You are on page 1of 263

Sub red

Dr. M
Şef de l
• Departa
Univers
• Laborat
Publică
Univers
“Ion Ion
Editura
Iaşi, Ro




Teh
în m
dacţia:
Mihai Mare
lucrări
amentul de M
sitatea “Petre
torul de Mico
ă, Facultatea d
sitatea de Ştiin
nescu de la Br

a PIM
omânia





hnici de
icologia

icrobiologie,
Andrei”, Iaşi
logie – Micot
de Medicină V
nţe Agricole ş
rad”, Iaşi
200
laborat
a medic
Facultatea de
toxicologie, D
Veterinară,
şi Medicină V
7
tor
cală
Medicină De
Departamentul
Veterinară
entară,
l de Sănătate

C
S
sa
S
ad

E
Şo
w
Ia
Copyright © 20
ocietatea Rom


Nici o p
au difuzată în
.R.M.M.M. T
dresate în scri
Societa
OP 6, C
Iaşi – R

Editor v
ing. Ion

Comenz
Societa
OP 6, C
Iaşi – R
e-mail:
www.fu


ditura PIM
os. Ştefan cel
www.pimcopy
aşi România

Descr
Tehni





I. Mar

543.0
582.2
007
mână de Mic
parte a acestei
orice formă s
Toate cererile d
is pe adresa:
atea Română d
CP 1356
România
volum şi desig
nuţ Ailincăi
zi la:
atea Română d
CP 1356
România
comenzi@fu
ungi.ro
Mare nr. 11
.ro
rierea CIP a B
ici de laborat
Mihai Mare
Bibliogr.
Index.
ISBN 978-9
reş, Mihai (ed
6
8

II
cologie Medic
i publicaţii nu
sau prin orice
de reproducer
de Micologie M
gn copertă:
de Micologie M
ngi.ro

Bibliotecii Na
tor în micolo
eş. – Iaşi : PIM
973-716-677-
d.)
cală şi Micoto
u poate fi repro
mijloace, fără
re a materialel
Medicală şi M
Medicală şi M
aţionale a Ro
ogia medicală
M, 2007
7
oxicologie
odusă, transm
ă acordul scris
lor publicate v
Micotoxicolog
Micotoxicolog
omâniei
ă / sub red.:
misă, stocată
s al
vor fi
gie
gie


III
Autori

• Ingrid Cezara Apetrei
Doctor medic veterinar, doctorand
Laboratorul de Microbiologie – Imunologie
Departamentul de Sănătate Publică
Facultatea de Medicină Veterinară
Universitatea de Ştiinţe Agricole şi Medicină Veterinară
“Ion Ionescu de la Brad”, Iaşi

• Olimpia Bazgan
Doctor medic veterinar, doctor în Medicină Veterinară
Profesor universitar
Laboratorul de Micologie - Micotoxicologie
Departamentul de Sănătate Publică
Facultatea de Medicină Veterinară
Universitatea de Ştiinţe Agricole şi Medicină Veterinară
“Ion Ionescu de la Brad”, Iaşi

• Petru Cazacu
Doctor medic veterinar, doctorand
Laboratorul de Histologie
Departamentul de Ştiinţe Fundamentale
Facultatea de Medicină Veterinară
Universitatea de Ştiinţe Agricole şi Medicină Veterinară
“Ion Ionescu de la Brad”, Iaşi

• Maria Dan
Doctor medic, doctor în Medicină
Laboratorul de Microbiologie
Institutul de Boli Cardiovasculare “G. Georgescu” Iaşi

• Bogdan Doroftei
Doctor medic, doctor în Medicină
Preparator universitar
Clinica II Obstetrică - Ginecologie
Facultatea de Medicină
Universitatea de Medicină şi Farmacie “Gr. T. Popa” Iaşi




IV



• Luminiţa - Iuliana Malic
Doctor medic veterinar, doctorand
Laboratorul de Micologie - Micotoxicologie
Departamentul de Sănătate Publică
Facultatea de Medicină Veterinară
Universitatea de Ştiinţe Agricole şi Medicină Veterinară
“Ion Ionescu de la Brad”, Iaşi

• Magdalena Mareş
Medic dentist, doctorand
Preparator universitar
Departamentul de Protetică
Facultatea de Medicină Dentară
Universitatea “Petre Andrei”, Iaşi
SC Dentomedica SRL

• Mihai Mareş
Medic dentist, doctor medic veterinar, doctor în Medicină
Şef de lucrări
Departamentul de Microbiologie
Facultatea de Medicină Dentară
Universitatea “Petre Andrei”, Iaşi
Laboratorul de Micologie – Micotoxicologie
Departamentul de Sănătate Publică
Facultatea de Medicină Veterinară
Universitatea de Ştiinţe Agricole şi Medicină Veterinară
“Ion Ionescu de la Brad”, Iaşi













V









































Volum editat cu sprijinul BRD-GSG


VI
Cuprins

Cap. 1 Tehnici de recoltare, transport şi procesare primară
a prelevatelor clinice ............................................................................................... 1
1.1. Sângele ..................................................................................................... 2
1.1.1. Recoltarea sângelui pentru hemocultură ................................... 3
1.1.2. Numărul de hemoculturi şi momentul prelevării ...................... 4
1.1.3. Volumul de sânge ce urmează a fi însămânţat .......................... 4
1.1.4. Medii de cultură ........................................................................ 4
1.1.5. Durata incubării şi prelucrarea hemoculturilor ......................... 7
1.1.6. Semnificaţia hemoculturilor pozitive cu fungi saprobioţi ........ 8
1.2. Măduva osoasă hematogenă ..................................................................... 8
1.3. Lichidul cefalo-rahidian ........................................................................... 8
1.4. Raclatul cornean ....................................................................................... 9
1.5. Prelevatul otic .......................................................................................... 9
1.6. Fluidele intraoculare ................................................................................ 9
1.7. Firele de păr ............................................................................................. 9
1.8. Fragmentele unghiale şi scuamele cutanate ............................................. 9
1.9. Secreţiile respiratorii joase ..................................................................... 10
1.10. Aspiratul pulmonar ................................................................................ 11
1.11. Biopsia pulmonară ................................................................................. 11
1.12. Alte fluide organice normal sterile ......................................................... 11
1.13. Secreţiile purulente din abcese subcutanate sau din plăgi deschise ....... 12
1.14. Produsele patologice de la nivelul mucoasei orale................................. 12
1.15. Urina ...................................................................................................... 12
1.16. Secreţiile vaginale .................................................................................. 14
1.17. Produse patologice de la nivelul tractului genital masculin ................... 15
1.18. Fragmentele tisulare biopsice ................................................................. 15
1.19. Tehnica aspiraţiei cu ac fin .................................................................... 15
Bibliografie selectivă ............................................................................. 18

Cap. 2 Tehnici de microscopie directă ................................................................. 21
2.1. Coloraţia negativă cu tuş de India .......................................................... 22
2.2. Coloraţia negativă cu mercurochrom 2% şi tuş de India ....................... 23
2.3. Coloraţia cu lactofenol şi albastru de anilină ......................................... 24
2.4. Coloraţia cu hidroxid de potasiu şi cerneală Parker ............................... 25
2.5. Clarificarea cu hidroxid de potasiu şi dimetil sulfoxid .......................... 25
2.6. Coloraţia cu calcofluor alb şi KOH 10% ............................................... 26
2.7. Coloraţia Gram ....................................................................................... 28
2.8. Coloraţia Gram - calcofluor alb ............................................................. 30
2.9. Coloraţia Giemsa.................................................................................... 31
2.10. Coloraţia May-Grunwald-Giemsa .......................................................... 32
2.11. Coloraţia Wright .................................................................................... 34
2.12. Coloraţia cu mucicarmin Southgat ......................................................... 35
2.13. Coloraţia Musto ..................................................................................... 36
Bibliografie selectivă ............................................................................. 39


VII

Cap. 3 Medii de cultivare ...................................................................................... 41
3.1. Generalităţi ............................................................................................. 41
3.2. Compoziţia mediilor de cultură .............................................................. 42
3.3. Prepararea şi sterilizarea mediilor .......................................................... 43
3.4. Controlul de calitate şi păstrarea mediilor ............................................. 44
Medii de cultivare .................................................................................. 46
Bibliografie selectivă ............................................................................. 96

Cap. 4 Tehnici de însămânţare şi transplantare ............................................... 101
4.1. Tehnici uzuale ...................................................................................... 101
4.2. Tehnici speciale.................................................................................... 103
4.2.1. Tehnica de purificare a izolatelor levurice .............................. 103
4.2.2. Tehnica însămânţării levurilor pe Agarul cu făină
de porumb şi tween 80 ......................................................... 105
4.2.3. Tehnica de cultivare pe suporturi transparente ...................... 105
4.2.4. Tehnica de cultivare în „picătură suspendată” ....................... 106
4.2.5. Tehnica de cultivare pe bloc de geloză ................................. 106
4.3. Tehnici de transplantare ....................................................................... 107
Bibliografie selectivă ........................................................................... 108

Cap. 5 Tehnici de examinare microscopică a fungilor din culturi ................. 109
5.1. Preparatul extemporaneu cu lactofenol şi albastru de anilină
(levuri) .............................................................................................. 109
5.2. Preparatul extemporaneu cu lactofenol şi albastru de anilină
(fungi filamentoşi) ............................................................................ 110
5.3. Preparatul extemporaneu cu bandă adezivă ......................................... 110
5.4. Lutarea preparatelor extemporanee ...................................................... 111
Bibliografie selectivă ........................................................................... 112

Cap. 6 Tehnici de histopatologie ........................................................................ 113
6.1. Obţinerea probelor ............................................................................... 113
6.2. Examenul macroscopic ........................................................................ 113
6.3. Fixarea .............................................................................................. 113
6.3.1. Formol soluţie 10% tamponată pH 6,8 ................................ 115
6.3.2. Fixatorul Bouin ..................................................................... 116
6.3.3. Fixatorul Hollande ................................................................ 116
6.4. Procesarea ţesuturilor ........................................................................... 117
6.4.1. Deshidratarea ........................................................................ 118
6.4.2. Clarificarea ........................................................................... 119
6.4.3. Impregnarea cu parafină ....................................................... 119
6.4.4. Includerea ............................................................................. 120
6.4.5. Secţionarea............................................................................ 120
6.4.6. Etalarea secţiunilor ............................................................... 121
6.4.7. Colorarea .............................................................................. 123
6.5. Montarea .............................................................................................. 148
Index


VIII
6.6. Etichetarea şi arhivarea ........................................................................ 150
Bibliografie selectivă ........................................................................... 151
Cap. 7 Tehnici de seromicologie ......................................................................... 153
7.1 Fungitell™ ........................................................................................... 153
7.1.1. Principiul testului .................................................................. 153
7.1.2. Materiale furnizate împreună cu testul Fungitell .................. 154
7.1.3. Materiale necesare dar nefurnizate împreună cu kitul .......... 154
7.1.4. Atenţionări şi precauţii ......................................................... 155
7.1.5. Păstrarea reactivilor .............................................................. 155
7.1.6. Recoltarea / Stocarea / Marcarea probelor ............................ 155
7.1.7. Tehnică de lucru ................................................................... 155
7.1.8. Interpretarea rezultatelor ....................................................... 157
7.1.9. Controlul calităţii .................................................................. 158
7.1.10. Limite ................................................................................... 158
7.1.11. Interferarea cu alte substanţe ................................................ 159
7.1.12. Valori aşteptate ..................................................................... 159
7.2. Platelia
®
Aspergillus ............................................................................ 160
7.2.1. Principiul testului .................................................................. 160
7.2.2. Materiale furnizate odată cu kitul ......................................... 160
7.2.3. Materiale necesare, dar nefurnizate odată cu kitul ............... 161
7.2.4. Conservarea reactivilor desigilaţi
şi a celor reconstituiţi ............................................................ 161
7.2.5. Tehnica de lucru ................................................................... 162
7.2.6. Interpretarea rezultatelor ....................................................... 164
7.3. Platelia
®
Candida Ac ............................................................................ 165
7.3.1. Introducere ............................................................................ 165
7.3.2. Principiul testului .................................................................. 165
7.3.3. Materiale furnizate împreună cu kitul ................................... 165
7.3.4. Materiale necesare dar nefurnizate impreună cu kitul .......... 166
7.3.5. Tehnica de lucru ................................................................... 166
7.3.6. Interpretarea rezultatelor ....................................................... 167
7.4. Platelia
®
Candida Ag ........................................................................... 169
7.4.1. Introducere ............................................................................ 169
7.4.2. Principiul testului .................................................................. 169
7.4.3. Materiale furnizate odată cu kitul ......................................... 169
7.4.4. Materiale necesare dar nefurnizate odată cu kitul ................ 169
7.4.5. Tehnica de lucru ................................................................... 170
7.4.6. Maniera de calcul şi interpretarea rezultatelor ...................... 171
7.5. Identificarea speciei Candida dubliniensis
prin latex-aglutinare .............................................................. 172
Bibliografie selectivă ........................................................................... 173

Cap. 8 Teste biochimice şi fiziologice ................................................................. 179
8.1. Fermentarea zaharurilor ...................................................................... 179
8.2. Capacitatea de asimilare a surselor de carbon ..................................... 180
8.3. Capacitatea de asimilare a surselor de azot ......................................... 180


IX
8.4. Testul de hidroliză a ureei (producerea de urează) la levuri ................ 180
8.5. Testul de hidroliză a ureei (producerea de urează) la dermatofiţi ........ 181
8.6. Testarea rezistenţei la cicloheximidă ................................................... 181
8.7. Producerea de fenol-oxidază ................................................................ 182
8.8. Testarea producerii altor enzime .......................................................... 182
8.9. Testul de depistare a necesităţilor nutritive speciale ............................ 182
8.10. Testul de cultivare pe Agar BCP-lapte-glucoză. .................................. 183
8.11. Testul de perforare a firului de păr in vitro. ......................................... 184
8.12. Testul de cultivare pe boabe de orez .................................................... 185
8.13. Testul de filamentare (testul de blasteză sau germ-tube test) ............... 185
8.14. Testul de termotoleranţă / termostimulare ........................................... 186
Bibliografie selectivă ........................................................................... 188

Cap. 9 Tehnici de micologie moleculară ............................................................ 191
9.1. Extracţia ADN-ului pentru PCR .......................................................... 191
9.2. Extracţia ADN-ului cu ajutorul kit-ului
High Pure Template Preparation Kit (levuri) .................................... 191
9.3. Extracţia ADN-ului prin crioprecipitare (fungi filamentoşi) ............... 192
9.4. Controlul calităţii acizilor nucleici extraşi ........................................... 193
9.5. Identificarea speciei Candida dubliniensis prin PCR duplex ............... 194
9.6. Identificarea moleculară a levurilor prin PCR şi
secvenţializarea regiunilor ITS ......................................................... 196
9.7. Reactivi utilizaţi în tehnicile de biologie moleculară ........................... 200
Bibliografie selectivă ........................................................................... 201

Cap. 10 Tehnici de evaluare a sensibilităţii la antifungice ............................... 203
10.1. Tehnica de lucru pentru levuri ............................................................. 203
10.2. Tehnica de lucru pentru fungi filamentoşi ........................................... 206
10.3. Testarea sensibilităţii la antifungice prin metoda
difuzimetrică Kirby-Bauer ................................................................ 208
Bibliografie selectivă ........................................................................... 210

Cap. 11 Tehnici de aeromicologie ...................................................................... 211
11.1. Caseta AIR-O-CELL™ ........................................................................ 212
11.2. Caseta MICRO-5.................................................................................. 214
11.3. Caseta CYCLEX-D .............................................................................. 215
11.4. Caseta BIOCELL ................................................................................. 215
11.5. Caseta LARO 100 ................................................................................ 216
11.6. Impactorul Zefon Z-A6 ........................................................................ 217
11.7. Dispozitivul CIP 10M .......................................................................... 219
11.8. Aprecierea încărcăturii fungice aeropurtate ......................................... 224
11.9. Tehnici de recoltare/examinare directă a probelor ............................... 225
11.9.1. Banda adezivă BIO TAPETM (Zefon International) ............ 225
11.9.2. Recoltarea fragmentelor inerte .............................................. 226
11.9.3. Recoltarea cu ajutorul tamponului tip exsudat ...................... 226
Bibliografie selectivă ........................................................................... 227
Index


X

Cap. 12 Norme generale de biosecuritate în
laboratoarele de micologie medicală ................................................ 229
12.1. Clasificarea fungilor în funcţie de clasele de risc biologic .................. 229
12.2. Norme generale de biosecuritate .......................................................... 230
12.2.1. Tehnici de laborator folosite în zona de lucru ....................... 232
12.3. Metode de protecţie primară ................................................................ 232
12.3.1. Hote de protecţie biologică ................................................... 232
12.4. Substanţe decontaminante folosite în
laboratoarele de micologie medicală ................................................. 233
12.5. Măsuri de protecţie împotriva substanţelor chimice ........................... 235
Bibliografie selectivă ........................................................................... 236

Anexă .................................................................................................................... 237

Index ..................................................................................................................... 245
































XI
Prefaţă

Fungii – microorganisme familiare tuturor prin omniprezenţa şi diversitatea
lor, au fost consideraţi mult timp inofensivi pentru om, singurele manifestări induse de
aceştia – candidozele superficiale şi dermatofitozele – având un prognostic vital
favorabil. Odată cu individualizarea micologiei medicale ca ştiinţă de sine stătătoare în
cadrul microbiologiei, în prima jumătate a secolului trecut, şi intensificării
investigaţiilor în acest domeniu, au apărut date din ce în ce mai certe privind
implicarea fungilor într-o serie de entităţi nosologice care pot fi grupate în micoze
(superficiale, profunde, sistemice), micotoxicoze şi alergoze.
În condiţiile actuale, când organismele umane sunt supuse intervenţiei a
numeroşi factori agresivi care le destabilizează homeostazia şi le induc modificări
reactive detrimentale, referindu-ne la posibilitatea implicării unei specii fungice sau a
alteia în determinarea unor entităţi morbide, aserţiunea că “practic, putem întâlni orice,
oriunde” este cât se poate de veridică. Limita dintre patogen şi nepatogen, dintre
colonizare şi oportunism, este extrem de labilă, neexistând practic o delimitare strictă.
Fungi consideraţi cu cca. 1 – 2 decenii în urmă ca nepatogeni, existând în mediul
ambiant doar ca banali contaminanţi, sunt astăzi recunoscuţi ca agenţi patogeni
redutabili în cazul gazdelor imunocompromise. Fungii patogeni reprezintă astăzi o
provocare pentru lumea medicală, atât din punct de vedere epidemiologic
(augmentarea incidenţei micozelor invazive), cât şi diagnostic sau terapeutic. Se
consideră că aproximativ 5% dintre decesele intraspitaliceşti se datorează unei cauze
sau complicaţii fungice. Micoze precum aspergiloza invazivă, zygomicozele sau
scedosporiozele sunt responsabile de un număr crescând de decese prin diagnosticarea
adeseori dificilă şi terapia extrem de costisitoare şi de multe ori ineficace.
Scopul prezentului volum este de a pune la dispoziţia medicului de laborator şi
clinicianului o suită de tehnici utile în diagnosticarea şi managementul ulterior al
micozelor. Am încercat prezentarea acestora în succesiunea lor logică, într-o manieră
cât mai comprehensibilă, urmărind toate etapele demersului diagnostic, de la
prelevarea probelor până la testele de sensibilitate la antifungice. De asemenea, am
imprimat lucrării un caracter de ghid practic, reducând la maxim consideraţiile
teoretice. Inevitabil, unele tehnici sau proceduri au fost omise, fie pentru a nu
supraîncărca textul cu informaţie redundantă, fie din cauza performanţelor reduse ale
acestora. Bineînţeles, varianta propusă este perfectibilă, iar sugestiile cititorilor avizaţi
vor sta la baza unei eventuale noi ediţii.
Speranţa noastră, a autorilor, este ca acest ghid să aducă o viziune unitară în
micologia clinică din România şi să contribuie la ameliorarea capacităţii de diagnostic
şi control a micozelor, atât a celor superficiale, dar mai ales a celor invazive, cu
prognostic infaust. Salvarea şi ameliorarea calităţii vieţii pacienţilor critici, printr-un
diagnostic etiologic corect şi o monitorizare riguroasă a terapiei antifungice, au
reprezentat argumentele primordiale ale acestui demers publicistic.

Autorii

Iaşi, iulie 2007


Maria Dan, Bogdan Doroftei, Petru Cazacu, Magdalena Mareş, Mihai Mareş


1
C
a
p
i
t
o
l
u
l
 
1
 



Maria Dan, Bogdan Doroftei, Petru Cazacu, Magdalena Mareş, Mihai Mareş

ecoltarea sau prelevarea probelor este o acţiune deosebit de importantă
pentru diagnosticul diverselor micoze interne sau superficiale, ea fiind o
etapă critică a acestui demers. Modul de prelevare a probelor şi operaţiunile ulterioare
la care acestea vor fi supuse sunt specifice fiecărui situs de recoltare şi pot reprezenta
tot atâţia factori limitativi pentru un diagnostic eficient în cazul executării lor incorecte.
Se recomandă ca prelevarea probelor să fie realizată de personalul laboratorului de
micologie, special instruit în acest scop. Cantitatea / volumul prelevatului trebuie să fie
suficient de mare pentru a permite efectuarea examenului microscopic direct,
cultivarea şi eventual examenul histopatologic pe biopsie. Procesarea probelor va
începe cât mai curând posibil după recoltare, fără a depăşi timpul maxim de aşteptare.

Formularul de cerere pentru analize microbiologice

Probele prelevate vor fi însoţite obligatoriu de un formular de cerere pentru
analize microbiologice care va cuprinde datele de identificare ale pacientului, tipul
prelevatului, ora recoltării şi examenele de laborator necesare. Unele date anamnetice
(profesie, călătorii în zone endemice etc.) ca şi unele informaţii clinice relevante sunt
importante pentru medicul de laborator în procesarea optimă a probelor şi vor fi
furnizate de către clinician în acelaşi formular. Formularul de cerere va conţine şi
numele medicului, numărul de telefon, clar indicate, pentru a fi contactat în cazul unor
rezultatele critice sau urgente.
Tratamentele recente cu antifungice trebuie imperios specificate pentru a ajuta
microbiologul la interpretarea rezultatelor testelor şi la efectuarea antifungigramei.
Rezultatele serologice şi culturale anterioare trebuie de asemenea specificate dacă au
fost efectuate.

Precauţii

1. Se urmează precauţiile standard pentru recoltarea şi manipularea produselor
biologice. Se tratează toate probele ca fiind potenţial periculoase.
2. După recoltare în recipiente adecvate, probele se introduc în pungi din plastic tip
ziplock, cu buzunar lateral (pentru formularul de cerere).
R
1
Tehnici de recoltare, transport şi
procesare primară a prelevatelor clinice
Tehnici de recoltare, transport şi procesare primară a prelevatelor clinice


2

Recoltarea

1. Când este posibil, probele se recoltează înaintea administrării agenţilor
antimicrobieni.
2. Se identifică sursa probei şi se specifică corect zona, astfel încât în cursul
procesării în laborator să fie selectat mediul de cultură adecvat.
3. Se indică când un microorganism particular este căutat în mod special în probă.
4. Dacă o probă este recoltată prin traversul pielii intacte, aceasta se va dezinfecta
cu alcool etilic 70%, urmat de o soluţie pe bază de iod (1-2% tinctură de iod
sau 10% soluţie de povidonă-iod). Excesul de tinctură de iod se îndepărtează
cu ajutorul unui tampon îmbibat în alcool, pentru a preveni eventualele iritaţii.
5. Pentru recoltarea din situsuri normal sterile se utilizează echipament sterilizat şi
tehnică aseptică pentru a preveni contaminarea cu microorganisme în timpul
procedurilor invazive.
6. Colectarea probelor se va face în recipiente ermetice, sterile şi rezistente, cu
capac filetat, care nu permit crearea de aerosoli în momentul deschiderii.
7. Se etichetează clar recipientul de transport cu numele pacientului, numărul de
identificare, data şi ora de colectare.
8. Probele obţinute prin aspiraţie cu ac fin trebuie transferate într-un tub steril sau
flacon de transport înainte de a fi trimise la laborator.
9. Dacă din probele fluide s-au executat frotiuri imediat după recoltare, acestea vor
fi individualizate corespunzător prin notare pe capătul mat al lamei. Se
recomandă trimiterea a 1-5 frotiuri pentru evaluare citologică. Acestea se vor
fixa imediat prin pulverizarea frotiului cu un fixator citologic sau se introduc în
etanol 95 % pentru 20 minute.

1.1. Sângele

Hemocultura este o importantă metodă de diagnostic care poate orienta sau
reorienta terapia antimicrobiană în cazul bolilor infecţioase grave. Obiectivul major al
tuturor metodelor de hemocultură este reprezentat de depistarea unui număr mic de
microorganisme în sânge, de aceea metodele de hemocultură variază şi sunt aproape
proprii fiecărui laborator. Indiferent de metoda aleasă, este esenţială prelevarea
sângelui în condiţii strict aseptice, însămânţarea acestuia pe un mediu lichid, folosirea
unor metode pentru depistarea creşterii microorganismelor în mediu lichid şi o fază
finală de subcultivare pe un mediu solid pentru identificarea şi testarea sesibilităţii la
antifungice.
Printre factorii cheie pe care şeful de laborator trebuie să-i stabilească se
numără şi metoda de hemocultură, cantitatea şi compoziţia mediului de cultură,
numărul şi momentul prelevării hemoculturilor, volumul de sânge care urmează a fi
însămânţat, frecvenţa subcultivărilor şi interpretarea rezultatelor.
Prelevarea se face direct în flacoanele de hemocultură de tipul Hemoline
Performance Duo, BacT/ALERT
®
FA (bioMérieux) sau, mai recomandat, BD
BACTEC
TM
- Mycosis IC/F Medium (BD Diagnostics). În cazul suspectării unor
infecţii fungice cu localizare intracelulară a microorganismului (e.g. Histoplasma
Maria Dan, Bogdan Doroftei, Petru Cazacu, Magdalena Mareş, Mihai Mareş


3
C
a
p
i
t
o
l
u
l
 
1
 
capsulatum), tehnica de liză-centrifugare şi utilizarea flacoanelor BD BACTEC
TM

Myco/F Lytic Medium (BD Diagnostics) cresc esenţial şansa de izolare a agentului
patogen.

1.1.1. Recoltarea sângelui pentru hemocultură

Sângele pentru hemoculturi trebuie recoltat prin puncţie venoasă periferică, astfel:
1. Se dezinfectează flaconul de hemocultură cu alcool izopropilic 70%, se aşteaptă
1 minut;
2. Se palpează vena;
3. Se antiseptizează tegumentul cu alcool 70%, apoi cu tinctură de iod 1-2% (sau
iodofori 10%), concentric, începând din centru;
4. Se aşteaptă să se usuce şi nu se mai palpează vena;
5. Se recoltează sângele, iar după puncţie se înlătură iodul de pe tegument cu
alcool (acest pas nu mai este necesar dacă se utilizează iodofori).

Recoltarea sângelui prin dispozitive intravasculare, arteriale sau venoase, este o
problemă controversată. Unele studii comparative arată că nu există diferenţe
semnificative între sensibilitatea şi specificitatea hemoculturilor prelevate de pe cateter
şi prin puncţie venoasă periferică. Factorii care influenţează acest rezultat favorabil
sunt durata scurtă a menţinerii cateterului şi tehnicile stricte de asepsie. Alte studii
arată că, atunci când rezultatele între cele două prelevări sunt discordante,
hemoculturile prelevate prin puncţie periferică sunt mai fidele în evidenţierea
bacteriemiilor / fungemiilor adevărate faţă de cele prelevate pe cateter. Cu toate
acestea, există un consens asupra faptului că orice hemocultură pozitivă necesită şi
interpretarea clinicianului, iar acesta trebuie avertizat cu privire la particularităţile
hemoculturilor pozitive prelevate pe cateter. Multe dispute a ridicat şi problema
înlocuirii sau nu a acului după flebotomie pentru inocularea sângelui în flaconul de
hemocultură. Majoritatea studiilor arată că nu există nici o diferenţă semnificativă
statistic între cele două metode, astfel că schimbarea acului nu ar fi necesară, reducând
astfel şi riscul accidentelor prin înţepare. O antiseptizare atentă a tegumentului este mai
importantă decât schimbarea acului. O meta-analiză a studiilor care au comparat rata
contaminării hemoculturilor cu şi fără schimbarea acului înainte de inoculare a arătat
că această rată este de 2,0% când se schimbă acul, faţă de 3,7% când nu se realizează
schimbarea acului. Pe de altă parte, reducerea contaminării hemoculturilor prin
schimbarea acului ar determina o economie de aproximativ 85000 $ pentru fiecare
1000 de hemoculturi. La modul ideal, pentru recoltarea hemoculturilor, ar trebui să se
apleze la personal special calificat (flebotomişti).








Tehnici de recoltare, transport şi procesare primară a prelevatelor clinice


4
1.1.2. Numărul de hemoculturi şi momentul prelevării

Majoritatea cercetătorilor sunt de acord că peste trei hemoculturi în 24 ore nu
determină o creştere semnificativă a rezultatelor pozitive. Trei prelevări intermitente în
24 ore, din zone de puncţie diferite, cresc sensibilitatea izolării aproape de 100%.
Hemoculturile trebuie prelevate pe cât posibil înaintea instituirii antibioticoterapiei
(dacă au fost administrate antibiotice, această informaţie trebuie luată în consideraţie la
interpretarea rezultatelor) şi conform evoluţiei predictive a curbei febrile sau / şi în
momentul când bolnavul semnalează apariţia frisoanelor.

1.1.3. Volumul de sânge ce urmează a fi însămânţat

Majoritatea autorilor recomandă să se recolteze la adulţi 10-30 ml de sânge
pentru fiecare set de hemoculturi. Însămânţarea a 20, respectiv 30 ml sânge, creşte
sensibilitatea cu 38% şi 68% faţă de însămânţarea a 10 ml de sânge. Recoltarea a peste
30 ml de sânge per set de hemocultură îmbunătăţeşte foarte puţin sensibilitatea
hemoculturii şi contribuie la instalarea anemiei iatrogene. La copii este necesar un
volum mai mic de sânge datorită bacteriemiilor cu un număr mai mare de UFC/ml faţă
de adulţi. Se recomandă 1-2 ml de sânge per set la nou-născuţi, 2-3 ml la sugari şi 3-5
ml la copii.
O raţie optimă de diluţie a sângelui în bulion nu a fost încă stabilită.
Majoritatea autorilor recomandă ca această diluţie să fie între 1:5 şi 1:10, iar unii au
arătat că un raport de diluţie de 1:10 este superior celui de 1:5 în ceea ce priveşte
rapiditatea şi sensibilitatea izolării. Majoritatea sistemelor de hemocultură conţin
polianetol sulfonat de sodiu, care pe lângă efectul anticoagulant inactivează şi anumiţi
agenţi antimicrobieni (e.g., aminoglicozidele, polimixinele).

1.1.4. Medii de cultură

Mediile pentru hemocultură prezintă variaţii în compoziţie şi de aceea studiile
comparative realizate sunt greu de interpretat.

Sistemele de hemocultură automate şi semiautomate computerizate pentru
detecţia rapidă a microorganismelor în hemoculturi sunt utilizate în multe laboratoare.
Sistemul BACTEC (Becton Dickinson Intruments Systems, Sparks, MD, SUA)
se bazează pe detecţia directă a producerii de CO
2
prin prelevare seriată de eşantioane
de gaz din flaconul de cultură, iar în camera de citire prezenţa CO
2
este depistată cu
ajutorul luminii infraroşii, ultraviolete sau radiometric. Câteva studii comparative au
arătat că sistemul BACTEC identifică o gamă largă de microorganisme, în special
levuri şi fungi dimorfici, în timp scurt. În comparaţie cu sistemul Isolator, mediile
BACTEC pentru fungi (BACTEC MYCO/F Lytic bottle şi BACTEC high-blood-volume
fungal medium) au avantajul monitorizării automate continue, dar timpii de izolare sunt
echivalenţi, cu excepţia tulpinilor de Histoplasma capsulatum care au fost izolate doar
în sistemul Isolator.
În sistemul BacT/Alert (Organon Teknika Corp., Durham, NC) creşterea este
semnalizată tot prin detecţia CO
2
, dar cu ajutorul unui detector colorimetric. BACTEC
Maria Dan, Bogdan Doroftei, Petru Cazacu, Magdalena Mareş, Mihai Mareş


5
C
a
p
i
t
o
l
u
l
 
1
 
şi BacT/Alert, similare în compoziţia bulionului pe bază de tripticază-soia şi cazeină,
diferă în suplimentele nutritive şi în concentraţia de polianetol sulfonat de sodiu.
Studiile comparative ale celor două sisteme au arătat că sistemul BacT/Alert este
superior în izolarea microorganismelor, în special a stafilococilor şi levurilor.
BACTEC este superior bulionului cu supliment de peptonă şi sistemului VITAL
în depistarea bacteriemiilor şi fungemiilor, iar această superioritate nu se datorează
metodei de detecţie.
Flacoanele speciale pentru fungi ar trebui luate în considerare în anumite
situaţii particulare (pacienţi HIV infectaţi), deoarece fungii filamentoşi şi dimorfici
necesită o atenţie specială. Studii recente arată că flacoanele pentru izolarea bacteriilor
sunt foarte potrivite pentru cultivarea levurilor genului Candida.

Sistemul Oxoid Signal (Oxoid USA, Inc., Columbia, MD) este format dintr-un
singur flacon de cultură, în care presiunea CO
2
degajat de creşterea microorganismelor,
forţează fluidul de cultură să treacă într-un compartiment semnal, de unde poate fi
examinat microscopic şi subcultivat. Deşi evaluările iniţiale au fost favorabile, studiile
ulterioare au arătat că furnizează un număr crescut de rezultate fals pozitive şi are
dificultăţi în semnalizarea creşterii bacteriilor anaerobe, a majorităţii levurilor, a
Hemophillus influenzae, bacililor gram-negativi nonfermentativi, Neisseria
meningitidis, Nocardia spp., şi Corynebacterium jeikeium. Noile modele care au
îmbunătăţit compartimentul de semnalizare (creşterea volumului) şi beneficiază de
agitare, au dovedit proprietăţi superioare în izolarea microorganismelor.

Mediile difazice (Septi-Chek: Roche Diagnostic Systems, Nutely, NJ;
Hemoline Performance Duo: BioMerieux, Vacutainer agar slant: Becton Dickinson)
sunt de asemenea larg utilizate. Au calităţi superioare bulionului suplimentat cu
peptonă, sunt avantajoase pentru izolarea micobacteriilor şi brucelelor. Însămânţarea
frecventă a pantei poate să furnizeze cultură suficientă pentru testarea sensibilităţii şi
identificare, astfel încât timpul de depistare a microorganismelor poate fi comparabil
cu al sistemelor automate. Folosite în asociaţie cu sistemul BACTEC s-a observat o
creştere cu 25% a depistării episoadelor bacteriemice, faţă de folosirea izolată a
sistemului BACTEC.

Metoda lizei cu centrifugare ( denumită anterior DuPont Isolator tube, în
prezent este comercializată de Wampole Laboratories, Cranbury, NJ) izolează
majoritatea microorganismelor, dar este indicată în special pentru depistarea
fungemiilor, (mai ales cu fungi dimorfici, fungi filamentoşi, Malassezia furfur), a
infecţiilor cu micobacterii la pacienţii cu SIDA şi a oportuniştilor (Bartonella
henselae). Sângele, prelevat în tuburi cu „liquoid” (polietilenglicol şi saponină) este
lizat, apoi centrifugat, iar sedimentul este însămânţat pe medii solide adecvate. Metoda
este echivalentă sistemului difazic în izolarea fungilor (chiar superioară în izolarea
Histoplasma capsulatum ), de asemenea şi în izolarea bacteriilor (metoda lizei cu
centrifugare fiind mai rapidă). Unii autori nu recomandă această metodă în investigaţia
de rutină a episoadelor febrile la pacienţii neutropenici, datorită ratei crescute de
rezultate fals pozitive.
Tehnici de recoltare, transport şi procesare primară a prelevatelor clinice


6
Hemoculturile anaerobe. Setul standard de hemoculturi conţine un flacon
aerob şi unul cu incubare anaerobă. Deoarece există o şansă mică de a izola fungi sau
bacterii strict aerobe în flaconul anaerob, folosirea de rutină a flaconului cu incubare
anaerobă poate determina scăderea sensibilităţii hemoculturii. Câteva studii au arătat că
în ultimii 20 de ani s-a produs o scădere a incidenţei infecţiilor sistemice determinate
de bacteriile anaerobe; pe de altă parte, tot în această perioadă s-a produs o creştere a
incidenţei fungemiilor. Aceste schimbări în etiologia infecţiilor sistemice au început să
pună sub semnul întrebării utilitatea folosirii de rutină a flaconului anaerob.
Unii autori au arătat că folosirea a două flacoane aerobe şi doar în cazuri
selecţionate a flaconului anaerob, a dus la creşterea cu 6% a izolării microorganismelor
cu semnificaţie clinică, în comparaţie cu practica standard (un flacon aerob şi unul
anaerob). Date asemănătoare au fost găsite la copii şi având în vedere cantitatea mică
de sânge care se poate recolta de obicei de la aceşti pacienţi, este indicat ca întreaga
cantitate să se însămânţeze în flacoane aerobe şi doar în cazurile cu risc crescut să se
utilizeze flaconul anaerob.
Pe de altă parte, utilizarea flacoanelor anaerobe determină o creştere
semnificativă a izolării bacteriilor strict anaerobe. În concluzie, la ora actuală este
indicată folosirea a două flacoane aerobe per set şi în circumstanţe bine selecţionate
(e.g., afecţiuni intraabdominale, infecţii orale, neutropenii, celulite, muşcătură de om)
şi pe cea a flaconului anaerob.

Neutralizarea şi inactivarea substanţelor antimicrobiene. Datorită
frecventei recoltări a sângelui pentru hemoculturi de la pacienţi aflaţi sub terapie
antimicrobiană, pe piaţă au apărut produse care încearcă să înlăture posibilele efecte
inhibitorii ale creşterii. Sistemul BacT/Alert are variante FAN pentru flacoanele aerobe
şi anaerobe. Utilizarea acestora a demonstrat îmbunătăţirea izolării microorganismelor
în comparaţie cu mediile standard, iar noua formulă a mediului a optimizat şi
microscopia directă din hemocultură. Studiile comparative ale sistemelor BacT/Alert
FAN şi BACTEC cu rezină au arătat că performanţele celor două medii sunt
echivalente.

Mediile hipertone cu 10% sucroză sunt utilizate pentru a crea un mediu
osmotic protector, îmbunătăţind astfel izolarea bacteriilor şi fungilor cu perete defectiv
din sângele pacienţilor care au primit antibioticoterapie. În general, aceste medii au fost
evitate în laboratoarele care utilizează citirea vizuală a creşterii datorită rezultatelor fals
pozitive date de efectul hemolitic, dar pe de altă parte producerea unor mari cantităţi de
gaz de către anumite bacterii, poate fi utilă în evidenţierea creşterii. Valoarea acestor
medii în depistarea bacteriemiilor şi fungemiilor este controversată. Unele studii arată
o îmbunătăţire a izolării stafilococilor, bacililor gram-negativi (Enterobacteriaceae,
Pseudomonas aeruginosa) şi fungilor, dar o reducere şi o întârziere în izolarea
bacteriilor anaerobe şi a Neisseria gonorrhoeae.

Noile metode rapide de identificare şi testare a sensibilităţii la antibiotice
(Vitek - bioMerieux Vitek, Hazelwood, MO, USA, autoSCAN-W/A - W/A; Dade
Behring Microscan Inc., West Sacramento, Calif.; BD PHOENIX Automated
Microbiology System; PCR) a microorganismelor direct din hemoculturile pozitive,
Maria Dan, Bogdan Doroftei, Petru Cazacu, Magdalena Mareş, Mihai Mareş


7
C
a
p
i
t
o
l
u
l
 
1
 
furnizează rezultate corecte în aproximativ 2-6 ore şi pot determina iniţierea
antibioticoterapiei, schimbarea terapiei de primointenţie cu o terapie mai eficientă sau
mai puţin costisitoare. Unii autori au estimat o economie de aproximativ 158 $ per
pacient, apreciată la pacienţii la care s-a administrat un antibiotic mai ieftin sau la care
a fost întreruptă antibioticoterapia, prin primirea rezultatelor cu 24-48 de ore mai
devreme.
Metodele moleculare au o sensibilitate şi o specificitate de aproximativ 100%
în identificarea bacteriilor şi levurilor din hemoculturile monomicrobiene şi furnizează
rezultatele în aproximativ 2 ore.

