spermija: jedna vrsta nosi x spolni kromosom. SPOLNA GENERACIJA. SPOLNO RAZMNOŽAVANJE. Uglavnom ih izlučuju spolne žlijezde (sjemenici. akrosom koji sadrži enzime koji omogućuju prodor spermija u jajašce. pubertet. v. Spermiji čovjeka su vrlo male stanice čiji su glavni dijelovi glava i rep. npr. Sintezu i lučenje spolnih hormona stimuliraju gonadotropni hormoni. gamete koje nastaju u sjemenicima tijekom spermatogeneze. SPERMATOGONIJE. iz svake primarne spermatocite. a spajanjem jajne stanice sa spermijem koji nosi y spolni kromosom nastaje potomak muškog spola. tzv. v. a druga vrsta y spolni kromosom. androgene. SPIKULE. nezrele zametne stanice u sjemeniku iz kojih tijekom spermatogeneze nastaju spermiji. mišićno. nastaju četiri zrela spermija. proces nastajanja muških spolnih stanica.

4. 3. a slično se označuje i gen za hemofiliju (h) ili x. Isp. Žive u morima.) Iz odnosa zdravog muškarca i žene oboljele od hemofilije sva ženska djeca bit će prenositelji. U spongocel voda s hranom (npr. U čovjeka su takva svojstva daltonizam. a sva muška 5. v. nespolna generacija u biljaka u kojoj nastaju nespolne rasplodne stanice. U primjerima praćenja spolno vezanog nasljeđivanja. isp. šupljina u tijelu spužve. SPOROFIT. Skelet izgrađuju vapnene ili kremene iglice (spikule) ili pak elastične bjelančevinaste niti spongina. a ona se zbog svoje recesivnosti ispoljavaju kod muških potomaka. nespolne rasplodne stanice biljaka. najprimitivnije mnogostanične životinje. Tako je kod papratnjača i sjemenjača sama biljka sporofit dok je gametofit veoma reduciran. SPOSOBNOST SAMOUMNOŽAVANJA. v. shemu u Dodatku 1. shemu u Dodatku 1) Iz odnosa muškarca oboljelog od hemofilije i žene prenositelja dobiva se potomstvo u kojem će 50 % muške djece oboljeti od hemofilije. SPUŽVE (Spongia). SPOLNO VEZANO NASLJEĐIVANJE.) Iz odnosa zdravog muškarca i žene prenositelja dobiva se potomstvo u kojem je 50 % muške djece oboljelo od hemofilije. bakterijama. algama i sitnim životinjama) i kisikom ulazi kroz mnogobrojne sitne otvore na površini tijela. Geni koji određuju ta svojstva smješteni su u x spolnom kromosomu i zovemo ih spolno vezani geni. nemogućnost raspoznavanja boja (daltonizam) itd. SPORE. shemu u Dodatku 1. Pravila spolno vezanog nasljeđivanja mogu se izvesti iz slijedećih primjera: 1. SPONGOCEL. mutacije. DNA i RNA. spore. nasljedna nesposobnost grušanja krvi (hemofilija). gametofit. a 50 % bit će prenositelji. spužve. a 50 % bit će zdravo. Ostalih 50 % muške i 50 % ženske djece je zdravo. U unutarnjosti je šupljina spongocel obložena bičastim stanicama ili hoanocitama.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE čovjeka. spore. haploidna generacija. (V. (V. (v. Neprobavljeni ostaci izlaze kroz najveći otvor ili oskulum. 131 . dok će 50 % ženske djece oboljeti od hemofilije. shemu u Dodatku 1. SPORANGIJ. Stijenka tijela sastoji se od tri sloja stanica. Nastaju u posebnim organima – sporangijima. nasljeđivanje pojedinih svojstava čiji su geni smješteni u x spolnom kromosomu. v. dok su žene većinom samo prenositelji gena za ta svojstva. v.) SPONGIN. Iz odnosa muškarca oboljelog od hemofilije i zdrave žene rađaju se zdrava muška djeca dok su ženska djeca prenositelji. a samo mali broj vrsta u kopnenim vodama sjedilačkim načinom života. Spužve su 2. gen za recesivno svojstvo daltonizam može se označavati malim slovom (a ili d) ili x. Evolucijom biljnog svijeta jače se razvija sporofit u odnosu na spolnu generaciju. Nemaju izgrađena tkiva. a 50 % ženske su prenositelji. hemofilija itd. djeca će oboljeti od hemofilije. Iz spora se u povoljnim uvjetima razvijaju nove biljke. (V. spužve. shemu u Dodatku 1) Iz odnosa muškarca oboljelog od hemofilije i žene oboljele od hemofilije sva će djeca oboljeti od hemofilije. SPONTANE MUTACIJE. (V.

u srcu se nalaze središta koja upravljaju radom srca. poprečnoprugasti mišić. Bolest je neizlječiva. Dok se hrani crijevnim bakterijama. žile koje služe za provođenje minerala. praživotinja iz skupine korjenonošci.V) čvor (nalazi se na granici između pretklijetki i klijetki). SRČANI MIŠIĆ. Srednje uho je povezano s gornjim dijelom ždrijela Eustahijevom cijevi. Nespolni pup se naziva gemula. uzimanjem droge. hranjivih tvari i kao potporno tkivo jer imaju lignizirane stanične stijenke. Kada se poremeti rad debelog crijeva (drugim zarazama. obrađuje i pohranjuje primljene in- formacije te upravlja brojnim tjelesnim voljnim i autonomnim radnjama. tri dijela njihovih tijela: korijen. SRDOBOLJNA AMEBA.atrijski ili sinus-atrijski (S . ameboidnih stanica i hoanocita. mala šupljina između bubnjića i unutarnjeg uha. Stabljika i list nazivaju se jednim imenom izdanak. a između desne pretklijetke i klijetke trikuspidalni zalisci. Razlikujemo tri temeljna. Oplođuju se unutar tijela spužve iz kojeg izlazi trepetljikava ličinka parenhimula koja se pričvrščuje za dno i izraste u spužvu. SREDIŠTE AUTOMACIJE RADA SRCA. SREDIŠNJI (centralni) ŽIVČANI SUSTAV.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ većinom dvospolci (hermafroditi). To su: primarno središte automacije srca . Po dužini podijeljeno je na lijevo (arterijsko) i desno (vensko) srce. Danas je poznato oko 5000 vrsta. SRPASTA ANEMIJA (anemija srpastih stanica). Svaki taj dio podijeljen je poprečno. SREDNJE UHO. Vraćanje krvi iz aorte ili plućne arterije u srce nakon sistole sprječavaju semilunarni (polumjesečasti) zalisci. Spužve imaju sposobnost regeneracije. stabljiku i list. vegetativna organa. Smješteno je u sredini prsne šupljine između dva plućna krila u osrčju ili perikardu. pušenjem itd. nasljedna je bolest uzrokovana sintezom nenormalnog hemoglobina HbS. nametnik u debelom crijevu čovjeka. stremen (stapes). šuplji mišićni organ koji kod čovjeka teži oko 300 g. kopnene biljke). nakovanj (incus). u njemu se odigrava fotosinteza. isp. nije opasna. Između srca i stijenki perikarda nalazi se tekućina. Služi za izjednačivanje tlaka zraka u srednjem uhu s vanjskim tlakom. biljna skupina prilagođena životu na kopnu. Čine ga: veliki mozak (cerebrum). mali mozak (cerebellum). alkohola. premoštena sa tri slušne košćice: čekić (malleus). produžena moždina (medulla oblongata) i leđna moždina (medulla spinalis). Čovjek se zarazi zaraženom hranom ili vodom. postoji kožno staničje prekriveno voštanom pre- 132 . Između lijeve pretklijetke i klijetke nalaze se mitralni ili bikuspidalni zalisci. Osrčje štiti od neposrednog pritiska na srce ili od trenja plućnih krila pri disanju. Eritrociti su u obliku srpa i imaju smanjenu sposobnost prijenosa kisika. Spolne stanice spermiji i jaja nastaju od tzv. Razmnožavaju se nespolno pupanjem i spolno. hipoteze o postanku metazoa. SRCE. v. Korijen služi za učvršćivanje biljke i upijanje vode i otopljenih minerala. STABLAŠICE (više biljke. Zoolozi smatraju da su se spužve razvile iz zadružnih bičaša.A) čvor (nalazi se u desnoj pretklijetki i predvodnik je rada srca) te sekundarno središte automacije srca ili atrio – ventrikularni (A . pa srce ima dvije pretklijetke (atriji) i dvije klijetke (ventrikuli). U biljaka postoje i provodni organi. Postoje i generativni organi koji isključivo služe razmnožavanju.) počinje se hraniti eritrocitima iz sluznice crijeva te uzrokuje patogene promjene.

tri odjeljka: mahovine. vitice. filokadije itd. biljne stanice sadrže staničnu stijenku. isp. Stablašice su se razvile iz pradavnih zelenih alga. Ostale jednostanične organizme i višestanične organizme. U citoplazmi tipične eukariotske stanice nalaze se različite stanične strukture: endoplaz- matska mrežica. postoje otvori. Zelena biljna stanica je autotrofna za razliku od heterotrofne životinjske stanice. a mogu se podijeliti na tri velike skupine. v. lizosomi. s obzirom na složenost građe njihovih stanica. Obavljaju fotosintezu pa su time autotrofne. papratnjače i sjemenjače. sprermišni organi (u korabice). Moraju dobiti hranu izvana pa su heterotrofne. Sva živa bića. kloroplaste i druge plastide što ne nalazimo u životinjskih stanica. Najjednostavniji jednostnanični organizmi su prokarioti čije stanice ne sadrže oblikovanu jezgru ni druge stanične strukture obavijene membranama. puči za izmjenu plinova. vakuole su male. Velike stanice određenog oblika. stapke. a razvija se iz klicinog pupoljka. Sadrže kloroplaste (klorofil). Tako. jedan od tri temeljna organa kopnenih biljaka. npr. STANICA. STAFILOKOKI. Preobrazbe stabljike: podzemne stabljike su podanak ili rizoma (npr. odnosno životinjsku stanicu. trnovi. Imaju velike vakuole ispunjene staničnim sokom. cvjetove i plodove. Većina životinjskih stanica sadrži centriole koji se još nalaze samo u stanicama nekih algi. lukovica (u sunovrata) i gomolj (krumpir). STANIČNA IMUNOST. Drvo ili stablo je oblik višegodišnje drvenaste stabljike s nerazgranatim dijelom deblom i razgranatim. oblik stečene imunosti u kojoj organizam nakon podražaja antigenom stvara veliki broj aktivira- 133 . Tipične eukariotske stanice sadrže jezgru obavijenu ovojnicom koja ima mnogobrojne pore kroz koje se izmjenjuju tvari između jezgre i citoplazme. Osim tih struktura koje se nalaze gotovo u svim eukariotskim biljnim i životinjskim stanicama postoje i strukture karakteristične samo za biljnu. bilo biljne ili životinjske. specijalizirane epidermske stanice lista koje okružuju otvor puči. mitohondriji i mikrotubuli. temeljna građevna i funkcionalna jedinica svakog živog bića (organizma). STABLJIKA. STANICE ZAPORNICE. Kada su i prisutne. možemo podijeliti na prokariote i eukariote. nosi listove i druge organe koji su se razvili bilo preobrazbom stabljike bilo preobrazbom listova.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE vlakom (kutikulom) koja štiti biljku od isušivanja. Bez kloroplasta (klorofila) su. Na vrhu stabljike i bočnih ogranaka nalazi se vršni pup s tvornim staničjem za produžni rast. krošnjom. Osnovne razlike između biljnih i životinjskih stanica Biljne stanice Obavijene su celuloznom stijenkom. bakterije. Ona je os izdanka. Stabljika može biti zeljasta ili drvenasta. izgrađuju eukariotske stanice. Golgijevo tijelo. Male stanice nepravilna oblika. Životinjske stanice Nemaju celulozne stijenke. u perunike i paprati).

plastidi. jezgra. W. mitohondrij. kromosomi.) američki znanstvenik koji je prvi izdvojio virus u čistom stanju.) u kojem živi populacija jedne vrste. Glavni sastojci stanične tekućine su voda. disanje. prostor sa svim životnim uvjetima (svjetlo. v. životni ciklus stanice koji se sastoji od dva razdoblja interfaze (razdoblje između dvije stanične diobe) i mitoze (diobe stanice). Stanični organeli su jezgra. Ljudska stanična tekućina 4 ima pH 7. Schleiden i zoolog T. bios = život. v. Značenje ove teorije je u tome što ukazuje na jedinstvo građe živih bića i na njihovo zajedničko podrijetlo.M. voda. STANIČNO FRAKCIONIRANJE. STANLEY. STANIČNA MEMBRANA. specifično građene strukture unutar stanice koje su obavijene membranom i obavljaju određenu funkciju. Postoje i manje strukture unutar stanice koje također vrše važne funkcije npr. neke teže. Centrifugiranjem se pojedini stanični dijelovi razdvajaju na osnovi razlika u brzini njihova taloženja. a za neke je nepropusna. ali kako nisu obavijeni membranom ne smatramo ih organelima u užem smislu. botaničar M. mineralne tvari itd. Zatim se tako dobivena stanična kaša centrifugira. rastavljanje stanica na sastavne dijelove. tanka ovojnica (7 do 10 nm) koja obavija stanicu. STANIŠTE (biotop. topos = mjesto). STANIČNI METABOLIZAM. STANIČNO DISANJE. Golgijevo tijelo.0. Građena je od proteina i lipida pa se naziva još i lipoproteinska ovojnica.. grč. U ljudskom tijelu je ima oko 25 litara. Kemijske reakcije u stanici možemo podijeliti u dvije skupine: procesi izgradnje (anabolizam) i procesi razgradnje (katabolizam). STANIČNI ORGANELI. STANIČNA JEZGRA. Stanični ciklus započinje od trenutka kada ta stanica nastaje diobom i traje sve dok se i ona sama ne podijeli na dvije nove stanice. kalijev kation (K+) te − hidrogen karbonatni ( HCO 3 ) i sulfatni ( SO 2− ) anion. ribosomi. To je postupak izdvajanja pojedinih staničnih organela ili još manjih dijelova stanice u zasebne homogene frakcije da bi se bolje upoznala njihova fiziološka uloga i biokemijski sastav. Najprije se stanice kidaju gnječenjem tkiva u tarioniku. STANIČNA STIJENKA. STAPČARKE. ugljik(IV)-oksid. STANIČNA TEORIJA. jezgrice. skup svih kemijskih reakcija u stanici odnosno izmjena tvari i energije u stanici. To je bio virus mozaične bolesti duhana. Schwann. Najvažnija tvar stijenke je celuloza. rezanjem vrtećim noževima ili ultrazvučnim vibracijama. STANIČNA TEKUĆINA je tekućina unutar stanice. teorija po kojoj sva živa bića imaju staničnu građu. STANIČNI CIKLUS. centrioli. Stanična membrana je selektivno propusna što znači da ne propušta sve tvari jednako. a samo u gljiva celuloza je nadomještena hitinom. skupina od oko 30 000 vrsta gljiva u koje spadaju i sve one što ih u svakodnevnom govoru zovemo gljive.-1971. (1904. Utemeljitelji ove teorije su njemački znanstvenici. Plo- 134 . endoplazmatska mrežica.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ nih limfocita T koji specifično uništavaju antigen. već vrši selekciju: neke tvari propušta lako. protiskivanjem stanica kroz uski prostor određenih dimenzija. Stanična tvorevina koja obavija većinu biljnih stanica i daje im oblik i čvrstoću.

oštećenja membrana lizosoma. npr. STEŽLJIVI MJEHURIĆI (kontraktilna vakuola). list i cvijet). isp. afrički noj. STONOGE. v. smanjenje regeneracijskih sposobnosti oštećenih stanica itd. organski spojevi iz skupine lipida. To su npr. npr. snijeti. humoralna i stanična imunost. jednostanične ili všestanične. v. organeli u protoplazmi praživotinja pomoću kojih izbacuju suvišnu tekućinu iz tijela i na taj način održavaju osmotsku ravnotežu. a najvažniji su fiziološki i patološki. Obuhvaćaju različite organizme nazvane jednim imenom ALGE. STH. v. STERILIZACIJA. Starenje i umiranje nekih stanica započinje zapravo odmah nakon začeća i traje sve do smrti iako se najčešće pod starenjem podrazumijevaju procesi koji nastaju nakon pedesete godine. nakupljanje štetnih tvari. oblik otpornosti organizma koja nastaje nakon unosa antigena u organizam. rupičarke (vrganji). sve promjene koje nastaju u odrasloj dobi kada se nepovratno mijenja građa i funkcija stanica. tkiva i organa. uzdušnice i očna pjega. v. biljno tijelo jednostavne građe na kojemu se ne razlikuju pojedini vegetativni organi (korijen. imunizacija. zupčarke (prosenjak). U organizmu čovjeka poznati steroidi su spolni hormoni. mekušaca i rakova. npr. talofiti. Stapčarke imaju raznolike skupine. bazidiju. To objašnjava zašto steljnjače nemaju tijelo razlučeno u tkiva i organe. Na 135 . puči. Pokreće se imunološka reakcija. To je značajno za praživotinje slatkih voda jer voda zbog osmotskog tlaka neprestano ulazi kroz membranu u tijelo i razrjeđuje koncentraciju anorganskih i organskih tvari u protoplazmi. jednostavno građeni uzdušnjaci iz skupine člankonožaca. hormoni kore nadbubrežne žlijezde i neki vitamini. gubitak vode zbog čega se mijenjaju bjelančevine u citoplazmi. STARENJE. hormon rasta. STAROČELJUSKE (bezgrebenke). lističarke (pečurka. Nositelji te vrste imunosti su limfociti (B i T). v. zelena pupavka). STOME. STERKOBILIN B. npr. U stanicama se zbiva niz fizioloških promjena. Specifična imunost može biti stečena aktivno i pasivno. STEROIDI. STELJKA (talus). Šumske gljive žive u mikorizi s drvećem. prvenstveno vodeni organizmi pa cijela njihova površina sudjeluje u primanju vode i izmjeni tvari. eritrociti. STEČENA IMUNOST (specifična). vitamin D. izlaganje supstrata temperaturi iznad 100 oC i više pri čemu ugibaju ne samo bakterije već i njihove spore. velike kopnene ptice koje ne mogu letjeti jer im je prsna kost bez grebena. a s vremenom nastupa i smrt. STATOCISTI. puhare itd. kariogamijom se razvijaju i posebne – bazidiospore i to po 4 na zajedničkoj stapci. Uz različite druge spore. Kod mekušaca većinom se nalaze u stopalu. Postoji niz pretpostavki o uzrocima starenja. STELJNJAČE. južnoamerički nandu i australski emu. stabljika. Dva su osnovna oblika stečene imunološke reakcije.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE dišta su im najčešće oblika kišobrana ili klobuka na stručku. Broj mjehurića može biti od jednog do nekoliko. Patološki razlozi starenja posljedica su težih oštećenja pojedinih organa. osjetila za ravnotežu kod nekih beskralježnjaka. niže biljke. STIGMA. Jednostavne su građe.

ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

kolutićima imaju 1 ili 2 para člankovitih nogu, ukupno i do 200 pari. Na glavi su ticala i jednostavne oči. Žive na vlažnim staništima. Poznate su strige i dvojenoge.
STRATIGRAFSKA GEOLOGIJA (povijesna geologija), znanost koja proučava razvojni put Zemlje od postanka litosfere do danas. STREPTOKOKI, v. bakterije. STROBILA, v. trakavica. STROMATOLITI, tvorevine posebne građe u kojima se nalaze fosilizirane bakterije i cijanobakterije. STUPANJ OTROVNOSTI (toksicitet), količina otrova koja ubija 50 posto otrovanih jedinki. To je tzv. 50 %-tna letalna doza ili LD50. SUKCESIJE, procesi smjenjivanja čitavih biocenoza na nekom prostoru. SUKCESIVNA EVOLUCIJA (filetička, susljedna), postupno nakupljanje malih nasljednih promjena i novih svojstava organizama te postupan prijelaz jedne vrste u drugu. SUNAŠCE, v. korjenonošci. SUSLJEDNA EVOLUCIJA, v. sukcesivna evolucija. SVINJSKA TRAKAVICA, nametnik u crijevu čovjeka, (isp. trakavice). Čovjek se zarazi ako pojede njezinu ikricu s mesom zaražene svinje. Iz ikrice se razvije trakavica. Stražnji zreli članci s oplođenim jajnim stanicama se otkidaju i izlaze iz crijeva čovjeka. Ako te članke pojede svinja, u njezinu crijevu će se razviti ličinke koje se u mišićima začahure stvarajući ikricu. SVITAK (horda, chorda dorsalis), potporni savitljivi prutić sastavljen od vezivnog tkiva. Proteže se na leđnoj strani duž čita-

vog tijela iznad crijeva i ulazi u glavu. U embrionalnom razvitku razvija se iz endoderma. Plaštenjaci imaju svitak samo u stadiju ličinke, a svitkoglavci u svim stadijima razvitka.
SVITKOGLAVCI (Cephalochordata), pripadaju bezlubanjcima iz koljena svitkovci. Najpoznatija skupina su kopljače. Žive u morima. Uvijek imaju svitak. Mišići, organi za izlučivanje i krvotok te škržne pukotine na ždrijelu imaju kolutićav raspored. Živčani je sustav cjevast i proteže se iznad svitka s leđne strane tijela. Kopljača je razdvojena spola. Oplodnja je vanjska. U Jadranskom moru živi zašiljena kopljača koja obitava u pijesku, a i pliva. U Tihom oceanu živi kalifornijaka kopljača. U Kini kopljača služi kao hrana. SVITKOVCI (Chordata), životinje koje na leđnoj strani (ispod živčanog sustava, a iznad crijeva) imaju svitak ili hordu, isp. Svitkovci su dvobočno simetrične životinje bez znakova vanjske kolutićavosti. Naseljavaju sva staništa u vodama i na kopnu. Danas živi oko 45000 vrsta. Svitkovcima pripadaju tri potkoljena: plaštenjaci, svitkoglavci i kralježnjaci. Plaštenjaci i svitkoglavci su bezlubanjci, a kralježnjaci su lubanjci. Preci svitkovaca su davni srodnici žiroglavaca ili polusvitkovaca, isp. Osnovna obilježja svih svitkovaca jesu, osim svitka, i škržne pukotine na prednjem dijelu probavila. Kod viših kralješnjaka postaju prave škrge ili pluća. Dalje, živčani sustav je s leđne strane trupa. U kralješnjaka se razvija u leđnu moždinu koja je smještena u kralješnici. Na prednjem dijelu leđne moždine razvija se mozak, u lubanjaca zaštićen hrskavičnom ili koštanom lubanjom. Optjecajni (krvožilni) sustav je zatvoren, sa srcem s trbušne strane. SVOJTA, filogenetske sustavske jedinice bez obzira na njihov stupanj. Svojte koji-

136

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

ma označujemo različite oblike nekih vrsta koje je čovjek postigao na umjetan način, tj. uzgojem su kultivar, sorta, klon i linija.

ultrazvuk kojim pronalaze hranu i lakše se snalaze u prostoru.
ŠKOLJKAŠI,. pripadaju skupini mekušaca, isp. Većinom žive u moru, npr. dagnje, prstaci, periske. U slatkim vodama najpoznatija je bezupka. Tijelo im je bočno spljošteno i smješteno između dviju ljuštura. Ljušture su spojene zubićima i ligamentom, a otvaraju ih i zatvaraju mišići zatvarači. Stopalom se pričvršćuju za podlogu. Između plašta i tijela je plaštena šupljina u koju stalno ulazi voda. Filtrirajući vodu školjkaši dolaze do hrane i kisika. Nemaju radulu. Većina su rastavljenog spola. Oplodnja je vanjska. ŠKORPIONI, v. paučnjaci. ŠKRGE, organi za disanje kod kružnousta, riba i ličinke vodozemaca. Nastaju u području škržnih pukotina u ždrijelu. Škrge su u obliku resa (škržni listići) i dobro su prokrvljene krvnim kapilarama. Voda ulazi kroz usta i oplakuje škržne listiće. Otopljeni kisik iz vode difuzijom prelazi u krv, a iz krvi izlazi ugljik dioksid. ŠKROB, složeni organski spoj iz skupine polisaharida koji sadrži kemijski vezano nekoliko stotina molekula glukoze. Opća formula mu je (C6H10O5)n. On je pričuvni polisaharid biljaka koji se u obliku škrobnih zrnaca nalazi u spremišnim organima biljaka (zadebljali dijelovi korijena, lukovice, gomolji itd.). U slučaju kada su ugljikohidrati potrebni i kao izvor energije u stanicama, škrob se postupno razgrađuje uz pomoć niza enzima (npr. amilaze, maltaze) do glukoze koja zatim ulazi u proces staničnog disanja. U ljudskom organizmu prvi se počinje probavljati, v. probava. ŠTIPALJKE (pedicelarije), nalaze se, kod bodljikaša, između bodlji (npr. kod ježinaca i zvjezdača). Služe za obranu, hvatanje plijena i čišćenje.

Š
ŠARENICA (iris), v. bjeloočnica. ŠARLAH (scarlatina, škrlet), akutna zarazna bolest uzrokovana bakterijama (streptokokima). ŠEĆERI, v. ugljikohidrati. ŠEĆERNA BOLEST (dijabetes), bolest koja nastaje zbog smanjenja ili potpunog izostanka izlučivanja hormona inzulina beta stanicama Langerhansovih otočića u gušterači. Nedostatkom inzulina u krvi nastaje povećana razina šećera u krvi (hiperglikemija), a istovremeno nedostatak šećera za energetske potrebe u stanicama. Kod bolesnika s smanjenom proizvodnjom inzulina daju se lijekovi koji stimuliraju gušteraču na pojačano lučenje inzulina. Kod težeg oblika dijabetesa, tzv. inzulin ovisan dijabetes daju se injekcije inzulina. Bolesnici se moraju strogo držati ugljikohidratne dijete. Bolest se javlja u djece (juvenilni dijabetes) i u odraslih (adultni dijabetes). ŠEŠVA, v. boginje. ŠIŠMIŠI (netopiri), jedina skupina sisavaca koji mogu letjeti. Krila imaju letnu kožicu ili letnicu razapetu između dugačkih kosti prstiju. Kada se odmaraju, pričvrste se stražnjim nogama za stijenu i vise glavom prema dolje. Neki spavaju zimski san. Hrane se kukcima ili malim kralježnjacima, voćem, nektarom, peludom, a neki sišu krv. Šišmiši ispuštaju

137

ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

ŠTITARKE, skupina uglavnom zeljastih biljaka dvosupnica. Listovi su im razdijeljeni, stabljika je šuplja, a cvijetovi skupljeni u štitac. U svim dijelovima, naročito u plodićima, sadrže aromatične i ljekovite tvari pa se štitarke rabe u prehrani, farmaciji i kao začinske biljke. Neke od njih su: mrkva, peršin, celer, kopar i kim. ŠTITNA ŽLIJEZDA (štitnjača), žlijezda s unutarnjim izlučivanjem, smještena je ispod grkljana s obje strane dušnika. Žlijezdane stanice štitnjače izlučuju hormone tiroksin (T4), trijodtironin (T3), tireokalcitonin i dr. Ti hormoni stimuliraju metabolizam u tijelu. U svom sastavu imaju jod. ŠULJEVI (hemoroidi), proširene vene na kraju zadnjeg crijeva (rektum) i čmara. Vene oteknu zbog učestalo povišenoga tlaka, što je obično posljedica opetovanog naprezanja prilikom ispražnjivanja crijeva. Hemoroidi mogu biti unutarnji i vanjski. Prolaskom fekalija mogu lako popucati i krvariti. ŠUPLJE VENE, gornja i donja, najveće vene, ulaze u desnu pretklijetku srca. Nemaju venskih zalisaka, v. veliki optok. ŠUPLJINA, v. celom.

njuje vrijeme predviđeno za odmor srčanog mišića.
TAKSIJA, vrsta lokomotornog gibanja biljaka čiji je smjer gibanja ovisan o smjeru vanjskog podražaja. Kreću li se organizmi u smjeru podražaja, gibanja nazivamo pozitivnom taksijom, a ako se organizmi kreću od izvora podražaja, gibanja nazivamo negativnom taksijom. Prema podražajima koji ih uzrokuju razlikujemo: kemotaksije (uzrokovane kemijskim tvarima), fototaksije (reakcije na svjetlost), tigmotaksije (izazvane dodirom), hidrotaksije (reakcije na vlagu), termotaksije (izazvane temperaturom) i geotaksije (podražaj je sila teže). Taksije su osobito važne za mnoge jednostanične organizme koji se kreću bičevima, trepljama, ameboidalno ili kližu po podlozi. TAKSIN, v. tise. TAKSON, isto što i svojta. TAKSONOMIJA, (grč. taksis = raspored, poredak + nomos = zakon) znanost o zakonima razvrstavanja organizama, hijerarhija sistematskih kategorija (vrsta, rod, porodica, red, razred, odjeljak/koljeno, carstvo), isp. filogenetski (prirodni) sustav i sistematika. TALUS, v. steljka. TANKO CRIJEVO, cjevasti organ probavnog sustava koji se proteže od želuca, a nastavlja debelim crijevom. Ukupna dužina iznosi 5 do 6 metara. Sastoji se od: početnog dijela – dvanaesnika (duodenum), srednjeg dijela (jejunum) i krajnjeg dijela (ileum). Unutarnja površina crijeva sadrži crijevne resice. Sluznica tankog crijeva ima brojne žlijezde a to su: Brunnerove žlijezde koje se nalaze na početnom dijelu duodenuma i luče sluz koja štiti crijevnu stijenku od probavnog djelovanja želučanog soka prije neutralizacije himusa u

T
T - LIMFOCITI, vrsta leukocita koji nastaju najviše u timusu (prsnoj žlijezdi), a manje u limfnim čvorovima i slezeni. Oni su jedni od nositelja stanične specifično stečene imunosti. TAHIKARDIJA, nagli porast frekvencije srca s prosječnih 70 otkucaja u minuti na 100 i više. Tahikardija je štetna jer se sma-

138

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

dvanaesniku; Liberkühnove kripte su žlijezde koje se osim u duodenumu nalaze po cijeloj površini tankog crijeva i luče sluz i crijevni sekret.
TARAXACUM OFFICINALE, stručni latinski naziv za maslačak. TARTUFI (gomoljače), gljive mješinarke, rastu petnaestak centimetara pod zemljom u listopadnim šumama. Kulinarski su specijalitet posebne arome pa ih ljudi pronalaze uz pomoć dresiranih pasa ili svinja. TELOCENTRIČAN KROMOSOM, kromosom s pričvrsnicom na svom kraju. TELOFAZA, završna faza stanične diobe, mitoze. U telofazi se kromosomi koji su stigli na suprotne polove stanice počinju despiralizirati i oko njih nastaje jezgrina ovojnica. Dvije novonastale stanice imaju diploidan broj kromosoma, a svaki kromosom je građen od jedne kromatide. U stanicama se formiraju jezgra i jezgrica. TELOFAZA DRUGE DIOBE, v. telofaza II. MEJOTIČKE

TEPALA, v. cvijet. TERMONASTIJE, v. nastije. TERMOREGULACIJA, održavanje stalne tjelesne temperature čovjeka i homeotermnih životinja. U čovjeka središta za regulaciju tjelesne temperature nalaze se u hipotalamusu. Sastoje se od središta za "produkciju" i središta za "redukciju" topline. Ako je tijelo pregrijano, uključuje se središte za redukciju topline koje šalje informacije živčanim putovima na periferiju. Dolazi do širenja krvnih kapilara (vazodilatacija), povećava se dotok krvi u kožu pa se toplina otpušta u okoliš. Stezanjem žlijezda znojnica oslobodit će se znoj koji isparavanjem hladi kožu. Hormonalnim putem regulirat će se smanjenje razgradnje hranjivih tvari i time smanjiti proizvodnja topline. Ako je tijelo pothlađeno, aktivira se središte za produkciju topline. Tada prestaje znojenje, krvne kapilare se stežu (vazokonstrikcija), smanjuje se protok krvi u koži, a hormonima (tiroksin) stimuliraju se kataboličke reakcije. TEST KRIŽANJE (povratno križanje), križanje koje se koristi kada se želi provjeriti da li su jedinke F2 generacije homozigotne (npr. AA) ili heterozigotne (npr. Aa) za određeno svojstvo jer se razlika ne može zamijetiti po fenotipu. Jedinka nepoznatog genotipa se križa s recesivnim homozigotom (aa). Ako su svi dobijeni potomci dominantnog tipa, testirana jedinka je bila homozigotna, a ako je 50 % dominantnih i 50 % recesivnih, jedinka je bila heterozigotna. (v. shemu u Dodatku 1.) Test križanje može se koristiti i ako se želi provjeriti genotip jedinki F2 generacije koje su nastale dihibridnim križanjem s dominacijom. U tom slučaju jedinka nepoznatog genotipa križa se s recesivnim homozigotom za oba svojstva (aabb). Ako je testirana jedinka bila homozigotna za oba svojstva (AABB), dobiveni

TELOFAZA I (telofaza prve mejotičke diobe), završna etapa mejoze I u kojoj su vidljive dvije novonastale stanice s haploidnim brojem kromosoma koji su građeni od dvije kromatide. Kromosomi se despiraliziraju, a oko njih se formira jezgrina ovojnica. U stanicama postaju vidljive jezgra i jezgrica. TELOFAZA II (telofaza druge mejotičke diobe), završna etapa mejoze II u kojoj nastaju četiri stanice s haploidnim brojem kromosoma od kojih je svaki kromosom građen od jedne kromatide. Oko despiraliziranih kromosoma formira se jezgrina ovojnica te nastaju jezgra i jezgrica. TELOFAZA PRVE MEJOTIČKE DIOBE, v. telofaza I. TENTAKULA, ticalo, isp. virnjaci.

139

ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

će potomci biti dominantnog tipa, a ako je bila heterozigotna za oba svojstva (AaBb), dobit će se omjer fenotipova 1/4:1/4: 1/4: 1/4. (v. Dodatak 1.)
TESTISI, v. sjemenici. TESTOSTERON, muški spolni hormon kojega izlučuju intersticijske stanice sjemenika. Manje količine testosterona izlučuju se već u embrionalnoj i fetalnoj dobi, a veće količine u pubertetu. Utječe na razvoj primarnih i sekundarnih spolnih obilježja muškaraca. Izlučivanje testosterona pod kontrolom je gonadotropnih hormona iz prednjeg režnja hipofize. TETRADA, grupa od četiri kromatide u mejozi, v. profaza I. TETRAPLOIDNI BROJ KROMOSOMA, v. poliploidija. TIGMONASTIJA, v. nastije. TIGMOTROPIZAM, v. tropizam. TILAKOIDI, sustav membrana u unutarnjosti kloroplasta (isp.) i drugih plastida. TILAKOIDNE MEMBRANE, specifično građene membrane koje se nalaze u unutarnjosti kloroplasta i drugih plastida. Mogu sadržavati različita biljna bojila (klorofil, karotene, ksantofile) ovisno o tipu plastida u kojima se nalaze. U tilakoidnim membranama koje sadrže klorofil odvija se fotosinteza. TIMIN, organski spoj s dušikom iz skupine pirimidinskih baza. Sudjeluje u izgradnji nukleotida odnosno nukleinskih kiselina i to samo DNA. Strukturna formula mu je:
O H O N C C N H C C CH 3 H

TIMPANALNI ORGANI, osjetila za sluh kod kukaca. Smješteni su na različitim dijelovima tijela. To su udubine u kutikuli prekrivene timpanalnom membranom ili bubnjičnom opnom. Opne titraju podražene zvukom, a titranje primaju osjetne stanice i podražaj dalje prenose u moždana središta. TIMUS (prsna žlijezda), smješten je u prsnoj šupljini iznad dušnika i srca. U embrionalno i fetalno doba pa sve do puberteta, to je najveći proizvođač limfocita, koji su po timusu i dobili prefiks T – limfociti. TIREOKALCITONIN, hormon štitne žlijezde koji regulira koncentraciju iona kalcija u krvi i potiče ugradnju kalcija (i fosfora) u kosti. TIREOSTIMULACIJSKI v. tireotropni hormon. HORMON,

TIREOTROPNI HORMON (tireostimulacijski hormon, TSH), hormon kojega izlučuje prednji režanj hipofize (adenohipofiza), a koji potiče rast štitne žlijezde i izlučivanje tiroksina. TIROKSIN (T4), hormon kojega izlučuje štitna žlijezda, a stimulira cjelokupni metabolizam u organizmu, v. štitna žlijezda. TIROZIN, kemijski spoj iz skupine aminokiselina. TISE, porodica biljaka iz skupine četinjača (golosjemenjača). Listovi su plosnati. Sjemenke se nalaze unutar mesnatog ovoja (arilus) koji sadrži hranjive tvari. Ostali dijelovi tise sadrže taksin (otrovni alkaloid). U hrvatskoj flori zastupljena je s jednom vrstom: običnom tisom koja je zaštićena jer je rijetka i ugrožena na prirodnim staništima . TJELESNA STANICA (somatska stanica), osnovna građevna jedinica višestaničnih organizama. Nastaje diobom mitozom

140

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

od stanice majke, a njen životni vijek traje dok se i ona mitotičkom diobom ne podijeli u dvije nove stanice kćeri. Razdoblje u životu stanice između dviju dioba naziva se interfaza.
TJELESNI (somatski) ŽIVČANI SUSTAV, prima i prenosi različite osjete (i svjesno zapažanje), te upravlja radom mišića. Sastoji se od središnjeg živčanog sustava (kojem pripadaju mozak i leđna moždina) i perifernog živčanog sustava tj. perifernih živaca. TJEMENO OKO (parijetalno oko, tjemeni organ), mjehurić sličan oku kod nekih gmazova, npr. premosnika i gušterice. Sastoji se od osjetnih stanica za svjetlo i pigmentnih stanica. Unutarnjost mjehurića ispunjena je staklastim tijelom. Na lubanji je iznad mjehurića otvor koji je presvučen prozirnom kožicom kroz koju pada svjetlost na tjemeni organ. TKIVNI MAKROFAGI, stanice sa sposobnošću fagocitoze, nastaju iz monocita koji su iz optoka krvi došli u tkiva. Nalaze se npr. u jetri i slezeni i nemaju mogućnost ameboidnog kretanja. TMV, v. virus mozaične bolesti duhana. TOBOLČARI, primitivni sisavci koji se razvijaju unutar majčina tobolca. U tobolac se otvaraju mliječne žlijezde. Ženke tobolčara imaju kratkotrajnu trudnoću te rađaju male i slabo razvijene mlade. Razvitak u tobolcu traje nekoliko puta dulje od razvitka u majčinom tijelu. Danas u biosferi živi oko 200 vrsta. Poznatiji su: klokan, koala, oposum i psoglavi vučak. TOKSICITET, v. stupanj otrovnosti. TOKSIČNI ELEMENTI (otrovni elementi), elementi kao što su živa, olovo, kadmij, radioaktivni izotopi itd. Oni se najčešće javljaju u otpadnim tvarima industrije, prometa itd. Slijedom hranidbenih

lanaca postupno se nakupljaju u pojedinim dijelovima organizma postižući koncentraciju koja je za organizam toksična, otrovna.
TOKSIČNOST, v. otrovnost. TOKSINI, otrovi živih organizama, a mogu biti bakterijskog (bakteriotoksini), gljivičnog (mikotoksini), životinjskog (zootoksini) i biljnog (fitotoksini) porijekla. TONOPLAST, u biljnoj stanici granični sloj plazme prema vakuoli. TORNARIJA, ličinka žiroglavaca iz skupine malokolutićavaca. TOTIPOTENTNOST, mogućnost diferencirane somatske stanice da sačuva potencijal razvitka čitavog novog organizma, v. klon. Stanična diferencijacija često je povratna (reverzibilna), a dediferencirane (ponovo nediferencirane) se stanice mogu opet dijeliti i po potrebi regenerirati čitavu biljku (osobito kada se biljno tkivo uzgaja u kulturi). Pojava je rezultat regulacije aktivnosti gena. TRAHEJE, v. uzdušnice. TRAHEOLA, v. udušnice. TRAKAVICA, beskolutićava životinja koja pripada koljenu plošnjaka, isp. Žive kao nametnici u probavilu kralježnjaka. Tijelo im je plosnato i pokriveno kutikulom, dugačko i 15 m. Na prednjem dijelu je "glava" (skoleks) s kukicama i prianjalkama te vrat i tjelesni članci (proglotidi) koji tvore strobilu. Trakavice su anaerobni organizmi i nemaju organa za disanje ni optjecanje. Nemaju ni probavilo već hranu uzimaju osmotski preko površine tijela. Dvospolci su. Svaki proglotid sadrži muške i ženske rasplodne organe. Imaju hiperprodukciju potomaka. Tijekom života trebaju barem jednog međudomadara. Najpoznatije trakavice su goveđa, svinjska i pasja trakavica ili ehinokok.

