Héctor Rocha L.

Principios de Medicina Molecular

796

Héctor Rocha L. Principios de Medicina Molecular

GENES 1 1) HERRAMIENTAS DE LA BIOLOGÍA CELULAR 800

a) EMPLEO DE ALGUNAS ENZIMAS

802

b) AMPLIFICACIÓN POR CLONACIÓN

803

c) BIBLIOTECAS DE GENES

806

d) ANÁLISIS DE LOS PRODUCTOS CLONADOS

806

e) AMPLIFICACIÓN POR REACCIÓN EN CADENA DE LA POLIMERASA (PCR)

808

f) SECUENCIACIÓN DEL DNA

813

2) MARCADORES MOLECULARES QUE NO SON GENES

814

a) RFLP (Restriction Fragment Length Polymorphism) o Polimorfismo en el Largo del Fragmento de Restricción 815 b) VNTR (Variable Number Tandem Repeats) o Reticiones en Tandem (una tras otra) de Número Variable 816 c) RAPD (Random Amplified Polymorphic DNA) o DNA Polimórfico Amplificado al Azar 818 d) AFLP ( Amplified Fragment Length Polymorphism ) Polimorfismo en el Largo del Fragmento Amplificado 818 e) STS (Sequence Tagged Site) o Sitio Marcado por la Secuencia 819 819

f) EST por Expresed Sequence Tag o Expresión de la secuencia marcadora g) MARCADORES MICROSATÉLITES 821

797

Héctor Rocha L. Principios de Medicina Molecular

GENES 2

3) APLICACIONES EN LA MEDICINA MOLECULAR a) MUTACIONES b) CARIOTIPO 825 828 829

823

c) EL PROYECTO GENOMA HUMANO d) MAPEO DE LOS GENES 829

e) MAPEO LIGADO A MARCADORES

830

f) EMPLEO DE RFLP POR RESTRICTION FRAGMENT POLYMORPHISM O POLIMORFISMO EN EL LARGO DE LOS FRAGMENTOS g) MAPEO DE UN GEN 833 831

h) EMPLEO DE VNTRS POR VARIABLE NUMBER TANDEM REPEATS O REPETICIONES EN TANDEM DE NUMERO VARIABLE 834 i) MAPAS FISICOS O MAPAS DE ADN j) MAPA CITOGENETICO k) LA HIBRIDACIÓN IN SITU 837 838 839 837

l) FISH POR FLUORESCENCE IN SITU HYBRIDIZATION m) MAPEO TOP-DOWN n) MAPEO BOTTOM-UP 840 841

4) GLOSARIO

844

798

Héctor Rocha L. Principios de Medicina Molecular

799

Héctor Rocha L. Principios de Medicina Molecular

1) HERRAMIENTAS DE LA BIOLOGÍA MOLECULAR

La Medicina Molecular se caracteriza por estudiar las enfermedades y su curación a nivel molecular. Para ello emplea las herramientas de la Biología Molecular y la Bioquímica aplicadas tanto en el estudio de las Proteínas como de los Ácidos Nucleicos. Entre estas herramientas podemos empezar por aquellas enzimas denominadas Endonucleasas de Restricción. Estas enzimas son originalmente empleadas por las bacterias para defenderse de las infecciones causadas por Fagos, es decir las bacterias restringen a los Fagos.

Eco R1 5’ G A A T T C 3’ 3’ C T T A A G 5’

Hae III 5’ G G C C 3’ 3’ C C G G 5’

Hind III 5’ A A G C T T 3’ 3’ T T C G A A 5’

Bam H1 5’ G G A T C C 3’ 3’ C C T A G G 5’
: Sitios de corte

Fig. 1 - 16. Secuencias de corte reconocidas por distintas Endonucleasas de Restricción.

Así, cuando aparecen secuencias de DNA que el fago ha introducido en la bacteria, se produce el corte de estas mientras que las secuencias similares, propias de la bacteria se metilan para no ser reconocidas por la misma enzima. A su vez los sitios de corte, se caracterizan por estar flanqueados por secuencias cortas de simetría bicatenaria. Una vez ocurrido el corte, ambos extremos pueden formar lados asimétricos o cohesivos. Sin embargo, otras enzimas de restricción cortan en el mismo sector en ambas hebras quedando ambos lados romos.

800

Héctor Rocha L. Principios de Medicina Molecular

Las Endonucleasas de Restricción son más de 400 y reconocen y cortan cerca de 100

sitios diferentes. Algunos de estos sitios, se encuentran frecuentemente o cada unos cuantos cientos de pares de bases, mientras que otros se hallan esporádicamente, cada 10.000 pb

Vector cortado por Hind III Fragmento cortado por Hind III DNA del Vector

Unión entre DNA del vector y fragmento Empleando la enzima Ligasa

Molécula de DNA Recombinante Recombinante introducido a la bacteria

DNA Recombinante Cromosoma Bacteriano

Fig. 2 - 16. Concepto de DNA recombinante destinado a ser amplificado por clonación.

801

Héctor Rocha L. Principios de Medicina Molecular

En promedio las enzimas de restricción cortan en sitios reconocidos que tienen 4, 6 y 8 pares de bases (fig. 1 – 16), produciendo segmentos sucesivos de 256, 4000 y 64.000 bases de largo en el genoma humano. Las endonucleasas de restricción hicieron posible la tecnología del DNA recombinante (fig. 2 – 16), ya que con estas enzimas se pueden cortar segmentos de DNA que tengan distintos orígenes y posteriormente juntarlos y proceder a ligarlos, empleando una enzima denominada Ligasa, que produce la unión 3´, 5´ Fosfato o en otras palabras, forma el Fosfodiester. Posteriormente, bajo las condiciones adecuadas (alta concentración de CaCl2 , etc) las moléculas de DNA recombinante pueden entrar a las bacterias y replicarse, autónomamente o bien pueden integrarse al cromosoma celular. Volver al inicio a) EMPLEO DE ALGUNAS ENZIMAS Algunas enzimas de E.Coli se emplean para el manejo de los fragmentos de DNA con que se trabaja en la Medicina-Molecular. Así tenemos que el DNA puede ser sometido a varios tratamientos, se puede marcar con grupos Fosfatos como P32 (así se lo ubica en una radioautografía), se puede amplificar con los cebadores adecuados (para aumentar Tabla 1 - 16 Enzima Actividad Transcriptasa Inversa DNA polimerasa RNA dependiente de origen viral

DNA Ligasa

Fosfatasa Alcalina

Une covalentemente la unión Fosfodiester 5´ Fosfato al grupo 3´ Hidroxilo Elimina fosfatos del extremo 5´ del DNA

Uso Se emplea para convertir RNAm en su copia complementaria de DNAc continuo Se emplea en los procedimientos donde se requiere DNA recombinante Se emplea para reemplazar el fosfato 5´ por otro radiactivo

Polinucleótido kinasa Introduce el γ Fosfato de ATP en el extremo 5´ del DNA DNA polimerasa termoestable Tac (Thermophylus que resiste los cambios de Acuaticus) DNA temperatura para abrir polimerasa (desaparear ambas hebras) y cerrar (aparear hebras complementarias) el DNA

Endonucleasas de Restricción

Técnica PCR (Polymerase Chain Reaction) Amplifica ambas hebras de un segmento de DNA, a partir de unos cebadores sintéticos (de secuencia conocida) que se aparean con su parte complementaria. Al repetir el proceso en ciclos de frío (apareamiento) y calor (desapareamiento) de las hebras Reconocen sitios de simetría DNA recombinante, mapeo, bicatenaria de 4, 6 y 8 pbs cortan etc. dejando lados cohesivos y romos

802

Héctor Rocha L. Principios de Medicina Molecular

su número de copias), transcribir desde RNA a DNA (se emplea una Transcriptasa Inversa de un retrovirus) o se puede cortar en lugares específicos (con Endonucleasas de Restricción). Algunas de estas enzimas se observan en la Tabla 1 - 16. Volver al inicio b) AMPLIFICACION POR CLONACION

Uno de los vectores (fig. 3 – 16), que se emplea para introducir DNA exógeno o foráneo a la bacteria es el Plásmido, mientras que el DNA foráneo puede ser DNAc (Ver Glosario al final), obtenido de un RNAm (por Transcriptasa Inversa) o DNA genómico (fragmentos de DNA al azar de un organismo). Es posible aquí sintetizar una segunda hebra al DNAc con una DNA pol I y luego se pueden insertar ambas hebras en un Plásmido o un vector Lambda, para ser posteriormente amplificado por clonación. La clonación se lleva a cabo en vectores contenidos en levaduras, bacterias y partículas virales. El empleo de uno u otro dependerá del tamaño del fragmento a clonar. El Plásmido (fig. 3 –16), es normalmente conocido por ser un DNA doble hebra circular extracromosómico y autoreplicante de la bacteria, es distinto al genoma normal y no es esencial para la sobrevivencia de la célula. Son conocidos por conferir ventajas selectivas a la bacteria (resistencia a antibióticos).

Ori C Vector pBR322

Resistencia a la Ampicilina

PLASMIDO

Resistencia a la Tetrac iclina

Fig. 3 - 16. Características del vector pBR322

Los Plásmidos pueden ser transferidos de célula en célula y algunos de ellos se pueden integrar al genoma de la bacteria. Una célula huésped puede tener muchas copias de un plásmido. En la actualidad existe una serie de plásmidos artificialmente construidos, que cuentan con sitios específicos para cargar DNA foráneo y se pueden seleccionar al entregar a la bacteria resistencia a algún antibiótico. Esto permite separar aquellas bacterias que han adquirido el Plásmido de las otras que no. Algunos de estos plásmidos, pueden también ser replicados en levaduras. Otros Plásmidos constituyen lanzaderas que son capaces de replicar tanto en E. Coli como en levaduras y son conocidos por las siglas YIP o Yeast Integrating Plasmid, YRP por Yeast Replicating Plasmid, YEP por Yeast Expression Plasmid y aún por el nombre

803

Héctor Rocha L. Principios de Medicina Molecular

de YCP por Yeast Centromer Plasmid. El uso de cualquiera de ellos depende del tamaño del segmento de DNA que se quiera amplificar. Mediante los plásmidos se puede crear una biblioteca genómica o colección no ordenada de clonos formada por fragmentos superpuestos de DNA amplificado, perteneciente a un organismo cualquiera. La relación de unos con otros de los fragmentos se puede establecer posteriormente por mapeo físico, hasta poner orden en la biblioteca, es decir tener una colección de fragmentos amplificados, pero contiguos. Esto significa que donde termina la secuencia de uno empieza la del otro. Esta colección debe corresponder en total, a un sector específico de un gen. Los clonos individuales (fragmentos amplificados) se colocan en placas de microtitulación en dos dimensiones con múltiples pocillos en el plano, donde la ubicación de cada uno es conocida por el número de la fila y columna, fig. 35 - 16. Otro vector a emplear, puede ser una partícula viral o un bacteriófago como el fago Lambda que contiene 40kb de DNA doble hebra (fig. 4 – 16). A este se puede integrar DNA humano de un tamaño que bordea las 15 a 25kb. Esto se logra por acción de la misma endonucleasa de restricción y posterior unión mediante la enzima Ligasa. Posteriormente al infectar una bacteria y entrar en la etapa lítica se generan nuevas copias del fago que se amplificará junto con el DNA humano, produciendo tantas copias como partículas virales existan. Otro bacteriófago, es el conocido como P1, que puede acomodar más DNA que el Lambda y constituye el tipo P1- PAC por P1- Plasmid Artificial Chromosome o cromosoma artificial de plásmido.
Forma lineal Bacteriópfasgo Lambda Cos: Lados Cohesivos Cos: Lados Cohesivos. La hebra es complementaria al otro extremo

OP RS
Secuencia de cabeza y cola Región b2. Genes No esencial Rec. para Implica sobreviven dos en cia recombi nación Secuencia de cabeza y cola Genes de Regulación son genes que inician y terminan el proceso Región b2 no esencial para la sobrevivencia Genes Rec. Implicados en Recombinación Genes de Regulación Lados Cohesivos

RS OP

RS: Lísis del huesped OP: Sints. DNA

Forma circular del Bacteriófago Lambda

Fig 4 — 16. Caracteríosticas del fago Lambda.

804

Héctor Rocha L. Principios de Medicina Molecular

Un vector aún, de mayor capacidad que los anteriores se denomina Cósmido, y se encuentra construido artificialmente de forma quimérica o mixta con genes del plásmido, para resistencia a antibióticos y otros del Fago Lambda como transportador. Contiene el gen cos (Cohesivo) del fago, cuya actividad promueve el empaquetamiento del DNA foráneo en la partícula viral para posteriormente infectar una bacteria tipo E. Coli, lo que permite la replicación del DNA foráneo con fragmentos de 30 Kb a 45 Kb de largo. Continuando con la descripción de los vectores, tenemos a los YAC, por Yeast Artificial Chromosome (fig. 5 – 16) o cromosoma artificial de levadura. Contiene todos los elementos que un DNA necesita para funcionar como cromosoma en el organismo huésped y se puede cargar con uno de los mayores fragmentos de 400 Kb a 500 Kb. Se encuentra construido con un fragmento telomérico, que entrega los extremos necesarios para la replicación, más fragmentos centroméricos y las secuencias correspondientes, que indican y promueven el sitio de origen de la replicación que es necesario en la levadura (YCP + Telómeros). También contienen genes que se emplean en la selección de las levaduras que sí han tomado el vector. A fin de propagar estos vectores en E. Coli antes de cargarlos con DNA, se les ha incorporado un sitio denominado Ori C o de inicio u origen de la replicación bacteriana y un gen que les entrega resistencia a la Ampicilina. Este último se emplea para seleccionar las bacterias que han tomado el YAC.
SECUENCIA DE REPLICACION AUTÓNOMA Sitio Ori de plasmido y gen Amp

CENTROMERO Eco R1 Marcador de Selección

Telomerasa

Telomerasa

Bam H1
Fig. 5 - 16. Características del YAC.