1.1.5. Durata incubării şi prelucrarea hemoculturilor

Majoritatea laboratoarelor care utilizează sisteme automate, incubează
hemoculturile 5-7 zile. Laboratoarele care deservesc spitale în care fungii,
Pseudomonas aeruginosa şi grupul HACEK sunt izolaţi frecvent din sângele
pacienţilor, ar trebui să evalueze cu atenţie necesitatea subcultivărilor terminale, iar
hemoculturile ar trebui incubate peste 7 zile.
Dacă apare semnalizarea creşterii în timpul incubării, proba este examinată
microscopic (frotiu colorat Gram) şi subcultivată pe medii solide în funcţie de
categoria microscopică observată. În cazul observării fungilor este indicată
subcultivarea pe Agar Sabouraud cu incubare la 30° sau 37°C. În situaţia în care nu
sunt depistate microorganisme pe frotiu, trebuie realizate subcultivări oarbe, iar
flaconul reintrodus la incubat.
Pentru sistemele manuale de depistare a creşterii, în cazul suspiciunii
fungemiilor, ar trebui realizate subcultivări „oarbe” la 48 ore şi apoi săptămânal, până
la 30 de zile, pe Agar Sabouraud, cu incubare la 30°C.
Examinarea microscopică de rutină, cu ajutorul coloraţiei Gram, a
hemoculturilor negative macroscopic după 24-48 ore de incubare este controversată şi
puţin indicată, datorită numărului mic de microorganisme care pot fi detectate utilizând
frotiul colorat Gram (aproximativ 10
5
UFC/ml). Coloraţia cu acridină orange este mai
sensibilă, detectând între 10
3
şi 10
4
UFC/ml. Unii autori au comunicat o creştere de
16,8% în depistarea rapidă a septicemiilor prin examinarea cu acridină orange a
hemoculturilor negative macroscopic.
Pentru metoda lizei-centrifugare, sângele (7,5-10 ml) este recoltat în tuburi cu
saponină (lizează hematiile şi globulele albe). După recoltare, tuburile se agită de
câteva ori pentru liza completă, iar apoi se centrifughează 15 minute la 3000 rpm
pentru concentrarea microorganismelor. Sedimentul este aspirat şi însămânţat astfel: o
placă cu Agar sânge-ciocolat şi o placă cu Agar tripticază-soia, se incubează 3 zile la
37°C, apoi 18 zile la 30°C; o placă cu Agar Sabouraud şi una cu Agar infuzie cord-
creier, 4 săptămâni la 30°C. Rata contaminărilor accidentale poate fi controlată printr-o
bună tehnică aseptică în incinta hotei de siguranţă microbiologică de clasă II.





Tehnici de recoltare, transport şi procesare primară a prelevatelor clinice


8
1.1.6. Semnificaţia hemoculturilor pozitive cu fungi saprobioţi

Aspergillus spp. reprezintă cea mai frecventă cauză a infecţiilor fungice
invazive, dar este rar izolat din sânge. Pe de altă parte, Fusarium spp. este izolat în 60-
70% din hemoculturile pacienţilor cu fusarioză diseminată. Printre fungii emergenţi
implicaţi tot mai des în infecţii invazive, inclusiv în fungemii, se numără Scedosporium
spp., Alternaria spp.şi Paecilomyces spp.
Cu excepţia fungemiilor asociate cu prezenţa cateterelor venoase centrale,
determinarea semnificaţiei clinice a hemoculturilor pozitive cu fungi, chiar şi la
pacienţii cu hemopatii maligne reprezintă o provocare. Cele mai frecvente cauze de
fungemii adevărate sunt determinate de Scedosporium spp., iar prezenţa leucemiei sau
transplantului medular reprezintă un factor de risc important.
Semnificaţia hemoculturilor pozitive cu Aspergillus spp. este încă neclară. În
literatură sunt doar puţine cazuri documentate din punct de vedere clinic, histologic şi
microbiologic pentru evidenţierea aspergilozei invazive cu hemocultură pozitivă certă.
O singură hemocultură pozitivă, în sistemul lizei cu centrifugare, reprezintă în mod
obişnuit un indicator al pseudoaspergilemiei, iar în faţa unei asemenea situaţii trebuie
căutate argumentele clinice şi radiologice pentru stabilirea semnificaţiei clinice a
izolatului. Totuşi, se consideră că hemoculturile pozitive pentru Aspergillus, cu reală
semnificaţie clinică, sunt foarte rare.
Candida spp (în particular Candida albicans) este frecvent izolată în
hemoculturi, reprezentând până la 10% dintre infecţiile sistemice nosocomiale; cu toate
acestea aproximativ 50% din hemoculturi rămân negative la pacienţii cu candidemie.
În cazul hemoculturilor pozitive cu Candida spp, trebuie depistată posibila sursă a
infecţiei, iar cateterele intravasculare înlocuite. Candiduria poate apare secundar
candidemiei.

1.2. Măduva osoasă hematogenă

Se recoltează prin aspiraţie cu seringă heparinizată, calea de acces fiind creată
prin puncţie sternală sau puncţia crestei iliace. Puncţia se realizează respectând cele
mai severe măsuri de asepsie. Aspiratul medular, în volum de minim 0,5-1 ml, se
transferă într-un tub steril cu dop de cauciuc şi se expediază la laborator în maxim 2
ore.Pe parcursul acestui interval de timp, prelevatul se menţine la temperatura camerei.

1.3. Lichidul cefalo-rahidian

Lichidul cefalo-rahidian (fluidul cerebro-spinal sau LCR) se recoltează prin
puncţie rahidiană în spaţiile intervertebrale L3-L4, L4-L5 sau L5-S1. Puncţia se
realizează respectând cele mai severe măsuri de asepsie şi decontaminarea zonei cu
povidonă-iod 2%. După poziţionarea în spaţiul subarahnoidian a cateterului de puncţie,
LCR se colectează prin curgere liberă, în tuburi sterile, în volum de 3-5 ml. Înainte de
examinare, proba se concentrează prin centrifugare la 1500 rpm timp de 10 minute.
Supernatantul se păstrează pentru testarea antigenică, iar sedimentul pentru cultură şi
microscopie directă. Timp de aşteptare în vederea procesării: maxim 15 minute. Nu se
refrigerează!
Maria Dan, Bogdan Doroftei, Petru Cazacu, Magdalena Mareş, Mihai Mareş


9
C
a
p
i
t
o
l
u
l
 
1
 
1.4. Raclatul cornean

Se instilează 1-2 picături de anestezic topic, apoi cu ajutorul unei
microchiurete oftalmologice / spatule Kimura sterile, printr-o mişcare scurtă, se
raclează zone multiple din segmentul ulcerat. Prelevatul se însămânţează direct pe
medii de cultură cu ajutorul instrumentului de recoltare, prin înţepare; totodată, se
pregătesc frotiuri pentru examenul microscopic direct. Timp maxim de aşteptare: 15
minute la temperatura camerei.

1.5. Prelevatul otic

Din conductul auditiv extern se pot preleva probe cu ajutorul tampoanelor
sterile (secreţiile) sau prin raclare cu o chiuretă (scuamele). Timp maxim de aşteptare:
2 ore la temperatura camerei sau 24 ore la 4°C.

1.6. Fluidele intraoculare

Se recoltează prin aspiraţie cu un ac fin steril sau prin vitrotomie, apoi se
transferă la laborator în maxim 15 minute pentru procesare. Volumul recomandat este
de cca. 0,5 ml.

1.7. Firele de păr

Se recoltează cu ajutorul unei pense, de preferat sub lumină UV, în cameră
obscură. Se expediază la laborator în plicuri de hârtie. Timp maxim de aşteptare: 72 ore
la temperatura camerei.

1.8. Fragmentele unghiale şi scuamele cutanate

Fragmentele unghiale se recoltează de la nivelul joncţiunii ţesutului sănătos cu
cel afectat, prin raclare cu o chiuretă sterilă sau prin cupare cu ajutorul unui foarfece,
după toaletarea zonei cu apă şi săpun. Nu se recomandă decontaminarea cu alcool
deoarece diminuează şansa de izolare a dermatofiţilor prin cultivare. Raclarea se
realizează de obicei pe partea inferioară a tablei unghiale, distal sau lateral, la
joncţiunea zonei normale cu cea modificată. În cazul leziunilor de leuconichie
superficială, raclarea va interesa suprafaţa superioară a unghiei. Materialul recoltat se
expediază la laborator în plicuri de hârtie. Timp maxim de aşteptare: 72 ore la
temperatura camerei.
La pacienţii suspectaţi de tinea sau impetigo, unguentele sau alte preparate
aplicate în prealabil trebuie îndepărtate prin ştergere cu alcool. Pentru recoltare, se va
utiliza un bisturiu neascuţit, o pensă, o chiuretă Vidal sau un careu rectangular de
mochetă. Dacă leziunile sunt multiple, se va alege pentru prelevarea de probe cea mai
recentă, deoarece raclarea scuamelor vechi, în curs de detaşare este adesea
nesatisfăcătoare pentru diagnostic. Scuamele tegumentare se recoltează prin raclarea
zonei active a leziunii (de obicei cea periferică) cu ajutorul unei chiurete sterile sau
prin ştergere apăsată şi repetată cu un tampon steril preumezit în ser fiziologic steril.
Tehnici de recoltare, transport şi procesare primară a prelevatelor clinice


10
Recoltarea cu tamponul este recomandată în cazul leziunilor de epidermofiţie circinată
şi presupune însămânţarea imediată a prelevatului pe medii de izolare. Recoltarea cu
ajutorul mochetei este mai eficientă deoarece asigură concomitent abrazarea leziunii şi
reţinerea sporilor, crescând astfel şansele de izolare în cultură. Careurile de mochetă se
aplică direct pe suprafaţa mediului de cultivare, se lasă în contact cu acesta cca. 5-10
minute, după care se îndepărtează .
Când leziunile sunt localizate la nivelul unor pliuri (axilar, fesier, mamar,
crural etc.) şi sunt umede / inflamate, recoltarea se va face cu ajutorul unui tampon
pentru exsudate umectat în prealabil cu ser fiziologic, recoltarea fiind indoloră.
La pacienţii cu Pityriasis versicolor, scuamele se recoltează cel mai bine
utilizând un fragment de bandă adezivă transparentă (tip scotch) cu care se
amprentează leziunea şi care apoi se etalează pe o lamă de microscopie; în laborator,
pentru efectuarea examenului microscopic direct, se va adăuga între lamă şi banda
adezivă o picătură de colorant, de obicei lactofenol cu albastru de anilină.

1.9. Secreţiile respiratorii joase

Sputa poate fi prelevată prin expectoraţie spontană (neprovocată) şi prin
expectoraţie indusă (provocată).
a) În cazul expectoraţiei spontane, pacientul va fi sfătuit să-şi clătească cavitatea
bucală cu apă distilată sterilă sau cu o soluţie slab antiseptică (apă de gură)
anterior colectării sputei. De asemenea, pacientul va fi instruit să nu
expectoreze saliva. Colectarea probelor se va realiza prin tuse profundă urmată
de expectorarea secreţiei într-un recipient steril, cu capac etanş. Volumul
minim recoltat va fi de 2 ml. Proba se trimite la laborator în maxim 2 ore (dacă
se menţine la temperatura camerei) sau în 24 ore (dacă este pastrată la
temperatura de refrigerare);
b) În cazul expectoraţiei induse, pacientul va fi îndrumat să-şi perieze dinţii,
mucoasa linguală şi gingiile, apoi să se clătească riguros cu apă. Pentru
inducerea expectoraţiei, pacientul va inhala aproximativ 30-50 ml de soluţie
cloruro-sodică 3-10%, aerosolizată prin intermediul unui nebulizator
ultrasonic. Sputa obţinută prin expectoraţia astfel indusă se colectează într-un
recipient steril, cu capac filetat;
c) Aspiratul traheostomic
Canula de traheostomie este colonizată într-un interval de cca. 24 ore după
inserţie. Aspirarea probelor se realizează cu catetere de sucţiune, iar sputa
astfel obţinută se colectează în recipienţi sterili. Rezultatele trebuie corelate cu
datele clinice şi imagistice;
d) Aspiratul endotraheal
Pentru recoltare, se utilizează un cateter de sucţiune nou, iar secreţia aspirată se
stochează într-un captator de spută steril. Tubul endotraheal este frecvent
colonizat cu bacterii şi levuri, de aceea rezultatele trebuie să fie corelate cu
constatările clinice şi cu datele imagistice. Extremităţile inferioare ale tuburilor
endotraheale nu reprezintă probe acceptabile;
e) Prelevatele bronhoscopice
Maria Dan, Bogdan Doroftei, Petru Cazacu, Magdalena Mareş, Mihai Mareş


11
C
a
p
i
t
o
l
u
l
 
1
 
Acestea includ lavajul bronhoalveolar (LBA), spălătura bronşică, periajul
bronşic şi probele biopsice transbronhiale;
Principalele etape ale bronhoscopiei:
- Bronhoscopul se introduce transnazal sau transoral la pacienţii neintubaţi sau prin
sonda endotraheală la pacienţii intubaţi. Se înaintează cu bronhoscopul până la
nivelul unei bronhii segmentare (pentru spălătura bronşică) sau a unei bronhii
subsegmentare (pentru LBA);
- Se instilează fracţionat soluţie de NaCl 0,85% sterilă, de obicei în volum total de
până la 150 ml, cu o seringă prin canalul bronhoscopului. Se aspiră uşor soluţia
salină într-un recipient steril înaintea administrării următoarei fracţii. Se
consideră că lavajul obţinut reprezintă secreţiile de la nivelul a cca. un milion
de alveole şi bronhiolele aferente şi conţine aproximativ 1 ml secreţie;
- Probele recoltate în flacoane sterile, în volume suficiente, se tratează cu substanţe
mucolitice de tipul N-acetil-cisteinei şi se centrifughează timp de 20 minute la
1500 rpm. Timp maxim de aşteptare: 2 ore la temperatura camerei sau 24 ore
la 4°C.

1.10. Aspiratul pulmonar

Se recoltează prin inserarea transtoracică a unui ac în infiltratul pulmonar, sub
ghidaj radiologic sau computer-tomografic. Se aspiră materialul din leziune. Dacă
leziunea este de dimensiuni mari sau dacă leziunile sunt multiple, se vor colecta mai
multe probe din zonele reprezentative. Aspiratul se transferă într-un recipient steril şi
se expediază imediat la laborator.

1.11. Biopsia pulmonară

Se efectuează în serviciile de chirurgie toracică şi vizează obţinerea unei piese
de 1-3 cm
3
ţesut. Dacă leziunea este de dimensiuni mai mari sau dacă se decelează
leziuni multiple, se recomandă recoltarea mai multor probe din zonele reprezentative.
Probele se trimit la laborator în recipienţi sterili, fără formol, protejate într-o compresă
umectată cu ser fiziologic steril. Timp de aşteptare: 15 minute la temperatura camerei.

1.12. Alte fluide organice normal sterile
(pericardic, peritoneal, pleural, sinovial)

Se recoltează prin puncţie, în volume de minim 5-10 ml, stocându-se în
flacoane sterile. Probele se concentrează prin centrifugare, sedimentul însămânţându-se
pe medii solide de izolare sau se transferă ca atare în flacoane conţinând medii pentru
hemocultură. Timp maxim de aşteptare: 15 minute la temperatura camerei sau 24 ore la
4°C.





Tehnici de recoltare, transport şi procesare primară a prelevatelor clinice


12
1.13. Secreţiile purulente din abcese subcutanate sau din plăgi deschise

Se prelevează fie prin aspiraţie, fie prin tamponament profund. Se recomandă
folosirea sistemelor de transport pentru tampoane, în vederea prevenirii desicării
materialului patogen. De la pacienţii cu suspiciune de micetom, se recoltează puroi din
leziuni pentru studierea culorii granulelor, examenul microscopic direct şi cultură. De
la pacienţii suspecţi de cromomicoză se recoltează exsudat sau cruste din leziuni pentru
efectuarea de frotiuri sau preparate extemporanee în vederea decelării corpilor
fumagoizi prin examen microscopic direct. De la pacienţii cu sporothricoză se
recoltează probe prin amprentarea leziunilor cu ajutorul unei lame de microscopie,
frotiul obţinut colorându-se Gram, Musto sau cu calcofluor alb. În cazul criptococozei
diseminate sau a celei cutanate, se recomandă recoltarea de probe biopsice sau raclate
din leziunile cutanate în vederea efectuării de frotiuri pentru examenul microscopic
direct. În cazul ulcerelor şi nodulilor se urmează paşii: se decontaminează suprafaţa cu
soluţie de povidonă-iod, se îndepărtează detritusurile suprapuse şi se chiuretează baza
ulcerelor sau a nodulilor. Dacă exsudatul este prezent, acesta se colectează cu o seringă
sau cu un tampon steril.
Timp maxim de aşteptare: 2 ore la temperatura camerei.

1.14. Produsele patologice de la nivelul mucoasei orale

Se recoltează cu ajutorul unui tampon steril, preumezit în ser fiziologic, prin
trecerea repetată a acestuia, de minim 10 ori, peste zonele cu leziuni. Alternativ, în
cazul leziunilor pseudo-membranoase sau ulcerate, se poate recurge la raclarea uşoară
a acestora cu ajutorul unei chiurete sterile. În cazul aparatelor protetice amovibile,
prelevarea probelor se realizează de pe faţa mucozală a acestora – zona predilectă de
apariţie a biofilmelor levurice. Din pungile parodontale prelevarea probelor se
efectuează cu sonda parodontală, în zonele vestibulară, orală, vestibulo-distală,
vestibulo-mezială, oro-distală şi oro-mezială. În endodontite, probele se prelevează cu
ajutorul conurilor de hârtie sterile, de diferite diametre, funcţie de dimensiunea
canalelor radiculare. Timp maxim de aşteptare: 2 ore la temperatura camerei.

1.15. Urina

Tehnici de recoltare (fracţiunea mijlocie în timpul micţiunii spontane):
a) la femei:
- Persoana care recoltează proba trebuie să-şi igienizeze mâinile în
prealabil, prin spălare cu apă şi săpun. Înainte de recoltare, pacientul
va fi instruit în detaliu asupra manoperelor ce vor urma;
- Se îndepărtează lenjeria intimă, se toaletează zona vulvo-vaginală şi
deschiderea uretrei cu apă şi săpun lichid, folosind un tampon de tifon,
din faţă către spate;
- Se clăteşte zona cu apă sau se şterge cu un tifon umed, cu aceleaşi
mişcări din faţă către spate. Fiecare tampon se utilizează o singură
dată;
- În timpul micţiunii, labiile se îndepărtează;
Maria Dan, Bogdan Doroftei, Petru Cazacu, Magdalena Mareş, Mihai Mareş


13
C
a
p
i
t
o
l
u
l
 
1
 
- Se elimină un volum de aproximativ 40-50 ml urină, fără ca pacienta să-
şi întrerupă apoi micţiunea;
- Se recoltează apoi urina din jetul urinar mijlociu, într-un recipient steril,
având grijă ca deschiderea acestuia să nu vină în contact cu suprafeţe
posibil contaminate;
b) la bărbaţi:
- Persoana care va recolta proba trebuie să fie corect igienizată prin
spălarea mâinilor cu apă şi săpun. Dacă pacientul este cel ce colectează
urina, el trebuie să primească în prealabil instrucţiuni detaliate;
- Se toaletează glandul penisului şi meatul urinar prin retractarea
prepuţului (dacă nu este circumcis) şi spălare cu apă şi săpun lichid;
- Menţinându-se prepuţul retractat, se începe micţiunea, lăsând să curgă
primii mililitri de urină. Pacientul nu-şi va întrerupe emisia de urină;
- Se colectează apoi urina din jetul urinar mijlociu, într-un recipient steril.
c) Recoltarea prin cateterizare vezicală
Inserarea cateterului pentru colectarea unei probe de urină este în general
descurajată. Se poate totuşi utiliza când urina se nu se poate obţine altfel sau
când pacientul se află în stare critică.
- Se toaletează deschiderea uretrei pacientului şi a zonei adiacente, cu apă
şi săpun lichid, apoi se clăteşte cât mai riguros;
- Se introduce cateterul până în vezică prin tehnica recomandată, funcţie de
sexul pacientului;
- Se îndepărtează fracţiunea iniţială, de 30-50 ml urină;
- Se colectează urina din fracţiunea mijlocie sau terminală, într-un
recipient steril.
d) Recoltarea pe cateter preexistent
Trebuie de obicei evitată datorită colonizării uneori masive cu microorganisme
a cateterelor.
- Se dezinfectează peretele cateterului cu alcool 70%;
- Se puncţionează cateterul, în condiţii de asepsie, cu ajutorul unui ac
ataşat la o seringă. Niciodată se va recolta urina din punga de
colectare !
- Se aspiră urina şi apoi se descarcă seringa într-un recipient steril.
e) Recoltarea prin puncţie suprapubiană
Aspiraţia suprapubiană se practică pentru diagnosticarea infecţiilor urinare la
adulţi, în cazul în care se suspectează o infecţie şi rezultatele procedurilor de
rutină au fost nerelevante. Aspiraţia suprapubiană este de asemenea utilizată la
pacienţii pediatrici, atunci când probele de urină sunt dificil de obţinut.
- Se rade pilozitatea din zona suprapubiană (dacă este necesar) şi se
dezinfectează tegumentul cu soluţie de povidonă-iod;
- Se puncţionează vezica, pe linia mediană, în dreptul simfizei pubiene
superioare;
- Se aspiră prin acul de puncţie cca. 50-100 ml urină şi se descarcă seringa
într-un recipient steril.
Timp maxim de aşteptare: 2 ore la temperatura camerei.

Tehnici de recoltare, transport şi procesare primară a prelevatelor clinice


14
1.16. Secreţiile vaginale

Se recoltează cu ocazia examinării pereţilor vaginali şi a porţiunii vaginale a
colului uterin. Se va efectua întotdeauna înaintea tuşeului vaginal pentru a evita
modificarea secreţiilor cervicale sau vaginale prin contaminare sau manevre septice. Se
efectuează cu pacienta pe masa ginecologică, în poziţie ginecologică (decubit dorsal,
coapsele în abducţie, flexate pe abdomen, gambele flexate pe coapse şi sprijinite în
suporturi). Valvele se aleg în funcţie de mărimea vaginului pacientei. Ele sunt inegale -
una mai mare şi alta mai mică. Introducerea valvelor în vagin trebuie să fie indoloră.
Nu se foloseşte lubrifiant dacă se recoltează probe pentru frotiu citobacteriologic sau
cultură. Folosirea serului fiziologic steril ca lubrifiant poate fi utilă în cazul examinării
unor paciente cu vagin atrofic, deoarece facilitează introducerea valvelor şi nu
modifică rezultatele testelor de laborator.
Se îndepărtează cu policele şi indexul mâinii stângi labile mici şi se introduce
mai întâi valva posterioară cu lama situată vertical, apoi printr-o mişcare de rotaţie şi
înaintare se aduce lama orizontal, menţinându-se tracţiunea asupra valvei. Valva
anterioară se introduce direct cu lama situată orizontal până în fundul de sac vaginal
anterior. Se exercită o tracţiune divergentă asupra valvelor pentru a împiedica
prinderea peretelui vaginal între valve şi pentru a evidenţia colul şi fundurile de sac
vaginale. Extragerea valvelor se face în ordine inversă introducerii lor, extrăgându-se
iniţial valva anterioară şi ulterior valva posterioară.
Vizualizarea pereţilor vaginali se poate obţine şi prin folosirea unui speculum -
instrument ginecologic care poate fi confecţionat din plastic sau din metal şi este
alcătuit din două valve care sunt articulate printr-un şurub sau ecartor. Sunt de mai
multe tipuri, mari, mici, cu lame egale, cu lame inegale, cu diverse denumiri (Cusco,
Graves, Pederson, Collin). Introducerea speculumului se face fie cu lamele situate
orizontal (mai uşor la multipare), fie cu lamele vertical, imprimându-se ulterior
introducerii o mişcare de rotaţie şi împingere. După introducerea speculumului, se
îndepărtează lamelele cu ajutorul ecartorului şi se examinează fundurile de sac
vaginale şi colul. Extragerea speculumului se face apropiind lamele şi efectuând
mişcarea în sens invers introducerii.
După introducerea valvelor sau a speculumului se observă şi se noteză starea
mucoasei vaginale şi a colului. Normal, mucoasa vaginală este de culoare roz-
trandafirie, uniformă. Poate deveni violacee în sarcină sau palidă, atrofiată după
menopauză. Se mai are în vedere troficitatea mucoasei vaginale, eventuale cicatrici,
chisturi, noduli endometriozici, ulceraţii, vegetaţii, malformaţii şi nu în ultimul rând
secreţiile patologice. Acestea diferă în funcţie de agentul patogen; în candidoze,
secreţia este albă, grunjoasă, în infecţiile cu Trichomonas este spumoasă, aerată,
abundentă, iar gonococul produce o secreţie galben-verzuie, fetidă.
Examenul colului va obiectiva situarea, orientarea, forma, mărimea, aspectul
exocolului, prezenţa unor secreţii patologice, prezenţa unor leziuni. Normal, colul este
de culoare roz, după menopauză este palid, iar în sarcină este de culoare violacee
(semnul Jaquemier). În caz de inflamaţii, mucoasa este hiperemiată. Pe suprafaţa
colului se mai pot observa chişti Naboth, focare endometriozice sau noduli fibromatoşi.
Pentru a fi cât mai concludentă, prelevarea trebuie să respecte anumite condiţii:
- prelevarea se face înaintea instituirii tratamentului antimicrobian sau antifungic;
Maria Dan, Bogdan Doroftei, Petru Cazacu, Magdalena Mareş, Mihai Mareş


15
C
a
p
i
t
o
l
u
l
 
1
 
- nu se folosesc creme vaginale sau ovule cu cel puţin 2 zile înainte;
- nu se folosesc irigaţii vaginale cu cel puţin 24 de ore înainte;
- prelevarea nu se realizează în prezenţa sângelui în vagin;
- se folosesc recipiente sterile, pentru a preveni contaminarea probelor;
- evitarea contactului cu substanţe antimicrobiene a produsului patologic;
- în unele cazuri trebuie folosite medii de transport sau lichide conservante;
-recipientele de transport se închid ermetic pentru a preveni contaminarea mediului
şi a personalului care manipulează produsul biologic;
- produsul va fi însoțit de un bilet de trimitere completat corect;
- probele vor fi etichetate şi transportate la laborator în cel mai scurt timp posibil.
Secreţia se recoltează cu ajutorul valvelor sau a speculumului, nelubrifiate,
folosind mici tampoane de vată montate pe pense port-tampon sau pipete absorbante.
Instrumentarul trebuie să fie steril. Tampoanele de vată pot fi iniţial umezite în ser
fiziologic. Prima recoltare se face din fundul de sac posterior. Produsul recoltat se
etalează pe o lamă în strat subţire, se aplică o picătură de ser fiziologic, eventual o
picătură de albastru de metilen şi apoi o lamelă. A doua prelevare se realizează în
acelaşi mod, iar după etalarea pe lamă se aplică o picătură de KOH 10%, apoi lamela.
A treia recoltare se realizează cu o baghetă sterilă sau cu un tampon pentru exsudate şi
presupune ştergerea fundului de sac posterior cu vârful acestora.
Probele se expediază la laborator în maxim 2 ore (stocare la temperatura
camerei).

1.17. Produse patologice de la nivelul tractului genital masculin

În această grupă includem prelevatele balano-prepuţiale (pseudo-membranele
candidozice), secreţia prostatică, aspiratul prostatic şi biopsia testiculară. În cazul
leziunilor balano-prepuţiale, recoltarea probelor se realizează facil prin ştergere
repetată cu un tampon steril de vată, umectat în prealabil cu ser fiziologic.
Secreţia prostatică se obţine prin efectuarea unui masaj digital transrectal.
Colectarea probelor se realizează în tuburi sterile sau cu ajutorul unui tampon steril şi
va fi precedată obligatoriu de toaletarea peniană. Detectarea ecografică a abceselor
prostatice permite recoltarea de probe prin aspiraţie cu ac fin. Aspiratul de prostată se
trimite în recipienţi sterili.
Biopsia testiculară se efectuează în servicii chirurgicale, în condiţii de asepsie
şi antisepsie depline, iar probele se trimit la laborator în recipiente sterile (cele pentru
cultură) sau conţinând fixator Bouin (cele pentru diagnostic histopatologic).

1.18. Fragmentele tisulare biopsice

Se recoltează în timpul intervenţiilor chirurgicale şi se transportă învelite în
tifon steril umectat cu ser fiziologic, în containere sterile. Timp maxim de aşteptare: 15
minute la temperatura camerei. Fragmentele de ţesut suspectate a proveni dintr-un
focar de zygomicoză nu se mojarează, nu se triturează, deoarece se distruge miceliul şi
creşte enorm riscul de a obţine culturi negative.


Tehnici de recoltare, transport şi procesare primară a prelevatelor clinice


16
1.19. Tehnica aspiraţiei cu ac fin

Aspiraţia cu ac fin (AAF) este utilă pentru diagnosticul leziunilor care sunt
uşor palpabile, cum ar fi excrescenţele pielii, leziunile deformante ale ţesutului
subcutanat, tiroidă, limfonoduri, glande salivare şi sâni. Aspiraţia ghidată prin tehnici
imagistice cum ar fi computer-tomografia sau ultrasonografia permite obţinerea de
probe şi în cazul leziunilor organelor interne ca pulmonul, organele abdominale şi
retroperitoneale, prostata etc. Riscul scăzut al complicaţiilor permite executarea ei în
ambulatoriu. AAF este indicată şi la pacienţii debilitaţi, cu leziuni multiple, fiind o
tehnică minim invazivă.
Acele pentru puncţie vor avea un calibru standard de 22-24 G şi lungime de
2,5-4 cm. Lungimea şi calibrul acului trebuie să fie adecvate mărimii, profunzimii,
zonei şi consistenţei „ţintei”. Pentru leziunile subcutanate mici, acele de calibru 23G şi
lungime de 2,5 cm sunt ideale, deşi în leziunile profunde sunt necesare ace mai lungi şi
cu diametru mai mare. Acele fine sunt de asemenea recomandate pentru copii, şi pentru
organele vascularizate, cum ar fi tiroida.
Seringile recomandate în această tehnică sunt cele single-use, cu volum util de
10 ml. Seringile trebuie să fie de calitate, capabile să producă o presiune negativă
adecvată aspirării. Seringile cu capacitate de 5 ml pot fi utilizate pentru organele
vascularizate precum tiroida. Un factor important este adaptarea etanşă a acului la
capătul seringii. O potrivire neglijentă a acestuia poate compromite procedura.
Manipularea pistonului seringii se realizează cu o mână, iar cu cealaltă se fixează
leziunea.

Tehnica aspiraţiei

Înaintea executării aspiraţiei trebuie urmate etapele:
1. Efectuarea unei anamneze riguroase şi a unui examen clinic detaliat, cu
revederea rezultatelor radiologice şi stabilirea diagnosticul prezumtiv. Trasarea
cu ajutorul unui marker a zonei corporale în care se va executa aspiraţia;
2. Leziunea ce urmează să fie aspirată este palpată şi fixată pentru a aprecia
punctul optim de abordare. Se va alege în consecinţă acul cel mai adecvat;
3. Procedura trebuie să fie clar explicată pacientului şi consimţită de acesta.
Pacientul poate prezenta o stare de anxietate, fiind necesară o premedicaţie cu
tranchilizante. Pielea se dezinfectează ferm cu un tampon de vată îmbibat în
soluţie iodată. Anestezia locală este uneori necesară;
4. Înainte de începerea procedurii, ne vom asigura că tot echipamentul necesar,
instrumentarul şi accesoriile sunt disponibile;
5. Poziţionarea pacientului: orice poziţie poate fi aleasă, ţinându-se bineînţeles cont
de confortul pacientului şi asigurarea căii de abord. AAF este de obicei
executată cu pacientul aşezat în decubit dorsal pe un pat de examinare;
6. Imobilizarea leziunii: leziunea este fixată între policele şi indexul mâinii stângi,
cu pielea uşor tensionată. Se încearcă evitarea interpunerii maselor musculare
importante;
7. Penetrarea leziunii: se puncţionează leziunea printr-o mişcare atentă şi rapidă,
unghiul şi profunzimea penetrării variind după caz. Pentru formaţiunile mici,
Maria Dan, Bogdan Doroftei, Petru Cazacu, Magdalena Mareş, Mihai Mareş


17
C
a
p
i
t
o
l
u
l
 
1
 
este indicată aspiraţia din zona centrală . Pentru formaţiunile mai mari, care pot
avea necroze, modificări chistice sau hemoragice centrale, aspiraţia poate fi
executată şi de la periferie. Dacă se aspiră numai puroi sau material necrotic
din leziunile mari, AAF poate fi repetată imediat, de la periferie. Dacă acul se
plasează tangenţial în cazul unei formaţiuni mici sau dacă penetrează dincolo
de formaţiune, materialul nu va putea fi recoltat.
Notă: Dacă suprafaţa zonei de execuţie a AAF este localizată lângă cutia toracică
(formaţiuni nodulare axilare sau supraclaviculare), aspiraţia se va executa într-un
plan paralel faţă de cutia toracică pentru a evita penumotoraxul. În AAF la nivelul
tiroidei, pacientul trebuie instruit să nu înghită sau să vorbească când acul este plasat
în interiorul formaţiunii.
8. Crearea vacuumului şi obţinerea materialului biologic: aspiraţia este executată
după pătrunderea în leziune şi se menţine în timp ce acul este acţionat viguros
prin multiple mişcări de ,,du-te - vino”, în câteva direcţii diferite dar
convergente. Întreaga procedură trebuie să dureze maxim 6-8 secunde. Nu se
roteşte acul şi nici nu se fac mişcări de pompare a pistonului seringii (înăuntru-
înafară). Rezultatul aspiraţiei este extragerea de fragmente de ţesut şi celule
dislocate de bizoul acului.
9. Eliberarea vacuumului şi retragerea acului: când materialul biologic este
observat la baza acului, procedura se întrerupe. Înaintea retragerii acului, se
eliberează din tensiune pistonul seringii, apoi acul se scoate din formaţiune,
drept, fără al înclina. Pistonul revine singur, încet (fără a fi împins). O eliberare
insuficientă a presiunii negative în interiorul formaţiunii va cauza aspirarea
materialului biologic la intrarea în seringă, ceea ce-l va face dificil de
recuperat. În situaţii excepţionale, seringa şi acul pot fi clătite cu ser fiziologic
sau fixator care apoi se va centrifuga pentru a prepara un frotiu. Imediat după
retragerea acului, pe zona puncţionată se aplică un tampon îmbibat cu
dezinfectant şi se presează câteva minute, de preferat de către un asistent.
Aceasta se realizează cu scopul de a preveni formarea unui hematom în zonele
intens vascularizate.
















Tehnici de recoltare, transport şi procesare primară a prelevatelor clinice


18
Bibliografie selectivă

1. Artal M E (2004) - Diagnóstico histopatológico de las micosis; Rev
Iberoam Micol; 21:1-9.
2. Bates D W, Cook E F, Goldman L, et al. (1990) - Predicting bacteremia in
hospitalized patients: a prospectively validated model; Ann Intern Med;
113:495-500.
3. Brouqui P, Raoult D (2001) - Endocarditis Due to Rare and Fastidious
Bacteria; Clin Microbiol Rev; 24(1): 177-207.
4. Buiuc D, Neguţ M (1999) - Tratat de microbiologie clinică; Ed. Medicală;
Bucureşti.
5. Cicalese L (1999) - Bacterial translocation in intestinal transplant
recipients; Transplantation; 67(9): S589.
6. Darby J M, Linden P, Pasculle W, et al. (1997) - Utilization and diagnostic
yield of blood cultures in a surgical intensive care unit; Crit Care Med;
25:989-994.
7. Debelian G J (1998) - Anaerobic bacteremia and fungemia in patients
undergoing endodontic therapy: an overview; Ann Periodontol; 3(1):281-
287.
8. Doern G V (1994) - Manual blood culture systems and the antimicrobial
removal device; Clin Lab Med; 14:133-147.
9. Edgeworth J D, Treacher D F, Eykyn S J (1999) - A 25-year study of
nosocomial bacteremia in an adult intensive care unit; Crit Care Med;
27:1421-1428.
10. Golăescu M (1997) - Diagnosticul şi tratamentul micozelor interne; Ed.
Viaţa Medicală Românească; Bucureşti.
11. Grillot R (1996) - Les mycoses humaines - démarche diagnostique;
Elsevier; Paris.
12. Hampton J R, Harrison M J G (1964) - Sterile blood cultures in bacterial
endocarditis; QJ Med; 36:167-174.
13. Harlod C N (1986) - Cost Effective Blood Cultures - Is It Possible or
Impossible to Modify Behavior? Infection Control; 7(1):32-33.
14. Hoog G S de, Guarro J, Gené J, Figueras M J (2000) - Atlas of clinical
fungi; 2
nd
edition; Centraalbureau voor Schimmelcultures / Universitat
Rovira i Virgili.
15. Jaimes F, Arango C, Ruiz G et al (2004) - Predicting Bacteremia at the
Bedside; Clinical Infectious Diseases; 38:357-362.
16. Lichtman Steven M (2001) - Baterial Translocation in Humans; Journal
of Pediatric Gastroenterology & Nutrition; 33(1):1-10.
17. Lionaskis M S (2004) - The significance of blood cultures positive for
emerging saprophytic moulds in cancer pacients; Clin Microb Infect; 10
(10):922-926.
18. Maoxin W, David E B (2004) - Fine Needle Aspiration, Cancer
Investigation; 22(4).
19. Peţeanu V, Peţeanu V, Baltă M (1997) - Examene şi investigaţii în
ginecologie şi obstetrică; Ed. Ex Ponto, Bucureşti.
Maria Dan, Bogdan Doroftei, Petru Cazacu, Magdalena Mareş, Mihai Mareş


19
C
a
p
i
t
o
l
u
l
 
1
 
20. Richardson M D, Warnock D W (2003) - Fungal infection - Diagnosis
and Management; Blackwell Publishing.
21. Ronveaux O, Jans B, Suetens C, Carasauw H (1998) - Epidemiology of
Bloodstream infections in Belgium 1992-1996; Eur J Clin Infect Dis; 17:
695-700.
22. Sutton D A (2003) - Specimen collection, transport, and processing:
Mycology; In Murray P R et al. (eds.); Manual of clinical microbiology;
8
th
edition; ASM Press; Washington D C; 2:1659-1667.
23. Varghese C, Venkataraman K, Bhagwat S et al. (2005) - Manual for
Cytology; Directorate General of Health Services Ministry of Health and
Family Welfare, India.
24. Warran D, Zack J, Elward A, Cox M, Fraser V (2001) - Nosocomial
primary bloodstream infections in intensive care unit patients in a
nonteaching community medical center: a 21-month prospective study;
Clin Infect Dis; 33:1329-1335.
25. Wingard J R (1999) - Fungal infections after bone marrow transplant; Biol
Blood Marrow Transplant; 5(2):55-68.







Mihai Mareş, Bogdan Doroftei, Petru Cazacu, Maria Dan


21
C
a
p
i
t
o
l
u
l
 
2
 




Mihai Mareş, Bogdan Doroftei, Petru Cazacu, Maria Dan

xamenul microscopic direct al produselor patologice recent recoltate poate
orienta diagnosticul către o infecţie fungică şi uneori poate chiar oferi
indicii importante privind etiologia acesteia prin evidenţierea unor formaţiuni sau
elemente caracteristice. El este obligatoriu pentru orice tip de prelevat cu excepţia
sângelui şi are valoare diagnostică intrinsecă deoarece permite confirmarea rapidă a
suspiciunii de infecţie micotică şi informarea timpurie a clinicianului, cu mult timp
înainte de pozitivarea culturii. Se efectuează pe prelevate în stare proaspătă, cu sau fără
colorare prealabilă (calcofluor, Giemsa etc.): lavaj bronhoalveolar (după centrifugare),
biopsii (frotiuri prin amprentă), spută (după tratare cu N-acetil-cisteină), hemoculturi,
prelevate superficiale – cutanate, sinusale, conjunctivale, unghiale, auriculare.