141

zatvorom u prvoj fazi. v. presađivanje tkiva ili organa na drugo mjesto istog organizma ili na drugi organizam. organ za izlučivanje kod gmazova. tRNA. a koji se oslobađa iz mrtvih bakterija i ugrađuje u žive bakterije. TRANSKRIPCIJA.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ TRANSDUKCIJA. v. TRANSFUZIJSKA REAKCIJA.stomatalna tranpiracija. Osnovna anatomska jedinica bubrega je nefron. uzrokovana je komadićem molekule DNA koji sadrži gen. ptica i sisavaca. TRANSPIRACIJA. najveća skupina praživotinja. TRANSPLATACIJA. Bubrežne cjevčice počinju Bowmanovim čahurama. 142 . tRNA. Isparavanje vode s vanjskih površina biljke naziva se kutikularna transpiracija. v. kroz puči (stome) . sinteza proteina. TREONIN. TRANSLOKACIJA. Inkubacija traje od 7 do 14 dana. TREPETLJIKAŠI.lenticelna transpiracija. Proces transpiracije je važan pokretač za kretanje vode kroz biljku. MASOVNI. Uzročnik bolesti je bakterija Salmonella typhi koja izaziva upalu crijevnih stijenki. TRBUŠNI TIFUS (tifus) je akutna zarazna crijevna bolest s temperaturom. U nefronima se stvara mokraća koja kroz mokraćovod ulazi u nečisnicu ili kod sisavaca u mokraćni mjehur. v. kada se krvna grupa davatelja ne podudara s krvnom grupom primatelja krvi. prebacivanje segmenta jednoga kromosoma na drugi nehomolog. isp. TRANSFER RNA. specifičan način transporta kroz staničnu membranu kada se transportiraju velike molekule ili krute čestice koje zbog svoje veličine ne bi mogle proći kroz staničnu membranu na drugi način. Rijetko su nametnici. TRANSLACIJA. Svi trepetljikaši imaju barem 2 jezgre: malu jezgru mikronukleus i veliku jezgru – makronukleus.drugi bubreg. Mokraćovod nastaje iz donjeg dijela Wolfove cijevi. TRANSPORTNA RNK. Da ne bi došlo do odbacivanja presađenog organa ili tkiva davatelja zbog pokretanja imunološke reakcije na strani antigen. mora se nakon presađivanja tkiva imunološki sustav primatelja zakočiti svakodnevnim uzimanjem lijekova koji slabe imunoreakciju. reakcija koja nastaje prilikom transfuzije krvi. a kroz lenticele . TREĆI BUBREG (pravi bubreg ili metanefros). Oblici masovnog transporta su endocitoza i egzocitoza. TRENICA (radula). kemijski spoj iz skupine aminokiselina. Također može spriječiti pregrijavanje biljke. izlučivanje (isparavanje) vode iz biljaka u obliku vodene pare. Transfuzijsku reakciju karakterizira sljepljivanje (aglutinacija) i raspadanje (hemoliza) eritrocita. Novougrađeni gen daje bakteriji nove osobine. TRANSPORT. a eventualno proljevom u drugoj. Imunološki sustav organizma prepoznaje svoje bjelančevine kao vlastite i na njih ne reagira (imunološka tolerancija). Vrlo su pokretljivi. Najprepoznatljiviji su papučice (parameciji) i zvončići (vorticele). TRANSFORMACIJA STANICA. Mikronukleus ima diploidan broj kromosoma (2n) i sudjeluje u konjugaciji. Žive u moru i slatkim vodama. Trenica je "jezik" pokriven rožnatim zubićima kojima životinje stružu čestice hrane po podlozi. prijenos genetičkog materijala jedne bakterije u drugu virusom. struktura u usnoj šupljini mekušaca (puževa i glavonožaca) za mrvljenje hrane. sinteza proteina. Na površini pelikule imaju trepetljike ili cilije. te se krvotokom prenosi po cijelom tijelu.

TROFOBLAST. kodon. Iz stanica trofo- 143 . posebni mjehurići koji se nalaze u donjem sloju pelikule. zelenih i glatkih sjemenki i biljka niskog rasta. žutih i naboranih sjemenki. Postoji 20 različitih vrsta molekula tRNA. zelenih glatkih sjemenki 9 6. kao i u ostalim prikazima križanja. a njihovim međusobnim križanjem dobivamo F2 generaciju koja može imati 8 različitih fenotipova. a recesivni malim. tkivo ili organizam koji ima uz homologni par još jedan kromosom viška (2n+1). poliploidija. niski. niski. TRIPSIN. tRNA (transportna RNK ili tRNK. TRIPLOIDNI BROJ KROMOSOMA. žutih naboranih sjemenki-3 5. zelenih naboranih sjemenki-3 7. v. žutih naboranih sjemenki-1 (V. TRIHIBRIDNO KRIŽANJE S DOMINACIJOM. v. a generacije potomaka (filijalne) prema redoslijedu s F1 i F2. izmjenom plinova. zelenih i glatkih sjemenki. TRIHOMONAS. vrsta ribonukleinske kiseline koja se nalazi u citoplazmi. osmoregulacijom). visoki. Aleli pojedinih svojstava označuju se slovima i to dominantni velikim slovima. Javlja se u tropskom području Afrike. a svaka se odlikuje sposobnošću da veže na sebe samo jednu određenu aminokiselinu. visoki. žutih glatkih sjemenki-9 4. TRISOMIK. zelena boja sjemenke i glatka površina sjemenke dominantna. jednostanična životinja (praživotinja) iz skupine bičaša koja u čovjeka uzrokuje smrtonosnu bolest spavanja. niski. Križanjem takvih biljaka dobiva se F1 generacija čije su sve jedinke istog fenotipa: visokog rasta. Trofoblast okružuje unutarnji sloj stanica (embrioblast). Obje biljke su homozigoti za navedena svojstva s tim da su svojstva: visoki rast. Omjer fenotipova u F2 generaciji je: 27:9:9:3:9:3:3:1.) TRIHOCISTI. Jedinke F1 generacije mogu stvarati 8 različitih tipova gameta. zelenih naboranih sjemenki-9 3. Njena je uloga da veže na sebe odgovarajuće aminokiseline i prenosi ih na ribosom gdje će se sintetizirati proteini. zelenih glatkih sjemenki-27 2. Ispunjeni su sekretom koji se na podražaj izbacuje van. a sudjeluje u razgradnji bjelančevina do aminokiselina. vanjski sloj stanica blastociste čovjeka i ostalih sisavaca. visoki. TRIPANOSOMA. stanica. jedan od probavnih enzima kojega izlučuje gušterača u početni dio tankog crijeva (dvanaesnik. v. shemu u Dodatku 1. bičaši. mogući su sljedeći fenotipovi: 1. štitna žlijezda. TRIPTOFAN. prijenosna RNK. Ona sačinjava 10 do 15 % ukupne stanične RNA. Trepetljikaši se najčešće razmnožavaju dvojnim ili binarnim dijeljenjem. transfer RNA). žutih glatkih sjemenki-3 8. križanje u kojem se prati nasljeđivanje triju svojstava. Nastaje u jednoj od etapa embrionalnog razvitka. I u ovom slučaju. tj. početna roditeljska (parentalna) generacija se označuje s P. TRIJODTIRONIN (T3). niski. kemijski spoj iz skupine aminokiselina. U ovdje navedenom primjeru parentalnu generaciju predstavlja biljka visokog rasta. v. Ti organeli služe za obranu i zaštitu praživotinja. duodenum).____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE Makronukleus upravlja drugim životnim aktivnostima (hranjenjem. TRIPLET. blastulaciji. visoki. Građena je od 80-ak nukleotida pa je po veličini najmanja vrsta RNA.

ateroskleroza. Trudovi su uzrokovani izlučivanjem hormona oksitocina kao i povećanim izlučivanjem estrogena i to iznad vrijednosti progesterona. tzv. krvni ugrušak. v. započinje razvoj posteljice koja će osigurati prehranu zametka u kasnijoj fazi embrionalnog razvitka. jedna vrsta gibanja biljnih organa u obliku svijanja uzrokovana i usmjeravana jednostranim vanjskim podražajima. najniži sloj atmosfere gdje žive mikroorganizmi. TROFOGENI SLOJ. pravilna ritmička stezanja i opuštanja mišića maternice koja će uzrokovati potiskivanje ploda kroz porođajni kanal. npr. u kojem se odvija proces fotosinteze i primarne organske proizvodnje (bioproizvodnje). Razvija se iz oplođene jajane stanice. TROPOSFERA. a negativan ako se giba od izvora podražaja. te djelomično ili potpuno začepiti neku užu krvnu žilu. U jednostavnijih oblika mekušaca trohofora se razvija u odraslu jedinku. TROJKA. npr. začepljuju otvor. TRŠĆANI ŠEĆER. kemotropizam (izazvan kemijskim tvarima) i tigmotropizam (uzrokovan mehaničkim podražajima). a u kopnenim vodama stajačicama do oko 50 m. u sisavaca. Trudovi se u početku pojavljuju svakih 15 do 20 minuta. TROPIZAM. biljke i životinje. ličinka kod mekušaca i morskih kolutićavaca. Tromb može potpuno ili djelomično spriječiti protok krvi kroz žilu ili se može otkinuti od hvatišta na stijenci žile i slobodno kolati po tijelu (embolus). To stanje mogu uzrokovati pojedini lijekovi. Pozitivan je tropizam ako se organ giba prema izvoru podražaja. TROMB.). nenormalno stvaranje ugrušaka krvi (tromba) u žilama (venama ili arterijama) zbog različitih uzroka (ateroskleroza. antibiotici. TROMBOCITI (krvne pločice). saharoza. Trudnoća u žene traje u prosjeku 280 dana ili 40 tjedana. u moru do 200 m. Do svijanja dolazi redovito zbog različito jakog rastenja suprotnih strana organa. TRUDOVI. protuupalni lijekovi i dr. ima vijenac trepetljika te može slobodno plivati. v. Imaju važnu ulogu u kontroli krvarenja sudjelujući u procesima zgrušavanja krvi nakon ranjavanja. površinski osvjetljeni sloj. genetička uputa. infarkt. a mnogi imaju kasniji stadij ličinke. Prema vrsti podražaja koji uzrokuju ova gibanja razlikujemo fototropizam (gibanje rastenjem uzrokovano jednostranim djelovanjem svjetlosti). ljepljeći se za ozljeđeno mjesto zajedno s fibrinogenom i krvnim stanicama. TROMBOZA. velinger linčiku. isp. citoplazmatski dijelovi velikih stanica megakariocita iz kojih se oslobađaju raspadanjem. TROMBOCITOPENIJA. kasnije sva- 144 . kod plućne embolije dio se krvnog ugruška zaustavi u plućima ili kod infarkta srca (isp. TRUDNOĆA. oko 16 dana nakon oplodnje. TROHOFORA.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ blasta i decidua stanica (stanice sluznice maternice). ozljede krvnih žila i dr. izlučuje se više progesterona nego estrogena što sprječava pojavu menstruacije koja dovodi do gubitka ploda. razdoblje od oplodnje do rođenja. Tijekom trudnoće zbivaju se različite hormonalne promjene.) u srčanom mišiću što uzrokuje neprokrvljenost dijelova pluća i srca te odumiranje tih dijelova. bolest kod koje je smanjen broj krvnih pločica – trombocita. geotropizam (gibanje kojim biljke dovode svoje organe u određeni položaj prema sili teže). Npr.

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

ke dvije do tri minute, a traju 30 do 60 sekundi.
TRUSKOVCI, nametničke praživotinje. Razmnožavaju se nespolno truskama ili sporama i spolno. Najpoznatiji truskovci su plazmodiji, uzročnici malarije u čovjeka. Također su nametnici na mnogim bezkralježnjacima i kralježnjacima. TSH, v. tireotropni hormon. TUBA UTERINA, v. jajovod. TUBERKULOZA (sušica), teška zarazna bolest uzrokovana Kochovim bacilom, bakterijom štapićastog oblika. Uzrokuje oštećenja tkiva pluća. TUČAK, ženski dio cvijeta. Nastao je sraštavanjem jednog plodnog lista (megasporofila) ili više njih. Sastoji se od plodnice, vrata i njuške. U plodnici se nalazi jedan sjemeni zametak (makrosporangij) ili više njih, u kojima se razvija makrospora (embrionska vreća). Makrosporogenezom razviti će se ženski gametofit. Nakon oprašivanja vegetativna stanica peludnog zrna klije u polenovu mješinicu koja provodi dvije spermalne stanice kroz mikropilu u embrionsku vreću. Jedna spermalna stanica oplodi jajnu stanicu. Iz diploidne zigote (2n) nastaje klica (embrij). Druga se spermalna stanica stapa s dvije središnje jezgre (stanice) embrionske vreće pa nastaje triploidna stanica (3n) iz koje se, mitotičkom diobom, razvija endosperm, isp. sjemeni zametak. TUMOR, u širem smislu svaka izraslina u organizmu, a u užem smislu novo-stvoreno tkivo karakterizirano nekontroliranim rastom stanica. TUNDRA, karakteristična biljna zajednica rasprostranjena u sjevernim polarnim područjima Zemlje, npr. Sibiru, Kanadi, Grenlandu itd. Sastoji se uglavnom od mahovina i lišajeva.

TUNICIN, organska tvar slična biljnoj celulozi, v. plaštenjaci. TURGOR (turgorski tlak), unutarnji hidrostatski tlak stanice koji pritišće plazmalemu uz staničnu stijenku biljnih stanica. Povećava se ulaženjem vode u stanicu. Kada turgorski tlak po visini postane jednak tlaku bubrenja (a po smjeru djelovanja mu je suprotan), zaustavi se ulazak vode. Turgor je važan za čvrstoću biljke. Ako biljka gubi vodu, turgorski tlak opada, stanice postaju mlohave i biljka vene. Turgorski se tlak, ovisno o organu, mijenja od 0.1 do 1.0 MPa (0.1 MPa = 1 bar). TURGORSKA GIBANJA, nastaju zbog promjena turgora u pojedinim susjednim tkivima ili slojevima tkiva nekih plodova (npr. štrcalica, nedirak). Kao posljedica velikih napetosti među tkivima dolazi do pucanja tih plodova i izbacivanja sjemenki. TURNEROV SINDROM, v. aneuploidija. TVORNO STANIČJE, meristem, tkivo koje omogućuje rast bilja. Stanice koje izgrađuju tvorno staničje su razmjerno male, bogate citoplazmom, bez vakuole, imaju veliku jezgru, stanične stijenke su tanke, a glavno im je obilježje da se dijele mitozama. Razlikujemo tjemenišne ili vršne meristeme koji se nalaze na vršcima izdanaka i korijena, bočne meristeme (kambij) koji omogućuju rast stabljike u debljinu itd. TVORNO TKIVO, v. tvorno staničje.

U
UČINAK STAKLENIKA, zadržavanje topline u atmosferi zbog stakleničkih pli-

145

ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

nova (naročito ugljikovog dioksida) koji upijaju toplinsko zračenje sa Zemlje umjesto da ga propuštaju u svemir. Rezultat je povećavanje prosječne temperature Zemlje ili globalno zagrijavanje.
UDARNI VOLUMEN SRCA, volumen krvi (oko 70 ml) koje srce utisne u krvotok za vrijeme jedne kontrakcije. UGLJENO DOBA, v. karbon. UGLJIKOHIDRATI, prirodni organski spojevi koji se nalaze u svim dijelovima staničnog tkiva, i kao funkcionalni i kao strukturni sastojci. Neki ugljikohidrati (pentoze) izgrađuju nukleinske kiseline. Predstavljaju i izvore i skladišta energije koja je dobijena fotosintezom od Sunca (npr. glukoza, škrob, glikogen). Definiraju se kao spojevi opće formule Cn(H2O)n. Naziv ugljikohidrat se obično upotrebljava u mnogo užem značenju i označuje tvari sastavljene od polihidroksi aldehida i ketona i njihovih derivata. Šećeri ili saharidi su tipični predstavnici ugljikohidrata. Monosaharidi su ugljikohidrati koji se obično sastoje od 3 do 9 atoma ugljika pa se prema tome mogu i svrstavati u trioze, tetroze, pentoze, heksoze itd. Najpoznatiji monosaharidi ili jednostavni šećeri su pentoze riboza i dezoksiriboza te heksoze glukoza, fruktoza i galaktoza. Povezivanjem 2 do 10 monosaharida nastaju oligosaharidi pa se prema tome mogu svrstati u disaharide, trisaharide, tetrasaharide itd. Najpoznatiji oligosaharidi su disaharidi saharoza, laktoza i maltoza. Povezivanjem više od 10 monosaharida nastaju polisaharidi. Najpoznatiji polisaharidi su škrob, glikogen, celuloza i hitin. UHO, osjetilo za sluh. Sastoji se od vanjskog, srednjeg i unutarnjeg uha. VANJSKO UHO, sastoji se od ušne školjke (uške), građene od hrskavice, od zvukovoda (vanjskoga slušnoga kanala), koji

vodi od uške do bubnjića (membrana tympani).
ULTRAMIKROELEMENTI, v. elementarni sastav. UMJETNI ELEKTROSTIMULATOR RADA SRCA, tzv. pacemaker, mali generator na baterije koji je povezan s elektrodama koje se stavljaju na stijenku srca. Električni impulsi dolaze na srčani mišić frekvencijom programiranom prije ugradnje u rahlo tkivo stijenke prsnog koša. Pacemaker se ugrađuje kod nenormalnog rada S - A čvora, v. središte automacije rada srca. UMJETNI SUSTAV, sustav u koji su svrstane jedinke u skupine s gledišta njihova korištenja, npr. samonikle i kultivirane biljke. UMNI ČOVJEK, v. Homo sapiens. UMOR MIŠIĆA, nastaje zbog nakupljanja mliječne kiseline nakon dugotrajne i snažne mišićne kontrakcije. Razlog nakupljanja mljiječne kiseline je utrošeni ATP u mišićnim vlaknima, nedostatak glukoze ili kisika. Bez kisika glukoza se razgrađuje u dvije molekule pirogrožđane kiseline koje prelaze u mliječnu kiselinu. UNUTARNJE UHO, sastoji se od pužnice (cochlea) i polukružnih kanalića važnih za održavanje ravnoteže. Pužnica je šuplji kanal, zavijena dva i pol puta. Kanal je podijeljen sa dvije tanke membrane u tri hodnika (skale). Ti su hodnici ispunjeni tekućinom (endolimfom u sredini i perilimfom u gornjem i donjem hodniku). Na donjoj pregradnoj - bazilarnoj membrani nalaze se receptori za sluh tzv. Cortijev organ koji sadržava slušne Cortijeve stanice s dlačicama. Iz Cortijevih stanica izlaze živčana vlakna koja se udružuju u slušni živac i prenose električne potencijale nastale u Cortijevim stanicama u slušnu regiju mozga (sljepoočni režanj).

146

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

UNUTARNJI FAKTOR, luči ga pilorusni dio želuca. Omogućuje apsorpciju vitamina B 12 u tankom crijevu. Taj vitamin je važan u proizvodnji eritrocita. Nedostatak unutarnjeg faktora uzrokuje anemiju. UPALA CRVULJKA (apendicitis), nastaje kod zastoja crijevnog sadržaja u šupljini crvuljka. Upalu mogu izazvati i strana tijela (koštice) ili paraziti koji uđu u crvuljak. Crvuljak se upali i ispuni gnojem uz pojavu jake boli u donjem desnom dijelu trbušne šupljine. Liječi se brzim kirurškim odstranjivanjem upaljenog crvuljka (apendektomija). UPALA GUŠTERAČE (pankreatitis), vjerojatno nastaje djelovanjem probavnih gušteračinih enzima na samo tkivo gušterače. Kod upale se javlja izrazito jaka bol u gornjem dijelu trbušne šupljine. Bol se širi u leđa i prsni koš, uz povraćanje i jaku mučninu. UPALA PLUĆA (pneumonija), teška bolest pluća koja je najčešće uzrokovana bakterijom pneumokokom. Uzrok može biti i infekcija virusima ili mikoplazmom. Alveole se pune tekućinom što otežava disanje jer se bitno smanjuje respiracijska površina. UPOZORAVAJUĆA OBOJENOST (aposemija), izrazita obojenost tijela živim i upadljivim bojama kojom se predatori opominju na prisutnost otrovnih izlučevina, neugodne mirise, žalac i sl. Poznati su primjeri aposemične obojenosti kod daždevnjaka, mnogih zmija ili tvora.
O H O
Uracil

URACIL, organski spoj s dušikom iz skupine pirimidinskih baza. Sudjeluje u izgradnji nukleotida odnosno nukleinskih kiselina i to samo RNA. UREMIJA, otrovanje organizma zbog nakupljanje ureje u tjelesnim tekućinama (krvi) jer se kod oboljelih bubrega smanjuje se mogućnost izlučivanja tog otrovnog spoja (ureje) iz krvi. URETRA, v. mokraćna cijev. URIN, v. mokraća. UROBILIN B, v. eritrociti. URTIKARIJA v. koprivnjača. USNAČE, skupina pretežno zeljastih biljaka dvosupnica. Stabljika je četverobridna. Cvijetovi su jednosimetrični, a na vjenčiću razlikujemo gornju i donju usnu (ime!). Plod je kalavac koji se raspada na četiri oraščića. Većina usnača sadrži eterična ulja i ljekovite tvari te se rabe kao začinsko i ljekovito bilje. To su npr: bosiljak, mravinac (origano), mažuran, majčina dušica, metvica, ružmarin, lavanda i ljekovita kadulja. Česte su vrste mrtve koprive. USPRAVNI ČOVJEK, v. Homo erectus. UZDUŠNICE (traheje), hitinske cjevčice kod uzdušnjaka (stonoge i kukci) za udisanje zraka i prijenos kisika neposredno u tkiva. Na površini se tijela otvaraju otvorima koje nazivamo odušak ili stigma, a u unutarnjosti se granaju u sve manje cjevčice: dušnice ili traheole. Dopiru u tkivima do samih stanica, a ulaze i u krila. UZDUŠNJACI (Tracheata), životinje iz skupine člankonožaca, isp. Prilagođeni su životu na kopnu. Dišu uzdušnicama ili trahejama, isp. Uzdušnjacima pripadaju stonoge i kukci. UZLAZNI TOK VODE U BILJCI, prolazak vode kroz kapilarni sustav stabljike

N C

C N H

C C

H H

147

ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

od korijena do vrha biljke. Omogućen je pojavama osmoze i korijenovog tlaka, silama kohezije i adhezije, kapilarnosti, transpiracijom i gutacijom, isp.

V
VAGILNI ORGANIZMI, v. bentos. VALIN, kemijski spoj iz skupine aminokiselina. VANJSKO DISANJE, v. disanje. VAPNENAČKE BILJKE, v. bazofilne biljke VARIOLA, v. boginje. VAZODILATATORI, lijekovi koji šire male krvne žilice i na taj način snizuju krvni tlak VEGETACIJA, sve biljne zajednice nekog područja. Flora i vegetacija nekog područja čine njegov biljni pokrov. VEGETATIVNI ORGANI, v. stablašice. VEGETATIVNI ŽIVČANI SUSTAV, v. autonomni živčani sustav. VEGETATIVNO RAZMNOŽAVANJE, razmnožavanje kojim od dijelova vegetativnih organa (korijena, listova, stabljike) nastaju jedinke koje su genetički istovjetne s matičnom biljkom. VELIKE BOGINJE, v. boginje. VELIKI (sistemski) OPTOK KRVI, započinje s aortom. Krv se dalje potiskuje velikim a potom malim arterijama u arteriole, te dalje u arterijski i venski kraj kapilara. U području kapilara izmjenjuju se plinovi. Oksigenirana (arterijska) krv otpušta stanicama kisik, a od stanica pre-

uzima ugljikov dioksid. Otpuštanjem kisika arterijska krv se deoksigenira i postaje venska krv. Venska krv teče dalje venulama, malim i velikim venama te gornjim i donjim šupljim venama ulazi u desnu pretklijetku. Kontrakcijom desne pretklijetke krv se potiskuje u desnu klijetku, a odatle malim (plućnim) krvotokom u pluća, isp.
VELIKI MOZAK (cerebrum), zaštićen je kostima lubanje i obavijen s tri ovojnice (dura mater, pia mater i arahnoidea). Podijeljen je na dvije hemisfere: lijevu i desnu. Kora mozga se sastoji od brojnih vijuga (gyrusa) i udubina (sulcusa) a podijeljena je i na režnjeve. To su čeoni ili frontalni, tjemeni ili parijetalni, zatiljni ili okcipitalni, te sljepoočni ili temporalni režanj. Koru (cortex) velikog mozga čini siva tvar građena od živčanih stanica, a srž (medullu) velikog mozga čini bijela tvar kroz koju prolaze motorički i osjetni završeci živčanih vlakana. Siva kora velikog mozga upravlja voljnim pokretima tijela, prima, sređuje i pamti informacije, određuje svijest, ponašanje, inteligenciju i središte je više živčane (nervne) djelatnosti. VELIKI PRASAK, (engl. “big bang”), velika eksplozija kojom je vjerojatno nastao svemir. Smatra se da je to bilo prije 10 do 20 miljardi godina. VELINGER-LIČINKA, ličinka kod mekušaca. Razvija se iz trohofore. VENE, žile dovodnice, jer dovode krv u srce. Manje su elastične od arterija. Izvana su obavijene vezivnim tkivom ispod kojeg se nalazi tanki mišićni sloj ili ga uopće nema te zatim unutarnji sloj (endotel). U unutarnjosti vena se nalaze venski zalisci koji priječe vraćanje krvi u suprotnom smjeru. VENSKI ZALISCI, v. vene. VERNALIZACIJA, proces u kojem se cvjetanje stimulira izlaganjem hladnoći (u

148

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

stadiju sjemenke ili u razvijenom, olistalom stadiju).
VERTIKALNE ZONE BIOSFERE, podjela biosfere u slojeve karakteristične po svojim klimatskim i drugim uvjetima o kojima ovisi raspored biljnih i životinjskih vrsta. Najvažnije zone odnosno njihove granice dane su u tablici. Granica
Nadmorska visina, m

overa dobiva se potomstvo čiji je omjer fenotipova 1:1 umjesto 3:1 kao kod dihibridnog križanja s dominacijom gdje nema vezanih gena. (V. shemu u Dodatku 1.) VIBRIONI, v. bakterije. VINSKA MUŠICA (Drosophila melanogaster), maleni kukac dvokrilac čije ličinke u velikom broju žive svuda gdje vrije grožđe i drugo voće. Lako se uzgaja, brzo razmnožava pa je pogodna za genetička i druga biološka istraživanja. VINSKA MUŠICA, KROMOSOMSKA GARNITURA, svi kromosomi pojedine stanice vinske mušice. U tjelesnim stanicama vinske mušice nalazi se 8 kromosoma i oni predstavljaju diploidnu garnituru. Od tih 8 kromosoma 6 je autosoma, a 2 su spolna kromosoma. Ženke imaju 6 autosoma i 2 x spolna kromosoma, a mužjaci 6 autosoma, 1 x i 1 y spolni kromosom. U gametama ili spolnim stanicama nalaze se 4 kromosoma i to predstavlja haploidnu garnituru kromosoma. Ženske gamete ili jajne stanice imaju 3 autosoma i 1 x spolni kromosom, a muške gamete ili spermiji mogu imati ili 3 autosoma i 1 x spolni kromosom ili 3 autosoma i 1 y spolni kromosom. Prema tome, kod vinske mušice mužjak stvara dvije vrste spermija s različitim kromosomskim garniturama u odnosu 50 %:50 %. Ta je shema značajna jer se u istom obliku pojavljuje i kod čovjeka. VINSKI KVASAC, v. kvaščeve gljivice. VIRCHOW, R. (1821. – 1902.), njemački patolog koji je 1858. godine dao ključni prilog staničnoj teoriji tvrdnjom da sve nove stanice nastaju diobom od stanica koje su postojale (lat. Omnis cellula ex cellula.) VIRION, potpuno izgrađena infektivna virusna čestica.

Najviša točka na Zemlji Gornja granica za životinje Gornja granica za cvjetnice Gornja granica za prebivanje čovjeka Gornja granica kultura Gornja granica šuma Gornja granica šuma u Alpama Donja granica za organizme ovisne o svjetlu Donja granica biosfere

8880 7000 6000 5000 4500 4000 2200 -200 -11 000

VETERNICA, spilja u Medvednici (Zagrebačkoj gori) u kojoj su pronađeni ostaci slični krapinskom pračovjeku. VEZANI GENI, geni koji se nalaze na istom kromosomu jedan blizu drugoga, a određuju različita svojstva. Ta se njihova svojstva nasljeđuju uvijek zajedno. Iznimno, ima slučajeva kada se vezani geni ne nasljeđuju zajedno i to onda kada dođe do pojave crossing overa. Prilikom praćenja križanja, kada su geni vezani i kada nema krosingovera treba paziti na označavanje gameta. Geni za različita svojstva koja se nasljeđuju vezano, u gametama moraju biti zajedno. Na primjer ako križamo AaBb x aabb, a geni su vezani i nema crossing

149

ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

VIRNJACI, beskolutićave životinje koje pripadaju koljenu plošnjaka. Od oko 3000 vrsta većina živi slobodno u moru i kopnenim vodama. Dugački su do 20 mm. Površina virnjaka je pokrivena trepetljikavim epidermom. Ispod se nalaze mišići. Tijelo je ispunjeno parenhimom koje im daje potporu i služi za spremanje rezervnih tvari, npr. glikogena. Hrane se manjim životinjama. Imaju jedan usni otvor i probavilo koje se sastoji od ždrijela i crijeva. Za izlučivanje imaju protonefridije. Živčani se sustav sastoji od glavina ganglija i živčanih vrpci. Od osjetila imaju ticala (tentakule) i jednostavne oči (ocele). Razmnožavaju se uglavnom spolno. Većina virnjaka su dvospolci ili hermafroditi. Imaju veliku moć regeneracije. v. i plošnjaci. VIROIDI, čestice manje od virusa, otkrivene sedamdesetih godina. Sastoje se samo od gole ribonukleinske kiseline, a uzrokuju bolesti samo u biljaka. VIROZE, bolesti biljaka, životinja i čovjeka uzrokovane virusima. VIRUS MOZAIČNE BOLESTI DUHANA (TMV), virus koji uzrokuje mozaičnu bolest duhana. Bolesne biljke imaju listove sa žućkastim pjegama poput mozaika i sporije rastu. VIRUSI (lat. virus – otrov), sitne čestice koje uzrokuju često opasne zaraze, jedan od najjednostavnijih oblika života. Sadrže samo jednu nukleinsku kiselinu (ili DNA ili RNA) koja je obavijena proteinskom ovojnicom (kapsidom). Svi virusi su paraziti (nametnici) jer mogu živjeti i razmnožavati se samo u živim stanicama biljaka (npr. duhana, mozaična bolest duhana), životinja i čovjeka (npr. gripa, bjesnoća, velike boginje, vodene kozice, ospice, dječja paraliza, herpes, AIDS itd.). Osim biljnih i životinjskih virusa postoji i skupina virusa koja napada bakterije, tzv bakteriofagi.

Virusi su dugi od 10 do 300 nm pa se ne mogu vidjeti svjetlosnim, već samo elektronskim mikroskopom. Ne pokazuju sve osobine žive tvari pa se ne smatraju organizmima, već ih se najčešće naziva česticama žive tvari. Neki virusi brzo mutiraju.
VIŠE BILJKE, v. stablašice. VITAMINI, organski spojevi potrebni za normalno odvijanje mnogih metaboličkih procesa u organizmu. Vitamini kao i minerali ne sadrže energetske zalihe, ali su neophodni za izgradnju i održavanje organizma. Najvažniji vitamini su: vitamin C, B1, B2, A i D. VOĆNI ŠEĆER, v. fruktoza. VODA, najvažnija anorganska tvar u živim stanicama. Ona je polarna molekula i zbog toga je dobro otapalo za veliki broj anorganskih, ali i organskih tvari. Od svih kemijskih spojeva voda ima najveći udio u masi živih bića i njihovih stanica. Tako je, npr. maseni udio vode u protoplazmi stanice 70 do 85 %. Gubitak vode uzrokuje različite poremećaje u živim organizmima, npr. gubitak 15 do 20 % vode tijekom gladovanja u sisavaca uzrokuje fiziološke promjene, a na kraju i smrt. Mnoge tvari unutar organizma prenose se uz pomoć vode, kao vodene otopine. Voda je važna pri sintezi mnogih spojeva u organizmu, npr. u procesu fotosinteze sudjeluje kao jedna od sirovina. Vodene otopine podmazuju zglobove pa možemo reći da voda sudjeluje u omogućavanju kretanja mnogih organizama. Mnogi organizmi koriste vodu kao medij kroz koji muške spolne stanice putuju do ženskih omogućujući na taj način oplodnju. Voda je i neizostavan sudionik regulacije tjelesne temperature itd. VODENJACI, v. repaši. VODIKOVA VEZA, vrsta kemijske veze elektrostatičke prirode. Javlja se među pol-

150

Za kretanje po tlu i plivanje služe se razvijenim prednjim i stražnjim udovima. jednostanična zelena alga s bičevima udružena u velike kuglaste nakupine. hranjenje. fermentacija.-1935. Vodozemci imaju sposobnost regeneracije. Srednje uho je Eustahijevom cijevi povezano s usnom šupljinom. (1848. stanje povišene tjelesne temperature uzrokovano pireticima. Oko zaštićuju kapci i suzne žlijezde. glasne žice. prvi kralježnjaci koji su se djelomično prilagodili životu na kopnu. Dobro je razvijen koštano . Služi za pokretanje. Koža je višeslojna.mišićni sustav. Iz pet zrakasto postavljenih cjevčica izlaze prionljive ili ambulakralne nožice. Vodikovim vezama npr. kod bodljikaša sustav prstenasto i zrakasto raspoređenih cjevčica kroz koje struji morska voda. VODOZEMCI (Amphibia). Vrstu čine: jedinka.). Mogu prilagođavati oči blizom i dalekom gledanju. skupina meristemskih stanica smještenih u vršnim dijelovima korijena stabljike koje se kontinuirano dijele i pomoću kojih biljka raste u visinu (primarni rast). dio je pokretačkog živčanog sustava. VRUĆICA. neke preuzimaju prehrambenu ulogu a neke ulogu u razmnožavanju. Kralježnica je sastavljena od 9 kralježaka. Rebra su jako smanjena ili ih uopće nemaju. dem i populacija. Uho počinje bubnjićem na površini tijela. Većina vrsta se razmnožava u vodi ili vlažnim kopnenim staništima. Za razliku od kolonija u cenobiju vlada podjela rada: neke stanice su zadužene za kretanje. Žive u vlažnim staništima. za izmjenu plinova i za izlučivanje. Danas živi oko 2500 vrsta podijeljenih u 3 skupine: beznošci (rijači). Ima pokrovnu i zaštitnu ulogu te sudjeluje u disanju. Vodozemci su hladnokrvne životinje i ne mogu živjeti na niskim temperaturama. Oplodnje je vanjska. VOLVOKS (Volvox).____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE arnim molekulama. Srce je trodjelno: sastoji se od 2 pretklijetke i 1 klijetke. bogata žlijezdama i vlažna. Odrasli vodozemci dišu plućima i preko vlažne kože. Arterijska i venska krv se djelomično miješaju u klijetki. u grkljanu.) koja se sastoji od biljnih i životinjskih jedinki slične građe i načina života koje se mogu međusobno rasplođivati. VRENJE. Populaciju čini više dema među kojima još postoji mogućnost genske izmjene. cenobije. proučavao genetiku i promicao Mendelove zakone nasljeđivanja. De VRIES H. Njihovim se titranjem proizvode glasovi. Oni se hrane algama i postupno se preobražavaju u odrasle. U unutarnjem uhu nalazi se labirintni organ. Za pojačanje glasa mužjaci nekih vrsta žaba imaju zvučne mjehure. Prvi. repaši (daždevnjaci. bezrepci. Iz oplođenih jaja se razviju u vodi ličinke punoglavci. vremenski i prostorno blisko povezanih jedinki. VOLJNI ŽIVČANI SUSTAV. Uništava- 151 . vodenjaci i čovječja ribica) i bezrepci (žabe). na koji se vežu kosti lubanje zove se nosilac ili atlas. gdje se pozitivan kraj jedne molekule okreće prema negativnom kraju druge molekule. Zimi zapadaju u "zimski san". kao osjetilo. osnovna sistematska kategorija filogenetskog sustava (isp. Mokraću i spolne stanice izvode prvo u nečisnicu. nizozemski botaničar. VRSTA. međusobno su povezane molekule vode kao i odgovarajuće (komplementarne) duščine baze u molekuli DNA. Kontrolira mišiće koji rade našom voljom. Na dnu su usne šupljine. Dem je skupina genetički sličnih. v. VODOŽILNI (ambulakralni) SUSTAV. stanje mirovanja. VRŠNI (apikalni) MERISTEMI. isp. Za izlučivanje služi drugi bubreg. kao npr.