Bam H1

En general una vez que se tiene el DNA humano integrado, mediante el empleo de las Endonucleasas de Restricción y Ligasas en un vector, se procede a amplificarlo mediante la Clonación, proceso por el cual se producen múltiples copias exactas de un solo gen u otro segmento del DNA para así obtener suficiente material de estudio. El resultado de esta amplificación en distintos segmentos de DNA genera una biblioteca de clonos o colección de clonos hechos de una serie de fragmentos de DNA que se superponen representando el genoma entero del organismo.

805

Héctor Rocha L. Principios de Medicina Molecular

Otro tipo de clonación ocurre cuando se divide una célula haciendo múltiples copias de sí misma y este es el caso de la conocida oveja Dolly. En este caso se recurrió a la clonación produciendo animales genéticamente idénticos a la oveja donadora de los núcleos de células mamarias, los que fueron posteriormente implantados en oocitos fecundados. Volver al inicio

c) BIBLIOTECAS DE GENES. El objetivo de la clonación, fuera de amplificar copias del DNA sirve para aislar genes, expresar genes y generar clonos que se emplean como sondas para el análisis genómico. Por lo tanto, para reponer los clonos se debe echar mano a la biblioteca. Durante el procedimiento de aislar genes se debe seleccionar un clono de los muchos presentes en una biblioteca, empleando para ello una sonda formada por un polinucleótido de DNA o bien un anticuerpo. Una vez que se ha aislado un gen se debe estudiar su expresión mediante un vector de expresión, que consiste en la acción de un promotor específico para este gen y sus condiciones de cultivo en alguna célula huésped. Cuando se emplean clonos como sondas para el análisis genómico es posible determinar el número de copias de un gen en el genoma, sus relaciones taxonómicas y la construcción de mapas por ligación de caracteres. Biblioteca Genómica: Se produce cuando todo el DNA genómico se digiere y los fragmentos sé clonan dentro de un vector apropiado. De esta manera es posible disponer de muestras de todo el genoma del organismo representando a las secuencias que codifican y no codifican. En el caso de que se busque un gen se empleará un vector de inserción que permite amplificar un gran segmento (YAC). En otro caso cuando se necesita una fuente de sondas para mapeo por ligación se necesitaran inserciones menores en vectores (plásmidos). Idealmente una biblioteca de este tipo debe disponer de muchas copias de cada gen. Biblioteca DNAc: Esta biblioteca se genera a partir de RNAm y Transcriptasa Inversa, de tal manera que solo se representarán los genes que solo se expresan y no aquellos que permanecen silenciosos o aquellos segmentos que separan los genes y constituyen la mayor cantidad de DNA. Por lo tanto el número de genes de que se disponga dependerá del tejido que se esté considerando y el estado de desarrollo en que este se encuentre. Volver al inicio

d) ANÁLISIS DE LOS PRODUCTOS CLONADOS. Un gen puede ser identificado mediante el empleo del DNAc (DNA complementario, sin intrones) obtenido desde su propio RNAm. De esta forma se pueden identificar los segmentos de DNA que portan sus características e incluso a cual de todos los cromosomas corresponde. Con este fin se emplea la técnica denominada Southern 806

Héctor Rocha L. Principios de Medicina Molecular

Blotting y Northern Blotting. La primera de ellas consiste en separar los fragmentos de distinto tamaño producto de una digestión con Endonucleasas de Restricción en un gel de Agarosa (fig. 6 – 16). Luego se trata el gel con NaOH para denaturar el DNA (separar ambas hebras), se neutraliza este y el DNA es transferido a un filtro de nitrocelulosa o a un papel filtro de nylon, mediante difusión capilar o bajo corriente eléctrica (fig. 7 – 16). Posteriormente, se fija el DNA al papel filtro por tratamiento con UV o “baking”. El mismo papel filtro se pone luego en contacto con la sonda radioactiva o fluorescente que al reconocer su secuencia complementaria hibridiza, identificando a la hebra que después de una radioautografía (si la sonda es marcada radiactivamente), mostrará las bandas correspondientes a los segmentos del gen o exones que se encuentran presentes. En el caso del Northern blotting, se separa RNA por electroforésis (fig. 6 – 16), el que luego es transferido al papel filtro de nitrocelulosa, para ponerlo en contacto con una sonda DNAc y proceder a visualizarlo como se describió anteriormente. Existe otro desarrollo aún, de este mismo tipo y que se denomina Western blot, en el cual se separan ahora, proteínas por electroforésis con una mezcla: detergente (Sodio Dodecil Sulfato: SDS) en un polímero de separación (Acrilamida) denominada SDSPoliacrilamida. Las proteínas separadas por peso molecular se transfieren electroforéticamente a papeles filtros de nitrocelulosa. Luego, se detectan mediante una reacción con anticuerpos marcados con Yodo 131 o con Fluoresceína.
Suministro de energía a los electrodos

Gel

Hendiduras donde se pone la muestra

Buffer

Fig. 6 - 16. Serparación de ácidos nucleicos mediante electroforésis

Buffer

Capas de adsorbentes de toallas de papel Hoja de Nitrocelulosa
Hoja adsorbente

Gel de Agarosa

Fig. 7 - 16. Técnica de traspaso o Southern Blotting. Los ácidos nucleicos son arrastrados por las toallas absorbentes.

Volver al inicio

807

Héctor Rocha L. Principios de Medicina Molecular

e) AMPLIFICACIÓN POR REACCIÓN EN CADENA DE LA POLIMERASA O PCR (POLYMERASE CHAIN REACTION).

El análisis de los genes responsables de una enfermedad puede ser llevado a cabo en muestras extremadamente pequeñas como son los fibroblastos fetales extraídos del líquido amniótico. De esta manera se pesquisan posibles enfermedades genéticas antes del nacimiento, así mismo se puede detectar la identidad del DNA perteneciente a cualquier tejido, pelos, piel, sangre, semen dejado en la escena de algún crimen. Esta técnica es capaz de amplificar secuencias específicas de DNA, circunscrito a tan solo un determinado sector millones de veces, no se requiere de todo el genoma intacto. Incluso modificaciones a la misma técnica permiten detectar mutaciones puntuales de una sola base y niveles de expresión de los genes en muestras muy pequeñas de tejidos.

5´ 3´

3´ 5´

5´ CEBADOR 3´ 5´ 3´ UN SOLO CICLO DE REPLICACIÓ 5´ 3´

3´ 5´ 3´ 5´ CEBADOR

3´ 5´

DNA Pol + dNCT + Mg

HEBRA NUEVA

HEBRA NUEVA Fig. 8 - 16. Amplificación por medio de cebadores

La técnica presenta un solo inconveniente comparada con la amplificación por clonación, que siempre es necesaria en los trabajos preliminares y consiste en la síntesis in vitro de un segmento de oligonucleótidos complementario al segmento de DNA a amplificar. Este segmento constituye el cebador o extremo 3´ para la enzima DNA Polimerasa, que genera las hebras complementarias (fig. 8 – 16). De esta manera subiendo la temperatura la doble hebra se desune, separándose. A continuación al bajar la temperatura, esta vez se aparea con los cebadores o primers, dejando estos el extremo 3´ para que la DNA pol de Thermophylus Aquaticus (resistente a los cambios cíclicos de temperatura), empiece la replicación del segmento a amplificar. Posteriormente se repite el ciclo produciéndose nuevas copias cada vez que los cebadores se unen a sus respectivas secuencias complementarias. En 5 ciclos el segmento original de DNA se puede amplificar 2, 4, 16, 256, 65536 veces.

808

Héctor Rocha L. Principios de Medicina Molecular

El producto amplificado se puede analizar mediante electroforésis en Agarosa, seguido de tinción con Bromuro de Etidio, que se intercala entre las bases del DNA y lo hace visible a la luz UV. Por otro lado, también se puede marcar el producto con nucleótidos radioactivos en la posición γ P32 , de esta manera el P32 se incorpora en los productos y estos pueden ser visualizados por radioautografía después de separarse por electroforésis en Agarosa.. Variaciones de esta técnica se logran aplicándola al producto de la enzima Transcriptasa Inversa o RT-PCR, es decir a partir del RNA total producido por una célula del tejido, la enzima Transcriptasa inversa produce DNAc, el cual es un segmento continuo de solo exones. Posteriormente al agregarse los cebadores adecuados que aparean con los extremos del DNAc, es posible amplificarlo. De esta manera se puede distinguir el producto de tan solo un gen entre cientos de ellos que se encuentran expresados en un cierto tejido, en otras palabras se dice que se abre una ventana.
G EN β-G LO BINA NORM AL CCT G AG G AG G EN β-G LO BIN A MUT ADO CCT G T G G AG

GG ACT CCT C G G AC A CCT C Am plificación por m edio de cebadores CCT G AGG AG CCT G T G G AG G G ACT CCT C GG AC A CCT C

Material am plificado, m uchas copias a electroforésis MIGRAC IO N NO RM AL G EN β-G LO BINA Una sola hebra MIG RAC IÓN ANOR M AL GEN β-G LO BINA Una sola hebra

Fig. 9 - 16. Comparación entre gen normal y mutado por PCR- SSCP. La migración anormal de una sola hebra se debe a la mutación

Otra variación de estas técnicas, donde se puede aplicar PCR, es posible cuando se reconocen mutaciones puntuales en genes ya descritos o caracterizados. Esta técnica se denomina PCR-SSCP por PCR - Single Strand Conformation Polymorphism o Reacción en cadena de la Polimerasa con Polimorfismo en la Conformación de una Sola Hebra (Fig. 9 – 16), y consiste en explotar el cambio conformacional que se produce en una sola hebra entre el segmento del DNA que posee un gen mutado comparado al segmento normal sin mutación. Para ello se amplifica una secuencia de

809

Héctor Rocha L. Principios de Medicina Molecular

100 a 200 pb de un gen mutado y uno normal, empleando los cebadores que circunscriben el sector de la mutación. Posteriormente sobre el producto amplificado, se lleva a cabo la separación de ambas hebras y la electroforésis en Poliacrilamida (medio poroso de mayor resolución que la Agarosa), se discrimina aquí la forma de las
G E N β - G L O B IN A N O R M A L CCTGAGGAG T A GGACTCCTC L ig a s a t e r m o e s t a b le CCTGAGGAG O lig o n u c le ó t id o s L ig a d o s U n ió n 5 ,´ 3 ´ GGACTCCTC NORM AL CCTGTGGAG
O lig o n u c l e ó - tid o s N o lig a d o s

G E N β -G L O B IN A M U T A D O CCTGTGGAG

A p areo c o r r e c to

O lig o n u c le ó t id o s

T A

A p areo inc o rre c to

GGACACCTC

GGACACCTC A N E M IA F A L C IF O R M E

N ue vos O lig o n u c le ó ti d o s N o L ig a d o s

O lig o n u c l e ó t id o s L ig a d o s

Fig. 10 - 16. Reacción en cadena de la Ligasa.

hebras observándose una diferencia en la migración de ambas, la normal y la que posee la mutación. Otra técnica más empleada para detectar mutaciones puntuales en genes ya conocidos y secuenciados en pacientes con alto riesgo de poseer un alelo mutante, se denomina Ligase Chain Reaction (LCR) por Reacción en Cadena de la Ligasa (Fig. 10 – 16). Consiste en emplear una Ligasa termoestable que une dos Oligonucleótidos adyacentes siempre que estos hibridicen totalmente con la hebra complementaria. Si la hebra complementaria es la original o “wild type”, la hibridación es de 100% y ambos oligonuclótidos son ligados por la enzima, es decir se produce la unión 3´ OH con el 5´ Fosfato formando el Fosfodiester. Ahora, en el gen mutante si ambos oligonucleótidos aparean con el resto de su longitud, pero no en el extremo 3´ de cada Oligonucleótido donde se encuentra precisamente la mutación puntual, ya que las bases normales del oligonucleótido no corresponden a las complementarias en el DNA de cada hebra mutada. Se produce aquí una joroba que impide a la Ligasa unir los extremos de los oligonucleótidos adyacentes. Por lo tanto, solo los correctos correspondientes al “wild type” serán amplificados y no los que no se unieron. De esta manera examinando el número de copias de ambos genes original y mutante se conoce si el paciente lleva la enfermedad 810

Héctor Rocha L. Principios de Medicina Molecular

La Transgénesis (fig. 11 – 16), es una técnica que consiste en introducir genes foráneos para su estudio en la línea germinal de algunos animales. Una de las primeras experiencias se llevó a cabo al introducir en ratones el gen de la hormona del crecimiento, obteniéndose individuos con doble tamaño que el normal.

E nzim a d e re stric c ió n q ue co rta p a rc ialm e nte

F rag m e nto s sup e rp ue sto s

D N A ve cto r c o rta d a c o n la m ism a enzim a d e re stric ció n U nuió n d e lo s frag m e nto s usa nd o la enzim a L ig a sa

Fig. 11 - 16. Transgénesis.

Para ello se emplean vectores preparados con genes que codifican factores de transcripción, que promuevan la expresión del gen necesario y se inyectan en el núcleo de huevos fertilizados.

