You are on page 1of 14

HERPETOLOGICAL JOURNAL, Vol. 15, pp.

231-243 (2005)

TAXONOMIC CHAOS IN ASIAN RANID FROGS: AN INITIAL PHYLOGENETIC RESOLUTION
LIQIAO CHEN1, R OBERT W. M URPHY2, AMY L ATHROP2, ANDRE NGO2, NIKOLAI L. ORLOV3, C UC THU HO4 AND ILDIKO L. M. SOMORJAI5
1

Department of Biology, East China Normal University, Shanghai, China

2

Centre for Biodiversity and Conservation Biology, Royal Ontario Museum, Ontario, Canada
3

Zoological Institute, Russian Academy of Sciences, Petersburg, Russia

4

Institute of Ecology and Biological Resources, Nghai Do, Tu Liem, Hanoi, Vietnam
5

Genetics Department, University of Cambridge, England, UK

The taxonomy of ranid frogs is in a state of chaos, and Asian ranids are no exception. We undertook an investigation of the phylogenetic relationships of most major groups of Asian ranids using mitochondrial DNA sequences from the 12S, tRNAVal and 16S genes. The resulting phylogenetic hypothesis had varying correspondence with the current taxonomy of the frogs at the subfamilial and generic levels. In order to maintain a taxonomy that reflects phylogenetic history, a number of taxonomic changes are proposed. Within subfamily Raninae, we recognize the genera Rana, Amolops, Hylarana, Odorrana and Nidirana. Recognition of Huia is not supported by our data and the recognition of Pseudorana is equivocal. Tribe Limnonectini is elevated to subfamily Limnonectinae and it contains Limnonectes, Hoplobatrachus and Nanorana. Membership in Genus Limnonectes is redefined. Recognition of genera Paa and Chaparana results in a paraphyletic taxonomy. Key words: Anura, Asia, mtDNA, phylogeny, Ranidae

INTRODUCTION For many years following the major revisions of Boulenger (1882, 1918, 1920), the taxonomy of ranid frogs was stable. Now it is in a state of chaos. Numerous generic and subgeneric shifts have been proposed, usually without an examination of phylogenetic relationships. Dubois (1986 (1987)) recognized six tribes within the Raninae (=Ranidae by most authorities). Among ranids, his Ranini included the genera Altirana, Amolops, Batrachylodes, Micrixalus, Nanorana, Staurois, and Rana, with the subgenera Amietia, Hylarana, Paa, and Strongylopus, and Rana. Dubois' Tomopternini only included the genus Tomopterna. The tribe Ptychadenini had Ptychadena and Hildebrandtia. His Dicroglossini contained Ceratobatrachus, Conraua, Discodeles, Limnonectes (with five subgenera: Limnonectes, Bourretia, Fejervarya, Hoplobatrachus, and Taylorana), Occidozyga (with two subgenera: Occidozyga and Euphlyctis), Palmatorappia, Phrynoglossus, Platymantis, and Ingerana (with Ingerana and Liurana as subgenera). The fifth tribe, Pyxicephalini, included Pyxicephalus. Finally, tribe Ranixalini had Ranixalus, Nannophrys, and Nyctibatrachus. Higher taxonomy has continued to change. Dubois (1992) raised the tribe Dicroglossini to the subfamily level, Dicroglossinae. He recognized four tribes in this
Correspondence: R. W. Murphy, Centre for Biodiversity and Conservation Biology, Royal Ontario Museum, 100 Queen's Park, Toronto, Ontario, Canada M5S 2C6. E-mail: drbob@zoo.utoronto.ca

subfamily: (1) Ceratobatrachini (Ceratobatrachus, Discodeles, Ingerana, Palmatorappia, Platymantis, and Taylorana), (2) Conrauaini (Conraua), (3) Dicroglossini (Euphlyctis, Occidozyga, and Phrynoglossus), and (4) Limnonectini (Hoplobatrachus and Limnonectes). These arrangements have been controversial. Inger (1996) noted that tribe Limnonectini was demonstrably paraphyletic with respect to the Ceratobatrachini, Conrauini, and Dicroglossini. No evidence supported the monophyly of Limnonectini. It may be paraphyletic with respect to the Mantellinae and through the mantellines to the Rhacophoridae. Laurent (1951, 1979) and Ford (1993) questioned the monophyly of the Ranidae (sensu stricto) with respect to the family Rhacophoridae. Recently, Chinese authorities have proposed numerous other changes, in particular generic reallocations. Fei et al. (1990 [1991]) described or erected a number of new generic combinations for many Chinese species. Further generic changes were made by Ye et al. (1993) and Fei (1999). These changes were made in the absence of a phylogenetic evaluation. Thus, we undertook an investigation of ranid relationships, particularly for representative south-east Asian genera and species. When we initiated this study, no phylogenetic evaluation of the group had been attempted at a higher taxonomic level, although one distance-based evaluation had been made (Wallace et al., 1973). Subsequently, four other phylogenetic studies have reported on the relationships of ranid frogs, as discussed below.