H. kao npr.F. WILKINS. šumama. grč. ZAVOJITA TRIHINA. zakoni o npr. ZALISCI SRČANI (valvule). Uzrokuju bolove u mišićima.. v. Osnivanjem različitih kategorija zaštite prirode pokušavaju se očuvati određena biogeografska područja. rudimenti. Oko njih se stvara čahura od vezivnog tkiva. Zaštita prirode u Hrvatskoj utemeljena je 69. britanski biokemičar koji je svojim istraživanjima strukture molekule DNA potvrdio vrijednost modela molekule DNA kojeg su predložili Watson i Crick. Mendelovi zakoni. ZAMETAK. ZAMETNI LISTIĆ. njemački kemičar koji je 1828. R. bijela boja polarnih životinja. ZAKRŽLJALI ORGANI. jednostanični i višestanični zeleni organizmi čija boja potječe od Z ZAKONI NASLJEĐIVANJA. Ta prilagodba ima važnu ulogu pri prirodnom odabiru. WOHLER. vodama. godine iznio model molekule DNA. Zalisci mogu biti oštećeni i to najčešće zbog upale. Druga mogućnost su promjene u građi zalistaka što sprečava potpuno zatvaranje zalistaka. M.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ njem uzročnika bolesti i uzimanjem antipirogenih lijekova (antipiretici) moguće je tjelesnu temperaturu vratiti u normalu.. skup aktivnosti kojima se nastoji smanjiti štetno djelovanje čovjeka na živi i neživi okoliš.). Čovjek se zarazi ako jede zaraženu svinjetinu. ZAŠTITA OKOLIŠA.. ZEISS. što sužava otvor (stenoza) i otežava protok krvi. američki biolog koji je zajedno s britanskim fizičarom F: Crickom 1953. J. WIENER. njemački tvorničar. Oni osiguravaju jednosmjeran protok krvi iz pretklijetke u klijetku. ZELENE ALGE.. WHITTAKER. (rođ. kada nastaje zadebljanje zalistaka. (kategorije zaštite prirodne baštine Hrvatske). stapčarke. znameniti graditelj optičkih instrumenata. W WATSON.H. bez mogućnosti 152 . predložio je razdiobu živog svijeta u pet carstva. člankom. v. opasan nametnik iz skupine oblića. F.. ZAŠTITNA OBOJENOST (kriptična obojenost. embrij. Brzo se razmnožavaju. krypto = skriven). god. 1928. osim temeljnih (Zakon o zaštiti okoliša i Zakon o zaštiti prirode). A. v. v. a mlade trihine koje se izlegu u limfnim žilama čovjeka. Trihine se u organizam unose u obliku čahura. povišenu temperaturu i dr. ZELENA PUPAVKA. Time je dokazao mogućnost sinteze organskih spojeva bez djelovanja živih bića. nalaze se u otvoru između svake pretklijetke i klijetke. dodatak 4. kemijskim putem sintetizirao ureu. god. Ustava Također su donešeni. obojenost tijela ili dijelova tijela kojom organizmi oponašaju svoj okoliš te ih čini manje uočljivim njihovim neprijateljima. zaštiti bilja i zraka. v. naseljuju se u mišićima.. embrioblast. v. povratka krvi iz klijetke u pretklijetku. 1969. C. američki znanstvenik koji je s austrijskim znanstvenikom Landsteinerom otkrio Rhesus faktor.

ZELENE PLIJESNI. ZIMSKI SAN (hibernacija). a iz spore se razvije spolna generacija. Produkt fotosinteze je škrob. ZNOJNE ŽLIJEZDE. crvenkrpica i kravosas. ljuskaši iz skupine gmazova. matematika. glodavci i neki medvjedi. tekućina po kemijskom sastavu slična mokraći. ZNANOST. a od otrovnica poskok i riđovka. tj. ZOOCENOLOGIJA. zahvalu i popis literature. Te su žlijezde preobražene žlijezde slinovnice. U prirodne znanosti ubrajaju se biologija. v. Znanstveni rad iz područja biologije obično sadrži naslov rada. sporofit. povezano organizirano i sistematizirano ljudsko znanje. uvod. sažetak. fizika i kemija. a svaka se strana donje čeljusti može pomicati neovisno dok gutaju plijen. ZJENICA (pupilla). ime autora. uz prethodnu redukcijsku diobu. Nemaju noge već se pokreću svijanjem trupa i repa koji zajedno imaju 200 i više kralješaka. ZNANSTVENI RAD. mokraćne kiseline. Zigota se dijeli mitotičkim diobama te se tako iz nje razvija novi organizam. Razmnožavaju se vegetativno (mitotičkom diobom). morska salata (Ulva lactuca) itd. Iz zigote gametofita razvija se nespolna generacija. bjeloočnica. Umjesto organa za sluh imaju osjetljiv rašljasti jezik koji služi i za opip i njuh. Zmije nemaju pokretne očne kapke već im je oko pokriveno prozirnom opnom. Sadrži diploidan broj kromosoma (2n). gametofit. spolno gametama koje proizvodi spolna generacija ili gametofit te nespolno sporama koje se razvijaju na sporofitu. ZIGOTA. ZEMLJINA PRAATMOSFERA. zaključak. Taj proces se zove i antitetska izmjena generacija. Na pr. U našim krajevima česte su. a gametofit haploidna. Mnogi vodozemci i gušteri nepovoljne zimske uvjete preživljavaju zakopani u mulju ili u tlu. od sisavaca: kukcojedi. To je bit izmjene generacija. Stanična stijenka je od celuloze. spirogira (Spirogyra). tekst u kojem znanstvenik iznosi u javnost način rada i rezultate svojih istraživanja. Nemaju ni bubnjić. od neotrovnih zmija npr. mješinarke i penicilijum. Zmije otrovnice imaju žljebaste ili šuplje zube koji su povezani s parom otrovnih žlijezda. v. sveukupno. 153 . zimsko mirovanje životinja nalik na san. Ishlapljivanje znoja ima važnu ulogu u termoregulaciji i regulaciji sastava tjelesnih tekućina. materijal i metode rada. raspravu. Predstavnici su kišna alga (Pleurococcus). ZNOJ. amonijaka i hlapljivih masnih kiselina. haploidan broj kromosoma (n) od oca i haploidan broj kromosoma (n) od majke. isp. mokraćevine. isto što i žlijezde znojnice. Razlikujemo prirodne i društvene znanosti. volvoks (Volvox). rezultate. do točke smrzavanja organizma. Sastoji se od 95 do 98 posto vode. Spolno i nespolno razmnožavanje pravilno se izmjenjuju i nadopunjuju. praatmosfera.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE a i b klorofila. bjelouška. Tako se čuva energija jer se metabolizam jako uspori. klamidomonas (Chlamydomonas). Hrane se isključivo drugim životinjama. ZMIJE. U čeljustima imaju zube. Koža im je pokrivena rožnatim ljuskama. otopljena NaCl. oplođena jajna stanica koja nastaje stapanjem različitih spolnih stanica (gameta). v. šišmiši. Sporofit je uvijek diploidna generacija. ali vibracije osjete preko kostiju lubanje. Imaju kvadratnu kost. znanost o zoocenozama. Za to vrijeme životinje se ne hrane a štitna žlijezda održava tjelesnu toplinu i 20 0C nižu od normalne.

lisica. koralji i režnjaci. zrakasto simetrični bezkralježnjaci. Usta su okružena lovkama i nastavljaju se u probavnu (gastrovaskularnu) šupljinu. lasica. ne samo o samom organizmu. Jedini drvenasti žabnjak je pavitina. Žive pretežno u moru. ŽARNE STANICE (knidociti). koine = zajednica). ZOOLOGIJA. U dvospolnom se cvijetu nalaze zavojito poredani veći broj prašnika i plodnih listova. ZOOFAGI. U epidermu se nalaze i žarne stanice. kuna. posebni oblici stanica kod žarnjaka. Mnogi žarnjaci. bez crijevnog otvora. v. metageneza. znanost koja proučava životinje. Njima love hranu. Ovu životinjsku komponentu biocenoze proučava znanost zoocenologija. beta. Nemaju organe za disanje i izlučivanje. Pojavljuju se u dva oblika tijela . ZRAKAŠI.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ ZOOCENOZA (grč. izgrađuju unutarnje i vanjske kosture. a porodica hidri u slatkoj vodi. mezogleja i gastroderm ili endoderm. v. prirodna životna zajednica životinja u nekoj biocenozi. mejoza. ŽELUČANA LIPAZA. U svakoj se stanici nalazi žarnica ili knida. Plod je orah ili mjehur. Ako se spolno razmnožavaju spolovi su razdvojeni. Kod nas su poznate zvijeri: medvjed. gama i neutronsko zračenje) čije posljedice mogu biti vidljive odmah nakon ozračivanja ili se mogu ispoljiti u potomstvu (mogu izazvati mutacije). vuk. korjenonošci. Polipi žarnjaka imaju veliku moć regeneracije. isp. Kada se žarnica podraži. zoon = životinja. Najgušće su poredane na lovkama. Grabežljivci su i zubi su im prilagođeni za hvatanje. šumske biljke (bijela šumarica. Listovi su najčešće razdijeljeni. ZOOPLANKTON. ŽABNJACI. ZRAKASTA (radijalna) SIMETRIJA. ubijanje i komadanje plijena. v. Ž ŽABE. Sistematski se dijele na tri skupine: obrubnjaci. Tijelo izgrađuju tri sloja: epiderm ili ektoderm. Oplodnja je vanjska. zlatica). Utjecaj zračenja na neki organizam ovisi. ZRAČENJE. žarnjaci ili bodljikaši. već i o vrsti i količini zračenja. emitiranje različitih vrsta zraka od kojih neke mogu štetno djelovati na organizme. Radijalno simetrične životinje su sjedilački (sesilni) ili slabo pokretni organizmi. bezrepci. vidra i dr. posebno zadružni. jedna od najprimitivnijih skupina dvosupnica. v. 154 . To je stanični organel koji sadrži otrov i jednu smotanu cjevčicu. Žabnjacima pripadaju mnoge livadne biljke (žabnjak ljutić. Zeljaste su biljke. Mnogi žarnjaci imaju izmjenu nespolne i spolne generacija. plankton. Živčani sustav je mrežast. drugo ime za mesojede. Iz oplođenog jajeta razvija se trepetljikava ličinka planula. Razmnožavaju se nespolno pupanjem (polipi) i spolno. probavni enzim iz želučanog soka koji sudjeluje u razgradnji masti. kao npr. simetrija kod koje su organi smješteni zrakasto oko središnje osi. ris. crni kukurijek) te močvarne biljke (kaljužnica). ZORIDBENA DIOBA. skupina sisavaca koja se hrani mesom. Nove se žarnice mogu obnoviti za 48 sati. ZVIJERI. izbaci se cjevčica kroz koju istječe otrov. ŽARNJACI (Cnidaria). Tako je za zdravlje čovjeka posebno opasno radioaktivno zračenje (alfa.polip i meduza.

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE ŽELUČANE ŽLIJEZDE. kardije (cardia). ali i dišu jer je ždrijelo dobro prokrvljeno. Ima osjetilnih. Razlikuju se od nežive prirode po sljedećim obilježjima: imaju staničnu građu. razlikujemo unutarnje organe: jajnike. Na izlazu iz želuca nalazi se prstenasti mišić .5. 155 . Optjecajni sustav je otvoren. razmnožavaju se i umiru. akson (neurit). srednji sloj tkiva očne jabučice. volumena oko 1200 do 1500 ml. neurita) obavijeni ovojnicom. Filtrirajući vodu sakupljaju hranu. Zbog prisutnosti razrijeđene HCl u želucu je pH oko 1. ŽIVAC. Na ždrijelu imaju niz škržnih pukotina. Iz oplođenog jaja nastaje ličinka tornarija koja se razvija u odrasli oblik. nakon čega se hrana. Za izlučivanje imaju dva para nefridija. prijenosne i pokretačke (motorične). snopovi živčanih vlakana (aksona. jajovode. a na periferiji živce. podražaj koji nastaje i prenosi se u živčanom sustavu između živčanih stanica i to kemijskim putem pomoću posebnih kemijskih tvari. maternicu i rodnicu i vanjske organe: stidnicu i dražicu (klitoris). rilo). otpušta u dvanaesnik. Bogata je krvnim kapilarama koje oku dopremaju kisik i hranidbene tvari. Pokretni su i bilateralno simetrični oblici. Nazivaju se i polusvitkovci. Probavni želučani sokovi sastoje se od probavnih enzima (pepsin) i kloridne kiseline (HCl). Pri prolasku živčanog podražaja mijenja se propusnost membrane živčanih stanica za ione natrija što uzrokuje promjenu membranskog potencijala stanice. Građena je od tijela stanice (soma) iz kojega izlazi veći broj kratkih živčanih vlakana (dendrita) i jedno duže živčano vlakno. fundus) i izlaznog dijela. ŽENSKI SPOLNI ORGANI. što također pokazuje sličnost sa svitkovcima. Žiroglavci su razdvojena spola. Tijelo živčane stanice sadrži većinom iste organele kao i ostale tjelesne stanice osim centrosoma. rastu. U šupljinu glavice ulazi potporni štapić koji se može smatrati začetkom svitka. crvoliko i podijeljeno na tri dijela: glavicu (prosomu. izmjenjuju tvari s okolišem. prošireni je dio probavne cijevi u čovjeka.pilorični sfinkter koji zadržava hranu u želucu dok se dovoljno ne probavi. zbog čega se ne mogu dijeliti. biljni i životinjski organizmi i čovjek. Na okončinama aksona nalaze se završne nožice pomoću kojih se ostvaruje sveza . tijela želuca (fornix. One luče na dan oko 2000 mL probavnih sokova i sluzi (mukoza). Sastoji se od ulaznog dijela jednjaka u želudac. corpus. Neurone možemo podijeliti na osjetilne (receptorne. ŽILNICA (chorioidea). osjetljivi su na podražaj. senzorične). Žiroglavci imaju i leđnu živčanu vrpcu koja se može smatrati početkom razvoja leđne moždine kod svitkovaca. U stijenci se nalaze želučane žlijezde. Neurit je obavijen mijelinskom ovojnicom. Tijelo je oblo. neurohormona (neurotransmitera). osnovna građevna i funkcionalna jedinica živčanog sustava koja ima svojstvo primanja i provedbe podražaja. ŽIVA BIĆA. Smatra se da je iz sličnih oblika u davnoj prošlosti poteklo razvojno stablo svitkovaca. ogrlicu na kojoj su usta (sa donje strane) i dugačak trup. ŽIVČANA STANICA (neuron). motoričkih ili mješovitih živaca. dišu. hrane se. morske životinje koje pripadaju malokolutićavcima. sada pod nazivom himus. ŽIROGLAVCI. duodenum. ŽELUDAC. nalaze se u stijenci želuca. pilorusa koji se veže na dvanaesnik. ŽIVČANI PODRAŽAJ. Snopovi aksona čine živčane putove u mozgu i leđnoj moždini.sinapsa.

v. Funkcionalno ima dva osnovna dijela: tjelesni (somatski) i vegetativni (autonomni). Izlučuju na dan 1 do 1. mjesto prijenosa živčanog podražaja (impulsa) sa živca na mišićno vlakno. postoje šumske. ŽIVČANO-MIŠIĆNA VEZA (motorička pločica. Važne su za regulaciju sastava tjelesnih tekućina i termoregulaciju.ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ ŽIVČANI SUSTAV. jezerske i druge biocenoze. Nastaje akcijski potencijal mišićnog vlakna i povećava se koncentracija iona kalcija u vlaknu. a usko su povezane različitim međuodnosima. zajednica raznovrsnih biljnih i životinjskih organizama na određenom staništu. koine = zajednica). v. Iako nema posve oštrih granica među pojedinim skupinama živih bića ipak ih možemo podijeliti prije svega na nadcarstva prokariote. ŽIVOTINJSKI VIRUSI. ŽIVOTNA ZAJEDNICA (biocenoza. središnji i periferni. v. čine živa bića (isp. posebno u hranidbenim lancima. koja je potrebna za klizanje aktina i miozina jednih među druge odnosno kontrakciju mišićnih vlakana. voljni i autonomni. koji ulazi u sinaptičku pukotinu i omogućuje prijenos podražaja na mišić. endokrine žlijezde. u kojoj se nalazi probavni enzim ptijalin (alfa amilaza). Biljke Gljive Protisti Monere Životinje Eukarioti Prokarioti Shema podjele živih bića ŽIVOTINJE. odnosno skupina jedinki različitih populacija koje žive na određenom staništu. a u eukariote protisti. biljni i životinjski organizmi koji su živjeli u davnoj prošlosti. ŽLIJEZDE ZNOJNICE. obrađuje. sustav koji s milijardama živčanih stanica (neurona) prima. Tako npr. žlijezde koje luče slinu. Živčani podražaj uzrokuje oslobađanje prijenosne tvari acetil-kolina. stanica.). koja su građena od niti miozina i aktina. Npr. riba latimerija (iz Indijskog oceana) preostala je od davno izumrle skupine resoperki ili kinesko drvo ginko. heterotrofni eukarioti. živčani sustav možemo podijeliti na osjetilni i pokretački.5 sline. ŽLIJEZDE S UNUTARNJIM IZLUČIVANJEM. miofibrile. ŽIVI SVIJET. U 156 .6. nalaze se usmini kože. gljive. pohranjuje i očitava brojne informacije iz tijela i okoline. podvilične (submandibularne) i podjezične (sublingvalne) i imaju svoje izvodne kanale u usnu šupljinu. Taj enzim već u ustima razgrađuje škrob u maltozu i glukozu. Lučenje je sline refleksna reakcija. Vlakno sadrži brojna mišićna vlakanca. Dijele se na jednostanične i mnogostanične. pH vrijednosti 5. močvarne. U prokariote spada carstvo monere. životinja (zoocenoza) i mikroorganizama (mikrobiocenoza). te reagira na primljene podražaje ili obavlja misaonu radnju. Životne se zajednice sastoje od biljaka (fitocenoza). bios = život. Zajedno s endokrinim (hormonalnim) sustavom upravlja životnim funkcijama. ŽIVOTINJSKA STANICA. Kod čovjeka postoje tri para: podušne (parotidne). sinapsa). To potiče oslobađanje energije iz ATP-a. ŽIVI FOSILI. biljke i životinje. a održali su se do danas. grč. primitivna golosjemenjača koja je po nekim obilježjima srodna papratnjačama. prenosi. ŽLIJEZDE SLINOVNICE.6 do 7. livadne. eukariote i posebno izdvojene viruse. Prema građi. virusi. smještaju i ulozi koju obavlja.

Sastoji se od luteinskih stanica koje sadrže masti i koje su žute jer sadrže žutu boju lutein po čemu je čitava tvorba i dobila ime. Eterična ulja u štitarki proizvode proizvode se u posebnim stanicama i izlijevaju u uljne kanale. Izlučuju znoj. smolne kanale s bogatim sadržajem hlapljivih smola. ŽLJEZDANO (ekskrecijsko) STANIČJE. Jako se međusobno razlikuju u svim elementima ovisno o bljnoj vrsti. pod pazuhom. stvaraju se u žučnom mjehuru u početku kao male krute čestice. Zajednički izvodni kanal žučovoda (ductus choledocus) ulijeva žuč u dvanaesnik. Može nastati upala. Mliječne cijevi s mliječnim sokom svojstvene su biljkama iz porodica makova. ŽUČNI MJEHUR. Ako nije došlo do oplodnje žuto tijelo se smanjuje. v. Nektariji su žljezde koje luče slatki (“cvjetni”) sok nektar koji primamljuje kukce oprašivače. porodica usnača (majčina dušica. Četinjače. ŽUTO TIJELO (corpus luteum). Kapacitet žučnog mjehura je oko 500 mL žuči na dan. bosiljak i druge). Tijekom trudnoće žuto tijelo izlučuje povećane količine estrogena i progesterona koji sprječavaju pojavu menstruacije i time gubitak ploda. Uzrok nastanku žučnih kamenaca nije poznat.____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE tijelu ih ima oko 2 do 3 milijuna. tvorba koja nastaje u jajniku sisavaca iz Graafovog mjehurića nakon ovulacije. ŽUČ. a javljaju se grčevi i jaka bol (žučne kolike). pohranjuje i koncentrira žuč nastalu u jetri. 157 . Kod potpunog začepljenja žučovoda nastaje žutica. lecitin te različite elektrolite. prestaje izlučivati hormone. tvorba kruškolikog oblika smještena na donjoj strani jetre. osim porodice tise. kolesterol. Žuč je složena otopina koja sadržava soli žučnih kiselina za emulgiranje (raspršivanje) masti. isp. koje s vremenom postaju sve veće. Ako kamenac zapne u žučovodu. mlječika itd. stvara se u stanicama jetre. iz svojih stanica gubi masti i postaje bijelo tijelo (corpus albicans). ŽUTICA NOVOROĐENČETA. infekcija mjehura i žučovoda. ŽUČNI KAMENCI. u svim svojim dijelovima sadrže smolenice. na dlanovima i tabanima. nosu. npr. Luteinske stanice izlučuju hormone estrogene i progesteron. služi proizvodnji i izlučivanju određenih vrsta tvari u biljaka. žučnu boju bilirubin (produkt raspalog hemoglobina iz mrtvih eritrocita). Tu su još žljezdane dlake koje proizvode različite hlapljive i mirisne tvari. spriječit će se protok žuči u crijevo. Liječi se odstranjenjem žučnog mjehura s kamencima (kolecistektomija). fetalna eritroblastoza. kadulja. a najviše na čelu.

ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ 158 .

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE PITANJA 159 .

ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________ 160 .

Razasuti u citoplazmi ili vezani uz opne endoplazmatske mrežice su: A) lizosomi B) mitohondriji C) kloroplasti D) grana E) ribosomi 5. Raspored kromosoma i gena u gametama ovisi o: A) prvoj mejotičkoj diobi B) drugoj mejotičkoj diobi C) metafazi mitoze D) u jednakoj mjeri o obje mejotičke diobe E) o rasporedu kromosoma koji se uspostavi već u zigoti 4. Srednji zametni listić se zove: A) ektoderm B) endoderm C) mezoderm D) blastoderm E) blastocista 3._________________________________________________________________________ Pitanja Pitanja s jednim točnim odgovorom 1. Tilakoide nalazimo u: A) mitohondrijima B) ribosomima C) Golgijevom tijelu D) kloroplastima E) kromosomima 6. Nakupine hidrolitičkih fermenata nalaze se u: A) jezgri B) jezgrici C) kromatinu D) lizosomima E) ribosomima 161 . Aktivni prijenos kroz staničnu membranu ovisi o: A) veličini čestica koje se prenose B) koncentracijama otopina s jedne i s druge strane membrane C) veličini pora u membrani D) svojstvima otapala E) raspoloživom ATP 9. Kromatin je sastavni dio: A) jezgre B) ribosoma C) endoplazmatske mrežice D) centriola E) lizosoma 10. Mitoza je važna jer se za njenog trajanja: A) udvostručuju DNK B) udvostručuju kromosomi C) odvajaju kromatide istog kromosoma D) sparuju homologni kromosomi E) vrši redukcija broja kromosoma 8. Jezgru nemaju: A) spermiji B) jajašca C) spolne prastanice D) jednostanične alge E) modrozelene alge 7. Kretanje molekule otopljene tvari iz područja veće u područje manje koncentracije dviju otopina odvojenih opnom zove se: A) difuzija B) dijaliza C) osmoza D) fagocitoza E) Brownovo gibanje 11. Trofoblast nalazimo u embrionalnom razvitku: A) ježinaca B) žabe C) daždevnjaka D) kukaca E) čovjeka 2.

Oksidacija je proces: A) u kojem neka molekula prima elektrone B) u kojem neka molekula gubi elektrone C) uzajamnog primanja i gubitaka elektrona D) koji se događa samo za vrijeme svjetlosnih reakcija fotosinteze E) koji se događa samo u mitohondrijima 18. Dušične baze nalaze se u: A) polisaharidima B) trigliceridima C) polipeptidima D) polinukleotidima E) aminokiselinama 23. Proces u kojem se formiraju zametni listići zove se: A) brazdanje B) gastrulacija C) sporulacija D) partenogeneza E) metamorfoza 162 . Kromosomi se udvostručuju u: A) profazi B) metafazi C) anafazi D) telofzi E) ni u jednoj navedenoj fazi 13. Razgradnja glukoze do alkohola i CO2 zove se: A) glikoliza B) fosforilacija C) redukcija CO2 D) fermentacija E) Krebsov ciklus 15. Izvor vodikovih iona u fotosintezi je: A) klorofil B) NADPH2 C) atmosferski vodik D) voda E) glukoza 22. ATP je spoj skupine: A) aminokiselina B) monosaharida C) oligosaharida D) steroida E) nukleotida 21. Kojih su genotipova roditelji ili o kakvom se križanju radi: A) Aa x AA B) AA x AA C) Aa x Aa D) intermedijarno križanje E) test križanje 14. RNK su nasljedna tvar: A) bičaša B) bakterija C) modrozelenih alga D) bakterijskih virusa E) biljnih virusa 19. Disaharid je: A) škrob B) riboza C) saharoza D) fruktoza E) galaktoza 16. Sastavni dio enzima je uvijek: A) neki metal B) oligosaharid C) jedan ili više polipeptida D) jedan ili više polinukleotida E) oligonukleotid 20.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ 12. Oba roditelja (zamorci) s crnim krznom daju potomke i s crnim i s bijelim krznom. Glikoliza se odvija u: A) hrapavoj endoplazmatskoj mrežici B) glatkoj endoplazmatskoj mrežici C) Golgijevom tijelu D) citoplazmatskom matriksu E) mitohondriju 17.

Bijelo tijelo (korpus albikans) susreće se u: A) u svakoj stanici viših biljaka B) u spolnim stanicama životinja C) sjemeniku D) jajniku E) prostati 28. Koliko dušičnih baza određuje ugradnja jedne aminokiseline pri sintezi bjelančevina? A) 1 B) 3 C) 6 D) 9 E) 16 34._________________________________________________________________________ Pitanja 24. Izlučivanje oksitocina za vrijeme dojenja uvjetuje: A) mliječna žlijezda B) neurohipofiza C) adenohipofiza D) hipotalamus E) jajnik 32. Trojku ili kodon čine tri: A) dušične baze B) deoksiribonukleinska kiselina C) aminokiseline D) molekule ATP E) hormona hipofize 33. Jajna stanica sazrijeva u: A) Graafovom folikulu B) jajovodu C) maternici D) sjemeniku E) žutom tijelu 26. 4 fenotipa omjera 25%:25%:25%:25% nastaju križanjem: A) dvaju različitih homozigota B) dvaju različitih heterozigota C) dvaju jednakih heterozigoa D) jednog heterozigota s recesivnim homozigotom E) jednog heterozigota s dominantnim homozigotom 35. Za vrijeme trudnoće: A) luči se više estrogena od progesterona B) luči se više progesterona od estrogena C) prestaje sinteza progesterona D) prestaje sinteza estrogena E)adenohipofiza počne izlučivati oksitocin 29. Zakone nasljeđivanja formulirao je: A) Darwin 163 . Hipotalamus: A) sintetizira gonadotropne hormone B) izlučuje gonadotropne hormone C) kontrolira sintezu gonadotropnih hormona D) sintetizira prolaktin E) izlučuje tiroksin 27. Stalnu funkciju sjemenika regulira i održava: A) hipotalamus B) prostata C) muški spolni hormon kore nadbubrežne žlijezde D) timus E) neurohipofiza 31. Prolaktin izlučuje: A) hipotalamus B) mliječna žlijezda C) jajnik D) adenohipofiza E) neurohipofiza 30. Zigota je: A) jajna prastanica B) spermijska prastanica C) neoplođeno jaje D) oplođeno jaje E) partenogenetski aktivirano jaje 25.

Suvremenom shvaćanju evolucije ne pripada činilac: A) genska snaga B) izolacija C) svrsishodnost D) divergencija E) prirodna selekcija 44. Endoplazmatska mrežica: A) dobro je razvijena u embrionalnim stanicama B) dobro je razvijena u stanicama gušterače C) slabo je razvijena u stanicama gušterače D) dobro je razvijena u stanicama tumora E) u jednakoj je mjeri razvijena u svim tipovima životinjskih stanica. Svi ekosustavi zajedno čine: A) biotop B) biosferu C) populaciju D) biocenozu E) ionosferu 39. U Mendelovim križanjima graška duge i kratke stabljike djelovanje recesivnog činioca izrazilo se u F2 generaciji u: A) 50% potomaka B) 25% potomaka C) 75% potomaka D) 10% potomaka E) 0% potomaka 37. dok je manje razvijena u biljnih stanica 45. Prostor na kojem je raspoređena neka vrsta organizama je: A) biom B) relikt C) areal D) vegetacija E) endem 41. U tundri se uglavnom nalaze: A) crnogorično drveće B) listopadno drveće C) travnjaci D) papratnjače E) mahovine i lišaji 38. Na prvom mjestu hranidbenog lanca u biocenozi su: A) saprofagi B) fitofagi C) zoofagi D) heterofagi E) autotrofi 42.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ B) Mendel C) Mendelejev D) Morgan E) Lamarck 36. Omjer fenotipova 9:3:3:1 dobije se samo ako su genotipovi dvaju roditelja: A) AAbb i AAbb B) aaBB i aaBb 164 . Primarna organska produkcija je proizvodnja: A) autotrofnih biljaka B) heterotrofnih biljaka C) heterotrofnih životinja D) heterotrofnih bakterija E) mesojeda 43. Zelene biljke u morskoj vodi dopiru prosječno do dubine: A) 100 m B) 200 m C) 300m D) 400m E) 450 m 46. Važni razlagači u ekosustavima su: A) mesojedi B) stonoge i kukci C) zelene biljke D) biljojedi E) heterotrofne bakterije 40.

Prvi sisavci javljaju se u: A) permu B) trijasu C) srednjem mezozoiku D) tercijaru E) kvartaru 56. Koji će od navedenih genotipova dati fenotip koji se razlikuje od ostala 4 fenotipa: A) AABB B) AaBB C) AaBb D) AABb E) AAbb 48. Grašak genotipa AABb može proizvoditi gamete s genima: A) A B) B C) b D) Bb E) AB 57._________________________________________________________________________ Pitanja C) AaBb i AaBb D) AaBb i aabb E) AAbb i aaBB 47. Jednostruku membranu imaju: A) jezgra B) ribosomi C) mitohondriji D) centrosom E) lizosomi 58. Križanjem ružičaste i crvene zijevalice nastaju: A) sve ružičaste zijevalice B) sve crvene zijevalice C) 50% bijelih i 50% crvenih zijevalica D) 25% crvenih i 75% ružičastih zijevalica E) 50% crvenih i 50% ružičastih zijevalica 51. Točan rezultat fotosinteze je: A) C6H10O5 + 6O2 + 6H2O B) C6H12O6 + 12O2 + 6H2O C) C6H12O6 + 6O2 + 12H2O D) C6H12O6 + 6O2 + 6H2O E) C6H12O6 + 10O2 + 6H2O 53. Konjugacija kromosoma događa se u: A) profazi mitoze B) metafazi mitoze C) profazi I mejotičke diobe D) profazi II mejotičke diobe E) metafazi II mejotičke diobe 55. Što se ne odnosi na oksitocin: A) hormon koji izlučuje adenohipofiza B) hormon koji izlučuje neurohipofiza C) potiče sekreciju mlijeka nakon poroda D) dospijeva krvlju do maternice E) izaziva kontrakciju mišića maternice 54. Za pripadnike krvne grupe A karakteristično je da na membranama svojih eritrocita imaju: A) aglutinogen A B) aglutinogen B C) aglutinogen A i aglutinogen B D) anti A aglutinin E) anti A i anti B aglutinin 50. Citologija je znanost o: A) strukturi stanice 165 . Heterozigoti su zijevalice: A) samo bijele B) samo crvene C) samo ružičaste D) crvene i bijele E) crvene i ružičaste 49. Najpovoljniji pH za većinu enzima (fermenata) kreće se oko: A) 3 B) 5 C) 7 D) 9 E) 11 52.

Citoplazmatske organele obavijene membranom imaju: A) samo biljne stanice B) samo životinjske stanice C) bakterije D) modrozelene alge E) eukariotske stanice 66. Molekula klorofila može reagirati na svjetlosnu energiju Sunca ako je u: A) oksidiranom stanju B) reduciranom stanju C) blizini molekule glukoze D) blizini molekule glikogena E) blizini molekule škroba 64. Pasivni transport ne može biti: A) preko proteinskih prenosilca B) u smjeru pada koncentracije C) preko kanalnih proteina D) od manje koncentracije prema većoj E) olakšana difuzija 61. U kojem križanju dolazi do izražaja princip slobodne kombinacije? A) monohibridnom s dominacijom B) monohibridnom intermedijarnom C) dihibridnom s dominacijom D) u svim tipovima križanja E) u križanjima s diploidnim organizmima 166 . Zametni listići su slojevi stanica koji nastaju: A) brazdanjem B) gastrulacijom C) organogenezom D) histogenezom E) zbog posebne privlačnosti među stanicama 67. Za razvitak živčanog sustava potreban je kontakt: A) mezoderma s ektodermom B) endoderma s ektodermom C) endoderma s mezodermom D) svih triju zametnih listića E) trofoblasta s embrioblastom 69. Što ukazuje na početak gastrulacije u žaba: A) formiranje zametnih listića B) pojava blastoporusa C) povećanje blastule D) nestanak blastocela E) pojava arhenterona 68.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ B) molekulskoj građi stanice C) biokemijskoj građi jezgre D) biokemijskoj građi i funkciji stanice E) tri su odgvora točna 59. Koji su parovi komplementarnih baza u DNK? A) adenin-uracil B) adenin-gvanin C) citozin-timin D) citozin-gvanin E) citozin-uracil 62. Estrogen i progesteron su hormoni: A) hipofize B) gonadotropni hormoni C) intersticijskih stanica D) žutog tijela E) bijelog tijela 65. Vezivanjem jedne molekule glukoze i jedne molekule galaktoze nastaje: A) saharoza B) celuloza C) laktoza D) galaktoza E) fruktoza 60. Najveće količine energije u stanici veže molekula ovog sastava: A) adenozin. riboza i difosfat D) adenin. riboza i fosfat B) adenozin. riboza i trifosfat C) adenin. riboza i fosfat E) adenozin i trifosfat 63.

dan menstrualnog ciklusa B) 7. Vezani geni se nalaze: A) samo na X kromosomu B) samo na autosomima C) na spolnim kromosomima D) na različitim kromosomima E) na istom kromosomu 72. Modrozelene alge se razlikuju od bakterija po tomu što imaju: A) plastide B) kloroplaste C) klorofil D) jezgru E) jezgricu 73. Peptidnu vezu tvore skupine: A) OH i H B) COOH i NH2 C) COOH i COOH D) NH2 i NH2 E) COOH i OH 75. Genetski materijal bakteriofaga je: A) DNK B) RNK C) polinukleotidni lanci obilježeni izotopom D) polipeptidni lanci obilježeni izotopom E) DNK iRNK 76. dan menstrualnog ciklusa 79. Blastocistu u svom razvoju imaju: A) morski ježinac B) vodozemci C) sisavci D) identični blizanci E) višejajni blizanci 167 . Ovulacija se događa na: A) 1. Adenohipofiza luči: A) testosteron B) estrogen C) progesteron D) gonadotropne hormone E) oksitocin 81. dan menstrualnog ciklusa E) 28._________________________________________________________________________ Pitanja 70. dan menstrualnog ciklusa D) 21. Kloroplast se sastiji od: A) mikrofilamenata B) mikrotubula C) tilakoida D) endoplazmatskog retikuluma E) svi su odgovori točni 74. Neurosekrecijski faktori oslobađanja gonadotropnih hormona imaju kao glavni cilj tkivo: A) hipotalamusa B) hipofize C) uterusa D) dojke E) ovarija 80. Kod intermedijarnog nasljeđivanja u biljke zijevalice pojavljuju se u F2 generaciji i fenotipovi i genotipovi u omjeru: A) 1/2:1/2 B) 1/4:1/4:1/4:1/4 C) 3:1 D) 9:3:3:1 E) 1:2:1 71. dan menstrualnog ciklusa C) 14. DNK možemo razlikovati od RNK po: A) broju C-atoma u šećerima B) broju H-atoma u šećerima C) fosfornoj kiselini D) sustavu pirimidina E) sustavu purina 78. Testosteron se najjače izlučuje u: A) doba oplodnje B) embrionalno doba C) fetalno doba D) novorođenačko doba E) pubertetu 77.