811

Héctor Rocha L. Principios de Medicina Molecular

dAT P dG TP dCT P dTT P ddATP

dAT P dG T P dCTP dT T P ddG TP

dAT P dG TP dCT P dTT P ddTTP

dAT P dG T P dCT P dT T P ddCTP

P o s illo s d o n d e s e s e p a r a n lo s fra g m e n to s r e p lic a d o s c o n la s m e z c la s d e N uc le ó tid o s q u e s e o b s e r va n m á s a rr ib a

Fig. 12 - 16. Separación por electroforésis de la hebra replicada en presencia de los 4 dNTPs más un ddNTP

Los huevos a su vez, se trasplantan al útero de las hembras receptoras para el desarrollo de las crías transgénicas. El DNA de las crías se emplea luego para detectar la presencia del gen activo. Si el transgene posee herencia Mendeliana significa que se transfiere en la línea germinal. Esta técnica se emplea en plantas y animales de campo para introducir resistencia a enfermedades e infecciones, así como también para producir hormonas y proteínas humanas presentes en la leche animal. Un desarrollo de esta última técnica es la Terapia Génica practicada en humanos, sin embargo, existen barreras éticas que impiden su aplicación hasta ahora. En el futuro se pretende reemplazar de esta manera genes enfermos por los correctos. Si se introducen los genes en células somáticas y no en la línea germinal se impedirá el traspaso del gen hacia los descendientes. Se ha practicado esta técnica en la médula de los huesos, fibroblastos y hepatocitos. Los vectores que se emplean en estos casos son derivados de retrovirus, que cuentan solo con las regiones promotoras transcripcionales, como LTRs (Long Terminal Repeats) para manejar la expresión del gen de interés. Se ha logrado éxito solo en células en cultivo y aún no se ha pasado totalmente a la etapa en humanos. Volver al inicio

812

Héctor Rocha L. Principios de Medicina Molecular

f) SECUENCIACIÓN DEL DNA Para establecer que dos clonos específicos son adyacentes en el genoma se deben construir bibliotecas de clonos con fragmentos que se superpongan parcialmente. Estas bibliotecas de clonos se ordenan dividiendo los incertos en pequeños fragmentos y determinando que clonos tienen secuencias comunes. Uno de los métodos tradicionales que aún perdura es el de Sanger y consiste en el empleo de un dideoxinucleótido trifosfato (ddNTP) durante la replicación del DNA mediante la DNA pol I. Este nucleótido carece del grupo 3´-OH por lo que la enzima se detiene después que lo adiciona por su lado 5´ al extremo 3´ del Deoxiribonucleótido anterior y no puede continuar replicando en base a la hebra molde (figs. 12 y 13 – 16). De esta manera si se agrega un ddGTP junto a un dGTP se producirá una competencia entre ellos por ocupar un lugar en la hebra naciente. Cuando la hebra madre tiene

SECUENCIA DE LA HEBRA MADRE: SECUENCIA DE LA HEBRA HIJA:

3´ TCGATCGATCGATCGATCGA 5´

5´ AGCTAGCTAGCTAGCTAGCT3´

FRAGMENTOS EN CADA POSILLO ddATP ddGTP ddCTP ddTTP

ddA AddG AGCTddA AGCTAddG AGCTAGCTddA AGCTAGCTAddG AGCTAGCTAGCTddA

AGddC AGCddT AGCTAGddC AGCTAGCddT AGCTAGCAGddC AGCTAGCTAGCddT

Fig. 13 - 16. Secuencia de los fragmentos que se encuentran en cada pocillo del gel

Citosina en su secuencia, la hebra hija adicionará dGTP y una fracción adicionará ddGTP para detenerse produciendo una población de fragmentos que se detienen o siguen cada vez que en la hebra madre aparece una Citosina. Por lo tanto si contamos con cuatro mezclas de los cuatro dNTPs, más cada uno de ellos con ddNTP distinto, tendremos una población de hebras hijas o hebras nacientes que se detendrán cada vez que aparezca la base complementaria a la que tienen como ddNTP. Por lo tanto se dispondrá de una población de fragmentos de distintos tamaños que se pueden separar por electroforésis ocupando cuatro pocillos, cada uno correspondiente al nucleótido que se encuentra como ddNTP.

813

Héctor Rocha L. Principios de Medicina Molecular

Marcador que flanquea el gen

GEN SECUENCIADO

Marcador que flanquea el gen

5´ 3´
CEBADOR

5´ 3´

CEBADOR

CEBADOR

CEBADOR

CEBADOR

Fig. 14 - 16. Técnica de Chromosome Walking

Otra técnica empleada para llenar huecos durante la secuenciación es la denominada Chromosome walking (fig. 14 – 16) o caminar sobre el cromosoma. Mediante esta, sé hibridiza un cebador de secuencia conocida a un clono al azar de una biblioteca genética y se sintetiza la hebra complementaria, posteriormente esta se aísla y su secuencia terminal 3´ , se emplea como cebador para continuar replicando la hebra complementaria o continuar caminando sobre el cromosoma. Sin embargo, debido a que los cebadores deben ser sintetizados químicamente el gran número de cebadores que se necesita para avanzar presenta una desventaja. Volver al inicio . 2) MARCADORES MOLECULARES QUE NO SON GENES. Se encuentran constituidos por distintas secuencias que no son parte de los genes y entre ellas tenemos: a) sitios específicos de corte para las enzimas de restricción. b) secuencias repetidas en tandem de 8 a 16 pares de bases c) secuencias repetidas en tandem de 4 a 6 pares de bases 814

Héctor Rocha L. Principios de Medicina Molecular

Todas estas secuencias se heredan según la genética Mendeliana, así tenemos que mientras más relacionadas se encuentren dos personas, compartirán un número mayor de fragmentos de igual tamaño como producto de las enzimas de restricción. Esta técnica es la más antigua y se llama RFLP por Restriction Fragment Length Polymorphism o Polimorfismo en el Largo del Fragmento de Restricción. a) RFLP ( RESTRICTION FRAGMENT LENGTH POLYMORPHISM) O POLIMORFISMO DEL FRAGMENTO DE RESTRICCIÓN Esta técnica se basa en los polimorfismos que existen en la secuencia de los cromosomas, es decir, el mismo cromosoma en dos personas distintas, presenta una variación cada 200 a 500 pb en la secuencia. Esta variación crea o hace desaparecer un sitio de restricción y se alterará con ello el tamaño de los fragmentos. No requiere de secuenciación, pero sí de una biblioteca creada a partir de fragmentos de DNA clonados en un vector. Luego se emplea una sonda basada en DNA genómico o DNAc. Se debe emplear una separación electroforética en geles de Agarosa. El DNA del organismo que interesa se digiere con endonucleasa de restricción y luego es sondeado con una biblioteca de DNA clonado. Los apareamientos de la sonda con el DNA se observan por radioautografía o fluorescencia. Se puede detectar siempre el mismo sitio y sirve para mapeos. Los polimorfismos se detectan como diferencias en pesos moleculares manifestado por la migración en el gel de Agarosa de los fragmentos del DNA del huésped.

SITIOS DE CORTE POR LA ENZIMA DE RESTRICCIÓN

ALELO A

ALELO B

ALELO A

ALELO B

* *

*

SONDA MARCADA

Fig. 15-16. Los fragmentos producidos por los sitios de corte por la enzima de restricción se visualizan mediante un Southern Blot con su respectiva sonda.

Volver al inicio

815

Héctor Rocha L. Principios de Medicina Molecular

b) VNTR (VARIABLE NUMBER TANDEM REPEATS) O REPETICIONES EN TANDEM (UNA TRAS OTRA) DE NÚMERO VARIABLE Por otro lado, al agregar cebadores o partidores sintéticos que aparean con aquellos sectores de la hebra que flanquea a secuencias repetitivas en tandem, se logra observar que mientras más relacionadas se encuentren dos personas mayor será el número de fragmentos amplificados coincidentes, es decir con igual número de secuencias repetitivas y por consiguiente igual tamaño. Así tenemos que esta técnica se puede aplicar a los VNTR por Variable Number Tandem Repeats o Número Variable de Secuencias Repetidas en Tandem (cabeza con cola como los carros de un tren). Estos segmentos se encuentran interespaciados en el genoma humano. El número de secuencias repetitivas en un locus (lugar particular del cromosoma) varía con las personas, es decir presenta polimorfismos (pueden tener un mayor o un menor número de repeticiones). Además, en cada persona existe un alelo paterno y otro materno de distintos tamaños o número de la misma secuencia repetitiva. Así que, mientras más emparentados se encuentren las personas los segmentos repetitivos serán cada vez más similares. Ocurre que en mellizos idénticos, al ser su DNA cortado por la misma Endonucleasa de Restricción o en el caso de que sus secuencias repetitivas sean amplificadas por cebadores específicos ubicados en los flancos y ambos separados por Electroforésis, los fragmentos y las repeticiones deberán de ser todas iguales.

a) RFLP expuesto a sonda de VNTR (aparea con solo una secuencia repetitiva) en seis individuos distintos

b) VNTR disperso en genoma. Sonda VNTR multilocus (aparea con distintas secuencias repetitivas) en 5 individuos distintos

Fig. 16a - 16. Los fragmentos obtenidos por endonucleasa de restricción, que corta los sitios que flanquean a las secuencias repetitivas, se separan por tamaño mediante Electroforesis. Finalmente se visualizan aquellos que se unen a una sonda fluorescente o marcada con P32. Esta sonda es una secuencia complementaria a la región que se repite Fig. 16b – 16. La sonda se une a los fragmentos con distinto número de secuencias repetitivas ya que se trata de secuencias Repetitivas de distinta naturaleza con distintos tamaños. Esta sonda es complementaria a las múltiples secuencias repetitivas (Sonda Multilocus)

816

Héctor Rocha L. Principios de Medicina Molecular

Algunas secuencias repetitivas se encuentran en un solo locus (lugar) específico en el genoma humano. Las sondas construidas en base a estas secuencias, son sondas de un solo locus (un solo tipo de secuencia repetitiva) y dejan un patrón de distribución típico cuando se usan como sondas para hibridar Southern Blots de RFLPs, es decir a como se denomina a los traspasos de RFLPs, fig. 16a - 16. En este caso, la visualización producida por sondas de un solo locus de la VNTR previamente cortada con endonucleasas de restricción es más fácil de interpretar, puesto que cada individuo no debe de tener más de dos bandas claras constituidas por una región no codificante con la misma secuencia repetitiva, pero en distinto número presente en el alelo paterno y materno, que puedan coincidir o diferir entre ellas para determinar su relación o identidad. Otras secuencias con VNTRs se encuentran en muchos loci (mezcla de fragmentos con varios tipos de secuencias repetitivas) en el genoma humano o bien la visualización de estos fragmentos mediante sondas VNTR de múltiples locus, producen más información puesto que se sondean de 10 a 30 loci o lugares en el cromosoma donde se encuentran secuencias repetitivas, pero distintas. Estos loci se encuentran dispersos entre los cromosomas humanos como se observa en Figura 16b – 16, dando origen a muchas más bandas que se pueden comparar para identificar a los individuos. Análisis de un solo locus por sonda VNTR o análisis por VNTR de múltiples locus se pueden usar con fines forénsicos o para determinar paternidad.
EL EC T R OF O R ESIS

10 K b

Alelo s d e rep etició n co rta

3K b

10K b 9K b

S E C U E N C IAS R E P E TIT IV AS E N T AN D E M

9K b

6K b

Alelo s d e rep etició n larg a

6K b

3K b

S itios d e corte p or la E ndo nucle asa de R es tricció n

Fig. 17 - 16.Dos tipos de secuencias repetitivas visualizadas con sus respectivas sondas en distintos alelos

En la figura 17-16, se observan dos secuencias repetitivas con sus respectivos alelos junto a los sitios de corte por las Endonucleasas de Restricción. Ambas pueden ser identificadas por los fragmentos que aparecen en el Southern Blot a la derecha de la figura 17-16. En distintas personas variará el número de repeticiones y por lo tanto la

817

Héctor Rocha L. Principios de Medicina Molecular

posición de las bandas, si son parientes algunas bandas tendrán igual número de repeticiones entre ellos. Volver al inicio c) RAPD (RANDOM AMPLIFIED POLYMORPHIC DNA) O DNA POLIMÓRFICO AMPLIFICADO AL AZAR. Esta técnica requiere de PCR, pero no de clonación ni de secuenciación. Puede detectar varios loci o sitios mediante el empleo de cebadores cortos de 10pb que tienen una secuencia al azar, es decir, se amplifican sectores del DNA también al azar y que resultan en la presencia o ausencia de polimorfismos. Los cebadores demasiado cortos pueden ser afectados por las condiciones de hibridación al DNA, en este caso se emplean bajas temperaturas para hibridizar. Los resultados pueden no ser siempre reproducibles. No es apropiada para mapeos comparativos. Solo cuando un par de cebadores se dispone correctamente, es decir, se encuentran bien orientados y lo suficientemente, cercanos los segmentos amplificados pueden ser comparados entre individuos para observar su relación. Volver al inicio d) AFLP ( AMPLIFIED FRAGMENT LENGTH POLYMORPHISM ) POLIMORFISMO EN EL LARGO DEL FRAGMENTO AMPLIFICADO. Se encuentra basada en PCR y no requiere de enzimas de restricción o amplificación por clonación. Esta vez el cebador tiene 15 pb fijos y 2pb al azar. La porción fija entrega estabilidad al cebador y la sección al azar significa que amplificará muchos loci o sitios, los que pueden llegar a 100 con un solo tipo de cebador.
10 Kb Electroforésis de Fragmentos Amplificados
10Kb 9Kb

3Kb

SECUENCIAS REPETITIVAS EN TANDEM

9Kb

6Kb

6Kb

3Kb

CEBADORES

Fig. 18 – 16. Los cebadores se unen a los extremos de los segmentos que se desea amplificar. En distintos alelos los mismos cebadores amplificarán fragmentos de distinto

818

Héctor Rocha L. Principios de Medicina Molecular

largo o número de repeticiones que caracterizan a cada individuo. Mientras más emparentados, el número de repeticiones será igual