Produsele patologice pentru care există suspiciunea că ar conţine fungi se pot
examina microscopic prin una dintre următoarele forme:
- preparat extemporaneu între lamă şi lamelă, cu soluţie 20% KOH (scuame,
fragmente unghiale, secreţii linguale, vaginale); sensibilitatea metodei este
relativ scăzută, depinzând de abilitatea şi experienţa anterioară a
examinatorului. În acest scop, se omogenizează pe o lamă de microscopie
volume egale din materialul patologic şi soluţia clarificantă, după care se
acoperă cu o lamelă, astfel încât să se evite formarea bulelor de aer. Decelarea
formaţiunilor fungice în prelevate este mult ameliorată dacă la soluţia
clarificantă se adaugă un colorant – negru clorazol, cerneală Parker sau o
substanţă fluorescentă cu afinitate pentru glicanul din peretele fungilor
(Blankophor, Calcofluor – în proporţie de 0,1%). Utilizarea substanţelor
fluorescente incumbă examinarea preparatului la un microscop cu fluorescenţă.
- preparat extemporaneu cu soluţie 20% KOH + substanţă fluorescentă sau frotiu
colorat cu aceeaşi substanţă fluorescentă (Calcofluor, Blankophor etc.); este
metoda optimă de detecţie a fungilor în prelevate datorită unei sensibilităţi şi
specificităţi excelente, dar necesită microscopie în lumină ultravioletă (fig. nr.
2-1 vezi Anexa). Câteva fragmente din prelevatul recoltat de la pacient se
depun pe o lamă de sticlă, într-o picătură de lichid clarificant (soluţie 10-20%
KOH cu adaos de calcofluor 0,1%) care prin „digerarea” keratinei şi a celulelor
somatice va permite observarea la microscop a diverselor formaţiuni
E
2
Tehnici de microscopie directă
Tehnici de microscopie directă


22
caracteristice fungilor. După un contact de cca. 10-15 minute (eventual mai
îndelungat în cazul fragmentelor unghiale), lama se acoperă cu o lamelă şi se
examinează la microscop, cu obiectivele 10, 20 şi 40, după caz. Acţiunea
lichidului clarificant poate fi intensificată prin încălzirea lamei la flacăra unui
bec de gaz, fără însă a-l aduce la fierbere. În general, lama se poate examina
când opacitatea preparatului s-a diminuat vizibil.
- frotiu colorat Gram: pune cu uşurinţă în evidenţă filamentele, pseudohifele,
artrosporii şi blastosporii de dimensiuni mari, însă este inadecvată pentru
detecţia celulelor levurice de dimensiuni mici – de exemplu, Candida glabrata
(fig. nr. 2-2 vezi Anexa)
- frotiu pregătit pentru imunofluorescenţă prin tratare cu anticorpi monoclonali
cuplaţi cu markeri fluorescenţi (în special pentru detecţia Pneumocystis
jiroveci în prelevatele respiratorii)
- preparat extemporaneu colorat cu tuş de India: pune în evidenţă levurile capsulate
din genul Cryptococcus, în sedimentul LCR, urinar, etc. (fig. nr. 2-3 vezi
Anexa)
- frotiu colorat May-Grunwald-Giemsa: metodă de rutină pentru depistarea
levurilor intracelulare de tip Histoplasma, dar poate fi utilizată şi pentru
detectarea levurilor prin microscopie directă (fig. nr. 2-4 vezi Anexa)
- frotiu necolorat sau colorat cu albastru de metilen 3%: metoda se poate folosi
pentru detectarea levurilor din hemoculturi, însă alte tehnici cu specificitate
mai ridicată sunt recomandate (fig. nr. 2-5 vezi Anexa)
- preparat extemporaneu cu bandă adezivă, colorat cu albastru de metilen în
lactofenol: metodă expeditivă de diagnostic tip „one-step” a leziunilor de
Pityriazis versicolor (fig. nr. 2-6 vezi Anexa)
- frotiuri obţinute prin etalare sau amprentă (pornind de la prelevate ca aspiratul
bronşic, LBA sau biopsiile) care apoi se colorează Musto sau cu calcofluor şi
se examinează în vederea decelării aspectelor particulare care ar pleda pentru o
zygomicoză, aspergiloză etc.

Elementele morfologice identificabile prin examen microscopic direct sunt
levurile (burjeonate sau nu, intra- sau extracelulare, cu sau fără capsulă), fragmentele
hifale, septate sau nu, uneori ramificate, celulele fumagoide - celule cu aspect
muriform, melanizate, de 4-12 µm diametru, septate longitudinal şi transversal,
granulele (numite şi scleroţi - elemente sferice, dure, de cca. 1 mm diametru, formate la
nivelul micetoamelor prin întreţeserea densă a hifelor), rar structurile de fructificare ale
unor fungi filamentoşi.

2.1. Coloraţia negativă cu tuş de India

Scop
Se recomandă pentru decelarea levurilor aparţinând speciei C. neoformans în
sedimentul unor fluide biologice (LCR, urină, etc.).

Echipamente
Lame şi lamele de microscopie, mănuşi de unică folosinţă, pipete
Mihai Mareş, Bogdan Doroftei, Petru Cazacu, Maria Dan


23
C
a
p
i
t
o
l
u
l
 
2
 

Reactivi
Tuş de India sau tip Parker

Mod de lucru
1. Pe o lamă de sticlă degresată se depun şi se amestecă o picătură din sedimentul
probei de analizat şi o picătură tuş de India;
2. Se acoperă cu o lamelă de sticlă evitând formarea bulelor de aer;
3. Preparatul extemporaneu astfel obţinut se examinează la microscop
(x100, x400).

Rezultatul colorării
Cryptococcus neoformans se prezintă sub formă de celule levurice rotunde,
înmugurite sau nu, înconjurate de un halou clar, necolorat, facil de vizualizat pe fondul
maron-negru al preparatului. Datorită necolorării capsulei polizaharidice, metoda mai
poartă denumirea de “coloraţia negativă cu tuş de India”.

2.2. Coloraţia negativă cu mercurochrom 2% şi tuş de India

Scop
Reprezintă o variantă îmbunătăţită a metodei anterioare, permiţând
vizualizarea a trei zone în componenţa capsulei şi a unor corpusculi în interiorul
celulelor levurice la C. neoformans, ceea ce creşte considerabil specificitatea
examenului microscopic direct.

Echipamente
Lame şi lamele de microscopie, mănuşi de unică folosinţă, pipete

Reactivi
Soluţie 2% mercurochrom (C
20
H
8
Br
2
HgNa
2
O
6
– sarea disodică a 2,7-dibrom-4-
(hidroxomercurio)-fluoresceinei)
Tuş India (sau tuş negru tip Parker)

Mod de lucru
1. Pe o lamă de sticlă degresată se depun succesiv şi se omogenizează o picătură
din sedimentul probei de analizat, o picătură sol. 2% mercurochrom şi o
picătură tuş de India;
2. Se acoperă cu o lamelă;
3. Se examinează la microscop (x100, x400, x1000).

Rezultatul colorării
Cryptococcus neoformans se prezintă sub formă de celule levurice rotunde,
înmugurite sau nu, înconjurate de o capsulă clară, formată din 3 zone concentrice; în
interiorul celulelor levurice sunt adesea observabili corpusculi de formă rotundă.


Tehnici de microscopie directă


24
2.3. Coloraţia cu lactofenol şi albastru de anilină (Lactophenol Cotton Blue)

Scop
Metodă destinată colorării şi evidenţierii prin microscopie a fungilor din unele
prelevate clinice şi culturi.

Echipamente
Lame şi lamele de microscopie, curate şi degresate, ansă de însămânţare,
mănuşi de protecţie, pahar Berzelius, pâlnie, hârtie de filtru, agitator magnetic.

Reactivi

Lactofenol cu albastru de anilină

Albastru de anilină ......................................... 0,05 g
Fenol, cristale .............................................. 20,00 g
Glicerol ...................................................... 40,00 ml
Acid lactic .................................................. 20,00 ml
Apă distilată ............................................... 20,00 ml

Prepararea acestei soluţii durează cca. două zile:
1. În prima zi, se dizolvă albastrul de anilină în apa distilată. Se lasă peste noapte
pentru decantarea colorantului insolubil;
2. AIIa zi, purtând mănuşi de protecţie, se adaugă cristalele de fenol în acidul
lactic, într-un pahar Berzelius. Se omogenizează apoi folosind un agitator
magnetic până la dizolvarea completă a fenolului;
3. Se adaugă glicerolul;
4. Se filtrează soluţia de albastrul de anilină şi se adaugă în soluţia de fenol /
glicerol / acid lactic. Se amestecă şi se păstrează la temperatura camerei în
flacoane cu dop picurător.

Mod de lucru
1. Se etalează pe o lamă o cantitate suficientă de probă;
2. Se adaugă 1-2 picături soluţie de lactofenol şi albastru de anilină;
3. Se omogenizează uşor;
4. Se acoperă cu o lamelă şi se examinează la microscop.

Rezultatul colorării
Fungii – albastru-închis

Notă:
Soluţia de lactofenol şi albastru de anilină este disponibilă comercial: Merck, Remel,
Becton-Dickinson (Lactophenol blue solution)



Mihai Mareş, Bogdan Doroftei, Petru Cazacu, Maria Dan


25
C
a
p
i
t
o
l
u
l
 
2
 
2.4. Coloraţia cu hidroxid de potasiu şi cerneală Parker

Scop
Evidenţierea elementelor fungice în raclatele tegumentare, păr şi fragmente
unghiale, prin examen microscopic direct.

Echipamente
Lame şi lamele de microscopie, curate şi degresate, ansă de însămânţare, pensă

Reactivi

Hidroxid de potasiu .......................................... 10 g
Glicerol ........................................................... 10 ml
Cerneală Parker Quink Permanent Blue ......... 10 ml
Apă distilată .................................................... 80 ml

Se dizolvă KOH în apă, apoi se adaugă glicerol şi cerneala Parker. Glicerolul
previne cristalizarea reactivului şi deshidratarea probei.

Mod de lucru
1. Se utilizează o ansă de însămânţare sau pensă pentru îndepărtarea unei mici
porţiuni din proba de ţesut, în special din zonele necrotice sau purulente.
Aceasta se etalează într-o picătură de colorant, pe o lamă de microscopie;
2. Se acoperă cu o lamelă şi apoi se comprimă preparatul cu ajutorul capătului unei
anse de însămânţare pentru îndepărtarea excesului de fluid. Se încălzeşte uşor
preparatul prin trecerea acestuia de 2-3 ori prin flacără, evitându-se fierberea;
3. După clarificarea preparatelor (15-20 minute pentru raclatele pielii şi câteva ore
pentru raclatele unghiale), acestea se vor examina la microscop (x10, x20, x40)
pentru punerea în evidenţă a elementelor fungice.

Rezultatul colorării
Elementele fungice apar colorate în albastru pal.

Notă:
1. Această tehnică este frecvent utilizată, dar timpul necesar pentru clarificarea şi colorarea
completă poate fi mai îndelungat. Preparatele se pot păstra până când rezultatele culturii
sunt cunoscute.
2. Probele negative la prima citire trebuie păstrate şi reexaminate în ziua următoare pentru a
evita raportarea unor rezultate fals negative, datorită întârzierii clarificării şi colorării
probei.

2.5. Clarificarea cu hidroxid de potasiu şi dimetil sulfoxid

Scop
Evidenţierea elementelor fungice prin examenul microscopic direct al
raclatelor tegumentare, păr şi unghii (în special detecţia dermatofitozelor).

Tehnici de microscopie directă


26
Echipamente
Lame şi lamele de microscopie, curate şi degresate, ansă de însămânţare, pensă

Reactivi

Dimetil sulfoxid (DMSO) ............................... 40 ml
Apă distilată .................................................... 60 ml
Hidroxid de potasiu .......................................... 10 g

Se adaugă dimetil sulfoxidul în apa distilată şi apoi se dizolvă KOH în soluţia
respectivă.

Mod de lucru
1. Se utilizează o ansă de însămânţare sau o pensă pentru recoltarea unei mici
porţiuni din prelevat. Aceasta se etalează apoi într-o picătură de KOH-DMSO
pe o lamă de microscopie;
2. Se acoperă cu o lamelă, se comprimă uşor preparatul cu ajutorul capătului unei
anse de însămânţare şi apoi se îndepărtează excesul de fluid. Preparatul nu se
încălzeşte;
3. Se examinează la microscop, cu diafragma semideschisă pentu a surprinde mai
uşor elementele fungice refringente, necolorate.

Note:
1. DMSO permite o macerare şi o clarificare mult mai rapide decât hidroxidul de potasiu
singur.
2. Preparatele nu se vor păstra după examinare.

2.6. Coloraţia cu calcofluor alb şi KOH 10%

Scop
Evidenţierea elementelor fungice din diverse prelevate, prin microscopie cu
fluorescenţă.

Echipamente
Lame şi lamele de microscopie, curate şi degresate, ansă de însămânţare,
pensă.










Mihai Mareş, Bogdan Doroftei, Petru Cazacu, Maria Dan


27
C
a
p
i
t
o
l
u
l
 
2
 

Reactivi

Soluţia A

Hidroxid de potasiu .......................................... 10 g
Glicerol ........................................................... 10 ml
Apă distilată .................................................... 90 ml

Se dizolvă KOH în apă şi apoi se adaugă glicerolul.

Soluţie B

Calcofluor alb .................................................. 0,1 g
Apă distilată ............................................... 100,0 ml

Se dizolvă calcofluorul alb pulbere în apa distilată uşor încălzită.

Mod de lucru
1. Se amestecă o picătură din fiecare soluţie (A şi B) în centrul unei lame de
microscopie;
2. Se etalează proba de ţesut în soluţie şi apoi se acoperă cu o lamelă, comprimând
preparatul cu capătul unei anse de însămânţare. Excesul de lichid se elimină;
3. Alternativ, în funcţie de natura prelevatului se pot obţine şi frotiuri prin
amprentă sau ştergere, care se tratează apoi cu soluţiile reunite menţionate;
4. Se încălzeşte uşor lama şi se examinează la microscopul cu fluorescenţă echipat
cu filtre adecvate.

Rezultatul colorării
Elementele fungice prezente în preparat vor apare colorate în albastru
fluorescent sau verde-deschis, în funcţie de filtrele utilizate.

Note:
1. Este o metodă expeditivă şi sensibilă, totuşi este necesar ca microscopul cu fluorescenţa să
fie dotat cu filtre care să determine o sensibilizare la lumina ultravioletă, cu o lungime de
undă joasă, de cca. 400 nm.
2. Calcofluorul alb (M2R pulbere - Polysciences sau Blankophor BA - Bayer) este utilizat ca
agent de albire în industria hârtiei, legându-se selectiv de celuloză şi chitină. Este un
colorant fluorescent pentru fungi.







Tehnici de microscopie directă


28
2.7. Coloraţia Gram
*


Scop
Identificarea fungilor prin examenul microscopic al frotiurilor executate din
diverse lichide biologice.

Fixator
Metanol absolut

Echipamente
Lame de sticlă pentru microscopie (25/75 mm) cu un capăt mat, pipete Pasteur,
anse de însămâţare microbiologică, ace de inoculare, recipiente pentru depozitarea de
deşeuri biologice
Materiale opţionale, depinzând de sursa probelor şi de protocolul laboratorului:
a) plită încălzitoare, 60ºC;
b) centrifugă;
c) agitator tip Vortex;
d) tuburi sterile cu dop filetat;
e) foarfece sterile, bisturie, pense.

Reactivi

Soluţia de cristal violet

Cristal violet ....................................................... 2 g
Etanol 95% ..................................................... 20 ml
Oxalat de amoniu ............................................. 0,8 g
Apă distilată .................................................... 80 ml

Se dizolvă cristalul violet în etanol şi oxalatul de amoniu în apă. Se lasă soluţia
de oxalat de amoniu peste noapte pentru solubilizare completă sau se încălzeşte uşor
până la dizolvare. Se amestecă cele două soluţii şi apoi se filtrează.

Soluţia iod-iodurată Gram (soluţia Lugol)

Iod ....................................................................... 1 g
Iodură de potasiu ................................................ 2 g
Apă distilată .................................................. 275 ml

Se adaugă iodul peste iodura de potasiu, în aproximativ 25 ml apă distilată.
Când solubilizarea este completă se adaugă restul de apă.
Atenţie! Iodul este coroziv. Se evită inhalarea, ingestia sau contactul cu pielea.



*
vezi coloraţia Gram-calcofluor alb
Mihai Mareş, Bogdan Doroftei, Petru Cazacu, Maria Dan


29
C
a
p
i
t
o
l
u
l
 
2
 
Soluţia de alcool-acetonă

Etanol 95% ................................................... 100 ml
Acetonă ......................................................... 100 ml

Se omogenizează şi se păstrează într-un recipient brun, etichetat cu data
preparării, la temperatura camerei. Soluţia este stabilă 1 an.
Atenţie! Etanolul şi acetona sunt inflamabile.
Safranină O 0,4 %

Safranină O ......................................................... 1 g
Apă distilată .................................................. 250 ml

Mod de lucru
1. Frotiurile pot fi fixate prin încălzire sau cu metanol;
2. Frotiurile se pot usca în aer sau se menţin pe o platină încălzitoare electrică, la
60ºC, până la uscare:
3. Dacă frotiurile sunt uscate în aer se vor trece de două sau trei ori printr-o flacără.
Pentru a evita denaturarea frotiului, acesta nu se supraîncălzeşte.
4. Se lasă lama să se răcescă înainte de colorare;
5. Fixarea cu metanol previne liza eritrocitelor. De asemenea, fixarea cu metanol
este recomandată pentru toate prelevatele clinice lichide, în special pentru
urină, deoarece previne spălarea probelor în timpul colorării. Metanolul se
stochează în sticle brune cu dop etanş. O cantitate de lucru poate fi păstrată în
recipienţi de plastic, dacă aceasta se înlocuieşte la fiecare 2 săptămâni. Pentru
fixare, se adaugă câteva picături de metanol pe lamă, se lasă în contact timp de
1 minut, apoi se varsă şi se lasă lama să se usuce la aer;
6. Se inundă frotiul astfel fixat, cu soluţie de cristal violet. Se lasă în contact 60
secunde;
7. Se varsă soluţia de cristal violet şi se clăteşte lama uşor cu apă de robinet.
Atenţie! Clătirea excesivă poate determina îndepărtarea cristalului violet din
celulele gram-pozitive. Apa se varsă pe unul din capetele lamei, oblic, pentru a
asigura o curgere lentă peste frotiu.
8. Se clăteşte apoi cu soluţie Lugol, timp de 3 secunde;
9. Se inundă frotiul cu soluţie Lugol şi se lasă în contact 30 secunde;
10. Se spală cu apă de robinet;
11. Se toarnă soluţie alcool-acetonă peste frotiu, într-un capăt al lamei, oblic, până
când soluţia care se scurge la capatul opus devine clară. Timpul de decolorare
variază în funcţie de grosimea frotiului (în general 8-10 secunde);
12. Se spală cu apă de robinet;
13. Se inundă lama cu soluţie de safranină 0,4 %, timp de 30 secunde;
14. Se îndepărtează colorantul (safranină 0,4%) cu un jet de apă de robinet ;
15. Se usucă lama în aer, în poziţie verticală, iar apoi se şterge reversul acesteia cu
un şerveţel îmbibat în alcool sau acetonă.


Tehnici de microscopie directă


30
Rezultatul colorării
Fungii sunt Gram-pozitivi, deci se vor colora în violet.

Note:
1.Dacă soluţia de cristal violet prezintă precipitat sau sediment, se refiltrează înainte de
utilizare. Unii coloranţi, în special safranina, se pot contamina. Când se suspectează
acest lucru, se înlocuiesc.
2. Evaporarea poate altera eficacitatea reactivilor; soluţiile de lucru trebuie schimbate
regulat.
3. Zilnic sau când se foloseşte un nou lot de reactivi se realizează controlul de calitate prin
executarea unui frotiu din Escherichia coli (ATCC 25922) şi Staphylococcus
epidermidis (ATCC 12228) sau Staphylococcus aureus (ATCC 25923). Acesta se
fixează şi se colorează după tehnica descrisă mai sus. Rezultatele colorării frotiului de
control:
a) coco-bacili Gram-negativi: roz;
b) coci Gram-pozitivi: violet intens.
4. Câteva dintre cauzele cele mai frecvente care duc la obţinerea unor rezultate
nesatisfăcătoare ale coloraţiei Gram:
a) utilizarea unor lame de microscopie insuficient degresate. Pentru acest lucru, se
păstrează lamele într-un pahar cu etanol 95%. Excesul de alcool se
îndepărtează prin ştergerea sau flambarea lamelor înainte de utilizare;
b) executarea unor frotiuri prea groase;
c) supraîncălzirea frotiului când acesta este fixat prin căldură;
d) spălarea excesivă pe durata procedurii de colorare.

2.8. Coloraţia Gram - calcofluor alb

Scop
Uneori, fungii nu se pot distinge cu acurateţe în frotiurile colorate Gram sau
pot rămâne mascaţi de alte materiale din probă. În această situaţie, calcofluorul alb
poate fi utilizat pentru supracolorarea frotiurilor colorate Gram în vederea unei mai
bune evidenţieri a elementelor fungice.

Echipamente
Lame şi lamele pentru microscopie, hârtie de filtru, beţişoare din lemn,
microscop cu fluorescenţă, sticlărie de laborator

Reactivi

Xilen
Metanol absolut
Soluţie de hidroxid de potasiu 10 sau 20%
Calcofluor alb

Mod de lucru
1. Se colorează frotiul prin tehnica de colorare Gram;
2. Se aplică peste frotiul colorat Gram un fragment de hârtie absorbantă, pentru a-l
usca;
Mihai Mareş, Bogdan Doroftei, Petru Cazacu, Maria Dan


31
C
a
p
i
t
o
l
u
l
 
2
 
3. Se inundă lama cu xilen pentru 1-2 ore, în funcţie de grosimea frotiului;
4. Se clătesc lamele în metanol absolut pentru a îndepărta resturile tisulare;
5. Se inundă lama cu soluţie KOH 10-20% pentru 1-2 ore, în funcţie de grosimea
frotiului;
6. Se îndepărtează KOH, se adaugă o picătură de calcofluor alb 0,1% şi se
omogenizează uşor cu un beţişor de lemn;
7. Se aplică apoi o lamelă prin presare uşoară. Preparatul se examinează la
microscopul cu fluorescenţă folosind filtre speciale (490-520 nm);
8. Elementele fungice care în prealabil nu sunt vizibile sau sunt neidentificabile în
frotiurile colorate Gram, pot fi distinse mai facil ca structuri fluorescente.

Notă:
Multe din prelevatele clinice trimise laboratoarelor de microbiologie pentru
examinare pot conţine şi elemente fungice, care de multe ori sunt nedetectate sau confundate.
De aceea este imperios necesară o instruire a personalului în vederea creşterii performanţelor
examenului microscopic direct şi în ceea ce priveşte detectarea elementelor fungice pe frotiuri
colorate Gram.

2.9. Coloraţia Giemsa

Scop
Evidenţierea trofozoiţilor şi a corpilor intrachiştici (nu şi a chiştilor) la
Pneumocystis carinii, prin examenul microscopic al frotiurilor executate din prelevate
respiratorii joase.

Fixator
Metanol absolut

Echipamente
Lame şi lamele pentru microscopie, curate şi degresate, sticlărie de laborator,
hârtie de filtru

Reactivi

Soluţia Giemsa stoc

Colorant Giemsa, pulbere ................................ 0,8 g
Glicerol ........................................................ 50,0 ml
Metanol absolut ........................................... 50,0 ml

Se dizolvă pulberea de colorant Giemsa în glicerol, apoi se încălzeşte soluţia
pe baie de apă până la 56°-60ºC, timp de 90-120 minute. Se adaugă metanolul, se
omogenizează şi se filtrează. Soluţia stoc se va păstra la temperatura camerei într-un
recipient închis.

Soluţie Giemsa de lucru
Soluţia stoc se diluează în proporţie de 1:50 cu soluţie de fosfat Sorensen.
Tehnici de microscopie directă


32

Soluţie fosfat Sorensen pH 6,4

Fosfat de potasiu monobazic ......................... 6,63 g
Fosfat de potasiu dibazic anhidru .................. 2,56 g
Apă distilată ................................................ 1000 ml

Mod de lucru
1. Se usucă frotiul în aer;
2. Se fixează cel puţin 30 secunde (uzual 3-4 minute) în metanol absolut;
3. Se îndepărtează metanolul prin înclinarea lamei sau prin scoaterea acesteia din
paharul cu fixator, apoi se usucă în aer;
4. Se introduc lamele complet uscate într-un pahar Berzelius sau se aşează
orizontal în suportul unei baterii de colorare care conţine soluţie Giemsa de
lucru, pentru 20-30 minute;
5. Se spală lama cu apă distilată;
6. Se şterge pe verso, apoi se usucă în aer;
7. Se montează sau nu, apoi se examinează la microscop. Înainte de montare,
lamela se introduce în xilen pentru a evita apariţia bulelor.

Rezultatul colorării
Trofozoiţii – apar de obicei în plaje, aglomeraţi, cu nucleul colorat în roşu-
violet şi citoplasma în gri.

Note:
1. Prelungirea imersiei în soluţia Giemsa diluată poate face ca materialul biologic de pe
lamă să se desprindă.
2. Colorantul Giemsa este disponibil comercial.


2.10. Coloraţia May-Grunwald-Giemsa (MGG)

Scop
Este o coloraţie de elecţie pentru depistarea intramacrofagică a formei levurice
aparţinând speciei Histoplasma capsulatum var. capsulatum.

Fixator
Metanol absolut

Echipamente
Lame şi lamele pentru microscopie, curate şi degresate, sticlărie de laborator,
hârtie de filtru




Mihai Mareş, Bogdan Doroftei, Petru Cazacu, Maria Dan


33
C
a
p
i
t
o
l
u
l
 
2
 
Reactivi

Soluţia de colorare I (May- Grünwald)

May-Grünwald pulbere ................................... 0,3 g
Metanol absolut ......................................... 100,0 ml

După preparare se păstrează într-un recipient etanş, la temperatura camerei
timp de 24 ore. Se filtrează înainte de utilizare.


Soluţia de colorare II (Giemsa)

Colorant Giemsa pulbere .................................... 1 g
Glicerol ........................................................... 66 ml
Metanol absolut .............................................. 66 ml

Colorantul Giemsa se dizolvă în glicerol şi apoi se încălzeşte la 56ºC timp de
90-120 minute. Se adaugă metanolul agitând pentru omogenizare. Soluţia finală se
păstrează la temperatura camerei într-un recipient închis. Se filtrează înainte de
utilizare.

Soluţia tampon Sörensen pH 6,8

Fosfat de sodiu dibazic .................................... 0,3 g
Fosfat de sodiu monobazic .............................. 0,7 g
Apă distilată ............................................... 100,0 ml

După preparare, soluţia se păstrează la frigider; este stabilă timp de 1 an.

Mod de lucru
1. Se fixează frotiurile în metanol absolut, timp de 30 secunde;
2. Se îndepărtează metanolul;
3. Se aplică soluţia de colorare I proaspăt diluată 1:1 cu soluţie tampon, timp de 5
minute (lama va fi poziţionată orizontal sau introdusă într-un pahar);
4. Se transferă lamele fără spălare prealabilă în soluţia de colorare II diluată recent
cu 9 părţi de soluţie tampon, pentru 10-15 minute;
5. Se imersează lamele în soluţie tampon pentru îndepărtarea colorantului;
6. Se spală lamele cu apă de robinet din abundenţă;
7. Se transferă într-un pahar cu apă pentru 2-5 minute;
8. Se usucă apoi într-o poziţie oblică. Nu se usucă prin ştergere;
9. Se poate monta o lamelă, însă nu este neapărat necesar.

Rezultatul colorării
Fungii – nuanţe de roz, albastru, violet

Tehnici de microscopie directă


34
Note:
1. Este important ca lamele să nu se usuce în timpul colorării, pentru a preveni apariţia
artefactelor sau formarea de precipitate.
2.Soluţia stoc May-Grunwald şi colorantul Giemsa sunt disponibile comercial

2.11. Coloraţia Wright

Scop
Evidenţierea formelor levurice la Histoplasma capsulatum var. capsulatum
prin examen microscopic al frotiurilor executate din sânge şi măduvă osoasă
hematogenă

Fixator
Metanol absolut

Echipamente
Lame şi lamele pentru microscopie, curate şi degresate, sticlărie de laborator,
hârtie de filtru

Reactivi

Soluţie de colorare (care poate fi achiziţionată ca soluţie gata preparată sau ca pulbere
din diverse surse comerciale)

Colorant Wright pulbere .................................. 0,3 g
Metanol absolut ......................................... 100,0 ml

După preparare, soluţia se menţine într-un recipient etanş la temperatura
camerei timp de 24 ore şi se filtrează înainte de utilizare.

Soluţie tampon Sorensen pH 6,4

KH
2
PO
4
anhidru ............................................ 6,63 g
Na
2
HPO
4
anhidru ........................................... 2,56 g
Apă distilată .......................................... ad 1000 ml.

Mod de lucru
1. Se usucă frotiul şi se fixează apoi cel puţin 30 secunde în metanol absolut;
2. Se îndepărtează metanolul prin înclinarea lamei;
3. Se aplică soluţia de colorare, timp de 2 minute, peste lama poziţionată orizontal,
numărând picăturile;
4. Se adaugă peste colorant aceeaşi cantitate din soluţia tampon. Se omogenizează
atent colorantul şi soluţia tampon fără a atinge suprafaţa filmului de lichid (va
apare o strălucire metalică la suprafaţa amestecului);
5. Se lasă amestecul în contact cu frotiul timp de 3 minute;
6. Se clăteşte lama cu apă distilată timp de 30 secunde;
Mihai Mareş, Bogdan Doroftei, Petru Cazacu, Maria Dan


35
C
a
p
i
t
o
l
u
l
 
2
 
7. Lamele se usucă în poziţie verticală. Nu se vor şterge;
8. Dacă se doreşte, frotiul se poate monta prin acoperire cu o lamelă.

Rezultatul colorării
Fungii – culoare violetă

2.12. Coloraţia cu mucicarmin Southgat

Scop
Coloraţia se utilizează pentru detectarea materialului capsular la Cryptococcus
neoformans


Echipamente
Lame şi lamele de microscopie, curate şi degresate, ansă de însămânţare,
pahare Berzelius, pâlnie de filtrare, hârtie de filtru, baie de apă

Reactivi

Roşu Carmin .................................................... 1,0 g
Hidroxid de aluminiu pulbere .......................... 1,0 g
Etanol 50% ................................................ 100,0 ml

După omogenizarea acestor substanţe, în soluţie se adaugă:

Clorură de aluminiu anhidră ............................ 0,5 g

Se fierbe pe baia de apă pentru 2-3 minute, apoi se lasă să se răcească. Se
completează până la volumul iniţial cu etanol 50% şi apoi se filtrează. Soluţia stoc este
stabilă câteva luni.

Hematoxilina Ehrlich
Vezi coloraţia hemalaun-eozină

Alcool acid 0,5%
Vezi coloraţia hemalaun-eozină

Mod de lucru
1. Se hidratează secţiunile sau se execută un frotiu (după caz);
2. Se colorează cu hematoxilină timp de 15 minute;
3. Se diferenţiază cu alcool-acid şi apoi se clătesc cu apă de robinet;
4. Se colorează pentru 30 minute în soluţia roşu carmin;
5. Clătire în apă distilată, deshidratare, clarificare şi montare.



Tehnici de microscopie directă


36
Rezultatul colorării
Mucicarminul colorează mucinele acide în roz (capsula va deveni astfel
colorată)

2.13. Coloraţia Musto

Scop
Punerea în evidenţă a elementelor fungice prin examenul microscopic al
frotiurilor

Echipamente
Lame şi lamele pentru microscopie, curate şi degresate, sticlărie de laborator,
plită electrică, vase din sticlă Pyrex

Reactivi

Metenamină - soluţie stoc

Metenamină 3 % ........................................... 100 ml
Azotat de argint 0,15 % .................................... 5 ml

În momentul adaugării soluţiei de metenamină peste soluţia de azotat de argint,
se va forma un precipitat alb, care va dispare prin agitarea paharului. Soluţia finală este
stabilă 3 luni şi se păstrează la 4ºC.
Atenţie! Corozivă, posibil carcinogenă.

Metenamină - soluţie de lucru

Borax 5% .......................................................... 2 ml
Apă distilată .................................................... 25 ml
Metenamină soluţie stoc ................................. 25 ml

Se adaugă soluţia de borax în apă distilată, apoi se omogenizează cu soluţia
stoc de metenamină. Se prepară extemporaneu.

Acid cromic 5%

Trioxid de crom .................................................. 5 g
Apă distilată .................................................. 100 ml

Soluţia se poate păstra 6 luni.
Atenţie! Acidul este coroziv, posibil carcinogen. Se vor evita contactul şi
inhalarea.



Mihai Mareş, Bogdan Doroftei, Petru Cazacu, Maria Dan


37
C
a
p
i
t
o
l
u
l
 
2
 
Borax 5%

Borat de sodiu .................................................. 5,0 g
Apă distilată .......................................... ad 100,0 ml

Soluţia este stabilă 3 luni.

Bisulfit de sodiu 1%

Bisulfit de sodiu .................................................. 2 g
Apă distilată ............................................. ad 200 ml

Se păstrează la 4ºC.

Clorură de aur 0,2%

Clorură de aur .................................................. 0,2 g
Apă distilată ............................................... 100,0 ml

Se păstrează la frigider în recipiente etanşe, riguros igienizate în prealabil.
Soluţia este stabilă 1 an.
Atenţie! Se evită contactul şi inhalarea.

Tiosulfat de sodiu 2 %

Tiosulfat de sodiu ............................................... 4 g
Apă distilată ............................................. ad 200 ml

Se păstrează la 4ºC.

Verde luminos 1%

Verde luminos SF yellow ................................... 1 g
Apă distilată ............................................. ad 100 ml
Acid acetic glacial .................................... 5 picături

După preparare se păstrează la frigider.
Atenţie! Se evită contactul şi inhalarea.

Mod de lucru
1. Fixarea: se încălzeşte acidul cromic 5% până la 65ºC pe o plită electrică şi apoi
se imersează imediat lamele timp de 1 minut;
2. Clătire de două ori în apă distilată ;
3. Se introduc preparatele în bisulfitul de sodiu, timp de 1 minut;
4. Se clătesc lamele în apă distilată
Tehnici de microscopie directă


38
5. Impregnarea argentică: soluţia de lucru se transferă într-un vas de sticlă Pyrex şi
apoi se imersează lamele. Se încălzeşte rapid la 90-95ºC timp de 2-3 minute:
soluţia îşi schimbă culoarea de la cenuşiu la negru, iar lamele devin maro;
6. Clătire de trei ori în apă distilată;
7. Lamele se introduc în clorură de aur 0,2% timp de 1 minut;
8. Clătire cu apă distilată;
9. Imersare în tiosulfat de sodiu, timp de 1 minut;
10. Clătire cu apă distilată;
11. Contra-colorarea cu verde luminos, timp de 1 minut;
12. Clătire cu apă de robinet, timp de 2 minute;
13. Deshidratare în etanol 95% câteva secunde, apoi în alcool absolut, de două ori
timp de câteva secunde;
14. Se introduc lamele în xilen sau metil-ciclohexan câteva secunde, pentru
clarificare;
15. Se montează lamele în Eurik.

Rezultatul colorării
Fungii – culoare brun-negriciosă
Fondul – verde

Notă:
1. Coloraţia Musto este versiunea rapidă a metodei Gomori-Grocott, utilizând tot
principiul impregnării argentice.
2. Soluţiile din bateria de colorare se reînnoiesc după 4 etape sau din 2 în 2 săptămâni.
3. Această metodă comportă în principal trei faze:
• fixarea cu acid cromic
• colorarea cu nitrat de argint - metenamină
• contra-colorare cu verde luminos
4. Oxidarea grupării hidroxil a polizaharidelor fungice parietale şi complexarea lor cu
reactivul argentic, determină coloraţia brun-negricioasă a fungilor pe un fond verde
al preparatului.
5. Această tehnică prezintă mai multe avantaje:
• reproductibilitate excelentă şi rapiditate (aproximativ 20 minute)
• costuri moderate
• posibilitatea de aplicare pentru o varietate largă de probe biologice, inclusiv
pentru prelevatele bronho-alveolare în investigarea pentru pneumocistoză
• simplitatea tehnicii şi uşurinţa cu care se detectează elementele fungice, chiar
dacă acestea sunt foarte rare
6. Pentru reuşita coloraţiei trebuie respectate trei condiţii esenţiale:
• indicaţiile tehnice
• folosirea unei lame-martor la fiecare serie de colorare
• reînnoirea regulată a reactivilor
7. Frotiurile sero-fibrinoase (lichid pleural, articular etc.) prezintă uneori inconvenientul
că se desprind de pe lamă în cursul colorării. Acest inconvenient nu poate fi remediat,
dar dacă frotiul nu s-a desprins în totalitate se poate recurge la o metodă de
examinare microscopică directă între lamă şi lamelă.


Mihai Mareş, Bogdan Doroftei, Petru Cazacu, Maria Dan


39
C
a
p
i
t
o
l
u
l
 
2
 
Bibliografie selectivă

1. Bridgman C P (1992) - Micoscopic Anatomy Laboratory Manual;
Washington University School of Medicine, St. Louis, Missouri.
2. Buiuc D, Neguţ M (1999) - Tratat de microbiologie clinică; Ed. Medicală;
Bucureşti.
3. Golăescu M (1997) - Diagnosticul şi tratamentul micozelor interne; Ed. Viaţa
Medicală Românească; Bucureşti.
4. Grillot R (1996) - Les mycoses humaines - démarche diagnostique; Ed.
Elsevier; Paris.
5. Hoog G S de, Guarro J, Gené J, Figueras M J (2000) - Atlas of clinical fungi;
2
nd
ed; Centraalbureau voor Schimmelcultures / Universitat Rovira i Virgili.
6. Houwen B (2000) - Blood Film Preparation and Staining Procedures;
Laboratory Hematology; Carden Jennings Publishing Co Ltd.
7. Richardson M D, Warnock D W (2003) - Fungal infection - Diagnosis and
Management; Blackwell Publishing.
8. Zerba R, HuiHuicho L, Guillen A (1996) - Modified India ink preparation for
C.neoformans in cerebrospinal fluid specimens; J Clin Microbiol; 34(9):2290-
2291.


Luminiţa Malic, Olimpia Bazgan, Mihai Mareş


41
C
a
p
i
t
o
l
u
l
 
3
 



Luminiţa Malic, Olimpia Bazgan, Mihai Mareş

3.1. Generalităţi

efinirea mediilor de cultură într-o manieră completă şi complexă, în
contextul varietăţii covârşitoare a entităţilor taxonomice microbiene şi a
exigenţelor nutritive extrem de diverse pe care acestea le reclamă în dezvoltarea lor,
este o încercare destul de dificilă pentru microbiologul practician. Acest demers
rămâne în domeniul speculativ, deoarece orice încercare în acest sens va tinde să
satisfacă mai curând legile semanticii decât rigorile practicii medicale.
Totuşi, putem defini mediile de cultură ca un complex de substanţe chimice
pure sau dimpotrivă, de substraturi organice şi minerale cu un grad mai redus de
puritate, care să ofere microorganismelor posibilitatea dezvoltării şi multiplicării,
imitând pe cât posibil condiţiile trofico-habituale din organismele gazdă sau din
biotopurile naturale specifice.
Izolarea în condiţii de laborator a fungilor din prelevatele patologice, indiferent
de natura lor, este o necesitate indiscutabilă pentru înţelegerea procesului morbid
infecţios şi pentru iniţierea terapiei etiotrope.
Diversitatea fungilor, ca bioentităţi cu potenţial patogen, justifică includerea în
mediile de cultură a unei game largi şi variate de nutrienţi care să asigure izolarea
şi/sau identificarea lor în condiţii optime. Au fost formulate astfel o multitudine de
medii de cultivare incluzând ingrediente cu grade diferite de specificitate, care să
corespundă dezideratelor de eficienţă, precizie şi expeditivitate din micologia clinică.
Investigarea particularităţilor biochimice ale fungilor, în special a profilului lor
enzimatic, a făcut posibilă în ultimul timp formularea unor medii de cultură mai
complexe, care permit identificarea mai facilă a acestor microorganisme din
prelevatele patologice. Astăzi, o adevărată industrie, susţinută de o intensă activitate de
cercetare, produce o gamă extrem de diversificată de substraturi nutritive şi medii de
cultivare, care oferă generoase posibilităţi de folosire în demersul diagnostic al bolilor
infecţioase induse de fungi.