16SML and 16S2H (Table 1). and then once with chloroform-isoamyl alcohol (CI). comm. and an African mantelline (family Rhacophoridae.5 min) performed in 25 µl reactions. temporaria (Y11977). macrodon (U66132-33). L. University of Guelph). Sequence position indicates the starting position of the primer in the Xenopus laevis genome and is preceded by the amplification direction as indicated by (H) heavy or (L) light strand. 16S5H. and Xenopus laevis (M10217).232 L. R. U55269-70. Laliostoma labrosum (AF026354. ("duboisi. Dubois. TABLE 1. These species include Limnonectes acanthi (U6612021). Limnonectes sp. U66130-31. We also incorporated sequences from an analysis of fanged ranids (Emerson & Ward. ibanorum (U66122-23). and 16S mitochondrial gene and the relative positions of the primers used in this study. Schematic drawing of the 12S.. Primers used for amplifying and sequencing fragments of RNA genes in the subfamily Raninae. Hatched lines refer to primers that are complements to each other. 1979) and Ford (1993). U55274). were sequenced for three mitochondrial DNA genes. Annealing temperatures were changed from 45°C to 55°C as needed in order to improve the quality of PCR products. comm. deionized water. L. Specific primers are listed in Table 1. GenBank accession numbers. grunniens (U66124-25). U55275). Subsequently. 12S2H. limnocharis (U55265. The cleaned DNA was sequenced directly with Thermo Sequenase 33Plabeled terminator cycle sequencing kit (Amersham). We used X.bangor. 1998). Double stranded fragments were amplified in 33 cycles of the polymerase chain reaction (PCR. most of them south-east Asian ranines.) Modified from Palumbi (1996) Fu (2000) Fu (1998) Palumbi (1996) MATERIALS AND METHODS S PECIMENS EXAMINED Forty-five individuals. U55272). X86318). The products of the sequence reactions were resolved in a polyacrylamide 7M urea gel that was then dried and visualized on autoradiograph films (Kodak) within 2448 hr. paramacrodon (U55267. or in the tissue collections of Jinzhong Fu (JF) and James P. several internal primers were used for sequencing. DNA SEQUENCE A NALYSIS Sequences were initially aligned using ClustalW (Thompson et al. and Occidozyga laevis (U6613839). macrocephala (66116-17).uk/~bss166/ HJ/). Usually. A few sequences were resolved using an ABI 377 automated DNA sequencer using the manufacturer’s protocols. Total genomic DNA was extracted from frozen or alcohol preserved tissue sam- FIG 1. L and H denote light and heavy strands. CHEN ET AL. Locations of the primers are shown in Fig 1. L. (1989) Kocher et al. 16S3L. several populations of L. These tissue samples and most voucher specimens are preserved in the Royal Ontario Museum (ROM). 45-55°C for 30 sec 72°C for 1. L. Polypedates megacephalus (AF026350. Taxonomic assignment of examined species generally follows Frost (2004). L. AF026367). Name 12S1L 12S2H 12S2L 16S3H 16S3L 16S1H 16S5H 16S1M 16S2H Sequence 5' to 3' CAAACTGGGATTAGATACCCCACTAT AGGGTGACGGGCGGTGTGT ACACACCGCCCGTCACCCTC GTAGCTCACTTGATTTCGGG CCCGAAATCAAGTGAGCTAC GGCTATGTTTTTGGTAAACAG CTACCTTTGCACGGTTAGGATACCGCGGC CCGACTGTTTACCAAAAACAT CCGGATCCCCGGCCGGTCTGAACTCAGATCACG Sequence position Reference L2484 H2897 L2917 H3341 L3362 H3958 H4040 L3955 H4552 Kocher et al. in our study to evaluate the monophyly of the family Ranidae as questioned by Laurent (1951. 16S3H. subfamily Rhacophorinae). DNA AMPLIFICATION AND SEQUENCING ples of muscle or liver by digestion with proteinase K for 5-12 hr. L. magna (U66118-19). U66134-37). 1994) with gap-open and gap-exten- Three ribosomal RNA genes. Infrequently. R. L. 92°C for 30 sec. ingeri (U55268. AF026374). 12S. and included an Asian treefrog (family Rhacophoridae. the 25 l product was separated by electrophoresis on an agarose gel and stained with ethidium bromide. respectively. catesbeiana (M57572). PCR reactions amplified the entire fragment from 12S1L to 16S2H.) Fu (pers. After amplification. laevis as our initial outgroup taxon. Additional sequence data from GenBank were used for the following species: Rana pipiens (X86247. subfamily Mantellinae). blythii (U55262-3.ac. U66126-27. The mtDNA region of 12S through 16S was sequenced using the following method. amplification of the larger fragment was not possible and thus the following primers were used: 12S1L. tRNAVal. Bogart (JPB) (Department of Zoology. . L. and tRNAVal from the mitochondrial genome were selected to reconstruct the phylogeny. 1999) (U66112-13). (1989) Fu (1999) Fu (pers. U66114-15. The bands containing DNA were excised and the DNA was eluted using Gene Clean II kit (Bio101) and suspended in distilled." a nomen nudum. 16S. collection locality and voucher data for specimens sequenced in this study are given in an electronic Appendix dowloadable from the Journal’s website (http://biology. and purified three times with phenol-chloroform-isoamyl alcohol (PCI).

Only potentially cladistically informative sites were maintained for the analysis in PAUP* (ver. the differences constrained to one subclade. 1999). Sites with ambiguous alignment were excluded from the phylogenetic analysis because the homology cannot be confidently assumed (Hillis et al. Nidirana chapaensis was resolved as the sister group to all other members of clade A1. the mantelline. rugulosus.2. Ptychadena was resolved as the sister group of Pyxicephalus plus two major speciose clades (A and B) of ranids (Fig. Table 2). In total. TS = total number of homologous sites resolved. B1-B4. CI=0. analysis of the 236 potentially informative sites yielded six most parsimonious trees (MPTs. NPPIS = number of potentially phylogenetically informative sites. B2 consisted of Hoplobatrachus crassus. 16S rRNA = 206453206497). cytosine (c). and the rhacophorine. or thymine (t) (Swofford et al. a monophyletic Amolops (Amolops) was the sister group to a clade of Rana including subgenera Hylarana and Pelophylax. Limnonectes. In Clade A2.276 n/a 0. Nanorana. Laliostoma. Swofford. Occidozyga. RI = retention index. with random addition sequence. plus a mantelline. 500 replicates. were resolved as sister taxa. Clade B1. guanine (g).0. all RNA gene sequence data were combined for a total evidence analysis. including specimens of Odorrana and Rana. Bremer. 2): Clade A. Rana (Pantherana) pipiens was resolved as the sister species of R. All multistate characters were evaluated as unordered because there is no a priori reason to assume order of evolutionary change between nucleotide bases adenine (a). Together they formed the sister group of the three species of Occidozyga. was the sister group of clades B2-B4. NVS = number of variable sites. and a paraphyletic subgenus Sylvirana.24. Subsequently.239 RI 0. We also performed decay analyses (DI. Analysis of these data yielded three most parsimonious trees (8512 steps in length. (Pseudorana) johnsi plus R.0. using tree bisection reconnection branch swapping with steepest descent and collapsing zero length branches.237 0. Polypedates megacephalus. blythii being resolved as paraphyletic (Fig. LMPTs = Length of most parsimonious solution. Their sister group contained R. Eriksson. RI=0.9. Second.524 n/a 0. In Clade B1. and rhacophorine. NSR = number of homologous sites retained. It was the sister group of clades B3 and B4. and Rana.5. Nodal support was assessed for the combined data sets. Among these sites. 5..527 sion penalties set to 5. Clade A was treated as having two major subclades. 4. Laliostoma labrosum. NMPTs = number of most parsimonious trees resolved. The two genes were initially analyzed separately. The clade containing Rana formed the sister group to a clade composed of Amolops (Huia) nasica and a paraphyletic Odorrana. CI = consistency index. Limnonectes cancrivorus. with L. 1985) used 1000 replicates calculated in PAUP*. Trees for the tRNAVal gene were not calculated (n/a) owing to the limited number of characters (37) available to resolve nodes among the 52 taxa in the analysis. minor adjustments to the computer alignments were made by eye in BioEdit (ver. 546 sites were sequenced for 12S. 1988) using AutoDecay (ver 4.TAXONOMY OF ASIAN FROGS 233 TABLE 2.. Ratios of transitions to transversions were calculated in MacClade.0.0b8a. Hoplobatrachus. 2. Hylarana. in turn. All sequences were deposited in GenBank (12S = AF206072-AF206116. and a paraphyletic L. 728 potentially informative sites resulted in 16 cladograms. limnocharis. included Amolops. Chaparana and Nanorana. and 1509 for 16S for a total of 2127 aligned sites. Clade B was composed of Chaparana.53). Clade. and Paa. (Rana) temporaria. 2001). Bootstrap proportions (BSP. which consisted of Limnonectes blythii and its relatives. RESULTS Forty-five specimens were sequenced for 12S through 16S RNA genes. Polypedates. 4. AS =number off ambiguous sites removed. Maddison & Maddison. H. Clade B3 contained Paa (as a paraphyletic taxon). 2002). Summary of RNA genes sequenced from the ingroup and outgroup taxa. We did not attempt a separate phylogenetic analysis of the tRNAVal gene because there were too few potentially phylogenetically informative sites for a meaningful analysis. The sister group of Clade B3 was B4. P ARSIMONY EVALUATION For 12S. NT = Total number of taxa analyzed. The phylogenetic analysis using PAUP* employed an heuristic search.) . because different genes may experience different evolutionary pathways. Clade B was treated as having four major subclades. Combining all RNA gene sequence data into a single data set resulted in 1012 potentially cladistically informative characters. 72 for tRNAVal. For 16S. retaining minimal trees only. Odorrana. a combined data analysis was conducted. Hall.530 0. Gene 12S rRNA tRNAVal 16S rRNA All RNAs NT 53 52 69 70 TS 546 72 1509 2127 AS 29 2 25 56 NSR 517 70 1484 2071 NVS 335 48 910 1301 NPPIS 236 37 728 1012 NMPTs 6 n/a 16 3 LMPTs 1664 n/a 6279 8512 CI 0. 56 were ambiguously aligned and 1012 were potentially phylogenetically informative (Table 2). 1996). (Aquarana) catesbeiana. tRNAVal = AF206117-206161. Felsenstein. 2001) and MacClade (ver. Because of similarities in nucleotide proportions and levels of site divergence. A1 and A2. 1991). Nidirana.