El polimorfismo se detecta como la presencia o ausencia de una banda correspondiente al DNA amplificado. Es útil para “fingerprinting” o tipificación de sospechosos, tipificación de semillas, animales finos o de pedigrí, etc. No es útil para mapeos. Por ejemplo en dos individuos tomados al azar o heterogéneos, no relacionados entre sí, se detectará la amplificación del mismo sitio, pero en uno de ellos el fragmento amplificado por los mismos cebadores es más largo o más corto que en el otro (Fig. 18 –16) y se notará la diferencia durante la visualización de los fragmentos después de una electroforésis con la respectiva sonda marcada contra la secuencia o las distintas secuencias repetitivas. Volver al inicio e) STS (SEQUENCE TAGGED SITE) O SITIO MARCADO POR LA SECUENCIA. Los cebadores han sido diseñados para amplificar una región determinada que posee un polimorfismo entre dos o más individuos. Los elementos mapeados como clonos individuales, contigs o regiones secuenciadas en distintos laboratorios y que pertenecen a distintas personas se pueden comparar por STS. Esta técnica consiste en amplificar una secuencia corta reconocida de 200 a 500pb que no se repite y que sirve como secuencia marcadora de un lugar específico común a todos los genomas humanos, se le emplea como hito marcador o señal en el camino. Se puede formar el mapa sabiendo la posición de las secuencias STS en los segmentos del mismo cromosoma, pero de diferentes personas en estudio. Mediante PCR se puede detectar esta secuencia única en el genoma. No se requiere de clonación, pero si de información sobre la secuencia. Los cebadores son de 18 a 20 pb y están diseñados para amplificar este fragmento conocido de secuencia corta y única (STS) por RAPD-PCR, al contar con ambos cebadores y en presencia de todas las otras secuencias genómicas distintas, por lo tanto las STS definen una posición dentro del mapa físico o bien se pueden obtener de un clono de RFLP y generar hitos o mojones marcadores que mapean posiciones únicas dentro del genoma. Los polimorfismos se detectan como diferencias de tamaño en productos amplificados. El anterior es un buen método de mapeo y es confiable, todo depende de la selección de un buen par de cebadores. Con ellos se pretende crear un mapa de 100 kB de resolución teniendo cerca de 30.000 marcadores STS distintos. Para lograrlo se procede mediante el corte del DNA en pequeños trozos o por segmentos, los que se amplifican por clonamiento fabricando innumerables copias, es decir, se implanta un plásmido cargado con el segmento a amplificar y se hace que se replique en la bacteria. Una vez amplificados, los segmentos se alinean para reflejar el orden que llevan en los cromosomas al superponer las secuencias marcadoras. Las STS son útiles para localizar y orientar el mapeo junto a los datos de secuencia reportados por diferentes laboratorios y a la vez sirven de hitos para desarrollar un mapa físico del genoma humano. Volver al inicio

819

Héctor Rocha L. Principios de Medicina Molecular

f) EST POR EXPRESED SEQUENCE TAG O EXPRESIÓN DE LA SECUENCIA MARCADORA. Se emplea PCR que no requiere de clonación, pero si se requiere de información de la secuencia. Detecta una zona específica del genoma y es bueno para el mapeo. El polimorfismo se detecta como diferencia de tamaño en el producto amplificado, aunque toma tiempo crear un buen cebador representado por secuencias parciales de DNAc de 18 a 20 pb, como cebadores que proveen de marca específica para un gen. Volver al inicio g) MARCADORES MICROSATÉLITES. Sirven para detectar regiones hipervariables del genoma. Los Microsatélites se denominan por los nombres de: Simple Sequence Repeats (SSR) o Short Tandem Repeats (STR). Estas secuencias son cortas de 2 a 5 bases y se repiten múltiples veces flanqueadas por DNA único. Se encuentran bien distribuidas dentro del genoma humano. Es posible encontrar una STR trimérica o tetramérica por cada 20Kb. Muchos de estos loci o sitios son altamente polimórficos, varían entre individuos ya que tienen secuencias repetidas de distinto tamaño o con distinto número de repeticiones. Es posible distinguirlas unas de otras mediante la amplificación por medio de cebadores o partidores de la técnica de PCR (previamente diseñados), que se encuentran dirigidos a aparearse, con las regiones constantes o conservadas que las flanquean. Posterior a la amplificación se pueden visualizar estos sectores mediante una sonda complementaria a la parte repetitiva, después de su separación electroforética. Este procedimiento es útil en aplicaciones forénsicas y paternidades. Existen varias ventajas cuando se emplea tecnología basada en amplificación de marcadores STR comparados a los RFLP con enzimas de restricción. La amplificación, por su parte requiere de solo un par específico de cebadores para el sitio que flanquea a las secuencias repetitivas.

RFLP SITIOS DE RESTRICCIÓN

16-70 pb VNTR

2-4 pb STR CEBADORES Fig. 19 -16 Los tres sistemas emplean marcadores que buscan diferencias entre individuos.

820

Héctor Rocha L. Principios de Medicina Molecular

En la figura 19-16, se observan los distintos sistemas empleados cronológicamente (RFLP, VNTR y STR) para discriminar molecularmente los individuos. El más antiguo (1980, RFLP) emplea sitios de restricción como blancos para la enzima Eco R1. Los fragmentos obtenidos son separados por electroforésis en Agarosa y detectados por Southern Blot empleando una sonda radioactiva. Ambos alelos eran detectables por variaciones en su largo. Estas, eran características heredables que resultaban de la presencia o ausencia del sitio de restricción en un locus determinado. Luego, las VNTR empleadas desde 1985 en adelante contenían muchos alelos en cada locus individual, que no se debían a la variabilidad del sitio de corte, sino que a la variabilidad en el número de copias de una secuencia de consenso desde 15 a 70 bases que se encontraba repetida en tandem y a la vez era flanqueada por un par de sitios de restricción. Posteriormente, se descubrieron repeticiones con polimorfismos en di, tri y tetranucleótidos llamados STR. Tienen la misma estructura que las VNTR, pero las repeticiones de consenso en tandem son de dos a cuatro bases y son más compatibles con la técnica de PCR, ya que se pueden emplear varios cebadores o partidores (previamente diseñados) para amplificar muchos locus repetitivos a la vez. En la actualidad con el objeto de reconocer personas y/o tipificar exhaustivamente un DNA, sin importar que se encuentre parcialmente degradado o no, se ha recurrido al empleo de cebadores tipo Múltiplex (Fig. 20 -16). Es decir, estos cebadores tienen más de un par y se encuentran marcados con distintas moléculas fluorescentes y aparean en múltiples regiones que flanquean zonas repetitivas iguales o distintas. Se tiene cuidado en que el diseño de los cebadores o partidores no sea superponible y que se encuentren espaciados. De esta manera, es posible amplificar múltiples alelos del genoma al mismo tiempo y cada uno de ellos posee un color determinado. La probabilidad de encontrar alelos idénticos en dos individuos disminuye con el aumento de los sitios polimórficos, haciendo el ensayo mucho más específico y discriminatorio. Una vez hecha la amplificación se separa el DNA por electroforesis capilar, consistente en un capilar relleno con formamida bajo un campo eléctrico. Después de su separación se procede a su lectura con un láser para reconocer los distintos colores correspondientes a aquellos cebadores apareados y que han amplificado múltiples locus. La lectura de las bandas es transformada en peaks de distintos colores correspondientes a la fluorescencias de las sondas que han amplificado un locus determinado De esta manera cada persona distinta tendrá un número de peaks determinados y puede ser reconocida entre otras. Mientras mayor sea el número de locus amplificados mayor será la certidumbre. Esta técnica se emplea para comparar sospechosos frente a la evidencia, test de paternidad, reconocimientos históricos, investigación de personas desaparecidas, identificación de victimas de desastres, identificación de soldados y de delincuentes. Empleando 13 sitios de secuencias STR multilocus, es posible encontrar una serie de peaks repetidos de 1 en 594 trillones. Volver al inicio

821

Héctor Rocha L. Principios de Medicina Molecular

Regiones multilocus con 3 secuencias repetitivas de distinto tamaño

Escalera alélica: Regiones de múltiples peaks correspondiente a los distintos alelos existentes en la población y que se emplea como estándar

Alelos de

una persona común

Alelos de otra persona no relacionada con la primera

Fig. 20 – 16. Región multilocus amplificada por una mezcla de varios cebadores fluorescentes de tres colores distintos. Si la persona es homozigoto para una región el peak es más largo y si es heterozigoto el peak es más pequeño.

3) APLICACIONES EN LA MEDICINA MOLECULAR Una de las metas de la Medicina Molecular es predecir las enfermedades antes de que los signos y síntomas se manifiesten en el individuo. Por ambicioso que esto parezca, se pretende alcanzar tal capacidad en un futuro cercano, mediante diversas técnicas. De esta manera, es imperante explorar y analizar las unidades de información que se encuentran inmersas en el material hereditario conocido como DNA y que se identifica por el nombre de gen, junto a los factores que influyen tanto en su control como en su expresión. Al caracterizar el tipo de anomalías que pueda afectar a los genes, se espera poder predecir la susceptibilidad de las personas a este tipo de enfermedades y a la vez encontrar la forma de evitarlas y en el caso de que estas ocurran, cómo curarlas. Este último desarrollo de la Medicina, comenzó con la revolución tecnológica que ocurrió alrededor de la década del 70, cuando se aplicaron nuevos diseños experimentales que más tarde permitieron seleccionar, identificar y amplificar los genes humanos. Desde entonces hasta el año el año 2000 se han descubierto cerca de 4000 enfermedades, cuyo origen es atribuido al mal funcionamiento de uno o varios genes, como son por ejemplo los casos de Hipercolesterolemia familiar, Fibrosis Cística, Fenil Cetonurea y distintos tipos de Hiperamonemias junto a algunos tipos de cáncer, como son el de Colon o el de Mamas. Es también necesario considerar que a medida que progresan las técnicas y se hacen más comunes, las consideraciones éticas y morales junto a la legislación deben marchar a la par. De esta manera los resultados adversos obtenidos mediante la examinación de un paciente, deberán ser tan solo del dominio del equipo de profesionales tratante de la enfermedad y nunca entregados a los pacientes, sin el debido tacto y menos aún a las instituciones públicas o privadas. En general una persona joven, que tiene toda una vida por delante, se reciente y puede sufrir daño psicológico, al saber que debe enfrentar enfermedades para las cuales no se encontraba preparada, en vez de dejar estas al azar y al estilo de vida. Este es un tema que puede generar un intenso debate en el futuro cercano.

822

Héctor Rocha L. Principios de Medicina Molecular

Para comprender los alcances de esta nueva medicina debemos comenzar por estudiar las unidades de la herencia o las subunidades del DNA. Estas comprenden aquellas estructuras que almacenan la información útil para generar un individuo. Bastan cerca de 30.000 genes para definir un ser humano. En ellos reside la estructura de las proteínas junto al conocimiento implícito para sus interacciones tridimensionales en su microambiente hasta el comportamiento de un organismo entero. Sin embargo, los genes forman tan solo una pequeña parte de los cromosomas que tienen una mayor parte de DNA no codificante o de “relleno”. Los cromosomas humanos se encuentran divididos en dos juegos de 22 autosomas más un cromosoma sexual, que puede ser X o Y (Fig. 21-16). Cada una de las células de un organismo son totipotenciales es decir, tienen la información para generar un individuo completo. Este hecho se conocía hace ya algún tiempo, desde que se logró clonar ranas a partir de núcleos de células extraídas del intestino de una rana adulta, hasta la aparición de la famosa oveja “Dolly”. Esta última fue clonada a partir del núcleo de una célula de la glándula mamaria. Esto significa que todas las células de nuestro organismo poseen la misma información, pero los genes que se expresan son diferentes. Cada tejido es caracterizado por la expresión particular de sus genes, lo que ocurre durante un proceso denominado diferenciación celular y que acontece durante la Embriogénesis. Por lo tanto dependiendo del balance en la expresión de las células totipotenciales algunos genes se prenden y otros se apagan, sin embargo el potencial genético para convertir un hepatocito en neurona, aún se encuentra presente en el tejido diferenciado, pero se lo encuentra silencioso.

Fig. 21 - 16. Cromosomas humanos ordenados por tamaño mostrando sus bandeos.

En general, este tipo de disposición de la expresión genética, nos dice que los genes pueden ser inducibles y constitutivos. Los constitutivos se expresan siempre para que la célula subsista y codifican para enzimas que son responsables de las reacciones 823

Héctor Rocha L. Principios de Medicina Molecular

enzimáticas y síntesis de estructuras llevando a cabo las labores básicas, mientras que los genes inducibles se encuentran inactivos la mayoría del tiempo y solo se expresan para reacomodar el metabolismo o la estructura de la célula bajo determinadas circunstancias. Hay que considerar que dentro de estos genes, un subgrupo fue inducido durante la embriogénesis y mantiene a la célula diferenciada en lo que ya és, sea esta una neurona, hepatocito, miocito, etc. y una vez logrado este propósito permanecen silenciosos. Volver al inicio a) MUTACIONES La compleja interacción entre los genes determina el funcionamiento de nuestro metabolismo y sus defensas, sin embargo las mutaciones que se adquieren durante el curso de la vida pueden llegar a ser heredadas (Fig. 22 - 16) o “congénitas”, pasando por la línea germinal. Por otro lado también pueden ser somáticas (Fig. 23 - 16) o adquiridas, cuando en el transcurso de la vida solo pasan de célula en célula y no a los descendientes (efecto de la luz UV, tóxicos ambientales, etc.). Las primeras pueden afectarnos o predisponernos a enfermedades que van desde insignificantes, es decir, algo así como la intolerancia a ciertas dietas, hasta la inhabilitación total de la persona, como es el caso de las enfermedades congénitas del metabolismo (Hiperamonemias, Fenilcetonurea, etc.). Por otro lado, entre las mutaciones somáticas, podemos contar con la predisposición al cáncer provocado por el tabaquismo o a los melanomas provocados por el exceso de exposición a la luz solar.

Oocito

+

Espermio

Mutación

Hueso

Pancreas Neurona

Fig. 22 - 16. Mutaciones en la línea germinal pueden ser heredadas.