D
3
Medii de cultivare
Medii de cultivare

42
3.2. Compoziţia mediilor de cultură

Particularităţile metabolice şi numărul apreciabil al fungilor incumbă folosirea
unor substraturi nutritive variate, făcând practic imposibilă obţinerea unui mediu
standard pentru toate speciile de interes medical. Unele formule (Sabouraud, Czapek,
PDA) permit totuşi dezvoltarea unui număr mare de entităţi taxonomice aparţinând mai
multor genuri.
În general, principalele componente ale mediilor de cultură sunt reprezentate
de substanţele nutritive, agenţii revelatori, factorii inhibitori, apa şi agenţii de
solidificare (în cazul mediilor solide).
Substanţele nutritive sau nutrienţii sunt reprezentate de o grupare pletorică de
substanţe chimice care sunt incluse în medii pentru a oferi fungilor: o sursă de carbon,
o sursă de azot şi promotori de creştere (substanţe minerale, vitamine, acizi graşi etc.).
Din punct de vedere al structurii chimice, nutrienţii pot fi:
• în cazul surselor de carbon:
1. monozaharide (glucoza sau dextroza, fructoza, manoza, galactoza, xiloza,
ramnoza, arabinoza)
2. di- şi oligozaharide (zaharoza sau sucroza, lactoza, maltoza, celobioza,
trehaloza, rafinoza)
3. polizaharide (amidon, glicogen, celuloză, chitină etc.)
4. acizi organici (tartric, citric, oxalic, malonic etc.)
5. lipide
• în cazul surselor de azot:
1. substanţe anorganice azotate (nitraţi, nitriţi, săruri de amoniu)
2. peptide şi proteine (peptonă, hidrolizat de cazeină, gelatină, cazeină,
keratină, ovalbumină)
3. aminoacizi (glicină, triptofan, glutamină, histidină ş.a.)
4. uree
• în cazul promotorilor de creştere:
1. substanţe minerale (sub formă de săruri care să conţină Na, K, Mg, Ca,
Fe, Cu, Zn, Co, P, S ş.a.)
2. vitamine (tiamină, acid nicotinic, inozitol etc.)
3. acizi graşi cu lanţ lung de atomi de carbon (C
12
-C
24
), necesari pentru
dezvoltarea levurilor lipodependente ale genului Malassezia.
Se recomandă ca în mediile de cultură solide destinate izolării fungilor,
raportul C:N să fie de 9-12:1. Factorii inhibitori sunt reprezentaţi de substanţe ce pot
supresa dezvoltarea unor categorii de microorganisme, mai ales a celor contaminante,
indezirabile în manoperele de izolare şi identificare a fungilor cu semnificaţie clinică.
Este vorba, în principal, de bacterii şi fungi saprobioţi, ubicuitari, care alături de fungii
patogeni sau condiţionat patogeni, compun în mod obişnuit microflora diverselor
prelevate recoltate din situsuri normal nesterile. Pentru anihilarea dezvoltării
bacteriilor, se recomandă înglobarea în mediile de cultură destinate izolării fungilor, a
unor substanţe din grupa antibioticelor (penicilină, streptomicină, cloramfenicol,
gentamicină, ciprofloxacin, tobramicină) sau a coloranţilor (cristal violet, Rose
Bengal).
Luminiţa Malic, Olimpia Bazgan, Mihai Mareş


43
C
a
p
i
t
o
l
u
l
 
3
 
Izolarea fungilor patogeni este favorizată de însămânţarea prelevatelor pe
medii solide ce conţin cicloheximidă, substanţă capabilă să inhibe parţial sau total
dezvoltarea fungilor contaminanţi.
Formularea unor medii diferenţiale, care să asigure o bună discriminare între
diferitele specii de fungi potenţial prezente în diverse prelevate, a presupus includerea
unor agenţi revelatori în compoziţia mediilor de cultură; în marea lor majoritate,
aceştia sunt substraturi ale diverselor enzime produse în special de micromiceţii
levuriformi, prin a căror scindare se formează compuşi fluorescenţi (identificabili în
lumina ultravioletă) sau compuşi caracterizaţi printr-o culoare specifică.
Primele medii diferenţiale cromogene, utilizate pentru identificarea prezumtivă
a diverselor specii de Candida, au fost mediul Nickerson şi mediul Pagano-Levin,
agenţii revelatori folosiţi fiind reprezentaţi de sulfitul de bismut, respectiv sărurile de
trifenil-tetrazoliu. Însă numărul redus de specii identificabile a determinat în timp
renunţarea la aceste medii şi înlocuirea lor cu altele mai performante, atât ca spectru de
microorganisme identificabile, cât şi ca grade de specificitate şi sensibilitate ale
metodei.
Paleta acestor medii diferenţiale este destul de largă, doar în cazul speciei
Candida albicans şi a altor câtorva levuri, fiind disponibile comercial nu mai puţin de
6 astfel de medii (tabelul 1-1). Ele conţin substratul fluorogen sau cromogen pentru
una sau două enzime (β-D-galactozaminidază şi/sau L-prolin-aminopeptidază),
permiţând chiar izolarea şi identificarea simultană, într-o singură etapă, a levurilor din
diverse prelevate, fără a fi necesară utilizarea suplimentară a altor medii.

3.3. Prepararea şi sterilizarea mediilor

Prepararea mediilor este o etapă extrem de importantă, care condiţionează
hotărâtor dezvoltarea, replicarea şi exprimarea fenotipică plenară a tuturor caracterelor
culturale ale fungilor. Calitatea ingredientelor, modul de solubilizare a acestora,
succesiunea adăugării lor, ajustarea pH-ului şi repartizarea mediilor în vederea
sterilizării pot reprezenta tot atâţia factori limitativi ai demersului diagnostic, dacă nu li
se acordă importanţa cuvenită.
În prezent, în laboratoarele de diagnostic microbiologic este cvasigeneralizată
prepararea mediilor de cultură prin hidratarea asocierilor complete de ingrediente
standardizate, condiţionate sub formă de pulbere, comercializate de diferite firme. Prin
utilizarea unor astfel de medii standardizate sunt eliminate inconvenientele legate de
procurarea unor ingrediente de calitate, iar rezultatele obţinute prin cultivarea fungilor
sunt reproductibile.
În general, mediile deshidratate sunt reconstituite prin solubilizarea unor
cantităţi precise de pulbere în apă distilată sau apă de robinet, de preferat încălzită la
70º-80ºC, urmată apoi de fierberea amestecului până la dizolvarea completă a tuturor
ingredientelor. În cazul mediilor ce conţin ingrediente care nu suportă încălzire la
temperaturi crescute, se va renunţa la etapa de fierbere.
În general, la prepararea mediilor de cultivare comercializate se vor respecta
riguros instrucţiunile firmei producătoare.
După preparare, mediile repartizate în flacoane sau tuburi se vor steriliza prin
autoclavare, timp de 15-20 minute la 121ºC (sau respectând parametrii recomandaţi de
Medii de cultivare

44
producător). Componentele ce nu pot fi autoclavate datorită termolabilităţii lor, se vor
prepara separat şi se vor adăuga la mediul de bază după sterilizarea acestuia.
În vederea autoclavării eficiente se recomandă repartizarea mediilor în
flacoane cu o capacitate care să nu depăşească 400-500 ml. Cele mai indicate sunt cele
confecţionate din sticlă Pirex, gradate, cu capac filetabil, tip Deltalab - Spania.

3.4. Controlul de calitate şi păstrarea mediilor

Fiecare nou lot de medii de cultură, indiferent de provenienţa sa (medii gata de
folosire, repartizate în plăci sau tuburi “single-use” livrate de diverse firme sau medii
preparate în laborator) va fi supus unui control de rutină care vizează analiza unor
însuşiri esenţiale cum ar fi aspectul, pH-ul, sterilitatea şi performanţele mediului.
Aspectul (culoare, transparenţă, consistenţă) şi pH-ul trebuie să corespundă
parametrilor standard specifici pentru respectivul mediu de cultivare. Starea de
sterilitate a mediilor se verifică prin incubarea câtorva recipiente la temperaturile de
30ºC, respectiv 37ºC, timp de 24-48 ore. Absenţa dezvoltării unor colonii bacteriene
sau fungice indică o corectă sterilizare a mediului. Performanţele de creştere se verifică
utilizând tulpini tip din colecţia laboratorului, alese în funcţie de tipul de mediu şi de
recomandările privind aplicabilitatea acestuia în diagnostic:
- Mediile de izolare neselective se verifică prin evaluarea capacităţii lor de a
asigura dezvoltarea optimă a tulpinilor însămânţate;
- Mediile selective se verifică prin însămânţarea unor tulpini tip rezistente şi a
unora sensibile la agenţii inhibitori existenţi în mediu;
- Calitatea mediilor diferenţiale se evaluează prin modul de reacţie al acestora în
urma însămânţării cu tulpini producătoare de reacţii pozitive şi negative.
Conservarea mediilor de cultură preparate în laborator şi a celor reconstituite
prin rehidratare se face de preferinţă la temperaturi de refrigerare (2º-8ºC), plăcile Petri
plasându-se în pungi de polietilenă sau cutii închise ermetic, iar tuburile vor fi
etanşeizate cu dopuri confecţionate din material neporos pentru a preveni desicarea. În
aceste condiţii, mediile condiţionate în plăci Petri se pot păstra până la 3 luni, iar cele
în tuburi cu dop etanş până la 6 luni. Excepţie fac unele medii ce conţin ingrediente
perisabile, degradabile, a căror stocare în timp este limitată.













Luminiţa Malic, Olimpia Bazgan, Mihai Mareş


45
C
a
p
i
t
o
l
u
l
 
3
 
Tabelul 3-1
Utilitatea diagnostică a unor medii cromogene
Denumirea mediului şi
firma producătoare
Specii identificate Aspectul coloniilor
CandiSelect ™ 4
(Bio-Rad)
Candida albicans
Culoare roz-violet, contur
regulat
C. tropicalis
Culoare turcoaz intensă,
bombate, contur regulat,
de tip S.
C. glabrata
Culoare turcoaz mai
estompată, strălucitoare,
plate, contur regulat, de
tip S.
C.krusei
Culoare verde-turcoaz,
mate, contur neregulat, de
tip R.
Chromogenic Candida
Agar (Oxoid)
C. albicans
Culoare verde
C. tropicalis
Culoare albastru-închis
C. krusei
Culoare roz-închis, mate,
contur neregulat
C. glabrata
Culoare galben-bej
C. parapsilosis
Culoare brună
CHROMagar Candida
(BD Sciences)
C. albicans
Culoare verde-smarald
C. glabrata
Culoare violet-deschis
(lila), mate
C. krusei
Culoare roz-pal,
albicioase la periferie, de
tip R
C. tropicalis
Culoare albastră-verzuie
până la albastru-metalizat
Candida ID2
(bioMérieux)
C. albicans
Culoare albastră
C. tropicalis
C. lusitaniae
C. kefyr

Culoare roz
Candichrom II
(Elitech, Franţa)
C.albicans



Alte levuri
Culoare alb -crem,
colonii lucioase,
albastre verzui

Culoare albă
Agar cu extract de
seminţe de Niger
(Birdseed Agar)
Cryptococcus
neoformans
Culoare brună
Alte levuri Culoare alb – crem
Medii de cultivare

46
Medii de cultivare

M01 Agar acetat Fowell

Compoziţie
Acetat de sodiu x 3H
2
O
Agar
Apă purificată
5 g
20 g
ad 1000 ml

Preparare: se dizolvă acetatul de sodiu trihidrat în apă, după care se
ajustează pH-ul între 6,5-7 înainte de a adăuga agarul. Se
încălzeşte amestecul până la completa solubilizare a agarului.
Se sterilizează prin autoclavare, la 121°C timp de 15 minute.
Aspect: geloză translucidă
pH final la 25°C : 6,5-7
Controlul calităţii: Saccharomyces cerevisiae ATCC 9763 – dezvoltare cu
producere de ascospori
Utilizare: stimularea producerii formelor sexuate la levuri
Stocare: în eprubete, 4 luni la 2°-8 °C, în plăci o lună la 2°-8°C
Disponibil comercial: nu se comercializează.

M02 Agar acetat McClary

Compoziţie
Acetat de potasiu
Glucoză
Clorură de sodiu
Sulfat de magneziu
heptahidrat
Extract de drojdie
Agar
Apă purificată
9,8 g
1 g
1,2 g
0,7 g
2,5 g
15 g
ad 1000 ml

Preparare: se dizolvă ingredientele în apa preîncălzită, înainte de a adăuga
agarul. Se încălzeşte amestecul până la completa solubilizare a
agarului. Se sterilizează prin autoclavare, la 121°C timp de 15
minute.
Aspect: geloză gălbuie, translucidă
pH final la 25°C : 6,0 ± 0,2
Controlul calităţii: Saccharomyces cerevisiae ATCC 9763 – dezvoltare cu
producere de ascospori
Utilizare: stimularea producerii formelor sexuate la levuri
Stocare: în eprubete 4 luni la 2°-8 °C, în plăci o lună la 2°-8°C
Disponibil comercial: nu se comercializează.

Luminiţa Malic, Olimpia Bazgan, Mihai Mareş


47
C
a
p
i
t
o
l
u
l
 
3
 
M03 Agar BCG Candida

Compoziţie
Peptonă
Extract de drojdie
Dextroză
Agar
Verde de bromcrezol
Apă distilată
10,0 g
1,0 g
40,0 g
15,0 g
0,02 g
ad 1000 ml

Preparare: ingredientele se dizolvă în apa distilată şi se fierb un minut
până la completa dizolvare. Se autoclavează la 121
0
C timp de
15 minute. Se adaugă neomicină 500 mg/l, după răcirea
mediului la o temperatură de 50-55
0
C.
Aspect: geloză albastru-verzuie, uşor opalescentă
pH final la 25
0
C: 6,1 ± 0,1
Controlul calităţii: Candida albicans ATCC 10231: virarea culorii mediului spre
galben.
Candida tropicalis ATCC 9968: virarea culorii mediului spre
galben.
Escherichia coli ATCC 25922: virarea culorii mediului spre
verde.
Utilizare: mediu diferenţial şi selectiv folosit pentru izolarea primară şi
detecţia speciilor genului Candida din prelevatele clinice.
Plăcile Petri însămânţate se incubează 72 ore la o temperatură
de 30° ± 2
0
C.
Stocare: 2°–8 °C
Disponibil comercial: Difco (SUA)

M04 Agar BIGGY (Agar bismut - sulfit - glucoză - glicină - drojdie)
Agar Nickerson

Compoziţie
Citrat amoniacal de
bismut
Sulfat de sodiu
Dextroză
Glicină
Extract de drojdie
Agar
Apă distilată
5,0 g
3,0 g
10,0 g
10,0 g
1,0 g
16,0 g
ad 1000 ml

Preparare: ingredientele se dizolvă în apa distilată preîncălzită, sub agitare
continuă. Mediul se răceşte la 45 - 50
°
C, după care se
Medii de cultivare

48
repartizează în plăci Petri. Nu se autoclavează. Înainte de
utilizare se recomandă verificarea sterilităţii şi a pH-ului.
Aspect: mediu omogen, opalescent, alb-gălbui
pH final la 25
0
C: 6,8 ± 0,2
Controlul calităţii: Candida albicans ATCC 10231 ++
Candida kefyr ATCC 8553 ++
Candida tropicalis ATCC 1369 ++
Utilizare: mediu recomandat pentru izolarea şi identificarea speciilor
aparţinând genului Candida. Inocularea se realizează din
culturi proaspete, iar incubarea are loc la o temperatură de 25°
± 2°C, 18-24 ore (3-5 zile dacă este necesar)
Stocare: 2°-8°C
Disponibil comercial: Becton – Dickenson (SUA)

M05 Agar Blasto "D"

Compoziţie
Glucoză
Tween 80
Sulfat de potasiu
Citrat de magneziu
Fosfat dipotasic
Asparagină
Aminoacizi de tipul
"Casamino"
Clorură de sodiu
Agar
Apă deionizată
7 g
0,2 ml
0,5 g
1,5 g
5 g
5 g
3 g
0,85 g
15 g
ad 1000 ml

Preparare: ingredientele se adaugă în apa purificată preîncălzită şi se fierb
apoi sub agitare până la completa lor dizolvare. Se sterilizează
prin autoclavare la 121°C timp de 15 minute.
Aspect: geloză clară, transparentă
pH final la 25
0
C: 6,6 ± 0,2
Utilizare: transformarea formei filamentoase în formă levurică la specia
Blastomyces dermatitidis, prin incubare la 37
0
C.
Stocare: în eprubete 2 luni la 2°-8 °C, în plăci o lună la 2°-8°C
Disponibil comercial: nu se comercializează.








Luminiţa Malic, Olimpia Bazgan, Mihai Mareş


49
C
a
p
i
t
o
l
u
l
 
3
 
M06 Agar Bromcrezol purpur – cazeină - glucoză
(Bromcresol purple casein glucose Agar )

Compoziţie soluţie A
Lapte ecremat
Soluţie etanolică de
Bromcrezol purpur 1,6%
Apă distilată
80 g

2 ml
ad 1000 ml

Compoziţie soluţie B
Glucoză
Agar
Apă distilată
40 g
30 g
ad 1000 ml

Preparare: după solubilizarea ingredientelor în apa distilată preîncălzită,
cele două soluţii se sterilizează separat astfel: sol. A - 8 minute
la 115°C, sol. B - 15 minute la 121°C. După răcire la 45°-
50°C, cele două soluţii se amestecă, se omogenizează, se
ajustează pH-ul la valoarea 6,6 şi apoi se repartizează în tuburi
sterile, în pantă.
Aspect: geloză în pantă, bleu pal, opacă
pH final la 25°C : 6,6 ± 0,2
Controlul calităţii: Trichophyton rubrum ATCC 28188: dezvoltare fără alcali-
nizare (mediul nu îşi modifică nuanţa);
Trichophyton mentagrophytes ATCC 9533: dezvoltare cu alca-
linizare (virarea culorii în violet-purpuriu);
Utilizare: test de identificare a speciilor de dermatofiţi
Stocare: o lună la temperatura de refrigerare
Disponibil comercial: nu se comercializează.

M07 Agar Ciocolat (Agar Chocolate)

Compoziţie
Triptonă
Peptonă din soia
Clorură de sodiu
Agar
Apă distilată
Sânge defibrinat ovin
15,0 g
5,0 g
5,0 g
15,0 g
ad 1000 ml
5-10 %

Preparare: se dizolvă ingredientele în apa distilată preîncălzită şi se fierb
un minut. Mediul se repartizează (câte 90 ml) în flacoane şi se
sterilizează prin autoclavare la 121°C timp de 15 minute. După
sterilizare, mediul se răceşte la 75°-80°C, moment în care se
Medii de cultivare

50
adaugă câte 10 ml de sînge defibrinat ovin în fiecare flacon. Se
agită sub protecţia unei hote bacteriologice de clasă II, până la
apariţia culorii brun-ciocolatii.
Aspect: geloză brun-roşcată, opacă
pH final la 25°C : 7,3 ± 0,2
Controlul calităţii: Candida albicans ATCC 10231 ++ (colonii gri, de consistenţă
cremoasă, cu filamentare evidentă la periferie - aspect stelat)
Candida parapsilosis ATCC 22019 ++ (colonii netede, fără
filametare periferică)
Utilizare: identificarea tulpinilor de Candida albicans prin incubare la
37°C, în atmosferă cu 6% CO
2
, timp de 48 ore
Stocare: 2°-8°C
Disponibil comercial: mediul bază - Becton Dickenson (SUA), Remel (SUA),
Biokar Diagnostics (Franţa)

M08 Agar Christensen

Compoziţie soluţia A
Peptonă
Glucoză
Fosfat monopotasic
Clorură de sodiu
Uree
Roşu fenol
Apă distilată
1 g
1 g
2 g
5 g
20 g
0,012 g
100 ml

Compoziţie soluţia B
Agar
Apă distilată
15 g
900 ml

Preparare: se pregăteşte soluţia A şi se sterilizează prin filtrare, apoi se
fierbe agarul cu apa distilată până la dizolvare. Soluţia B se
sterilizează prin autoclavare la 121°C timp de 15 min, iar după
răcire la 50°C se adaugă soluţia A preîncălzită. Mediul astfel
obţinut se repartizează în tuburi şi se lasă să se solidifice în
poziţie înclinată. Soluţia A se poate steriliza şi prin
autoclavare, în acest caz ureea adăugându-se sub formă de
soluţie sterilă, după răcirea amestecului la 50°C.
Aspect: geloză galben-orange, transparentă
pH final la 25°C : 6,8 ± 0,2
Controlul calităţii: Candida albicans ATCC 10231 – dezvoltare fără modificarea
culorii mediului;
Cryptococcus albidus ATCC 66030 – dezvoltare cu virarea
culorii mediului spre roz-roşu;
Luminiţa Malic, Olimpia Bazgan, Mihai Mareş


51
C
a
p
i
t
o
l
u
l
 
3
 
Utilizare: identificarea speciilor fungice ureazo-pozitive (Cryptococcus
spp., Rhodotorula spp., Trichosporon spp. şi unii dermatofiţi)
Stocare: 2 luni la temperatura de refrigerare
Disponibil comercial: un mediu-bază care se aditivează după autoclavare cu soluţie
sterilă de uree Merck (Germania), Remel (SUA).

M09 Agar cu acid cafeic şi citrat feric

Compoziţie
Sulfat acid de sodiu
Glucoză
Extract levuric
Fosfat dipotasic
Sulfat de magneziu
hidratat
Acid cafeic
Cloramfenicol
Citrat feric
Agar
Apă distilată
5 g
5 g
2 g
0,8 g
0,7 g
0,18 g
0,05 g
0,002 g
15 g
ad 1000 ml

Preparare: ingredientele se adaugă în apa purificată preîncălzită şi se fierb
apoi sub agitare până la completa lor dizolvare. Se sterilizează
prin autoclavare, la 121°C timp de 15 minute.
Aspect: geloză maron deschis, translucidă
pH final la 25
0
C: nu se determină
Controlul calităţii: Cryptococcus neoformans ATCC 14116: colonii brune cu
aspect mucoid;
Utilizare: mediu pentru izolarea şi identificarea speciei Cryptococcus
neoformans;
Stocare: în eprubete 2 luni la 2°-8 °C, în plăci o lună la 2°-8°C
Disponibil comercial: nu se comercializează.













Medii de cultivare

52
M10 Agar cu extract de cartof şi glucoză (PDA)

Compoziţie
Glucoză (dextroză)
Infuzie de cartofi pulbere
Agar
Apă purificată
20 g
4 g
20 g
ad 1000 ml

Preparare: ingredientele se adaugă în apa purificată preîncălzită şi se fierb
apoi sub agitare până la completa lor dizolvare. Se sterilizează
prin autoclavare, la 121°C timp de 15 minute
Aspect: geloză alb-gălbuie, translucidă
pH final la 25°C : 5,6 ± 0,2
Controlul calităţii: Aspergillus niger ATCC 16404 ++
Candida albicans ATCC 10231 ++
Saccharomyces cerevisiae ATCC 9763 ++
Trichophyton mentagrophytes ATCC 9533 +
Utilizare: mediu folosit pentru cultivarea şi identificarea levurilor şi
fungilor filamentoşi
Stocare: în eprubete 2 luni la 2°-8 °C, în plăci o lună la 2°-8°C
Disponibil comercial: Merck (Germania), Remel (SUA), Biokar Diagnostics
(Franţa).

M11 Agar cu extract de drojdie şi cloramfenicol
(Yeast Extract Glucose Chloramphenicol Agar)

Compoziţie
Extract de drojdie
Glucoză
Cloramfenicol
Agar
Apă distilată
5,0 g
20,0 g
0,1 g
13,0 g
ad 1000 ml

Preparare: ingredientele se dizolvă în apa distilată preîncălzită, după care
se fierb un minut. Se autoclavează la 121ºC timp de 15 minute.
Aspect: geloză galben pal, translucidă
pH final la 25ºC: 6,6 ± 0,2
Controlul calităţii: Aspergillus niger ATCC 16404 ++
Candida albicans ATCC 10231 ++
Escherichia coli ATCC 25922 -
Saccharomyces cerevisiae ATCC 9763 +
Utilizare: cultivarea şi identificarea fungilor levuriformi şi filamentoşi
Stocare: în eprubete 4 luni la 2°-8 °C, în plăci o lună la 2°-8°C
Disponibil comercial: Difco (SUA).

Luminiţa Malic, Olimpia Bazgan, Mihai Mareş


53
C
a
p
i
t
o
l
u
l
 
3
 
M12 Agar cu extract de drojdie şi fitonă
(Phytone Yeast Extract Agar)

Compoziţie
Peptonă din soia
Extract de drojdie
Dextroză
Cloramfenicol
Agar
Apă distilată
10,0 g
5,0 g
40,0 g
0,05 g
17,0 g
ad 1000 ml

Preparare: ingredientele se dizolvă în apa distilată preîncălzită,
amestecând continuu, cu menţinerea temperaturii de fierbere
timp de un minut. Autoclavarea are loc la o temperatură de
121
o
C timp de 15 minute.
Aspect: geloză gălbuie, translucidă
pH final la 25ºC: 6,6 ± 0,2
Controlul calităţii: Aspergillus niger ATCC 16404 +
Candida albicans ATCC 10231 +
Penicillium roqueforti ATCC 9295 +
Saccharomyces cerevisiae ATCC 25923 –
Trichophyton verrucosum ATCC 38485 +
Utilizare: mediu pentru izolarea şi identificarea fungilor din prelevatele
clinice, în special a dermatofiţilor din specia Trichophyton
verrucosum
Stocare: în eprubete 2 luni la 2°-8 °C, în plăci o lună la 2°-8°C
Disponibil comercial: Difco (SUA).

M13 Agar cu extract de orez

Compoziţie
Extract de orez
Agar
Apă distilată
5,0 g
20,0 g
ad 1000 ml

Preparare: ingredientele se dizolvă în apa distilată preîncălzită,
amestecând continuu, cu menţinerea temperaturii de fierbere
timp de un minut. Autoclavarea are loc la o temperatură de
121
o
C timp de 15 minute.
Aspect: geloză de culoare galben-pal, translucidă
pH final la 25ºC: 6,6 ± 0,2
Controlul calităţii: Candida albicans ATCC 10231 +
Candida albicans ATCC 60193 +
Utilizare: formarea clamidosporilor la speciile de Candida
Stocare: în eprubete 2 luni la 2°-8 °C, în plăci o lună la 2°-8°C
Medii de cultivare

54
Disponibil comercial: Becton Dickinson (SUA).

M14 Agar cu extract de paprika
(Ground red hot pepper agar)

Compoziţie
Paprika
Glucoză
Agar
Apă distilată
40,0 g
4,0 g
15,0 g
ad 1000 ml

Preparare: ingredientele se adaugă în apa distilată şi se aduc la punctul de
fierbere, apoi se sterilizează prin autoclavare la 116°C timp de
30 minute.
Aspect: geloză opacă, de culoare brun-roşcată, cu miros de paprika
pH final la 25°C: 4,9
Controlul calităţii: Cryptococcus neoformans var. neoformans – colonii alb-
cremoase după 48 ore de incubare la 30°C, care se
pigmentează în brun după această perioadă
Utilizare: izolarea şi identificarea prezumtivă a tulpinilor de
Cryptococcus neoformans
Stocarea: 2°- 8°C
Disponibil comercial: nu se comercializează.

M15 Agar cu extract de sol

Prepararea
extractului de sol: 1 kg sol de grădină se amestecă cu 1000 ml apă de robinet, se
încălzeşte 30 de minute, se decantează, se filtrează şi se
completează la 1000 ml cu apă distilată. La 1000 ml extract de
sol se adaugă 2 g glucoză, 1 g extract de drojdie, 15 g agar şi
6,6 g de păr uman tocat şi sterilizat. Mediul este recomandat
pentru obţinerea de cleistoteci la specii de Arthroderma
(formele teleomorfe ale dermatofiţilor).
Stocare: în eprubete 4 luni la 2°-8 °C, în plăci o lună la 2°-8°C
Disponibil comercial: nu este disponibil comercial.










Luminiţa Malic, Olimpia Bazgan, Mihai Mareş


55
C
a
p
i
t
o
l
u
l
 
3
 
M16 Agar cu extract de tutun (Tobacco Agar)

Compoziţie
Extract din frunze de
tutun
Agar
1000 ml
20 g

Preparare: 50 grame frunze de tutun se fierb timp de 30 minute într-un
litru de apă distilată. Extractul obţinut se filtrează; se ajustează
pH-ul la valoarea 6 şi se readuce volumul la 1000 ml cu apă
distilată. După adăugarea agarului, amestecul se încălzeşte
până la dizolvarea completă a acestuia. Mediul se sterilizează
prin autoclavare la 121°C timp de 15 minute. După sterilizare,
mediul se repartizează în plăci Petri sterile (ø 90 mm), câte 25
ml/placă.
Aspect: geloză translucidă, de culoare galben-maronie
pH final la 25°C: 6,0 ± 0,1
Controlul calităţii: Candida dubliniensis CBS 7987 (formare de clamidospori în
urma însămânţării prin tehnica Dalmeau şi incubare la 30°C)
Utilizare: mediu destinat identificării tulpinilor de Candida albicans şi
Candida dubliniensis pe baza stimulării producerii de
clamidospori (C. albicans 96% dintre tulpini, C.dubliniensis
100% dintre tuplini)
Stocare: 2°-8°C
Disponibil comercial: nu se comercializează.

M17 Agar cu făină de porumb (Cornmeal agar)

Compoziţie
Făină de porumb
Glucoză
Agar
Apă distilată
40 g
10 g
15 g
ad 1000 ml

Preparare: se amestecă făina de porumb cu apa distilată şi se încălzeşte
amestecul la 52°C timp de o oră sau la 121°C timp de 10
minute. După tratamentul termic, amestecul se filtrează prin
tifon şi vată, apoi prin hârtie de filtru. În filtratul obţinut se
introduc agarul şi glucoza, fierbându-se până la topirea
acestora. Se readuce volumul la 1000 ml, apoi se sterilizează la
121°C timp de 15 minute.
Aspect: geloză albicioasă, translucidă
pH final la 25°C : 6,0 ± 0,2
Medii de cultivare

56
Controlul calităţii: Trichophyton rubrum ATCC 28188: pigment roşu în mediul
subiacent
Trichophyton mentagrophytes ATCC 9533: pigment brun sub
colonie
Utilizare: stimulează pigmentogeneza la suşele de T. rubrum şi le
diferenţiază de tulpinile aparţinând speciei T. mentagrophytes.
Stocare: în eprubete 4 luni la 2°-8 °C, în plăci o lună la 2°-8°C
Disponibil comercial: Remel (SUA).

M18 Agar cu făină de porumb şi Tween 80 (Cornmeal Agar Tween 80)

Compoziţie
Făină de porumb
Tween 80
Agar
Apă distilată
40 g
10 ml
20 g
ad 1000 ml

Preparare: făina de porumb se adaugă în 500 ml apă distilată şi se
macerează timp de o oră la 65°C; după filtrare şi reajustarea
volumului la 500 ml, soluţia astfel obţinută se amestecă cu
agarul în prealabil solubilizat în 500 ml apă distilată şi cu 10
ml Tween 80. Se ajustează pH-ul la 6,6 - 6,8 şi apoi se
sterilizează prin autoclavare la 121°C timp de 20 minute.
Aspect: geloză albicioasă, translucidă
pH final la 25°C : 6,8 ± 0,2
Controlul calităţii: Candida albicans ATCC 10131 ++
Candida albicans ATCC 60193 (cu apariţia clamidosporilor
prin cultivare submersă)
Utilizare: identificarea diferitelor specii ale genului Candida prin
studierea caracterelor morfologice microscopice etalate de
acestea în urma cultivării submerse, la 30°C timp de 48 ore
Stocare: în eprubete 4 luni la 2°-8 °C, în plăci o lună la 2°-8°C
Disponibil comercial: Becton Dickenson (SUA), Remel (SUA)

M19 Agar cu frunze de garoafă

Preparare: frunzele de garoafă sunt tăiate în bucăţi, uscate şi sterilizate
prin expunerea la radiaţii gamma sau oxid de etilenă. Câteva
bucăţi sterile sunt introduse în 1,5% agar nesolidificat. În locul
frunzelor de garoafă se pot folosi de asemenea şi bucăţi de
hârtie de filtru sterile. Acest mediu este recomandat pentru
cultivarea şi identificarea speciilor aparţinând genului
Fusarium.



Luminiţa Malic, Olimpia Bazgan, Mihai Mareş


57
C
a
p
i
t
o
l
u
l
 
3
 
M20 Agar cu L-canavanină – glicină - albastru de bromtimol (CGB Agar)

Compoziţie soluţia A
Glicină
Fosfat monopotasic
Sulfat de magneziu
Tiamină HCl
L-canavanină sulfat
Apă distilată
10 g
1 g
1 g
1 mg
30 mg
ad 100 ml

După solubilizarea completă a ingredientelor enumerate, se
ajustează pH-ul la 5,6 şi amestecul se sterilizează prin filtrare
utilizând filtre cu porozitate de 0,22 µm. Soluţia astfel obţinută
se păstrează la frigider (+4°C).

Compoziţie soluţia B
Albastru de bromtimol
Hidroxid de sodiu 0,01 N
Apă distilată
0,4 g
64 ml
36 ml

Albastrul de bromtimol se dizolvă în soluţia de hidroxid de
sodiu, apoi se adaugă apa distilată.
Preparare: pentru obţinerea unui litru de mediu, se amestecă 880 ml apă
distilată cu 20 ml soluţie B şi 20 g pulbere de agar. Sterilizarea
se realizează prin autoclavare la 121°C, timp de 15 minute.
După răcirea mediului la 48°C, se adaugă 100 ml soluţie A şi
se omogenizează, apoi se repartizează în plăci Petri.
Aspect: geloză translucidă de culoare galben-verzuie
pH final la 25°C : 5,8 ± 0,1
Controlul calităţii : Cryptococcus neoformans var. neoformans – dezvoltare
disgonică, fără modificarea culorii mediului;
Cryptococcus neoformans var. gattii - dezvoltare eugonică, cu
virarea culorii mediului de la galben-verzui la albastru-cobalt;
Utilizare: mediul este recomandat pentru diferenţierea celor două
varietăţi ale speciei Cryptococcus neoformans (var.
neoformans şi var. gattii). După însămânţarea tulpinilor de
testat, incubarea se realizează la 25°C timp de 5 zile. Doar var.
gattii are capacitatea de a cultiva în prezenţa L-canavaninei şi
de a folosi glicina ca unică sursă de carbon. Aceste
particularităţi metabolice determină pozitivarea testului pe
Agar CGB, adică schimbarea de pH (de la 5,8 la aproximativ
7,0) şi modificarea culorii mediului (de la galben-verzui la
albastru-cobalt).
Stocare: în plăci o lună la 2°-8°C
Medii de cultivare

58
Disponibil comercial: nu se comercializează.

M21 Agar cu sucroză şi creatină

Compoziţie
Creatină
Sucroză
KCl
MgSO
4
FeSO
4

K
2
HPO
4

Bromcrezol purpur
Agar
Apă distilată
3 g
30 g
0.5 g
0.5 g
0.01 g
1.3 g
0.05 g
15 g
ad 1000 ml

Preparare: ingredientele se introduc în apa distilată preîncălzită şi se
omogenizează până la completa dizolvare. Se autoclavează la
121ºC timp de 15 minute. Se ajustează pH-ul la valoarea 6,0 ±
0,2.
Aspect: geloză opalescentă, de culoare roz
pH final la 25 ºC: 6,0 ± 0,2
Controlul calităţii: Aspergillus niger ATCC 1015 ++
Utilizare: mediu destinat izolării şi identificării fungilor filamentoşi
Stocare: 2°-8°C
Disponibil comercial: nu se comercializează.





















Luminiţa Malic, Olimpia Bazgan, Mihai Mareş


59
C
a
p
i
t
o
l
u
l
 
3
 
M22 Agar cu sucroză, creatină şi dicloran
(Creatine Sucrose Dichloran Agar)

Compoziţie
Creatină
Sucroză
KCl
KH
2
PO
4

MgSO
4

FeSO
4
K
2
HPO
4

Cloramfenicol
Dicloran
Bromcrezol purpur
ZnSO
4

CuSO
4

Agar
Apă distilată
3 g
30 g
0.5 g
1 g
0.5 g
0.01 g
0,05 g
0,05 g
0,002 g
0,05 g
0,01 g
0,005 g
20 g
ad 1000 ml

Preparare: ingredientele se dizolvă în apa distilată preîncălzită, se
sterilizează prin autoclavare la temperatura de 121ºC timp de
15 minute. Se adaugă 0,05 g clortetraciclină şi se ajustează
pH-ul la valoarea 4,8.
Aspect: geloză de culoare roz, uşor opalescentă
pH final la 25 ºC: 4,8
Controlul calităţii: Aspergillus niger ATCC 1015 +
Utilizare: mediu destinat izolării şi identificării fungilor filamentoşi
Stocare: 2°-8°C
Disponibil comercial: nu se comercializează.

M23 Agar - acid acetic – dicloran - extract de drojdie
(Acetic Acid Dichloran Yeast Extract Agar)

Compoziţie
Extract de drojdie
Sucroză
MgSO
4
x 7 H
2
O
Dicloran
Agar
Apă distilată
20 g
150 g
0.5 g
0.002g
20 g
ad 1000 ml

Preparare: ingredientele se dizolvă în apa distilată preîncălzită, se
autoclavează la 121 ºC timp de 15 minute, după care se adaugă
0,5 % acid acetic glacial.
Aspect: geloză translucidă, de culoare gălbuie
Medii de cultivare

60
Controlul calităţii: Aspergillus niger ATCC 1015 ++
Utilizare: mediu destinat izolării şi identificării fungilor filamentoşi
Stocare: 2°-8°C
Disponibil comercial: nu se comercializează.

M24 Agar – dicloran - extract de drojdie - 18 % glicerol
(Dichloran Yeast Extract 18% Glycerol Agar)

Compoziţie
Extract de drojdie
Sucroză
K
2
HPO
4
MgSO
4

Cloramfenicol
Dicloran (0,2% în etanol)
ZnSO
4

CuSO
4

Agar
Glicerol
Apă distilată
20 g
150 g
1 g
0,5 g
0,05 g
1 ml
0,01 g
0,005 g
20 g
220 g
ad 1000 ml

Preparare: ingredientele se dizolvă în apa distilată preîncălzită, se
sterilizează prin autoclavare la temperatura de 121ºC timp de
15 minute. Se adaugă 0,05 g clortetraciclină.
Aspect: geloză de culoare gălbuie, uşor opalescentă
pH final la 25 ºC: nu se determină
Controlul calităţii: Aspergillus niger ATCC 1015 +
Utilizare: mediu destinat izolării şi identificării fungilor filamentoşi
Stocare: 2°-8°C
Disponibil comercial: nu se comercializează.

M25 Agar diferenţiere Aspergillus

Compoziţie
Mediu deshidratat Becton
– Dickenson


Preparare: conform recomandărilor firmei producătoare
Aspect: geloză gălbuie, translucidă
pH final la 25
0
C: 7,0 ± 0,5
Controlul calităţii: tulpinile de A. flavus produc virarea culorii mediului în galben
-portocaliu. Alte specii de Aspergillus (A.parasiticus, A.
sclerotiorum, A. thomii) produc de asemenea modificări ale
culorii mediului de cultivare, dar acestea sunt distincte faţă de
cele produse de A. flavus.
Luminiţa Malic, Olimpia Bazgan, Mihai Mareş


61
C
a
p
i
t
o
l
u
l
 
3
 
Utilizare: acest mediu de cultură conţine cazeină, aminoacizi, extract de
drojdie îmbogăţit cu complex vitaminic B. Citratul feric este
esenţial pentru producerea pigmentului galben care ajută la
diferenţierea speciei A. flavus de alte specii cu semnificaţie
clinică ale aceluiaşi gen. Cu ajutorul unei anse sterile, se
etalează pe suprafaţa mediului câteva colonii după care se
incubează la 25°C timp de 10 zile, pentru a permite virarea
culorii spre diferite nuanţe de galben.
Stocare: 2°-8°C
Disponibil comercial: Difco (SUA).