S i G2 faza D) vrijeme spiralizacije kromosoma E) vrijeme nestanka jezgrice 83. Aminokiseline se u bjelančevinama vežu: A) slabim vezama B) vodikovim vezama C) nekovalentnim vezama D) peptidnim vezama E) slabim kovalentnim vezama 86. DNK i RNK ponašaju se kao kiseline zbog svojih: A) deoksiriboza B) riboza C) purinskih baza D) pirimidinskih baza E) fosfata 90. Omjer fenotipova 75%:25% dati će roditelji: A) AA x aa B) Aa x aa C) aa x aa D) Aa x Aa E) AA x AA 84. Svojstva i ulogu neke bjelančevine određuje: A) broj aminokiselina B) broj i vrsta aminokiselina C) broj. vrsta i raspored četrdesetak raznih aminokiselina 87. vrsta i raspored aminokiselina D) broj. Enzimi: A) omogućuju kemijske reakcije u stanici B) mogu djelovati samo u stanicama C) se u stanicama nalaze u kristalnom stanju D) su dijelovi molekula vitamina E) djeluju kao hormoni 93. Lipaza razgrađuje: A) maltozu B) škrob C) lipide D) proteine E) glukozu 168 . Timin je: A) pirimidin B) purin C) vitamin D) nukleozid E) nukleotid 89. Membranski proteini mogu biti: A) Djelomično hidrofilni B) djelomično hidrofobni C) enzimski aktivni D) u obliku kanalića E) sve su tvrdnje točne 85.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ 82. vrsta i raspored trideset raznih aminokiselina E) broj. Interfaza je: A) razdoblje mirovanja stanica B) dioba kromosoma C) G1. Promjer dvostruke uzvojnice DNK iznosi: A) 3.34 nm C) 1 nm D) 2 nm E) 10nm 92. Nukleotidi izgrađuju: A) nukleus B) nukleolus C) nukleoid D) adenozin E) polinukleotide 88. RNK prepoznajemo po prisutnosti: A) riboze i fosforne kiseline B) riboze i adenina C) deoksiriboze i uracila D) riboze i timina E) riboze i uracila 91.4 nm B) 0.

Prolaktin nastaje u: A) režnjevima hipofize B) hipotalamusu C) neurohipofizi D) adenohipofizi E) žlijezdanom tkivu dojke 98. Pasivni prijenos kroz membranu: A) odvija se od niže prema višoj koncentraciji tvari B) odvija se "nizbrdo" kao u osmozi i dijalizi C) odvija se uz utrošak energije D) odvija se pomoću membranskih prenosilaca E) troši ATP 95. U nukleolusu se sintetizira: A) DNK B) RNK C) gRNK D) tRNK E) rRNK 96. Omjer fenotipova 1:1 dati će roditelji: A) AA x aa B) Aa x aa C) aa x aa D) Aa x Aa E) AA x AA 103. Blastomera je dio: A) neoplođenog jajeta B) zigote C) blastule D) gastrule E) blastocela 101. Ako se geni A i C nalaze na dva razna mjesta istog kromosoma onda govorimo o: A) slobodnoj kombinaciji B) vezanim genima C) spolno vezanim genima D) monohibridnom nasljeđivanju E) intermedijarnom nasljeđivanju 105. Korpus luteum luči: A) luteotropni hormon B) gonadotropne hormone C) FSH. Trofoblast se razvija u: A) embrij B) fetus C) placentu D) blastoderm E) blastocel 100. F1 generaciju dobiti ćemo križanjem roditelja: A) Aa x Aa B) Aa x aa C) AA x aa D) AaBb x AaBb E) AaBb x aabb 104._________________________________________________________________________ Pitanja 94. U biologiju spada: A) citologija B) molekulska biologija C) taksonomija D) histologija E) svi su odgovori točni 169 . Genotip recesivnog homozigota je: A) Aa B) aa C) AA D) AaBb E) AABB 102. Zametni listići nastaju: A) iz blastocela B) trofoblasta C) blastule D) blastoderma E) blastoporusa 99. LH i LTH D) progesteron i estrogen E) oksitocin 97.

Koji su parovi komplementarnih baza u RNK? A) adenin-timin B) citozin-uracil C) gvanin-citozin D) citozin-timin E) adenin-gvanin 112. Fenotip je genetički izraz koji označuje: A) oblik i boju organizma B) strukturu i funkciju organizma C) "miješanje" očevih i majčinih gena D) rezultat uzajamnog djelovanja okoliša i genotipa E) kakav je genotip 170 . U sastav adenina ne ulazi: A) vodik B) dušik C) sumpor D) ugljik E) kisik 110. Ovulacija je: A) formiranje žutog tijela B) formiranje bijelog tijela C) izbacivanje jajašca iz Graafovog mjehurića D) putovanje jajne stanice u maternicu E) spajanje jajašca sa spermijem 114. riboze i trifosfata D) adenina. Koji od navedenih organela nemaju membrane? A) mitohondriji biljnih stanica B) kloroplasti C) lizosomi D) ribosomi E) Golgijevo tijelo 107. riboze i fosfata C) adenozina. Mezoderm u žaba nastaje kretanjem stanica: A) u unutrašnjost blastule B) u arhenteron C) po površini gastrule D) ektoderma E) endoderma 117. Kojom se citološkom metodom služimo za proučavanje stanica izvan organizma? A) autoradiografijom B) svjetlosnim mikroskopom C) elektronskim mikroskopom D) kulturom stanica i tkiva E) svi su odgovori točni 109. riboze i trifosfata E) ništa od navedenog 113. Molekula koja veže najveće količine energije u stanici sastoji se od: A) adenina. Mejoza je dioba: A) jajnih stanica B) spermija C) slična mitozi D) spermatogeneze i oogeneze E) poznata samo u sisavaca 116. Kada se udvostručuje DNK? A) u anafazi mitoze B) u anafazi mejoze C) u profazi mitoze D) u profazi mejoze E) u interfazi 108.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ 106. riboze i fosfata B) adenozina. Vezanjem jedne molekule glukoze i jedne molekule fruktoze nastaje: A) laktoza B) galaktoza C) saharoza D) fruktoza E) celuloza 111. Hormon testosteron: A) je gonadotropni hormon B) luče intersticijske stanice C) luče stanice adenohipofize D) ne luči se u pubertetu E) luči se tek u doba spolne zrelosti 115.

U kemijskom sastavu gvanina nema: A) kisika B) natrija C) ugljika D) vodika E) dušika 127. Geološko razdoblje karbon ili ugljeno doba značajno je po razvoju: A) gljiva B) alga C) papratnjača D) golosjemenjača E) kritosjemenjača 124. Koji od navedenih genotipova može biti potomak roditelja AABB x aabb? A) AaBB B) aaBB C) aabb D) AaBb E) AAbb 120. riboza i fosfat B) adenozin. Omjeri fenotipova u F2 generaciji intermedijarnog križanja su: A) 9:3:3:1 B) 3:1 C) 1:2:1 D) 1:1 E) 1:1:1:1 121. Mutacije gena su uvijek: A) spontane mutacije B) inducirane mutacije C) nasljedne promjene gena D) dominantne E) na istom kromosomu 122. U sastav kože ne ulaze stanice: A) žlijezda znojnica 171 . Prijelaz tvari između dviju otopina različitih koncentracija odvojenih opnom zove se: A) osmoza B) difuzija C) dijaliza D) aktivan prijelaz E) svi su odgovori točni 129._________________________________________________________________________ Pitanja 118. Križanjem graška duge i kratke stabljike dobijeno je i potomstvo duge i kratke stabljike. Za endoplazmatsku mrežicu vezani su: A) mitohondriji B) kloroplasti C) centrioli D) ribosomi E) lizosomi 125. U kojem omjeru ih treba očekivati od ukupno 120? A) 60 dugih i 60 kratkih B) 80 dugih i 40 kratkih C) 90 dugih i 30 kratkih D) 70 dugih i 50 kratkih E) 100 dugih i 20 kratkih 119. Naziv ATP je kratica za molekulu sljedećeg sastava: A) adenin. Znanost koja se bavi odnosima u biocenozi i odnosima biocenoze i okoliša zove se: A) ekologija B) biocenologija C) biogeografija D) biogeokemija E) fitocenologija 123. riboza i trifosfat C) adenozin i trifosfat D) adenozin i fosfat E) ništa od navedenog 128. Konačni proizvod fotosinteze je: A) CO2 B) H2O C) NADP-H2 D) C6H12O6 E) O2 126.

Koje križanje ima kao rezultat uniformnost potomstva: A) test križanje B) monohibridno C) dihibridno D) križanje roditeljske (P) generacije E) križanje filijalne F1 generacije 138.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ B) žlijezda lojnica C) dlake D) masnog tkiva E) hrskavice 130. Nasljeđivanje: A) je prenošenje osobina na potomstvo B) vrši se preko jajeta C) vrši se preko spermija D) je spajanje gameta E) nijedan odgovor nije točan 137. Što od navedenog ne odgovora prvoj mejotičkoj diobi? A) konjugacija kromosoma B) spiralizacija kromosoma C) odvajanje homolognih kromosoma D) odvajanje kromatida E) odvajanje centriola 132. Od kojeg se zametnog listića razvije živčano tkivo? A) od mezoderma B) od ektoderma C) od bilo kojeg zametnog listića D) od endoderma E) svi su odgovori točni 134. Za vrijeme gastrulacije posebnom aktivnošću endodermalnih stanica nastaje: A) mezoderm u sisavaca B) trofoblast u sisavaca C) mezoderm u ježinaca D) sekundarna tjelesna šupljina E) ništa od navedenog 135. Što je karakteristično za oogenezu? A) dvije redukcijske diobe B) jedna mejotička dioba C) nema mitoze D) tri diploidne polocite E) jedna haploidna jajna stanica 131. Genotip jednog roditelja je AaBb. bijelih i ružičastih cvjetova 140. Adenohipofiza luči velike količine prolaktina: A) u trudnoći B) neposredno prije poroda C) neposredno nakon poroda D) za vrijeme ovulacije E) za vrijeme oplodnje 136. Arhenteron je šupljina: A) koja odgovara blastocelu B) koja odgovara blastoporusu C) pracrijeva D) obavijena mezodermom E) obavijena ektodermom 133. Kakve cvjetove ima zijevalica u F1 generaciji: A) crvene cvjetove B) bijele cvjetove C) ružičaste cvjetove D) ima i crvenih i bijelih cvjetova E) ima crvenih. Mutacije spolnih stanica se pojavljuju: A) u muškim spolnim stanicama B) u ženskim spolnim stanicama C) u određeno vrijeme D) u sljedećim generacijama 172 . Koji je genotip drugog roditelja ako je omjer potomstva 1/4 : 1/4 : 1/4 : 1/4? A) aaBB B) AAbb C) AaBB D) AABB E) aabb 139.

Koliko milijardi godina su stari prvi tragovi organizama na zemljinoj kori? A) 1._________________________________________________________________________ Pitanja E) zajedno sa somatskim mutacijama 141. Procesi smjenjivanja biocenoze na nekom prostoru spadaju u: A) evoluciju B) sukcesiju C) melioraciju D) fenološku pojavu E) svi su odgovori točni 144. DNK se sintetizira: A) udvostručavanjem ishodišne molekule B) na kalupu RNK C) od pojedinačnih baza D) od parova baza E) od dinukleotida 151.5 D) 3 E) 4 145. Mjerilo gustoće svake populacije je: A) abiotski činilac B) skup ekoloških činilaca C) skup bioloških činilaca D) biomasa E) ekološka valencija 143. Fotosinteza je predočena jednadžbom: A) CO2 + H2O → C6H12O6 + H2O B) 6CO2 + 6H2O → C6H12O6 + 6O2 + 6H2O C) 6CO2 + 12H2O → C6H12O6 + 6O2 + 6H2O 173 . Bjelančevine su izgrađene od: A) aminokiselina B) glicina C) alanina D) glicil-alanina E) dipeptida 148.5 B) 2 C) 2. Genetičke šifre UAG i UAA A) ne znače ništa (nonsense code) B) su degenerirane šifre za leucin C) su degenerirane šifre za prolin D) su degenerirane šifre za arginin E) su degenerirane šifre za serin 142. Pramajmun nazvan prophilopitekus živio je u: A) eocenu B) oligocenu C) miocenu D) pliocenu E) pleistocenu 146. DNK prepoznajemo po prisustvu: A) riboze i citozina B) gvanina C) adenina D) deoksiriboze i timina E) deoksiriboze i uracila 150. Gvanin je: A) pirimidin B) purin C) nukleozid D) nukleotid E) polinukleotid 149. Molekulska biologija proučava: A) sve molekule u prirodi B) uzajamno djelovanje makromolekula C) male molekule stanica D) velike molekule žive i nežive prirode E) metabolizam 147. Enzimi su: A) organske molekule male molekuske mase B) anorganske molekule C) bjelančevine D) vitamini E) hormoni 152.

Virchow B) J. Kodon UUU u glasničkoj RNK uvjetuje ugradnju sljedeće aminokiseline u rastući peptidni lanac: A) metionina B) lizina C) serina D) fenilalanina E) valina 154.→ 2NADP-H2 E) ADP + P + ENERGIJA → ATP 153. Blastula je konačni proizvod: A) oplodnje B) organogeneze C) brazdanja D) metamorfoze E) gastrulacije 158. Trudnoća u čovjeka. Purkinje C) M. računajući od prvog dana poslijednje menstruacije. Schwann E) R. Na proizvodnju mlijeka nakon poroda utječu: A) estrogeni u ovarija B) progesteron iz luteinskih stanica C) prolaktin iz adenohipofize D) oksitocin iz adenohipofize E) gonadotropni hormoni 157. Gonadotropni hormoni utječu na: A) hipotalamus B) adenohipofizu C) neurohipofizu D) gonade E) klimakterij 155. J. Bjelančevine ubrajamo u: A) male organske molekule 174 . Embriologija proučava: A) razvoj vrste B) razvoj jedinke od njenog začeća do rođenja C) samo embrij D) samo fetus E) samo gastrulu 163. traje: A) 38 tjedana B) 40 tjedana C) 42 tjedna D) 270 dana E) 9 mjeseci 159. Brown 156. Omjer fenotipova 9 : 3 : 3 : 1 dat će roditelji: A) Aa x Aa B) AA x aa C) AABB x aabb D) AaBb x aabb E) AaBb x AaBb 160. Križanjem graška duge stabljike (Aa) s kratkom (aa) dat će omjer fenotipova: A) 1 : 1 B) 1 : 1 : 1 : 1 C) 75% : 25% D) 9 : 3 : 3 : 1 E) 1 : 2 : 1 161. Disaharid laktoza sastoji se od: A) glukoze i glukoze B) glukoze i fruktoze C) glukoze i galaktoze D) galaktoze i galaktoze E) fruktoze i fruktoze 164. Poznati aksiom "Svaka stanica od stanice" dao je: A) R.+ 2NADP + 4e.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ D) 4H. Schleiden D) Th. Evolucija proučava: A) postanak jedinke B) razvoj jedinke od začeća do rođenja C) embrionalni razvoj čovjeka D) postanak vrsta E) razvoj odnosa žive i nežive prirode 162.

Intersticijske stanice testisa: A) luče testosteron B) luče faktore oslobađanja hormona hipofize C) predstavljaju germinativni epitel D) luče gonadotropne hormone E) aktivne su samo u toku puberteta 175 . Puno ima NADP iz svjetlosnih reakcija fotosinteze glasi: A) adenozin difosfat B) nikotin-adenin difosfat C) nikotinamid-adenin difosfat D) nikotinamid-adenin dinukleotid E) nikotinamid-adenin dinukelotid fosfat 173. Aktivni prijenos kroz membranu: A) odvija se od više prema nižoj koncentraciji tvari B) teče "nizbrdo" C) odvija se uz pomoć prenosilaca i energije D) uključuje dijalizu i osmozu E) predstavlja difuziju 174. U sastav proteina ulazi sljedeći broj različitih prirodnih aminokiselina: A) 5 B) 10 C) 15 D) 20 E) 25 166. Adenozin monofosfat je: A) purinska baza B) pirimidinska baza C) spoj baze i šećera D) nukleotid E) energetski vrlo bogat 172. Što se od navedenog ne nalazi u eukariotskim stanicama? A) bičevi B) cilije C) vaukole D) nukleoidi E) stanična stijenka 167. Stanična jezgra u interfazi: A) sadrži kromosome B) ima jednostruku opnu C) prisutna je u toku čitavog staničnog ciklusa D) sadrži jezgrin sok i kromatin E) prisutna je u svim stanicama čovječjeg tijela 175._________________________________________________________________________ Pitanja B) velike anorganske molekule C) polinukleotide D) polisaharide E) makromolekule 165. Polinukleotid je sastavljen od mnogo: A) aminokiselina B) polipeptida C) dušičnih baza D) nukleotida E) adenozina 170. Citozin je: A) pirimidin B) purin C) vitamin D) aminokiselina E) nukleotid 169. Nukleotidi izgrađuju: A) šećer B) lipide C) polisaharide D) enzime i proteine E) nukleinske kiseline 168. ATPaza razgrađuje: A) AMP B) ADP C) ATP D) škrob E) maltozu 171.

koji se sastoje od dviju kromatida. Genetička šifra koja daje uputu za sintezu polipeptida koji se sastoji isključivo od fenilalanina je sljedeća: A) GUA B) CUC C) AUC D) AUA E) UUU 187. Embrioblast se razvija u: A) placentu B) resice C) embrij D) blastoderm E) blastocel 178. Bakterijskom nukleoidu u eukariota po funkciji odgovara: A) nuklein B) nukleolus C) nukleotid D) kromosom E) nukleozid 183. Križanjem graška duge stabljike (AA) s kratkom (aa) dati će u potomstvu omjer: A) 1 : 1 B) 1 : 1 : 1 : 1 C) 75% : 25% D) 9 : 3 : 3 : 1 E) 100% dugih 180. Anafaza I je značajna po: A) razdvajanju centriola B) udvostručavanju pričvrsnica C) razdvajanju kromatida D) razdvajanju kromosoma E) konjugaciji kromosoma 184. Žuto tijelo izlučuje: A) LH B) LTH C) FSH D) ICSH E) progesteron 186. nalazimo u: A) profazi I B) metafazi I C) anafazi I D) telofazi I E) telofazi II 185. Interstitial Cell Stimulating Hormone) djeluje na: A) folikule B) uterus C) dojku D) testis E) intersticijske stanice 177. Golgijevo tijelo se nalazi: A) samo u životinjskim stanicam B) samo u biljnim stanicama C) u stanicama eukariota D) u bakterijama E) u virusima 182.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ 176. Intermedijarno nasljeđivanje pokazuje u F2 generaciji: A) jednu klasu fenotipova B) dvije klase fenotipova C) tri klase fenotipova D) proporciju 3 : 1 E) proporciju 1 : 1 181. ICSH (engl. F2 generaciju dobit ćemo križanjem roditelja: A) aa X AA B) aa X aa C) AA X AA D) aA X AA E) aA X aA 179. Kako će se prepisati genetska poruka koja na molekuli DNK ima sljedeći redoslijed baza TAGGCCA? A) TUGGCCU B) AUGGCCU 176 . Haploidan broj kromosoma.

Koliko ima različitih fenotipova u F2 generaciji dihibridnog križanja: A) 16 B) 9 C) 8 D) 4 E) 2 192. Omjer genotipova i fenotipova 1 : 1 dobiva se križanjem roditelja: A) BB x bb B) Bb x Bb C) Bb x bb D) Bb x BB E) bb x bb 198. U aktiviranoj zigoti najprije se javljaju: A) nove stanice B) mejotičke diobe C) mitotičke diobe D) blastomere E) sve su tvrdnje točne 190. Međusobnim križanjem roditelja istih genotipova CcDd dobiva se potomstvo u sljedećem omjeru: A) 1 : 1 B) 1 : 1 : 1 : 1 C) 1 : 2 : 1 D) 9 : 3 : 3 : 1 E) 3 : 1 197. Vrste kojima je areal rasprostranjenosti u prošlosti bio mnogo širi._________________________________________________________________________ Pitanja C) TUGGCCU D) AUCCGGU E) TAGGCCT 188. Geni A i b nalaze se na različitim kromosomima pa zato govorimo o: A) intermedijarnom nasljeđivanju B) monohibridnom nasljeđivanju C) slobodnoj kombinaciji D) vezanim genima E) spolno vezanim genima 194. Koja je od navedenih zigota po fenotipu različita od svih ostalih? A) AaBB B) AABb C) AABB D) AAbb E) AaBb 191. Koji od navedenih roditelja mogu dati potomstvo koje za jedno svojstvo pokazuje omjer 3 : 1: A) aabb x AABB B) AABb x aaBB C) aaBb x aaBb D) AaBb x aabb E) aabb x aaBb 193. Omjer genotipova u F2 generaciji intermedijarnog križanja je sljedeći: A) 1 : 1 B) 3 : 1 C) 1 : 1 : 1 : 1 D) jednak je omjeru fenotipova E) ništa od navedenog 195. a sada su ograničene na uže područje zovu se: A) biomi 177 . Koji produkt sinteze očekujemo od redoslijeda nukleotida na lancu DNK: CGTATGCGTACGCAAGCACCA? A) monopeptid B) dipeptid C) tripeptid D) polipeptid E) ništa od navedenog 189. Koji od navedenih primjera odgovara gameti zadanog roditelja AaBb: A) aa B) bb C) Aa D) Bb E) niti jedan odgovor nije točan 196.

Biologija je znanost o: A) biljkama B) životinjama C) čovjeku D) životu E) jednostaničnim organizmima 200. Kloroplaste nalazimo u: A) bakterija B) životinja C) prokariota D) biljaka E) virusa 204. za razliku od životinjske ima: A) ribosome B) jezgru C) citoplazmu D) staničnu stijenku E) staničnu membranu 209. Zeleni pigment koji omogućuje fotosintezu nalazi se u: A) jezgri B) mitohondriju C) ribosomu D) endoplazmatskoj mrežici E) kloroplastima 208. Biljna stanica.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ B) populacije C) relikti D) endemi E) svi su odgovori točni 199. Bakteriofagi predstavljaju viruse koji napadaju: A) biljne stanice B) životinjske stanice C) bakterijske stanice D) ljudske stanice E) eukariotske stanice 205. Ribosomi su zrnca na kojima se odvija sinteza: A) DNA B) RNA C) proteina D) masti E) šećera 203. Deoksiribonukleinska kiselina sastavljena je od: A) nukleusa B) nukleolusa 178 . Najvažnija anorganska molekula našeg tijela je: A) šećer B) voda C) protein D) mast E) DNA 210. Biljna stanica. za razliku od životinjske ima sposobnost: A) mitotičkih dioba B) metabolizma C) disanja D) fotosinteze E) mejotičkih dioba 207. Jezgru nalazimo u: A) virusa B) bakterija C) prokariota D) eukariota E) eritrocitima čovjeka 206. Eukariotska stanica: A) nema jezgru B) ima jezgru C) otkrivena je elektronskim mikroskopom D) velika je 1 mikrometar E) je stanica bakterije 201. Bakterija je: A) eukariotska stanica B) prokariotska stanica C) stanica s jezgrom D) životinjska stanica E) stanica bez DNA 202.

Citozin je: A) polisaharid B) polipeptid C) pirimidin D) purin E) vitamin 214. Pentapeptid je lanac sastavljen od: A) 3 aminokiseline B) 5 aminokiselina C) 7 aminokiselina D) 3 glukoze E) 5 nukleotida 218._________________________________________________________________________ Pitanja C) nukleoida D) nukleotida E) riboza 211. Brazdanje završava oblikom zametka koji zovemo: A) blastula B) gastrula C) zigota D) blastocel E) blastoderm 220. Molekula RNA najčešće je: A) jednolančani polinukleotid B) dvolančani polinukleotid C) jednolančani polisaharid D) dvolančani polisaharid E) trolančani polipeptid 217. DNA izgrađuje: A) ribosome B) citoplazmu C) mitohondrije D) gene E) membrane 215. Estrogene i progesteron luče: A) hipotalamus B) stražnji režanj hipofize C) prednji režanj hipofize D) jajnik E) sjemenik 222. Gonadotropne hormone luči: A) cijela hipofiza B) prednji režanj hipofize C) stražnji režanj hipofize D) hipotalamus E) sjemenik 221. Adenin je: A) šećer B) aminokiselina C) purin D) pirimidin E) hormon 213. Genetska šifra sastoji se od: A) jednog nukleotida B) dva susjedna nukleotida C) tri susjedna nukleotida D) četiri susjedne aminokiseline E) pet susjednih aminokiselina 219. DNA je odgovorna za sintezu: A) masti B) ugljikohidrata C) bjelančevina D) lipida E) steroidnih hormona 216. DNA ima u svom sastavu šećer: A) ribozu B) heksozu C) saharozu D) triozu E) deoksiribozu 212. Anatomija istražuje: A) mikroskopsku građu živih bića B) mikroskopsku građu pojedinih organa C) makroskopsku građu živih bića D) pojedine sustavne kategorije živih bića E) međusobne odnose pojedinih organa 223. Ekologija proučava: 179 .

Koji je od navedenih elemenata neophodan za život za razliku od ostalih koji se javljaju samo u tragovima: A) Cl B) H C) Mn D) Zn E) J 225.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ A) uzajamne odnose žive i nežive prirode B) postanak vrsta u prirodi C) uzroke sličnosti i razlika među organizmima D) funkciju pojedinih staničnih dijelova E) pojedine vrste živih bića 224. Koliko kromosoma imaju gamete vinske mušice? A) 2 180 . Koji je od navedenih primjera homozigot samo za 1 par alela: A) aAbB B) aaBB C) AABB D) aabb E) aaBb 230. Koje od navedenih baza nema DNK? A) citozina B) uracila C) timina D) gvanina E) adenina 228. Gvanin se veže za: A) uracil B) adenin C) citozin D) timin E) bilo koju pirimidinsku bazu 229. Koje od navedenih križanja nije test križanje? A) Aa x aa B) Bb x bb C) AAbb x aaBB D) AaBb x aabb E) Aabb x aaBb 232. U prevođenju genetičke poruke jedna je aminokiselina određena: A) s jednom bazom B) s tri baze C) s četiri baze D) s dvije baze E) svi odgovori mogu biti točni 227. Tirozin i serin spadaju u: A) aminokiseline B) purinske baze C) pirimidinske baze D) nukleotide E) ni jedan odgovor nije točan 226. Gamete dihibridnog križanja su sljedeće: A) Aa B) Bb C) AA D) Ab E) svi su odgovori točni 233. Koje od spomenutih križanja daje potomstvo u omjeru 1 : 1: A) AaBb x AAbb B) Aa x aa C) Aa x Aa D) AA x aa E) nijedno 231. Koji je omjer fenotipova u potomstvu koje dobijemo križanjem AaBb x AaBb ako su geni vezani i među njima nema krosingovera? A) 1 : 1 B) 3 : 1 C) 1 : 2 : 1 D) 9 : 3 : 3 : 1 E) 1 : 1 : 1 : 1 234.

Od trofoblasta će se razviti: A) blastoderm B) posteljica (placenta) C) tijelo embrija D) embrioblast E) amnion ili alantois 240. Promjenu genske upute zovemo: A) varijacija B) mutacija C) rekombinacija D) transformacija E) degenerirana šifra 243._________________________________________________________________________ Pitanja B) 4 C) 6 D) 8 E) ni jedan od navedenih 235. LH i LTH proizvodi su: A) ovarija B) testisa C) hipofize 181 . Koch C) A. a otac zdrav? A) 50% B) 25% C) 100% D) 75% E) Svi će sinovi biti zdravi 237. Virchow E) E. Fleming D) R. Haeckel 244. Pasteur B) R. Crossing over omogućuje postanak novih vrsta gameta u: A) monohibridnih homozigota B) monohibridnih heterozigota C) dihibridnih homozigota D) dihibridnih heterozigota u slobodnoj kombinaciji E) dihibridnih heterozigota s vezanim genima 242. Prvi antibiotik je otkrio: A) L. Koji od navedenih genotipova spada u P (parentalnu ili roditeljsku) generaciju? A) aaBb B) aabb C) AaBB D) AABb E) Aabb 236. Ekologiji danas pripada zadatak da ispita odnos: A) biljaka prema životinjama B) nežive prirode prema biljkama C) nežive prirode prema životinjama D) čovjeka prema fizičkim faktorima okoline E) čovjeka prema ostaloj prirodi 241. FSH. Koliko % muške djece će imati hemofiliju ako je majka prenosilac. Virusi nemaju: A) jezgre B) ribosome C) membrane D) RNK i DNK zajedno E) svi su odgovori točni 239. Homologni kromosomi uključuju u svojem paru: A) kromosom 1 i kromosom 21 B) kromosom 2 i kromosom 22 C) kromosom 5 i kromosom 15 D) kromosom 8 i kromosom 18 E) kromosom X i kromosom Y 245. Što se događa u anafazi I mejotičke diobe? A) konjugacija homolognih kromosoma B) redukcija broja kromosoma C) odjeljivanje homolognih kromosoma D) odjeljivanje kromatida svakog kromosoma E) sve navedeno 238.

Djed albino (aa. Križanje roditelja AAbbCC i aaBBcc dati će potomstvo sa sljedećim genotipom: A) AABBCC B) AaBbCc C) aabbcc D) 50% AaBbCc i 50% aabbcc E) 50% AABBCC i 50% AaBbCc 254. autosomsko recesivno svojstvo) i baka normalne pigmentacije (AA) imali su kćer normalne pigmentacije. Vezani geni moraju se nalaziti na: A) X kromosomu B) Y kromosomu C) prvom kromosomu D) dvadesetprvom kromosomu E) istom kromosomu 255. Obzirom na sastav svojih spolnih kromosoma. među kojima je jedno dijete albino. Jednak broj ženka i mužjaka u potomstvu drozofile nastaje stoga što vinska mušica ima: A) jednaki broj jajnih stanica s X i onih sa Y kromosomima B) jednaki broj spermija s X i onih sa Y kromosomima C) 3 para autosoma i 1 par spolnih kromosoma D) 6 autosoma i 2 X kromosoma E) ukupno 8 kromosoma 251. Kakvog je genotipa najvjerojatnije bio otac? A) AA B) Aa C) XY D) XX E) XXY 249. Križanjem genotipa Aabb s aaBb dobit ćemo u njihovom potomstvu omjer fenotipova: A) 1 : 1 B) 3 : 1 C) 9 : 3 : 1 D) 1 : 1 : 1 : 1 E) 1 : 2 : 1 252. Križanje roditelja AaBbCC s reoditeljem AaBbCC dati će u potomstvu sljedeći omjer fenotipova: A) 1 : 1 B) 3 : 1 C) 9 : 3 : 3 : 1 D) 1 : 1 : 1 : 1 E) uniformnu generaciju (100%) 253. Otac koji normalno raspoznaje boje i majka daltonist imat će: A) sve kćeri daltoniste B) svu djecu daltoniste C) sve sinove daltoniste D) svu djecu normalnu E) sve sinove normalne 248. dvije različite vrste stanica nalazimo među: A) jajnim stanicama B) somatskim stanicama žena C) somatskim stanicama muškaraca D) spermatogonijama E) spermijima 250. ATP se dobiva spajanjem: A) adenozina s monofosfatom B) adenozina s difosfatom C) AMP + P 182 . Prolaktin nastaje u: A) hipotalamusu B) adenohipofizi C) neurohipofizi D) dojci E) mliječnim mjehurićima 247. Ona je u svom braku imala četvoro djece.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ D) hipotalamusa E) neurohipofize 246.

Od endoderma nastaju: A) bubrezi B) vezivna tkiva C) spolne žlijezde D) krvne žile E) sluznica probavila 265. Stanicu je prvi opazio: A) Leeuwenhoek B) Hooke C) Schleiden D) Schwann E) Buchner 258. Živčani sustav razvija se od: A) mezoderma B) endoderma C) trbušnog ektoderma D) bočnog ektoderma E) leđnog ektoderma 264. Test križanje se primjenjuje: A) da bi se otkrio genotip dominantnog fenotipa B) da bi se otkrio genotip recesivnog fenotipa C) samo u monohibridnom križanju D) samo u dihibridnom križanju E) u intermedijarnom križanju 266. U monohibridnom križanju s dominacijom omjer fenotipova u F2 generaciji je sljedeći: A) 1 : 2 : 1 183 . Za mitozu je karakteristično: A) dioba kromosoma B) reduplikacija DNK C) redukcijska dioba kromosoma D) jednak broj kromosoma u novim stanicama E) dioba centriola 259. Blastocel je: A) otvor blastule B) otvor gastrule C) šupljina blastule D) šupljina gastrule E) osnova celoma 262._________________________________________________________________________ Pitanja D) ADP + P E) adenina s trifosfatom 256. Pomoću adenozin trifosfata u stanicama se obavlja sljedeće: A) sintetske aktivnosti B) proizvodnja topline C) proizvodnja podražaja D) kretanje E) svi su odgovori točni 257. U ježinaca se mezoderm razvija od stanica: A) animalnog pola blastule B) vegetativnog pola blastule C) gastrule D) endoderma E) ektoderma 263. Pričvrsnica je posebno mjesto na: A) centriolu B) endoplazmatskoj mrežici C) Golgijevom tijelu D) kromatinu E) kromosomu 260. Nukleoidi su: A) jezgrice B) jezgre C) područja s DNK u bakterija D) spolni kromosomi E) kariotipovi 261. Koji od navedenih primjera odgovara test križanju: A) aa x AA B) aa x Aa C) Aa x Aa D) AaBb x AaBb E) aaBB x AAbb 267.

Za Golgijevo tijelo nije točno: A) da spada u stanične organele B) da se sastoji od kanalića C) da ima ribosome D) da se nalazi u žlijezdanim stanicama E) da se nalazi u biljnim stanicama 275. Koje od navedenih baza nema u RNK? A) gvanina B) adenina C) uracila D) timina E) citozina 277. Adenin i uracil spadaju u: A) peptide B) aminokiseline C) dušikove baze D) nukleinske kiseline E) nukleotide 274.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ B) 3 : 1 C) 1 : 1 D) 1 : 1 : 1 : 1 E) 9 : 3 : 3 : 1 268. Za ribosome je značajno: A) da su obavijeni membranom B) da su uvijek vezani za membrane endoplazmatske mrežice C) da se nalaze u svim tipovima stanica D) da u svome sastavu nemaju bjelančevina E) da u svome sastavu nemaju enzima 276. Kemijski sastojci stanične membrane su: A) RNK B) DNK C) svi tipovi nukleinskih kiselina D) lipidi E) sve navedeno 278. Fiziologija proučava: A) čovjeka B) funkcije pojedinih organa C) životinje D) biljke E) biljna i životinjska tkiva 271. Koliko različitih gameta može dati genotip AaBb ? A) 1 B) 2 C) 3 D) 4 E) 8 269. Koji je od spomenutih primjera recesivan za jedan par alela ? A) Aabb B) aaBB C) aaBb D) AAbb E) svi primjeri 184 . Autoradiografija: A) pomaže kod proučavanja staničnog metabolizma B) zasniva se na primjeni nestabilnih radioaktivnih izotopa C) pomaže kod praćenja sinteze molekula D) pomaže kod praćenja raspada molekula u stanici E) svi su odgovori točni 273. Kojoj aminokiselini odgovara slijed baza UUU u g-RNK: A) glicinu B) lizinu C) valinu D) argininu E) fenilalaninu 270. Nauka o evoluciji proučava: A) uzajamne odnose živih bića B) postanak vrsta u prirodi C) pojedine vrste životinja D) pojedine vrste biljaka E) funkciju pojednih organa 272.

Koji je diploidan broj kromosoma u drozofile: A) 4 B) 6 C) 8 D) 10 E) 12 285. Aleli su geni: A) koji kontroliraju jedan drugog B) koji mogu biti u odnosu dominacije i recesivnosti C) u parovima za svako svojstvo D) na paru homolognih kromosoma E) svi su odgovori točni 288. Vezani geni se nalaze: A) na različitim kromosomima a određuju ista svojstva B) na istom kromosomu a određuju ista svojstva C) na istom kromosomu a određuju različita svojstva D) na istom kromosomu bez obzira na svojstva koja određuju E) jedino na kromosomima vinske mušice 281. Ako u dihibridnom test križanju ne dobijemo cijepanje alela u potomstvu nego su svi potomci jednaki. to zanči da je dominantni fenotip roditelja morao biti sljedećeg genotipa: A) AaBB B) AABB C) aaBb D) AABb E) Aabb 286. Koje od navedenih križanja nije test križanje ? A) AaBb x aabb B) AaBB x AAbb C) Aabb x aaBb D) Aa x aa E) Bb x bb 280. koja je vjerojatnost da njihova djeca dobiju hemofiliju ? A) 25% ženske djece B) 50% muške i 50% ženske djece C) 100% ženske djece D) 100% muške djece E) nijedan odgovor nije točan 284._________________________________________________________________________ Pitanja 279. Virusi imaju: A) staničnu membranu B) staničnu stijenku C) ribosome D) RNK i DNK E) sve gore navedeno 185 . Koji omjer genotipova dobijemo u potomstvu ako križamo AABB x Aabb uz pretpostavku da se radi o vezanim genima? A) isti kao i omjer fenotipova B) svi su genotipski jednaki C) isti kao da geni nisu vezani D) 3 : 1 E) 1 : 1 : 1 : 1 283. Genotipovi F2 (druge sinovske) generacije mogu biti: A) AaBB B) aaBb C) AaBb D) Aabb E) svi navedeni 287. Ako je majka prenosilac hemofilije a otac hemofiličar. Gamete dihibridnog križanja su sljedeće: A) Ab B) AA C) Bb D) Aa E) svi su odgovori točni 282.

Struktura i funkcija svake ljudske stanice ovisi prvenstveno o njenim: A) lipidima B) ugljikohidratima C) nukleinskim kiselinama D) proteinima E) RNK 295. Četiri različite vrste gameta dati će jedinka genotipa: A) Aa B) AA C) AAbb D) AaBb E) AaBbCc 186 . Čovjek kao i sva druga živa bića pokazuje sljedeće značajke: A) staničnu građu B) individualnost C) metabolizam D) razmnožavanje E) sve nabrojene 290. Sintezu proteina prema genetskoj uputi zapisanoj u glasničkoj RNK zovemo: A) prepisivanje B) udvostručavanje C) mutiranje D) čitanje E) prevođenje 297. Križanac ili hibrid prikazan je sljedećim genotipom: A) AABBCC B) aabbcc C) AAbbCC D) aaBBcc E) AABbCC 292. Tripansoma spada u: A) zelene alge B) zelene bičaše C) korijenonošce D) truskovce E) praživotinje 293. Novi oblici gena. Ribonukelinsku kiselinu prepoznajemo po prisustvu: A) citozina B) gvanina C) adenina D) pentoze E) uracila 296. Izrazito polarna molekula našeg tijela je: A) kolesterol B) mast C) steroidni hormon D) estrogen E) voda 294. Golgijevo tijelo nalazimo u: A) mitohondrijima B) citoplazmi C) ribosomima D) jezgri E) jezgrici 291. nastaju: A) prevođenjem genske upute B) prepisivanjem genske upute C) udvostručavanjem D) mutiranjem E) čitanjem 298.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ 289. aleli. Omjer od 3/4 graška duge stabljike prema 1/4 biljaka kratke stabljike dobivamo križanjem: A) dviju biljaka kratke stabljike B) dviju biljaka dugih stabljika (homozigotnih) C) dviju biljaka dugih stabljika (heterozigotnih) D) kratkih s dugim biljkama (homozigotnih) E) kratkih s dugim biljkama (heterozigotnih) 299.