Dentro de este último punto, ocurre que algunas personas pueden ser más susceptibles que otras a las enfermedades adquiridas, resaltando lo complejo que es su control y que parece depender de la expresión de varios genes a la vez.

824

Héctor Rocha L. Principios de Medicina Molecular

Podemos citar que si una función determinada depende de los genes A, B, C y D, esta se lleva a cabo en un 100%, sin embargo, si la misma función se puede llevar a cabo en un 80% con tan solo A, B y C, debido a que D se encuentra mutado. Esta persona será más propensa a sufrir una enfermedad determinada por falta del control aportado por D. Aunque no es seguro de que así sea, no se tiene la certeza exacta de que se producirá una falla, pero es lo más probable.

Mutación

Células mutadas

Células normales

Fig. 23 - 16. Mutaciones somáticas solo pasan de célula en célula y no son heredadas.

En los humanos los genes se encuentran en pares y una copia pertenece a cada padre. Cada una de estas copias recibe el nombre de alelo, los cuales pueden ser del tipo dominante o recesivo (Fig. 24a - 16). El alelo dominante (D) en las enfermedades autosómicas, se expresa y prevalece independientemente de sí su contrapartida es dominante (DD) o recesiva (Dd), mientras que el recesivo (d) se expresa si su contrapartida es también recesiva (dd). En el caso de que una persona posea un gen recesivo con la enfermedad y otro dominante normal, prevalece el normal, siempre que este último no sea desactivado o se pierda. Sin embargo, la persona heterozigota para el gen recesivo es portadora de la enfermedad y tiene un 25% de probabilidad de pasar el gen alterado a cada individuo de su descendencia. Si ahora ambos padres son portadores, la probabilidad de producir descendencia portadora en cada embarazo es de 50% (Fig. 24a - 16). Estas probabilidades se hacen posibles, en especial en aquellos grupos étnicos cerrados, con poco intercambio genético con la población mundial.

Por otro lado, es necesario aclarar que no todos los alelos mutados pueden conducir a una enfermedad. El cáncer de mamas, cuyo responsable es un gen dominante y no el recesivo, tiene solo un 80% de riesgo y no de 100% a edades superiores a 65 años, ya que intervienen otros genes que se encuentran coludidos con el alelo mutado y de estos últimos dependerá en parte, que el mal aparezca o no. Este hecho indica que para hacer posible un cáncer, deben existir distintas mutaciones simultáneas o bien que estas sean del tipo acumulativo y que ocurran durante todo el transcurso de la vida. Por ejemplo, en la enfermedad denominada Alzheimer se requieren mutaciones en los cromosomas 1, 14, 19 y 21. A la vez que esta enfermedad se encuentra asociada a la sobreproducción de Apo E (Apoproteína E). Esta última participa en el transporte de los 825

Héctor Rocha L. Principios de Medicina Molecular

lípidos y cuando sus niveles se encuentren alterados, constituiría la señal marcadora de la enfermedad.
Am b o s p a d res p o rta d o res G en d e la F ib ro sis C ís tic a

a)

H o m b re

M u je r

b)
N o rm a l M u tació n 1

Dd

Dd

DD

Dd

Dd

dd

S in sín to m a s

S ín to m as le ves

H o m b re M u je r H o m b re M u je r N o rm a l P o rta d o ra P o rta d o r E n fe rm a 25% 50% 25%

M u ta ció n 2 D d G en o Alelo D o m in an te G en o Alelo R e ces ivo S ín to m as s eve ro s

M u ta ció n 3

S ín to m as d e carácter in term ed io

Fig. 24a - 16. La persona homozigota que porta los alelos recesivos (dd) tiene un 100% de probabilidad de padecer la enfermedad. Fig. 24b - 16. Mutaciones en distintas partes del mismo gen producen diferentes síntomas.

Por otra parte, ocurre de que las mutaciones pueden caer en distintos segmentos de un mismo gen (Fig. 24b - 16), produciendo manifestaciones clínicas que van desde el rango de severas a leves e incluso silenciosas, como es el caso de la Fibrosis Cística. En otros casos los genes mutados se pueden heredar, ya que se transportan en células reproductivas, por lo que la mutación estará presente en todos los tejidos del individuo producto de estos genes. Así tenemos que los desórdenes hereditarios pueden ser también causados por un alelo mutante o un solo gen, como es la distrofia muscular de Duchenne, el Retinoblastoma o la Anemia falsiforme, comparados con otros desordenes que son poligénicos, es decir ocurre que más de un gen o alelo se encuentra involucrado. Se necesita aquí de la interacción de varios genes para causar la enfermedad. Entre ellas tenemos las enfermedades al corazón, diabetes y algunos tipos de cánceres. Volver al inicio

826

Héctor Rocha L. Principios de Medicina Molecular

b) CARIOTIPO Un primer avance en la búsqueda del origen de las enfermedades genéticas, lo constituyó la obtención del Cariotipo. Mediante esta técnica se puede visualizar a los cromosomas y sus características presentes en una muestra de sangre extraída a una determinada persona. Luego se procede a sincronizar la división celular y posteriormente se observa la disposición de los cromosomas en metafase. Se determina así el número de ellos, la composición de los cromosomas sexuales y se identifica cualquiera anomalía que se presente en cuanto a su forma, ya que les puede faltar o sobrar un segmento, lo cual nos entrega una idea de la cantidad de DNA que portan. El Cariotipo nos permitirá también determinar cual es el sexo real de una persona, así como los problemas de infertilidad que puedan existir.

TELOMEROS

CENTROMERO

BANDEO DE UN CROMOSOMA

q p
Submetacéntrico Metacéntrico
Fig. 25 - 16. Tipos de cromosomas que se encuentran en un Kariotipo

Acrocéntrico

Los cromosomas pueden ser distinguidos por su tamaño y por la posición del centrómero, que puede llegar a ser Metacéntrico (Fig. 25 - 16), cuando se ubica equidistante a ambos extremos del cromosoma. Submetacentricos, cuando el centrómero se encuentra fuera del centro, ya que un par de brazos del cromosoma es mayor que el otro p (brazo corto) y q ( brazo largo) y finalmente Acrocéntrico, cuando el centrómero se encuentra en un solo extremo. Otro tipo de identificación que se puede llevar a cabo sobre los cromosomas lo constituye su bandeo. Este aparece bajo ciertos tratamientos químicos que dependen de la composición de las bases y la estructura de la cromatina. Así tenemos, que el bandeo C tiñe Centrómeros, luego el bandeo R es el inverso del C y tiñe regiones no centroméricas como los brazos p y q. A continuación tenemos el bandeo G, que se obtiene con la tinción de Giemsa, produciendo bandas a lo largo de su estructura y por último el bandeo Q que se obtiene con Quinacrina y produce fluorescencia. Los dos últimos bandeos G y Q son suficientes para permitir la identificación de cada cromosoma y proceder a su arreglo por tamaño y número de bandas para observar el Cariotipo. Volver al inicio

827

Héctor Rocha L. Principios de Medicina Molecular

c) EL PROYECTO GENOMA HUMANO El Proyecto Genoma Humano (HGP) auspiciado por Europa y Estados Unidos partió en octubre de 1990 y pretendió secuenciar todo el DNA de la especie humana incluyendo los 80.000 a 100.000 genes supuestos genes , que resultaron ser solo 30.000 y que constituyen el patrimonio humano, más el DNA “de relleno” en un periodo de 13 años. Es decir, se reconoció la secuencia de aproximadamente 3 x 109 bases que forman el material genético humano y se trabaja en la actualidad dilucidando todos los mecanismos de control posibles. Otros desarrollos consistirán en el análisis de los productos proteicos de los genes y la observación de cromosomas teñidos con sondas fluorescentes en lugares específicos donde se encuentren las posibles anomalías. A la vez se llevaron a cabo estudios paralelos en otros organismos como Drosophylas, Levaduras y E. Coli, para desarrollar la tecnología e interpretar la función de los genes en humanos. Las tareas fundamentales se desarrollaron a través de varios métodos independientes de análisis que garantizaron su validez. A continuación se ilustran algunos de los métodos empleados: Volver al inicio d) MAPEO DE LOS GENES Consiste en emplear una técnica que permita determinar el orden de estos y de otros marcadores (secuencias específicas que no son genes), junto al espacio que ocupan en cada cromosoma y a la vez determinar la distancia que exista entre ellos. Así se pudo identificar ciertos genes asociados a determinadas enfermedades y las propiedades biológicas de las cuales son responsables, constituyendo la columna vertebral del mapeo físico. De esta manera se pretende mostrar el arreglo de los genes y los marcadores de secuencia del DNA. Estos mapas se construyeron en varias escalas y niveles de resolución.
PRESENCIA DE AMBOS ALELOS EN EL PADRE Y LA MADRE MARCADORES EN EL PADRE Crossing-over o

X Y
HIJOS

recombinación

X

Y

X Y

X Y

Fig. 26 - 16. El material genético del padre sé recombinó durante el proceso de espermatogénesis. La frecuencia de estos eventos de crossing-over ayudan a determinar la distancia entre los marcadores

Volver al inicio 828

Héctor Rocha L. Principios de Medicina Molecular

e) MAPEO LIGADO A MARCADORES

El Mapeo ligado a marcadores se encuentra constituido por los mapas de menor resolución y dependen de regiones expresadas del DNA (genes), como secuencias que no se expresan, pero cuya pauta de herencia (secuencia específica) puede ser reconocida y seguida (Ver marcadores moleculares en Herramientas) en los descendientes. Los genes se pueden analizar por sus características fenotípicas, como X e Y en la figura 26 - 16 o bien pueden ser reconocidos por sus características polimórficas, es decir las formas alternativas de un alelo o bien la presencia de distintos alelos entre los diferentes individuos de una familia, como ocurre con el color de los ojos, el pelo, la estatura. En cambio entre las secuencias que no se expresan y que pueden ser seguidas, encontramos a los polimorfismos representados por secuencias repetitivas en su DNA que pueden variar en tamaño y número de repeticiones en los distintos individuos. En el mapeo ligado a marcadores se emplean las frecuencias con que se expresan los marcadores o las características ligadas a los genes que aparecen en los descendientes para asignar las ubicaciones en el cromosoma. Este reconocimiento se lleva a cabo después de la gametogénesis cuando han pasado por la recombinación o “crossing-over”. Es así posible construir un mapa observando cuan frecuentemente dos marcadores o genes se heredan juntos o cuan frecuentemente dos marcadores o genes pasan desde los padres hacia los hijos. Mientras más juntos en el cromosoma, es menos posible que se separen y mientras más lejos es más posible que se hereden separados y aparezcan en distintos hermanos y no en uno solo de ellos. De esta forma es posible asignar un par de genes o marcadores a un área específica del cromosoma, donde las distancias se miden en términos de Centimorgans (cM), en honor a un genetista de ese apellido. Dos marcadores se encuentran separados por 1cM cuando aparecen separados por recombinación, tan solo el 1% de todas las veces (el 99% salen juntos) y esto equivale en un mapa físico a la distancia de 1 millón de pares de bases entre los dos marcadores. Por otro lado, dentro de los marcadores determinados por la secuencia cuya pauta puede ser seguida se encuentran ciertas secuencias con simetría bicatenaria que constituyen polimorfismos. Esto significa que la misma secuencia se ubica en distintos lugares en diferentes individuos y son reconocidas por ciertas enzimas denominadas Endonucleasas de Restricción (Ver herramientas). Cada una de estas enzimas es capaz de reconocer una secuencia específica, pero como esta se ubica en distintas posiciones en los distintos individuos, tanto en el DNA “de relleno” como en los genes que son de interés. Al ser cortadas generan una población de fragmentos de distinto largo o polimorfismos típicos de cada individuo. Cada endonucleasa actúa produciendo un patrón típico de cortes para cada individuo. Estos fragmentos se pueden emplear para reconocer sectores específicos del DNA tanto en los mapas físicos como en aquellos mapas de entrecruzamiento o recombinación y la técnica derivada de esta análisis se denomina RFLP.

Volver al inicio

829

Héctor Rocha L. Principios de Medicina Molecular

f) EMPLEO DE RFLP (RESTRICTION FRAGMENT LENGTH POLYMORPHISM) O POLIMORFISMO EN EL LARGO DE LOS FRAGMENTOS DE RESTRICCIÓN

En la Fig. 27 - 16 se observa el empleo de la técnica denominada RFLP. Esta técnica es utilizada para estudiar aquellos casos donde una enfermedad genética produce un patrón típico de fragmentos polimorfos distribuido entre los progenitores y descendientes. Esta observación se logra mediante el análisis de los productos de una digestión con una o más endonucleasas de restricción, lo que deja un patrón reconocido de cortes que se visualiza por una electroforésis. Los fragmentos obtenidos por digestión enzimática (endonucleasa de restricción) se separan por electroforésis en un gel de Agarosa según tamaño y carga. Los fragmentos de DNA migrarán desde el Cátodo (-) hacia el Ánodo (+) de acuerdo a: a) su carga negativa (Fosfatos), que aumenta con el largo del fragmento b) el diámetro de los poros del gel.. En aquellos individuos considerados como mellizos univitelinos o en aquellos casos en que los distintos genes poseen ambos alelos idénticos, se produce un patrón típico de homocigotos, es decir la endonucleasa de restricción cortó el DNA entregando fragmentos del mismo tamaño y que en el gel se superponen en la misma posición (Fig. 27 – 16). Por otro lado, los fragmentos de distinto tamaño que aparecen en el gel serán típicos de los polimorfos o provenientes de genes heterozigotos de cada padre y dan una banda superior y otra inferior (Fig. 27 – 16). En ambos casos los fragmentos se distinguirán al visualizarlos pasando luz UV por ellos o tiñendo con Bromuro de Etidio, colorante que se intercala en el DNA y lo hace visible.