M26 Agar Dixon

Compoziţie
Agar cu extract de malţ
Bilă de bou deshidratată
Tween 40
Glicerol mono-oleat
Apă distilată
60 g
20 g
10 ml
2,5 ml
ad 1000 ml

Preparare: glicerolul mono-oleat se emulsionează cu Tween 40 apoi se
adaugă treptat, sub agitare continuă, mediul preparat prin
amestecarea celorlalte ingrediente. Se sterilizează prin
autoclavare, la 121°C timp de 15 minute.
Aspect: geloză închisă la culoare, translucidă
pH final la 25°C : 5,6 ± 0,2
Controlul calităţii: Malassezia furfur ATCC 12078 ++
Utilizare: izolarea levurilor lipofile aparţinând genului Malassezia
Stocare: în eprubete 4 luni la 2°-8 °C, în plăci o lună la 2°-8°C
Disponibil comercial: nu se comercializează.















Medii de cultivare

62
M27 Agar Dixon modificat

Compoziţie
Extract de malţ
Bilă de bou deshidratată
Tween 40
Peptonă
Glicerol
Acid oleic
Agar
Apă distilată
36 g
20 g
10 ml
6 g
2 ml
2 ml
15 g
ad 1000 ml

Preparare: glicerolul şi acidul oleic se emulsionează cu Tween 40, apoi se
adaugă treptat, sub agitare continuă, mediul preparat prin
amestecarea celorlalte ingrediente. Se sterilizează prin
autoclavare, la 121°C timp de 15 minute.
Aspect: geloză închisă la culoare
pH final la 25°C : 6,0 ± 0,2
Controlul calităţii: Malassezia furfur ATCC 12078++
Utilizare: izolarea levurilor lipofile din prelevate patologice
Stocare: în eprubete 4 luni la 2°-8 °C, în plăci o lună la 2°-8°C
Disponibil comercial: nu se comercializează.

M28 Agar glucoză - peptonă - drojdie
(Glucose Peptone Yeast Extract Agar)

Compoziţie
Glucoză
Peptonă
Agar
Extract de drojdie
Apă distilată
20 g
5 g
20 g
5 g
ad 1000 ml

Preparare: ingredientele se solubilizează în apa preîncălzită. Se
sterilizează prin autoclavare la 121°C timp de 15 minute.
Aspect: geloză gălbuie, uşor opalescentă
pH final la 25°C : nu se determină
Controlul calităţii: Candida albicans ATCC 10231 ++
Saccharomyces cerevisiae ATCC 9763 ++
Utilizare: cultivarea levurilor în vederea conservării
Stocare: în eprubete 4 luni la 2°-8 °C, în plăci o lună la 2°-8°C
Disponibil comercial: nu se comercializează.



Luminiţa Malic, Olimpia Bazgan, Mihai Mareş


63
C
a
p
i
t
o
l
u
l
 
3
 
M29 Agar infuzie cord - creier (Brain Heart Agar BHI )

Compoziţie
Infuzie de cord
Infuzie de creier
Peptonă
Glucoză
Clorură de sodiu
Fosfat disodic
Agar
Apă distilată
250 ml
200 ml
10 g
2 g
5 g
2,5 g
15 g
ad 1000 ml

Preparare: ingredientele se adaugă în apa distilată preîncălzită, apoi
amestecul se fierbe sub agitare până la completa dizolvare a
acestora. Mediul astfel obţinut se repartizează în eprubete sau
flacoane şi se sterilizează prin autoclavare, la 121°C timp de
15 minute. Reţeta se poate modifica prin îmbunătăţirea cu 5-
10% sânge defibrinat de berbec sau prin adaos de
cloramfenicol şi/sau gentamicină (500 mg/l).
Aspect: geloză transparentă, de culoare galben-pal; geloză opacă de
culoare roşie (varianta aditivată cu sânge)
pH final la 25 °C: 7,4 ± 0,2
Controlul calităţii: Candida albicans ATCC 10231 ++
Streptococcus pyogenes ATCC 19615 ++ ( - în cazul variantei
aditivate cu antibiotice)
Utilizare: izolarea unei game largi de microorganisme cu exigenţe
nutritive particulare, cum ar fi fungii dimorfici
Stocare: eprubete 4 luni la 2°-8 °C, în plăci o lună la 2°-8°C
Disponibil comercial: Remel (SUA), Biokar Diagnostics (Franţa), Becton
Dickinson (SUA), bioMérieux (Franţa).

M30 Agar izolare Candida

Compoziţie
Extract de drojdie
Extract de malţ
Peptonă
Dextroză
Agar
Albastru de anilină
Apă distilată
3,0 g
3,0 g
5,0 g
10,0 g
20,0 g
0,1 g
ad 1000 ml

Medii de cultivare

64
Preparare: ingredientele se adaugă în apa distilată şi se fierb un minut
până la completa solubilizare. Se autoclavează la 121
0
C timp
de 15 minute.
Aspect: geloză de culoare albastră, opalescentă
pH final la 25
0
C: 6,2 ± 0,2
Controlul calităţii: Candida albicans ATCC 10231: produce fluorescenţă bleu–
verzuie la 354 nm;
Bacillus subtilis ATCC 6633: nu produce fluorescenţă;
Escherichia coli ATCC 25922 : nu produce fluorescenţă;
Utilizare: izolarea şi identificarea speciei Candida albicans din prelevate
clinice. Plăcile Petri însămânţate se incubează 72 ore la o
temperatură de 30 ± 2
0
C.
Stocare: 2°–8°C
Disponibil comercial: Becton – Dikinson (SUA).

M31 Agar Lactrimel (Borelli)

Compoziţie
Făină de grâu
Lapte praf ecremat
Miere
Agar
Cloramfenicol
Cicloheximidă
Apă distilată
14 g
14 g
7 g
20 g
0,5 g
0,5 g
ad 1000 ml

Preparare: ingredientele se amestecă cu apa distilată preîncălzită, sub
agitare continuă, până la completa lor solubilizare. Se
sterilizează prin autoclavare la 105°C timp de 10 minute. După
autoclavare se repartizează în plăci Petri.
Aspect: Geloză opacă, de culoare albă
pH final la 25°C: 6,8 ± 0,2
Controlul calităţii: Microsporum canis ATCC 1162: dezvoltare cu sporulare
intensă şi pigmentogeneză
Utilizare: favorizează sporularea marii majorităţi a dermatofiţilor şi
stimulează producerea pigmentului specific în cazul M.
audouinii, M. canis şi T. rubrum
Stocare: o lună, în plăci Petri la 2°-8°C
Disponibil comercial: nu se comercializează.







Luminiţa Malic, Olimpia Bazgan, Mihai Mareş


65
C
a
p
i
t
o
l
u
l
 
3
 
M32 Agar Leeming

Compoziţie
Peptonă
Glucoză
Bilă de bou deshidratată
Tween 60
Glicerol
Glicerol mono-stearat
Lapte integral
Extract de drojdie
Cloramfenicol
Agar
Apă distilată
10 g
5 g
4 g
0,5 ml
1 ml
0,5 g
10 ml
0,1 g
0,5 g
12 g
ad 1000 ml

Preparare: glicerolul şi glicerolul mono-stearat se emulsionează cu Tween
60, apoi se adaugă treptat, sub agitare continuă, mediul
preparat prin amestecarea celorlalte ingrediente. Se sterilizează
prin autoclavare, la 121°C timp de 15 minute.
Aspect: geloză închisă la culoare
pH final la 25°C : 6 ± 0,2
Controlul calităţii: Malassezia furfur ATTC 12078 ++
Utilizare: izolarea levurilor lipofile din prelevate patologice
Stocare: în eprubete 4 luni la 2°-8 °C, în plăci o lună la 2°-8°C
Disponibil comercial: nu se comercializează.

M33 Agar Littman (Littman Oxgall Agar)

Compoziţie
Peptonă
Dextroză
Bilă de bou deshidratată
Agar
Cristal violet
Streptomicină
Apă distilată
10,0 g
10,0 g
15,0 g
20,0 g
0,01 g
30,0 mg
ad 1000 ml

Preparare: ingredientele se dizolvă în apa distilată, amestecând continuu,
cu menţinerea temperaturii de fierbere timp de un minut.
Autoclavarea are loc la o temperatură de 121
o
C timp de 15
minute, cu răcire la 47ºC pentru adăugarea antibioticului;
streptomicina se poate înlocui cu cloramfenicol, acesta
putându-se adăuga chiar înaintea autoclavării.
Aspect: geloză de culoare bleu-cenuşie, uşor opalescentă
Medii de cultivare

66
pH final la 25ºC: 7,0 ± 0,2
Controlul calităţii: Candida albicans ATCC 10231 +
Escherichia coli ATCC 25922 ±
Trichophyton mentagrophytes ATCC 9533 ++
Utilizare: mediu pentru cultivarea şi identificarea fungilor, în special a
celor dermatofiţi
Stocare: în eprubete 2 luni la 2°-8 °C, în plăci o lună la 2°-8°C
Disponibil comercial: Remel (SUA), Difco (SUA).

M34 Agar Mueller – Hinton - glucoză 2%

Compoziţie
Extract de carne pulbere
Cazeină
Amidon
Agar
Glucoză
Albastru de metilen
Apă distilată
2 g
17,5 g
1,5 g
15 g
20 g
0,5 mg
ad 1000 ml

Preparare: ingredientele se solubilizează în apa distilată preîncălzită, sub
agitare continuă. Se repartizează în tuburi sau flacoane şi se
sterilizează prin autoclavare la 110°C, timp de 20 minute.
Aspect: geloză opalescentă
pH final la 25
0
C: 6,9 - 7,1
Utilizare: mediul se foloseşte pentru testarea susceptibilităţii la
antifungice (voriconazol şi fluconazol) prin metoda CLSI
M44-A (metodă difuzimetrică cu discuri). Se recomandă ca
grosimea stratului de mediu să fie de 4 ± 0,5 mm (cca. 25 ml/
placă Petri cu ø 90mm sau cca. 60 ml / placă Petri cu ø 150
mm).
Stocare: 2°-8°C
Disponibil comercial: mediul bază (fără glucoză) este comercializat de Remel (SUA),
Biokar Diagnostics (Franţa), Becton Dickinson (SUA),
bioMérieux (Franţa).

M35 Agar cu făină de ovăz (Oatmeal Agar)

Compoziţie
Făină de ovăz
Agar
Apă distilată
60,0 g
18,0 g
ad 1000 ml

Preparare: ingredientele se dizolvă în apa distilată, amestecând continuu,
cu menţinerea temperaturii de fierbere timp de un minut.
Luminiţa Malic, Olimpia Bazgan, Mihai Mareş


67
C
a
p
i
t
o
l
u
l
 
3
 
Autoclavarea are loc la o temperatură de 121
o
C timp de 15
minute.
Aspect: geloză albicioasă, uşor opalescentă
pH final la 25ºC: 6,0 ± 0,2
Controlul calităţii: Aspergillus niger ATCC 16404 +
Candida albicans ATCC 10231 +
Saccharomyces cerevisiae ATCC 9763 +
Utilizare: mediu pentru cultivarea şi studierea caracterelor morfologice
ale fungilor filamentoşi; stimulează sporularea
Stocare: în eprubete 2 luni la 2°-8 °C, în plăci o lună la 2°-8°C
Disponibil comercial: Difco (SUA).

M36 Agar Pal

Compoziţie
Glucoză
Fosfat monopotasic
Creatinină
Agar
Extract apos din seminţe
integrale de floarea-
soarelui
1 g
1 g
1 g
15 g
ad 1000 ml

Preparare: se mărunţesc 50 g seminţe de floarea-soarelui nedecorticate,
nesărate, cu ajutorul unui blender şi se fierb timp de 30 minute
într-un litru de apă distilată. Se filtrează, se adaugă restul
ingredientelor, se ajustează pH-ul la 5,5 şi se sterilizează apoi
prin autoclavare la 110°C timp de 20 minute.
pH final la 25°C: 5,5
Controlul calităţii: Candida albicans ATCC 10231 ++
Candida dubliniensis CBS 7987 ++
Utilizare: diferenţierea speciilor C. albicans şi C. dubliniensis pe baza
morfologiei coloniilor şi producerii de clamidospori; C.
dubliniensis produce clamidospori şi colonii cu filamentare
periferică evidentă, prin incubare la 30°C timp de 48-72 ore, în
timp ce C. albicans nu.
Stocare: 2°-8°C
Disponibil comercial: nu este disponibil comercial.







Medii de cultivare

68
M37 Agar pentru studierea morfologiei levurilor
(Yeast Morphology Agar)

Compoziţie
Sulfat de amoniu
Asparagină
Dextroză
L-histidină HCl
LD-metionină
LD-triptofan
Biotină
Calciu pantotenat
Acid folic
Inizitol
Niacin
Acid p-aminobenzoic
Piridoxină HCl
Riboflavină
Tiamină HCl
Acid boric
Sulfat de cupru
Iodură de potasiu
Clorură ferică
Sulfat de magneziu
Molibdat de sodiu
Sulfat de zinc
Fosfat monopotasic
Sulfat de magneziu
Clorură de sodiu
Clorură de calciu
Agar
Apă distilată
3,5 g
1,5 g
10,0 g
10,0 mg
20,0 mg
20,0 mg
2,0 µg
400,0 µg
2,0 µg
2000,0 µg
400,0 µg
200,0 µg
400,0 µg
200,0 µg
400,0 µg
500,0 µg
40,0 µg
100,0 µg
200,0 µg
400,0 µg
200,0 µg
400,0 µg
1,0 g
0,5 g
0,1 g
0,1 g
18,0 g
ad 1000 ml

Preparare: ingredientele se dizolvă în apa distilată preîncălzită, după care
se fierb un minut. Se autoclavează la 121ºC timp de 15 minute.
Aspect: geloză galben-pal, opalescentă
pH final la 25ºC: 5,6 ± 0,2
Controlul calităţii: Kloeckera apiculata ATCC 9774 +
Saccharomyces cerevisiae ATCC 9080 +
Candida albicans ATCC 10231 +
Utilizare: cultivarea şi identificarea levurilor pe baza caracterelor
culturale şi a celor morfologice
Stocare: în eprubete 4 luni la 2°-8 °C, în plăci o lună la 2°-8°C
Disponibil comercial: Difco (SUA)


Luminiţa Malic, Olimpia Bazgan, Mihai Mareş


69
C
a
p
i
t
o
l
u
l
 
3
 
M38 Agar peptonă - glucoză - fluconazol

Compoziţie
Peptonă
Glucoză
Agar
Cloramfenicol
Gentamicină
Fluconazol
Apă distilată
10 g
20 g
20 g
40 mg
25 mg
5 mg
ad 1000 ml

Preparare: ingredientele se solubilizează în apa distilată preîncălzită. Se
ajustează valoarea pH-ului la 7,0. Se autoclavează la 121°C
timp de 15 minute.
Aspect: geloză gălbuie, translucidă
pH final la 25
0
C: 6,8-7,0
Controlul calităţii: Aspergillus flavus ATCC 10124 ++
Candida albincans ATCC 66027 ±
Utilizare: mediu destinat izolării precoce a fungilor filamentoşi din
prelevate contaminate cu levuri (ex. spută)
Stocare: în eprubete 2 luni la 2°-8 °C, în plăci o lună la 2°-8°C
Disponibil comercial: nu se comercializează.























Medii de cultivare

70
M39 Mediul RPMI 1640
(cu glutamină, glucoză 0,2%, roşu fenol, fără bicarbonat)

Compoziţie
L-arginină
L-asparagină anhidră
Acid L-aspartic
L-cistină hidroclorică
Acid L-glutamic
L-glutamină
Glicină
L-histidină
L- hidroxiprolină
L-izoleucină
L- lizină hidroclorică
L- metionină
L- fenilalanină
L-prolină
L-serină
L-treonină
L-triptofan
L-tirozină disodică
L-valină
Biotină
Acid D-pantotenic
Colină HCl
Acid folic
Mio-inozidol
Niacinamidă
PABA
Piridoxină HCl
Riboflavină
Tiamină HCl
Vitamina B
12

Nitrat de calciu
monohidrat
Clorură de potasiu
Sulfat de magneziu
Clorură de sodiu
Fosfat disodic anhidru
D-glucoză
Glutation redus
Roşu fenol
Apă distilată
200 mg
50 mg
20 mg
65,2 mg
20 mg
300 mg
10 mg
15 mg
20 mg
50 mg
40 mg
15 mg
15 mg
20 mg
30 mg
20 mg
5 mg
28,83 mg
20 mg
0,2 mg
0,25 mg
3 mg
1 mg
35 mg
1 mg
1 mg
1 mg
0,2 mg
1 mg
0,005 mg
100 mg
400 mg
48,84 mg
6000 mg
800 mg
2000 mg
1 mg
5,3 mg
ad 1000 ml

Luminiţa Malic, Olimpia Bazgan, Mihai Mareş


71
C
a
p
i
t
o
l
u
l
 
3
 
Preparare : mediul se găseşte sub formă „ready for use” (Sigma Aldrich),
cât şi sub formă de pulbere pentru prepararea în laborator.
Pulberea se dizolvă în apă bidistilată în cantitate de 10,4 g
pentru mediul uzual şi 20,8 g pentru mediul dublu concentrat.
Aspect: bulion transparent de culoare roşiatică
Utilizare: pentru utilizare, mediul se tamponează cu MOPS [3-(N-
morpholino) propanesulfonic acid], concentraţia finală a
acestuia fiind 0,165 mol/litru. Se obţine astfel un pH cu
valoarea 7,0 convenabil dezvoltării microorganismelor ce vor
fi testate.
Stocare: 2°-8°C
Disponibil comercial: Sigma Aldrich (Germania).

M40 Agar SABHI

Este un mediu de cultivare disponibil comercial în multiple
variante (cu şi fără Cloramfenicol, Gentamicină sau
Cicloheximidă) obţinut prin amestecul unor cantităţi
echivalente de Agar Sabouraud şi Agar infuzie cord - creier. Se
recomandă pentru cultivarea şi izolarea selectivă a fungilor
patogeni.
Disponibil comercial: Remel (SUA), Becton Dickinson (SUA).

M41 Agar Sabouraud cicloheximidă

Compoziţie
Peptonă
Dextroză
Agar
Cicloheximidă
Cloramfenicol
Apă distilată
10,0 g
10,0 g
15,5 g
0,4 g
0,05 g
ad 1000 ml

Preparare: ingredientele se dizolvă în apa distilată, amestecând continuu,
cu menţinerea temperaturii de fierbere timp de un minut.
Autoclavarea are loc la o temperatură de 115
o
C timp de 15
minute.
Aspect: geloză de culoarea chihlimbarului, transparentă
pH final la 25ºC: 6,9 ± 0,2
Controlul calităţii: Aspergillus niger ATCC 16404 ±
Aureobasidium pullulans ATCC 9348 ±
Blastomyces dermatitidis ATCC 56218 +
Candida albicans ATCC 10231 +
Escherichia coli ATCC 25922 ±
Microsporum audouinii ATCC 9079 +
Medii de cultivare

72
Penicillium roquefortii ATCC 9295 ±
Phialophora verrucosa ATCC 10223 +
Staphylococcus aureus ATCC 25923 –
Streptomyces rimosus ATCC 10970 ±
Trichophyton mentagrophytes ATCC 9533 +
Utilizare: mediu pentru izolarea selectivă a fungilor rezistenţi la
cicloheximidă, în special a dermatofiţilor
Stocare: în eprubete 2 luni la 2°-8 °C, în plăci o lună la 2°-8°C
Disponibil comercial: Becton Dickinson (SUA), Merck (Germania), Remel (SUA),
Biokar Diagnostics (Franţa).

M42 Agar Sabouraud cloramfenicol

Compoziţie
Peptonă
Glucoză
Cloramfenicol
Agar
Apă distilată
10 g
40 g
0,5 g
15 g
ad 1000 ml

Preparare: ingredientele se adaugă în apa distilată preîncălzită, apoi
amestecul se fierbe sub agitare până la completa dizolvare a
acestora; mediul astfel obţinut se repartizează în eprubete sau
flacoane şi se sterilizează prin autoclavare, la 121°C timp de
15 minute.
Aspect: geloză de culoarea chihlimbarului, transparentă
pH final la 25 °C: 5,6 ± 0,2
Controlul calităţii: Candida albicans ATCC 10231 ++
Aspergillus niger ATCC 16404 ++
Trichophyton rubrum ATCC 28188 ++
Escherichia coli ATCC 25922 –
Proteus vulgaris ATCC 13315 –
Utilizare: izolarea unei game largi de fungi patogeni şi oportunişti din
prelevatele patologice
Stocare: în eprubete 4 luni la 2°-8 °C, în plăci o lună la 2°-8°C
Disponibil comercial: Remel (SUA), Biokar Diagnostics (Franţa), Becton Dickinson
(SUA), bioMérieux (Franţa).

M43 Agar Sabouraud Emmons

Compoziţie
Peptonă
Glucoză
Agar
Apă distilată
10 g
20 g
15 g
ad 1000 ml
Luminiţa Malic, Olimpia Bazgan, Mihai Mareş


73
C
a
p
i
t
o
l
u
l
 
3
 

Preparare: ingredientele se adaugă în apa distilată preîncălzită, apoi
amestecul se fierbe sub agitare până la completa dizolvare a
acestora. Se ajustează pH-ul la valoarea 7,0. Mediul astfel
obţinut se repartizează în eprubete sau flacoane şi se
sterilizează prin autoclavare, la 121°C timp de 15 minute.
Aspect: geloză de culoarea chihlimbarului, transparentă
pH final la 25 °C: 7,0 ± 0,2
Controlul calităţii: Candida albicans ATCC 10231 ++
Aspergillus niger ATCC 16404 ++
Trichophyton rubrum ATCC 28188 ++
Escherichia coli ATCC 25922 ±
Proteus vulgaris ATCC 13315 ±
Utilizare: izolarea unei game largi de fungi patogeni şi oportunişti din
prelevatele patologice (variantele aditivate)
Stocare: în eprubete 4 luni la 2°-8 °C, în plăci o lună la 2°-8°C
Disponibil comercial: există numeroase variante îmbunătăţite cu Cloramfenicol,
Gentamicină, Cicloheximidă.

M44 Agar sânge - glucoză - cisteină

Compoziţie
Triptonă agar bază
L-cisteină
Sânge de berbec
defibrinat
Cloramfenicol
Apă deionizată
33 g
1 g
50 ml
0,5 g
ad 1000 ml

Preparare: ingredientele (cu excepţia sângelui) se solubilizează în apa
preîncălzită, apoi se autoclavează timp de 15 minute la 121°C.
După autoclavare, mediul se răceşte lent la 45°-50°C, moment
în care se adaugă sângele şi se omogenizează.
Aspect: geloză de culoare roşie-vie, opacă
pH final la 25
0
C: 7,2 ± 0,2
Controlul calităţii: Escherichia coli ATCC 25922 -
Utilizare: mediu de conversie (folosit pentru transformarea formei
filamentoase în cea levurică) pentru identificarea tulpinilor de
Histoplasma capsulatum, Blastomyces dermatitidis,
Paracoccidioides brasiliensis şi Sporothrix schenckii.
Stocare: în plăci o lună la 2°-8°C
Disponibil comercial: nu se comercializează.



Medii de cultivare

74
M45 Agar selectiv cu triptofan

Este un mediu solid cu o compoziţie simplă, incluzând ca
ingrediente principale doar L-triptofan (0,01%) şi o sursă
lipidică. La pH 5 şi 37
o
C, permite dezvoltarea selectivă a
speciei Malassezia furfur, cu producerea unui pigment brun ce
difuzează în substratul nutritiv subiacent.

M46 Agar Staib (Agar cu infuzie de Niger) Bird seed Agar

Compoziţie
Extract apos din seminţe
de Niger
Glucoză
Fosfat monopotasic
Creatinină
Agar
1000 ml
10 g
1 g
1 g
15 g

Preparare: 50 g seminţe de Niger (Guizotia abyssinica) se autoclavează
într-un litru de apă timp de 10 minute la 115°C, apoi se
filtrează. În acest extract apos se adaugă restul ingredientelor şi
se încălzeşte până la completa dizolvare a acestora. Se readuce
volumul la 1000 ml şi se autoclavează la 121°C timp de 15
minute. Mediul se poate aditiva cu cloramfenicol (500 mg/l).
Aspect: geloză de culoare bej, opalescentă
pH final la 25°C : 5,5- 6,0
Controlul calităţii: Cryptococcus neoformans ATCC 14116: colonii brune, cu
aspect mucoid;
Candida albicans ATCC 10231 : colonii netede, lucioase;
Utilizare: mediu diferenţial pentru Filobasidiella (Cryptococcus)
neoformans; mediul este util şi pentru diferenţierea speciilor
Candida albicans (colonii de tip S, lucioase, similare celor de
pe mediile uzuale de cultivare) şi Candida dubliniensis
(colonii de tip R, majoritatea cu marginile franjurate).
Stocare: în eprubete 2 luni la 2°-8 °C, în plăci o lună la 2°-8°C
Disponibil comercial: Becton - Dickinson (USA)










Luminiţa Malic, Olimpia Bazgan, Mihai Mareş


75
C
a
p
i
t
o
l
u
l
 
3
 
M47 Agar Takaschio (Agar Sabouraud diluat)

Compoziţie
Glucoză
Neopeptonă
Sulfat de magneziu
Fosfat monopotasic
Agar
Apă distilată
2 g
1 g
1 g
1 g
20 g
ad 1000 ml

Preparare: ingredientele se amestecă cu apa distilată preîncălzită, sub
agitare continuă, până la completa lor solubilizare. Se
sterilizează prin autoclavare la 121°C timp de 15 minute.
Aspect: geloză translucidă, de culoare gălbuie
pH final la 25°C: 6,2 ± 0,2
Controlul calităţii: Microsporum canis ATCC 11621 - dezvoltare cu sporulare
intensă
Uitlizare: favorizează sporularea tulpinilor de dermatofiţi
Stocare: în eprubete 4 luni la 2°-8 °C, în plăci o lună la 2°-8°C
Disponibil comercial: nu se comercializează.

M48 Agar Tween 80 (destinat testului de opacifiere)

Compoziţie
Bacto peptonă
Clorură de sodiu
Clorură de calciu
Tween 80
Agar
Apă distilată
10 g
5 g
0,1 g
5 ml
15 g
ad 1000 ml

Preparare: ingredientele (cu excepţia Tween-ului) se dizolvă în apa
distilată preîncălzită şi se fierb un minut. Se sterilizează prin
autoclavare la 121°C timp de 15 minute. Se răceşte la 50°C,
moment în care se adaugă Tween-ul. Mediul se repartizează în
plăci Petri sterile (ø 90 mm), câte 25 ml/placă.
Aspect: geloză transparentă, de culoare galben pai
pH final la 25°C: 6,8
Controlul calităţii: permite dezvoltarea diferitelor specii ale genului Candida, cu
apariţia unui halo opac în jurul coloniilor de levuri secretoare
de esterază (Candida albicans, Candida guilliermondii,
Candida rugosa, Candida tropicalis).
Utilizare: mediul este recomandat pentru diferenţierea tulpinilor de C.
albicans şi C. dubliniensis. Tulpinile de testat se inoculează în
Medii de cultivare

76
puncte separate, iar incubarea se realizează la 30°C timp de 10
zile. Tulpinile de C. albicans şi C. tropicalis determină apariţia
unui halo opac în jurul coloniilor, la 2-3 zile post-inoculare, în
timp ce tulpinile de C. dubliniensis nu pozitivează testul nici în
10 zile post-inoculare. Tulpinile cu acţiune lipolitică secretă o
esterază capabilă să scindeze Tween-ul şi să elibereze acizii
graşi care se vor cupla cu ionii de Ca
2+
formând săruri vizibile
sub forma unei zone de opacifiere în jurul coloniilor. C.
dubliniensis este lipsită de acţiune lipolitică, comportament util
în diferenţierea de C. albicans.
Stocare: 2°-8°C
Disponibil comercial: nu se comercializează.

M49 Agar cu amidon

Compoziţie
Amidon solubil
Extract de drojdie
Agar
Apă distilată
40 g
5 g
20 g
ad 1000 ml

Preparare: substanţele se introduc în apă şi se dizolvă pe baie de apă. Nu
este necesară ajustarea pH-ului care, după sterilizare, are
valoarea 6,5-7.
Aspect: geloză gălbuie, uşor opalescentă
pH final la 25°C: 6,5-7
Controlul calităţii: Fusarium solani ATCC 22278 - dezvoltare cu sporulare
intensă;
Utilizare: mediu destinat stimulării sporulării la fungii filamentoşi
Stocare: în eprubete 4 luni la 2°-8 °C, în plăci o lună la 2°-8°C
Disponibil comercial: nu este disponibil comercial.

M50 Agar – apă de robinet

Compoziţie
Agar
Apă de robinet
15-25 g
ad 1000 ml

Preparare: agarul se dizolvă în apa preîncălzită şi apoi se sterilizează 20
minute la 121°C. Se pot adăuga paie de grâu sau boabe de orez
sterilizate.
Aspect: geloză gălbuie, translucidă
pH final la 25°C: nu se determină
Controlul calităţii: Fusarium solani ATCC 22278 - dezvoltare cu sporulare
Luminiţa Malic, Olimpia Bazgan, Mihai Mareş


77
C
a
p
i
t
o
l
u
l
 
3
 
Utilizare: mulţi fungi sensibili sporulează bine pe acest mediu. Este
utilizat atât pentru izolarea genului Pythium, cât şi pentru
izolarea şi stimularea sporulării la speciile de Fusarium. De
asemenea, transferul pe acest mediu a culturilor pleomorfe ale
dermatofiţilor induce sporularea şi chiar revenirea la tipul
„wild” a speciilor dezvoltate în prealabil pe mediul Sabouraud.
Stocare: în eprubete 4 luni la 2°-8 °C, în plăci o lună la 2°-8°C
Disponibil comercial: nu este disponibil comercial.

M51 Bulion cu uree ( test rapid pentru identificarea levurilor )
(Rapid Urea Broth Test for Yeasts)

Compoziţie
Peptonă
NaCl
Fosfat monopotasic
Roşu fenol
Glucoză
Uree
Apă distilată
1 g
5 g
2 g
0,012 g
1 g
20 g
ad 1000 ml

Preparare: ingredientele (cu excepţia ureei) se solubilizează în 500 ml apă
distilată preîncălzită şi apoi se sterilizează prin autoclavare la
121°C timp de 15 minute. Ureea se solubilizează în apa
distilată rămasă şi se sterilizează prin filtrare, utilizând
membrane cu porozitate de 0,22 µm. Cele două soluţii astfel
obţinute se răcesc la temperatura camerei şi se amestecă sub
protecţia unei hote microbiologice de clasă II; bulionul obţinut
se repartizează în tuburi (câte 3 ml).
Aspect: bulion transparent, de culoare gălbuie
pH final la 25°C: 6,8 ± 0,2
Controlul calităţii : Cryptococcus neoformans ATCC 66031 - ureazo pozitiv (roşu)
Candida albicans ATCC 1023 - ureazo negativ (galben)
Utilizare: diferenţierea tulpinilor levurice ureazo-pozitive de cele ureazo-
negative şi identificarea prezumtivă a unor genuri
(Cryptococcus, Rhodotorula şi Trichosporon )
Stocare: - 20°C timp de 2 luni
Disponibil comercial: Remel (SUA).







Medii de cultivare

78
M52 Bulion Sabouraud

Compoziţie
Peptonă
Glucoză
Apă distilată
10 g
20 g
ad 1000 ml

Preparare: ingredientele se solubilizează în apa distilată preîncălzită, apoi
mediul astfel obţinut se repartizează în eprubete, în volum de
câte 5 ml. Se sterilizează prin autoclavare, la 121°C timp de 15
minute.
Aspect: bulion de culoare gălbuie, transparent
pH final la 25 °C: 5,6 ± 0,2
Controlul calităţii: Candida albicans ATCC 10231 ++
Aspergillus niger ATCC 16404 ++
Utilizare: purificarea suşelor de fungi contaminate cu bacterii; în acest
caz mediul se aditivează cu acid clorhidric 1N
Stocarea: o lună la temperatura de refrigerare
Disponibil comercial: Remel (SUA), Biokar Diagnostics (Franţa), Becton Dickinson
(SUA),bioMérieux (Franţa).

M53 CHROMagar Candida

Compoziţie
Peptonă
Amestec cromogen
Cloramfenicol
Agar
Apă purificată
10 g
22 g
0,5 g
15 g
ad 1000 ml

Preparare: ingredientele se dizolvă în apa distilată şi se fierb un minut
până la completa solubilizare. Se autoclavează la 121°C timp
de 15 minute. Se adaugă neomicină, 500 µg/ml, în momentul
răcirii mediului la o temperatură de 50°-55°C.
Aspect: transparent, uşor opalescent
pH final la 25
0
C: 6,1 ± 0,1
Controlul calităţii: Candida albicans ATCC 10231 ++
Candida tropicalis ATCC 1369 ++
Candida krusei ATCC 34135 ++
Utilizare: izolarea levurilor din prelevatele patologice şi identificarea
speciilor: C. albicans - colonii de culoare verde-smarald, C.
krusei - colonii de tip R de culoare roz-pal, albicioase la
periferie, C.tropicalis - colonii de culoare albastru-verzui până
la albastru-metalizat, C.glabrata – colonii mate de culoare
violet deschis (lila);
Luminiţa Malic, Olimpia Bazgan, Mihai Mareş


79
C
a
p
i
t
o
l
u
l
 
3
 
Stocare: în plăci, 2 luni, la temperatura de refrigerare
Disponibil comercial: Becton Dickinson (SUA)

M54 Cireşe - Agar

Compoziţie
Extract de cireşe
Agar
Apă distilată
300 ml
20 g
ad 1000 ml

Preparare: obţinerea extractului de cireşe - se scot sâmburii din fructele
roşii, la 450 g pulpă de cireşe adăugându-se 1000 ml apă
distilată. Amestecul se fierbe înnăbuşit 2 ore. Se filtrează prin
tifon şi se sterilizează o oră la 110°C. Extractul se păstrează în
flacoane, la frigider. Se dizolvă agarul în apă şi se adaugă
extractul. Se distribuie în eprubete sterilizate şi se autoclavează
5 minute la 120°C. Nu se supraîncălzeşte deoarece reacţia
acidă a mediului împiedică solidificarea.
Aspect: geloză roşiatică, translucidă
pH final la 25°C: 3,5 - 4,6
Utilizare: favorizează sporularea la fungii filamentoşi superiori
Stocare: în eprubete 4 luni la 2°-8°C, în plăci o lună la 2°-8°C
Disponibil comercial: nu este disponibil comercial.

M55 Agar – glicerină

Compoziţie
Glicerină
Sucroză
Peptonă
MgSO
4
x 7H
2
O
KH
2
PO
4
NaCl
Agar
Apă distilată
7,5 g
7,5 g
5,0 g
0,05 g
0,06 g
4,0 g
20,0 g
ad 1000 ml

Preparare: glicerina, sucroza, sulfatul de magneziu şi fosfatul de potasiu
se adaugă în 200 ml apă. Se omogenizează peptona şi clorura
de sodiu cu 200 ml apă preîncălzită la 60°C şi se adaugă peste
prima soluţie. Agarul se dizolvă în 600 ml apă şi apoi se
amestecă cu celelalte soluţii. Nu se ajustează pH-ul.
Autoclavarea mediului se face la 121°C timp de 20 minute.
Aspect: geloză gălbuie, uşor opalescentă
pH final la 25°C: nu se determină
Medii de cultivare

80
Controlul calităţii: Aspergillus niger ATCC 16404 ++
Utilizare: cultivarea şi identificarea speciilor aparţinând genului
Aspergillus.

M56 Infuzie de cartofi

Compoziţie
Cartofi
Apă de robinet
300 g
900 ml

Preparare: se lasă cartofii taiaţi, în apă, la frigider, timp de 24 de ore, după
care se filtrează şi se autoclavează infuzia 1 oră la 110
0
C.
Aspect: lichid alb-gălbui, translucid
pH final la 25°C : nu se determină
Controlul calităţii: nu se realizează
Utilizare: pentru prepararea mediului PDA
Stocare: se recomandă utilizarea imediată
Disponibil comercial: nu se comercializează.

M57 Malţ agar (Malt Agar)

Compoziţie
Extract de malţ
Agar
Apă distilată
30,0 g
15,0 g
ad 1000 ml

Preparare: ingredientele se dizolvă în apa distilată, amestecând continuu,
cu menţinerea temperaturii de fierbere timp de un minut.
Autoclavarea are loc la o temperatură de 121
o
C timp de 15
minute. Mediul nu se va reîncălzi.
Aspect: geloză de culoarea chihlimbarului, uşor opalescentă
pH final la 25ºC: 5,5 ± 0,2
Controlul calităţii: Aspergillus niger ATCC 16404 ++
Candida albicans ATCC 10231 ++
Saccharomyces cerevisiae ATCC 9763 +
Utilizare: mediu pentru conservarea fungilor şi pentru studierea
caracterelor morfologice ale acestora în vederea identificării
Stocare: în eprubete 2 luni la 2°-8 °C, în plăci o lună la 2°-8°C
Disponibil comercial: Merck (Germania), Remel (SUA), Biokar Diagnostics
(Franţa).




Luminiţa Malic, Olimpia Bazgan, Mihai Mareş


81
C
a
p
i
t
o
l
u
l
 
3
 
M58 Malţ extract agar (Malt Extract Agar)

Compoziţie
Maltoză
Dextrină
Glicerol
Peptonă
Agar
Apă distilată
12,75 g
2,75 g
2,35 g
0,78 g
15,0 g
ad 1000 ml

Preparare: ingredientele se dizolvă în apa distilată, amestecând continuu,
cu menţinerea temperaturii de fierbere timp de un minut.
Autoclavarea are loc la o temperatură de 121
o
C timp de 15
minute.
Aspect: geloză de culoarea chihlimbarului, transparentă
pH final la 25ºC: 4,7 ± 0,2
Controlul calităţii: Aspergillus niger ATCC 16404 ++
Candida albicans ATCC 10231 ++
Saccharomyces cerevisiae ATCC 9763 +
Utilizare: mediu pentru cultivarea, identificarea şi aprecierea cantitativă a
fungilor filamentoşi şi levuriformi
Stocare: în eprubete 2 luni la 2°-8°C, în plăci o lună la 2°-8°C
Disponibil comercial: Remel (SUA), Becton Dickinson (SUA), Merck (Germania)






















Medii de cultivare

82
M59 Mediu bază pentru levuri
(Yeast Carbon Base)

Compoziţie
Dextroză
L-histidină
monohidroclorică
LD-metionină
LD-triptofan
Biotină
Calciu pantotenic
Acid folic
Inozitol
Niacină
Acid p-amino benzoic
Piridoxină hidroclorică
Riboflavin
Tiamină hidroclorică
Acid boric
Sulfat de cupru
Iodură de potasiu
Clorură ferică
Sulfat de mangan
Molibdat de sodiu
Sulfat de zinc
Fosfat monopotasic
Sulfat de magneziu
Clorură de sodiu
Clorură de calciu
Apă distilată
10,0 g
1,0 g
2,0 mg
2,0 mg
2,0 µg
400,0 µg
2,0 µg
2000,0 µg
400,0 µg
200,0 µg
400,0 µg
200,0 µg
400,0 µg
500,0 µg
40,0 µg
100,0 µg
200,0 µg
400,0 µg
200,0 µg
400,0 µg
1,0 g
0,5 g
0,1 g
0,1 g
ad 1000 ml

Preparare: în vederea sterilizării prin filtrare se prepară o soluţie de
concentraţie 10 x prin dizolvarea a 11,7 g pulbere în 100 ml
apă distilată preîncălzită. Apoi se filtrează utilizând filtre cu
porozitate de 0,2 µm. Varianta de lucru se prepară prin
adăugarea de apă distilată sterilizată în proporţie de 9 volume
la un volum mediu concentrat.
Aspect: bulion transparent, de culoare galben-pai
pH final la 25°C: 5,5 ± 0,2
Utilizare: mediu bază pentru auxonograma levurilor
Stocare: 2°- 8°C
Disponibil comercial: Difco (SUA)




Luminiţa Malic, Olimpia Bazgan, Mihai Mareş


83
C
a
p
i
t
o
l
u
l
 
3
 
M60 AM3
(Antibiotic medium 3)

Compoziţie
Extract de carne pulbere
Extract de drojdii
Peptonă
Dextroză
Clorură de sodiu
Fosfat dipotasic
Fosfat monopotasic
Apă distilată
5,0 g
1,5 g
5,0 g
1,0 g
3,5 g
3,68 g
1,32 g
ad 1000 ml

Preparare: ingredientele se dizolvă în apă distilată preîncălzită sub agitare
continuă. Se repartizează în tuburi sau flacoane şi se
autoclavează la 121°C timp de 15 minute.
Aspect: mediu transparent de culoarea chihlimbarului
pH final la 25
0
C: 7,0 ± 0,5
Controlul calităţii: incubare la 35
0
C ± 2
0
C / 24 ore
Escherichia coli ATCC 10536 +
Staphylococcus aureus ATCC 6538 +
Candida albicans ATCC 10231 +
Utilizare: mediu destinat depistării rezistenţei la amfotericină prin
metoda benzilor E-test.
Stocare: 2°-8°C
Disponibil comercial: Becton Dickenson (SUA)

M61 Mediu sintetic pentru testul de filamentare

Compoziţie
Glucoză
Fosfat monopotasic
Clorură de calciu
Sulfat de magneziu
Sulfat de amoniu
Apă distilată
0,5 g
2,0 g
0,05 g
0,05 g
0,5 g
ad 1000 ml

Preparare: după solubilizarea glucozei şi a tuturor sărurilor, pH-ul se
ajustează la 6,75 cu ajutorul unei soluţii de hidroxid de potasiu
2M şi amestecul se sterilizează prin autoclavare
Aspect: mediu lichid, transparent
pH final la 25°C: 6,75-6,80
Controlul calităţii: Candida albicans ATCC 10231 ++
Candida parapsilosis ATCC 22019 ++
Medii de cultivare

84
Utilizare: permite producerea de tubi germinativi la tulpinile de Candida
albicans, prin incubare pe baia de apă, la 37°C timp de 4 ore.
Este utilizat pentru trierea selectivă a tulpinilor levurice şi
identificarea prezumtivă a speciilor C. albicans şi C.
dubliniensis (diferenţierea între acestea necesită teste
suplimentare).
Stocare: în eprubete 4 luni la 2°-8°C, în plăci o lună la 2°-8°C
Disponibil comercial: nu este disponibil comercial.