FIG 2. 1992 appear to the right of the tree. Numbers above the line are bootstrap proportions (50) and those below are Bremer decay indices examined up to six steps longer than the most parsimonious trees. Taxonomic groupings proposed by Dubois. Xenopus laevis was used to root the tree. . The strict consensus tree of the two most parsimonious explanations of mtDNA sequence data for south-east Asian ranids. CHEN ET AL.234 L. Taxonomy reflects current usage.

representatives of Fejervarya. 1997. Nannophrys. The two mitochondrial genes evolved in similar ways. though their focus was on the biogeography of these frogs rather than taxonomy. Fejervarya. 1995). For example. Occidozyga. 2002): “Do you believe that evolution occurs in a most parsimonious manner? If not (which is demonstrably true-homoplasy exists). of Toronto. which was resolved as the sister group to Fejervarya. perhaps as old as 150 Ma (Mindell & Honeycutt. which together formed the sister group of all other ranids plus rhacophorids. Given the small numbers of characters analyzed. including species of Buergeria. Siddall & Kluge. our analysis discovered several problematic associations. Independent analyses for each gene revealed compatible branching patterns. Hoplobatrachus. cancrivorus. The genera Limnonectes. lower taxonomic groupings were congruent in a number of ways with those proposed by Dubois (1986[1987]. Ptychadena and several species of Rana were also included. Rana was paraphyletic. More recently. Philautus. In this taxonomy. 2). They evaluated 34 ranids using a total of 903 homologous nucleotide sites from 16SrRNA and 12SrRNA with 281 sites being potentially phylogenetically informative. as was a clade containing representative species of Fejevarya. Support was found for a monophyletic Hoplobatrachus. Transversion weighting and the phenetic evaluation resolved paraphyly in Philautus. Asian treefrogs were monophyletic. Unfortunately. Our phylogenetic analysis of the combined data resulted in three MPTs. except those not generally supported by high BS proportions. 1993) and consensus methods themselves have long been known to be suspicious (Miyamoto. recognizing Family Rhacophoridae as a subfamily within family Ranidae. Univ. by “Brooks’ conundrum” (D. P ATTERNS OF RELATIONSHIPS Although the relationships we resolved among the putative subfamilies of ranid frogs were not entirely consistent with previous taxonomies. Decay analyses revealed that many nodes required a considerable number of additional steps to collapse. Asian Tomopterna (Sphaeroteca) and some Limnonectes. bootstrapping is problematic (Kluge & Wolf. Euphlyctis. Limnonectes. the basal relationships in the bootstrap consensus tree of Bossuyt and Milinkovich were unresolved. Representative rhacophorids. . Roelants et al. DISCUSSION Because different portions of the mtDNA genome evolve at different rates. which is exactly what maximum likelihood does?” Maximum parsimony should be used as a criterion for selecting among all possible trees. formed one monophyletic group.. M ONOPHYLY OF THE RANIDAE AND RELATIONSHIPS AMONG S UBFAMILIES Family Ranidae was resolved as a paraphyletic taxon with respect to rhacophorids. cladograms from different genes for the same set of organisms may differ. and not as a model of evolution. which occur in both Asia and Africa. We assume that this conciliation is due to their phylogenetic history.TAXONOMY OF ASIAN FROGS A SSESSING NODAL STABILITY 235 Values of nodal support are indicated on the tree (Fig. and an additional example of paraphyly with respect to Rana. and vice versa. However. Maximum likelihood analyses are philosophically problematic (Kluge. comm. and Taylorana formed a third clade and several species of Rana formed the fourth cluster. 1992). Miyamoto & Fitch. Brooks. Phrynoglossus. Hoplobatrachus. Subfamily Dicroglossinae was not resolved as a monophyletic grouping in either of the two trees presented. transversion weighting. 1990). Regardless. Hoplobatrachus. The relatively slowly evolving 12S and 16S rRNA genes seem appropriate for resolving older divergences. excluding third position codon sites for cytochrome b. The remaining taxa clustered into four groups whose relationships to each other were not resolved. Sphaeroteca. and phenetic neighbour joining. then why try to force a model of maximum parsimony on the analysis of your data. 1997). Nanophrys. Marmayou et al. (2000) evaluated a short. The taxonomic implications of their study are summarized below. the genus Rana was not resolved as a monophyletic taxon and Limnonectes limnocharis appears to be paraphyletic with respect to L. Though their focus was on the biogeographical relationships of Asian and African Hoplobatrachus. (2001) investigated the monophyly of tiger frogs. They constructed trees using maximum likelihood and BS consensus methods based on maximum parsimony. P REVIOUS STUDIES The phylogenetic relationships of ranid frogs have been investigated in three recent molecular studies. Amolops and Rana chalconota formed another group. Kosuch et al. This puzzle is exemplified. Bootstrapping (BS) trials supported 43 nodes with a consistency greater than 70%. R. pers. it is not surprising that most nodes received low levels of branch support. Their unweighted parsimony evaluation resolved Occidozyga and Phrynoglossus as sister taxa. as suggested by Dubois (1992) and BlommersSchlösser (1993). Bossuyt & Milinkovich (2000) evaluated 2692 bp of mitochondrial and nuclear homologous DNA sequence sites. (2004) evaluated DNA sequences of several groups of ranid frogs. 305 bp segment of mtDNA 12S for 28 species of ranid and rhacophorid frogs using maximum parsimony. Therefore. Polypedates and Chirixalus. Because the initial outgroup was very divergent it was dropped from the analysis and Madagascan ranids and rhacophorids were used to root the network of Asian ranids and rhacophorids combined. in part. Limnonectes. 1985. provides an acceptable solution.