Cómo resultado de la migración de los segmentos de DNA es posible observar innumerables bandas, sin saber cuales son las que corresponden al gen de la cadena β de la hemoglobina. Luego, para identificar al gen en esta población de fragmentos de distinto tamaño, se debe usar una sonda o hebra de DNA o RNA con marca radiactiva o inmunológica o fluorescente a la UV. Esta sonda debe corresponder a una secuencia de bases específica, complementaria al segmento del gen de la cadena β.

Ahora, para que la sonda reconozca y se una a la hebra complementaria correspondiente al gen de la cadena β, entre los fragmentos del gel. Se debe proceder a un tratamiento con una solución salina capaz de separar ambas hebras. Posteriormente se traspasa una de ellas por difusión a un papel de nitrocelulosa. Esta última técnica se denomina Southern Blot (ver herramientas) o técnica del traspaso.

830

Héctor Rocha L. Principios de Medicina Molecular

Padre Fragmentos dobles
GENOTIPOS : PADRE

Madre

Descendencia

MADRE

HIJO

HIJA

HIJO

GUAGUA

Homocigoto Homozigoto Heterozigoto Homozigoto Normal Anormal Normal Normal

Gen de la cadena β de la Hemoglobina

Er Er

GEN CON DELECION

Er Er

GEN NORMAL

Fig. 27 - 16. Se observa la técnica de RFLP. Donde se estudia una familia que posee una delación en el gen de las cadenas β de la Hemoglobina.

A continuación, al disponer de un patrón de fragmentos representados tan solo por una de las hebras del DNA en el papel de nitrocelulosa, es posible agregar la sonda en un medio acuoso de menor salinidad, para observar como esta se aparea a su fragmento complementario, marcándolo para ser posteriormente identificado por medio de fluorescencia, una radioautografía o mediante un procedimiento inmunológico.

Volver al inicio

831

Héctor Rocha L. Principios de Medicina Molecular

g) MAPEO DE UN GEN

En la Fig. 28 - 16 se observa un gen que sé mapea físicamente para conocer su posición mediante el empleo de dos Endonucleasas de Restricción Eco R1 y Ind. III. La Eco R1 produce dos fragmentos de 4 y 6 Kb, mientras que la Hind III solo uno de 10Kb. La acción de ambas enzimas simultáneamente, produce fragmentos de 1, 4 y 5 Kb. Los fragmentos fueron sometidos a la técnica de Southern Blot y visualizados mediante una sonda para ubicar finalmente al gen entre los dos fragmentos de 1Kb, que no se observan en las
Fig. 28 - 16. Mapeo de un gen mediante dos enzimas de restricción

Posición desconocida del GEN
2 4 6 8 10 12 Kb

Visualización de los fragmentos por Southern Blot

10Kb

SONDA RADIACTIVA

GEN

6Kb 4Kb

4Kb Eco R1 Eco R1

6Kb Eco R1 10 Kb

GEN

10 Kb Hind III Hind III

6 Kb 4 Kb

Tratamiento con ambas enzimas de restricción Eco R1 y Hind III

10 Kb

GEN

6Kb 5Kb 4Kb

1Kb 4Kb Hind III Eco R1

5Kb 1Kb Eco R1 Hind III Eco R1

radioutografías, pues la sonda no se une a ellos.

832

Héctor Rocha L. Principios de Medicina Molecular

De esta forma es posible ubicar el gen en un mapa físico, al saber por que endonucleasas de restricción se encuentra flanqueado o bien en que patrón reconocible es fragmentado por estas enzimas. Es también posible saber el tamaño en Kb de los fragmentos, conociendo la cantidad de DNA que comprende cada uno de ellos por medio de estándares consistentes en distintos pesos moleculares conocidos que no aparecen en la figura anterior. Volver al inicio h) EMPLEO DE VNTRS POR “VARIABLE NUMBER TANDEM REPEATS SÉQUENCE” O NÚMERO VARIABLE DE SECUENCIAS REPETITIVAS Y EL USO DE LOS STS POR “SEQUENCE TAGGED SITES” O SITIOS MARCADOS POR SECUENCIA. Otra de las metodologías para detectar polimorfismos hace uso del DNA microsatélite que presenta un Número Variable de Secuencias Repetitivas o Variable Number Tandem Repeats Sequence (VNTRS). Las secuencias repetitivas se encuentran asociadas o ligadas a algún gen o alelo y al variar en tamaño o número de repeticiones entre una persona u otra, desplazan los sitos de restricción produciendo fragmentos de distintos largos o polimorfos, que se pueden separar por electroforésis y visualizar por radioautografía o tinción con Bromuro de Etidio. De esta manera, es posible ordenarlos para generar un mapa de la sección basado en los genotipos y tamaños de los fragmentos (Fig. 29 -16). Lo que se busca por estas técnicas es la diferencia entre los sitios de restricción reconocidos por una misma enzima o mezcla de ellas, para así tener fragmentos donde se relaciona su tamaño con el genotipo.
Sitios de restricAlelo a ción fijos:

VNTRs

Alelo b

Sitios de restricción desplazados por tamaño de las VNTRs

Alelo c

GENOTIPOS: 0 aa 3,0 Kb ab

1 bb

2 bc

3 Kb cc ac

2,5 Kb

2,0 Kb
Fig. 29 - 16. Las secuencias VNTR tienen distintos tamaños los que se pueden atribuir a polimorfismos.

833

Héctor Rocha L. Principios de Medicina Molecular

Una vez que se han caracterizado varios genes en un mismo cromosoma es posible ordenarlos mediante su reconocimiento por medio de marcadores moleculares (ver herramientas). Estos marcadores se pueden generar por diferentes técnicas como se observará más adelante. Una de ellas consiste en los STS o Sequence Tagged Sites por Sitios Marcadores caracterizados por la Secuencia. En esta técnica se emplean dos cebadores de 18 a 20 bases que amplifican por PCR (Reacción en Cadena de la Polimerasa, ver herramientas), una secuencia conocida de DNA. Esta secuencia se emplea como un hito o letrero caminero (el mismo letrero en distintos caminos o secuencias), para saber si los genes caracterizados por las endonucleasas de restricción se encuentran antes o después de ellos. Por otro lado algunas de las alteraciones que sufren los genes pueden hacer desaparecer o crear nuevos sitios de restricción. Estos sitios de corte varían de posición de un individuo a otro, dando fragmentos de distintos tamaños o bien si son normales se pueden llamar polimorfismos de un mismo gen o alelos a y b como ocurre en la Figura 30 - 16.

Sonda

Alelo a Alelo b Genotipos a a 3Kb 2 1 0 1 a b
SOUTHERN BLOTS

2

3

Alelo b con sitio nuevo b b

Fig 30 - 16. Dos alelos de un gen presentan una secuencia distinta en el sitio de corte por la endonucleasa de restricción, lo que permite estudiar sus genotipos. En los Southern Blots respectivos se observa una doble banda formada por alelos a,a largos de 3Kb y dos cortos b,b de 2 Kb, más el afectado con un nuevo sitio de restricción (al medio) a de 3Kb y b de 2Kb. El fragmento de 1 Kb no es visible pués la sonda no se unió a él.

834

Héctor Rocha L. Principios de Medicina Molecular

Ambos genes de la figura 30 – 16, tienen una secuencia diferente que les hace capaces de producir distintos genotipos. En el caso normal que este gen codificara para una enzima podría dar origen a Isoenzimas o bien Aloenzimas. Esto significa que su secuencia aminoacídica difiere en uno u otro aminoácido, pero cataliza la misma reacción, lo que se traduce en una adaptación para ser activa a una temperatura o a un pH diferente de la copia original Como se puede observar, en estas técnicas se hace uso de las diferencias más leves que existan en la secuencia de deoxiribonucleótidos entre uno u otro individuo, de esta forma

S in D ig e s t ió n 8 ,0 K b 4 ,7 3 ,3 1

S a l I

X h o l

S a l I + X h o l

6 ,5 K b 3 ,3 1 3 ,1 9 1 ,5 1 S a l I X h o l

3 ,3 1 K b

3 ,1 9 K b

1 ,5 1 K b

Fig. 31 - 16. Mapeo por restricción. Se ordena un fragmento de 8Kb por las posiciones relativas en el corte de las enzimas de restricción Sal I y X ho l.

se pueden detectar los distintos genotipos de que están constituidos. En general entre los mismos humanos, se asume que puede existir una variabilidad de un 0.3% en la secuencia total de las bases que constituye el DNA de cada persona, comparado con el 1,7% de diferencia entre hombre y Chimpancé Bonomo. En la figura 31 - 16, se observa un ejemplo de cómo ordenar mediante endonucleasas de restricción (Sal I y Xhol I) y electroforésis un fragmento de DNA de 8Kb. Mediante esta técnica se separan los fragmentos de distintos tamaños producidos por las enzimas de forma individual y ambas juntas. De similar forma es posible alinear grandes fragmentos de DNA como se observará más adelante con el fin de mapear un sector de un cromosoma mediante el procedimiento denominado top-down. Volver al inicio

835

Héctor Rocha L. Principios de Medicina Molecular

i)

MAPAS FÍSICOS O MAPAS DE ADN.

Se basan en la formación de clonos que contribuyen a proveer de la distancia física real entre marcadores presentes en el cromosoma expresado en kilobases. Los mapas

Células donadoras

Radiación

Células donadoras irradiadas

Células de ratón

Análisis Citológico Análisis molecular Células clonadas
Fig. 32 - 16. Mapeo obtenido por fusión de células de ratón con humanas cuyos cromosomas han sido sometidos a Rayos x para cortarlos. Posteriormente se observa en los híbridos la aparición de los caracteres o marcas. Mientras más cercanas menos posible de separarse y es más probable que aparezcan juntos.

Células híbridas

Físicos indicarían en un camino cuantos Kilómetros faltan para llegar a una ciudad o gen, mientras que el mapa genético sería algo así como lo que dice un lugareño, que la ciudad queda más adelante o que ya la pasó, pero no sabe a cuantos Kilómetros. Los mapas físicos proveen de las bases para la aislación y caracterización de genes individuales u otras regiones del DNA que presenten interés, así como proveen de material para el mapeo molecular a distintas resoluciones. Volver al inicio j ) MAPA CITOGENÉTICO De esta manera, el mapa citogenético o mapeo de los cromosomas, que se basa en el bandeo observado sobre los cromosomas teñidos (Fig. 25 – 16) es un mapeo de baja resolución. Otro de estos mapeos similares, consiste en el análisis de los híbridos obtenidos por radiación (Fig. 32 - 16), se analiza aquí la frecuencia con que dos marcadores se separan después de radiación por rayos X que rompe ambas hebras del DNA en el cromosoma. Posteriormente las células humanas irradiadas se fusionan con otras intactas de ratón y se procede a estudiar los genotipos o fenotipos de los conjuntos de células descendientes a partir de un par original humano-ratón fusionado, que portan

836

Héctor Rocha L. Principios de Medicina Molecular

variados cromosomas. La distancia se mide aquí en CentiRay (cR) que equivale al intervalo en el cual existe un 1% de probabilidad de ruptura inducida por irradiación. Se pueden emplear marcadores no polimórficos ya que se requiere de tan solo un cromosoma para determinar la frecuencia de aparición de marcadores ligados entre sí, dependiendo de la distancia que los separa después de la fragmentación Volver al inicio k) LA HIBRIDACIÓN IN SITU Entre las técnicas para confeccionar los mapas se encuentra la hibridación in situ, que consiste en emplear una sonda de una secuencia no específica del DNA, constituida por un DNA genómico (cualquier trozo de DNA) o bien una sonda específica, como el DNAc (DNA complementario sin intrones obtenido del RNAm con Transcriptasa Inversa). Su localización se puede detectar al observar la sonda unida a la hebra de DNA complementaria del cromosoma intacto. El DNAc marcado se emplea como una sonda específica para detectar las regiones expresadas o Exones de un gen donde se aparea. Las sondas de DNAc pueden reconocer las posiciones de los genes que más interesa identificar y que se pueden ubicar en las cercanías de otro mapa generado por técnicas de marcadores ligados (linkage map). De esta forma se pueden emplear distintas sondas y se pueden ubicar distintas secuencias marcadoras al mismo tiempo. La sonda se marca con biotina, dioxigenina o dinitrofenol de tal manera que pueda ser reconocida por proteínas específicas a estas moléculas, como son los anticuerpos o la avidina que se unirá a la biotina. En resumen, la sonda después de hibridizar, acompañada de su grupo específico, recibe a una proteína que se une a la sonda y que tiene una porción conjugada con una molécula fluorescente, como la fluoresceína o la rhodamina, etc., que posteriormente señala el lugar permitiendo su visualización.

SONDA

A

B

C

Fig. 33 - 16. En la figura A, una sonda de 1 kbp aparea con un exón de una sola copia de un gen. En la figura B, la sonda es de 40kpb y aparea inespecíficamente en varios sitios. En la figura C, La Sonda anterior es acompañada por un exceso de DNA repetitivo.