M62 Mediul Bilai

Compoziţie
KH
2
PO
4
KNO
3

MgSO
4
x 7H
2
O
KCl
Amidon pudră
Glucoză
Sucroză
Agar
Apă distilată
1 g
1 g
0,5 g
0,5 g
0,2 g
0,2 g
0,2 g
18,0 g
ad 1000 ml

Preparare: ingredientele se dizolvă în apa distilată preîncălzită, se fierb un
minut, apoi se autoclavează la 121°C timp de 15 minute.
Aspect: geloză albicioasă, opalescentă
pH final la 25°C: nu se determină
Controlul calităţii: Fusarium solani ATCC 22278 - dezvoltare cu sporulare
intensă
Utilizare: mediul induce formarea conidiilor la Fusarium
Stocare: în eprubete 4 luni la 2-8 °C, în plăci o lună la 2-8°C
Disponibil comercial: nu este disponibil comercial.

M63 Mediu cu lapte diluat

Compoziţie
Lapte natural pasteurizat
Cloramfenicol
Apă distilată sterilă
170 ml
0,250 g
ad 1000 ml

Preparare: ingredientele se omogenizează sub protecţia unei hote cu flux
laminar de clasă II şi se repartizează în flacoane. Este
obligatorie folosirea laptelui pasteurizat UHT, deoarece este
steril.
Aspect: mediu lichid, de culoare albă, opac
Luminiţa Malic, Olimpia Bazgan, Mihai Mareş


85
C
a
p
i
t
o
l
u
l
 
3
 
Controlul calităţii: Candida albicans ATCC 10231 (dezvoltare abundentă, cu
producere de pseudomiceliu şi clamidospori)
Utilizare: mediu recomandat pentru studierea caracterelor morfologice la
levuri (clamidospori, hife, pseudohife, blastoconidii,
artrospori). În acest scop se suspensionează o colonie tânără în
3-4 ml mediu şi se incubează la 28°-30°C timp de 24-48 ore.
Se observă la microscop între lamă şi lamelă (x100 ... x400).
Stocare: 2°-8°C
Disponibil comercial: nu se comercializează.

M64 Mediu cu pâine

Felii de pâine se taie în formă de prisme de 5 cm lungime şi 1
cm lăţime. Se introduc în eprubete şi se adaugă apă. Pentru
sterilizare se încălzeşte treptat pentru a evita fărâmiţarea
miezului. Folosind cantităţi variabile de apă se obţine
sporularea speciilor higrofile, mezofile, xerofile, în special la
Aspergillus, Penicillium şi Mucor; mediu utilizat de asemenea
pentru izolarea zygomicetelor din infecţii cerebrale
(fragmentele de ţesut cerebral cu dimensiuni de câţiva mm
diametru se însămânţează în mai multe puncte, pe fragmentele
de pâine, apoi se incubează la 37°C).
Stocare: în eprubete 4 luni la 2°-8°C, în plăci o lună la 2°-8°C
Disponibil comercial: nu este disponibil comercial.

M65 Mediu cu sol

Solul (pământ de grădină cernut printr-o sită fină) se introduce
în eprubete sau flacoane şi se sterilizează 30 de minute la
121°C. După 7 zile se sterilizează din nou pentru a distruge
toate microorganismele termorezistente care au supravieţuit
primei sterilizări. Se inoculează solul şi se umezeşte în acelaşi
timp cu 2-3 ml suspensie de spori. Se incubează culturile 10-14
zile apoi se păstrează la 3°-6°C. Mediul este recomandat
pentru conservarea fungilor.
Stocare: în eprubete 4 luni la 2°-8°C, în plăci o lună la 2°-8°C
Disponibil comercial: nu este disponibil comercial.









Medii de cultivare

86
M66 Bulion / Agar Czapek-Dox (Czapek - Dox Broth / Agar)

Compoziţie
Zaharoză
Nitrat de sodiu
Fosfat dipotasic
Sulfat de magneziu
Clorură de potasiu
Sulfat feric
Apă distilată
30,0 g
3,0 g
1,0 g
0,5 g
0,5 g
0,01 g
ad 1000 ml

Preparare: ingredientele se dizolvă în apa distilată, amestecând continuu,
cu menţinerea temperaturii de fierbere timp de un minut.
Autoclavarea are loc la o temperatură de 121
o
C timp de 15
minute; în cazul mediului solid se adaugă 15 g agar.
Aspect: transparent, uşor opalescent; uneori poate prezenta un uşor
precipitat
pH final la 25
o
C: 7,3 ± 0,2
Controlul calităţii: Aspergillus niger ATCC 9642 ++
Candida albicans ATCC 10231 ++
Candida tropicalis ATCC 750 ++
Saccharomyces cerevisiae ATCC 9763++
Utilizare: mediu utilizat pentru izolarea fungilor aparţinând speciilor
Aspergillus, Penicillium şi Paecilomyces din probele de apă
conform unor standarde; mediu pentru identificarea tulpinilor
de Aspergillus
Stocare: în eprubete 2 luni la 2°-8 °C, în plăci o lună la 2°-8°C
Disponibil comercial: Merck (Germania), Remel (SUA), Biokar Diagnostics (Franţa).

M67 Mediul Kurung-Yegian

Compoziţie soluţia A
Fulgi de cartofi
Apă deionizată
5 g
500 ml

Compoziţie soluţia B
Melanj de ouă
Gălbenuş de ou
250 ml
500 ml

Preparare: se prepară separat cele două soluţii, apoi se amestecă şi se
repartizează în tuburi. Se sterilizează prin autoclavare la
110°C timp de 10 minute.
Aspect: mediu în tuburi, turnat în pantă, de culoare galbenă, opac
Luminiţa Malic, Olimpia Bazgan, Mihai Mareş


87
C
a
p
i
t
o
l
u
l
 
3
 
pH final la 25°C : 6,6 ± 0,2
Utilizare: asigură conversia la forma levurică în cazul speciilor
Histoplasma capsulatum şi Blastomyces dermatitidis
Stocare: în eprubete o lună la 2°-8°C
Disponibil comercial: nu se comercializează.

M68 Mediul Nikersen-Mankovski

Compoziţie
Fosfat monopotasic
Sulfat de amoniu
Biotină
Albastru de tripan
Agar
Apă distilată
1,0 g
1,0 g
5,0 g
0,10 g
15,0 g
ad 1000 ml

Preparare: se solubilizează toate substanţele în apa distilată preîncălzită.
Se sterilizează prin autoclavare la 121°C timp de 15 minute.
Mediului răcit (la 50°C) i se adaugă 20 g glicogen sau amidon
purificat şi sterilizat prin tindalizare.
Aspect: geloză opalescentă, de culoare bleu- pal
Controlul calităţii: Candida albicans ATCC 10231 dezvoltă clamidospori în 24-
48 de ore de incubare la 25°C
Utilizare: mediu destinat stimulării producerii de clamidospori la levuri
Stocare: 2°-8°C
Disponibil comercial: nu se comercializează.

M69 Mediul Pagano-Levin (TTC Sabouraud Agar)

Compoziţie
Peptonă
Dextroză
Agar
Clorură de
trifeniltetrazoliu sol.1%
(TTC)
Neomicină sau
Cloramfenicol
Apă distilată
10,0 g
40,0 g
15,0 g
10 ml
0,5 g
ad 1000 ml

Preparare: ingredientele se dizolvă în apa distilată, amestecând continuu,
cu menţinerea temperaturii de fierbere timp de un minut.
Autoclavarea are loc la o temperatură de 115
o
C timp de 15
Medii de cultivare

88
minute. La temperatura de 50°-55°C se adugă sol. 1% TTC şi
antibioticul.
Aspect: geloză transparentă, de culoare slab gălbuie, opalescentă
pH final la 25
0
C: 5,6 ± 0,2
Controlul calităţii: Candida albicans ATCC 26790 ++
Candida albicans ATCC 36232 ++
Candida krusei ATCC 34135 ++
Escherichia coli ATCC 25922 –
Utilizare: acest mediu diferenţial este recomandat pentru identificarea
speciei Candida albicans din prelevatele patologice. Tulpinile
acestei specii prezintă pe mediul Pagano-Levin culoarea alb-
deschis, în timp ce alte specii din genul Candida prezintă
colonii roz, de diferite nuanţe.
Stocare: în plăci o lună la 2°-8°C
Disponibil comercial: bioMérieux (Franţa).

M70 Mediu pentru izolarea dermatofiţilor (DTM)

Compoziţie
Peptonă din soia
Dextroză
Roşu fenol
Cicloheximidă
Cloramfenicol
Agar
Apă distilată
10,0 g
10,0 g
0,2 g
0,5 g
0,1 g
20,0 g
ad 1000 ml

Preparare: ingredientele se dizolvă în apa distilată, amestecând continuu,
cu menţinerea temperaturii de fierbere timp de un minut.
Autoclavarea are loc la o temperatură de 121
o
C timp de 15
minute
Aspect: agar galben-portocaliu, uşor opalescent
pH final la 25ºC: 5,5 ± 0,2
Controlul calităţii: Aspergillus niger ATCC 16404 ±
Microsporum audouinii ATCC 9079 ++
Pseudomonas aeruginosa ATCC 10145 ±
Trichophyton mentagrophytes ATCC 9533 ++
Utilizare: mediu selectiv şi diferenţial pentru izolarea şi identificarea
dermatofiţilor din prelevatele clinice
Stocare: în eprubete 2 luni la 2°-8 °C, în plăci o lună la 2°-8°C
Disponibil comercial: Remel (SUA), Becton – Dickinson (SUA)





Luminiţa Malic, Olimpia Bazgan, Mihai Mareş


89
C
a
p
i
t
o
l
u
l
 
3
 
M71 Mediul RPMI 1640 - MOPS (CLSI)

Compoziţie
Mediu RPMI 1640
MOPS
Apă distilată
10,4 g
34,53 g
ad 1000 ml

Preparare: se amestecă ingredientele sub agitare continuă până la
completa dizolvare. La 25
0
C se ajustează pH-ul la valoarea 7,0
cu ajutorul unei soluţii de NaOH 1M. Se sterilizează prin
filtrare utilizând un filtru cu porozitate 0,2 µm. Se stochează la
4°C până la utilizare. Înainte de utilizare se testează sterilitatea
şi pH-ul .
Aspect: bulion transparent, de culoare roşiatică
pH final la 25
0
C: 6,9 - 7,1
Controlul calităţii: trebuie să se obţină CMI-urile recomandate pentru tulpinile
test.
Utilizare: mediu destinat testării susceptibilităţii la antifungice prin
tehnicile CLSI
Stocare: 2°C–8°C
Disponibil comercial: nu se comercializează.

M72 Mediul RPMI 1640 - MOPS ( EUCAST)

Compoziţie mediu concentraţie uzuală 1X
Mediu RPMI 1640
MOPS
Glucoză
Apă distilată
10,4 g
34,53 g
18 g
ad 1000 ml


Compoziţie mediu dublu concentrat 2X
Mediu RPMI 1640
MOPS
Glucoză
Apă distilată
20,8 g
69,06 g
36 g
ad 1000 ml

Preparare: se adaugă ingredientele în apă bidistilată, amestecându-se
continuu până la dizolvarea lor completă. Se ajustează pH-ul la
valoarea 7,0 folosind NaOH soluţie 1 M. se completează cu
apă bidistilată până la 1 litru. Se sterilizează prin filtrare,
utilizând un filtru cu porozitate 0,22 µm. Se păstrează la 4°C
până în momentul folosirii. Înainte de utilizare, se testează
sterilitatea mediului şi se verifică pH-ul.
Medii de cultivare

90
Aspect: bulion transparent de culoare roşiatică
pH final la 25
0
C: 6,9- 7,1
Controlul calităţii: trebuie să se obţină CMI-urile recomandate pentru tulpinile test
Utilizare: mediu destinat testării susceptibilităţii la antifungice prin
tehnicile EUCAST
Stocare: 2°-8°C
Disponibil comercial: nu se comercializează.

M73 Agar RPMI - MOPS - glucoză 2 %

Compoziţie
Mediu RPMI 1640
(cu L-glutamină şi roşu
fenol, fără bicarbonat)
MOPS
Glucoză
Agar pulbere
NaOH soluţie 1M
Apă distilată
8,4 g
34,5 g
20,0 g
15,0 g
80-90 ml
ad 1000 ml

Preparare: se dizolvă pulberile de RPMI şi MOPS în cca. 450 ml apă
distilată şi se sterilizează prin filtrare utilizând un filtru cu
porozitate 0,2 µm. Se solubilizează glucoza şi agarul în cca.
450 ml apă distilată şi se sterilizează prin autoclavare timp de
15 minute la 121°C; se răceşte apoi amestecul la 45°-50°C. Se
încălzeşte lent soluţia conţinând RPMI şi MOPS la cca. 45°C
şi se amestecă cu cea care conţine glucoza şi agarul, sub
protecţia unei hote microbiologice de clasă II. Se ajustează
pH-ul amestecului la valoarea 7,0 utilizând soluţie NaOH 1M,
şi se aduce volumul final al amestecului la 1000 ml. Se toarnă
mediul în plăci Petri (cca. 60 ml/ placă ø 150 mm sau cca 25
ml / placă Petri ø 90 mm, sub protecţia lămpii UV, utilizând o
hotă microbiologică de clasă II. Se stochează la 4°C.
Aspect: geloză translucidă, de culoare roşiatică
pH final la 25
0
C: 6,9-7,1
Controlul calităţii: se realizează cu benzi E-Test la 48 ore










Luminiţa Malic, Olimpia Bazgan, Mihai Mareş


91
C
a
p
i
t
o
l
u
l
 
3
 
Intervalul CMI (µg/ ml)

Tulpina test FC AP FL IT VO
C.parapsilosis
ATCC 22019
0,064 -
0,258
0,25 - 1
1 - 4 (rar
colonii
izolate la
8)
0,064 -
0,25
0,016 -
0,064
C.krusei
ATCC 6258
≥ 32 0,5 - 2 128 -≥256 0,25 - 1 0,25 - 1
C.albicans
ATCC 90028
0,5 - 2 0,125 -0,5 0,125 -0,5
0,064 -
0,25
0,004 -
0,016

Utilizare: mediu destinat testării susceptibilităţii la antifungice cu benzi
E-test
Stocare: 2°-8°C
Disponibil comercial: AES Laboratoire (Franţa)

M74 Agar Dicloran - Rose Bengal - cloramfenicol
(DRBC Agar)

Compoziţie
Peptonă proteazică 3
Dextroză
Fosfat monopotasic
Sulfat de magneziu
Dicloran
Roz Bengal
Cloramfenicol
Agar
Apă distilată
5,0 g
10,0 g
1,0 g
0,5 g
2,0 m g
25,0 m g
0,1 g
15,0 g
ad 1000 ml

Preparare: ingredientele se dizolvă în apa distilată, amestecând continuu,
cu menţinerea temperaturii de fierbere timp de un minut.
Autoclavarea are loc la o temperatură de 121
o
C timp de 15
minute
Aspect: geloză de culoare roz, transparentă sau uşor opalescentă
Medii de cultivare

92
pH final la 25ºC: 5,6 ± 0,2
Controlul calităţii: Aspergillus niger ATCC 1015 - colonii albe
Candida albicans ATCC 10231 - colonii roz.
Escherichia coli ATCC 25922 -
Micrococcus luteus ATCC 10240 -
Utilizare: mediu pentru cultivarea şi identificarea fungilor filamentoşi
Stocare: în eprubete 2 luni la 2°-8°C, în plăci o lună la 2°-8°C
Disponibil comercial: Remel (SUA), Biokar Diagnostics (Franţa).

M75 Trichophyton Agar 1-7

* Trichophyton Agar 1

Compoziţie
Aminoacizi Casamino
Difco
Dextroză
Fosfat monopotasic
Sulfat de magneziu
Agar
Apă distilată
2,5 g
40,0 g
1,8 g
0,1 g
15,0 g
ad 1000 ml

* Trichophyton Agar 2

Compoziţie
Aminoacizi Casamino
Difco
Dextroză
Fosfat monopotasic
Sulfat de magneziu
Agar
Inozitol
Apă distilată
2,5 g
40,0 g
1,8 g
0,1 g
15,0 g
50,0 mg
ad 1000 ml












Luminiţa Malic, Olimpia Bazgan, Mihai Mareş


93
C
a
p
i
t
o
l
u
l
 
3
 
* Trichophyton Agar 3

Compoziţie
Aminoacizi Casamino
Difco
Dextroză
Fosfat monopotasic
Sulfat de magneziu
Agar
Inozitol
Tiamina HCL
Apă distilată
2,5 g
40,0 g
1,8 g
0,1 g
15,0 g
50,0 mg
200 µg
ad 1000 ml

* Trichophyton Agar 4

Compoziţie
Aminoacizi Casamino
Difco
Dextroză
Fosfat monopotasic
Sulfat de magneziu
Agar
Tiamină HCl
Apă distilată
2,5 g
40,0 g
1,8 g
0,1 g
15,0 g
200 µg
ad 1000 ml

* Trichophyton Agar 5

Compoziţie
Aminoacizi Casamino
Difco
Dextroză
Fosfat monopotasic
Sulfat de magneziu
Acid nicotinic
Agar
Apă distilată
2,5 g
40,0 g
1,8 g
0,1 g
200 µg
15,0 g
ad 1000 ml








Medii de cultivare

94
* Trichophyton Agar 6

Compoziţie
Nitrat de amoniu
Dextroză
Fosfat monopotasic
Sulfat de magneziu
Agar
Apă distilată
1,5 g
40,0 g
1,8 g
0,1 g
15,0 g
ad 1000 ml

* Trichophyton Agar 7

Compoziţie
Nitrat de amoniu
Histidină HCl
Dextroză
Fosfat monopotasic
Sulfat de magneziu
Agar
Apă distilată
1,5 g
30,0 mg
40,0 g
1,8 g
0,1 g
15,0 g
ad 1000 ml

Preparare: ingredientele se amestecă cu apa distilată până la completa
dizolvare şi se fierb un minut. Se autoclavează la 121ºC timp
de 12 minute.
Aspect: geloză gălbuie, uşor opalescentă
pH final la 25ºC: 6,8 ± 0,2
Controlul calităţii: Trichophyton concentricum ATCC 9358 ++
Trichophyton schoenleinii ATCC 4822 ++
Trichophyton verrucosum ATCC 34470 ++
Utilizare: cultivarea şi identificarea speciilor aparţinând genului
Trichophyton
Stocare: în eprubete 4 luni la 2°-8°C, în plăci o lună la 2°-8°C
Disponibil comercial: Difco (SUA)

M76 Agar peptonă 3% (Agar Sabouraud conservare)

Compoziţie
Peptonă
Agar
Apă distilată
30,0 g
20,0 g
ad 1000 ml

Preparare: ingredientele se dizolvă în apa distilată, amestecând continuu,
cu menţinerea temperaturii de fierbere timp de un minut.
Luminiţa Malic, Olimpia Bazgan, Mihai Mareş


95
C
a
p
i
t
o
l
u
l
 
3
 
Autoclavarea are loc la o temperatură de 121
o
C timp de 15
minute.
Aspect: geloză de culoare galben-pal, translucidă
pH final la 25ºC: nu se determină
Controlul calităţii: M. persicolor - colonii cu tentă roz-lila
Utilizare: mediu pentru diferenţierea M. persicolor de T. mentagrophytes
şi pentru conservarea suşelor de dermatofiţi
Stocare: în eprubete 2 luni la 2°-8°C, în plăci o lună la 2°-8°C
Disponibil comercial: nu se comercializează


































Medii de cultivare

96
Bibliografie selectivă

1. Abildgren M P, Lund F, Thrane U, Elmhold S (1987) - Czapek-Dox agar
containing iprodione and dicloran as a selective medium for the isolation
of Fusarium species; Lett Appl Microbiol; 5:83-86.
2. Acha P N, Szyfrer B (1989) - Zoonoses et maladies transmissibles
communes à l’homme et aux animaux; Office International des
Epizooties; 2
nd
edition; Paris.
3. Andrews S (1992) - Differentiation of Alternaria species isolated from
cereals on dichloran malt extract agar. In Modern Methods in Food
Mycology, Samson R A, Hocking A D, Pitt J I, King A D (eds.); Ed.
Elsevier, Amsterda; 351-355.
4. Andrews S, Pitt J I (1986) - Selective medium for the isolation of
Fusarium species and dematiaceous Hyphomycetes from cereals; Appl
Environ Microbiol; 51:1235-1238.
5. Baertschi C, Berthier J, Guiguettaz C, Valla G (1989) - A selective
medium for the isolation and enumeration of Mucor species; Mycological
Research; 95:373-374.
6. Baron E J, Peterson L R, Finegold S M (1994) - Bailay & Scott’s
diagnostic microbiology; 9
nd
edition. Mosby-Year Book; Inc; St. Louis;
M.O.
7. Barr F S, Collins G F (1996) - A rapid method for isolation and
identification of Candida; J Southern Med Assoc; 59:694-695.
8. Baumgartner C, Freydiere A-M, Gille Y (1996) - Direct identification and
recognition of yeast species from clinical material by using Albicans ID
and CHROMagar Candida plates; J Clin Microbiol; 34:456-465.
9. Bensignore E, Feuilhade de Chauvin M (1999) - Microsporum persicolor
(Sabouraud) Guiard et Grigorakis 1929 chez l’animal et chez l’homme:
etude in vitro et revue de la littérature; Rec Méd Vét; 175(1-2):45-60.
10. Booth C (1971) - Fungal culture media. In Methods in Microbiology, ed.
Booth C; Academic Press, London; 49-94.
11. Buiuc D, Neguţ M (1999) - Tratat de microbiologie clinică; Ed. Medicală;
Bucureşti.
12. Chabasse D (Editor) (2004) - Les dermatophytes; Cahier de formation en
Biologie médicale; Bioforma; Paris; No. 31.
13. Chabasse D, Cimon B, Gentile L, Bouchara J P (1991) - Les mycoses
transmisées d’animal à l’homme; Revue française des laboratoires;
10(228):77-83.
14. Chermette R, Bussieras J (1993) - Abrégé de parasitologie vétérinaire;
Fasc. V; Mycologie vétérinaire; ENV d’Alfort; Paris.
15. Coman I, Mareş M (2000) - Micologie medicală aplicată; Ed. Junimea,
Iaşi.
16. Constantinescu O (1974) - Metode şi tehnici în micologie; Ed. Ceres;
Bucureşti.
Luminiţa Malic, Olimpia Bazgan, Mihai Mareş


97
C
a
p
i
t
o
l
u
l
 
3
 
17. Costa S O, de Lourdes Branco C (1964) - Evaluation of a molybdenum
culture medium as selective and differential for yeasts; J Pathol Bacteriol;
87:428-431.
18. Cutsem Van J, Rochette F (1992) - Mycoses des animaux domestiques;
Janssen Researchers Foundation.
19. Freydière A M, Guinet R (1997) - Rapid methods for identification of the
most frequent clinical yeasts; Rev Iberoam Micol; 14:85-89.
20. Freydiere A-M, Rousselle P, Gille P (1995) - Apport des milieux
d’identification rapide de Candida albicans: Fluoroplate et Albicans ID; J
Med Mycol; 5:190-191.
21. Garcia-Martos P, Garcia-Agudo R, Hermandez- Molina J M et al. (1998) -
Identificacion de levadudas de interes clinico en el medio de cultivo
CHROMagar Candida; Rev Iberoam Micol; 15:131-135.
22. Golăescu M (1997) - Diagnosticul şi tratamentul micozelor interne; Ed.
Viaţa Medicală Românească; Bucureşti.
23. Grillot R (1996) - Les Mycoses humaines: demarche diagnostique; Ed.
Elsevier, Paris.
24. Gueho E, Midgley G, Guillot J (1996) - The genus Malassezia with
description of four new species; Antonie van Leeuwenhoek; 69:337-355.
25. Guillot J, Gueho E, Mialot M, Chermette R (1998) - Importance des
levures du genre Malassezia en dermatologie vétérinaire; Le point
Vétérinaire; 29:691-701.
26. Hocking A D, Pitt J I (1980) - Dichloran-sucrose agar, a differential
medium for enumeration of xerophilic fungi from low-moisture foods.
Appl Environ Microbiol; 39:488-492.
27. Hoog de G S, Guarro J, Gené, Figueras M J (2000) - Atlas of clinical
fungi; 2
nd
edition; Centraalbureau voor Schimmelcultures / Universitat
Rovira i Virgili.
28. Hopfer R L, Blank F (1975) - Caffeic acid - containing medium for
identification of Cryptococcus neoformans; J Clin Microbiol; 2:1158-
1200.
29. Jacquemin P, Jacquemin J L (1974) - Abrégé de parasitologie clinique;
Masson et C
ie
; Paris.
30. Jarvis B (1973) - Comparison of an improved rose bengal-chlortetracycline
agar with other media for the selective isolation and anumeration of
moulds and yeasts in foods; J Appl Bacteriol; 36:723-727.
31. Kane J (1984) - Conversion of Balstomyces dermatitidis to the yest form at
37ºC and 26ºC; J Clin Microbiol; 20:594-596.
32. King A D,Hocking A D, Pitt J I (1979) - Dichloran-rose bengal medium
for enumeration and isolation of moulds from foods; Appl Environ
Microbiol; 37:959-964.
33. Kumar Girish C P, Menon T (2005) - Tobacco agar: a new medium for
chlamydosporulation in Candida albicans and Candida dubliniensis; Med
Mycol; 43(5):473-475.
Medii de cultivare

98
34. Kurtzman C P, Boekhout T, Robert V, Fell W, Deak T (2003) - Methods
to identify yeasts. In Boekhout T, Robert V (eds) - Yeasts in Food; B
Behr’s Verlag GmbH & Co; Hamburg; Germany.
35. Kurung J M, Yegian D (1954) - Medium for maintenance and conversion
of Histoplasma capsulatum to the yeast like phase; Am J Clin Pathol;
24:505-508.
36. Kwon-Chung K J, Bennett J E (1992) - Medical Mycology; Lea & Febiger;
Philadelphia.
37. Leeming J P, Notman F H (1987) - Improved methods for isolation and
enumeration of Malassezia furfur from human skin; J Clin Microbiol;
25:2017-2019.
38. Martin M V, Schneidau J D (1970) - A simple and reliable assimilation
test for the identification of Candida species; Am J Clin Pathol; 53:875-
879.
39. Mayser P, Wille G, Imkampe A., Thoma W et al. (1998) - Synthesis of
fluorchromes and pigments in Malassezia furfur by use of triptophane as
single nitrogen sourse; Mycoses; 41:265-271.
40. Mc Ginnis M R (1980) - Laboratory handbook of medical mycology;
Academic Press; New York.
41. Mitroiu P (1976) - Micoze şi micotoxicoze la animale; Ed. Ceres;
Bucureşti.
42. Mosaid al A, Sullivan D, Coleman D C (2003) - Differentiation of
Candida dubliniensis from Candida albicans on Pal’s Agar; J Clin
Microbiol; 41(10): 4787-4789.
43. Mosaid al A, Sullivan D, Salkin I F et al.(2001) - Differentiation of
Candida dubliniensis from Candida albicans on Staib Agar and Caffeic
Acid- Ferric Citrate Agar; J Clin Microbiol; 39(1):323-327.
44. Moser S A, Lyon F L, Greer D L (1988) - Sistemic mycoses; In BB
Wentworth (ed.) - Diagnostic procedures for mycotic and parasitic
infection; American Public Health Association; Washington DC; 173-238.
45. Nelson C S, Yau Y C W, Richardson E S, Matlow A (1995) - Improved
detection of Malassezia species in lipid-supplemented Peds Plus Blood
Culture Bottles; J Clin Microbiol; 33:1005-1007.
46. Peman J, Martin-Mazuelos E, Rubio Calvo M C (eds) (2001) - Guia
Practica de Identificacion y Diagnostico en Micologia Clinica; Rev
Iberoam Micol; Bilbao.
47. Percebois G (1973) - Introduction à une etude des dermatophytes;
Société d’Impressions Typographiques; Nancy.
48. Pfaller M A, Messer S A, Boyken L et al.(2004) - Evaluation of the
NCCLS M44-P Disk Diffusion Method for Determining Susceptibilities of
276 Clinical Isolates of Cryptococcus neoformans to Fluconazole; J Clin
Microbiol; 42(1):380-383.
49. Randhawa H S, Chowdhary A, Sinha K P et al. (2006) - Evaluation of
peptone glucose fluconazole agar as a selective medium for rapid and
enhanced isolation of Aspergillus fumigatus from the respiratory tract of
Luminiţa Malic, Olimpia Bazgan, Mihai Mareş


99
C
a
p
i
t
o
l
u
l
 
3
 
bronchopulmonary aspergillosis patients colonized by Candida albicans;
Med Mycol; 44(4):343-348.
50. Rousselle P, Freydiere A-M, Couillerot P J et al. (1994) - Rapid
identification of Candida albicans by using Albicans ID and Fluoroplate
agar plates; J Clin Microbiol; 32:3034-3036.
51. Segretain G, Drouhet E, Mariat F (1987) - Diagnostic de laboratoire en
micologie médicale; Maloin; Paris.
52. Sheth C C, Johnson E, Baker E M et al. (2005) - Phenotypic identification
of Candida albicans by growth on chocolate agar; Med Mycol; 43(8):735-
738.
53. Sinski J T, Kelley L M, Reed G L (1975) - Pagano-Levin Candida test
medium; evaluation using vaginal samples; J Clin Microbiol; 1:206-211.
54. Slifkin M (2000) - Tween 80 opacity test responses of various Candida
species; J Clin Microbiol; 38(12):4626-4628.
55. Staib F, Arastéh K (2000) - Chlamydospore formation on Staib Agar.
Observations made before Candida dubliniensis was described; Mycoses ;
44:23-27.
56. Staib F, Seibold M, Antweiler E et al. (1987) - The brown color effect
(BCE) of Cryptococcus neoformans in the diagnosis, control and
epidimiology of Cryptococcus neoformans infections in AIDS patiens;
Zentralbl Bakteriol Microbiol Hyg A; 266:167-177.
57. Staib P, Morschhauser J (1999) - Chlamidospore formation on Staib agar
as a species-specific characteristic of Candida dubliniensis; Mycoses;
45:521-524.
58. Stepanović S, Vuković D, Radonjić I et al. (2002) - Ground red hot pepper
agar in the isolation and presumption identification of Cryptococcus
neoformans; Mycoses; 45:384-388.
59. Strachan A A, Yu R J, Blank F (1971) - Pigment production of
Cryptococcus neoformans grow with extracts of Guizotia abyssinica; Appl
Microbiol; 22:478-179.
60. Summerbell R C, Rosenthal A S, Kane J (1988) - Rapid method for
differentiation of Trichophyton rubrum, Trichophyton mentagrophytes,
and related dermatophyte species; J Clin Microbiol; 26(11): 2279-2282.
61. Waller J, Koenig H, Debruyne, Contant (1993) - Evaluation d’un nouveau
milieu d’isolement des levures et de diagnostic rapide de Candida
albicans; Revue Française de Laboratoire; 252:89-92.
62. Warren N G, Hazen K C (1995) - Candida, Cryptococcus and other yeasts
of medical importance; In Muray P R, Baron E J, Pfaller M A et al. (eds) -
Manual of clinical microbiology; 6
nd
edition; American Society for
Microbiology; Washington D C; 723-737.
63. Willinger B, Hillowoth, Selitsch B (2001) - Performance of Candida ID, a
new chromogenic medium for presumptive identification of Candida
species, in comparison to CHROMagar Candida; J Clin Microbiol;
39:3793-3795.
Medii de cultivare

100
64. Willinger B, Manafi M, Selitsch B, Hillowoth C (1999) - Bewetung von
CHROMagar Candida zum schnellachweis von Candida - Arten aus
Klinischer Untersuchungsmaterial; Mycoses; 42:61-65.
65. Willinger B, Manafi, Rotter M L (1994) - Comparison of rapid methods
using flourogenic assays for detecting Candida albicans; Lett Appl
Microbiol; 18:47-49.
66. Yamane N, Saitoh Y (1985) - Isolation and detection of multiple yeasts
from a sigle clinical sample by use of Pagano-Levin agar medium; J Clin
Microbiol; 21:276-277.
67. * * * CLSI (2002) - Quality assurance for commercially prepared
microbiological culture media; Approved Standard: M22-A2; Villanova;
P.A.
68. * * * Subcommittee on Antifungal Susceptibility Testing (AFST) of the
ESCMID European Committee for Antimicrobial Susceptibility Testing
(EUCAST) (2002) - Method for the determination of minimum inhibitory
concentration (MIC) by broth diluation of fermentative yeasts (E. Dis.
7.1).
Mihai Mareş, Olimpia Bazgan


101
C
a
p
i
t
o
l
u
l
 
4
 




Mihai Mareş, Olimpia Bazgan

4.1. Tehnici uzuale

a regulă generală, însămânţarea prelevatelor se poate face prin mai multe
tehnici uzuale:
- epuizare pe medii solide condiţionate fie în plăci Petri, fie în tuburi (în pantă) –
asigură separarea fungilor cu semnificaţie clinică de cei contaminanţi şi inhibă
prin diluare eventualele substanţe antimicrobiene cu rol antifungic;
- etalare în puncte izolate – prin spotare: la unele prelevate paucibacilare sub
formă de lichide organice – LCR, pasaje din hemoculturi (fig. nr. 4-1 vezi
Anexa), sedimente, fragmente de ţesut şi prin înţepare: la fire de păr, scuame,
diverse raclate;
- înglobare în medii solide pretopite şi răcite la 45°C: la fire de păr, fragmente
unghiale, scuame.

În timpul însămânţărilor se va ţine seama de următoarele reguli:
- Însămânţările se vor executa în boxe sau hote speciale, care se pot steriliza
periodic şi nu permit formarea de curenţi de aer în timpul lucrului.
Însămânţarea prelevatelor provenite din situsuri normal sterile se va face
preferabil sub protecţia unei hote microbiologice clasă 2, pentru a preveni
eventuala lor contaminare cu spori fungici ambientali.
- Se evită conversaţia şi orice mişcare în jurul operatorului;
- Instrumentul utilizat la însămânţare (ansă microbiologică, ac de însămânţare,
pipetă etc.) nu se va atinge de obiecte nesterilizate (halat, masă de lucru );
- Însămânţările se vor executa într-un timp scurt, pentru a reduce la minim
contactul materialului de însămânţat cu atmosfera ambiantă;
- În timpul cât tuburile de cultură sunt deschise, vor fi ţinute într-o poziţie oblică,
cât mai aproape de orinzontalitate şi cu deschiderea în imediata apropiere a
flăcării becului de gaz;
- Operatorul trebuie să poarte mască de protecţie;
- Tuburile şi plăcile Petri însămânţate se notează cu markerul, fără a omite numărul
probei, denumirea abreviată a mediului de cultivare şi data însămânţării.

C
4
Tehnici de însămânţare şi transplantare
Tehnici de însămânţare şi transplantare

102
Însămânţarea se execută în faţa flăcării unui bec de gaz care asigură condiţii de
antisepsie în timpul acţiunii. În micologia medicală, produsele patologice se
însămânţează în mod similar cu cel din bacteriologie. Acul de însămânţare / ansa se
flambează şi se răceşte în ser fiziologic sterilizat, apoi se ia un fragment de produs
patologic ce aderă de ac şi se depune pe suprafaţa mediului de cultură. Din aceeaşi
probă, se însămânţează mai multe plăci sau tuburi, în puncte separate, cîte 3 – 4
fragmente de cercetat.
Culturile se examinează zilnic, urmărindu-se aspectul macroscopic (suprafaţa,
relieful, culoarea, prezenţa pigmentării, consistenţa şi viteza creşterii). În timpul
dezvoltării, coloniile îşi schimbă aspectele macroscopice. Aspectele coloniilor se
notează periodic, pentru a surprinde toate caracterele culturale. Paralel se face şi
examenul morfologic al fragmentelor de colonii.
Şansele de izolare a fungilor cu semnificaţie clinică cresc direct proporţional
cu numărul probelor însămânţate. Temperatura de incubare după însămânţare este de
36°-37°C pentru prelevatele interne / profunde şi de 30°C pentru cele superficiale.
Atenţie! Fragmentele biopsice recoltate din leziuni suspecte de zygomicoză nu
se omogenizează cu diluant prin mojarare sau fragmentare, deoarece se distruge
miceliul şi cultura va fi fals negativă. Temperatura de incubare recomandată este
37°C.
Pentru izolarea levurilor, însămânţarea prelevatelor se face pe Agar Sabouraud
aditivat cu cloramfenicol. Acest mediu permite o bună dezvoltare a levurilor şi
supresează multiplicarea eventualelor bacterii contaminante. Pentru levurile lipo-
dependente ale genului Malassezia, cultivarea prelevatelor se face fie pe Agarul
Sabouraud cu cloramfenicol pe suprafaţa căruia s-a etalat prin striere o fină peliculă de
ulei de măsline sterilizat prin autoclavare, fie pe medii speciale (Dixon, Leeming). Pe
Agar Sabouraud cu cloramfenicol, culturile mixte apărute prin asocierea a două sau
mai multe specii de levuri sunt uneori dificil de observat, de aceea ideal ar fi ca
însămânţarea prelevatelor să se facă pe un mediu diferenţial cromogen, care pe lângă
discriminarea între speciile levurice poate aduce informaţii esenţiale pentru
identificarea agentului etiologic. Se realizează astfel într-o singură etapă, atât izolarea,
cât şi identificarea levurii / levurilor incriminate. Pe mediile de izolare, levurile de
interes medical se dezvoltă în 24-72 ore de incubare. În funcţie de provenienţa
prelevatului se va face şi alegerea temperaturii de incubare. Pentru prelevatele
provenind din situsuri în care în mod normal temperatura este identică cu cea a
organismului, se va alege temperatura de 37°C pentru incubare. În cazul celor
provenind de la nivelul tegumentului sau unghiilor, incubarea se va face atât la 37°C,
cât şi la 30°C, deoarece unele levuri cultivabile la 30°C dar necultivabile la 37°C, pot
avea semnificaţie clinică fiind cauza unor micoze superficiale.
În cazul dermatofitozelor, se recomandă ca primocultura să se efectueze în
plăci Petri şi nu în tuburi, deoarece atât însămânţarea cât şi manoperele ulterioare sunt
mult facilitate. Mediul de elecţie pentru izolarea dermatofiţilor este Agarul Mycobiotic
(Agar Sabouraud aditivat cu cloramfenicol şi cicloheximidă); prezenţa
cloramfenicolului suprimă dezvoltarea bacteriilor care pot contamina prelevatul, iar
cicloheximida (Actidione) inhibă multiplicarea fungilor contaminanţi, facilitând
izolarea dermatofiţilor. Materialul patologic se însămânţează în mai multe puncte
pentru a creşte probabilitatea izolării dermatofiţilor şi a putea acorda semnificaţie
Mihai Mareş, Olimpia Bazgan


103
C
a
p
i
t
o
l
u
l
 
4
 
clinică tulpinii izolate. Cu cât numărul punctelor de însămânţare pozitivate este mai
mare, cu atât implicarea clinică a tulpinii izolate este mai sigură. Este posibilă şi
însămânţarea prin înglobarea prelevatului în mediul de cultură, însă interpretarea
semnificaţiei clinice devine mai dificilă. Incubarea se realizează la 25°-30°C, timp de
cca. 4 săptămâni. Când se suspicionează o infecţie cu T. verrucosum, plăcile se vor
incuba la 37°C (creştere accelerată). În cazul absenţei sporulării în primocultură,
tulpinile se pot pasa pe medii speciale care favorizează producerea macroconidiilor şi
pigmentogeneza: mediul Lactrimel (Borelli), PDA, agar peptonă 3%. Se recomandă
observarea culturilor de 2 ori / săptămână pentru a surprinde în dinamică aspectele
caracteristice coloniilor de dermatofiţi. Importante din punct de vedere diagnostic sunt
viteza de creştere, caracterele morfologice macro- şi microscopice. La unele specii de
dermatofiţi apar aşa-numitele „formaţiuni ornamentale” care reprezintă de fapt hife cu
aspect modificat, al căror rol nu este încă elucidat: hife „în rachetă” sau cu aspect de
„tijă de bambus”, candelabre favice, hife spiralate (vrile), celule osiforme (aspect de
„ganteră”), organe nodulare, hife pectinate.