Mendela B) T. Ljudski kromosomi 1. Watsona E) A. Polifenilalanin nastavit će u toku sinteze bjelančevine na kalupu sljedeće ribonukleinske kiseline: A) AAA B) UUU AAA 187 . Dvije različite vrste gameta dati će jedinka genotipa: A) AA B) aa C) AaBB D) AaBb E) AaBbCc 301. Broj jedinki neke vrste ne određenom prostoru predstavlja njenu: A) biomasu B) populaciju C) gensku snagu D) konkurenciju E) simbiozu 304. Pojam genetič ka karta potječe iz znanstvenog rada: A) G._________________________________________________________________________ Pitanja 300. Kodoni predstavljaju trojke nukleotida u: A) DNK B) virusnoj RNK C) ribosomskoj RNK D) transportnoj RNK E) glasničkoj RNK 309. Što se od navedenog nalazi i u bakterija i u modrozelenih algi ? A) ribosomi B) kloroplasti C) mitohondriji D) lizosomi E) ništa od navedenog 306. Ostatak repića u novorođenčeta predstavlja: A) relikt B) mutaciju C) rudiment D) endem E) edem 308. Atavizmima se najintenzivnije bavi: A) genetika B) pedijatrija C) kirurgija D) citologija E) evolucija 307. Fiziološka je otopina dakle prema eritrocitima: A) monotonična B) izotonična C) hipertonična D) hipodonična E) atonična 303. Humana genetika raspoređuje gene čovjeka u genetičke karte. Hersheya 305.9% NaCl i eritrociti čovjeka u njoj ostaju neoštećeni. Cricka D) J. Fiziološka otopina sadrži 0. Poliuridilnu kiselinu predočuje: A) uridin-uridin B) AAA AAA C) UUA UUA D) AUG AUG E) poliU 310.2 i 3 čine u kariotipu skupinu: A) A B) B C) C D) D E) E 302. Morgana C) F.

Ekologija je nauka o: A) pojedinim vrstama životinja B) pojedinim vrstama biljaka C) pojedinim vrstama živih bića D) međusobnim odnosima živih bića i njihove okoline E) postanku vrsta u prirodi 314. Histologija je nauka o: A) biljkama B) životinjama C) funkciji pojedinih organa D) biljnim i životinjskim tkivima E) međusobnom djelovanju tkiva i organa 313. Pirimidinske baze su: A) dušične baze B) citozin C) timin D) uracil E) svi su odgovori točni 318. Glicin i alanin spadaju u: A) nukleinske kiseline B) nukleotide C) dušikove baze D) peptide E) aminokiseline 317.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ C) TTT UUU AAA D) UUU UUU UUU UUU E) AAA AAA AAA AAA AAA 311. Vezanim genima nazivamo gene koji se nalaze: A) na istom kromosomu a određuju različita svojstva B) na istom kromosomu a određuju ista svojstva C) na istom kromosomu bez obzira na svojstva koja određuju D) na različitim kromosomima a određuju ista svojstva E) nijedan odgovor nije točan 321. Genetska uputa u molekule DNK za ugradnju aminokiseline fenilalanin u peptidni lanac glasi: A) UUU B) TTT C) AAA D) CCC E) GGG 312. Koje od navedenih križanja nije test križanje ? A) AaBb x aabb B) Aabb x aaBb C) Aa x aa D) AA x Aa E) Bb x bb 320. Hipoglikemija je: A) nedostatak minerala u organizmu B) pomanjkanje tekućine u organizmu C) smanjena razina glukoze u krvi D) nedostatak vitamina C E) nedostatak vitamina D 315. Steroidi su: A) posebna skupina lipida B) spolni hormoni C) hormoni kore nadbubrežne žlijezde D) neki vitamini E) svi su odgovori točni 316. Koji od navedenih primjera nije recesivan samo za jedan par alela ? A) aaBb B) AAbb C) aaBB D) Aabb 188 . Koji je od spomenutih primjera dominantan fenotip ? A) Aa B) AA C) AaBb D) AABb E) svi navedeni primjeri 319.

Nije točno da modrozelene alge imaju: A) klorofil B) kloroplaste C) nukleoid D) jednostavnu steljku E) posebnu boju 328. Ako križamo AaBb x aabb a geni su vezani i nema krosingovera. Bakteriofagi nemaju: A) DNK B) proteinsku ovojnicu C) “glavice” D) “repa” E) membrane 332. Koji je haploidan broj kromosoma u vinske mušice? A) 1 B) 2 C) 3 D) 4 E) 5 327. Cijepanje osobina se javlja: A) u parentalnoj generaciji B) u F1 generaciji C) u F2 generaciji D) samo u test križanju E) ništa od navedenog 330. koliko je njihove djece slijepo za boje? A) sva muška djeca B) sva ženska djeca C) 50% muške djece D) 50% ženske djece E) nijedan odgovor nije točan 326. Za I mejotičku diobu nije točno da dolazi do: A) odvajanja homolognih kromosoma B) odvajanja kromatida svakog homologa C) konjugacije homolognih kromosoma D) spiralizacije kromosoma E) nestajanja jezgrine ovojnice 331._________________________________________________________________________ Pitanja E) aabb 322. Koje nasljeđivanje nazivamo spolno vezanim? A) koje je vezano za jedan spol B) nasljeđivanje gena na X kromosomu C) nasljeđivanje gena na Y kromosomu D) nasljeđivanje gena na spolnim kromosomima E) svi su odgovori točni 325. Što je embrioblast: A) svaka skupina embrinalnih stanica B) skupina embrionalnih stanica u sisavaca nakon brazdanja C) isto što i trofoblast D) odgovara zametnim listićima E) sudjeluje u formiranju posteljice 189 . koji omjer dobivamo kod potomstva? A) 1 : 1 B) 1 : 1 : 1 : 1 C) 9 : 3 : 3 : 1 D) 3 : 1 E) 1 : 2 : 1 324. Koji od navedenih genotipova može biti iz P (parentalne ili roditeljske) generacije? A) Aabb B) AABb C) AAbb D) aaBb E) AaBB 329. Koji od navedenih omjera odgovara rezultatu test križanja ? A) 9 : 3 : 3 : 1 B) 1 : 1 : 1 : 1 C) 3 : 1 D) 1 : 2 : 1 E) niti jedan 323. Ako je majka slijepa za boje a otac nije.

Od mezoderma se razvijaju: A) sluznica probavila B) jetra C) gušterača D) mišići E) pluća 344. Neuron je: A) neurit B) akson C) dendrit D) živčana stanica E) živac 340. Za oksidaciju i redukciju molekula je značajno: A) oksidacijom se gube elektroni B) oksidacijom se prihvaćaju elektroni C) redukcijom se gube elektroni D) ishodište su im anoganski spojevi E) niti jedan odgovor nije točan 335. Bakterije imaju: A) jezgru B) jezgricu C) nukleoide D) plastide E) endoplazmatsku mrežicu 190 . DNK se nalazi u: A) kromosomima B) kloroplastima C) mitohondrijima D) bakterijama E) svi su odgovori točni 337. Kromosomi se nalaze u središtu stanice u: A) profazi B) metafazi C) anafazi D) telofazi E) mejozi 339. Jezgrica nema: A) bjelančevina B) rRNK C) DNK D) ribosomskih podjedinica E) ovojnice (membrane) 338. Fagocitoza spada u: A) enzimske reakcije B) endocitozu C) električni potencijal stanične membrane D) aktivni prijenos iona E) pasivni prijenos 336.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ 333. Blastoporus je: A) otvor na embrioblastu B) otvor na trofoblastu C) otvor na gastruli žabe D) šupljina blastule E) šupljina gastrule 343. Najtočniji odgovor za ATP je sljedeći: A) adenin i trifosfat B) adenozin i monofosfat C) adenozin i difosfat D) AMP+P E) adenin. Blastoderm je sloj stanica koji okružuje: A) embrioblast B) trofoblast C) blastocel D) celom E) pracrijevo 342. riboza i trifosfat 334. U koži se nalaze: A) opipna tjelešca B) živčani ogranci C) žlijezde lojnice D) masne stanice E) svi su odgovori točni 341.

Koji je odgovarajući antikodon na tRNK? A) GAC-UAG B) GTC-TAG C) CAC-UAC D) GAG-TAC E) GUC-UAC 353. Mitohondriji su organele: A) samo životinjskih stanica B) samo biljnih stanica C) važne za sintezu proteina D) važne za sintezu nukleinskih kiselina E) važne kao energetske centrale 355. Koja gameta pripada genotipu AaBb? A) A B) a C) B D) b E) Ab 350. Slijed baza UUU odgovara sljedećoj aminokiselini: A) tirozinu B) serinu C) fenilalaninu D) asparginu E) metioninu 352. Test križanje je sljedeće: A) aaBb x Aabb B) aaBB x AAbb C) AaBb x AaBb D) aabb x AABB E) AaBb x AABB 349. Koja od spomenutih zigota nije homozigota? A) aaBB B) AAbb C) aabb D) AABB E) AaBb 347. u anafazi I mejoze: A) nastaju 2 nove jezgre 191 . Morgan je nazvao crossing-overom: A) razmjenu dijelova kromosoma i gena B) razdvajanje homolognih kromosoma C) razdvajanje kromatida pojedinih kromosoma D) pojavu kod nevezanih gena E) niti jedan odgovor nije točan 351. Kodon na gRNK je CUG-AUC. Drugi Mendelov zakon nasljeđivanja je primjenjen u: A) svakom križanju B) intermedijarnom križanju C) monohibridnom križanju D) slobodnoj i nezavisnoj kombinaciji E) križanju s vezanim genima 348._________________________________________________________________________ Pitanja 345. Kromatin se nalazi u: A) profazi B) metafazi C) anafazi D) interfazi E) telofazi 357. Lizosomi: A) obavijeni su dvostrukom opnom B) nemaju membrane C) sadrže enzime D) sadrže mitohondrije E) niti jedan odgovor nije točan 354. Koji od spomenutih organizama spadaju u prokarite: A) jednostanične alge B) neke gljive C) praživotinje D) virusi E) modrozelene alge 346. Za jezgricu je značajno: A) nije obavijena opnom B) ima RNK C) ima DNK D) sintetizira rRNK E) svi su odgovori točni 356.

svaki sa svoje dvije kromatide. Tilakoide i grana pripadaju: A) vakuolama biljnih stanica B) mitohondrijima C) kloroplastima D) kromosomima E) centrosomima 366. Spermatogeneza i oogeneza odgovaraju: A) diobi citoplazme B) mejotičkoj diobi C) mitotičkoj diobi D) diobi kromosoma E) niti jedan odgovor nije točan 359. U biologiju spada: A) fiziologija B) taksonomija C) paleontologija D) zoologija E) svi su odgovori točni 367. Žlijezde s unutrašnjim izlučivanjem su: A) hipofiza B) štitnjača C) nusštitne žlijezde D) nadbubrežne žlijezde E) svi su odgovori točni 192 . Omjer genotipova i fenotipova 1:1 dobijamo križanjem roditelja: A) Bb x bb B) Bb x Bb C) Bb x BB D) BB x bb E) bb x bb 364.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ B) nastaje haploidan broj kromosoma C) odvajaju se homologni kromosomi D) odvajaju se kromatide E) kromosomi se ne vide 358. Koji od navedenih roditeljskih parova daje potomstvo u omjeru fenotipova 3:1 za jedno od spomenutih svojstava: A) AaBb x AAbb B) AaBb x aaBB C) AaBb x aabb D) AABB x aabb E) AaBB x Aabb 362. Nije točno da od ektoderma nastaju: A) koža B) osjetila C) živčani sustav D) epitel E) hrskavica 361. Geni A i b nalaze se na različitim mjestima istog kromosoma pa govorimo o: A) monohibridnom nasljeđivanju B) intermedijarnom nasljeđivanju C) slobodnoj kombinaciji D) vezanim genima E) spolno vezanom nasljeđivanju 363. nalazimo u: A) telofazi I B) interfazi C) profazi D) metafazi I E) telofazi II 360. Haploidan broj kromosoma. Nukleoid je: A) spolni kromatin B) jezgra biljnih stanica C) DNK u jednostaničnim organizmima D) organela u citoplazmi E) DNK u bakterija 365. Prijelaz vode kroz membranu zove se: A) difuzija B) osmoza C) dijaliza D) aktivan prijelaz E) nijedan odgovor nije točan 368.

Hrapavi endoplazmatski retikulum najviše je razvijen u stanicama: A) embrionalnim B) tumora C) koje sintetiziraju mnogo bjelančevina D) živčanim E) koje sintetiziraju mnogo ugljikohidrata 379. Blastoporus je otvor koji vodi u: A) arhenteron B) blastocel C) sekundarnu tjelesnu šupljinu D) amnionsku tekućinu E) blastocistu 372. Životinjski virusi imaju od genetskog materijala: A) samo DNK B) RNK ili DNK C) samo RNK D) proteine E) polisaharide 375. Ektoderm nastaje: A) u unutrašnjosti gastrule B) na površini gastrule C) na animalnom polu gastrule D) oko blastocela E) oko arhenterona 373. Razgradnja glukoze do alkohola i CO2 zove se: A) glikoliza B) fosforilacija C) redukcija CO2 193 . Nakupine hidrolitičkih enzima nalaze se u: A) jezgri B) jezgrici C) kromatinu D) lizosomima E) ribosomima 380. U profazi I mejotičke diobe odvija se: A) smještaj kromosoma u sredini stanice B) konjugacija kromosoma C) odvajanje homolognih kromosoma D) odvajanje kromatida E) isto kao u mitozi 370. Trofoblast je sloj stanica koji: A) okružuje zigotu B) okružuje gastrulu C) okružuje embrioblast D) se razvija u amnion E) se razvija u alantois 374._________________________________________________________________________ Pitanja 369. Rezultat križanja je omjer fenotipova 9:3:3:1. Na polovima diobenog vretena nalaze se: A) ribosomi B) lizosomi C) centrosomi D) Golgijeva tijela E) nukleoidi 378. Blastoderm je sloj embrionalnih stanica koji se nalazi: A) oko blastoporusa B) oko blastocela C) na vegetativnom polu blastule D) oko trofoblasta E) oko embrioblasta 371. Nasljeđivanje vezano za spol prenosi se: A) izravno s oca na sina B) izravno s oca na kći C) s majke samo na sina D) s majke samo na kći E) na potomstvo jednako s oca i majke 377. Koji su genotipovi roditelja? A) aabB x AABb B) AABB x aabb C) AaBb x AaBb D) AaBB x AABb E) AaBb x aabb 376.

Najstariji ostaci prvih hominida pripadaju: A) australopitekusu B) ramapitekusu C) neandertalcu 194 . Primarna organska produkcija je proizvodnja: A) autotrofnih biljaka B) heterotrofnih biljaka C) heterotrofnih životinja D) heterotrofnih bakterija E) dušikovih bakterija 390. Koji je ekosustav najproduktivniji u proizvodnji organskog ugljika? A) stepa B) obrađena površina C) šuma D) jezero s tvrdom vodom E) jezero s mekom vodom 392. Periodičke sezonske promjene organizama zovu se: A) sukcesije B) fenološke pojave C) biotičke pojave D) ekološke valencije E) vegetativne promjene 387. Do oplodnje jajne stanice sisavaca dolazi u: A) vagini B) maternici C) jajovodu D) trbušnoj šupljini E) jajniku 383. Zigota je: A) jajna prastanica B) spermijska prastanica C) neoplođeno jaje D) oplođeno jaje E) partenogenetski aktivirano jaje 384. U tundri se uglavnom nalaze: A) crnogorično drveće B) listopladno drveće C) travnjaci D) papratnjače E) mahovine i lišajevi 385.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ D) fermentacija ili vrenje E) Krebsov ciklus 381. Oksidacijski proces: A) u kojem neka molekula prima elektrone B) u kojem neka molekula gubi elektrone C) uzajamnog primanja i gubitka elektrona D) koji se događa samo za vrijeme svjetlosnih reakcija fotosinteze E) koji se događa samo u mitohondrijima 382. Prostor na kojemu je raspoređena neka vrsta organizama je: A) biom B) relikt C) areal D) vegetacija E) endem 388. Važni razlagači u ekosistemima su: A) mesojedi B) stonoge i kukci C) zelene biljke D) biljojedi E) heterotrofne bakterije 386. Vrsta ograničena na uže područje je: A) relikt B) endem C) plankton D) nekton E) rudiment 391. Na prvom mjestu hranidbenog lanca u biocenozi su: A) saprofagi B) fitofagi C) zoofagi D) heterofagi E) autotrofi 389.

Biološki indikatori zagađenja okoliša su: A) virusi i bakterije B) bakterije i modrozelene alge C) bičaši i zelene alge D) gljive i mahovine E) lišajevi i borovi 394. Dječja paraliza (polio) uzrokovana je: A) virusom B) bakterijom C) kokima D) bacilima E) spirilima 401. Fenotip je genetički izraz koji označuje: A) oblik i boju organizma B) strukturu i funkciju organizma C) “miješanje” očevih i majčinih gena D) rezultat uzajamnog djelovanja okoliša i genotipa E) kakav je genotip 398. Antropologija pručava ponajprije: A) antropomorfne majmune B) australopitekusa C) neandertalce 195 . Trajne oblike bakterija zovemo: A) prokariot B) nukleoid C) spora D) viroid E) prion 402. U sastav kože ne ulaze stanice: A) žlijezda znojnica B) žlijezda lojnica C) dlake D) masnog tkiva E) Bowmanove čahure 400._________________________________________________________________________ Pitanja D) javanskom pračovjeku E) krapinskom pračovjeku 393. Mutacije gena su uvijek: A) spontane mutacije B) inducirane mutacije C) nasljedne promjene gena D) dominantne E) na istom kromosomu 399. Trajnu promjenu genske upute zovemo: A) varijacija B) mutacija C) rekombinacija D) transformacija E) degenerirana šifra 404. Zelene biljke u morskoj vodi dopiru prosječno do dubine: A) 100 m B) 200 m C) 300 m D) 400 m E) 450 m 395. Kuga (crna smrt) uzrokovana je: A) bakterijom B) virusom C) viroidom D) prionom E) bakteriofagom 403. Escherichia coli: A) koristi se u genetskom inženjerstvu B) može proizvoditi inzulin C) je crijevna bakterija D) može se naći u mokraći E) svi su odgovori točni 397. Bakteriofagi pripadaju: A) biljnim virusima B) primitivnim jednostaničnim biljkama C) primitivnim jednostaničnim životinjama D) pneumokokima E) ni jednoj navedenoj skupini 396.

Morgana C) F.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ D) pračovjeka Homo erectus E) čovjeka 405. Pojam genetička karta potječe iz znanstvenog rada: A) G. Cricka D) J. Kultura stanica i tkiva: A) su izolirane stanice i tkiva uzgajane u strerilnim uvjetima B) su stanice i tkiva uzgajane izvan organizma C) je rast stanica i tkiva na posebnim hranilištima D) je uzgoj stanica i tkiva u različitim eksperimentalnim uvjetima E) svi su odgovori točni 407. Najznačajniju sekundarnu organsku produkciju ostvaruju: A) virusi B) bakterije C) protisti D) biljke E) životinje 415. Bakterije imaju: A) jezgru B) jezgricu C) nukleoide D) plastide E) endoplazmatski retikulum 409. Koji od spomenutih organizama spadaju u prokariote? A) jednostanične alge B) neke gljive C) praživotinje D) virusi E) modrozelene alge 410. Mendela B) T. Biljojedi kao članovi ishrane svake biocenoze spadaju u: A) razlagače B) autotrofne organizma C) heterotrofne organizme D) saprofage E) karnivore 414. Populacija različitih biljnih i životinjskih vrsta čine složeniju cjelinu: A) biomasu B) biocenozu C) biocenologiju D) biotop E) biosferu 413. Prijelaz vode kroz membranu zove se: A) difuzija B) osmoza C) dijaliza D) aktivan prijelaz E) olakšana difuzija 412. Životinjski virusi se razmnožavaju: A) konjugacijom B) diobom C) pomoću DNA D) pomoću RNA ili DNA E) cijepanjem 408. Humana genetika raspoređuje gene čovjeka u genetičke karte. Hersheya 406. Watsona E) A. Dvostruku membranu imaju: A) ribosomi B) lizosomi C) centrioli D) Golgijevo tijelo E) mitohondriji 411. Na dnu hranidbene piramide nalaze se: A) konzumenti B) fitofagi C) zoofagi D) karnivora E) autotrofni proizvođači 196 .

Oplođeno jaje sisavca implantira se u: A) sluznicu maternice B) tijelo maaternice C) sluznicu jajovoda D) cerviks uterusa 422. Među stanicama odrasla čovjeka ne dijele se: A) spermatogonije B) neuroni C) oogonije D) primarne spermatocite E) sekundarne spermatocite 423. Opseg prostorne rasprostranjenosti ljudske vrste zovemo njegovim: A) biomom B) ekosistemom C) biocenozom D) arealom E) biotopom 426. Mitohondriji: A) su energetske centrale stanica B) su glavni proizvođači ATP C) imaju dvostruku ovojnicu D) sadrže DNA E) sve su prethodne tvrdnje točne 420. Plazma je dakle prema urinu: A) atonična 197 . U zdrava čovjeka osmotski tlak urina može biti 2 do 3 puta veći od osmotskog tlaka plazme._________________________________________________________________________ Pitanja E) trbušnu šupljinu 416. Urin je dakle prema plazmi: A) izotoničan B) monotoničan C) hipertoničan D) hipotoničan E) hipertrofičan 424. Koje su bakterije uzročnici upale pluća? A) streptokoki B) spirili C) stafilokoki D) diplokoki E) vibrioni 418. U zdrava čovjeka osmotski tlak urina može biti 2 do 3 puta veći od osmotskog tlaka plazme. Stanično disanje: A) nazivamo respiracijom B) razgradnjom ugljikohidrata oslobađa energiju C) počinje glikolizom D) nastavlja se Krebsovim ciklusom E) sve su prethodne tvrdnje točne 419. Limfa se razlikuje od krvi po tome što nema: A) plazme B) leukocite C) trombocite D) eritrocite E) krvne pločice 421. U ishrani biocenoze na prvom su mjestu hranidbenog lanca: A) saprofagi B) heterotrofne bakterije C) autotrofni proizvođači D) fitofagi E) zoofagi 417. Porast ljudske populacije određen je: A) natalitetom B) morbiditetom C) genskom snagom D) biološkim faktorima (isključivo) E) fizičkim faktorima (isključivo) 425. Tuberkulozu i šarlah uzrokuju: A) amebe B) protoza C) fagi D) virusi E) bakterije 427.

Posebni zoološki rezervat je: A) otok Mljet B) Risnjak C) Plitvička jezera D) Ćorkova uvala E) Kopački rit 436. Bentosku biocenozu čine: A) životinje koje se pomoću mišića brzo kreću u vodi B) svi organizmi koji žive u vodi stajaćici C) svi organizmi koji žive uz morsku obalu D) organizmi koji žive na morskom dnu E) organizmi koji lebde u slojevima morske vode 430. Ekosustav čine: A) ekološka valencija B) biotop i biocenoza zajedno C) populacija D) abiotički učinci E) biotički učinci 432. Rasprostranjenost većine ljudse populacije na Zemlji ovisi o: A) vegetaciji tog područja B) bentoskim biocenozama C) planktonu D) nektonu E) reliktima 429. U heterotrofne organizme ne spadaju: A) alge B) gljive C) člankonošci D) spužve E) jednostanične životinje 435. Jezgre nemaju: A) primitivne životnjske stanice B) neuroni C) stanice glatkog mišića D) eritrociti sisavaca E) poprečno prugasti mišić 434. Prema načinu ishrane bakterije mogu biti: A) autotrofne 198 .ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ B) monotonična C) hipertonična D) hipotonična E) izotonična 428. Virusi mogu uzrokovati: A) tuberkulozu B) aterosklerozu C) dječju paralizu D) sifilis E) tetanus 437. Krapinski pračovjek: A) živio je prije milijun godina B) imao je istaknutu bradu C) poznavao je vatru D) pripadao je tipu kromanjonca E) pripadao je tipu australopitekusa 431. Bakteriofagi su sastavljeni od: A) citoplazme i membrane B) jezgre i ovojnice C) mitohondrija i proteina D) glavice i repa E) prokariontskih stanica 438. Koki su: A) virusi B) bakterije C) eukariotske stanice D) animalne stanice E) štapićastog oblika 439. Koje tvrdnje odgovaraju krapinskog pračovjeka? A) potječe iz pleistocena B) kromanjonac C) visine do 160 cm D) satar 300 – 500 000 godina E) ima izraženu bradu opisu 433.

dana E) visokim LH od 1. Biljni virusi: A) razaraju biljnu stijenku B) svi se prenose kukcima C) genetski materijal je RNA D) slični su bakterijskim virusima E) razmnožavaju se diobom 448. Znanstveno ime (binarna nomenklatura) suvremenog čovjeka: A) glasi Hominidae B) glasi Homo erectus C) glasi Homo sapiens D) zahvaljujemo radu D. do 28. Vitamin D: A) spada u skupinu ugljikohidrata B) spada u skupinu nukleinskih kiselina C) važan je za razvitak crvrenih i bijelih krvnih stanica D) važan je za razvitak kostiju i zubi E) važan je za razvitak spolnih žlijezda 443. Modifikacije: A) spadaju u mutacije B) su mutacije građe kromosoma C) su mutacije gena D) su nasljedne E) nisu nasljedne 199 . do 14. Eukariontske stanice uključuju: A) koke B) bacile C) vibrione D) sve bakterijske stanice E) biljne stanice 441. do 14.G. Iz srednjeg kvartara – pleistocena – potječe A) kromanjonski čovjek B) neandertalski pračovjek C) australopitekus D) driopitekus E) propliopitekus 446. Među “živim fosilima” su poznati: A) ihtiostega B) kinesko drvo ginkgo C) mamut D) praptica E) pteridosperme 447. Bujnost života na kopnu ovisna je uglavnom o: A) biotičkim faktorima B) svim abiotičkim faktorima C) povoljnoj temperaturi D) raspoloživosti dušika E) raspoloživosti ugljika 450. Krambergera E) zahvaljujemo radu Ch. Darwina 451. Endocitoza je pojava vezana uz sljedeće organele u stanici: A) mitohondrije B) lizosome C) jezgricu D) ribosome E) endoplazmatsku mrežicu 442. dana D) visokim LTH od 1. dana 445. Najveće količine kisika u atmosferi potrebnog za disanje potječu: A) od vulkanske aktivnosti B) od aktivnosti razlagača C) od fotosintetske aktivnosti D) od nektona E) od bentosa 449. Menstrualni ciklus karakteriziran je: A) visokim progesteronom u preovulacijskoj fazi B) visokim progesteronom u postovulacijskoj fazi C) visokim progesteronom od 1._________________________________________________________________________ Pitanja B) mesojedi C) biljojedi D) zoofagi E) fitofagi 440.

a različitog postanka B) istog postanka. Kod alga kremenjašica kao produkt asimilacije nastaje: 200 . Prijelazni oblici između vodozemaca i gmazova su: A) štitoglavci (Seymouria) B) resoperke (Crossoptergia) C) zvijerogušteri (Theriodontia) D) gmaz Ichtiosaurus 463. a različiti po funkciji C) istog postanka i istih funkcija D) različitog postanka i različitih funkcija 464. Koji od pojmova su krivo spareni? A) bakterija – nukleoid B) protocita – organeli C) eucita – jezgra D) eucita – citoskelet 454. U razvojnom putu mahovine spolna generacija su A) protonema s mahovinom B) mahovina sa sporangijem C) sporogon D) protalij 459. Amiloplasti su A) leukoplasti koji sadrže škrob B) proplastidi koji sadrže proteine C) kloroplasti koji sadrže škrob D) leukoplasti koji sadrže aminokiseline 457. Homologni organi su: A) isti po funkciji. Endocitoza je A) aktivan prijenos kroz membranu B) stanično “proždiranje” velikih čestica C) unošenje molekula direktno u citosol D) unošenje iona u stanicu 456. Uobičajeni predstavnici planktona su: A) algašice B) bentonski organizmi C) bičaši i kremenjašice D) zelene alge 466. Rudimentarni organ nije: A) crvuljak slijepog crijeva B) trtica C) palčana kost D) zub mudrost 465. Sorusi su A) muški spolni organ mahovine B) nakupine sporangija na listu paprati C) diploidna generacija mahovina D) stabalce mahovine s muškim rasplodnim organima 460. Plazmidi su: A) specifični virusi B) vrste mikroorganizama C) hibridne molekule DNA D) hibridne molekule RNA E) male čestice DNA 453.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ 452. Saprofiti su organizmi koji A) obitavaju u drugim organizmima B) se razmnožavaju samo pomoću spora C) žive na štetu domadara D) upijaju hranu iz mrtvih organizama 455. Lišaj je osobit oblik simbioze između A) gljive i alge B) gljive i bakterije C) alge i bakterije D) bakterije i korijena lepirnjača 458. Makrosporangij odgovara A) plodnom listu B) zametnoj vrećici C) sjemenom zametku D) mikrospori 461. Točna tvrdnja je A) dvosupnice imaju čupavo korijenje B) stabljika dvosupnica raste u debljinu pomoću kambija C) glavne žile u listu jednosupnica su razgranjene D) glavne žile u listu dvosupnica su usporedne 462.

dolazi do: A) osmoze 201 . Centromera je A) mjesto na kromosomu za koje se vežu ili diobenog vretena B) sekundarno suženje kromosoma C) satelitski kromosom D) dio centrosoma 476. Predstavnici porodice ruža imaju A) cvjetove s peteročlanim ocvijećem i mnogo prašnika B) devet prašnika i plod mahunu C) četiri lapa i četiri latice D) cvijetove skupljene u rese 472. populacija. atomi 478. molekule. stanica. organizam. makromolekule. Sve biljne zajednice nekog područja čine A) floru B) vegetaciju C) biocenozu D) biotop 474. makromolekule. organizam. ekosustav. atomi E) biocenoza. stanica. molekule. ekosustav D) ekosustav. ekosustav B) atomi. Steljka je: A) rasplodni organ alge B) tijelo alge C) mala stabljika D) embrionalni organ biljke 468._________________________________________________________________________ Pitanja A) škrob B) bjelančevine C) ulje D) kremen 467. Ako se biljna stanica nalazi u hipertoničnoj otopini. makromolekule. ekosustav C) atomi. makromolekule. Autosomi su A) svi kromosomi nekog organizma B) spolni kromosomi C) svi kromosomi nekog organizma osim x i y kromosoma D) samo kromosimi vinske mušice 475. biocenoza. makromolekule. populacija. organizam. populacija. biocenoza. stanica. molekule. Točan redoslijed živih sustava u organizacijskoj ljestvici (od najvišeg prema najnižem) je: A) atomi. stanica. Plod komušku imaju A) žabnjaci B) ruže C) lepirnjače D) krstašice 473. Koji od pojmova su krivo spareni? A) plodni list – listić s makrosporangijem B) sjemeni zametak – makrosporangij C) peludovo zrno – mikrospora D) peludnica – makrosporangij 471. Protalij je A) razvojni stadij paprati B) razvojni stadij mahovina C) sporofit D) nespolna generacija 469. populacija. organizam. Svjetlosnim mikroskopom ne vidimo: A) pseudopodije amebe B) staničnu jezgru C) plastide D) trepetljike papučice E) uzročnika herpesa 477. molekule. organizam. populacija. Smatramo da su se sjemenjače (cvijetnjače) razvile od: A) vodenih biljka koje su prešle na kopno B) mnogostaničnih alga C) cikadina D) izumrlih heterospornih papratnjača 470. biocenoza. molekule. stanica.

Iz oplođene jajne stanice u kritosjemenjača razvija se: A) sekundarni endosperm B) embrionska vreća C) klica 202 . Koja od navedenih biljaka pripada porodici trava? A) vladac B) bijeli luk C) riža D) preslica E) divlji kupus 485. Florni elementi nekog područja su: A) biljke rasprostranjene samo u nekom većem području i značajne za floru tog područja B) sve biljne vrste nekog područja bez obzira na površinu koju pokrivaju C) biljne zajednice nekog područja D) biljke kojima je areal ograničen na usko područje E) svi odgovori su točni 487. U izgradnji sedrenih naslaga na jezerima sudjeluju: A) lišaji i gljive B) dvosupnice i jednosupnice C) paprati D) alge kremenjašice E) modrozelene alge i mahovine 482. Prve kopnene zelene biljke bile su A) mahovine B) psilofiti C) pteridosperme D) lišaji E) papratnjače 483. a nemaju plod D) od sjemenog zametka nastaje plod E) za razmnožavanje im je potrebna voda 481. a to znači da: A) sve tjelesne stanice žene imaju po jedan x kromosom B) sve tjelesne stanice muškarca imaju po jedan y kromosom C) 50 % spermija sadrži x kromosom D) 50 % jajnih stanica sadrži x kromosom E) svi spermiji imaju y kromosom 489. “Crossing-over” se događa u mejozi za vrijeme: A) profaze I B) anafaze I C) interfaze D) profaze II E) telofaze II 488. Reliktni endem je: A) krški runolist B) degenija C) ilirska perunika D) dubrovačka zečina E) hrvatska sibireja 484. Spol čovjeka određuju spolni kromosomi x i y. Ulogu korijena kod mahovina vrši: A) protonema B) hifa C) rizom D) rizoid E) grebenica 486. Za kritosjemenjače je karakteristično: A) sjemeni zameci smješteni su otovreno na plodnim listovima B) sjemeni zameci su zatvoreni u plodnici C) imaju plodnicu.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ B) plazmolize C) dijalize D) deplazmolize E) difuzije 479. Spolna generacija kod papratnjača A) razvijenija je od sporofita B) protalij je diploidan C) na protaliju se nalazi arhegonij i antreridij D) je sorus E) spermatozoidi nastaju u arhegoniju 480.

Ostatke kukovlja u kita ubrajamo u: A) atavizme B) zakržaljale rudimentarne organe C) prijelazne oblike D) prilagodbe na život u vodi E) ništa od navedenog nije točno 491. Vegetacija je: A) popis životinjskih vrsta nekog područja B) skup biljnih zajednica nekog područja C) popis biljnih vrsta nekog područja D) skup endemičnih biljaka nekog područja E) flora i fauna nekog područja 498. Najjednostavniji virusi izgrađeni su od: A) lipida B) proteina i nukleinske kiseline C) proteina i masti D) lipida i organskih kationa E) lipida i nukleinskih kiselina 496. Fototropno svijanje klice uzrokovano je: A) djelovanjem sile teže 203 . Bakterije sadrže: A) DNA i RNA B) samo DNA C) nekad DNA. nekad RNA D) samo dvolančanu RNA E) samo RNA 497. a nije zastupljen u biljnoj stanici je: A) jezgrica B) centriol C) vakuola D) mitohondrij E) kloroplast 499. građeni su od: A) proteina B) RNA i proteina C) RNA D) DNA E) DNA i proteina 495. Organel prisutan u animalnoj stanici. Najvažniji činilac u postanku vrsta je: A) genska snaga B) mutacija C) divergencija D) prekobrojno potomstvo E) varijabilnost 492._________________________________________________________________________ Pitanja D) peludna mješinica E) plodnica 490. Rast biljke u debljinu ostvaruje se diobom stanica A) epiderme B) parenhima C) felogena D) floema E) kambija 493. RNA može biti izvor genetičkih informacija kod: A) mikoplazma B) priona C) bakterija D) virusa E) alga 494. Uzročnici biljnih bolesti. Katabolizam je: A) podražaj koji izaziva osjet boli B) reakcija u kojoj se oslobađaju kationi C) razgradnja većih molekula u manje jedinice D) sinonim za stanično disanje E) sintetički proces 501. viroidi. Svjetlosna energija apsorbirana tijekom fotosinteze pohranjuje se u: A) klorofilu B) karotenoidima C) ATP i ugljikohidratima D) NADPH2 E) vodi 500.

Koacervatne kapljice su: A) koloidne kapljice s opnom koje nastaju otapanjem nekih organskih spojeva u vodi uz dodatak različitih soli B) agregati aminokiselina nastali suhim zagrijavanjem C) prve žive stanice D) kapljice lipida i proteina E) koloidne kapljice s čvrstom membranom Pitanja s dva točna odgovora 509. Kriptorhizam je: A) prilagodba biljaka na hladna staništa B) razvoj adventivnog korjenja u kritosjemenjača C) zadržavanje sjemenika u trbušnoj šupljini D) vrsta hemofilije E) suženje porođajnog kanala 504. Nitrifikacijske bakterije su kemosintetske bakterije koje: A) razgrađuju organske spojeve uginulih organizama B) su uzročnici brojnih bolesti C) dobivaju energiju oksidacijom organskih spojeva D) oksidiraju amonijak u nitrit E) vežu dušik iz zraka 503. Od polisaharida u životinjskim organizmima dolazi: A) škrob B) fruktoza C) glukoza D) glikogen E) laktoza 506. Bulbili su: A) rasplodni pupovi B) spore gljiva C) mlade lukovice D) organeli u biljnim stanicama E) vrste gomolja 505. Pubertet započinje lučenjem neurosekretornih tvari i hormona u: A) štitnjači B) hipotalamusu C) adenohipofizi D) nadbubrežnoj žlijezdi E) neurohipofizi 507.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ B) razlikama u sadržaju škroba između gornjeg i donjeg dijela C) prejakim osvjetljavanjem D) promjenom turgora na osvjetljenoj strani E) razlikama u sadržaju hormona između osvjetljene i zasjenjene strane 502. Centri za regulaciju tjelesne temperature nalaze se u: A) termoreceptorima kože B) hipotaalamusu C) stijenkama krvnih žila D) kori velikog mozga E) štitnjači 508. Koje se od navedenih tvrdnji odnose na populaciju? A) sastoji se od jedinki različitih vrsta koje naseljavaju isto područje 204 . Olistala biljka paprati je: A) diploidna generacija B) haploidna generacija C) gametofit D) sporofit E) sporangij 510. Zaštićene vrste našeg područja su: A) vidra B) podbjel C) potajnica D) obična kockavica E) bizamski štakor 512.