837

Héctor Rocha L. Principios de Medicina Molecular

l) FISH POR FLUORESCENCE IN SITU HIBRIDIZATION O HIBRIDACIÓN IN SITU CON FLUORECENCIA Una de estas técnicas se denomina FISH (Fluorescence In Situ Hibridization o Hibridación In Situ con Fluorescencia) (fig. 33 – 16) y es de baja resolución por lo que se pueden detectar cromosomas en núcleos en interfase cuyos marcadores o genes se encuentran separados de 2 a 5 Mbp. En los cromosomas en interfase o prometafase, cuando son menos compactos se pueden incluso

Cromosoma Humano
Fragmento de 400Kb clonado en YAC

Fragmento de 40 Kb clonado en cosmido

Subclono proveniente de un YAC: Cromosoma artificial de levadura Cosmido

Eco R1

Eco R1

Eco R1

Eco R1

Eco R1

Eco R1 Eco R1

Bam H1

Bam H1

Bam H1

Bam H1 Bam H1 Bam H1

Bam H1

4 Kb clonadas en un Plásmido

Cada subclono es mapeado por enzimas de restricción Plasmido

Secuencia nucleotídica parcial del gen de laβ-Globina Humana

Fig. 34 - 16. Clonación y subclonación de un fragmento de DNA el que se amplifica y mapea por endonucleasas de restricción para disponer de material para su secuencia

ordenar los marcadores para que el mapa morfológico y molecular sean colineales. Aún es posible amplificar los fragmentos correspondientes mediante PCR (Ver herramientas) al disponer de los cebadores adecuados y se pueden incluso aislar y caracterizar genes individuales y otras regiones de interés del DNA, a la vez que esta técnica provee de sustratos para la secuencia del DNA. Por otro lado, aquellos mapas genéticos obtenidos por análisis de la recombinación (lynkage map) no son lo suficientemente precisos para aislar un gen, por lo tanto se

838

Héctor Rocha L. Principios de Medicina Molecular

debe recurrir a un nuevo tipo de mapas físico. Para obtenerlos se debe emplear una serie de clonos que amplifican segmentos de DNA. Es decir, fabricando un YAC (Yeast Artificial Chromosome), CAC (Cosmid Artificial Chromosome) o un LAC (Lambda Artificial Chromosome), como se observa en la Fig. 34 – 16. Estos vectores se superponen cubriendo todo un sector del cromosoma y dan la idea física de la distancia entre los marcadores o genes en el cromosoma. La distancia se expresa aquí en Kb y se pueden ordenar por los cortes provocados por las enzimas de restricción Eco R1, Bam H1 como ocurre en las figura 35 – 16. Se empieza con baja
resolución y posteriormente se refina

Los mapas físicos son diferentes de los genéticos aunque tienden a ser iguales hacia el final cuando se tiene toda la secuencia.

Se emplean endonucleasas de restricción que no cortan en todos los sitios posibles:

Cromosoma

De los 8 sitios de corte, en un principio solo se corta en 4

Cortes posteriores

Se reconocen los fragmentos por la superposición de los sitios de corte

Fig. 35 – 16. Mapa top-down de macrorestricción basado en la superposición de macrofragmentos.

Volver al inicio m) MAPEO TOP-DOWN La aproximación top-down, se lleva a cabo cuando se dispone de un fragmento de gran tamaño. Este se aísla mediante electroforésis de pulso en dos dimensiones (40Kpb a 10Mpb) o bien es un cromosoma aislado por citometría de flujo (aislado de células en división donde se separan por diferencia de flujo y cantidad de DNA presente), o mediante células híbridas humano–ratón (que se propagan hasta dejar en su contenido cromosómico tan solo un cromosoma humano). A continuación el fragmento se corta con una enzima de restricción que digiere en menos sitios de los realmente existentes para ella, produciendo fragmentos de gran tamaño (Fig. 35 – 16). Estos fragmentos se pueden ordenar y proceder a cortarlos en fragmentos menores que a su vez también se pueden ordenar como se observa en la Figura 36 – 16.

839

Héctor Rocha L. Principios de Medicina Molecular

A
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30

B

C

D

E

Fig. 36 -16. clonación mediante Cósmidos, se separan por Electroforésis después de su digestión con una o más Endonucleasas de Restricción. El fragmento A no está relacionado con los otros.

De esta manera se genera un mapa de macrorestricción y se determina el orden y la distancia entre los sitios de corte por estas enzimas que son capaces de cortar rara vez. Así se producen mapas de mayor continuidad que los contig, pero la resolución es baja y no se pueden encontrar los genes en ellos ya que van de 100Kb a 1 Mb. Volver al inicio n) MAPEO BOTTOM-UP La aproximación desde abajo hacia arriba (bottom-up) consiste en subdividir en pequeños trozos los fragmentos mayores. Estos forman una biblioteca que se puede Clonar en un vector, generando millones de copias idénticas que posteriormente se pueden alinear por superposición. La biblioteca debe ser indexada o bien cada volumen o segmento de DNA debe estar ordenado y clasificado, es decir a que colección pertenece 840

Héctor Rocha L. Principios de Medicina Molecular

y en que posición se debe de encontrar. En la Figura 34 -16, se observan los fragmentos de cinco clonos de cósmidos que han sido digeridos. Se procedió a digerir con Hind III, una enzima de restricción con 6 pb en el sitio de reconocimiento, se marcó y luego se digirió con Mbo I, que reconoce solo 4 pb en el sitio de corte. Los fragmentos se separaron posteriormente mediante electroforésis en Acrilamida y aquellos marcados se reconocieron por radioautografía (Fig. 36 - 16). En este caso corresponderá a un arreglo multidimensional de los clonos donde se sabe la posición de cada uno de ellos. De esta manera se puede decir, que los cósmidos C, E, D, B se encuentran superpuestos en este sentido, mientras que A no se relacionaba con ellos (Fig. 37- 16).

C E D B

Fig. 37 - 16. Superposición de fragmentos cortados por las endonucleasas para indicar la continuidad del macrofragmento mayor formado por fragmentos contiguos.

Así se visualiza el orden existente en el cromosoma original, aquellos fragmentos que se superponen son contiguos y presentan en el gel de Agarosa igual migración, o bien las bandas se encuentran a la misma altura unas de otras. Los fragmentos alineados de esta manera, se ordenan ahora en la biblioteca, por clonos contiguos y se denominan Contigs (Fig. 38 - 16). En el caso de que el mapeo, por marcadores ligados (lynkage map) indique que en estos fragmentos alineados reside un gen, se pueden emplear los clonos contiguos de cada uno de ellos para

Frag m entos co ntig uo s

Las superposiciones se detectan por m apa de restricción, secuencia o hibridizaciones.

Se determina que C lonos son contiguos B ib lio teca de C lo no s
Fig. 38 - 16. Se localizan las posiciones relativas de las secuencias clonadas de la biblioteca. Se determinan los fragmentos y clonos contiguos.

841

Héctor Rocha L. Principios de Medicina Molecular

Determinar la secuencia de las bases. El mapeo por Contigs genera mapas muy detallados, pero solo de áreas pequeñas. No se pueden extender a algunas regiones del cromosoma, pues estas no se pueden clonar. En la Figura 39 - 16, se pueden apreciar los distintos mapas desde la menor a la mayor resolución. Entre ellos tenemos al mapa genético obtenido por frecuencia de recombinación de los genes o polimorfismos, seguido por aquel obtenido mediante alineación de fragmentos de restricción y el alineamiento por superposición de una serie de fragmentos representados por clonos contiguos que generan una biblioteca, para llegar finalmente a la secuencia individual de cada fragmento.

M GENETICO PO APA R RECOM BINACIO N 2-5cM M FISICO DE M R APA ENO RESOLUCION O M APEO CROM OSOM ICO 5M b M FISICO PO APA R FRAGM ENTOS DE RESTRICCIO N 1-2M b 1m B

G opoliom en orfism o

2m B

0,5m 2,5m B B

TOP- DOW N M FISICO DE BIBLIOTECA APA ORDENADA DE COSM IDOS CONTIG QUE SE UOS SUPERPONEN BOTTOM- UP M FISICO DE M R APA AYO RESOLUCION SECUENCIA deBASES 1b
Fig. 39 - 16. Tipos de mapas con diferentes resoluciones

842

Héctor Rocha L. Principios de Medicina Molecular

En general en la figura 39 – 16, aparece el diseño general a seguir para obtener el Mapa físico del genoma humano
CROMOSOMA

Mapa genético por recombinación de marcadores tipo RFLP y STS separados por 1cM o 1Mb

Mapa físico de marcadores RFLP y STS, donde se observa el orden y la distancia de alrededor de 100kb entre los marcadores

Clonos superpuestos de 0,5 a 1Mb

AGCTCTAGCGATGCAG

SECUENCIAS DE LOS FRAGMENTOS CLONADOS LAS QUE SE EMPALMARAN POSTERIOORMENTE EN LOS LUGARES DONDE SE SUPERPONGAN

Fig. 40 - 16. Estrategia general para secuenciar el genoma humano.

Volver al inicio

843

Héctor Rocha L. Principios de Medicina Molecular

GLOSARIO A Alelo: Forma alternativo de un sitio genético. Se hereda separadamente un alelo por cada padre. Pueden tener información como los genes o pueden ser sectores sin información como son las secuencias repetitivas de distinto tamaño según cada padre. Amplificación: Aumento en el número de copias de un fragmento específico de DNA. El procedimiento puede ser in vivo por clonación de un vector o in vitro por PCR. Autoradiografía: Es una técnica que emplea película impresionable por rayos X para visualizar moléculas marcadas radiactivamente. Se emplea para analizar el largo y número de los fragmentos de DNA después de separados por electroforésis. Autosoma: Es un cromosoma que no esta involucrado en la determinación del sexo. El genoma humano diploide consiste de 46 cromosomas con 22 pares de autosomas y un par de cromosomas sexuales denominados X e Y.

B Bacteriófago: Es un virus cuyo huésped es una bacteria. Se emplean estos virus como vectores para amplificación de fragmentos de DNA. Banco de Clonos: Colección de clonos consistente en fragmentos superpuestos de DNA que representan el genoma de un organismo. Biblioteca ordenada: Clonos primarios de DNA recombinante en Fagos, Cósmidos o YACs, que se colocan en un arreglo en dos dimensiones en placas de microtitulación. Biotecnología: Conjunto de técnicas biológicas desarrolladas por medio de la educación básica y aplicadas a la investigación y desarrollo de un producto. En especial en la industria del DNA recombinante. C Centimorgan (cM): Unidad de medida de la frecuencia de recombinación. Un centimorgan es igual a la probabilidad de 1% que un marcador en un sitio genético esté separado de otro marcador en otro sitio debido a la recombinación en una sola generación. En humanos 1cM es en promedio equivalente a 1 millón de pares de bases. 844

Héctor Rocha L. Principios de Medicina Molecular

Centrómero: Región especializada del cromosoma donde las fibras del huso se unen durante la división celular. Clono: Una copia exacta de material biológico, que puede ser un segmento de DNA que constituya un gen u otra región, o bien una célula completa o un organismo completo. Clonación: La obtención de múltiples copias exactas de un solo gene, un segmento de DNA o un organismo completo. La colección de moléculas de DNA copiadas o clonadas se denominan bibliotecas de clonos. Otro tipo de clonos lo constituyen las líneas celulares constituidas por células descendientes de una sola célula original. Un tercer tipo de clono al inyectar el núcleo de una célula cualquiera organismo superior en un oocito produce un animal completo genéticamente idéntico al patrimonio genético del núcleo inyectado como la conocida oveja Dolly. Clonamiento posicional: Es una técnica destinada a identificar genes responsables de enfermedades en el cromosoma. El gen puede cartografiarse, aislarse y clonarse sin ningún conocimiento del producto génico. Contig.: Grupo de fragmentos de DNA copiados o clonados que representan fragmentos superpuestos de un cromosoma particular. Cósmido: Vector de Clonación construido artificialmente que contiene el gen cos del fago lambda. Los cósmidos pueden ser empaquetados en partículas de Fago Lambda para infectar E. Coli. Se pueden introducir en estos huéspedes bacterianos fragmentos de hasta 45kb. Cromosoma: Estructura genética autoreplicante de la célula que contiene el DNA celular que mantiene en su secuencia nucleotídica el arreglo lineal de los genes. En procariontes la totalidad del genoma es llevado en un solo cromosoma. En eucariontes existen una serie de cromosomas cuyo DNA se encuentra asociado a una serie de proteínas. Cromosoma Artificial de Bacteria: Es un vector denominado BAC por Bacterial Artificial Chromosome, que se emplea para clonar fragmentos de 100 a 300 Kb en células de E. Coli. Su componente principal es el plásmido F que se encuentra en esta bacteria. D Deleción: Es cuando falta una o más bases en una de las hebras del DNA. Desorden de un solo gen: Desorden hereditario causado por un alelo mutante de un solo gen. 845

Héctor Rocha L. Principios de Medicina Molecular

Diploide: Contenido total de material genético consistente de cromosomas apareados, un cromosoma por cada padre. DNAc o DNA Complementario: DNA que se sintetiza empleando RNA mensajero como hebra patrón mediante una Transcriptasa Inversa. La hebra de DNAc se emplea como una sonda durante el mapeo físico de los cromosomas. Dominio: Porción discreta de una proteína con su propia función. E E. Coli: Bacteria común que se ha estudiado intensivamente debido a su pequeño genoma, tamaño, carencia de patogenicidad y facilidad de crecimiento en condiciones de laboratorio. Electroforésis: Método de separación de moléculas como fragmentos de DNA y Proteínas desde una mezcla de moléculas similares. Se somete la mezcla a un campo eléctrico sobre una matriz porosa produciéndose la separación al chocar las moléculas con los poros de la matriz de distinto tamaño. La migración se debe a la carga y los choques al tamaño de las moléculas para atravesar los poros. Agarosa y Acrilamida son los polímeros que se emplean para ácidos nucleicos y proteínas. Enzima de Restricción o Endonucleasa: Es una enzima que reconoce secuencias cortas con simetría bicatenaria y las corta. Son originarias de un mecanismo de defensa bacteriano contra el DNA inyectado por los bacteriófagos. EST: Expressed Sequence Tag por Etiqueta de Secuencia Expresada o Marcación de Secuencia Expresada. Se usan estas secuencias específicas que marcan el DNA como puntos de referencia, para comparar fragmentos de distintas personas y ubicar los genes antes o después de estas secuencias marcadoras. Eucarionte: Célula u organismo cuyo núcleo es una entidad discreta y que consta de una membrana, además, poseen formas subcelulares incluidas en el núcleo. Constituyen todos los organismos excepto partículas virales, bacterias y algas azul-verdosas. Exón: Secuencia del DNA que codifica para proteína. Exonucleasa: Una enzima que rompe nucleótidos secuencialmente desde un extremo de un fragmento lineal de DNA.