236 L. 1997. and Rana. Polypedates megacephalus. The problem requires further investigation using sequences from more conserved genes and a broader array of taxa. Nidirana. 2003). chloronota and a similar species. Dubois. CLADE A1 Genus Rana (part). Our data and cladogram support this conclusion. and its sister group represented by the European R. subgenera Aquarana. As cryptic species are identified.. (Rana) temporaria. and B4))). has been particularly problematic. R. (Aquarana) catesbeiana. Kosuch et al. Hoplobatrachus. 1991). CHEN ET AL. Chaparana. separated by the ranine frogs Chaparana. a rhacophorine. This pattern of sympatry repeats in most other areas in Vietnam. chloronota and O. temporaria. subgenus Nidirana: One species. Vietnam. ricketti and A. CLADE A Clade A consisted of five potential genera of ranid frogs: Amolops. We also found a monophyletic Hoplobatrachus. Hylarana. Polypedates. especially African ranids and rhacophorids. pipiens plus R. and a larger survey of species Genera Paa. O. The large. The association of subgenera is as follows: (Sylvirana((Sylvirana. other sympatric species appear to be much more closely related. R. (B3. Pantherana. and Pseudorana: One species each was used to represent four relatively speciose subgenera of Rana. (Nidirana) chapaensis. such as the co occurrence of O. and found a monophyletic Hoplobatrachus to be the sister group to Fejervarya. is currently underway. Limnonectes (part) and Fejervarya: This subclade.. 1984. RANINAE/RHACOPHORIDAE. Rana. CLADE B2 Genera Hoplobatrachus. 2003). These taxa formed the sister group to a monophyletic Occidozyga. 1994. CLADE B1 Genera Occidozyga. such as O. CLADE B Alternatively. Pelophylax. hongkongensis. three large species of this clade occur in sympatry (Bain et al. Odorrana. A. Nghe An Province. possibly reflecting. Amolops spinapectoralis was resolved as the sister group of these species. a mantelline. was used to represent this subgenus of Rana. Genus Rana. with H. Amolops formed the sister group of the remaining subclade containing Rana maosonensis and R. R. subgenus Odorrana: The group containing Odorrana and Amolops (Huia) forms the sister group to the clade containing Rana catesbeiana and R. The frogs within clade B clustered into four serially arranged clades as follows: (B1. These genera were distributed amongst two subclades (A1 and A2). greater attention) and a greater amount of anatomical divergence. multiple families could be recognized. Bain et al. Frogs within this clade belong to several genera. RANINAE. Genus Rana. and the geographically more distant.b). loloensis. The rice frog. (2001) examined the biogeographic relationships of Hoplobatrachus. 2). The two North American species. 1998a. like the Khe Moi River. formed a terminal sister relationship. the number of species of Odorrana will likely increase significantly. and Sylvirana: this clade includes a paraphyletic assemblage of subgenera within the genus Rana. hence. CLADE B3 Genus Amolops. johnsi and R. although group membership did not mirror current taxonomy. were resolved as sister taxa. but anatomically similar A. However. CLADE A2 The second major group of ranines contains relatively stocky. is resolved as paraphyletic with respect to L. their economic significance (and. The two most anatomically similar species included in this analysis. largely edible Asian frogs. subgenus Amolops: the sampled species are monophyletic. were resolved as sister taxa. limnocharis. in part. and Paa (Fig. In some regions. morafkai. Pelophylax)(Hylarana))). and not with other Amolops with which it is usually associated (Yang. subgenera Hylarana. crassus plus H. (Pseudorana) johnsi.g. It was resolved as the sister taxon to the following two subclades of Clade A1: Genus Rana (part). cancrivorus. odoriferous ranids sometimes referred to the genus Odorrana formed a paraphyletic lineage with respect to Amolops (Huia) nasica. followed basely by A. although the species composition changes. Their sister group contained the Asian species. rugulosus being the sister group to the remainder of the clade. bacboensis. Amolops (Huia) differs from Odorrana by its non-glandular skin and the absence of enlarged toe discs. sometimes considered to be three genera. and Laliostoma: The two representative rhacophorids. Nanorana. (B2. Some sympatric species are derived from distant lineages.. A considerable amount of allozyme work in other parts of its extensive range suggests that it is a composite of many cryptic species (e. torrentis. The sister group to this clade contains the dicroglossine frogs of the genera Fejervarya. Toda et al. erythraea. (Pantherana) pipiens and R. Paa spinosa is resolved as the sister group of a clade containing two other . and Nanorana: This clade is a paraphyletic assemblage of genera. and Limnonectes. Amolops (Huia) was resolved within a group of Odorrana. Our data also support the finding that Odorrana chloronota is a species complex (Murphy et al.. in order to avoid having an extremely speciose Ranidae. and Laliostoma labrosum. L.

(1990). Taxonomically. On the basis of priority. Occidozyga laevis and O. fansipani. and O. R. TAXONOMIC IMPLICATIONS Type species of Rana Linnaeus 1758: Before undertaking revisions. blythii from the Malay Peninsula and southern Vietnam. Wiley. then to genus Hoplobatrachus. Genus Nidirana Dubois 1992: In order to maintain recognition of genus Odorrana and not render genus Rana paraphyletic. caldwelli. Table 3 briefly summarizes some of the changes for Asian groups from 1985 onward for many of the species included in this study. the species was placed in Genus Fejervarya (Fei. we recognize genus . This clade. placement in one group or another has remained relatively stable. Subfamily Raninae: The subgenus Nidirana Dubois 1992 contains seven species: R. 1993) have left the species in the genus Rana. and L. subgenus Euphlyctis Fitzinger 1843 by Frost (1985). Genus Hylarana Tschudi 1838: The genus Rana is paraphyletic with respect to Amolops Cope 1865. martensii have been placed in the genus Phrynoglossus Peters 1867 by many authorities (e. 1996.g. is resolved as the sister group to the remaining ranine clade. 2002). R. It has been resolved as the sister taxon to the clade containing Rana temporaria plus Odorrana Fei Ye et Huang 1991.TAXONOMY OF ASIAN FROGS species of Paa plus Chaparana fansipani. but the taxonomic rank accorded to the groups has been quite unstable. another ranine genus must be recognized. A phylogenetically based taxonomy reflects the greatest amount of information within a hierarchical system (Farris. N. N. they are not large frogs like Paa. and R. Pelophylax Fitzinger 1843. pleskei. 1996. Within the genus Rana. (N. given that. However. 1986 [1987]). laevis and O. johnsi forms the sister group of the type species. Peters. 1980. 1962. both studies found weak support at the conflicting nodes. This species is the name-bearer of the genus. Our data do not refute this placement but recognition of Phrynoglossus could result in a paraphyletic Occidozyga. Dubois. chapaensis.) lini. lima. tribe. the genus Paa is paraphyletic with respect to Nanorana and C. N. paraphyly is the rule rather than exception. temporaria and the two North American representatives of the subgenera Pantherana Dubois 1992 and Aquarana Dubois 1992. The association of these species is particularly interesting. (Nidirana) adenopleura. The clades have a greater correspondence to geographic location than taxonomy. 1758 as the type species of Rana. as with L. In order to maintain the genus Amolops. 1999). Taxonomic chaos: At virtually every hierarchical level. subfamily. Brooks & McLennan. 1998). For most species. Populations of L. Much of this taxonomic instability is due to the absence of a reasonable phylogeny upon which to identify membership within particular clades. Below. Zhao. N. Given the lack of additional specimens from this group and arguments for its rejection (Tanaka-Ueno et al. subgenus Fejervarya Bolkay 1915 by Dubois (1992). (1999) noted several anatomical differences between L. R. the taxonomy of this group needs to be revised as it undoubtedly represents far more species than previously thought. (N. in turn. (N. 1867. The group of ranids that form the sister group of Amolops contains the subgenera Hylarana Tschudi 1838. Thus. Roelants et al.) chapaensis. Inger et al. tribe Ranini is a paraphyletic assemblage of genera with respect to the genus Rana and at the subfamilial level with the genus Nanorana Günther 1869. subgenus Nidirana must be elevated to generic status for N. Taylor. R. L. subgenus. 1931. Thus. Within this clade. Limnonectes cancrivorus. (N. 1967. we believe it preferable not to recognize Pseudorana until sufficient evidence exists. was placed in Genus Rana. R. 1991. (2004) who resolved this group as the sister of clade B2+B3. ingeri.) psaltes. (N. tribe Dicroglossini: This group was represented by three of 12 species from the genus Occidozyga Kuhl et Hasselt 1882: O. It is one of the most speciose groups of vertebrates and contains many independent lineages.) caldwelli. psaltes. Sister taxa co-occur on a single island. Whereas we included 19 specimens. This association does not appear to be spurious since all nodes within this clade received substantial support. recognition of these major lineages as genera would better summarize their phylogenetic history. adenopleura. lini. albeit conservatively. Nanorana parkeri and N... Not exhaustive. The taxonomy of these frogs has been unstable. Yet others (e. (N. CLADE B4 237 Genus Limnonectes (part): The third subclade of Asian edible frogs includes species placed in this genus. Our data neither refute recognition of Fei's genus Pseudorana Fei Ye et Huang 1991 nor support it. and N. Our arrangement differs from that of Roelants et al. Nguyên & Ho. the crabeating frog. Zhao & Adler. paramacrodon. (2004) sequenced two representatives. For example. and family. blythii are variously associated with L. pleuraden. though Chaparana and Nanorana are heavy-set. Sylvirana Dubois 1992. 1994. Smith & Chasen. For example. then into genus Limnonectes Fitzinger 1843. taxonomic problems exist. Subsequently. Inger. Fleming (1822) designated Rana temporaria Linnaeus. R.g. and Tenuirana Fei Ye et Huang 1991. it is first necessary to establish the relationships of the type species of the genus Rana. daunchina. For example. subgenus Hoplobatrachus Peters 1863 by Dubois (1986 [1987]). Most recently. Subfamily Dicroglossinae.) daunchina.) pleuraden. N. macrodon. R. it was assigned to genus Euphlyctis by Fei et al. martensii. limnocharis. Genus Rana sensu Frost (2004) has more than 240 species divided into 22 subgenera. Some species appear to be large complexes of morphologically similar species. we review the taxonomy of these frogs and make taxonomic changes that directly reflect phylogenetic history.