4.2. Tehnici speciale

4.2.1. Tehnica de purificare a izolatelor levurice

După obţinerea primoculturii, se va verifica obligatoriu puritatea acesteia
deoarece contaminarea bacteriană este indezirabilă în acţiunea ulterioară de identificare
a speciei. În acest scop, se pregătesc fie preparate între lamă şi lamelă, fie frotiuri
colorate Gram care se examinează la microscop, cu obiectivul de imersie. În cazul
prezenţei bacteriilor, se recurge la pasarea tulpinii în bulion Sabouraud aditivat cu acid
clorhidric soluţie 1N, conform schemei prezentate în fig. nr. 4-2.
După incubare şi reverificare prin coloraţia Gram, se epuizează 0,1 ml din
tubul cu numărul maxim de picături de HCl care a permis dezvoltarea levurilor, pe
suprafaţa unui Agar Sabouraud cu cloramfenicol în vederea obţinerii coloniilor
purificate.

Tehnici de însămânţare şi transplantare

104



Fig. nr. 4-2. Purificarea izolatelor levurice – metodologie de lucru




Mihai Mareş, Olimpia Bazgan


105
C
a
p
i
t
o
l
u
l
 
4
 

4.2.2. Tehnica însămânţării levurilor pe Agarul cu făină de porumb şi tween 80
(metoda Dalmau)

Prin cultivare submersă pe acest mediu, levurile îşi exprimă plenar toate
detaliile morfologice: blastospori, pseudohife (pseudofilamente), filamente (hife),
clamidospori, artrospori, ascospori. În funcţie de gen şi specie, aceste formaţiuni apar
sau nu şi prezintă anumite caracteristici utile identificării. Rezultatele acestui test pot fi
doar rareori utilizate singular; de obicei, ele se coroborează obligatoriu cu rezultatele
profilului biochimic al tulpinii în cauză (fermentarea zaharurilor, asimilarea diverselor
surse de carbon sau azot, producerea unor enzime ca ureaza, fenol-oxidaza,
hexozaminidaza, L-prolin-aminopeptidaza, catalaza.
Tehnica de lucru: se pregătesc plăci Petri cu o grosime a mediului de 4-5 mm
(cca. 25-30 ml mediu / placă cu ø 90 mm); după solidificare, cu ajutorul ansei
microbiologice cu care s-a prelevat în prealabil o mică porţiune din colonia levurii de
identificat, se practică 3 „incizii” ale mediului, după cum urmează: primele două –
paralele între ele, la distanţă de cca. 1-1,5 cm, apoi o aIIIa – perpendiculară pe celelalte
(fig. nr. 4-3). În timpul însămânţării mediului, ansa se menţine înclinată sub o incidenţă
de cca. 60°-70° faţă de orizontală. Porţiunea de agar astfel însămânţată se acoperă cu o
lamelă sterilizată. După o incubare de 48-72-96 ore la 25°C-30°C, placa Petri se
examinează direct la microscop, formaţiunile dezvoltate în mediu fiind observabile
prin traversul lamelei. Alternativ, după însămânţare, mediul nu se acoperă cu lamelă,
iar pentru examinare se prelevează cu ajutorul ansei un bloc de geloză de pe linia de
însămânţare şi se etalează prin strivire între lamă şi lamelă. Se examinează apoi la
microscop, fără colorare suplimentară, urmărindu-se prezenţa clamidosporilor, forma şi
mărimea pseudohifelor, modul de dispunere a blastosporilor (blastoconidiilor) de-a
lungul acestora.



Fig. nr. 4-3. Tehnica însămânţării levurilor pe CMA (cultivare submersă).


4.2.3. Tehnica de cultivare pe suporturi transparente

Metoda constă în plasarea unei lamele sterilizate pe suprafaţa gelozei, foarte
aproape de colonia activă. Miceliul va creşte peste lamelă, care la un anumit interval de
timp poate fi ridicată şi examinată la microscop.
Tehnici de însămânţare şi transplantare

106
În locul lamelelor se pot folosi pătrate de celofan de mărimea lamelelor,
sterilizate prin autoclavare. Inoculul se depune în mijlocul pătratului de celofan, iar
după dezvoltarea miceliului, pelicula de celofan se montează pe lamă şi se examinează
la microscop.

4.2.4. Tehnica de cultivare în „picătură suspendată”

Inele de sticlă cu diametrul de 2 cm şi înălţimea de 1 cm se imersează în
parafină topită şi imediat se aşează pe o lamă de sticlă sterilizată. În interiorul inelului
de sticlă se pune o picătură de apă distilată sterilizată. Lamela de sticlă se flambează şi
în zona centrală se depune o picătură de bulion Sabouraud, în care se însămânţează
materialul de cercetat. Marginea superioară a inelului de sticlă se gresează cu lanolină,
se trece prin flacără pentru sterilizare şi se aplică apoi lamela cu picătura însămânţată
în jos.
Lamela se examinează la microscop după câteva zile de incubaţie.

4.2.5. Tehnica de cultivare pe bloc de geloză (cultivarea pe lamă)

Cultura pe bloc de geloză (pe lamă) este recomandată pentru studierea în
dinamică a morfologiei structurilor de fructificare (generatoare de conidii) la fungii
filamenoşi septaţi (nu însă la cei din genurile Aspergillus şi Penicillium). În acest scop,
fungul de identificat se însămânţează în două puncte opuse ale unui bloc de geloză
(PDA) de 1 x 1 x 0,5 cm etalat pe o lamă de sticlă. După însămânţare, acesta se
acoperă cu o lamelă, iar lama se aşează pe o baghetă de sticlă în formă de „U” plasată
într-o cameră umedă (de fapt, o placă Petri ce conţine un fragment de hârtie de filtru
umectat cu cca. 5 ml apă distilată). Camera umedă (fig. nr. 4-4) se incubează la 25°-
30°C, un timp variabil, până la apariţia pe lamă a structurilor de fructificare cu
morfologie caracteristică, fapt constatat în urma examinării microscopice. În final,
blocul de geloză se îndepărtează, iar din lamă, respectiv lamelă, se obţin prin adăugare
de lactofenol şi montare, două preparate extemporanee. Aceste două preparate obţinute
se pot păstra, dacă vor fi lutate, timp de aproximativ cinci ani.


Fig. nr. 4-4. Cameră umedă pentru cultivarea fungilor pe bloc de geloză.


Mihai Mareş, Olimpia Bazgan


107
C
a
p
i
t
o
l
u
l
 
4
 


4.3. Tehnici de transplantare

Prin transplantări sau pasaje se urmăreşte izolarea în stare pură a fungilor de
interes medical din culturile mixte sau menţinerea lor în timp, în condiţii de laborator
(tulpini de colecţie) şi obţinerea de colonii monosporale.
Din culturile pe medii lichide, recoltarea materialului de transplantat se poate
face cu pipeta Pasteur sau cu ansa de însămânţare. Cu pipeta Pasteur se recoltează o
cantitate din cultura veche, din care se însămânţează câteva picături în mediul lichid şi
câteva picături pe suprafaţa mediului solid. În cazul transplantării cu ansa, se introduce
ansa sterilizată în cultura veche, apoi se face însămânţarea pe mediile proaspete (întâi
pe mediul lichid şi apoi în trei puncte pe mediul solid).
Din culturile pe medii solide, transplantarea se face cu ansa sau cu o
microspatulă, luând o cantitate redusă de miceliu de la periferia coloniei vechi. Acest
material biologic se transferă pe bulion şi pe un mediu agarizat (Agar Sabouraud, PDA,
Agar Czapek – Dox, Agar cu extract de malţ etc.).





























Tehnici de însămânţare şi transplantare

108


Bibliografie selectivă

1. Bazgan O (1999) - Diagnostic de laborator şi igiena alimentelor de
origine animală; Ed. Moldogrup; Iaşi.
2. Buiuc D, Neguţ M (1999) - Tratat de microbiologie clinică; Ed. Medicală;
Bucureşti.
3. Coman I, Mareş M (2000) - Micologie medicală aplicată; Ed. Junimea;
Iaşi.
4. Constantinescu O (1974) - Metode şi tehnici în micologie; Ed. Ceres;
Bucureşti.
5. Golăescu M (1997) - Diagnosticul şi tratamentul micozelor interne; Ed.
Viaţa Medicală Românească; Bucureşti.
6. Grillot R (1996) - Les mycoses humaines démarche diagnostique;
Elsevier; Paris.
7. Guého E, Midgley G, Guillot J (1996) - The genus Malassezia with
description of four new species; Antonie van Leeuwenhoek; 69:337-355.
8. Hoog G S de, Guarro J, Gené J, Figueras M J (2000) - Atlas of clinical
fungi; 2
nd
edition; Centraalbureau voor Schimmelcultures / Universitat
Rovira i Virgili.
9. Ribes J A, Vanover-Sams C L, Baker D J (2000) - Zygomycetes in Human
Disease; Col Rev; 2(13):236-301.
10. Ribes J A, Vanover-Sams C L, Baker D J (2000)– Zygomycetes in Human
Disease; Col Rev ; vol. 13(2): 236-301.




Mihai Mareş, Olimpia Bazgan


109
C
a
p
i
t
o
l
u
l
 
5
 













Mihai Mareş, Olimpia Bazgan

xamenul microscopic al fragmentelor de colonii fungice urmăreşte:

- Aspectul hifelor - septate sau nu;
- Aspectul miceliului - difuz, gros, colorat, incolor;
- Prezenţa şi tipul sporilor sexuaţi - zigospori, ascospori;
- Prezenţa corpilor fructificanţi asexuaţi (tipul şi aspectul sistemului sporal,
aranjarea (îmbinarea) conidioforilor şi a sporangioforilor, forma, culoarea,
mărimea şi eventuala septare a sporului;
- Prezenţa şi tipul unor structuri particulare: rizoizi, stoloni, scleroţi, celule Hülle.
Pentru studiul morfologiei microscopice a fungilor obţinuţi în urma
însămânţării prelevatelor se utilizează mai multe tehnici, în funcţie de tipul acestora:
- levuri - frotiuri (colorate Gram, cu albastru de metilen etc.) sau preparate
extemporanee (între lamă şi lamelă) cu tuş de India sau lactofenol şi albastru
de anilină;
- fungi filamentoşi – preparate extemporanee cu lactofenol şi albastru de anilină,
preparate cu bandă adezivă sau preparate obţinute prin cultivare pe lamă.

5.1. Preparatul extemporaneu cu lactofenol şi albastru de anilină (levuri)

Este o metodă mai rar utilizată pentru studierea morfologiei levurilor, însă este
uneori preferată pentru expeditivitatea sa, mai ales în cazul levurilor din primoculturi.
În acest scop, pe o lamă de microscopie curată şi degresată, se depune o picătură de
lactofenol cu albastru de anilină în care se va suspensiona apoi cu mişcări cât mai fine,
cu ajutorul unei anse microbiologice, o mică porţiune din colonia levurică de studiat.
Suspensia astfel obţinută se acoperă cu o lamelă şi se examinează la microscop (x10,
x20, x40, x100 – după caz). Pentru reuşita preparatului, este importantă cantitatea de
material biologic prelevat din colonie; aceasta trebuie să fie cat mai redusă, astfel încât
densitatea suspensiei obţinute să fie mică.



E
5
Tehnici de examinare microscopică
a fungilor din culturi
Tehnici de examinare microscopică a fungilor din culturi


110

5.2. Preparatul extemporaneu cu lactofenol şi albastru de anilină
(fungi filamentoşi)

Se obţine parcurgând următoarele etape:
- se depune o picătură de lactofenol pe o lamă de microscopie, curată şi degresată;
- se prelevează cu ajutorul unui ac sau al unei microspatule metalice un fragment
de dimensiuni milimetrice din colonia de examinat, se etalează în picătura de
lactofenol şi se dilacerează cu mişcări fine miceliul, utilizând două ace;
- se acoperă cu o lamelă curată, se presează, se încălzeşte uşor la flacără pentru a
obţine un film cât mai fin de lactofenol şi a elimina eventualele bule de gaz;
- se examinează la microscop, folosind succesiv obiectivele x10, x20, x40,
eventual x100;
- în cazul în care se doreşte păstrarea preparatului în lamotecă, pentru conservarea
sa, acesta se poate luta (fig. nr. 5-1 vezi Anexa).

5.3. Preparatul extemporaneu cu bandă adezivă

În acest caz, prelevarea structurilor fungice de la nivelul coloniilor se face cu
ajutorul unui fragment de bandă adezivă transparentă (tip scotch), cu dimensiuni de
1,0-1,5 x 2,5-3,0 cm, cu care se amprentează marginea coloniei. Acest fragment de
bandă adezivă se lipeşte apoi pe o lamă pe care s-a etalat în prealabil o picătură de
lactofenol (fig. nr. 5-2). Opţional, peste bandă se pot etala o nouă picătură de lactofenol
şi apoi o lamelă, în vederea ameliorării vizibilităţii la examinarea microscopică
ulterioară. În cazul coloniilor care sporulează intens (Aspergillus spp., Penicillium spp.
etc.) se recomandă pregătirea a 2-3 preparate cu bandă adezivă din acelaşi loc – prima
va fixa sporii, iar următoarele vor recolta conidioforii, astfel încât prin examinarea
ulterioară să fie surprinse toate aspectele utile încadrării taxonomice.


Fig. nr. 5-2. Obţinerea preparatului extemporaneu cu bandă adezivă

180°
scotch
lamă
lamelă
Mihai Mareş, Olimpia Bazgan


111
C
a
p
i
t
o
l
u
l
 
5
 

O altă variantă a tehnicii presupune etalarea fragmentului de bandă adezivă pe
o lamelă cu o picătură de lactofenol, adăugarea peste aceasta a unei alte picături de
colorant şi apoi a lamei de microscopie. Preparatul se roteşte apoi cu 180° pentru a-l
aduce în poziţia de examinare. Prin acest procedeu, claritatea imaginii este maximă
datorită faptului că între ochiul examinatorului şi structurile fungice se interpune doar
lamela, nu şi banda scotch ca în tehnicile anterioare.

5.4. Lutarea preparatelor extemporanee

Etanşarea sau lutarea preparatelor este necesară pentru a evita evaporarea
lichidului de montare. Suprafeţele lamei şi lamelei, pe care se aplică substanţele de
etanşare, trebuie să fie perfect uscate şi curate. Substanţele folosite la etanşare nu
trebuie să reacţioneze cu lichidul de montare, să fie impermeabile, elastice, persisente
şi să adere de suprafaţa sticlei.

Răşinile naturale
Se pot folosi pentru lutare colofoniul, guma arabică, şerlacul, balsamul de
Canada.

Lacul pentru unghii este cel mai utilizat la etanşarea preparatelor deoarece se
usucă repede şi se manipulează uşor. Se îndepărtează excesul de lichid de montare de
pe lamă şi lamelă, prin ştergere cu un fragment de hârtie de filtru. Cu un penson se
aplică un strat subţire de lac peste marginea lamelei şi suprafaţa lamei din imediata
apropiere a acesteia. Se lasă să se usuce, apoi se poate stoca.

Cimentul Thorner, cunoscut sub denumirea de „Glyceel” este format din:
- ulei polimerizat .......................... 31,75 ml
- alcool metilic industrial ................ 4,76 ml
- acetat de butil ............................. 20,41 ml
- toluen (fără sulf) ......................... 20,41 ml
Glyceelul este un lichid siropos, incolor, se usucă repede, formând o peliculă
elastică, rezistentă şi care aderă bine de sticlă.

Amestecul de ceară galbenă de albine şi colofoniu
20 g ceară de albine se topesc într-o capsulă de porţelan, apoi se adaugă treptat
80 g colofoniu şi se încălzesc până la topirea completă. Amestecul se aplică cu o
spatulă pe marginile lamei şi lamelei montate. Înainte de fiecare folosire, amestecul se
retopeşte.

Amestecul de colofoniu şi lanolină (60%, respectiv 40%)
Se omogenizează prin topire, apoi se distribuie în plăci Petri şi se lasă la
solidificare. În momentul folosirii, se lichefiază cu ajutorul aplicatorului încălzit la
flacără. Se foloseşte similar cu celelalte lichide de lutare.


Tehnici de examinare microscopică a fungilor din culturi


112
Bibliografie selectivă

1. Bazgan O (1999) - Diagnostic de laborator şi igiena alimentelor de
origine animală; Ed. Moldogrup; Iaşi.
2. Buiuc D, Neguţ M (1999) - Tratat de microbiologie clinică; Ed. Medicală;
Bucureşti.
3. Coman I, Mareş M (2000) - Micologie medicală aplicată; Ed. Junimea;
Iaşi.
4. Constantinescu O (1974) - Metode şi tehnici în micologie; Ed. Ceres;
Bucureşti.
5. Golăescu M (1997) - Diagnosticul şi tratamentul micozelor interne; Ed.
Viaţa Medicală Românească; Bucureşti.
6. Harris J (2000) - Safe, low-distortion tape touch method for fungal
mounts; J Clin Microbiol; 38(12):4683-4684.
7. Hoog G S de, Guarro J, Gené J, Figueras M J (2000) - Atlas of clinical
fungi; 2
nd
edition; Centraalbureau voor Schimmelcultures / Universitat
Rovira i Virgili.





























Petru Cazacu


113
C
a
p
i
t
o
l
u
l
 
6
 



Petru Cazacu

ragmentele de ţesut recoltate de la pacient în vederea diagnosticului trebuie
procesate în laboratorul de histopatologie pentru a obţine preparate
permanente care vor fi examinate microscopic de către morfopatolog. Fragmentele de
ţesut pot fi recoltate prin biopsie, prin exereză chirurgicală şi prin autopsie. Procesarea
ţesuturilor în vederea diagnosticului histopatologic presupune o suită de operaţiuni şi
tehnici care vor permite vizualizarea elementelor fungice intratisulare şi / sau a
leziunilor specifice determinate de acestea.

6.1. Obţinerea probelor

Probele de ţesut primite în laboratorul de histopatologie trebuie să fie însoţite
de un formular de cerere a examenului de laborator în care vor fi specificate datele
pacientului şi istoricul bolii, precum şi descrierea zonei de origine a fragmentului de
ţesut. Probelor primite li se va atribui un număr care va identifica fiecare probă pentru
fiecare pacient. Acest număr va corespunde cu numărul de ordine din registrul
laboratorului.

6.2. Examenul macroscopic

Examinarea macroscopică constă în descrierea probelor, alegerea zonelor
relevante pentru diagnostic şi introducerea lor (totală sau parţială) în mici casete din
plastic, unde vor sta pe toată durata procesării iniţiale, până în momentul includerii în
parafină. Iniţial, casetele sunt plasate într-un fixator.

6.3. Fixarea

Fixarea are scopul de a conserva morfologia ţesuturilor aşa cum se prezintă ea
în momentul recoltării. Fixarea trebuie realizată cât mai curând posibil după prelevarea
probelor de ţesut pentru a preveni autoliza. Nu există un fixator perfect, deşi
formaldehida este considerată aproape un „gold standard”. Există o varietate de
fixatori, care se vor folosi în funcţie de tipul de ţesut.

F
6
Tehnici de histopatologie
Tehnici de histopatologie


114
Factorii care influenţează procesul fixării:
-soluţia-tampon;
-penetrarea;
-volumul piesei vs. volumul fixatorului;
-temperatura;
-concentraţia fixatorului;
-intervalul de timp.

Fixarea trebuie realizată la un pH aproape de neutralitate, adică între 6 şi 8.
Datorită hipoxiei ţesuturilor, fixatorul trebuie să aibă capacitatea de a tampona
aciditatea acestora prevenind dehiscenţa lizozomală şi autoliza tisulară consecutivă
acesteia. Aciditatea favorizează formarea de pigment hem - formol care apare colorat
în negru, prin depuneri polarizate în ţesuturi. Soluţiile-tampon includ fosfatul de sodiu,
bicarbonatul de sodiu, cocodilatul de sodiu şi veronalul. Formolul comercial este o
soluţie de formaldehidă în tampon fosfat cu pH 7.
Penetrarea ţesuturilor depinde de difuzibilitatea fiecărui fixator. Formolul şi
alcoolul penetrează foarte bine, iar glutaraldehida foarte prost. Ceilalţi fixatori au un
grad intermediar de penetrabilitate tisulară. O posibilitate de a rezolva acest
inconvenient este secţionarea cât mai fină a ţesuturilor (2-3 mm grosime), deoarece
penetrarea unei secţiuni subţiri va fi mult mai rapidă decât cea a unei secţiuni mai
groase.
Volumul de fixator este de asemenea extrem de important. Acesta trebuie să fie
în raport de 10:1 (fixator-ţesut). Se recomandă schimbarea fixatorului la diferite
intervale de timp pentru a evita o eventuală scădere a volumului acestuia. Agitarea
probelor în fixator va intensifica fixarea.
Creşterea temperaturii, ca în cazul tuturor reacţiilor chimice, va creşte viteza de
fixare, dar se va avea totuşi în vedere să nu degradeze ţesuturile. Formolul fierbinte va
fixa ţesuturile mai repede şi acesta este adesea primul pas în procesarea automatizată a
ţesuturilor.
Concentraţia fixatorului va fi cea mai redusă concentraţie activă, acest fapt
reprezentând şi un avantaj economic. Formolul este cel mai activ la 10%;
glutaraldehida este în general activă la concentraţii de 0,25-4%. Concentraţiile prea
ridicate pot avea efect advers asupra ţesuturilor producând artefacte asemănătoare cu
cele ale creşterii temperaturii fixatorului.
De asemenea, foarte important este intervalul de timp recomandat pentru
menţinerea probelor în afara fixatorului. După fixare, probele vor fi prelucrate rapid
deoarece prin deshidratare se vor produce artefacte. Ţesuturile menţinute temporar în
afara vasului cu fixator, se vor umezi cu ser fiziologic.
Tipul fixatorului indicat este dat de tipul de ţesut şi de detaliile histologice care
urmează a fi vizualizate. Formolul este utilizat pentru toate ţesuturile recoltate
chirurgical şi necropsic, când se doreşte obţinerea unor preparate colorate H-E.
Formolul este cel mai puţin pretenţios dintre toţi fixatorii atunci când condiţiile de
fixare nu sunt cele ideale, el dăunând aproape neglijabil ţesutului respectiv. Pentru
fixarea ţesuturilor în vederea procesării lor pentru diagnosticul histopatologic al
micozelor profunde se folosesc frecvent următorii fixatori: soluţia de formol 10%
tamponată pH 6,8, fixatorul Bouin şi fixatorul Hollande. Pentru fixarea frotiurilor
Petru Cazacu


115
C
a
p
i
t
o
l
u
l
 
6
 
citologice cu importanţă în diagnosticul micologic se folosesc: metanolul absolut,
etanolul 90% şi acidul cromic 5%. Alcoolii sunt fixatori rapizi şi ieftini. Deoarece
frotiurile nu sunt groase, acestea nu pun probleme de contractare şi întrucât frotiurile
nu sunt secţiuni, acestea nu prezintă inconvenientul friabilităţii. Alcoolii nu se
recomandă pentru fixarea frotiurilor obţinute din fluide biologice sau patologice.
Alături de imersie, fixarea frotiurilor se poate realiza şi prin pulverizarea
fixatorului peste frotiu. Fixatorii care se pulverizează sunt compuşi dintr-un alcool care
fixează celulele şi parafină care formează un strat protector subţire peste acestea
(Carbowax - conţine polietilenglicol). Fixativii de păr (e.g. Diaphine Spray), cu un
conţinut ridicat de alcool şi un minimum de lanolină sau ulei, sunt de asemenea fixatori
eficace. Distanţa optimă de pulverizare a fixatorilor este de 25-30 cm. Fixarea cu
fixatori aerosolizabili nu este recomandată pentru frotiurile de sânge sau a celor
executate din lichide hemoragice pentru că determină clumping eritrocitar (aglutinare).
Parafinele şi uleiurile din spray-urile fixative de păr modifică reacţiile de colorare dacă
nu sunt îndepărtate adecvat. Astfel, înaintea colorării, lamele trebuie menţinute peste
noapte în etanol 95% pentru a îndepărta fixatorul de acoperire.

6.3.1. Formol soluţie 10% tamponată pH 6,8

Scop
Este un fixator larg utilizat, cu pH 6,8

Reactivi

Fosfat de sodiu monobazic ........................... 4,0 mg
Fosfat de sodiu dibazic ................................. 6,5 mg
Formaldehidă 37% ..................................... 100,0 ml
Apă distilată ............................................... 900,0 ml

Se omogenizează, apoi se etichetează şi se datează.
Atenţie! Carcinogen.

Timpul de fixare
Fragmentele biopsice ar trebui fixate timp de minim 1-4 ore. Un timp mai
îndelungat se recomandă pentru piesele mai mari.

Tehnica fixării
1. Piesele recoltate de chirurgi sunt păstrate în acest tip de fixator;
2. Primele două staţii ale tuturor procesatoarelor de ţesuturi conţin formol 10%;
3. Probele pot fi păstrate în formol 10% indefinit sau sunt transferate în etanol
70%.

Note:
1. Se lucrează într-un spaţiu ventilat. Se vor purta ochelari de protecţie, mănuşi şi halat.
2. Formaldehida este puternic iritantă pentru ochi şi piele. Este sensibilizantă (prin
contact) pentru piele şi aparatul respirator. Este toxică prin ingestie şi inhalare. Are
Tehnici de histopatologie


116
acţiune corozivă şi carcinogenă. Se etichetează cu inscripţia: ATENŢIE
FORMALDEHIDĂ!

6.3.2. Fixatorul Bouin

Scop
Se utilizează pentru fixarea pieselor biopsice; de asemenea este un mordantant
în diferite tehnici de colorare.

Reactivi

Acid picric saturat .................................... 3000,0 ml
Formaldehidă ........................................... 1000,0 ml
Acid acetic glacial ..................................... 200,0 ml

Atenţie! Soluţia este carcinogenă, iritantă şi toxică.

Timpul de fixare
Probele biopsice de dimensiuni mici, 2-4 ore, iar probele de dimensiuni mari
pot rămâne în fixator până la trei zile.

Tehnica fixării
1. Ţesuturile fixate pot rămâne în formol 10% sau etanol 70%;
2. Se îndepărtează acidul picric din ţesut înainte de colorare prin:
a) spălare cu apă de robinet;
b) tratare cu etanol 50%;
c) sau soluţie saturată de etanol 70% cu carbonat de litiu.

Note:
1. Se lucrează în spaţii bine ventilate, se vor purta mănuşi, halat şi ochelari de protecţie.
Se evită contactul şi inhalarea.
2. Acidul picric poate deveni exploziv dacă se usucă. Este toxic de contact.
3. Formaldehida este puternic iritantă pentru ochi şi piele. Este sensibilizantă prin contact,
pentru piele şi aparatul respirator. Este toxică prin ingestie şi inhalare. Are acţiune
corozivă şi carcinogenă. Se etichetează cu inscripţia: ATENŢIE FORMALDEHIDĂ!
4. Acidul acetic: aparatul respirator este organul ţintă afectat. Este coroziv.

6.3.3. Fixatorul Hollande

Scop
Acest fixator conferă o strălucire coloraţiilor care utilizează hematoxilină -
eozină şi reduce consistenţa ţesuturilor evitând astfel obţinerea unor secţiuni casante.
Acidul picric lizează hematiile.




Petru Cazacu


117
C
a
p
i
t
o
l
u
l
 
6
 
Reactivi

Acetat de cupru .............................................. 75 mg
Apă distilată ................................................ 3000 ml
Acid picric ................................................... 120 mg
Formaldehidă ................................................ 300 ml
Acid acetic glacial .......................................... 45 ml

Se dizolvă acetatul de cupru în apă fără încălzire, apoi se adaugă treptat acidul
picric. Se amestecă până se dizolvă complet. Se adaugă formaldehida şi acidul acetic.
Se etichetează şi se datează.
Atenţie! Soluţia este carcinogenă, iritantă şi corozivă.

Timpul de fixare
Probele de dimensiuni mici 2-4 ore, iar cele mai mari până la 3 zile.

Tehnica fixării
1. Probele biopsice sunt imersate imediat în fixatorul Hollande, notându-se timpul
pe recipient;
2. Când fixarea este completă, proba de ţesut se trece apoi în etanol 70%;
3. Nu se permite ca probele fixate cu Hollande să vină în contact cu soluţia de
formol 10%, deoarece poate determina apariţia unui precipitat albastru.

Note:
1. Se lucrează într-un spaţiu bine ventilat sau în nişa chimică, se poartă mănuşi, halat şi
ochelari de protecţie. Se evită contactul şi inhalarea.
2. Acidul picric poate exploda dacă se usucă. Este toxic prin expunere cutanată.
3. Formaldehida este iritantă puternic pentru ochi şi piele. Este toxică prin ingestie şi
inhalare. Afectează aparatul respirator. Este corozivă şi carcinogenă. Se etichetează
cu: ATENŢIE FORMALDEHIDĂ !
4. Acidul acetic afectează aparatul respirator. Este coroziv.

6.4. Procesarea ţesuturilor

Odată ce ţesuturile au fost fixate, ele trebuie înglobate într-o formă care să
permită manipularea şi efectuarea unor secţiuni seriate foarte subţiri. Cel mai folosit
material în acest scop este parafina. Ţesuturile incluse în parafină pot fi secţionate în
fragmente cu grosimi de la 3 la 10 µm, uzual 4-6 µm. Tehnica de includere în parafină
a ţesuturilor fixate se numeşte „Procesarea ţesuturilor”. Paşii principali ai acestui
proces sunt deshidratarea şi clarificarea.
- Ţesuturile fixate umed (în soluţii apoase) nu pot fi direct impregnate cu parafină
deoarece aceasta nu este miscibilă cu apa. De aceea, ţesuturile trebuie
deshidratate. Aceasta se realizează de obicei cu ajutorul unor soluţii de etanol,
de concentraţii crescânde - 70%, 95% şi 100%. Uneori, primul pas este tratarea
cu un amestec format din formol şi etanol. Pot fi utilizaţi şi alţi deshidratanţi,
dar unii prezintă dezavantaje majore: acetona deşi este foarte rapidă, este
inflamabilă, de aceea se poate utiliza doar pentru mici seturi de ţesuturi
Tehnici de histopatologie


118
procesate manual. Dioxanul poate fi utilizat fără clarificare, dar vaporii săi sunt
toxici.
- Etapa următoare se numeşte „Clarificare” şi constă în îndepărtarea
deshidratantului cu o substanţă care va fi miscibilă cu mediul de includere
(adică cu parafina). Xilenul este agentul de clarificare cel mai frecvent
întrebuinţat. Toluenul clarifică bine şi este mult mai tolerant faţă de cantităţile
mici de apă rămase în ţesuturi, dar este de 3 ori mai costisitor decât xilenul.
Cloroformul acţionează lent şi este periculos pentru cei care-l manipulează.
Salicilatul de metil este rar utilizat datorită costului ridicat.

În final, proba de ţesut este impregnată cu agentul de includere care aproape
întotdeauna este parafina. Parafina poate avea diferite puncte de topire, ceea ce permite
obţinerea unor grade variate de duritate. Un produs numit Paraplast conţine un adaos
de plastifianţi care fac ca blocurile de parafină să fie mai uşor de procesat de către
tehnologi în vederea secţionării. Pentru a asigura o mai bună penetrare a ţesutului de
către agentul de includere, în interiorul procesatorului de ţesuturi se poate crea o
presiune negativă cu ajutorul unei pompe de vacuum.
Procedurile de mai sus sunt aproape întotdeauna automatizate pentru un volum
mare de probe ce trebuie procesate de rutină. Automatizarea constă într-un dispozitiv
circular, programabil, care imersează succesiv probele de ţesut în diferite băi de
deshidratare şi clarificare, după o scală de timp presetată.
După procesarea probelor în procesatorul de ţesuturi, acestea sunt încă în
casete, urmând a fi incluse în parafină lichidă. Procesul este foarte important deoarece
ţesuturile trebuie orientate corespunzător în momentul includerii pentru a asigura
obţinerea ulterioară a unor secţiuni de calitate. O alternativă pentru includerea în
parafină este folosirea diverselor mase plastice care permit obţinerea unor secţiuni
subţiri. Astfel de mase plastice sunt meta-acrilatul de metil, meta-acrilatul glicol şi
eponul. Materialele plastice necesită reactivi speciali pentru deshidratare şi clarificare,
de obicei foarte costisitori. Pentru secţionarea acestor blocuri este necesar un microtom
special. Blocurile trebuie să fie mici, tehnica pretându-se de exemplu pentru biopsiile
hepatice sau cerebrale.

6.4.1. Deshidratarea

1. Dacă piesa de ţesut a fost imersată în apă după scoaterea din fixator, ea trebuie
să fie transferată în etanol 30%, 1-2 ore;
2. Etanol 50%, 1-2 ore;
3. Etanol 70%, 1-2 ore;
4. Etanol 95%, 1-2 ore;
5. Etanol 100%, 1-2 ore;
6. Etanol 100%, 1-2 ore;
7. Ţesuturile deshidratate vor fi pregătite pentru clarificare, adică se scot piesele
histologice din etanol şi se trec în toluen.

Notă: Etanolul absolut produce o deshidratare foarte rapidă a ţesuturilor: pentru a avea
această siguranţă, flacoanele cu etanol se vor păstra închise etanş.
Petru Cazacu


119
C
a
p
i
t
o
l
u
l
 
6
 
6.4.2. Clarificarea

1. Se transferă piesele histologice din etanol 100% într-un amestec constituit din o
parte toluen şi 3 părţi etanol 100%, 1 oră;
2. Se trec apoi în amestecul de 1:1 toluen-etanol 100%, 1 oră;
3. Apoi în amestecul de 3:1 toluen-etanol 100%, 1 oră;
4. Toluen 100%, 3-4 ore;
5. Toluen 100%, 3-4 ore;
6. După clarificare, ţesuturile sunt gata pentru impregnare cu parafină.

Notă:
Agenţii de clarificare, cum ar fi etanolul, trebuie introduşi lent pentru a preveni
degradarea ţesuturilor. Aceste amestecuri de toluen şi etanol permit în plus şi îndepărtarea
oricăror urme de apă. Flacoanele se închid etanş. Apariţia unei turbidităţi a soluţiilor sau a
unor pete opace pe ţesuturi sunt indicatori siguri ai deshidratării incomplete. În ambele cazuri,
lamele cu secţiuni se reintroduc în etanol 100% pentru o deshidratare suplimentară, apoi se
continuă cu băile de toluen - etanol. Insuficienta îndepărtare a alcoolului va determina
imposibilitatea impregnării cu parafină în zonele respective ale ţesutului, ceea ce va produce
dificultăţi de secţionare. Actualmente, există numeroşi agenţi de clarificare disponibili
comercial (Histosolve, Americlear etc.) care sunt mai puţin toxici şi au un miros mai plăcut
decât toluenul sau xilenul.

6.4.3. Impregnarea cu parafină

1. Se transferă ţesuturile din agentul de clarificare într-un nou flacon cu un amestec
preîncălzit de parafină - toluen 1:2. Se acoperă etanş flaconul şi se lasă la
etuvă, la 45ºC, timp de 1 oră;
2. Se transferă ţesuturile într-un al doilea flacon care conţine un amestec încălzit de
parafină - toluen 1:2. Se acoperă flaconul şi se meţine la 45ºC timp de 1 oră;
3. Se transferă piesele apoi în prima baie de parafină pură. Aceasta este un flacon
cu parafină lichidă care se menţine în etuvă setând o temperatură superioară
punctului de topire al parafinei. Piesele se menţin în această baie timp de 2-4
ore;
4. Se transferă piesele în a doua baie de parafină, unde se menţin încă 2-4 ore;
5. Se includ (pasul următor).

Notă:
O alternativă a metodei de impregnare:
1. Se introduce piesa histologică în agentul clarificator proaspăt şi apoi se adaugă
parafină până la saturarea clarificatorului. Se lasă în repaus 1 oră la 30ºC – 60ºC,
apoi se mai adaugă parafină şi se lasă peste noapte. În dimineaţa următoare, se
adaugă parafină până când amestecul conţine aproximativ 75 % parafină, apoi se
menţine 1 oră la 45ºC.
2. Se trece piesa apoi direct prin 2 băi de parafină pură.




Tehnici de histopatologie


120
6.4.4. Includerea

1. Se lubrifiază interiorul barelor Leuckart, al sticlelor de ceas sau al diferitelor
tăviţe metalice cu un amestec de etanol 60% - glicerină 9:1. Acesta va preveni
aderarea parafinei la recipientul ce constituie forma de turnare a blocurilor.
Acest lucru nu este necesar dacă se utilizează matriţe de hârtie.
2. Se răceşte matriţa prin menţinerea părţii sale inferioare pe gheaţă câteva minute.
3. Se scoate recipientul cu parafină topită din etuvă şi se varsă în matriţă.
4. Se introduce ţesutul în matriţă cu ajutorul unei pense hemostatice încălzite şi se
verifică dacă piesa a fost orientată corect. În funcţie de dimensiunea matriţei,
se pot include simultan mai multe piese (1-10) obţinându-se un număr
echivalent de blocuri. Etichetele din hârtie sunt ataşate în parafină, la marginea
matriţei, în dreptul piesei histologice.

6.4.5. Secţionarea

După includere, ţesuturile trebuie secţionate pentru a putea fi etalate pe lamă.
Secţionarea se realizează cu un microtom, la grosimi de 4-6 µm. Pentru realizarea unor
secţiuni corespunzătoare este necesar ca lama cuţitului să fie perfect ascuţită; se preferă
utilizarea cuţitelor single use. Odată obţinute secţiunile, acestea se depun pe suprafaţa
apei dintr-o baie de apă preîncălzită, fapt care ajută la deplierea panglicii secţionate.
Fragmentele de panglică sunt recuperate cu ajutorul unei lame de microscopie. Lama
cu secţiunea etalată este apoi plasată într-o etuvă timp de aproximativ 15 minute pentru
ca, prin topirea parţială a parafinei, secţiunile să adere mai bine la lamă.