Koja je od navedenih stanica agranularni leukocit? A) monocit B) trombocit C) eozinofil D) neutrofil E) bazofil 518. Od navedenih endokrinih žlijezda samo su dvije s unutarnjim i vanjskim izlučivanjem A) gušterača B) štitna žlijezda C) spolna žlijezda D) nadbubrežna žlijezda E) hipofiza 514. Prema Haeckelovoj hipotezi o podrijetlu (metazoa) višestaničnih organizama. Ciklus limunske kiseline ili Krebsov ciklus je: A) prva faza disanja koja se odvija u citoplazmi B) proces u kojemu se iz 1 mola glukoze oslobodi energija 1254 kJ 205 . Probavne enzime ne izlučuje: A) želudac B) taanko crijevo C) jetra D) gušterača 520. Brzinu reakcije u stanici reguliraju sljedeći spojevi: A) ugljikovodici B) enzimi C) ugljikohidrati D) masti E) hormoni Pitanja s jednim točnim odgovorom 515. U ljudskom organizmu prvo se počmu probavljati: A) masti B) proteini C) škrob D) fosfolipidi E) nukleinske kiseline F) celuloza 522. Voda koju izlučujemo u mokraći potječe od: A) tekućine koju pijemo B) hrane koju jedemo C) metaboličkih procesa D) A+B E) A+B+C 521. Najproduktivniji ekosistem je: A) obradivo tlo B) listopadne šume C) jezero D) zapadni Atlantik 516. Pomoću albumina u krvi se može transportirati: A) željezo B) tiroksin C) vitamin C D) fibrin E) holesterol 519._________________________________________________________________________ Pitanja B) sastoji se od jedinki iste vrste koje su prostorno izolirane C) sastoji se od jedinki iste vrste koje nadeljavaju određeni prostor D) skup jedinki povezanih prehrambenim lancima E) skup jedinki čija je genetska osnova zajednička i u stalnoj je međusobnoj razmjeni 513. višestanične životinje razvile su se iz: A) bičaša B) volvoksa C) organizma koji se razvio udruživanjem većeg broja jednostaničnih bičaša D) trepetljikaša 517.

ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ C) dio aerobne respiracije u kojem se pirogrožđana kiselina razlaže u molekule ugljik(IV)-oksida i atome vodika D) dio anaerobne respiracije kojom se oslobađa 25 % energije pohranjeno u 1 molu glukoze E) proces koji oslobađa energiju iz produkata oksidativne fosforilacije 523. Homeotermni organizam je: A) morski ježinac B) aligator C) šaran D) šišmiš E) daždevnjak F) pingvin 531. a drugi hidrofoban Pitanja s dva točna odgovora 524. U oligomeria spadaju: A) trp B) peripatus C) zmijača D) volak 529. Genetska snaga ili genetska slučajnost: A) dolazi do izražaja u malim populacijama B) dominantni geni se brže šire C) recesivni geni se mogu izgubiti ili proširiti D) značajna je za veliki otvoren skup populacija 527. vodika. Koje su od navedenih tvrdnji točne: A) najslabiju moć regeneracije imaju primitivne životinje B) najslabiju moć regeneracije imaju odvedene životinje C) sposobnost regeneracije je manja u životinja na višem stupnju razvoja D) sposobnost regeneracije je manja u životinja na nižem stupnju razvoja 528. a na drugom kraju negativno nabijeni C) se povezuju s bjelančevinama koje ih pravilno orjentiraju D) su izgrađeni od ugljika. Zajedničko mahovinama i papratnjačama su: A) sporogoni B) spore C) anteridiji D) sorusi E) sorediji F) protaliji G) protoneme H) plazmodiji 530. kisika i fosfata E) je jedan kraj molekule hidrofilan. Većina vode koju biljka prima: A) cijepa se tijekom fotosinteze i služi kao izvor elektrona i vodika B) gubi se stomatalnom transpiracijom C) apsorbiraju stanice tijekom produžnog rasta D) ulazi u korijen iz tla osmozom E) ugrađuje se neposredno u organski materijal 525. Polumjesečasti zalisci nalaze se između: A) lijeve pretklijetke i klijetke 206 . Molekulu RNA čini različitom od molekule DNA: A) šećer riboza B) fosfat C) baza uracil D) baza timin E) ništa od navedenog nije točno 526. Lipidi u biološkim membranama čine dvosloj zato jer: A) su to molekule dipolna karaktera kao i voda B) su na jednom kraju pozitivno.

ima potpunu preobrazbu 3. koti žive mlade 4. Uz pojmove u gornjem stupcu na praznu crtu upiši broj iz donjeg stupca uz koji je naveden odgovarajući opis! A) __ oogeneza B) __ spermalna stanica C) __ speramtogeneza D) __ gametogeneza 1. A) __ kukurijek B) __ glog C) __ soja D) __ livadna kadulja E) __ uljana repica 1. A) __ kromanjonski čovjek B) __ ramapitekus C) __ australopitekus 1. povaljenica 3. Uz ime biljke u gornjem stupcu upiši broj koji je napisan uz naziv porodice kojoj određena biljka pripada. postanak spermija 2. Fotosinteza je proces 207 . 539. prodica krstašice 3. Uz nazive životinja u gornjem stupcu na praznu crtu upiši broj iz donjeg stupca uz koji je napisan način razmnožavanja. muška spolna stanica 4. prije 500 tisuća godina Pitanja kojima treba upisati odgovore 538. Pitanja s jednim točnim odgovorom 540. prije 30-40 tisuća godina 3. ima nepotpunu preobrazbu 535. A) __ magnolija B) __ lukovičasta režuha C) __ perunika D) __ begonija 1. Izlučivanje mlijeka prilikom dojenja potiče: A) estrogen B) prolaktin C) progesteron D) oksitocin Pitanja s povezivanjem odgovora 533. Populaciju čine jedinke iste vrste koje žive na istom prostoru i međusobno su povezane __________. prodica žabnjaka 4. postanak jajnih stanica 534. prije 15 milijuna godina 2. Uz naziv čovjekovih predaka u gornjem stupcu upiši broj ispred navedenog vremena kada su živjeli. prodica usnjače 536. rizom 2. prodica ruža 2. list 4. Uz ime biljke u gornjem stupcu upiši broj koji je napisan ispred dijela kojim se ta biljka vegetativno razmnožava._________________________________________________________________________ Pitanja B) lijeve klijetke i aorte C) desne pretklijetke i klijetke D) desne klijetke i plućne arterije 532. A) __ tuljan B) __ skakavac C) __ šaran D) __ hrušt 1. bulbil 537. prodica lepirnjača 5. ima vanjsku oplodnju 2. Imela je poluparazit jer od svog domadara prima vodu s mineralnim tvarima pomoću __________. stvaranje spolnih stanica 3.

C) Prodor peludne mješinice u embrionsku vreću omogućuje oplodnju. Kemosintetske bakterije dobivaju energiju za asimilaciju ugljik(IV)-oksida A) pomoću bakterioklorofila B) apsorpcijom UV-zraka C) apsorpcijom infracrvenih zraka D) oksidacijom organskih spojeva E) oksidacijom anorganskih spojeva 545. B) Mejozom se u peludnim zrncima razvija muški gametofit. D) Nakon oprašivanja vegetativna stanica razvija se u peludnu mješinicu. Koja je izjava o peludnom zrncu pogrešna? A) Peludna zrnaca nastaju u peludnicama. Koja od navedenih životinja je dvospolac i nema organa za disanje ni probavila ni krvotoka A) gujavica B) hobotnica C) hidra D) trakavica 542.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ A) kojim označavamo sve kemijske sinteze na svjetlosti B) koji se zbiva u kromoplastima biljne stanice C) kojim se iz organskih tvari oslobađa kisik D) kojim se Sunčeva svjetlost pretvara u kvantume energije E) kojim se svjetlosna energija pretvara u kemijsku 541. 543. Iz 12 spermatogonija. Glavonošci su najrazvijenija skupina mekušaca. Koja se od navedenih osobina ne odnosi na glavonošce? A) imaju vrlo razvijen mozak B) građa oka im je slična kralješnjacima C) imaju razvijen krvožilni sustav D) dvospolci su 544. Pri klijanju sjemenke pšenice u aleuronskom sloju pod utjecajem hormona događa se sljedeće: A) enzim amilaza razgrađuje škrob B) hormoni auksini i citokinini potiču diobu stanica C) enzimi proteaze razgrađuju pričuvne bjelančevine D) razgradnja aleuronskog sloja bakterijama uvjetuje klijanje Pitanja s dva ili više točnih odgovora 547. odnosno 12 primarnih spermatocita razvit će se A) 48 sekundarnih spermatocita B) 24 spermatide i 48 spermija C) 48 spermija D) 12 spermija E) 24 sekundarne spermatocite F) 48 sekundarnih spermatocita 549. Četverodjelno srce (dvije klijetke i dvije predklijetke) imaju sljedeće životinje: A) pastrva B) čovječje ribica C) krokodil D) grlica E) klokan F) stonoga 548. U uvjetima bez kisika kvasci dolaze do energije za životne procese A) vrenjem B) trulenjem C) eksplozivnim oslobađanjem toplinske energije D) ciklusom limunske kiseline E) kemosintetski 546. U molekuli crvenog pigmenta hemiglobina dolazi do vezanja A) kisika za žaljezo 208 .

a zoolog Juri Što su po specijalnosti Jura. Svaki prethodni član mesojed u hranidbenom lancu u pravilu je A) manji od sljedećeg B) veći od sljedećeg C) brojniji od sljedećeg D) ima manju ukupnu biomasu E) ima manju ukupnu energiju 552. 556. Božo. Božo je __________. ružičaste. ljubičaste i narančaste boje. Sadnice hrasta sade se na razmaku od 4 m. ekolog. Partenogeneza je: A) stapanje spermija s jajnom stanicom B) razvoj jedinke iz neoplođene jajne stanice C) razvoj spolnog partnera 209 . Ivo i Vlado? Jura je __________. Pitanja s jednim točnim odgovorom 557. Podražavanje receptorskog dijela neurona ima za posljedicu A) ulaženje kalija u stanicu B) ulaženje neurohormona u stanicu C) uspostavu pozitivnog električnog naboja u stanici D) oslobađanje neurohormona u međuneuronski prostor E) uspostavu negativnog električnog naboja u stanici F) oslobađanje auksina u međuneuronski prostor G) ulaženje natrija u stanicu Pitanja kojima treba upisati odgovor 554. 555._________________________________________________________________________ Pitanja B) ugljik(IV)-oksida za željezo C) kisika za bjelančevinasti (globinski) dio molekule D) kisika za željezo i bjelančevinasti (globinski) dio molekule E) ugljik(IV)-oksida bjelančevinasti (globinski) dio molekule 550. Ivo. genetičar i zoolog pomažu si u znanstvenom radu. Genetičar je pomagao Boži. Koliko cvijetova treba izvaditi iz vreće da bi se sigurno izvadile najmanje dvije ruže jednake boje? _________. genetičar i mikrobiolog pomagali su Juri 3. Vlado je __________. žute. U neprozirnoj vreći nalazi se 12 ružinih cvjetova. Ivo je __________. Otvaranje i zatvaranje puči na listu ovisi o sljedećim događajima: A) fotosintezi i porastu sadržaja šećera u svim epidermskim stanicama B) fotosintezi i porastu sadržaja šećera u stanicama zapornicama C) povišenju osmotskog tlaka u stanicama zapornicama D) ualženju vode u zapornice bubrenjem i kapilarnošću E) primanju vod etranspiracijom 553. 1. bijele. Koliko se sadnica može posaditi u ravan niz na zemljište dužine 80 m? __________. Četiri prijatelja biologa: mikrobiolog. Božo i Vlado pomagali su zologu 2. od toga se po dva cvijeta crvene. Radom srčanog mišića usmjerava se A) venska krv iz desne klijetke plućnim arterijama u pluća B) arterijska krv iz pluća plućnom venom u lijevu pretklijetku C) venska krv iz desne klijetke plućnom venom u pluća D) arterijska krv iz pluća plućnim arterijama u lijevu pretklijetku E) venska krv iz tijela plućnom venom u desnu pretklijetku 551.

Lišće zimi otpada A) boru B) arišu C) bukvi D) tisi E) omoriki 567. a B otopinu kuhinjske soli iste koncentracije. Koja je tvrdnja točna? A) Svi svitkovci imaju barem začetak pluća. s oznakom A i B. Osmometar A sadrži otopinu šećera koncentracije 1 mol/L. Probava bjelančevina (proteina) počinje u: A) ustima B) jednjaku C) želucu D) tankome crijevu 559. Otrovne gljive su A) vrganj B) blagva C) pupavka D) rujnica E) muhara 566. C) Plaštenjaci i svitkoglavci nemaju kralježnicu. B) Svi svitkovci imaju škržne pukotine na prednjem dijelu crijeva i svitak na leđnoj strani tijela. Fosilni ostaci južnog pračovjeka (australopitekusa) nađeni su u: A) zapadnoj Australiji B) južnoj Aziji C) istočnoj i južnoj Africi D) južnoj Europi Pitanja s dva točna odgovora 565. 210 . Sintezu i lučenje spolnih hormona induciraju: A) tireotropni hormon B) gonadotropni hormon C) ACTH 564. ali imaju kralježnicu. D) Plaštenjaci i svitkoglavci nemaju svitak.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ D) vanjska oplodnja E) unutarnja oplodnja 558. Od tri metabolička segmenta razgradnje glukoze jedan je anaeroban: A) glikoliza B) Krebsov ciklus C) oksidativna fosforilacija 563. Koji od navedenih organa ima ključnu ulogu u održavanju stalnog volumena tjelesnih tekućina? A) jetra B) slezena C) bubreg D) mišić 562. barem tijekom embrionalnog razvoja. U posudi s vodom postavljena su dva osmometra. Metodom antibiograma utvrđuje se: A) najdjelotvorniji antibiotik za ljiječenje virusnih infekcija B) nove lijekove protiv gripe C) nove lijekove protiv AIDS-a D) najdjelotvorniji antibiotik po najmanjoj zoni inhibicije rasta bakterija E) najdjelotvorniji antibiotik po najvećoj zoni inhibicije rasta bakterija 561. E) U svitkovce ubrajamo kopljaču i žiroglavce. Osmotski tlak A) jednak je u oba osmometra B) 4 puta viši je u A nego B C) 2 puta viši je u A nego B D) u A iznosi ½ vrijednosti tlaka u B E) u B iznosi ½ vrijednosti tlaka u A 560.

Hormon inzulin: A) pospješuje ulazak glukoze u stanice B) olakšava izlazak glukoze iz stanica C) pospješuje sintezu glikogena u stanicama jetre D) pospješuje razgradnju glikogena (glikogenolizu) u stanicama 570. Među navedenim žlijezdama endokrine su: A) slinovnice B) hipofiza C) znojnice D) lojnice E) štitnjča F) jetra 569. U ciklusu kruženja dušika u biosferi. Kljunaši i tobolčari: A) nesu jaja B) su aplacentalni sisavci C) nose mlade u tobolcu D) hrane mladunčad mlijekom koje se stvara u mliječnim žlijezdama majke E) su fosili F) su placentalni sisavci 574. Koje od navedenih tvari nazivamo spolnim hormonima? A) tiroksin B) oksitocin C) adrenalin D) kortizol E) estrogen F) progesteron 571. Mjerilo gustoće populacija je: A) odnos između malađih i starijih članova populacije B) odnos spolova u populaciji C) broj jedinki neke vrste na određenom prostoru D) broj ženskih jedinki neke vrste u zajednici E) ukupna biomasa neke vrste na nekom prostoru 577. Među nacionalne parkove Hrvatske ubrajamo: A) Malostonski zaljev B) otok Lokrum C) Risnjak D) Kopački rit E) otok Biševo s Modrom spiljom F) dio otoka Mljeta 576._________________________________________________________________________ Pitanja 568. U biocenozama saprofagi se harane: A) živim algama B) uginulim biljnim dijelovima C) bakterijama D) algama i bakterijama koje žive u moru E) životinjskim lešinama 575. U procesu fotosinteze: A) dolazi do oksidacije CO2 B) toplina Sunca pobuđuje molekule klorofila C) se dio Sunčeve energije veže i pretvara u kemijsku energiju D) Sunčeva svjetlost oksidira NADPH2 E) Sunčeva svjetlost razlaže molekule vode F) sve sinteze ovise izravno o svjetlosti 572. Dormancija je A) bolest spavanja B) uzrokovana nedostatkom vitamina C C) nemogućnost klijanja sjemenke zbog nedostatka vlage D) razdoblje mirovanja kada sjemenka ne može proklijati E) bolest koju prenosi muha ce-ce F) nemogućnost klijanja sjemenke uzrokovana unutarnjim čimbenicima 573. dušik iz zraka mogu vezati: A) nitrifikacijske bakterije B) denitrifikacijske bakterije C) dušikove bakterije D) patogene bakterije 211 .

72 C) 0. Za koliko je veći broj mušica kojima sada raspolaže genetičar od onog koji je preostao zoologu? __________ 579. 32.9445×105 D) 3. Genetičar je planirao pokus te mu je zoolog dao 880 mušica.94×106 B) 2. 10. 17. __ D) 2. od toga su polovica ženke. __.8×106 586. Koliki je ukupni udarni volumen srca u mililitrima ako srce kuca 1 sat. __. __. Za koliko je dana bilo zaraženo pola šume? _________ 581. __ 212 . Unutrašnju oplodnju imaju: A) svi kralješnjaci B) kukci C) ježinci D) meduze 587. 3. U jednom polinukleotidnom lancu dvolančane molekule DNA brojevni udio pojedinih baza je: x(G) = 20 %.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ E) modrozelene alge F) djetelina Pitanja s jednim točnim odgovorom 583. to znači da je sastav drugog lanca sljedeći: x(G) __________ % x(A) __________ % x(C) __________ % x(T) __________ % 582. 8. x(T) = 21 %. U pauka krstaša predljive žlijezde se otvaraju na A) helicerama (kliještima) B) nogama za hodanje C) stražnjem dijelu tijela D) žalcu 588. 20 minuta i 30 sekundi: A) 2.94×105 C) 3. U kavezu ima 20 miševa. 15. 24. 8. U regulaciji koncentracije natrija putem bubreega sudjeluje: A) aldosteron B) antidiuretički hormon C) kortizon D) kortizol E) tiroksin 589. 12. 3. Gametofit je veći od sporofita kod: A) heterospornih papratnjača B) mahovina C) golosjemenjače ginka D) kritosjemenjača 584. 18. 5. Leđna moždina se nalazi A) ispod svitka B) iznad svitka C) unutar svitka D) ispod škržnog ždrijela 585. 5. 37 B) 2. Za sedam dana cijela šuma bila je zaražena. U proksimalnom (silaznom) tubulu bubrega resorbira se: Pitanja kojima treba upisati odgovore 578.9445×106 E) 9. x(A) = 35 %. Genetičar i zoolog imali su jednak broj vinskih mušica. x(C) = 24 %. Koliko najmanje miševa treba nasumce prebaciti u novi kavez ako se žele dobiti potomci? __________ 580. Upiši brojeve koji nedostaju: A) 2. Gubari su napali šumu i svakim danom bilo je dvostruko više zaraženog drveća nego dan ranije.

Neurohormoni ili neurotransmiseri su spojevi koji se A) vežu za eksitacijske receptore neurona u kojem nastaju B) vežu za inhibicijske receptore neurona u kojem nastaju C) vežu za eksitacijske mjehuriće D) vežu na specifične receptore narednog neurona E) vežu na specifične receptore istog neurona 592. UGA. papratnjače i vodeni beskralježnjaci B) bakterije. CCA D) UAC. GGA. U procesu glikolize od jedne molekule glukoze nastaju A) dvije molekule jabučne kiseline i 2 ATP-a B) četiri molekule jabučne kiseline i 4 ATP-a C) dvije molekule pirogrožđane kiseline i 2 ATP-a D) četiri molekule pirogrožđane kiseline i 2 ATP-a E) dvije molekule pirogrožđane kiseline i jedna molekula jabučne kiseline 594. CCU. gljive. AUG B) AUG. Kod navedenih hranidbenih lanaca u ekosustavima nije moguć: A) u moru planktonska alga – planktonski račić – punoglavac – skuša – morska mačka B) u jezeru planktonska alga – planktonski račić – riba ukljeva – riba pastrva – vidra C) u moru bakterije – školjkaš – hobotnica D) na kopnu trava – skakavac – zec – ris E) na kopnu biljni plodovi – šumski miš – kobac 597. GGU E) TAC. Čovjek se može zaraziti trihinom ako A) jede neoprano voće i povrće onečišćeno zrelim jajima trihine B) pojede trihinom zaraženo meso C) pije vodu onečišćenu zrelim jajima trihine D) ga ubode trihinom zaraženi komarac 595. ACU. Hidatode su žlijezde za A) izlučivanje vodene pare B) izlučivanje vode C) izlučivanje sluzi D) primanje vode E) primanje sluzi 593. CCA C) ATG. GGT Pitanja s dva točna odgovora 596. alge. GGA. ACT. alge i vodeni beskralježnjaci D) bakterije. uzročnikom SIDE._________________________________________________________________________ Pitanja A) ukupna količina fruktoze B) ukupna količina glukoze C) ukupna količina saharoze D) ukupna količina maltoze E) ukupna količina inulina 590. TGA. U kambriju su na Zemlji živjele A) bakterije. Ako je kod u genu za protein ATGGGATGACCA. alge. GGA. primitivne ribe i prvi kopneni kralješnjaci 591. papratnjače. vodeni beskralježnjaci i primitivne ribe C) bakterije. alge. papratnjače. UGA. karakterizira: A) povećanje broja leukocita (leukemija) B) propadanje limfocita zbog umnažanja virusa u njima C) pojava oportunističkih infekcija D) virus ne pobuđuje nastajanje specifičnih protutijela 213 . CCU. Infekciju virusom HIV. onda pri sintezi proteina ribosomu redom pristupaju tRNA sa sljedećim antikodima: A) CCA. vodeni beskralježnjaci.

Ako je vjero jatnost da njihovo dijete vidi normalno 1:4. Kratkovidan muškarac. Najmanji uzročnici bolesti su __________ i __________. 214 . 605. 604. čiji je otac plavokos. no možemo reći da su tamna kosa i smeđe oči dominantne osobine) __________. ima plave oči. kolika je vjerojatnost da uz normalan vid i smeđe oči ima još i plavu kosu? (Napomena: kratkovidnost je dominantna osobina. a ima vjerojatnost da ima smeđe oči 1:2. čija je majka normalnog vida. Dvije od navedenih bolesti uzrokovane su bakterijama: A) dječja paraliza B) bjesnoća C) mumps D) gripa E) encefalitis F) tuberkuloza G) sifilis 601. Unos većih količina otpadnih razgradljivih organskih tvari u jezerski ekosustav izazvat će: A) bujniji razvoj alga i povećanje koncentracije kisika u površinskim slojevima B) nedostatak kisika u pridnenim slojevima C) razvoj veće brojnosti vrsta s malim brojem jedinki D) smanjenje primarne organske proizvodnje E) smanjenje sekundarne organske proizvodnje 602. Karakteristike bakterija su: A) razmnožavaju se sporama B) vide se samo elektronskim mikroskopom C) ne mogu se uzgajati na umjetnim hranjivim podlagama D) neke fotosintezom stvaraju organske spojeve E) iz zraka vežu kisik i njime obogaćuju tlo F) po organizaciji stanice pripadaju prokariotima Pitanja kojima treba upisati odgovore 603. Organomotorna gibanja čiji je smjer neovisan o smjeru izvora podražaja i određen samo građom organa zovu se: __________. ima plavu kosu i smeđe oči. U karakteristike jednosupnica ubrajamo: A) čupavo krijenje B) žile u stabljici poredane u krugu C) peteročlani prsten D) rast u debljinu E) usporedne glavne žile u listu F) četveročlani cvijet 600. Kratkovidna žena crne kose. Smreku prepoznajemo po sljedećim morfološkim karakteristikama: A) iglice su duge do 5 cm i drže se u parovima B) iglice su plosnate i tupe s dvije bijele usporedne pruge na donjoj strani C) iglice su četverouglaste i na vrhu šiljaste D) iglice su poredane okolo čitave grančice E) češeri stoje uspravno i ne otpadaju cijeli F) krošnja je nepravilnog oblika 599. a boja kose i očiju određena je većim brojem gena.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ E) zaraza se ustanovljava samo elektronskim mikroskopom F) osobe bez simptoma bolesti nisu prenosioci virusa 598.

O kakvoj vrsti onečišćenja govorimo u tom slučaju? 215 .1. 607. C. Koliko će bakterijskih stanica nastati od jedne bakterije nakon triju uzastopnih dioba? 607.3. Kako se naziva polimer sastavljen od mnogo takvih molekula? 607. A. Slika prikazuje molekulu kojoj nedostaje središnji element. B. 607. Kakve su bakterije nastale diobom od jedne ishodišne? 607.Pitanja otvorenog tipa 606. Bakterija Diplococcus pneumoniae uzrokuje upalu pluća. E. Na slici zaokruži slovo odgovarajućeg oblika ove bakterije. Kojoj skupini organskih spojeva pripada molekula na slici? 606.3. Upišite na slici simbol kemijskog elementa koji nedostaje.4. D.4. Kako se zove veza kojom se međusobno povezuju takve molekule? 606. 606. U vodi koju smo uzeli iz obližnjeg potoka otkrili smo prisutnost bakterije Escherichia coli.2.2.1. Bakterije se u povoljnim uvjetima razmnožavaju velikom brzinom. 606.

608. Slike od 4.1. prikazuju cvjetove i cvatove. Koja slika prikazuje zaštićenu biljku i kako se biljka zove? 608.2. 216 . Slika prikazuje rodoslovno stablo svitkovaca. Što je cvat? 608.3. Navedite četiri glavna dijela cvijeta. Cvat je prikazan na slici/slikama? 608.608. 609.4. do 7.

3. 611. 610. 610. Navedite dvije zajedničke osobine svitkovaca. Navedite dvije uloge dišnog epitela. Slika prikazuje shematski prikaz građe eukariotske stanice. Imenujte strukturu koja je na slici označena slovom D i navedite njezinu ulogu u disanju. 609. Imenujte dijelove dišnog sustava označene slovima A.4.3. 609. Slika prikazuje dišni sustav.4. Napišite imena glavnih skupina prikazanih svitkovaca. Zbog čega CO2 izlazi iz kapilarne krvi u alveole? 610.609.2. Iz kojih su se peraja vodenih kralježnjaka razvile noge kopnenih kralježnjaka? 609.1.1. B i C 610. Koji od svitkovaca prikazanih na slici imaju amnion i zašto? 610. 217 .2.

2.2. Koja molekula čini genetički materijal bakterijske stanice? 613. Po čemu to zaključujete? Navedite jedan razlog. Kako se naziva genetički materijal bakterijske stanice koji je na slici označen slovom A? 612. 612. 218 . Kako se zovu mjehurići koji sadrže probavne enzime i na kojem organelu nastaju? 611. Koji je organel na slici označen slovom A? Koja je njegova uloga? 611.611. Prikazuje li slika životinjsku ili biljnu stanicu? Po čemu to zaključujete? 611. Koji tip stanice imaju bakterije? 612.4. Slika prikazuje građu plodišta gljiva.1. 612.3.3.4. Slika prikazuje bakteriju. 612.1. Navedite tri osobine koje su zajedničke mitohondrijima i plastidima.

Koje gljivice proizvode antibiotike i koja je svrha primjene antibiotika? 614. Navedite dvije osobine gljiva po kojima su slične životinjama. Slika prikazuje list i detalj njegova presjeka. 219 . Objasnite koja je uloga srčanih zalistaka. Kojoj skupini gljiva pripada plodište označeno slovom A.1. 613.4. Slika prikazuje shematski prikaz građe srca.1.4.3. 614. 614.2.3. Koja je krvna žila označena na slici slovom A i koju krv provodi? 614. Koja srčana komora ima najdeblju mišićnu stijenku? Objasnite zašto? 614. Objasnite kako se uznapredovala arteroskleroza odražava na vrijednosti krvnog tlaka.613. Zbog čega dolazi do „dizanja” tijesta pod utjecajem kvaščevih gljivica? 613.2. 615. a kojoj plodište označeno slovom B? 613.

Na slici označite strjelicama tri glavna dijela od kojih se sastoji tijelo kukca.1. Po čemu se nepotpuna preobrazba kukaca razlikuje od potpune? 617. Slika prikazuje ljudski jezik.615. Navedite prilagodbe u razmnožavanju kukaca za život na kopnu.1. 616. 617. gorko i kiselo.4.4. Na svakoj strjelici napišite njegov naziv. Koji organski spoj sudjeluje u izgradnji oklopa kukaca? 616. slatko. Slika prikazuje vinsku mušicu.3. Koje tvari provode žile lista? 616. 616.3. Navedite dvije važne uloge puči. Kako se naziva tkivo lista koje se nalazi ispod gornje epiderme i koja mu je uloga? 615.2. prikazuje li slika list jednosupnice ili dvosupnice? Po čemu to zaključujete? 615. 616. 615.1. Na slici na prazne crte upišite okusna područja: slano. 220 .2.

3. a koja molekula nastaje tim procesom? 618. 619.4.617.1. Kako se naziva osnovna građevna jedinica škroba? 620. Zaokružite na slici osnovnu građevnu jedinicu škroba. Navedite dvije namirnice u kojima smo mogli dokazati škrob.4. U kojem se dijelu stanice događa glikoliza? 618. 619. Navedite još dvije uloge jezika osim osjetilne. Glikoliza je metabolički proces zajednički svim živim bićima.3.2. 221 .2.2. Slika prikazuje stanicu euglene. 619.1.4. Kojoj skupini kralježnjaka jezik pomaže u „sakupljanju” mirisa? 618.3. Koja je uloga glikolize u metabolizmu stanice? 619. Koja je početna molekula u tom procesu. Koji enzim iz sline razgrađuje škrob? 619. 617. Koji se proces nastavlja na glikolizu u aerobnim uvjetima? 618. U nastavi biologije ispituju se svojstva škroba u različitim namirnicama. 618. U koju skupinu receptora pripadaju osjetilna tjelešca za okus? 617.

Koja krvna tjelešca odstupaju brojnošću ili strukturom kod osobe koja je anemična? 621. u čisto vodi ili u vodi opterećenoj organskim tvarima? Objasnite zašto? 620. B.1. Koja su krvna tjelešca na slici označena slovom D? 621. Koja je uloga tjelešaca označenih slovom D? 621.1.620. Gdje je veća vjerojatnost za pronalazak euglene.4. Na slici slovima A.3.2. Koje je najvažnije krvotvorno tkivo čovjeka? 622. Koje eukariotske stanice sadrže kloroplast? 222 . 622. Može li euglena živjeti bez stežljivog mjehurića (kontraktilne vakuole)? Objasnite zašto? 620.3. 621.2. 621. C i D označeni su sastojci ljudske krvi.1. Koji je organel na slici označen slovom F? Koja je njegova uloga? 620.4. Objasnite koje je značenje prabičaša u tumačenju evolucije živoga svijeta. Slika prikazuje kloroplast.

623.1. U kojoj se fazi mitoze nalazi stanica na slici? Navedite jednu značajku po kojoj je ta faza prepoznatljiva. Iz čega su se prema teoriji o endosimbiozi. 623. 223 .3.622. razvili kloroplasti? 623. Jednom rečenicom objasni koja je uloga mitoze u živim bićima. Kako se naziva dio kloroplasta označen slovom A? 622.4.4. Što je kariotip? 623.2. Kako se naziva tvorba koja je na slici označena slovom A? Koja je njezina uloga u mitozi? 623. Koji se proces događa u kloroplastima? 622.3.2. Slika prikazuje stanicu u jednoj fazi mitoze.

624.2.1. 224 .624. Slika prikazuje pet carstava živih bića.4.3. Navedite po jednog predstavnika iz svakog prikazanog carstva. Kojim su slovom označeni prokariotski organizmi? 624. 625. 624. Kako se naziva osnovna taksonomska (sistematska) kategorija? 624. Slika prikazuje promjenu broja bakterija u likvoru bolesnika. Proučite sliku i odgovorite na postavljena pitanja. Navedite imena carstava sa slike. Bolesnik se liječio antibioticima.

Kako se naziva proces koji na slici provode bakterije označene slovom A? 626. 627.3. Kojeg je dana počeo djelovati antibiotik? 625. Kojim će se krvnim tjelešcima povećati brojnost nakon što je osoba zaražena bakterijama? 625. Slika prikazuje šest predstavnika jedne skupine algi: volvoks. 626.4. kaulerpu. Navedite jednu organsku molekulu u koju se dušik ugrađuje.3.2.1. Jednom rečenicom objasnite zašto mahunarke mogu rasti na tlu siromašnom dušikovim spojevima? 626. 625. Dušik je značajan biogeni element. Slika prikazuje kruženje dušika u prirodi. 627. Jednom rečenicom objasnite koji su mogući uzroci porasta broja bakterija u likvoru nakon 24. dana. Navedite dvije biljke mesožderke. 626. klamidomonas.625.4. Kako se zove znanstvenik koji je dokazao da su mikroorganizmi uzročnici zaraznih bolesti? 626.2. morsku salatu i spirogiru.1. Koje dvije od prikazanih algi žive u planktonu kopnenih voda? 225 . jadranski klobučić.1.

Slika prikazuje organe kritosjemenjača. 627. Navedite jednu osobinu koja ukazuje na njihovo zajedničko podrijetlo.1. 628. Koji od prikazanih organa pripadaju jednosupnicama? 628. smeđih i crvenih algi. 628. Koja se dva tipa provodnih cijevi nalaze u provodnim žilama lista kritosjemenjača? 226 .4.627.2. Znanstvenici smatraju da su se iz drevnih zelenih algi razvile današnje kopnene biljke. Navedite dvije zajedničke osobine zelenih. Kako se naziva alga pridošlica u Jadran iz tropskih mora? 627.2.3.

1. Kojoj krvnoj grupi pripada testirani uzorak označen na slici brojem 1? 630.1. odnosno anti-B aglutinine. Koja je razlika u geotropizmu korijena i stabljike? 629. 628.2.4. Koje aglutinogene sadrži osoba krvne grupe 0? 630. Na slikama strjelicom označite stopalo svakog organizma 630. Kakvu tjelesnu simetriju ima organizam označen slovom B? Jednom rečenicom obrazložite svoj odgovor.2. Slika prikazuje rezultat reakcija krvi različitih krvnih grupa (stupci označeni brojevima od 1 do 4 ) s test-serumima koji sadrže anti-A. 629.4.3. Navedite dvije uloge korijena.4.3.628. 629. Kojim je slovom označen najrazvijeniji mekušac na slici? Kojoj skupini mekušaca pripada? 629.3. Slika prikazuje predstavnike mekušaca. Koja je krvna grupa „univerzalni primatelj”? 630. Razgradnjom kojeg spoja nastaje bilirubin? 227 . 630. Kako organizam označen slovom C uzima hranu? 629.

228 . Kako se naziva struktura u jajniku u kojoj sazrijeva jajna stanica? 631. Jednom rečenicom objasnite zašto propadanje žutog tijela u jajniku ima za posljedicu pojavu menstrualnog krvarenja? 632. Navedite puni naziv hormona koji izlučuju jajnici. Navedite puni naziv hormona koji oslobađa adenohipofiza a djeluje na jajnike.2. Dopunite shemu tako da na prazne crte upišete pune nazive odgovarajućih hormona.4. Slika prikazuje unutarnje ženske spolne organe.631.3. 631.1. Na shemi je nedovršen prikaz razina koje rezultiraju izlučivanjem spolnih hormona u žene. 631. 631.

Uz pomoć tablice napišite redoslijed aminokiselina u tom peptidu.2. Karcinom maternice je jedan od najučestalijih karcinoma u žene. Na kromosomima je naznačen položaj alelnih gena za dvije osobine dlake neke životinje. Na kojem se dijelu maternice najčešće razvija? Koja je najpoznatija metoda koja doprinosi ranomu otkrivanju ovoga oblika raka? 632.3. Navedeni niz kodona na mRNA nosi uputu za neki peptid. Slovo D označava dugu dlaku a d kratku.4. 633.1.632. 229 . Kako se naziva triplet na tRNA koji je komplementaran kodonu u mRNA? 634.2. 633. Navedite dvije mjere koje smanjuju rizik obolijevanja od spolno prenosivih bolesti. 632.3.4. dok E označava crnu boju dlake a e bijelu. 633. Kako se naziva faza menstrualnog (ovarijskoga) ciklusa u kojoj je endometrij maternice najrazvijeniji (najdeblji)? 632. Kako se naziva veza kojom se povezuju aminokiseline? 633. Slika prikazuje par homolognih kromosoma tijekom mejoze.1. Slika prikazuje niz kodona na mRNA. Kako se naziva proces u kojem se aminokiseline povezuju u protein na ribosomu prema redoslijedu zapisanom u mRNA? 633. Kojim je slovom na slici označen jajovod? Navedite dvije uloge jajovoda.

Napišite moguće genotipove gameta Katarine i Luke za navedena svojstva.2. Kolika je vjerojatnost da navedeni bračni par dobije sina daltonista koji je istodobno i nositelj gena za albinizam ? Vjerojatnost izrazite razlomkom. Kakav će biti fenotip jedinke genotipa ddEe? 634. Prikažite sve moguće genotipove njihove djece za navedena svojstva.3. Aleli koji određuju normalnu pigmentaciju kože (A) ili albinizam (a) dolaze na jednom od parova autosoma. mejotičke diobe ako se dogodio krosingover na način prikazan na slici. Aleli za normalno razlikovanje boja (XD ) i daltonizam (Xd) su spolno vezani geni. 634. Napišite sve moguće genotipove gameta koje će nastati na kraju II. Napišite genotipove Katarine i Luke. Napišite genotipove gameta koje bi nastale na kraju II.4.4.2. Katarina i Luka su supružnici normalne boje kože koji normalno raspoznaju boje. 635. mejotičke diobe u slučaju da se nije dogodio krosingover. Katarinin otac je daltonist i albino.1. 635.634.3. odnosno tablicu križanja. 635. Napišite genotip organizma za dva prikazana svojstva prije udvostručenja DNA.1. Lukini roditelji su zdravi homozigoti. 635. 635. 230 . 634.