(Paa) Occidozyga Occidozyga Amolops Amolops Hylarana Amolops Pseudorana Odorrana H. (Tenuirana) R. (Pantherana) R. (Aquarana) Limnonectes Hoplobatrachus Fejervarya Fejervarya Paa (Paa) Nanorana Nanorana Paa (Paa) . (Hylarana) R. (Sylvirana) R. hongkongensis loloensis ricketti torrentis erythraea guentheri nasica johnsi (as sauteri) livida macrodactyla maosonensis milleti taipehensis lateralis pipiens catesbeiana fansipani kuhlii toumanoffi blythii rugulosus cancrivorus limnocharis labrosa yunnanensis parkeri pleskei chapaensis spinosa laevis lima Rana (Rana) R. (Sphaeroteca) Paa (Gyandropaa) N. (Euphlyctis) Tomopterna R. (Bourretia) L. (Hylarana) Rana R. (Pseudorana) R. (Limnonectes) Hoplobatrachus L. (Hylarana) R. (Paa) Occidozyga Phrynoglossus Amolops Amolops H. (Sylvirana) R. (Rana) R. (Hylarana) Amolops Pseudorana Odorrana Hylarana (Tenuirana) Hylarana (Tenuirana) Limnonectes Tigrina Euphlyctis Euphlyctis Paa (Paa) phrynoides Altirana Nanorana Paa Pseudorana Odorrana H. (Hylarana) R. (Chaparana) L. (Limnonectes) L. (Hoplobatrachus) L. (Amolops) A. (Paa) phrynoides Altirana Nanorana Rana (Hylarana) R. 238 Specific epithet Dubois 1987 “1986” Fei et al. (Fejervarya) T. A representative summary of the history of names applied to some of the Asian species of ranid frogs investigated in this study. (Amolops) A. (Tenuirana) H. (Altirana) N. (Fejervarya) L. (Tenuirana) H. (Rana) L. (Nanorana) R. (Fejervarya) T. (Limnonectes) L. (Tenuirana) R. (Aquarana) Limnonectes Hoplobatrachus Euphlyctis Euphlyctis Paa (Paa) Altirana Nanorana R. (Amolops) A. (Hylarana) R. (Euphlyctis) R. (Amolops) R. (Hylarana) R. 1991 “1990” Dubois 1992 Ye et al. (Huia) R.TABLE 3. (Aquarana) C. (Limnonectes) R. (Sphaeroteca) R. 1993 Amolops Amolops Amolops H. (Euphlyctis) R. (Hylarana) R. (Limnonectes) L. (Hylarana) Amolops R. (Euphlyctis) R. (Hylarana) R. (Pelophylax) R. (Rana) R. (Eburana) R. (Rana) Rana (Paa?) R. (Hylarana) Amolops - Frost 1985 Fei 1999 Amolops L. (Paa) A. (Hylarana) R. (Hoplobatrachus) L. (Hylarana) R. (Bourretia) L. CHEN ET AL. (Nidirana) Paa (Quasipaa) Amolops Amolops Amolops Amolops R. (Euphlyctis) R. (Sylvirana) A. (Paa) R.