846

Héctor Rocha L. Principios de Medicina Molecular

Expresión Genética: Es el proceso por el cual la información del gen se convierte en estructuras Funcionales de la célula. La expresión de un gen consiste en la transcripción y la traducción en proteína o tan solo la transcripción en RNA. F FISH por Fluorescence In Situ Hibridization: Aproximación a un mapa físico que usa una marca de fluoresceína unida a una sonda que hibridiza con cromosomas en metafase y con la cromatina menos condensada de la interfase. G Gameto: Célula reproductiva madura de macho o hembra conocida como esperma o huevo con un número haploide de cromosomas. Gen: La unidad física y funcional de la herencia. Es una secuencia ordenada de nucleótidos localizado en una posición particular de un cromosoma particular que codifica para un producto funcional como lo es el RNA o las proteínas. Genética: Estudio del patrón como se heredan las características específicas de un individuo u espécimen. Genoma: Todo el material genético en los cromosomas de un organismo en particular. Su tamaño se encuentra representado por el número de bases.

H Heterozigoto: La presencia de alelos diferentes en uno o más lugares de los cromosomas homólogos. Homebox: Se traduce textualmente como boletería o lugar caracterizado por una secuencia corta de nucleótidos cuya secuencia de bases es virtualmente idéntica en todos los genes que la contienen. Se encuentra desde la mosca de la fruta hasta humanos. Se encuentra relacionada con la expresión de un grupo particular de genes durante el desarrollo. Homología: Igualdad entre secuencias de DNA o proteína entre individuos de una misma especie y entre especies.

847

Héctor Rocha L. Principios de Medicina Molecular

Hibridización: Es el proceso de juntar dos hebras complementarias de DNA o una de DNA y otra de RNA para formar una molécula de doble hebra. I Informática: Es el estudio de la aplicación de técnicas computacionales y estadística para el manejo de la información. dentro del proyecto Genoma Humano se deben buscar los datos de las distintas secuencias y compararlos para encontrar la continuidad y ala vez predecir la estructura y función de la información almacenada en los genes y traducida a proteínas.

Interfase: Periodo durante el ciclo celular cuando el DNA es replicado en el núcleo y es seguido por la mitosis. Intrón: Es la secuencia de DNA que se encuentra entre los exones de un gen y que no codifica para proteína. Solo separa los dominios de una proteína en el gen. In vitro: Significa fuera de un organismo vivo.

K Kariotipo: Fotomicrografía de los cromosomas individuales arreglados de acuerdo a un formato estándar mostrando su número, tamaño y forma de cada tipo de cromosoma. Se emplea en mapeo físico de baja resolución para correlacionar anormalidades groseras (trisomia 21) con enfermedades características. Kilobase(kb): Unidad de largo de un fragmento de DNA y corresponde a mil bases. L Loci: (Plural de locus o varios locus) Posición en un cromosoma donde se encuentran varios genes. Locus: Posición de un gen u otro marcador en un cromosoma. Lleva implícito el entendimiento de que es una secuencia que se expresa.

M Mapa de Exclusión: Indica en que cromosomas o regiones no se encuentra un determinado gen. 848

Héctor Rocha L. Principios de Medicina Molecular

Mapa de Macrorestricción: Es un mapa que indica el orden y distancia a la cual las enzimas de restricción cortan los fragmentos de DNA o los cromosomas. Mapeo:

Ubicación de los genes u otras secuencias que forman hitos o son marcadoras y se encuentran en el genoma humano u de otro organismo
Mapeo físico: Es un mapa de lugares que pueden ser identificados por sus características locales como lo son sitios de corte por enzimas de restricción, secuencias repetidas en tandem, genes, etc. Su distancia se mide en pares de bases. En humanos el mapa de más baja resolución es él bandeo de los cromosomas y el de más alta es la secuencia de bases de cada cromosoma. Mapeo por ligamiento o unión: Es un mapa que indica las posiciones relativas de los lugares o regiones donde se encuentran los genes (loci). Se determina la posición observando cuán a menudo se heredan juntas las características otorgadas por el loci (varios genes). La distancia se mide en centimorgans (cM). En algunos casos se emplea RFLP para producir mapas por ligamiento. Se estudian la disposición de un gen o el patrón de cortes por enzimas de restricción en una familia multigeneracional y se observa si se encuentra asociado a alguna enfermedad. En este caso se estudia la segregación de un patrón de cortes determinado y una enfermedad en tres o más generaciones de una familia. Por lo tanto un cierto patrón de cortes corresponderá a la herencia de una característica o enfermedad. Existe ligamiento si el patrón determinado y la enfermedad se encuentran en el mismo cromosoma y en el caso contrario significa que el cromosoma no contiene el locus de la enfermedad.

Mapeo por deleción: Descripción de un cromosoma empleando sitios específicos donde han ocurrido mutaciones por deleción empleados como marcadores de áreas específicas.

Mapeo por restricción: Mapa que indica el orden y la distancia entre las secuencias que sirven de sustratos de las enzimas de restricción en el cromosoma o un fragmento de DNA. Marcador: Lugar físico identificable en un cromosoma que puede ser el sitio de corte de una enzima de restricción o un gene cuyo patrón de herencia pueda ser monitoreado. Los marcadores pueden ser regiones expresadas de los genes o secuencias que no codifiquen, pero cuyo patrón de herencia pueda ser reconocido y seguido. Megabase (Mb): Significa un millón de bases y es equivalente a 1 cM.

849

Héctor Rocha L. Principios de Medicina Molecular

Meiosis: Dos divisiones celulares consecutivas en células diploides destinadas a formar gametos, pero solo una replicación de DNA dando origen a cuatro células haploides. Minisatélite: Son secuencias de DNA repetidas de 2(AG AG) a 100 (AGAGAGAGAGAG.........AG100) nucleótidos de longitud que se pueden encontrar entre dos sitios de restricción. Mutación: Cualquier cambio heredable en la secuencia del DNA.

N Núcleo: Organelo celular en Eucariontes que contiene el material genético.

O Oncogene: Un gen que se encuentra asociado con el cáncer. Los Proto-oncogenes se encuentran regulando el crecimiento y la diferenciación celular durante el desarrollo y posteriormente permanecen silenciosos durante la vida del organismo. Sin embargo, pueden mutar a los denominados oncogenes y estimular el crecimiento sin control.

P P1-Cromosoma Artificial Derivado ( PAC): Un vector para clonar fragmentos de DNA de 100 a 300kb con un promedio de 150 kb en E. Coli. Se basa en el bacteriófago con genoma P1. PCR o Reacción en Cadena de la Polimerasa: Técnica para amplificar fragmentos de DNA que emplea dos cebadores de al menos 20 pares de bases con una secuencia conocida. Estos aparean con el fragmento y sirven para iniciar la replicación que emplea la enzima resistente al calor Taq –1 DNA polimerasa, ya que se emplean ciclos sucesivos cambios de temperatura para abrir y cerrar la doble hebra apareando con los cebadores para así amplificar el fragmento en presencia de los nucleótidos y su enzima.

Plásmido: DNA circular extracromosómico que se replica autónomamente en la bacteria. No es esencial para la sobrevivencia de la célula bajo condiciones no selectivas y son capaces de integrar fragmentos de DNA foráneo. Se emplean como vectores de clonación.

850

Héctor Rocha L. Principios de Medicina Molecular

Polimorfismo: Diferencia en la secuencia de DNA entre individuos. Las variaciones genéticas que suceden en más del 1% de la población se consideran útiles para el análisis genético por ligación. Polimorfismo en la Longitud de los Fragmentos de Restricción (RFLP): Se emplean para distinguir copias normales de copias mutantes y también se emplean como marcadores genéticos ya que se hereda un determinado patrón de cortes. La variación entre los individuos ocurre en el tamaño de los fragmentos producidos por las enzimas de restricción. El tamaño polimórfico de los fragmentos se emplea en el mapeo físico y de ligación genética. Existe una base cambiada cada 200 nucleótidos en el DNA de uno a otro individuo normal y estas variaciones crean o destruyen sitios de corte para las endonucleasas de restricción. Distintas personas tendrán distintos patrones de corte aunque sean normales. De esta manera el patrón de cortes puede seguirse en distintas generaciones para identificar un gen o una región intergénica, así como regiones reguladoras adyacentes e intrones. Procarionte: Célula u organismo que no posee una membrana que rodee su material genético. En general son las bacterias. Promotor: Un sitio en el DNA donde se une la RNA polimerasa para iniciar la transcripción.

Proyecto Genoma: Es la investigación y desarrollo de nuevas técnicas para el mapeo y secuenciación de todo el genoma humano.

R Recombinación: Proceso mediante el cual la progenie cuenta con una combinación distinta de genes que los otorgados por sus padres. Esto ocurre por crossing-over o entrecruzamiento de cromátidas hermanas. Durante la meiosis se rompe el cromosoma de la madre y el padre para intercambiarse. Este proceso puede resultar en un intercambio de alelos entre ambos cromosomas.

S Secuenciar: Determinación del orden de los nucleótidos o la secuencia de bases en una molécula de DNA o RNA o bien el orden de los aminoácidos en una proteína.

851

Héctor Rocha L. Principios de Medicina Molecular

Secuencia Complementaria: Es la secuencia de ácidos nucleicos de una hebra cuyas bases puede aparear con la otra hebra para formar una doble hebra. Secuencia Conservada: Secuencia de bases o aminoácidos que no ha cambiado a pesar del proceso evolutivo. Secuencia Genómica: Orden de las bases de un fragmento particular de DNA

Secuencias Repetidas en Tandem (TRS): Copias múltiples de las mismas secuencias de bases en un cromosoma. Se emplean como marcadores de mapeo físico Secuencias Repetidas en Tandem de Número Variable (VNTR): Grupos de secuencias ampliamente repetidas de 14 a 100 nucleótidos que constituyen polimorfismos entre los humanos. Tienen distintos tamaños entre una y otra persona, es decir, producen alelos y a la vez sirven de marcadores genéticos por encontrarse en algunos casos en las cercanías de algún gen o en un locus dado. Producen un determinado patrón de bandas al ser cortadas con endonucleasas de restricción cuando los sitios de corte se encuentran flanqueándolas. Las bandas se visualizan después de una separación electroforética en un gel, como la huella molecular del DNA o “Fingerprinting”, ya que es específico para cada individuo, sin importar de qué tejido venga.

Sitio marcado por su secuencia o Sitio de etiquetaje de la secuencia (STS): Secuencia específica única ubicada en los cromosomas y que sirve de hito o marcador de la posición de los genes al comparar los mapas físicos de las secuencias de distintas personas. Se pueden localizar en genes ya secuenciados y emplearlos de marcadores por hibridación in situ, para que se empleen como sitios de referencias. Otros marcadores STS son las Etiquetas de secuencias expresadas (EST) obtenidos de clonos de DNAc pertenecientes a genes que se expresan demasiado en un tejido (como ejemplo la cadena α de la hemoglobina en eritroblastos). También se pueden localizar por hibridación in situ.

Otro marcadores STS son los segmentos P transponibles de las cepas salvajes en Drosófilas que al ser transpuestas a las cepas de laboratorio crean sitios de secuencia específica donde se han insertado

Sitio de Corte por enzima de Restricción: Sitio específico donde actúa la enzima de restricción. Cada persona posee estos sitios, pero se encuentran ubicados en distintas partes del DNA.

852

Héctor Rocha L. Principios de Medicina Molecular

Sitios de corte infrecuentes: Algunas enzimas de restricción cortan los sitios cada 100 pares de bases y otras las poco frecuentes cada 10.000 pares de bases.

Sonda: Hebra de DNA o RNA marcadas inmunológica o radiactivamente que se emplean para detectar secuencias complementarias por hibridación. Southern Blotting: Transferencia por absorción a papel de nitrocelulosa de los fragmentos de DNA separados por electroforésis para detección de la secuencia específica por medio de sondas radiomarcadas.

T Telómero: Extremo final del cromosoma. Se encuentra involucrado en la replicación y estabilidad de las moléculas de DNA lineales. Transformación : Proceso por el cual el material genético que lleva una célula se altera por incorporación del DNA exógeno.

V Vector: Molécula de DNA que se origina de un virus, plásmido u algún otro organismo superior en el cual otro fragmento de DNA de tamaño apropiado puede ser integrado sin pérdida de la capacidad de autoreplicación del vector. Los vectores sirven para introducir DNA foráneo en células anfitrionas donde se pueden reproducir o amplificar en grandes cantidades. Como ejemplos tenemos a plásmidos, cósmidos y cromosomas artificiales de levaduras. Los vectores son moléculas recombinantes que contienen secuencias de distintos orígenes. Vector de Clonación: Molécula de DNA que se origina de un virus, bacteria o célula de un organismo superior (levadura) dentro de la cual un fragmento de DNA de un determinado tamaño puede ser integrado sin pérdida de la capacidad de auto replicación del vector. Los vectores introducen DNA ajeno a las células huéspedes donde puede ser reproducido en grandes cantidades. Ejemplo son los plásmidos, cósmidos y los cromosomas artificiales de levadura (YAC).

853

Héctor Rocha L. Principios de Medicina Molecular

Y YAC. o Cromosoma Artificial de Levadura: Es un vector que se emplea para clonar fragmentos de DNA de hasta 400kb. Se construye de la s secuencias teloméricas, centroméricas y de las necesarias para dar origen a la replicación en levaduras.

Volver al inicio

854

Héctor Rocha L. Principios de Medicina Molecular

REFERENCIAS

Human Biology Web Site http://www.people.virginia.edu/~rjh9u/humbiol.html DNA Forensic Crime http://www.people.virginia.edu/~rjh9u/humbiol.html Fingerprinting via Southern Blotting http://www.people.virginia.edu/~rjh9u/humbiol.html

855