1. Slika prikazuje glave lisica koje žive u različitim geografskim pojasevima. Umjereni pojas:__________ Polarni pojas: __________ Pustinjski pojas: __________ 636. Koji je član hranidbenog lanca mesožder i potrošač drugoga reda? 231 .2. Navedite dvije promjene u ekosustavu koje mogu dovesti do smanjenja populacije polarnih lisica. Jednom rečenicom objasnite razlike u boji krzna lisica koje žive u različitim geografskim područjima. 637.1. Koji članovi lanca prikazanoga na slici imaju najveću biomasu i količinu energije a koji najmanju? 637. 636. 637. 636.636. Koji abiotički čimbenik utječe na veličinu uški lisice u različitim područjima? 636.2. Slika prikazuje prehrambeni lanac u moru. Kojemu geografskom području pripadaju lisice sa slike? Na praznu crtu upišite slovo kojim je označena odgovarajuća lisica.4.3.

Kako se naziva vrsta prijenosa kroz membranu koji prokazuje slika? 638.2. Slika prikazuje stanicu u jednoj fazi mitoze.4. u odnosu na kap vode? 638. Jednom rečenicom objasnite zbog čega se dogodila prikazana promjena.3.3.637. prikazuje stanicu u trenutku kada smo je stavili u kap vode. Kakva je citoplazma stanice na slici A.)? 638. Što se dogodilo sa stanicom dok je stajala u kapi vode (slika B. Kako će se povećanje biomase fitoplanktona odraziti na biomasu svih ostalih članova lanca? 638. 639.1.4. istu stanicu nakon nekoliko minuta. Kod kojih se sve članova lanca prikazanih na slici odvija sekundarna organska proizvodnja? 637. Slika A. 638. a slika B. 232 .

640. Koliko će kromosoma imati svaka stanica-kći.2. Koji se organel životinjske stanice tijekom evolucije najvjerojatnije razvio iz aerobne bakterije. 640.1. U kojoj se fazi mitoze nalazi stanica na slici? Navedite jednu značajku po kojoj je ta faza prepoznatljiva.2. 233 .1. nastala diobom stanice koja ima 48 kromosoma? 639. 639.639. Kako se naziva tvorba koja je na slici označena slovom A. Navedite dvije zajedničke strukture prokariotske i životinjske stanice.4.4. Slika prikazuje životinjsku i bakterijsku stanicu.3. 640. Koja je molekula nositeljica nasljedne upute u bakteriji? 640.3. Navedite dvije osnovne razlike u građi prikazanih tipova stanica.? 639. 640. Jednom rečenicom objasnite razliku u građi metafaznih i anafaznih kromosoma u mitozi.

642. Proučite sliku i odgovorite na postavljena pitanja.2. 641. Jednom rečenicom objasnite koji su mogući uzroci porasta broja bakterija u urin u nakon 16. Bolesnik se liječio antibioticima. a inače je normalni simbiont u ljudskim crijevima? 641. klamidomonas. jadranski klobučić. 641. Koja je bakterija mogla izazvati ovakvu zarazu. kaulerpu. 234 . Slika prikazuje promjenu broja bakterija u urinu bolesnika. morsku salatu i spirogiru. dana.4.3.641.1. Slike prikazuju šest predstavnika jedne skupine algi: volvoks. Koliko je dana prošlo od infekcije do početka djelovanja antibiotika? 641. Kako se naziva prvi antibiotik koji je korišten za liječenje ljudi? Imenujte znanstvenika koji ga je otkrio.

1. 643. Kojoj skupini algi pripadaju prikazane vrste? 642. 642. 643. 643.______________________________ D. haploidan ili diploidan broj kromosoma? Jednom rečenicom obrazložite svoj odgovor. Navedite dva razloga koja podupiru ovu tvrdnju._______________________________ E. Kako se naziva gametofit papratnjača? 643. Slika prikazuje životni ciklus paprati.______________________________ F.2. Jednom rečenicom objasnite koje je značenja volvoksa za evoluciju. A. koja je na slici označena slovom B. Imaju li stanice tvorbe.4.1. Na praznu crtu uz slova kojima su označene alge na slici upišite odgovarajuća imena algi.______________________________ B._______________________________ C. Alge su značajne za život u vodenim ekosustavima. Kako se zove nespolna generacija paprati? Kojim je slovom označena slici? 643.2._______________________________ 642.3.4.3. Jednom rečenicom objasnite zašto je tijekom evolucije kopnenih biljaka došlo do redukcije spolne generacije? 235 .642.

Slika prikazuje probavni sustav čovjeka. odnosno anti-B aglutinine. 644. 236 . Slika prikazuje rezultat reakcija krvi različitih krvnih grupa (stupci označeni brojevima od 1 do 4) s test-serumima koji sadrže anti-A. Kojoj krvnoj grupi pripada testirani uzorak označen na slici brojem 4 i zaokružen? 644.1.644.3. Koje aglutinine sadrži osoba krvne grupa AB? 644.2. Koja se krvna grupa smatra„ univerzalnim davateljem”? 644.4. Što su po kemijskom sastavu aglutinini i aglutinogeni? 645.

2. Navedite tri spolne zarazne bolesti.4.4.3.3. Kako se naziva enzim pomoću kojega se replicira (udvostručuje) DNA? 647. Kako se naziva organ koji svoje probavne enzime izlučuje u dvanaesnik? Kojim je slovom označen na slici? 645. Napišite niz baza na komplementarnome lancu iste molekule. Koja je uloga crijevnih resica u tankome crijevu? 645. U kojem se dijelu interfaze događa replikacija (udvostručenje) DNA? 647.1. Napišite niz baza na mRNA koja nastaje transkripcijom zadanoga niza: 237 . Kojim je slovom na slici označe jajnik? Navedite dvije najvažnije uloge jajnika. Slika prikazuje unutarnje ženske spolne organe. Kojim je slovom na slici označena maternica? Koja je uloga maternice? 646. Kojim je slovom na slici označen spolni organ u kojem se događa oplodnja? Kako se naziva taj organ? 646. 646. Na slici označite žučnu vrećicu. 647. 646.1.645.4. 647.2.1. Koja je uloga žuči? 645. Niz baza na lancu DNA je sljedeći: 647.3.2. Koji je najčešći uzrok ciroze jetre u razvijenim zemljama? 646.

648.1.1. Martin otac boluje od hemofilije.4. Napišite moguće genotipove gameta Marte i Petra za navedena svojstva. 648. Kolika je vjerojatnost da Marta i Petar dobiju zdravoga sina krvne grupe B? 238 . dok slovo F označuje dugu stabljiku. a e bijelu.648.4. a Petar krvnu grupu 0. 649.3. 649.0) koji dolaze na jednom od parova autosoma.3. 648. a f kratku. Aleli za hemofiliju (Xh ) i normalno zgrušavanje (XH) su spolno vezani geni. Jednom rečenicom objasnite što su homologni kromosomi. Napišite genotip organizma za dva prikazana svojstva prije udvostručenja DNA. Slovo E označuje crvenu boju cvijeta. Slika prikazuje par homolognih kromosoma tijekom mejoze. mejotičke diobe ako se dogodio krosingover na način prikazan na slici.B. a krvne grupe određuju aleli (A. Napišite sve moguće genotipove gameta koje će nastati na kraju II. 648. Marta ima krvnu grupu AB. Marta i Petar su zdravi supružnici i imaju dvoje djece. Napišite genotipove Marte i Petra. Kako će izgledati fenotip sljedećeg potomka: eeFf 649. 649. odnosno tablicu križanja.2. Na kromosomima je naznačen položaj alelnih gena za dva svojstva neke biljke. Prikažite moguće genotipove njihove djece za navedena svojstva. 649.2.

Kako se nazivaju organi različiti po postanku koji obavljaju sličnu funkciju? 650. C.3.4. Iz koje su se skupine (razreda) kralježnjaka razvile današnje ptice i sisavci? 650.. 239 .650.2. označena su krila različitih životinja. 651.1.1. 651. Slika prikazuje dva odrasla primjerka pingvina vrste A.. i B.? Upišite slova na karti svijeta u dvama od ponuđenih četiriju kvadratića. i B. Navedite dvije osobine koje je imala praptica (Archaeopteryx). 650. B. U kojem dijelu svijeta žive prikazane vrste pingvina A. Na slikama A. a nemaju ih današnje ptice. Iz kojeg tkiva/organa nastaju krila kukaca? 650.

4. Slika prikazuje prehrambeni lanac u moru.3. Koji su članovi lanca na slici biljojedi a koji mesojedi? 652. Koje ekološko pravilo govori o razlozima različitih veličina tijela srodnih vrsta u ovisnosti o temperaturi? 651. Kako će se povećanje biomase zooplanktona odraziti na biomasu riba i liganja? 652.1.2.3.2. Hoće li biomasa fitoplanktona u moru biti veća zimi ili proljeće? Jednom rečenicom objasnite zašto? 240 .651. Pripadaju li pingvini grebenkama ili bezgrebenkama? 652. 651. Jednom rečenicom obrazložite svoj odabir. 652.

4.652. Slika prikazuje životinjsku stanicu. Kako se naziva stanični organel u kojem nastaje veliki broj molekula ATPa? 654. 653.4. Koju ulogu u stanici ima spoj prikazan na slici? 653. Slika pokazuje strukturu molekule ATP-a. U kojem je dijelu molekule ATP-a pohranjena energija? 653. 241 . Navedite naziv jednoga staničnog procesa u kojem nastaje ATP. 653. 653.2.1.3. Jednom rečenicom objasnite razliku između primarne i sekundarne organske proizvodnje.

2. Kako se naziva jedna stanična struktura koju ima životinjska. Kako se naziva stanični organel na kojem će se sintetizirati inzulin. 242 . Pretpostavimo da slika prikazuje stanicu gušterače. Navedite jedan od staničnih organela u kojem se nalaze molekule DNA i kojim je slovom označen na slici.3. 654. Na kojoj staničnoj tvorbi nastaju lizosomi? 655.4. a nema biljna stanica? Uz naziv stanične strukture upišite slovo kojim je označena na slici.1. 654.654. na slici označen slovom E ? 654. Na slici je pojednostavljen prikaz mejoze.

3.1. Kojim je slovom na slici prikazana metafaza II.2.4. Pogledajte sliku i ponuđenim opisima etapa u razmnožavanju pridružite odgovarajuća slova. Vezanje virusa na površinu bakterije:___ Sklapanje novih virusnih čestica:___ 656.1. Kako se nazivaju subvirusne čestice koje uzrokuju bolest stoke „kravlje ludilo”? 243 .? 655. Koji je proces u profazi I. U kojim se spolnim organima muškaraca zbiva mejoza? 655.4. najvažniji uzrok genetičke raznolikosti stanica? 656. U kojoj fazi mejoze dolazi do razdvajanja homolognih kromosoma? Kojim je slovom ta faza označena na slici? 655. Slika prikazuje umnožavanje virusa u bakterijskoj stanici.655.2.3. 656. Koji je najpouzdaniji način zaštite od virusnih bolesti? 656. Koji je virus označen slovom A na slici? 656.

Slika prikazuje cvijet kritosjemenjače. U koju skupinu praživotinja (Protozoa) pripadaju papučice? 657.3. Kako se naziva struktura koja obavija tijelo papučice i daje mu stalni oblik i čvrstoću? 657. 244 . Slika prikazuje papučicu.2. Kako se naziva struktura koja ima ulogu izbacivanja suviška vode iz papučice i kojim je slovom označena na slici? 657.4. Kako se zove „otac mikroskopa” koji je prvi promatrao jednostanične organizme? 658.1. 657.657.

2.4. Kako se naziva dio cvijeta koji je na slici označen slovom A ? 658.1. Navedite jednu prilagodbu za letenje u građi kostura ptica. U kojem se dijelu tučka događa oplodnja? 658. 659. 659. Slika prikazuje kostur ptice. Na temelju izgleda prsne kosti odredite skupinu ptica čiji je primjer kostura prikazan na slici. 659. Kako se naziva cvijet koji sadrži i tučak i prašnike? 658.4.1. Navedite jednu zajedničku osobinu ptica i gmazova. Preobrazbom kojih organa nastaju dijelovi cvijeta? 659.2.3.658. 245 .3. Kojim je slovom na slici označena bedrena kost? 659.

4.2.3. Koja je žlijezda prestala ispravno funkcionirati? 661. Navedite puni naziv hormona koji će pacijent morati uzimati.2.4.660. Pacijentu su dijagnosticirali patuljasti rast. 246 . 660. Kako se zove poremećaj povećane koncentracije ureje u krvnoj plazmi? 661. Navedite jednu tvar iz koje nastaje ureja ili karbamid.1.1. Jednom rečenicom objasnite razliku u načinu izlučivanja egzokrinih i endokrinih žlijezda. Liječnik mu je odredio hormonsku terapiju. Slika prikazuje osnovnu građevnu jedinicu bubrega. Kakva će biti koncentracija mokraće osobe koja je jela pršut nakon otprilike četiri sata u odnosu na osobu koja je jela lubenicu? 660. 660. 661. 661. Koji poremećaj nastaje ako se isti hormon luči u prekomjernoj količini? 661.3. Kojim je slovom na slici označen glomerul i koja je njegova uloga u radu bubrega? 660.

662. Zaokružite na slici haploidnu fazu životnoga ciklusa čovjeka. 662. Kako se naziva niz mitoza kojima iz oplođene jajne stanice nastaje blastocista? 662.3. Navedite zametne listiće gastrule? 247 .1.4. 662. Upišite riječ „mejoza” i „oplodnja” na za to predviđena mjesta u pravokutnicima na slici. Slika prikazuje životni ciklus čovjeka.662.2.

Koliko autosoma i koliko spolnih kromosoma ima gameta čovjeka? 664.4.3. 664.4.3. Prikazuje li slika muškarca ili žene i po čemu se to može zaključiti? 663.663. Divlji tip ima sivo-smeđu boju tijela(e+) i ravna krila dulja od tijela (vg+). Ove osobine nisu spolno vezane.1. Napišite genotip ženke ako je za obje osobine heterozigot.1. 664. Slika prikazuje kariogram čovjeka. Kakve će osobine imati potomak sljedećeg genotipa: eevg+vg ? 664. Za označivanje osobina vinskih mušica rabe se međunarodno priznati simboli. Napišite genotip mužjaka. Kako se zove znanstvenik koji je započeo istraživanja na vinskim mušicama? 248 . Križana je ženka divljeg tipa za obje osobine i mužjak mutant za obje osobine.2. Koje organske makromolekule dolaze u sastavu kromosoma? 663. 663. a mutant ima crno tijelo (e) i zakržljala krila (vg). 664. Kako se naziva faza mitoze u kojoj se nalaze kromosomi na slici? 663.2.

Na prazne crte upišite slova kojima su na slici označeni glavni dijelovi Miller – Urayeva pokusa.3.665.4. Navedite jednu molekulu koja se nalazila u praatmosferi. Slika prikazuje Miller – Urayev pokus kojim je dokazana teorija organske evolucije. 665. Praatmosfera ___________ Stvaranje vodene pare __________ „Prajuha” ___________ 665. Jednom rečenicom objasnite pojam kemijske evolucije.1. 665. Kolika je starost Zemlje prema suvremenim procjenama geologa? 249 .2. 665.

666.4.3.2. Navedite jednu prilagodbu na oprašivanje pčelama. Očitajte sa slike temperaturni minimum pri kojem se razvija najmanji broj ličinki pčela iz jajašaca. Slika prikazuje ovisnost broja ličinki pčela izlegnutih iz jajašaca pri određenim temperaturama.666. 666. Slika prikazuje kruženje vode u prirodi. 250 .1. Očitajte sa slike koliki je broj ličinki pčela pri temperaturi od 150C. 666. Očitajte sa slike temperaturu pri kojoj će se razviti najviše ličinki pčela iz jajašaca. 666. 667.

667. Kako se naziva proces kojim biljke vodu iz tla oslobađaju u atmosferu? 667.3. Kako se nazivaju najvažniji kemijski elementi koji izgrađuju živa bića i čije cikluse pratimo u prirodi? 251 .1.2.4. Kojim procesom površinska voda prelazi u atmosferu? 667. 667. Navedite jednu prilagodbu četinjača za štednju vode.

ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ 252 .

_______________________________________________________________________ Odgovori ODGOVORI 253 .

ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ 254 .

v. disaharidi 16. sinteza proteina 34. v. D. v. v. C. D. A. v. v. monohibridno križanje s dominacijom 37. dijaliza 11. A. gastrulacija 24. odg. odg. D. E. C. test križanje 35. ATP 21. odg. v. E. B. E. v. A. ribosomi 5. odg. odg. biljni virusi 19. v. C. v. modrozelene alge 7. hranidbeni lanac 42. D. A. v. odg. odg. B. odg. v. C. prolaktin 30. odg. v. odg. 48. pasivni transport 61. A. odg. B. odg. C. odg. dihibridno križanje s dominacijom 47. C. C. profaza I 55. odg. odg. E. v. odg. lizosomi 58. C. peptidna veza 75. odg. laktoza 60. v. odg. odg. razlagači 40. odg. v. odg. odg. v. C. D._______________________________________________________________________ Odgovori 1. E. fotosinteza i reakcije na svjetlosti 22. E. mejoza I 4. v. vertikalne zone biosfere 46. v. enzimi 52. v. odg. Dodatak 5 56. D. v. citologija 59. C. odg. bijelo tijelo 28. B. v. A. odg. B. neurosekrecijski faktori 80. odg. v. v. blastoporus 68. Graafov folikul 26. B. E. E. v. v. odg. E. E. odg. D. oksitocin 54. odg. v. odg. Mendelovi zakoni 70. odg. odg. odg. odg. odg. v. areal 41. v. D. dušikove baze 23. B. v. odg. odg. C. C. C. odg. v. v. odg. vezani geni 72. v. odg. D. kloroplasti 6. gastrulacija 67. odg. v. klorofil 64. A. v. v. v. gonadotropni hormoni 255 . B. odg. v. interfaza 13. pokretačke sile evolucije 44. D. krvne grupe 50. odg. v. v. odg. odg. E. v. B. E. odg. odg. E. E. v. B. žuto tijelo 65. komplementarne baze 62. B. v. hipotalamus 31. trofoblast 2. v. v. v. v. organogeneza 69. odg. v. heterozigoti 49. odg. C. odg. odg. E. C. v. oksidacija 18. enzimi 20. E. v. aktivni prijenos 9. odg. odg. odg. testosteron 77. B. v. v. označavanje nasljednih faktora i generacija Genotip AAbb dati će fenotip u kojem će se izraziti recesivno svojstvo za razliku od ostalih. kloroplasti 74. v. odg. odg. zakoni nasljeđivanja 36. A. v. D. odg. v. ovulacija 79. odg. E. bakteriofagi 76. D. v. v. odg. v. genetska uputa 33. hipotalamus 27. trudnoća 29. v. E. zigota 25. v. odg. Dodatak 2 14. tundra 38. v. odg. D. odg. v. D. C. odg. D. v. v. odg. B. v. C. mezoderm 3. v. odg. lizosomi 12. odg. v. v. v. v. odg. modrozelene alge 73. odg. mitoza 8. B. biosfera 39. odg. fotosinteza 53. v. endoplazmatska mrežica 45. odg. D. nukleinske kiseline 78. E. odg. odg. odg. kromatin 10. ATP 63. A. B. v. odg. C. odg. eukarioti 66. odg. odg. E. D. v. v. v. odg. Dodatak 2 51. monohibridno intermedijarno križanje 71. označavanje naslijednih faktora i generacija 57. glikoliza 17. odg. v. primarna organska produkcija 43. v. v. fermentacija 15. v. oksitocin 32. v. A. odg.

v. odg. ektoderm 134. blastula 158. D. Dodatak 5 145. odg. odg. D. v. odg. D. blastocista 82. sukcesija 144. genetska uputa 142. D. v. odg. timin 89. C. fenotip 118. v. A. v. v. C. v. odg. v. B. B. E. B. vezani geni 105. odg. v. v. v. proteini 87. odg. odg. v. odg. biocenologija 123. blastoderm 99. odg. Mendelovi zakoni 138. E. D. odg. proteini 86. odg. D. D. lipaza 94. odg. v. C. molekularna biologija 147. ovulacija 114. odg. interfaza 83. kodon 154. v. monohibridno križanje s dominacijom 104. odg. odg. v. nukleolus 96. proteini 165. A. B. mejoza I 132. v. odg. D. v. A. v. D. gonadotropni hormoni 155. odg. v. odg. C. odg. nukleinske kiseline 90. odg. v. C. odg. v. E. odg. odg. v. homozigot 102. odg. test križanje 120. B. odg. testosteron 115. v. B. enzimi 93. v. gastrulacija 135. odg. odg. odg D. v. odg. laktoza 164. odg. v. žuto tijelo 97. v. v. E. C. prophliopitekus 146. A. monohibridno križanje s dominacijom 84. dihibridno križanje s dominacijom 160. C. odg. D. v. B. E. odg. E. karbon 124. C. odg. odg. odg. interfaza 108. odg. komplementarne baze 112. v. odg. C. D. A. ribosomi 107. fotosinteza 153. v. v. pasivni prijenos 95. odg. C. monohibridno intermedijarno križanje 140. B. A. embriologija 163. odg. D. mezoderm 117. odg. C. v. v.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ 81. odg. odg. v. v. odg. odg. v. monohibridno intermedijarno križanje 121. citološke metode 109. v. odg. v. odg. v. v. C. v. odg. B. v. v. test križanje 103. v. test križanje 161. D. odg. E. adenin 110. fotosinteza 126. nukleinske kiseline 91. C. v. C. mutacije 122. arhenteron 133. odg. odg. nasljeđivanje 137. saharoza 111. odg. v. odg. trudnoća 159. vidi DNA 92. v. A. D. D. C. ATP 128. C. D. v. odg. membranski proteini 85. odg. odg. v. E. B. v. ATP 113. E. v. v. odg. dijaliza 129. test križanje 119. v. B. E. odg. ribosomi 125. odg. prolaktin 98. odg. B. nukleinske kiseline 150. odg. D. v. C. v. D. odg. mutacije 141. D. test križanje 139. v. odg. C. C. odg. mejoza 116. proteini 148. odg. v. v. v. v. odg. odg. odg. C. v. koža 130. v. v. odg. C. v. v. odg. v. odg. v. v. v. Virchow 156. blastomere 101. v. B. proteini 256 . odg. gvanin 127. E. v. nukleotidi 88. odg. A. odg. odg. A. C. A. v. prolaktin 136. odg. C. odg. D. v. biomasa 143. B. v. odg. E. v. gvanin 149. v. biologija 106. v. oogeneza 131. D. C. v. enzimi 152. C. v. odg. D. DNA 151. v. v. odg. E. evolucija 162. v. v. odg. prolaktin 157. odg. odg. trofoblast 100. odg.

v. odg. D. v. v. v. v. odg. v. E. zigota 190. odg. odg. odg. estrogen i progesteron 222. odg. homozigot 230. A. v. E. DNA 216. E. v. odg. v. ekologija 224. v. v. v. odg. odg. v. voda 210. v. v. dihibridno križanje s dominacijom 192. A. B. odg. D. odg. v. v. v. v. odg. relikti 199. odg. prokarioti 202. blastula 220. v. odg. D. E. C. v. C. nukleoid 183. v. B. biologija 200. v. B. v. odg. v. v. odg. genetska uputa i sinteza proteina 189. odg. v. eukarioti 206. anafaza I 184. aktivni prijenos 174. v. E. B. v. v. odg. B. v. v. D. E. odg. označavanje nasljednih faktora i generacija 196. D. dihibridno križanje s dominacijom 233. odg. odg. odg. v. C. odg. odg. D. odg. genetska uputa 187. DNA 212. odg._______________________________________________________________________ Odgovori 166. v. odg. Golgijevo tijelo 182. C. A. odg. odg. odg. komplementarne baze 229. odg. RNA 217. E. monohibridno križanje s dominacijom 180. krosingover 257 . AMP 172. odg. odg. gonadotropni hormoni 221. v. B. E. D. genetska uputa 227. A. E. žuto tijelo 186. C. odg. C. interfaza i jezgra 175. odg. D. E. odg. citozin 169. v. ICSH 177. odg. odg. dihibridno križanje s dominacijom i vezani geni 234. odg. embrioblast 178. v. v. odg. citozin 214. v. v. ATPaza 171. D. odg. D. A. odg. B. biljna stanica 207. odg. v. fenotip 191. odg. v. v. C. Dodatak 2. v. odg. C. monohibridno intermedijarno križanje 195. v. trofoblast 240. odg. monohibridno križanje s dominacijom 179. C. v. B. nukleinske kiseline 168. v. test križanje i dihibridno križanje s dominacijom 236. kloroplasti 208. biljna stanica 209. E. odg. odg. odg. D. v. v. v. v. odg. C. test križanje 198. D. vinska mušica. eukarioti 201. odg. odg. C. eukarioti 167. D. odg. v. odg. aminokiseline 226. bakteriofagi 205. dihibridno križanje s dominacijom 197. C. odg. D. Dodatak 3 225. odg. odg. D. C. odg. v. genetska uputa i sinteza proteina 188. v. odg. D. D. B. DNA 215. anafaza I 238. kloroplasti 204. v. v. odg. odg. v. odg. D. B. v. B. odg. v. C. virusi 239. testosteron 176. odg. v. v. odg. v. v. C. v. v. v. v. telofaza I 185. D. B. odg. odg. A. v. anatomija 223. D. DNA 228. C. C. v. C. odg. monohibridno intermedijarno križanje 181. odg. NADP 173. DNA 211. genetska uputa 219. E. test križanje 232. v. A. v. odg. odg. C. v. B. odg. v. test križanje 231. Mendelovi zakoni 194. ribosomi 203. odg. D. ekologija 241. peptidi 218. odg. odg. D. v. odg. C. v. 193. kromosomska garnitura 235. v. E. spolno vezano nasljeđivanje 237. polinukleotidi 170. adenin 213. E.

odg. A. v. odg. dihibridno križanje s dominacijom 300. vezani geni 281. A. C. v. E. odg. B. Golgijevo tijelo 291. D. odg. E. B. v. blastocel 262. odg. odg. v. E. v. Hooke 258. Dodatak 2 253. tripanosoma 293. B. v. LH i LTH 246. A. odg. odg. test križanje 286. v. v. odg. E. v. genetske karte 305. dihibridno križanje s dominacijom 287. v. v. B. čovjek. D. v. test križanje 280. dihibridno križanje s dominacijom i vezani geni 283. odg. odg. B. prokarioti 306. C. odg. pričvrsnica 260. D. odg. C. E. hipoglikemija 315. fiziologija 271. v. označavanje nasljednih faktora i generacija 301. v. dušikove baze 274. A.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ 242. ekologija 314. vinska mušica. E. odg. C. odg. odg. v. odg. E. nukleoidi 261. E. C. autoradiografija 273. histologija 313. C. RNA 296. Dodatak 2 254. odg. odg. v. odg. Dodatak 2 249. Golgijevo tijelo 275. C. ATP 256. odg. ribosomi 276. odg. v. fenilalanin i genetska uputa 270. odg. stanična membrana 278. odg. E. C. odg. E. D. v. D. virusi 289. odg. E. test križanje 267. B. v. FSH. v. v. RNA 277. biomasa 304. mezoderm 263. v. odg. C. v. odg. odg. v. C. kariotip 302. E. spolno vezano nasljeđivanje 284. odg. C. vinska mušica. v. D. v. odg. D. D. v. v. v. B. v. mitoza 259. C. kromosomska garnitura 250. odg. v. v. odg. v. v. v. križanac 292. B. odg. odg. mutacija 243. Fleming 244. v. odg. prolaktin 247. odg. odg. odg. ATP 257. v. v. odg. v. dihibridno križanje s dominacijom 282. v. v. A. v. živa bića 290. C. odg. poliU 310. sinteza proteina 297. Dodatak 2 252. v. mutacije 298. odg. kromosomska garnitura 251. atavizam 307. E. D. odg. v. odg. v. ektoderm 264. v. E. v. kromosomska garnitura 285. v. odg. odg. B. dihibridno križanje s dominacijom 269. C. odg. odg. aleli 288. D. v. odg. monohibridno križanje s dominacijom 299. B. v. odg. v. odg. B. v. D. odg. odg. steroidi 316. B. v. odg. odg. odg. B. odg. odg. v. odg. E. test križanje 266. v. v. sinteza proteina i genetska uputa 312. odg. polifenilalanin 311. v. v. v. odg. E. B. odg. D. E. E. odg. C. voda 294. B. aminokiseline 258 . odg. v. D. odg. odg. recesivno svojstvo 279. spolno vezano nasljeđivanje 248. fiziološka otopina 303. E. v. odg. v. v. E. v. v. proteini 295. v. C. v. odg. odg. v. monohibridno križanje s dominacijom 268. v. odg. E. C. v. endoderm 265. D. B. v. E. E. homologni kromosomi 245. kodon 309. odg. evolucija 272. odg. v. rudimenti 308. v. odg. odg. v. vezani geni 255. v. odg.

v. v. E. odg. A. odg. C. anafaza I 358. v. blastoderm 371. v. ekosustav 392. komplementarne baze i kodon 353. v. odg. D.odg. E. odg. B. mejoza I 331. blastoporus 372. spolno vezano nasljeđivanje 377. bakteriofagi 332. jezgrica 356. recesivno svojstvo i homozigoti 322. odg. v. B. odg B. jezgrica 338. homozigot 347. odg. C. D. v. kromatin 357. odg. dihibridno križanje s dominacijom 329. v. v. test križanje 349. A. v. D. v. spolno vezano nasljeđivanje 326. odg. D. odg. v. test križanje 320. mezoderm 344. C. fenilalanin i genetska uputa 352. A. tundra 385. odg. odg. C. C. D. v. v. E. odg. E. v. C. odg. B. Mendelovi zakoni 330. nukleoid 365. odg E. v. odg. v. odg. C. prokarioti 346. E. v. C. osmoza 368. odg. fenološke pojave 387. v. odg. odg. C. vezani geni 321. D. ektoderm 361. E. B. E. modrozelene alge 328. v. v. D. odg. v. lizosomi 380. v. B. A. A. autotrofi 389. odg. odg. v. E. odg A. odg. D. oksidacija 335. zigota 384. odg. v. životinjski virusi 375. C. B. v. v. odg. E. v. E. odg. v. C. B. vinska mušica. odg. B. spolno vezano nasljeđivanje 325. v. B. v. odg. odg. v. blastoderm 342. v. v. telofaza I 360. odg. v. v. v. odg. odg. v. odg. odg. ATP 334. odg. blastoporus 343. E. E. B. B. C. A. v. Dodatak 2 362. heterotrofi i bakterije 386. B. odg. v. E. v. koža 341. v. v. v. D. v. primarna organska produkcija 390. E. fagocitoza 336. v. odg. neuron 340. v. odg. A. embrioblast 333. Medelovi zakoni 348._______________________________________________________________________ Odgovori 317. biologija 367. odg. v. odg. A. biološki indikatori onečišćenja 259 . v. D. odg. D. v. dihibridno križanje s dominacijom 376. v. odg. trofoblast 374. B. test križanje 323. odg. odg. fermentacija 381. pirimidinske baze 318. odg. odg. spermatogeneza i oogeneza 359. odg. v. lizosomi 354. A.odg. v. E. v. test križanje 364. v. odg. označavanje nasljednih faktora i generacija 350. odg. E. vezani geni 324. kromosomska garnitura 327. endem 391. kloroplasti 366. odg. odg. E. B. odg. krosingover 351. oplodnja 383. odg. v. odg. odg. v. A. C. v. odg. odg. endoplazmatska mrežica 379. v. odg. mitohondriji 355. v. v. B. v. DNA 337. odg. v. ektoderm 373. odg. odg. oksidacija 382. australopitekus i dodatak 5 393. v. odg. v. centrosomi i diobeno vreteno 378. v. A. odg. v. odg. E. odg. C. C. vezani geni 363. dominantno svojstvo i označavanje nasljednih faktora i generacija 319. endokrine žlijezde 369. metafaza 339. B. odg. odg. v. v. areal 388. v. odg. bakterije 345. odg. E. v. v. v. odg. E.odg. v. v. profaza I 370. v. odg. E. v. odg.

odg. areal 426. E. v. odg. v. A. v. T. prokariotska stanica 454. odg. odg. virusi 401. odg. odg. odg. A. B. patogene bakterije 427. E. v. odg. D. odg. hranidbena piramida 416. odg. odg. odg. fenotip 398. v. odg. osmoza 412. lišaj 458. v. odg. B. v. populacija 429. D. krapinski pračovjek 433. odg. D. odg. odg. odg. kultura tkiva 407. v. lizosomi i endocitoza 442. E. C. mahovine i prokličnica 459. endocitoza 456. saprofiti 455. B. odg. mutacije 399. odg. mitohondriji 420. leukoplasti 457. sekundarna organska produkcija 415. D 478. v. v. v. B. E. odg. pričvrsnica 476. v. bakterije 439. odg. v. v. C. C. Homo sapiens 451. v. sjemeni zametak i tučak 461. v. v. v. v. odg. plazmoliza 479. A. E. v. odg. odg. odg. virusi 477. v. v. v. odg. A. odg. sorus i paprati 460. v. prirodni rezervat i dodatak 4 436. herbivori i heterotrofi 414. abiotički faktori 450. v. C. v. implantacija jajašca 422. odg. dvosupnice 462. eukarionti 441. D. v. v. odg. v. odg. E. B. E. alge 435. hranidbeni lanac 417. odg. C. v. v. v. odg. prijelazni oblici 463. protalij 480. D. kremenjašice 467. kritosjemenjače 260 . B. bakterije 440. odg. živčana stanica 423. odg. C. B. E. E. odg. v. v. odg. E. C. B. D. odg. v. v. C. Escherichia coli 397. vertikalne zone biosfere 395. v. C. odg. odg. hipertoničan 424. 406. C. odg. B. prokarioti 410. bentoska biocenoza 430. odg. B. mutacija 404. v. odg. B. v. odg. C. A. odg. odg. homologni organi 464. bakteriofag 438. A. C. odg. v. odg. koža 400. odg. živi fosili i ginkgo 447. odg. vitamini 443. D. plod 473. protalij 469. B. v. v. biocenoza 413. bičaši i kremenjašice 466. bakterije 409. odg. odg. autosomi 475. odg. odg. v. C. odg.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ 394. odg. v. D. disanje 419. v. D. B. odg. v. patogene bakterije 403. B. v. virusi 408. v. odg. D. odg. D. E. C. A. v. dvosupnice 472. D. ekosustav 432. v. v. v. mitohondriji 411. virusi i dječja paraliza 437. v. steljnače. modifikacije 452. prašnik 471. menstrualni ciklus 445. v. v. odg. v. v. antropologija 405. C. limfa 421. E. E. A. D. B. v. C. v. odg. odg. odg. v. odg. B. C. v. bakterije 402. plazmidi 453. odg. A. odg. odg. A. A. B. odg. rudimentarni organi 465. v. odg. v. odg. v. Morgan. odg. B. hipotoničan 428. odg. v. v. v. v. v. B. odg. bakteriofagi 396. v. D. E. patogene bakterije i upala pluća 418. A. odg. E. v. fotosinteza 449. vegetacija 474. v. steljka i alge 468. odg. odg. A. eritrocit 434. odg. v. odg. D. virusi 448. B. v. odg. B. v. odg. krapinski pračovjek 431. odg. natalitet 425. v. E. pteridosperme 470. v. A. v. v. odg. neandertalski pračovjek i dodatak 5 446. v. C. odg. v. v. v. C. odg. odg. v. odg. v.

odg. v. C. odg. B. D2 534. odg. psilofiti 483. v. B. B i C. v. vegetacija 498. Krebsov ciklus 523. v. v. odg. odg. prašnik 543. RNA 526. odg. virusi 494. v. v. A. drift 527. relikti 484. v. D. A. A2. B. D i G. E. C1. odg. A3. giberlini 547. v. v. odg. v. neuron 554. odg. E. odg. B. korijen. B. D. v. A. C1. partenogeneza 558. v. v. v. odg. E. A i C. odg. A. populacija 540. spolna određenost potomaka 489. v. odg. A. D. odg. leukociti 518. v. v. odg. odg. A i D. dojenje 533. odg. A i C. B. regeneracija 528. glikoliza 563. odg. odg. D. odg. Jura je ekolog. odg. biljni hormoni. odg. C. D5. v. oligomeria 529. nitrifikacija 503. centriol 499. odg. odg. D. A._______________________________________________________________________ Odgovori 481. B. odg. A i D. C. papratnjače 530. C. A i B. B. odg. v. v. kriptorhizam 504. v. odg. osmotski tlak 560. C. A4. odg. v. C. odg. v. odg. odg. osmoza. v. v. v. A i D. C. v. v. odg. B i E. v. v. odg. odg. enzimi. v. kemoautotrofi 545. odg. sisulja (haustorija). C. škrob 522. vegetativno razmnožavanje 505. v. v. A2. odg. odg. v. odg. B. odg. mutacije 492. mahovine. odg. odg. v. v. A i D. v. v. krvna plazma 519. v. C. odg. v. v. odg. fermentacija 546. v. v. D i F. flora 487. probavni sustav 520. B i D. C. v. v. odg. C. mahovine 486. pubertet 507. odg. 557. D. B1. populacija 513. odg. E. raznožavanjem. fotosinteza 525. odg. paprati 510. odg. v. v. viroidi 495. B4. bubreg 562. odg. v. v. odg. E. odg. B3. B i D. srce 551. odg. odg. odg. odg. A i C. odg. C. odg. odg. vidi bubreg 521. E. virusi 496. hormoni 515. glavonošci 544. C. ekosistem 516. v. v. odg. odg. D3 537. 7 cvjetova 556. v. endokrine žlijezde 514. odg. hemoglobin 550. odg. D2 535. v. glikogen 506. 21 sadnica 555. spermatogeneza 549. v. B. E. ugljikohidrati. odg. gonadotropni i spolni hormoni 564. odg. odg. termoregulacija 508. odg. Vlado je genetičar. odg. odg. bakterije 497. E. v. odg. odg. B i C. v. B. odg. v. odg. B. v. v. odg. B1. A i C. C4. v. v. probava 559. A i C. fototropizam 502. B. A3. v. homeotermni organizmi 531. odg. v. oksihemoglobin. B4. C i E. klica 490. odg. kambij 493. C i E. puči 553. A. srce 532. D i E. v. Ivo je zoolog. zaštita okoliša 512. v. v. antibiogram 561. sedrene barijere 482. D. stanična membrana 524. odg. odg. Božo je mikrobiolog. hranidbeni lanac 552. odg. v. v. fotosinteza 541. katabolizam 501. plošnjaci 542. višestanične životinje 517. rudimenti 491. D. C i D. v. krosingover 488. v. odg. odg. gmazovi i kralježnjaci 548. jetra. jednosupnice 485. C. odg. razvoj čovjeka i dodatak 5 261 . v.C1. E. odg. haustorije 539. v. koacervati 509. B. odg. C3 538. E2 536. C. v. B. fotosinteza 500.

odg. C. spolni hormoni 571. odg. odg. odg. C i E. B. D i F. 17 583. A. v. 37 B) 2. nastije 605.5 min×70 mL×70/min = 3. antikodon 596. C. 12. nitrofiksacija 578. svitkovci 585. x(G) 24 % x(A) 21 % x(C) 20 % x(T) 35 % 582. hidatode 593. HIV 598. v. B. v. B i E. 72 C) 0. 35 D) 2. v. E i F. v. B i C. A i D. gljive 566. v. v. odg. odg. 5. odg. B. 6 dana 581. v. A i E. B i C. odg. 1/16 (0. C i E. 3. dodatak 5 591. odg.9445×105 mL) 586. kambrij. 8. odg. odg. odg. odg. odg. v. mahovine 584. v. v. B i C. C i E. 1760 mušica 579. v. 15. borovi 599. odg.C i E. A i B. odg. nacionalni parkovi i dodatak 4 576. odg. odg. neurohormoni 592. onečišćenje voda 602. odg. v. inzulin 570. odg. v. odg. hranidbeni lanci 597. v. odg. B. A i C. v. 8. v. v. v. gustoća populacije 577. v. odg. odg. v. v. v. C. odg. 40. srce (80. v. odg. odg. kliještari 588. kukci 587. D i F. v. odg. 11 miševa 580. 5. odg. odg. v. C i D. dormancija 573.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ 565. odg. 17. 26. bakterije 603. B. v. odg. odg. saprofagi 575. fotosinteza 572. D. bubreg 590. v. A) 2.0625) 262 . v. sisavci 574. v. odg. odg. a zec ne jede skakavce. v. B i D. odg. v. 24. bakterije 601. 3. odg. bubreg 589. C. jednosupnice 600. odg. F i G.. oblići 595. borovi 567. 10. 8. B. skuša ne jede punoglavce kojih ni nema u moru. B. B i E. odg. 32. odg. 18. svitkovci 568. glikoliza 594. endokrine žlijezde 569. odg. v. C i F. viroidi i prioni 604.