G ENUS RANA LINNAEUS 1758 239 Rana temporaria is a member of the clade consisting of R. R. H. milleti is the sister group of the clade containing R. hainanensis. rugulosus. parkeri by original designation). nasica. Tenuirana contains only R. O. 1927 (type species N. 3). Genus Hoplobatrachus Peters 1863: This genus was represented by the species H. Nanorana aenea. Chaparana (type species Rana (Chaparana) fansipani by original designation). and R. O. guentheri. doing so still leaves subfamily Dicroglossinae a paraphyletic group with respect to the Rhacophorinae and Mantellinae. tribe Limnonectini must be elevated to subfamily Limnonectinae. though our data reveal that Amolops (Huia) nasica occurs within the clade containing Odorrana chloronota. pleskei by original designation) is the oldest available name having priority over Altirana Stejneger. O. margaretae. Genera Chaparana Bourret 1939. pipiens. guentheri (subgenus Sylvirana in part). Genus Amolops Cope 1865: Few have questioned the validity or membership of genus Amolops. recognition of these or any other subgenera or genera is premature in the absence of a more complete phylogeny. johnsi and the American frogs. the apparent polyphyly within the subgenus Sylvirana. nasuta. and Paa Dubois 1975: The subclade containing Paa also contains members of the genera Chaparana and Nanorana. O. hmongorum. catesbeiana and R. and subgenus Pelophylax. O. limnocharis is paraphyletic with respect to F. N. However. these species have been closely associated with one another. Con- sequently. F. Finally. and R. . Recognition of the subgenera within Hylarana requires a phylogeny and the current taxonomy results in paraphyletic groupings (Fig. However. erythraea. One lineage contains genus Hoplobatrachus and some species of genus Limnonectes referred to genus Fejervarya by Fei (1999). including: O. huangwuensis. O. O. Thus. exiliversabilis. Nanorana Günther 1896. It contains those species associated with the subgenera Hylarana. crassus and H. Although these two species are sister taxa. 2). to avoid paraphyly. Dubois (1992) included H. and Pelophylax. we did not have tissue samples from this species and no sequences exist in GenBank. Tenuirana. Nanorana and Paa (but see below). Paraphyletic relationships preclude retention of the subgenera within Nanorana. swinhoana. lungshengensis. maosonensis and H. tribe Paini must be moved from subfamily Raninae and placed in subfamily Dicroglossinae. macrodactyla. Taxonomically. temporaria in subgenus Rana. Sylvirana. whereas H. O. anlungensis. contains the genera Chaparana Bourret 1939. we recognize genus Odorrana and include within it O. Genus Fejervarya Bolkay 1915: Fejervarya is represented. Unfortunately. O. O. Subfamily Limnonectinae (new content/combination): Dubois placed genus Paa Dubois 1975 in subfamily Raninae. morafkai. The genera Nanorana and Chaparana fall out as sister taxa within the genus Paa. Another lineage. However. Thus. by the two species F. [named originally as a subgenus of Rana] by original designation). jingdongensis. guentheri is the sister group of subgenus Pelophylax. O. Fei (1999) included both species in the genus Fejervarya. O. Genera Odorrana Fei Ye et Huang 1991 and Huia Yang 1991: The usually large. 1950 by original designation. This subgeneric arrangement is phylogenetically acceptable from the perspective of our data. 2004) of which two were included in our study plus one undescribed species. Tenuirana should not be elevated to generic status as it leaves Hylarana a paraphyletic taxon. Nevertheless. cancrivora. For example. subfamily Raninae is a paraphyletic group. schmackeri. Recognition of the families Rhacophoridae and Mantellidae will necessitate recognition of the family Limnonectidae. tribe Paini. quadranus. The genus is paraphyletic. livida. limnocharis and F. O. Given the large number of species in Hylarana. O. subgenus Hylarana. Though both species are generally assigned to genus Limnonectes. Dubois (1992) included R. and Paa (type species Rana liebigii Günther. daorum. and O. tribe Limnonectini along with the genera Hoplobatrachus and Limnonectes. in this clade. Limnonectinae has three distinctive lineages (Fig. catesbeiana in subgenus Aquarana.TAXONOMY OF ASIAN FROGS Hylarana. O. The genus Paa contains more than 29 species (Frost. chloronota. megatympanum. Consequently. we add those species previously recognized as Paa. pipiens in subgenus Pantherana. The type species of Hylarana. subgenus Sylvirana. delacouri. However. Our data support their conclusion. N. 1860. O. taipehensis and R. as well as Nanorana fansipani. odoriferous frogs referred to the genus Odorrana are the sister group to Rana. The subgenus Tenuirana is also a puzzle. N. sauteri) in the subgenus Pseudorana. membership in one genus or another may be uncertain for many of the larger species referred to as either Amolops (Huia) or Odorrana (see above). andersonii. In addition to species already included in the genus Nanorana. The type species for the genus Odorrana is Rana margaretae Liu. and the problems surrounding the recognition of Tenuirana. johnsi (as R. O. was included in our evaluation. cancrivora. recognition of this subgenus results in the paraphyly of other subgenera. tribe Paini. for the moment. bacboensis. These frogs are placed in the tribe Hoplobatrachini (new combination). H. Nanorana (type species N. Kosuch et al. Among the available generic names. (2001) found this genus to be monophyletic. maosonensis plus R. R. grahami. Our data and cladogram support this conclusion. and O. This list of species is not exclusive and at least 13 additional species could belong to the genus. banaorum. tribe Limnonectini contains genus Limnonectes excluding those species previously referred to Fejervarya. He placed R. milleti in genus Rana.

Import permits for frozen tissues and preserved specimens were issued by Agriculture Canada. toumanoffi. Equipment and supplies were donated by Maglite. London: British Museum. cancrivora. major Asian groups are represented herein.. Bain. Zug. paramacrodon. C. and Benjamin Film Laboratories. Second Edition. Fu. and exclusive of Fejervarya limnocharis and F. D. G. Our evaluation revealed that most assemblages of species contained paraphyletic grades of species. A. Lowcock. grunniens. Future investigations using gene sequences from 12S and 16S rRNA of smaller subsets of species should . Johnson Wax. Genus Limnonectes Fitzinger 1843: The type species of Limnonectes is L. Consequently. (“duboisi”). Ethology. Taxonomy reflects the recommendations of this manuscript. Tilley Endurables. N. in the interest of nomenclatorial stability we believe that further divisions of ranid frogs in the absence of a phylogenetic hypothesis will only result in additional confusion in an already incredibly complex history of names and species. V. (2003). Ecology. No doubt the genus Rana remains a “megataxon” in that it is a paraphyletic assemblage of species. and Evolution 5. China supported the sabbatical leave of LC to Toronto (1998-1999). Tissue samples from Vietnam were exported with permits issued by the Institute of Ecology and Biological Resources. Odorrana and Paa. N. Vietnam CITES authority. ventripunctata. kuhlii. G. Richardson. Murphy. China. Tien.. acanthi.. Beckley and C. and private donations from M. 172183. S. (1915). (1882). and North Australian species of the genus Rana. D. H. K. T. J. R. L. 236-242. L.. Bolkay. L. 1-60. J. R. C. USA 97. L. Fieldwork in Vietnam and laboratory work was financially supported by the generous assistance of the Members Volunteer Committee of the Royal Ontario Museum (ROM). Fu. prove equally fruitful for resolving relationships among the genera of ranid frogs. 1. and D. Fu provided valuable laboratory advice. Limnonectes sp. and D. macrocephala. and the Forest Protection Department. Blommers-Schlösser. Cathay Pacific Airlines kindly donated free excess baggage. N. A. L. J. P. To the right of the tree are the subfamilial taxonomic groupings supported by this study. (2000). N. Vaughn Fund. macrodon. (1993). L. (1918). Ohler provided valuable comments on the manuscript. R. Currie. On the Papuan.240 L. & Milinkovitch. R. Although our analysis contains a small number of ranid frogs. M. T. F. Nora E. Swan. A. V. Mason to RWM. Shanghai. kuhlii by original designation. W. CHEN ET AL. Cryptic species of a cascade frog from Southeast Asia: Taxonomic revisions and description of six new species from Vietnam. one anonymous reviewer and especially A. Convergent adaptive radiations in Madagascan and Asian ranid frogs reveal covariation between larval and adult traits. We recognize Limnonectes for the following species included in our study. and not monophyletic assemblages. (2004) does not conflict with this new taxonomy. L. Lathrop. M. 6585-6590. 199-218. Annals and Magazine of Natural History series 9. magna. Proceedings of the National Academy of Sciences. Bogart. S.. Ecaudata in the Collection of the British Museum. ibanorum. particularly Amolops. ROM Foundation. L. Mason. Anatomischer Anzeiger 48. sikimensis. Orlov. Bossuyt. unculuanus. Catalogue of the Batrachia Salientia s. Systematic relationships of the Mantellinae Laurent 1946 (AnuraRanoidea). R. J. REFERENCES Bain. but also including Vietnamese species in the genus Hylarana. & Ho. All fieldwork was conducted using approved Animal Use Protocols. N. Boulenger. For assistance in fieldwork. ACKNOWLEDGEMENTS The Bai Yulan Foundation for Qualified Scientists and Technicians. L. Frost donated tissue samples. FIG 3. blythii. Coleman. ingeri. We have initiated further biochemical studies on some genera. Melanesian. de Sá. A. J. National Sciences and Engineering Research Council (Canada). Beiträge zur Osteologie einiger exotischer Raniden.P. MacCulloch. American Museum Novitates 3417. The tree of Roelants et al. Nguyên S. we thank R. and L. Boulenger. Ananjeva. University of Toronto. G. Cao. O. The National Geographic Society supported fieldwork in China by J. pleskei and N. L. A. the Department of Zoology. parkeri. L. A reduced cladogram with genera as terminal taxa depicting nomenclatorial adjustments.

A. L.. Stockholm. A. J. Chicago: University of Chicago Press. Commentary on a proposed classification of the family Ranidae. 2. G. Ecology. Molecular Phylogenetics and Evolution 9. Cladistics 13. Felsenstein.. London. (1920). Brooks. Fei. Ver 2. 81-100. S. BioEdit Sequence Alignment Editor. Fu. (1843). 143-159. A. Miscellanea nomenclatorica batrachologica. Meyer. (1986 [1987]). Sketch of the primary groups of Batrachia Salientia. Emerson.. Thomas. Proceedings of the Zoological Society of London 1860. The meaning of relationship and taxonomic procedure. Pääbo. F. Records of the Indian Museum 20. (1988). http:// research. 231.. J. A. Fleming. Atlas of Amphibians of China. Inger. (1860). X. E. D.. Anoures). (1975). Chicago: University of Chicago Press. Toward the phylogeny of the family Lacertidae . A. L. Systema Reptilium. (2000). J. T. Notes Herpétologiques sur l'Indochine Française. Annuaire du Musée Zoologique de l'Academie Impériale des Sciences de St. L. Zoological Journal of the Linnean Society 122. 1093-1115. or a general view of the structure. 241-246. (2002). 5-39. 1-46. 537553. ver. Reptiles et Batraciens reçus au Laboratoire des Sciences Naturelles de l'Université au cours de l'année 1938. Dubois. 1-226.TAXONOMY OF ASIAN FROGS Boulenger. Raleigh.. (1967). A.118-130. (1998). (1999). (1985). Biological Journal of the Linnean Society 71. Papuan. L. Cladistics: What's in a word? Cladistics 9. Amphibian Species of the World. S. (1999). A monograph of the South Asian. 203-217. C. batrachians and fishes made by Messrs. The phylogenetic position of the dartpoison frogs (Dendrobatidae) among anurans: an examination of the competing hypotheses and their characters. Bulletin Mensuel de la Société Linnéenne de Lyon 61. Toward the phylogeny of the family Lacertidae: implications from mitochondrial DNA 12S and 16S gene sequences (Reptilia: Squamata). The limits of amino acid sequence data in angiosperm phylogenetic reconstruction. Alytes 17. R. A Taxonomic and Geographical Reference. Amblyglossae.) (2004). & McLennan. Testability and the refutation and corroboration of cladistic hypotheses. (1822). B. V. D. Frogs of Vietnam: A report on new collections. Y. A.amnh. Male secondary sexual characteristics. Dubois. Günther. Ye. W. Royal Swedish Academy of Sciences. S. Herpetologica 52.Why 4708 base pairs of mtDNA sequences cannot draw the picture. G. Lawrence: Allen Press and Assoc. Coll. G.0. (1993). Farris. AutoDecay ver. & McLennan. and classification of Animals. R. Report on the collections of reptiles. Notes on the nomenclature of Ranidae and related groups.) (1999). Contribution to a knowledge of the reptiles of the Himalaya Mountains. A. Edwards. R. Evolution 39. T. R. 219231. Dubois. (ed. Fasciculus Primus. Keys to Chinese Amphibians. Orlov. A. (1989). 199-219 Hall. & Ward. Annexe au Bulletin Général de l'Instruction Publique. Note preliminaire sur le groupe de Rana limnocharis Gravenhorst. Miscellanea Taxinomica Batrachologica (I). A. 5. University of Toronto. D. T. Anoures). Frost. Kocher. 241 Fitzinger. R. C.R. 7-95.html Fu. A. Cope. A. Descriptions de trois espèces nouvelles. (1984). C. Alytes 5. & Wolf. K. Dubois. Dubois. I. Petersbourg 1896.21. F. (1990 [1991]). Sketch of the primary groups of Batrachia Salientia. Brooks. Syst. Inger. R. A.9. Bergius Foundation. M. Edinburgh & London Ford. F. J. Quarterly Review of Biology 66.0. Toronto. (ed. Bourret. (ed. H. 97-120. Frost. sexual selection. Evolution 42. (1996). Kluge. 44-51 Fei. (1939). Zhengzhou: Henan Publishing House of Science and Technology. and molecular divergence in fanged ranid frogs of Southeast Asia. J. Bulletin du Museum National d'Histoire Naturelle. Kluge. G. Ribosomal DNA: molecular evolution and phylogenetic inference. M. Hanoi 1939. C. 19.org/herpetology/amphibia/index. The Philosophy of Zoology. Chongqing: Chongqing Branch. Publishing House of Science and Technology Materials. Ethology Ecology and Evolution 5. (1991). L. D. D. Günther. R. (1997). 411-453. T. D. Vindobonae (=Vienna): Braumüller and Seidel. N. Alytes 3. Hillis. 183-199. D. K. Dynamics of mitochondrial DNA evolution in animals: . J. (1999). 81-96. Fieldiana: Zoology New series 92. pp. (1896). 1829 (Amphibiens. PhD thesis. D. D. V. (1998). S.) (1985). L. 795-803. 4. The Nature of Diversity: An Evolutionary Voyage of Discovery. Department of Microbiology North Carolina State University. Phylogeny. Eriksson. & Dixon. 304-350. 148-175. (1865). and Behavior: A Research Program in Comparative Biology. functions. 783791. (1992). Amphibian Species of the World: An online reference. Systematic Zoology 16. G. Confidence limits on phylogenies: an approach using the bootstrap. Fu.2 (program distributed by the author). A. & Wilson. & Darevsky. (1993)... XVII. J. Bremer. Phylogeny of lacertid lizards (Squamata: Lacertidae) and the evolution of unisexuality. (1991). Potanin and Berezowski in the Chinese provinces Kansu and Sze-chuen. Melanesian and Australian frogs of the genus Rana. & Huang. J. Villablanca. S. Notes sur la classification des Ranidae (Amphibiens Anoures). 3e ser. A. (2001). Remarques sur la phylogénie des Ranidés (Amphibiens. Un nouveau sous-genre (Paa) et trois nouvelles espèces du genre Rana. (1999)...