4. bakterije 607. Escherichia coli 608. aminokiselinama. Odgovori: 608. i 7. v. E. v.1. v. peptidna veza 606. aminokiseline 606. Odgovori : 606. kockavica. dvojna dioba 607. 608. v. E.Odgovori na pitanja otvorenog tipa 606.3. v. prašnici.slika 4. peptidi 607.2. cvijet 609. proteini. coli je simbiont u probavilu .1. v. lapovi. U središtu molekule je C (ugljik). bakterije. Odgovori: 607. 23 = 8. v. cvat 608.3. v. v. v.2.4. 8 (osam). peptidna veza. jednake su (klonovi).1..1. cvat je skup cvjetova na istoj cvjetnoj stapci.3. svitkovci 263 .aminokiseline 606. cvat je prikazan na slikama 5.4. latice. v.bakterije 607. Odgovori: 609. o fekalnom onečišćenju.2. 608.protein ili bjelančevina. tučak.

2. v. mitohondrij. v. razvoj zametka izvan vode. vlastita DNA prokariotskog tipa. zagrijavanje. mogućnost umnožavanja neovisno o staničnoj diobi.lizosomi. dušnik. A.amniota i Dodatak 5. alveola 610. mitohondriji 611. škržno ždrijelo i živčana vrpca s leđne strane tijela. nema vakuole.1. B. Odgovori: 610.4. vlaženje i dezinficiranje zraka 610. v. mitohondrij. životinjska stanica. v. v. ošit ili dijafragma. stanično disanje .3. ovojnica (dvostruka membrana). nastaju na golgijevom tijelu (aparatu). v.4. golgijevo tijelo 611.1.2. svojim položajem omogućava promjenu volumena prsnog koša (udisaj – izdisaj) 611. kloroplast 264 .3. svitkovci 609.3. ribosomi. pluća (desno plućno krilo). Odgovori: 611. zbog toga što je u krvi veći parcijalni tlak CO2 nego u alveoli. dišni sustav 610. 610. stanica 611.609. v. ptice i sisavci kao prilagodba na kopneni način života tj. iz parnih peraja (prsnih i/ili trbušnih) 609. C. nema kloroplast. gmazovi.2. v. pročišćavanje.4. svitak barem u jednoj fazi razvitka. sinteza ATP-a. lizosomi. grkljan (ždrijelo). nema staničnu stijenku.

v. vodenu otopinu mineralnih tvari i asimilate (produkte fotosinteze). v. v. Odgovori: 614. nukleoid 613. v.2. asimilacijski parenhim. kvaščeve gljivice 613. list dvosupnice. provodi vensku (deoksigeniranu) krv. Odgovori: 613.2. ima nukleoid. hitinska stijenka kao kod člankonožaca. mali optok krvi 614.1. srce 614. bakterije.3.mješinarke.2.1. v. antibiotici sprječavaju rast i razvoj bakterija. v.4. provodno staničje 616. liječenje bakterioza. nukleoid ili bakterijski kromosom. lijeva klijetka. v. kvasci uzrokuje alkoholno vrenje i pritom nastaje CO2 koji „diže” tijesto. rezervna tvar glikogen. heterotrofnost.1.4. v. bakterije. transpiracija i izmjena plinova. potrebna je najveća snaga da krv potisne u aortu. antibiotik 614. v.612. Odgovori: 615. ateroskleroza 615. nema jezgru niti stanične organele. prokarioti 612.4.3. Odgovori: 616. bakterije. osnovno staničje 615.3. plućna arterija. Slika A . v. uzrokujući suženje krvnih žila povećava krvni tlak. mješinarke. v.2. v. u njemu se odvija fotosinteza. v. prokarioti 612. prokariotski tip. sprječavaju vraćanje krvi. prokarioti 612. puči 615. slična struktura DNA. zelene plijesni (kistac). nukleoid. slika B – stapčarke. 265 .1. prema mrežastoj nervaturi u listu. mali optok. DNA. stapčarke 613. gljive 613. v. v.3. dvosupnice (osobine dvosupnica) 615. zalisci srčani 614. Odgovori: 612.4. v.1. penicilijum.

u citoplazmi. dobivanje energije. Krebsov ciklus 618. v. nema stadija kukuljice.4.4. v. gmazovima.3.v.1. v. v. kukci 617. kukci 616. početna je glukoza a nastaje pirogrožđana kiselina. glikoliza 266 .2. Odgovori: 618. glikoliza 618. kemoreceptori 617. kukci 616. glikoliza 618. Krebsov ciklus ili stanično disanje. v. v. gmazovi 618. potiskivanje hrane u ždrijelo. kukci 616. 617. v. miješanje hrane. hitin. preduvjet za daljnju razgradnju šećera. artikulacija glasa (govor) 617.2.3.1. unutarnja oplodnja i jaja sa zaštitnom ovojnicom.2.3. v. polisaharid – hitin.4. Odgovori: 617.

4. očna pjega. ptijalin 619. eritrociti. v.2. iz modrozelenih algi. rasprsnula bi se. škrob 619.1. hematopoeza 622.2. kloroplast 622. u vodi opterećenoj organskim tvarima. to je ishodišna skupina za biljni (autotrofija) i životinjski svijet (heterotrofija).3. glukoza. Odgovori: 619. v. v. v.2. v.1. v. ako ne obavlja fotosintezu euglena je heterotrofna. stežljivim mjehurićem izbacuje vodu. fotosinteza . grana tilakoidi. v. zgrušavanje krvi. trombociti. Odgovori: 621. trombociti 621. kloroplast 622. zbog razlike u koncentracijama u euglenu prodire voda. krumpir. v. v. stežljivi mjehurići 620. eritrociti 621. cijanobakterija . v. v. koštana srž. biljne stanice. euglena 620. trombociti 621. v. v. Odgovori: 622. F – crvena očna pjega (stigma) je fotoreceptor. škrob 620. simbiogeneza 267 .4. tjestenina ….4.3. Odgovori: 620. škrob. v. bičaši 621.2.4.3.kloroplast i fotosinteza 622. α-amilaza (ptijalin). tilakoidi. v. riža. ne može.619.1.škrob 619. euglena 620. v. koštana moždina.1.3.

nukleinska kiselina. v. C. vrsta. antibiotik. tvorba diobenog vretena. leukocitima. v. C. protisti 624. v.1.4.2. klorofil a (fotosinteza). mitoza 624. aminokiselina. Odgovori : 627.2. E. omogućuje rast organizma. smeđe alge. v. v.4. gljive. smeđe alge. v. crvene alge. E.1. A. Ili 13. Odgovori : 624.3.1. bakterije su postale rezistentne na antibiotik 625. D. bolesnik je prerano prestao uzimati antibiotik. kromosomska garnitura određene vrste.2.3. L. životinje.3. proteini.. centrosom. C. v.4. v.. v.dušikove bakterije 626.623. v. Odgovori: 626. bjelančevina. volvoks (B).1.4. D. B. zbog odnosa simbioze s dušikovim bakterijama.3.4. 12. Pasteur. centriol. B. leukocitoza 625. hrast. rosika. protista. kromosomi su pravilno smješteni u sredini stanice u ekvatorijalnoj ravnini pričvršćeni za niti diobenog vretena. spirogira 627. zelene alge 627. spirogira (C).nitrifikacija 626. metafaza 623.aminokiseline.3. v. Odgovori : 625. crvene alge. nukleinske kiseline 626. kaulerpa (F) 627. provode pravu fotosintezu kojom se oslobađa kisik.1. biljke.kariotip 623. Odgovori : 623. Pasteur. v. zelene alge 268 . v. v. u metafazi. nitrifikacija. 626. vrsta 624. muhara. zec. Escherichia coli. papučica 625. v. venerina muholovka.centrosom 623. volvoks. pogledaj na graf 625. izmjena generacija. karnivorne biljke 627. v. A.2.2. monera.L. carstvo 624. v.

2.4. filtracijom vode. v.3. v. glavonošcima. v. torzijom tijelo je zakrenuto i nestala je simetrija. krvne skupine 629. pretvara se u bijelo tijelo i dolazi do ljuštenja stijenke maternice i menstrualnog krvarenja. eritrociti Odgovori : 631. sitaste cijevi. v. razgradnjom hemoglobina. v. Odgovori: 628. v. v. asimetričan je.4.B. Odgovori : 629. v. AB.gonadotropni hormon 631.2. korijen je pozitivno a stabljika negativno geotropna. krvne skupine 629.1. v.3. v.F.4. v.1. jednosupnice 628. Graafov folikul. glavonošci 629. A. gonadotropni hormon. A.1. v. učvršćuje izdanak. korijen 628. v.glavonošci 629.4.2.školjkaši 629. nema aglutinogena. krvne skupine 629.1. opskrbljuje biljku vodom i mineralnim tvarima. žuto tijelo 269 . krvnoj grupi B. estrogen ili progesteron.3. provodno staničje 628. traheje. Odgovori : 629.Graafov folikul 631.628.2. v. v.jajnici 631.3. puževi 629. tropizmi 629. propadanjem žutog tijela prestaje izlučivanje spolni hormona .

3.1. v. genotip. Katarinin genotip: XD Xd Aa Lukin genotip: XD Y AA v. Odgovori : 632. v.4. fenotip 634. de. DdEe . v. PAPA-test.3. 1.1.3. DE.4. Xd A.3.4. jajovod 632. v. Katarinine gamete: XD A. 1/8 . antikodon. genetička uputa 633. Dihibridno križanje 634.2. A. v. Met .1. de. na grliću maternice.632.genotip. Dodatak 1. Dihibridno križanje i Spolno vezano nasljeđivanje 270 . De.Arg – Pro – Tyr. mejoza 635. menstrualni ciklus 632. Odgovori: 634. Dihibridno križanje i Spolno vezano nasljeđivanje 635. antikodon. peptidna veza. oplodnja.2. Dodatak 1. peptidna veza 633. v. X D a. Dodatak 1. kratka i crna dlaka. Dodatak 1. sinteza proteina 633. prihvaćanje i provođenje jajne stanice od jajovoda do maternice. Dihibridno križanje i Spolno vezano nasljeđivanje 635. DE. Dodatak 1. krosingover 634.1. Odgovori: 635. v. v.2. sekrecijska faza. Odgovori: 633. Higijena spolnih organa. v. upotreba prezervativa pro spolnom odnosu 633. sinteza proteina 634.2. dE. Xd a v. PAPA test 632. genotip. v. v. v. prevođenje ili translacija.4. albinizam. Dihibridno križanje i Spolno vezano nasljeđivanje 635. v.

osmoza.636.najmanja biomasa . hranidbeni lanac 637. hipertonična otopina. metafaza. u zooplanktonu.1. Alenovo pravilo 636. povećanje biomase fitoplanktona dovodi do porasta biomase svih ostalih članova lanca.2.3. različita područja različita boja krzna. mitoza 639. bubrenje 638. hipertonična.1. profaza 639. voda se giba iz područja gdje je ima više u područje gdje je ima manje. Odgovori: 639.1. anafaza 640.3. Odgovori: 637. profaza.1.4.2. osmoza 639. odnosno nema stanične organele. više koncentracije. centrosom 639. mitoza.fitoplankton.2. 2. osmoza 638. v. v. abiotički čimbenici. hranidbeni lanac. osmoza 638. v. bolest. osmoza. centrioli ili centrosom.1. Polarni pojas . sekundarna organska proizvodnja 637.4. najveća biomasa . metafazni kromosomi su dvostruki (imaju 2 kromatide). Odgovori: 636. hranidbeni lanac.lignje. voda (otapalo) se kreće iz područja više koncentracije vode u područje niže koncentracije vode. primarna organska proizvodnja 638. hranidbeni lanac 637. zatopljenje 637.4. zaštitna obojenost 636. promjena: nedostatak hrane. v.4. anafazni kromosomi su jednostruki (imaju 1 kromatidu). v. v. ribama i lignjama.3. v. v. centrioli.B. pasivni prijenos. v. v. temperatura. Umjereni pojas . Odgovori: 638. zaštitna obojenost 636. postupno nestaju jezgrica i jezgrina ovojnica. v. v.C.2. 1.A v. v. v.3. iz kromatina se oblikuju kromosomi. prokarioti 271 . bolja prilagodba okolišu. prokariotska stanice nema jezgru već nukleoid. povećao se volumen stanice. Odgovori: 640. pasivni prijenos. promjena: paraziti. svaka stanica-kćer će imati 48 kromosoma. v. riba. Pustinjski pojas .

4. krvnoj grupi A. sporofit . D-jadranski klobučić. zelene alge. primarna organska proizvodnja.1. pogledaj na graf 641. v. paprati. v. A.4. bjelančevine ili proteini 272 .2.1. Escherichia coli 641.640.3. zato što ta tvorba (protalij) nastaje iz haploidne spore. v. penicilijum. E klamidomonas. F-kaulerpa 642. v. Aleksandar Fleming . B-volvoks. zbog prilagodbe kopnenom načinu života. nema aglutinina.3. 8 ili 9 dana. hranidbeni lanac. citoplazma. zelene alge 642. protalij. v. simbiogeneza 641. ribosomi. v. protalij. stanična membrana.2./ neredovito je uzimao antibiotik. A-morska salata./ nastupila je neka nova infekcija 641. antibiotik. C-spirogira. sporofit. v. v. eukariotske stanice 640.4. v.4. v. Alge su primarni proizvođači i čine osnovu svim hranidbenim lancima u vodenim ekosustavima.4. Odgovori: 643. v. nukleoid 640.. slovom A. penicilin. volvoks. haploidan.3. paprati 643.2.3. paprati 643. Fleming.1.3.2. Odgovori: 644. krvne skupine 644. tj oplodnja je neovisna o posredovanju vodom 644. v.1. 642. mitohondrij. krvna grupa 0 jer nema aglutinogena na eritrocitima. v. 643. Odgovori: 641. v. molekula DNA. prokarioti. Escherichia coli . pacijent je prerano prestao uzimati antibiotik. 642. protalij 643./ bakterije su postale rezistentne na antibiotik. alge. fotosintezom oslobađaju kisik. Odgovori: 642. krvne skupine 644. v. krvne skupine 644. Volvoks je kolonijalni oblik jednostaničnih algi s podjelom rada i predstavlja prijelazni oblik iz jednostaničnih prema višestaničnim organizmima.2.

Odgovori: 647. krvne skupine. v. apsorpcija hrane 645. AIDS 647. Odgovori: 648. Dihibridno križanje i Spolno vezano nasljeđivanje 649.3. gušterača (pankreas). sifilis. oogeneza. v. hemofilija. AIDS (SIDA). polimeraza 647. v. v. povećavaju apsorpcijsku površinu crijeva. DNA-polimeraza.2. v. v.4. jajovod 646. slovom B . eF. krosingover 648. slovom C .3. genotip.4. gušterača. Dodatak 1.2. v. Dodatak 1. komplementarne baze 647. v. v. EeFf. u S fazi. jajovod. upijaju hranjive tvari iz crijevnog sadržaja. v.3. ATGCTGCAT.2.3. slovom A .4. genotip. sifilis (lues). sinteza proteina 648. gonoreja (kapavac). v.2. maternica 646. v.3. v. Ef.1. žuč 645. Y0. Xh B. Xh A. interfaza 647.645. u njoj se razvija razvoj zametka (embrio – fetus). ef. genotip 648. v.2. Martine gamete XH A. Petrove gamete XH 0. homologni kromosomi. tanko crijevo. v. v. AUGCUGCAU. v. slovo D. emulgiranje (raspršivanje) masti u sitne kapljice čime se olakšava djelovanje lipazama. imaju pričvrsnicu na istome mjestu. ciroza jetre 646. gonoreja.1. alkoholizam. 648. duga stabljika. Odgovori: 645. Dihibridno križanje i Spolno vezano nasljeđivanje 649. Petrov genotip XH Y 00.1. fenotip 649. proizvodnja jajnih stanica (oogeneza) / lučenje ženskih spolnih hormona (estrogen i progesteron). izgledom su jednaki i nose gene za ista svojstva. Homologni kromosomi su parovi kromosoma koji su jednako dugački. bijeli cvijet . v. gušteračin sok 645. XH B. endokrine žlijezde 646. 273 . Odgovori: 649.1. jajnici. Odgovori : 646. Martin genotip XH Xh AB.4. žučni mjehur.1. EF.

povećanje biomase riba i liganja. Bergmanovo pravilo. Dihibridno križanje i Spolno vezano nasljeđivanje 649. 652. zubi u kljunu. analogni organi 650. Pohranjivanje energije. hranidbeni lanac 652. primarna organska proizvodnja. Primarna organska proizvodnja je sinteza organske tvari iz anorganske a odvija se u autotrofnim organizmima (zelene biljke).4. Bergmanovo pravilo 651. predaka današnjih gmazova. Bergmanovo pravilo 651. v. zaliha energije. B-uz Patagoniju (posljednji. grebenkama. Odgovori: 653.1. izvor energije. Odgovori: 651. pune kosti. dok je sekundarna organska proizvodnja ona koja se odvija u heterotrofnim organizmima (životinje). v. primarna organska proizvodnja. biljojedi – zooplankton. v. kandže na krilima.4.1. Odgovori: 652. v. analogni organi.4. v. v. v.3.1. 650. v. Dodatak 1. v. Dihibridno križanje i Spolno vezano nasljeđivanje 650. kralješnica u repu. A-uz Čile (pretposljednji kvadratić).4. v. vjerojatnost je 1/8. sekundarna organska proizvodnja.2.v. v. najjužniji kvadratić) 651. 653. v. skladištenje energije. iz pragmazova.2. vrste koje žive sjevernije.3. ATP 274 . U proljeće se očekuje veća biomasa fitoplanktona zbog viših temperatura i više svjetla ( veći intenzitet fotosinteze i veće razmnožavanje).2. novočeljuske 652. Dodatak 1. nastala su iz pokrovnog tkiva (kože).3.1. praptica 651. bliže ekvatoru su manje a vrste koje žive bliže južnome polu su krupnije. 650. Odgovori: 650. hranidbeni lanac 652. mesojedi – riba i lignja v.

Odgovori: 656. bakteriofagi 656. anafaza I. jezgra. centrioli 654. U vezama između fosfata. mejoza. v. kloroplast. v. cijepljenje. na Golgijevom aparatu (tijelu). v. označena slovom B.1.2. praživotinje 657. svjetlosne reakcije fotosinteze. papučica. v. 656. u plodnici tučka. cvijet 658.4.653.2. list 275 . v.2. v. bakteriofag. v.. spermatogeneza 655.1. imunizacija 656.4. v. v. v.4. stežljivi mjehurić. v. endoplazmatska mrežica 654. v. stežljivi mjehurić 657. jezgra. v. v. Odgovori: 658.2. centriol. profaza I. između fosfatnih skupina. v. 655. u sjemenicima (testisima). kloroplast 654. mejoza II. stanično disanje. anafaza I. slovo E. Krebsov ciklus. glikoliza. v. tučak 658.3. mejoza. imunizacija. v. mitohondrij. bakterijski virus. Odgovori: 654. prioni 657. cvijet 658. ATP 653. hrapava (zrnata) endoplazmatska mrežica (retikulum). Odgovori: 655. mejoza I. oksidativna fosforilacija. trepetljikaši.4. pelikula. Odgovori : 657. v. crossing-over.1. fag. Mitohondrij. 655.3. dvospolni cvijet. u sjemenom zametku.3. 658. slovo C ili mitohondrij slovo F. vrenje. v. pelikula 657. bakteriofagi 656.3. Van Leeuwenhoek A.. latica ili vjenčić..1. fotosinteza 653.. sklapanje i sazrijevanje novih virusnih čestica – D. mejoza. vezanje virusa na površinu bakterije – B. A.2.3. prioni.4. mitohondrij 654.2. vakcinacija. Glikoliza. centrosom. disanje. v. cijepljenje. van Leeuwenhoek. centrosom. slovo B. mejoza I. krosingover. v. preobrazbom listova. Golgijevo tijelo 655.4. slovo D. kontraktilna vakuola. v.3.1. v. trepetljikaše (Ciliata).

4. antidiuretički hormon 660. suha koža prekrivena rožnatim ljuskama. adenohipofiza 661. Odgovori: 661.2. akromegalija 661. slovo C. endokrine žlijezde. hipofiza. v. izlučuju u probavilo. nesu jaja. uremija 661. glomerul. filtriranje krvi. v. gigantizam. v. v. aminokiseline. veće koncentracije.3. amniota 660.659. hormon rasta. v. proteini.1. ptice 659. ptice. prsni greben. v. novočeljuske. a egzokrine svoje produkte (npr.4. ptice. v. v. nefron 660. adenohipofiza 661. somatotropni hormon ili hormon rasta. akromegalija. prednji udovi preobraženi u krila. slovo A. ptice 659. gmazovi.1. uremija.4. hipofiza.3. v. šuplje (pneumatične) kosti. hipertonična. koncentriranija. Odgovori: 659. adenohipofiza.2. amniota. novočeljuske 659. v. grebenke. v. Odgovori: 660.3. gigantizam. letačice. unutarnja oplodnja. probavni enzimi 276 . endokrine svoje produkte (hormone) izlučuju u krv.1. lake kosti. aminokiseline 660.2. probavne enzime).

po prisutnosti Y kromosoma tj. DNA i proteini. blastoderm 662. v. Odgovori: 664. ektoderm. spermiji.1. kariotip 663. gastrulacija.3. genotip.. e+evg+vg. genotip 277 . v. endoderm (unutarnji listić) v. mejoza I.3. i 662.1. zigota 662. spermatogeneza. oplodnja. v.662. vinska mušica.1. kromosomska garnitura 664. metafaza 663. ektoderm (vanjski listić). mejoza. v. kariogram muškarca. 22 autosoma (tjelesna kromosoma) i 1 gonosom (spolni kromosom) 22 + 1.2. mezoderm. eevgvg.4. brazdanje. blastula. v. oogeneza. Odgovori: 663. v. brazdanje. gamete 664.2. v. kromosomi 663. blastulacija. jajna stanica.4.2. endoderm 663. po spolnim kromosomima X i Y v. metafaza. Odgovori : 662. mezoderm (srednji listić).

Odgovori : 666. puči 667.S.4. cvijet 667. približno 4 . crno tijelo i ravna krila dulja od tijela.. miris. v. v.664. Dodatak 3.4.2. praatmosfera 666. evaporacija. isparavanje.4. transpiracija. 667. praatmosfera 665.4.2. prekrivena smolom. stvaranje vodene pare A . Miller. metan. vodena para. Odgovori : 667.1.3. v.4. (igličasti list). Odgovori: 665. Thomas Morgan 665. 4-6 °C 666. stvaranje složenih organskih spojeva iz jednostavnih organskih ili anorganskih spojeva. četinjače 667. v.1. „prajuha” C. v. v. praatmosfera B . amonijak. mala površina lista.2.3.1. 300 666.3. 278 . v. praatmosfera 665. boja. transpiracija.5 milijardi godina. v. biogeni elementi. fenotip 664. v. evolucija 665.3. 23-25 °C 666.

_________________________________________________________________________ Dodatci DODATCI 279 .

ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ 280 .

DIHIBRIDNO KRIŽANJE S DOMINACIJOM Aleli: za vrstu boje: crna = A._________________________________________________________________________ Dodatci DODATAK 1 U ovom dodatku prikazani su shematski primjeri koji su opisani pod određenim pojmom u Leksikonu. smeđa = a za raspored boje: jednobojno = B. pjegavo = b 281 . Pod tim istim pojmom svrstani su i u ovom dodatku.

ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ MONOHIBRIDNO INTERMEDIJARNO KRIŽANJE Aleli: za crveno = a1 za bijelo = a2 282 .

_________________________________________________________________________ Dodatci MONOHIBRIDNO KRIŽANJE S DOMINACIJOM Aleli: za visok rast = A za nizak rast = a 283 .

xx = prenositelji xx = bolesna xx = zdrava muška djeca xy = bolesna xy = zdrava 1.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ SPOLNO VEZANO NASLJEĐIVANJE ženska djeca xx. Primjer 2. Primjer 284 .

Primjer 4._________________________________________________________________________ Dodatci 3. Primjer 285 . Primjer 5.

Aa = testirane jedinke aa = recesivni homozigot AABB.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ TEST KRIŽANJE AA. AaBb = testirane jedinke aabb = recesivni homozigot za oba svojstva 286 .

žuta = z za oblik sjemenke: glatki = G._________________________________________________________________________ Dodatci TRIHIBRIDNO KRIŽANJE S DOMINACIJOM Aleli: za rast: visok = V. 287 . nizak = v za boju sjemenke: zelena = Z. naborani = g Tablični prikaz F2 generacije VZG VZG VVZZG G 1 VZg VVZZGg 1 VzG VVZzGG 1 Vzg VVZzGg 1 vZG VvZZGG 1 vZg VvZZGg 1 vzG VvZzGG 1 vzg VvZzGg 1 VZg VzG Vzg VVZZGg VVZzGG VVZzGg 1 1 1 VVZZgg 2 VVZzGg 1 VVZzgg 2 VvZZGg 1 VvZZgg 2 VvZzGg 1 VvZzgg 2 VVZzGg 1 VVzzGG 3 VVzzGg 3 VvZzGG 1 VvZzGg 1 VvzzGG 3 VvzzGg 3 VVZzgg 2 VVzzGg 3 VVzzgg 4 VvZzGg 1 VvZzgg 2 VvzzGg 3 Vvzzgg 4 vZG vZg vzG vzg VvZZGG VvZZGg VvZzGG VvZzGg 1 1 1 1 VvZZGg 1 VvZzGG 1 VvZzGg 1 vvZZGG 5 vvZZGg 5 vvZzGG 5 vvZzGg 5 VvZZgg 2 VvZzGg 1 VvZzgg 2 vvZZGg 5 vvZZgg 6 vvZzGg 5 vvZzgg 6 VvZzGg 1 VvzzGG 3 VvzzGg 3 vvZzGG 5 vvZzGg 5 vvzzGG 7 vvzzGg 7 VvZzgg 2 VvzzGg 3 Vvzzgg 4 vvZzGg 5 vvZzgg 6 vvzzGg 7 vvzzgg 8 Brojevima od 1 do 8 označeno je 8 različitih fenotipova F2 generacije.

recesivni = a dominantni = B.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ VEZANI GENI Aleli: za jedno svojstvo: za drugo svojstvo: dominantni = A. recesivni = b AB = vezani geni ab = vezani geni 288 .

Broj rješenja odgovara broju zadatka. Aleli: za crnu boju krzna = A. za bijelu boju krzna = a Potomci genotipa AA i Aa su s crnim krznom. 13._________________________________________________________________________ Dodatci DODATAK 2 U samim opisima pojmova iz Leksikona dana su pravila i rješenja po jedog od tipičnih primjera za svaki pojam. Zato su u ovom dodatku dana rješenja onih zadataka koji su konkretni primjeri pojedinih pojmova. a potomak genotipa aa je s bijelim krznom. 289 . Monohibridno križanje s dominacijom gdje je alel za crnu boju krzna dominantan.

za bijelo =a2 Križanjem ružičaste (a1a2) zijevalice i bijele (a1a1) zijevalice nastaje 50 % crvenih (a1a1) i 50 % ružičastih (a2a1) zijevalica.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ 50. recesivni = a za drugo svojstvo: dominantni = B. Monohibridno intermedijarno križanje gdje nema dominantnog alela. Aleli: za crveno = a1. 192. U ovom slučaju omjer vrijedi samo za drugo svojstvo koje smo označili B i b. recesivni = b Križanjem roditelja aaBb i aaBb moguće je dobiti potomstvo s dva različita fenotipa u omjeru 3:1. Aleli: za jedno svojstvo: dominantni = A. 290 . Dihibridno križanje s dominacijom. 56.

a ostala su djeca normalne pigmentacije (aA. AA) može se dobiti potomstvo u kojem su sva djeca. Monohibridno križanje s dominacijom. aa) i žene normalne pigmentacije (baka. AA._________________________________________________________________________ Dodatci 248. aA) i muškarca normalne pigmentacije i istog genotipa (Aa) dobiva se četiri potomka (unuka) među kojima je jedno dijete albino (aa). Iz odnosa žene normalne pigmentacije (kći. Aleli: za jedno svojstvo: dominantni = A. Aleli: za normalnu pigmentaciju = A za izostanak pigmentacije = a U ovom slučaju iz odnosa albino muškarca (djed. 291 . normalne pigmentacije i genotipa aA. 251. recesivni = b Križanjem genotipa Aabb s aaBa dobit će se potomstvo s četiri različita fenotipa. recesivni = a za drugo svojstvo: dominantni = B. Dihibridno križanje s dominacijom. pa tako i njihova kći. Aa).

Trihibridno križanje s dominacijom. 253. recesivni = b za treće svojstvo: dominantni = C. recesivni = b za tre}e svojstvo: dominantni = C. Trihibridno križanje s dominacijom. 292 . recesivni = a za drugo svojstvo: dominantni = B. Aleli: za jedno svojstvo: dominantni = A. recesivni = c Svo potomstvo dobiveno križanjem roditelja AAbbCC i aaBBcc ima isti genotip AabBCc zato jer svaki od roditelja stvara samo jednu vrstu gameta. recesivni = c Križanjem roditelja AaBbCC u F1 generaciji nastaju četiri fenotipa u omjeru 9:3:3:1. recesivni = a za drugo svojstvo: dominantni = B. Aleli: za jedno svojstvo: dominantni = A.ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ 252.

293 . U ovom slučaju omjer vrijedi samo za svojstvo koje je označeno s A i a. Dihibridno krianje s dominacijom Aleli: za jedno svojstvo: dominantni = A._________________________________________________________________________ Dodatci 361. recesivni = b Roditelji AaBB i Aabb dat }e potomke čiji je omjer fenotipa 3:1 za jedno od spomenutih svojstava. recesivni = a za drugo svojstvo: dominantni = B.

ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ 294 .

vanadij. fluor. silicij. bor. cink. molibden. kalcij. jod. BIOGENI ELEMENTI Elementi su jednostavne čiste tvari koje se ne mogu kemijskim putem rastaviti na druge čiste tvari. To su abecednim redom: arsen. stroncij. dušik. ugljik. mangan. sumpor. kisik. natrij._________________________________________________________________________ Dodatci DODATAK 3 ELEMENTI. krom. magnezij. kobalt. klor. kalij. nikal. IME aktinij aluminij antimon arsen bakar barij berilij bizmut bor brom cerij cezij cirkonij disporzij dušik europij fluor fosfor gadolinij galij hafnij helij holmij indij SIMBOL Ac Al Sb AS Cu Ba Be Bi B Br Ce Cs Zr Dy N Eu F P Gd Ga Hf He Ho In IME itrij jod kalcij kalij kisik klor kobalt kripton krom ksenon lantan litij lutecij magnezij mangan molibden neodimij neon nikal niobij olovo osmij paladij platina SIMBOL Y I Ca K O Cl Co Kr Cr Xe La Li Lu Mg Mn Mo Nd Ne Ni Nb Pb Os Pd Pt IME praseodimij prometij radij renij rubidij rutenij samarij silicij skandij srebro stroncij sumpor tantal tehnecij telur titan tulij ugljik vanadij vodik zlato željezo živa SIMBOL Pr Pm Ra Re Rb Ru Sm Si Sc Ag Sr S Ta Tc Te Ti Tm C V H Au Fe Hg Od navedenih elemenata dio njih je potreban u izgradnji živih organizama pa ih nazivamo biogeni elementi. U tablici su dani svi elementi koji se javljaju u prirodi. selen. Oni se kemijskim reakcijama spajaju dajući spojeve. vodik i željezo.elementarni sastav. Isp. bakar. 295 . fosfor.

ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ 296 .

dio Biokova i dio Velebita npr. Spomenici prirode 7. Risnjak. Lonjsko polje. runolist. Brusnik. Zlatni rt Rovinj. otok Lokrum. Pakleni otoci npr. Zeleni vir. velebitska degenija. tisa npr. Kornati. Nacionalni parkovi 3. Strogi prirodni rezervati 2. Značajni krajolici 9. dio Medvednice. Cerovačke pećine npr. Mljet. kockavica. medvjed. bjeloglavi sup 297 . kanjon Zrmanje i Čikole npr. Opeka Vinica._________________________________________________________________________ Dodatci DODATAK 4 KATEGORIJE ZAŠTITE PRIRODNE BAŠTINE HRVATSKE KATEGORIJA ZAŠTITE 1. Brijuni. otok Jabuka. Paklenica. Perivoj Maksimir npr. Modra špilja. Gupčeva lipa. vidra. Krka i Sjeverni Velebit Kopački rit. Specijalni rezervati 5. vuk. Trsteno. Parkovi prirode 4. jež. Marjan Split. Park-šume 6. Trakošćan npr. Hortikulturni spomenici 8. Pojedine vrste a) biljne b) životinjske BROJ 2 8 6 69 23 72 114 28 44 360 POLOŽAJ Hajdučki i Rožanski kukovi na Velebitu te Bijele i Samarske stijene na Velikoj kapeli Plitvička jezera. Vražji prolaz.

ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ 298 .

_________________________________________________________________________ Dodatci DODATAK 5 GEOLOŠKA VREMENSKA SKALA I FOSILNI ZAPISI PRVIH POJAVA POJEDINIH SKUPINA ŽIVIH BIĆA Geološki eoni Geološke ere KENOZOIK MEZOZOIK Geološke periode Kvartar Tercijar Kreda Jura Trijas Perm Karbon Devon Silur Ordovicij Kambrij Početak (prije milijuna godina) 2 65 120 155 190 215 300 350 390 480 550 2500 4500 FANEROZOIK PALEOZOIK PRETKAMBRIJ PROTEROZOIK ARHEOZOIK Fosilni zapisi prvih pojava pojedinih skupina organizama Geološke periode Kvartar Tercijar Kreda Jura Trijas Perm Karbon Devon Silur Ordovicij Kambrij Proterozoik Arheozoik Ribe Eukarioti. vodeni beskralježnjaci Prokarioti Kralježnj aci Čovjek Beskralježnjaci Biljke Ptice Sisavci Gmazovi Vodozemci Kukci Kritosjemenjače Golosjemenjače Papratnjače Mahovine Gljive Kopnene biljke (psilofiti) Alge 299 .

ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ JEDNO OD MOGUĆIH FILOGENETSKIH STABALA ČOVJEKOVIH PREDAKA KVARTAR gornji pleistocen Homo sapiens Homo sapiens neanderthalensis srednji pleistocen Homo erectus Paranthropus robustus donji pleistocen Australopithecus africanus pliocen Rhamapithecus punjabicus miocen TERCIJAR 300 .

_________________________________________________________________________ Dodatci DODATAK 6 TEMELJNA PODJELA GLJIVA. BILJKI I ŽIVOTINJA GLJIVE (Fungi) Sluznjače Algašice Mješinarke Stapčarke Gljive Lišajevi BILJKE (Vegetabilia) NIŽE BILJKE ILI STELJNJAČE Bičaši Kremenjašice Zelene alge Smeđe alge Crvene alge Mahovine VIŠE BILJKE ILI STABLAŠICE Papratnjače Sjemenjače Paprati Preslice Crvotočine Golosjemenjače Kritosjemenjače 301 .

ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________ ŽIVOTINJE (Animalia) JEDNOSTANIÈNE ŽIVOTINJE Praživotinje Bičaši Sluzavci ili Korijenonošci Truskavci Trepetljikaši MNOGOSTANIÈNE ŽIVOTINJE Spužve Plošnjaci BESKOLUTIĆAVCI Žarnjaci Oblenjaci Mekušci Kolutićavci Člankonošci Bodljikaši Žiroglavci Plaštenjaci Svitkoglavci Kružnouste Ribe Vodozemci Gmazovi Ptice Sisavci MNOGOKOLUTIĆAVCI MALOKOLUTIĆAVCI SVITKOVCI Kralježnjaci 302 .

Sign up to vote on this title
UsefulNot useful