M. Smith. P. Paris 104. A. Laurent. Revue de Zoologie et Botanique Africaine.. & Tillier. Paris. L. A. 313-336. G. Sunderland. (1985). Genetic vartiation in the Indian rice frog. utility. 265-599. C.455 ft. Lue. H. 397-422. Moritz & Mable. W. S. King. Species. M. V. The amphibian fauna of Thailand. S.. 6196-6200. Liu. G. Nguyên. (1867). M. mit Berucksichtigung der Fossilen Thiere dieser Abtheilung der Reptilien. Nishida. M. & Gibson. L. . Vences. Matsui.. R. Hillis. PAUP*: Phylogenetic Analysis Using Parsimony (*and Other Methods). Molecular Phylogenetics and Evolution 31. 1-13. (1998a). (2004). H. B. H. Bulletin of the Raffles Museum. A. C. Fernere Mittheilungen über neue Batrachier. C. E. MacCulloch. L. USA 86.. T. Takenaka. Bulletin de la Société Zoologique de France. Orlov. Ota.. (1950). Nishida. Dubois. F. M. C. Classification der Batrachier. M. C.. in Taiwan. ver. K. Rana amurensis inferred by mitochondrial cytochrome b gene sequences (Amphibia.. Stejneger. R. & Upton. 6pls. Ohler. É. Japanese Journal of Herpetology 17. 110-138.. Darevsky. 4. R.. Linnaeus. Monatsberichte der königlichen Akademie der Wissenschaften zu Berlin 1867. (1979). M. Ranidae).). Clustal W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting. W. ver. as revealed by allozyme data. D. Jiang. In Molecular Systematics. Ha Noi: Nha Xuat Ban Khoa Hoc Va Ky Thu At. Rana limnocharis (Amphibia: Anura). M. -Y. T.. (1927).0. Siddall. A. with special reference to sympatric cryptic species in Java. 445-470. 407-514. S. B. Moritz & Mable.. G. C. Molecular Phylogenetics and Evolution 21. J. Hillis. Massachusetts: Sinauer Associates. Monatsberichte der königlichen Akademie der Wissenschaften zu Berlin 1863. Locis. F. 317-319 Swofford. Sato. & Maddison. & Ota. Danh Luc Bo Sat Va Ech Nhai Viet Nam. Peters. University of Kansas Science Bulletin 43. R. M. -C. 541-566. & Ota. Mindell. (1996). Phylogenetic inference. Peters. Wallace. R. Sunderland. Fieldiana: Zoology Memoirs 2. M. & Honeycutt. (1997). A. In Molecular Systematics. M. A. N. Marmayou. N. (1863). M. Murphy. Tschudi. M. M. 99-104. Lowcock.. & van Hasselt. Life Sciences 323.. M. Temminck.. Amphibians of western China. Tanaka-Ueno. Pp.. Herpetologische Notizen. Genera.. & Fitch. & Hillis. P.. 205-248. Esquisse d'une phylogenèse des anoures. Takenaka. Higgins. A. 4. & Chasen. (Eds). 287-297. Nucleic Acid Research 22. Olsen.. Toda. (2000). J. -c. Petitpierre. Cladistics 1. W. K. & Böhme. I. M. Ohler. Genetic divergence among Southeast and East Asian populations of Rana limnocharis (Amphibia: Anura). & Kluge.. R. Amphibia-Reptilia 18. Algemeene Konst. (2001). (1990). C. genus Hoplobatrachus. 607-613. Zoological Science 15. & O. L. W. F. 13-37. R. J. Genetic divergence among East and South-east Asian populations of the Indian rice frog Rana limnocharis. O. Flow cytometry in biodiversity surveys: methods. and constraints. Waddell. Nishida. De Haan. cum Characteribus.. J. J. 73-82. Massachusetts: Sinauer Associates. F. position-specific gap penalties and weight matrix choice. v.. (1995). D. J. Kinabalu. Van Swinderen en W. Albumin differences among ranid frogs: taxonomic amplification and sequencing with conserved primers. T. H. 1-102. (1951). 91-97. 4673-4680. 1-400. The herpetology of Mt. Massachusetts: Sinauer Assoc. A new genus and species of frog from Tibet. Comptes Rendus de l'Académie des Sciences. Maddison.242 L. Testing species phylogenies and phylogenetic methods with congruence. (1994). Holmiæ (=Stockholm). 13. Sur la Nécessité de supprimer la famille des Rhacophoridae mais de Créer celle des Hyperoliidae. (1931). D. M.. D. (1998). 152 (abstract).. 730-740. (Eds. D. Journal of the Washington Acadademy of Sciences 17. Systematic Biology 44. Synonymis. K. Phylogenetic relationships in the Ranidae.. Probabilism and phylogenetic inference. M. Ribosomal RNA in vertebrates: evolution and phylogenetic applications. & Wilson.0b8a. Dubois. Herpetologica 54. Taylor. D. Sunderland. P. Neuchâtel. M. Smith. Editio Decima. Annual Review of Ecology and Systematics 21. H. (1822) Uittreksels uit brieven van de Heeren Kuhl en Van Hasselt. (2001). 3-32. 186-189 Miyamoto. MacClade. Out of Asia: mitochondrial DNA Evidence for an Oriental origin of tiger frogs. (2002). T. Nucleic acids II: The polymerase chain reaction. J. A.En Letter-Bode 7. (1996). (1994). J. J.) (1996). Kuhl. M. Independent origin of direct development in the genera Philautus and Taylorana. A. C. Toda. Differentiis. Proceedings of the National Academy of Science. Miyamoto. W. Pp. 64-76. D. H.. aan de Heeren C. K. D. Swofford. & Matsui. D. Matsui. Cladistics 13. (1758). D. C. 398-407. Matsui. Th. (ed. (1973). Massachusetts: Sinauer Associates. & Ho. Japanese Journal of Herpetology 15. Thompson.. Kosuch. Consensus cladograms and general classifications.. Roelants. Pp.. Palumbi. Local population differentiation and phylogenetic relationships of Russian brown frog. CHEN ET AL. Secundum Classes. S. E. E. (1838). Laurent. (1962).. (1997). errata. North Borneo. Singapore 5. (1998b). D. Ordines. J. Pasquet. L. Endemic ranid (Amphibia: Anura) genera in southern mountain ranges of the Indian subcontinent represent ancient frog lineages: evidence from molecular data. Laurenti Salvi. G. Systema Naturæ per Regna Tria Naturæ. J.5. & Bossuyt. M. W. H. C. M. Toda. D. Tervuren 38. Sunderland.

Oxford. Herpetology of China.-m. 1-13. & Hu. E. D. Ye. Rare and Economic Amphibians of China. USA. L. (1994). Zhao. 76-80.10. (1991). 1-42. Phylogenetic systematics of the Amolops group of ranid frogs of southeastern Asia and the Greater Sunda Islands. (1993). 243 Zhao. Sichuan Journal of Zoology 13.-m. Society for the Study of Amphibians and Reptiles. Ohio. Wiley. Systematic Zoology 22. Yang. individuals and historical entities. (1993). O. Fieldiana 63. (1980). C. E. Sichuan Science and Technology Publishing House..04 . S. Systematic Zoology 29. Fei. Comments on some current herpetological books. & Adler. E. 72-76. Accepted: 12.TAXONOMY OF ASIAN FROGS and phylogenetic implications. Chengdu. Is the evolutionary species fiction? A consideration of classes. K.

244 .