1. Blocurile de parafină cu piesele incluse, se secţionează rectangular pe lângă
ţesut, lăsându-se câţiva milimetri de parafină pe fiecare faţă a blocului;
2. Urmează o nouă fasonare a blocului cu ajutorul unei lame de ras. Se va îndepărta
mai întâi parafina de pe faţa de secţionare la microtom, cât mai aproape de
ţesutul din bloc. Următoarele secţionări se vor face pe celelalte feţe ale
blocului, în aşa fel ca acestea să devină paralele una cu alta. Se va lăsa
suficientă parafină la baza blocului astfel încât acesta să poată fi ataşat la
obiectiv. Tăierea bazei blocului se va face în aşa fel încât ea să fie paralelă cu
faţa de secţionare;
3. Se ataşează blocul de parafină la discul obiectiv. Se depune un mic fragment de
parafină pe discul obiectiv şi se modelează cu o spatulă încălzită prin flambare
la un bec de gaz. Se lasă ca stratul de parafină să se răcească, apoi se pregătesc
cele două suprafeţe (baza blocului şi suprafaţa obiectului) în vederea aderării
prin topirea stratului superficial de parafină (se ating cele două suprafeţe timp
de câteva secunde cu spatula bine încălzită). Se presează apoi blocul de
parafină pe discul obiectiv şi se lasă în repaus pentru solidificare;
4. Se fixează discul obiectiv cu blocul ataşat în mandrina microtomului, se
ajustează poziţia în aşa fel ca blocul să fie paralel cu tăişul cuţitului de
microtom;
5. Ajustarea unghiului cuţitului se face prin încercări succesive. Unghiul diedru
format de faţa cuţitului şi faţa blocului trebuie să fie de aproximativ 5 grade.
Petru Cazacu


121
C
a
p
i
t
o
l
u
l
 
6
 
6. Se alege grosimea de secţionare (4-6 µm pentru majoritatea ţesuturilor) şi se
începe secţionarea cu viteză moderată. Se manevrează panglica rezultată prin
înlănţuirea secţiunilor cu ajutorul unui penson, preferabil din păr de cămilă. Se
secţionează aproximativ 25 de secţiuni, apoi se îndepărtează panglica de la
cuţit şi se depune pe o coală de hârtie colorată în negru.
7. Dacă se vor practica secţiuni mai subţiri (de 2-4 µm) sau dacă ţesutul este dur, se
pot obţine rezultate superioare prin răcirea blocului de parafină şi a cuţitului. În
acest scop, se ia un cub de gheaţă şi se lasă să se topească în aşa fel ca gheaţa
topită să se prelingă peste partea frontală a blocului. Alt cub de gheaţă se pune
pe faţa anterioară a cuţitului. Se va folosi un material absorbant (lavete,
prosoape de hârtie) pentru colectarea apei rezultate în urma topirii gheţii şi
răcirii piesei / cuţitului. Cuburile de gheaţă se vor menţine cca. 1-2 minute,
apoi se îndepărtează orice picătură de apă de pe cuţit şi bloc cu ajutorul unui
prosop de hârtie şi se începe secţionarea. Răcirea blocului de parafină se poate
face şi prin menţinerea sa timp de câteva minute în congelator.
8. Microtomul şi cuţitul de secţionare se toaletează după fiecare utilizare. Niciodată
nu se lasă fixat cuţitul în microtom când nu este folosit.

6.4.6. Etalarea secţiunilor

Albumina Baker

Albuş de ou .................................................. 50,0 ml
Apă distilată ................................................. 50,0 ml
NaCl ................................................................. 0,5 g
p-hidroxibenzoat de sodiu
1
............................... 0,1g

În apa distilată încălzită la 90°C, se dizolvă clorura de sodiu şi conservantul (p-
hidroxibenzoatul de sodiu). După răcire se adaugă albuşul, se centrifughează până când
supernatantul devine clar, se filtrează prin vată ori se lasă în repaus până când stratul
superior devine clar. Ca adeziv, se utilizează numai supernatantul clar. Pentru o bună
conservare, acesta se păstrează la frigider.

Albumina Baker diluată

Albumină Baker........................................ 4 picături
Apă distilată .................................................... 10 ml







1
Moldex, Tegosept, timolul sau salicilatul de sodiu se pot folosi ca substituenţi ai
p-hidroxibenzoatului de sodiu.
Tehnici de histopatologie


122
Albumina Baker comercială

Adeziv ........................................................... 2,5 ml
Apă distilată ............................................... 100,0 ml

Soluţia trebuie încălzită şi corect omogenizată înainte de utilizare. Se va
prepara extemporaneu.

Mod de lucru

Procedura 1
1. Se degresează lamele şi lamelele prin imersia lor în alcool acidifiat 95% (1 ml
HCl concentrat la 100 ml etanol) şi se şterg energic cu o pânză curată din
bumbac. Secţiunile nu vor adera la lamă dacă acestea nu sunt complet
degresate. Se evită contactul degetelor cu suprafaţa lamelor;
2. Se plasează secţiunile pe lamă cu ajutorul unor ace de disociere. Acestea vor
pluti la adăugarea câtorva picături de albumină diluată la marginea panglicii.
Ne vom asigura că secţiunile au fost montate pe faţa lamei cu capătul mat şi nu
pe faţa cu capătul lucios;
3. Secţiunile se plasează pe lama încălzită cu ajutorul unei platine încălzitoare
reglată la o temperatură cu aproximativ 5-10ºC sub punctul de topire al
parafinei;
4. Secţiunile se vor întinde şi netezi rapid. Excesul de fluid se va îndepărta prin
înclinarea lamei, menţinând panglica cu secţiuni cu ajutorul unor ace de
disociere;
5. Se transferă lamele cu secţiuni în etuvă, la 30-40ºC şi se lasă peste noapte pentru
a se asigura deshidratarea completă a acestora.

Procedura 2
1. Se utilizează lame degresate ca mai sus; se adaugă o picătură de adeziv nediluat
pe lamă şi se etalează cu pulpa degetului mic prin mişcări circulare. Excesul se
şterge cu pulpa degetului inelar. Degetele vor fi degresate în prealabil cu alcool
acidifiat 95 %;
2. Se plasează una sau două secţiuni pe suprafaţa apei într-o baie reglată la o
temperatură cu 5-10ºC sub punctul de topire a parafinei. Se lasă câteva minute
pentru întinderea secţiunilor;
3. Se introduce lama în baie, sub secţiune şi folosind un ac de disociere se prinde şi
se fixează fragmentul de panglică pe lamă, după care aceasta se scoate din
baie; fragmentul de panglică va adera la lamă;
4. Se lasă lamele cu secţiuni în etuvă peste noapte pentru uscare. Dezlipirea
secţiunilor de pe lamă în timpul colorării este o problemă frecvent întâlnită la
histotehnicienii debutanţi. Dacă lamele sunt curate şi secţiunile sunt
întotdeauna uscate complet după etalare, aceste incidente vor fi rare.



Petru Cazacu


123
C
a
p
i
t
o
l
u
l
 
6
 
6.4.7. Colorarea

Procesul de includere în parafină, necesar secţionării pieselor, trebuie urmat de
deparafinarea secţiunilor etalate pe lamă astfel încât să fie permisă penetrarea
coloranţilor hidrosolubili. Lamele cu secţiuni se deparafinează prin trecerea succesivă
în băi de xilen (sau înlocuitori), alcool etilic şi apă. Tehnicile de colorare sunt diverse
şi se selectează în funcţie de abilitatea lor de a colora diferite componente celulare şi
ţesuturi. Coloraţia de rutină este Hematoxilină-Eosină (HE), celelalte metode de
colorare sunt „coloraţii speciale”, pentru că se utilizează în situaţii specifice conform
nevoilor de diagnostic.

6.4.7.1. Coloraţia Hemalaun – Eozină

Scop
Aceasta este cea mai comună coloraţie histologică şi histopatologică utilizată
pentru studierea de ansamblu a citoarhitectonicii tisulare. În cazul micozelor profunde,
permite aprecierea leziunilor la nivel microscopic, însă are o valoare diagnostică redusă
pentru decelarea speciei implicate. Hemalaun-Eozină este o metodă de colorare de
rutină, dar care necesită o execuţie atentă pentru a asigura obţinerea unor rezultate
corecte şi uniforme. Evidenţiază elemente fungice aparţinând genurilor Pneumocystis,
Blastomyces, Coccidioides, dar şi unele aspecte din cromomicoze, rinosporidioză,
adiaspiromicoză, ca şi fenomenul Splendore-Hoeppli sau culoarea originală a fungilor
dematiacei (pigmentaţi).

Fixator
Se obţin rezultate excelente, comparabile, folosind diverşi fixatori

Tehnica de secţionare
Secţiuni cu grosimea de 4-5 µm, din fragmente de ţesut incluse în parafină

Echipament
Sticlărie de laborator, timer de laborator

Reactivi

Hematoxilina Ehrlich (1886)

Hematoxilină ...................................................... 2 g
Etanol 95% ................................................... 100 ml
Apă distilată .................................................. 100 ml
Glicerină ....................................................... 100 ml
Alaun de potasiu, în exces ..................... aprox. 20 g
Acid acetic ...................................................... 10 ml



Tehnici de histopatologie


124
Hematoxilina Harris

Hematoxilină ................................................... 5,0 g
Etanol 95% .................................................. 50,0 ml
Alaun de potasiu .......................................... 100,0 g
Apă distilată ................................................ 1000 ml
Oxid de mercur ................................................ 2,5 g

Se dizolvă hematoxilina în etanol şi alaunul în apă cu ajutorul căldurii. Se
amestecă cele două soluţii. Amestecul se aduce la fierbere cât mai repede posibil şi
apoi se adaugă oxidul de mercur. Se continuă fierberea până când apare o culoare
purpurie intensă (roşu-închis, violet), apoi se introduce recipientul într-o baie de apă
până la răcirea completă. După răcire, se adaugă 40 ml de acid acetic glacial. Când se
observă o strălucire aurie a soluţiei, aceasta se filtrează. Dacă această strălucire nu
apare, coloraţia va fi de calitate inferioară.

Hematoxilina Mayer

Hematoxilină ................................................... 5,0 g
Apă distilată ............................................... 700,0 ml
Alaun de potasiu ............................................ 50,0 g
Glicerină .................................................... 300,0 ml
Iodat de sodiu .................................................. 0,4 g
Acid acetic glacial ....................................... 20,0 ml

Se dizolvă hematoxilina într-o cantitate redusă de apă, apoi alaunul în
aproximativ 650 ml de apă distilată. Se amestecă cele două soluţii şi se completează
până la 700 ml. Se adaugă iodatul de sodiu în soluţie, după care aceasta se încălzeşte
blând pentru a grăbi oxidarea hematoxilinei. Soluţia se lasă la răcit pentru o jumătate
de oră, se filtrează, apoi se adaugă acidul acetic glacial şi glicerina. Soluţia poate fi
utilizată imediat şi este stabilă 2-3 luni.

Soluţia de albăstrire Scott

Sulfat de magneziu ........................................ 20,0 g
Bicarbonat de sodiu ......................................... 3,5 g
Apă distilată ................................................ 1000 ml

Se dizolvă sărurile separat, apoi se amestecă soluţiile şi se adaugă un cristal de
timol.

Alcool - acid 0,5 %

Etanol 70% ................................................ 100,0 ml
HCl ................................................................ 0,5 ml
sau
Petru Cazacu


125
C
a
p
i
t
o
l
u
l
 
6
 
HCl ................................................................... 3 ml
Etanol 95% ..................................................... 97 ml

Se adaugă acidul clorhidric peste alcool.

Eozină Y - alcoolică, soluţia stoc

Eosină Y, solubilă în apă şi alcool ................... 2,5 g
Apă distilată ............................................... 500,0 ml
Acid clorhidric concentrat ................................ 4 ml

Se dizolvă eozina (tetrabromfluoresceină de sodiu) în apă şi se adaugă treptat
acidul clorhidric care se va combina cu sodiul. Precipitatul rezultat este forma acidă a
tetrabromfluoresceinei, insolubilă în apă. Se lasă precipitatul să se stabilizeze şi apoi se
decantează supernatantul fluid. Se adaugă aproximativ 500 ml apă distilată peste
precipitat şi se agită până când colorantul se află complet în suspensie, apoi se lasă în
repaus pentru sedimentare. Se repetă procesul de spălare de aproximativ 6 ori, până
dispar toate urmele de ioni de sodiu şi clor. Se filtrează şi apoi se lasă hârtia de filtru
împreună cu colorantul la uscat în etuvă (max. 60ºC). Ponderea pulberii de colorant
dizolvate în 100 ml de etanol 95% este de 0,5 g. Se filtrează şi se stochează într-un
recipient transparent cu dop rodat. Tratând eozina astfel, se va obţine un colorant cu o
putere tinctorială mai mare, colorantul fiind mult mai stabil în alcool.
Pentru utilizare se diluează 1:5 în etanol 95%.

Tehnica de colorare

1. Deparafinarea şi hidratarea cu apă distilată a secţiunilor;
2. Se imersează preparatele într-una din soluţiile de hematoxilină, un timp variabil,
conform variantei de hematoxilină întrebuinţate: 5-10 minute pentru
hematoxilina Mayer, 5 minute pentru hematoxilina Harris şi 15 minute pentru
hematoxilina Ehrlich;
3. Se spală lamele cu apă distilată, apoi se introduc în soluţia de albăstrire Scott
pentru 1-2 minute. Se clătesc în apă distilată şi se examinează la microscop.
Secţiunea trebuie să fie supracolorată;
4. Se diferenţiază cu alcool - acid 0,5% pentru a îndepărta excesul de colorant din
fond, lăsând coloraţi numai nucleii;
5. Clătire cu apă distilată şi apoi reimersare în soluţia de albăstrire Scott pentru
încă 1-2 minute;
6. Se reexaminează la microscop şi dacă secţiunile sunt suficient decolorate se
continuă cu pasul următor. Dacă secţiunea este insuficient diferenţiată atunci se
repetă paşii 4 şi 5;
7. Spălare în apă de robinet 5-10 minute;
8. Colorare cu eozină alcoolică (se lasă lamele cu secţiuni în soluţia de colorare
până când acestea sunt uşor supracolorate);
9. Clătire în 2 băi de etanol 95%;
10. Diferenţiere în alcool absolut până când se obţine o coloraţie optimă;
Tehnici de histopatologie


126
11. Deshidratare într-o baie de alcool absolut;
12. Clarificare în câteva băi de xilol;
13. Montarea lamelelor cu balsam de Canada, Xam sau alte medii neutre de
montare care sunt miscibile cu xilolul.

Rezultatul colorării
Nucleii – albastru purpuriu
Hematiile – roşu
Celulele musculare – roz intens
Fibrele de colagen – roz

Notă:
Pentru realizarea coloraţiei Hematoxilină-Eozină, se poate folosi oricare din soluţiile
de hematoxilină prezentate la reactivi.

6.4.7.2. Albastru Alcian pH 2,5 – pentru mucopolizaharide acide

Scop
Coloraţia cu Albastru Alcian pune în evidenţă mucopolizaharidele acide. Se
poate utiliza pentru evidenţierea mucopolizaharidelor capsulare la Cryptococcus
neoformans. Este o metodă destul de eficientă pentru diferenţierea criptococilor
capsulaţi tipici de alţi patogeni yeast-like, cu formă şi dimensiuni similare.

Fixator
Formol 10% tamponat pH 6,8, Bouin sau Hollande

Tehnica de secţionare
Secţiuni cu grosimea de 4 µm, din fragmente de ţesut incluse în parafină

Echipamente
Pahare Berzelius, pH-metru, cuptor cu microunde, microscop

Reactivi

Acid acetic 3%

Acid acetic glacial ............................................ 3 ml
Apă distilată ............................................. ad 100 ml

Soluţia este stabilă 1 an.

Soluţie Albastru Alcian

Acid acetic glacial 3% .................................. 100 ml
Albastru Alcian 8GX .......................................... 1 g

Petru Cazacu


127
C
a
p
i
t
o
l
u
l
 
6
 
Se amestecă cele două ingrediente apoi se ajustează pH-ul la 2,5, utilizând acid
acetic. Se filtrează şi se adaugă un cristal de timol, apoi se etichetează şi se datează.
Soluţia este stabilă 2 până la 6 luni.
Atenţie! Conţine acid, evitaţi contactul şi inhalarea.

Nuclear fast red (Kernechtrot)

Sulfat de aluminiu….…..25,0 g
Apă distilată…….…......500 ml
Nuclear fast red…….……0,5 g

Se dizolvă sulfatul de aluminiu în apă. Se adăugă Nuclear fast red şi se dizolvă
prin încălzirea soluţiei. Se filtrează şi se adaugă un cristal de timol. Soluţia este stabilă
timp de 1 an.
Atenţie! Iritant - se va evita contactul şi inhalarea.

Tehnica de colorare
1. Se hidratează preparatul în apă distilată;
2. Se introduc lamele în acid acetic 3%, 3 minute;
3. Se introduc preparatele în soluţia de albastru Alcian, la cuptorul cu microunde
(la o treaptă superioară), timp de 30 secunde; în metoda convenţională, soluţia
de albastru Alcian cu lamele, se menţine la temperatura camerei, timp de 30
minute;
4. Se spală lamele cu apă de robinet 2 minute şi apoi se clătesc în apă distilată;
5. Se colorează cu Nuclear fast red, 5 minute, apoi se spală în apă de robinet;
6. Se deshidratează, se clarifică şi se montează lamela.

Rezultatul colorării
Mucopolizaharidele acide: albastru
Nucleii: roz-roşiatic

Note:
1. Nu este o coloraţie specifică pentru capsula C. neoformans, deoarece s-a constatat că
peretele altor fungi ca Blastomyces dermatitidis, Paracoccidioides brasiliensis sau
Rhinosporidium seeberi pot fixa colorantul; însă, datorită diferenţelor morfologice
certe, aceşti fungi nu pot fi confundaţi cu C. neoformans.
2. Albastru Alcian face parte din grupul coloranţilor bazici polivalenţi solubili în apă.
Culoarea albastră se datorează prezenţei cuprului în moleculele sale. Soluţia de acid
acetic glacial 3% (pH 2,5) şi soluţia de albastru Alcian colorează mucopolizaharidele
acide sulfatate şi carboxilate dar şi sialomucinele (glicoproteinele) sulfatate şi
carboxilate. Se crede că sărurile formează legături cu grupările acide ale acizilor
mucopolizaharidici.
3. Pentru siguranţă se poartă mănuşi, ochelari de protecţie şi halat. Se adăugă acidul
acetic în apă. Coloraţia se face sub hotă. Se evită contactul şi inhalarea coloranţilor.
Acidul acetic este iritant pentru aparatul respirator. Este de asemenea coroziv.



Tehnici de histopatologie


128
6.4.7.3. Coloraţia Bauer

Scop
Coloraţia Bauer pune în evidenţă glicogenul, diferite mucosubstanţe şi fungii

Fixator
Este recomandat formolul 10% tamponat pH 6,8, dar se pot folosi şi alţi
fixatori. Majoritatea coloraţiilor tricromice necesită ca fixatori acidul picric sau clorura
mercurică. Formolul fixează bine ţesuturile, dar pentru obţinerea unei coloraţii de
calitate superioară se recomandă o fixare secundară cu lichidul Bouin.

Tehnica de secţionare
Secţiuni cu grosimea de 5 µm, din fragmente de ţesut incluse în parafină

Echipament
Sticlărie de laborator, microscop

Reactivi

Reactiv Schiff – de Tomasi

Fucsină bazică .................................................... 1 g
Apă distilată ............................................. ad 200 ml
Metabisulfit de potasiu ....................................... 1 g
Acid clorhidric 1N .......................................... 20 ml
Cărbune activat (pulbere) ................................... 2 g

Se încălzeşte apa distilată până la fierbere într-un flacon Erlenmeyer de
dimensiuni mari. Se îndepărtează flaconul de pe sursa de căldură şi se adaugă imediat
colorantul, cu grijă, pentru că dizolvarea are loc cu efervescenţă. Se agită până la
dizolvarea colorantului. Se lasă soluţia să se răcească până la 50°C, apoi se adaugă
acidul clorhidric şi se omogenizează. Se lasă în continuare soluţia la răcit până la 25°C,
moment în care se adaugă metabisulfitul de potasiu. Se omogenizează din nou. Se
închide flaconul cu dop etanş şi se păstrează la întuneric pentru 1-2 zile. Dacă soluţia
nu este limpede, se adaugă cărbune activat şi se agită pentru aproximativ un minut. Se
filtrează soluţia. Se păstrează la temperatura de refrigerare, într-un flacon de sticlă
închis etanş. Metabisulfitul de potasiu se poate înlocui cu cel de sodiu, fără a diminua
calitatea coloraţiei. Conform Indexului Merck, bisulfitul de sodiu comercial este
realizat predominant din metabisulfit de sodiu. Soluţia finală trebuie să fie incoloră sau
de culoarea chihlimbarului, dar foarte pal. Soluţiile brune vor colora adesea foarte
prost. De obicei, acestea au fost realizate dintr-o fucsină bazică care conţine o cantitate
inferioară de pararosanilină.




Petru Cazacu


129
C
a
p
i
t
o
l
u
l
 
6
 
Hemalaun Mayer (hematoxilina Mayer, Langeron 1942)

Hematoxilină ................................................... 1,0 g
Alaun de potasiu ............................................ 50,0 g
Apă distilată ........................................... ad 1000 ml
Iodat de sodiu .................................................. 0,2 g
Acid citric ........................................................ 1,0 g
Cloral hidrat ................................................... 50,0 g

Se dizolvă hematoxilina în apa distilată, se încălzeşte apoi şi se fierbe timp de
5 minute. Se îndepărtează recipientul de pe sursa de căldură şi se adaugă iodatul de
sodiu, apoi se lasă soluţia pentru maturare timp de 10 minute. Se adaugă treptat restul
substanţelor în ordinea dată, dizolvând-o pe fiecare înainte de adăugarea celeilalte. Se
etichetează cu iniţialele denumirii şi data preparării, soluţia fiind stabilă timp de un an.
Atenţie! Se va evita contactul şi inhalarea.

Acid cromic

Trioxid de crom .................................................. 4 g
Apă distilată ............................................. ad 100 ml

Acid sulfuros

Metabisulfit de sodiu 10% sol. apoasă ............. 6 ml
Acid clorhidric 1N ........................................... 5 ml
Apă distilată ............................................. ad 100 ml

Tehnica de colorare
1. Se introduc secţiunile în apă distilată după ce au fost trecute prin băile cu xilen şi
etanol;
2. Se oxidează în acid cromic timp de 40-60 minute;
3. Se clătesc lamele în apă de robinet, apoi în apă distilată;
4. Se introduc preparatele în reactivul Schiff pentru 15 minute;
5. Apoi în acid sulfuros, 3 băi a câte 2 minute fiecare;
6. Se spală cu apă de robinet;
7. Supracolorare cu hemalaun, 1 minut;
8. Se deshidratează cu etanol;
9. Se face clarificarea cu xilen şi montare cu balsam de Canada.

Rezultatul colorării
Glicogenul şi mucosubstanţele – roşii
Fungii – roşii
Nucleii celulelor somatice – albaştri




Tehnici de histopatologie


130
Note:
1. În practica modernă se evită clătirea cu acid sulfuros, spălarea realizându-se cu
cantităţi mari de apă de robinet.
2. Mucinele, de obicei, nu sunt aşa de intens colorate ca în coloraţia PAS.
3. Menţinerea în acid cromic un timp mai îndelungat va reduce colorarea datorită
continuării oxidării aldehidelor.

6.4.7.4. Coloraţia Chick

Scop
Prin această coloraţie se pot pune în evidenţă fungii, la microscopul cu
fluorescenţă.

Fixator
Formol 10% tamponat pH 6,8

Tehnica de secţionare
Secţiuni cu grosimea de 5 µm, din fragmente de ţesut incluse în parafină

Echipament
Sticlărie de laborator, microtom, microscop cu fluorescenţă

Reactivi

Hematoxilină ferică Weigert

Soluţia stoc A

Hematoxilină ................................................... 5,0 g
Etanol 95% ................................................ 500,0 ml

Se omogenizează, apoi se etichetează, notând iniţialele denumirii şi data
preparării. Soluţia este stabilă 1 an.
Atenţie! Inflamabil, se evită contactul şi inhalarea.

Soluţia stoc B

Clorură ferică 29% ...................................... 20,0 ml
Apă distilată ............................................... 475,0 ml
Acid clorhidric ............................................... 5,0 ml

Se omogenizează, apoi se etichetează, notând iniţialele şi data preparării.
Soluţia este stabilă 1 an.
Atenţie! Coroziv, se evită contactul şi inhalarea.



Petru Cazacu


131
C
a
p
i
t
o
l
u
l
 
6
 
Soluţia de lucru

Soluţia stoc A .............................................. 25,0 ml
Soluţia stoc B ............................................... 25,0 ml

Se omogenizează cât mai atent. Soluţia va rămâne stabilă 3-4 zile.

Acridină orange

Acridină orange ............................................... 0,1 g
Apă distilată ............................................... 100,0 ml

Tehnica de colorare
1. După trecerea lamelor cu secţiuni prin xilen şi etanol, acestea se introduc într-o
baie de apă;
2. Hematoxilină ferică Weigert (soluţia de lucru), 5 minute;
3. Se spală cu apă de robinet;
4. Se introduc lamele în soluţia de acridină orange, 2 minute;
5. Se spală în apă de robinet, 30 minute;
6. Se deshidratează, clarifică şi montează într-o răşină nefluorescentă.

Rezultatul colorării
Se utilizează filtrele BG 12 şi OG 4 (galben) şi / sau OG 5 (portocaliu).
Fungii vor apare coloraţi fluorescent verde-roşu.

Notă:
Aceasta este cea mai indicată metodă de screening.

6.4.7.5. Coloraţia Gridley

Scop
Coloraţia Gridley pune în evidenţă fungii viabili din preparatele histologice
obţinute din ţesuturi incluse în parafină şi secţionate. Nu este satisfăcătoare pentru
detecţia elementelor fungice neviabile, degradate.

Fixator
Ţesuturile se fixează în soluţie tamponată de formol 10 %, cu pH 6,8

Tehnica de secţionare
Secţiuni cu grosimea de 5 µm, din fragmente de ţesut incluse în parafină

Echipament
Sticlărie de laborator, microscop



Tehnici de histopatologie


132
Reactivi

Reactiv Schiff – de Tomasi
Vezi coloraţia Bauer (6.4.7.3).

Fucsin-aldehidă

Fucsină bazică .................................................... 1 g
Paraldehidă, proaspătă ...................................... 1 ml
Acid clorhidric concentrat ................................ 1 ml
Etanol 70 % .................................................. 200 ml

Se dizolvă colorantul în etanol, apoi se adaugă paraldehida şi acidul clorhidric.
Se lasă la temperatura camerei timp de 48-72 ore, pentru maturare. Se păstrează la
frigider, soluţia fiind stabilă 2-3 luni.

Acid cromic

Trioxid de crom .................................................. 5 g
Apă distilată .................................................. 500 ml

Decolorant

Metabisulfit de sodiu .......................................... 5 g
Apă distilată .................................................. 500 ml

Metanil yellow (Galben metanil)

Metanil yellow .................................................... 1 g
Apă distilată .................................................. 400 ml
Acid acetic glacial .................................... 2 picături

Tehnica de colorare
1. După trecerea secţiunilor prin băile cu xilen şi etanol, acestea se imersează în
apă distilată;
2. Se introduc apoi în acid cromic, 1 minut;
3. Se spală cu apă de robinet;
4. Se tratează cu soluţie de metabisulfit, 1 minut;
5. Se spală cu apă de robinet;
6. Se clătesc cu apă distilată;
7. Se introduc lamele în reactivul Schiff, 20 minute;
8. Se spală cu apă de robinet;
9. Se clătesc cu etanol 70%;
10. Colorare cu fucsin-aldehidă, 30 minute;
11. Se clătesc cu etanol 95%;
12. Se spală cu apă de robinet;
Petru Cazacu


133
C
a
p
i
t
o
l
u
l
 
6
 
13. Supracolorare cu metanil yellow, 1 minut;
14. Se clătesc cu apă distilată;
15. Preparatele colorate se deshidratează, clarifică şi apoi se montează lamela cu
balsam de Canada.

Rezultatul colorării
Fungii – culoare purpurie
Fondul – galben

Notă:
La pasul 2, menţinerea în soluţia de acid cromic 10% pentru 10 minute va da rezultate similare.

6.4.7.6. Coloraţia Schmorl

Scop
Această metodă de colorare pune în evidenţă fungii din preparatele histologice
obţinute din fragmente de ţesut incluse în parafină şi secţionate la microtom.

Fixator
Fragmentele de ţesut se fixează în soluţie de formol 10 % tamponat 6,8, dar se
pot folosi şi alţi fixatori.

Tehnica de secţionare
Secţiuni cu grosimea de 5 µm, din fragmente de ţesut incluse în parafină

Echipament
Sticlărie de laborator

Reactivi

Decolorantul Mallory

Soluţia A

Permanganat de potasiu ...................................... 1 g
Apă distilată .................................................. 100 ml

Soluţia B

Acid sulfuric ..................................................... 1 ml
Apă distilată .................................................. 100 ml





Tehnici de histopatologie


134
Soluţia C

Acid oxalic ......................................................... 1 g
Apă distilată .................................................. 100 ml

Soluţia de lucru

Soluţia A ..................................................... 1 volum
Soluţia B ..................................................... 1 volum

Soluţie de acid periodic

Se foloseşte soluţia de acid periodic 0,5% (McManus) din coloraţia PAS sau
următoarea variantă:

Iodat de sodiu ..................................................... 1 g
Acid nitric 0,5% soluţie apoasă .................... 100 ml

Ambele soluţii de acid periodic dau aceleaşi rezultate.

Acetanilină

Anilină ............................................................ 10 ml
Acid acetic glacial .......................................... 90 ml

Tiosemicarbazidă

Tiosemicarbazidă ................................................ 1 g
Apă distilată .................................................. 100 ml

Soluţie Schmorl

Clorură ferică, sol. apoasă 1% ........................ 30 ml
Ferocianură de potasiu, sol. apoasă 1% ............ 4 ml
Apă distilată ...................................................... 6 ml

Soluţia trebuie să fie proaspătă, preparându-se înainte de utilizare. Nu se
reutilizează!

Tehnica de colorare
1. După trecerea secţiunilor prin băile cu xilen şi etanol, acestea se introduc
în apă distilată;
2. Urmează decolorarea Mallory:
• Lamele cu secţiuni etalate se introduc în soluţia de lucru timp de
10 minute;
• Se clătesc apoi în apă distilată;
Petru Cazacu


135
C
a
p
i
t
o
l
u
l
 
6
 
• Se introduc în soluţia C câteva minute, până când se observă
decolorarea secţiunilor;
• Se clătesc cu apă;
• Se continuă cu următorii timpi ai tehnicii de colorare;
3. Se spală cu apă de robinet;
4. Se oxidează în acid periodic pentru 10-20 minute;
5. Se clătesc cu apă de robinet;
6. Tratare cu acetanilină, 30 minute;
7. Se spală cu apă de robinet;
8. Se readuc preparatele în acid periodic pentru încă 20 minute;
9. Se clătesc cu apă de robinet;
10. Se introduc lamele în tiosemicarbazidă, 10 minute;
11. Se spală cu apă de robinet pentru îndepărtarea tuturor urmelor de
tiosemicarbazidă;
12. Se introduc lamele în soluţia proaspătă Schmorl, 10 minute;
13. Se spală cu apă de robinet;
14. Opţional, supracolorare cu nuclear fast red sau eosină;
15. Se clătesc cu apă de robinet;
16. Se deshidratează cu etanol, se clarifică cu xilen şi se montează lamelele
cu balsam de Canada.

Rezultatul colorării
Fungii – albaştri
Nucleii celulelor somatice – roşii
Fondul – roz

Note:
1. Este binecunoscut faptul că azidele metalelor pot fi explozive. Totuşi, tiosemicarbazida
nu este o simplă azidă metalică.
2. Formula tiosemicarbazidei este H
2
NNHCSNH
2
. Grupul hidrazinic (H
2
NNH-) combinat
cu orice aldehidă generează prin acidul periodic o reacţie de oxidare. Gruparea
tiocarbamilică (-CSNH
2
) este un agent reducător mult mai puternic decât sunt
aldehidele şi reduce rapid fericianida la ferocianidă, cu formarea imediată a unui
depozit de albastru de Prusia.
3. Decolorantul Mallory clarifică uşor fondul, îmbunătăţind contrastul. El poate produce şi
unele aldehide care vor fi îndepărtate în etapa 6.

6.4.7.7. Coloraţia Fontana-Masson

Scop
Această metodă de colorare se utilizează pentru a evidenţia melanina şi
substanţele de tip melanin-like. Melanina este un pigment negru-brun prezent în mod
normal în păr, piele, retină, iris, în unele zone ale sistemului nervos central, dar şi în
peretele unor fungi (Cryptococcus spp., fungii dematiacei). De asemenea, coloraţia
poate fi utilizată pentru detecţia intratisulară a fungilor aparţinând genurilor
Aspergillus, Candida sau zygomicetelor.

Tehnici de histopatologie


136
Fixator
Fragmentele de ţesut se fixează în soluţie de formol 10 % tamponată 6,8

Tehnica de secţionare
Secţiuni cu grosimea de 4 µm, din fragmente de ţesut incluse în parafină

Echipamente
Sticlărie de laborator, cuptor cu microunde (sau etuvă reglată la 60ºC),
microscop

Reactivi

Argint amoniacal, soluţie stoc

Nitrat de argint 10% .................................... 25,0 ml

Se adaugă hidroxid de amoniu, picătură cu picătură, până la precipitarea
soluţiei şi apoi limpezirea ei;

Se adaugă apoi nitrat de agint 10% ............... 1,0 ml

Soluţia va deveni puţin tulbure şi se va lăsa în repaus pentru 4-24 ore. După
utilizare, soluţia se aruncă.
Atenţie! Soluţie corozivă - se va evita contactul şi inhalarea.

Argint amoniacal, soluţie de lucru

Argint amoniacal, soluţie stoc ..................... 12,5 ml
Apă distilată ................................................. 37,5 ml

Se pipetează tot argintul amoniacal, lăsându-se apoi la decantat. Se filtrează.
Soluţia nu se reutilizează.
Atenţie! Soluţie corozivă - se va evita contactul şi inhalarea.

Nitrat de argint 10%

Nitrat de argint ............................................... 20,0 g
Apă distilată .......................................... ad 200,0 ml

Se agită amestecul pentru solubilizare. Soluţia se păstrează la frigider într-un
recipient brun de sticlă, tratat în prealabil cu amestec sulfo-cromic. Soluţia se poate
folosi timp de 6 luni de la preparare.
Atenţie! Se evită contactul şi inhalarea.



Petru Cazacu


137
C
a
p
i
t
o
l
u
l
 
6
 
Clorură de aur 0,1 %

Clorură de aur 1%, soluţie stoc ...................... 5,0 ml
Apă distilată ................................................. 45,0 ml

Atenţie! Se evită contactul şi inhalarea.

Tiosulfat de sodiu 5%

Tiosulfat de sodiu ........................................... 200 g
Apă distilată .................................................... ad 4 l

Se dizolvă tiosulfatul de sodiu în apa distilată. Se păstrează într-un recipient cu
volum corespunzător, care se etichetează şi datează.
Atenţie! Se evită contactul şi inhalarea.

Nuclear fast red (Kernechtrot)

Sulfat de aluminiu......................................... 25, 0 g
Apă distilată .............................................. 500, 0 ml
Nuclear-fast red ............................................... 0,5 g

Se dizolvă sulfatul de aluminiu în apa distilată, apoi nucler fast red-ul, folosind
căldura (fierbere pentru 5 minute). Se lasă soluţia să se răcească, apoi se filtrează,
adăugându-se câteva cristale de timol pentru conservare. Se etichetează şi se datează.
Soluţia este stabilă timp de 1 an.
Atenţie! Iritantă, se evită contactul şi inhalarea.

Tehnica de colorare
1. Secţiunile etalate se vor deparafina şi hidrata cu apă distilată;
2. Soluţia de lucru de argint amoniacal cu lamele se introduce în cuptorul cu
microunde (la o treaptă superioară), timp de 2 minute. Se verifică lamele la
microscop pentru a observa dacă intensitatea impregnării este adecvată, iar
dacă este necesar, soluţia cu lame se va plasa suplimentar în cuptorul cu
microunde timp de câteva secunde (în metoda convenţională soluţia se
introduce în etuvă la 60ºC pentru 1 oră);
3. Clătire în apă distilată;
4. Clorură de aur 0,1%, 10 minute;
5. Clătire în apă distilată;
6. Tiosulfat de sodiu 5%, 5 minute;
7. Se spală lamele în apă de robinet şi apoi se clătesc în apă distilată;
8. Nuclear fast red, 5 minute;
9. Se spală în apă de robinet;
10. Se deshidratează, clarifică şi se acoperă cu lamelă.


Tehnici de histopatologie


138
Rezultatul colorării
Melanina şi celulele argentafine – negre (fig. nr. 6-1 vezi Anexa)
Nucleii celulelor somatice - roşii

Note:
1. O reacţie argentafină pozitivă este dată de faptul că celulele absorb argintul pe care îl
reduc apoi la o formă metalică vizibilă, fără ajutorul unui agent reducător.
2. Atenţie! Se vor purta în timpul lucrului mănuşi, ochelari de protecţie şi halat de
laborator. Se evită contactul şi inhalarea. Nitratul de argint: este iritant sever pentru
piele şi ochi, oxidant, ingestia va produce un puternic disconfort gastrointestinal;
posibil carcinogen. Soluţia de argint amoniacal poate fi explozivă; în caz de vărsare
accidentală, se va îndepărta folosind un volum mare de apă de robinet. Hidroxidul de
amoniu: este un iritant puternic pentru ochi şi aparatul respirator. Se manipulează în
nişă chimică. Tiosulfatul de sodiu: toxic prin ingestie, iritant gastric, tegumentar,
ocular şi respirator.

6.4.7.8. Coloraţia Gridley fluorescentă

Scop
Această metodă de colorare pune în evidenţă fungii din preparatele histologice,
prin microscopia cu fluorescenţă

Fixator
Fragmentele de ţesut se fixează în formol 10% tamponat pH 6,8, dar se pot
folosi şi alţi fixatori.

Tehnica de secţionare
Secţiuni din fragmente de ţesut incluse în parafină, cu grosimea de 5 µm

Echipamente
Sticlărie de laborator, microscop cu fluorescenţă

Reactivi

Reactiv Schiff fluorescent

Acriflavină .......................................................... 1 g
Apă distilată .................................................. 200 ml
Metabisulfit de potasiu ....................................... 2 g
Acid clorhidric 1N .......................................... 20 ml

Se dizolvă colorantul în apă şi se omogenizează. Se adaugă apoi succesiv
acidul clorhidric şi metabisulfitul, omogenizându-se cât mai atent. Se închide etanş
recipientul, se lasă la întuneric pentru 48 ore, apoi se filtrează. Acridina orange poate fi
de asemenea utilizată la prepararea acestei soluţii.


Petru Cazacu


139
C
a
p
i
t
o
l
u
l
 
6
 
Soluţia A

Trioxid de crom ................................................ 50 g
Apă distilată .................................................. 500 ml

Soluţia B

Sulfit de sodiu ..................................................... 5 g
Apă distilată .................................................. 500 ml

Soluţie C

Etanol 70% ................................................... 495 ml
Acid clorhidric .................................................. 5 ml

Tehnica de colorare
1. După trecerea secţiunilor prin băile cu xilen şi etanol, acestea se introduc în apă
distilată;
2. Imersare în soluţia A, 10 minute;
3. Clătire cu apă de robinet;
4. Decolorare în soluţia B, 1 minut;
5. Spălare cu apă de robinet;
6. Clătire cu apă distilată;
7. Tratare cu reactiv Schiff fluorescent, 20 minute;
8. Spălare cu apă de robinet;
9. Imersare în soluţia C, două băi, câte 5 minute fiecare;
10. Spălare cu apă distilată;
11. În final, preparatele se deshidratează, clarifică şi apoi se montează lamela cu o
răşină nefluorescentă.

Rezultatul colorării
Pentru examinare se utilizează filtrele BG 12, OG 4 (galben) şi / sau OG 5
(portocaliu). Fungii apar coloraţi în galben-fluorescent cu acriflavină şi verde-roşu cu
acridină orange.

Note:
1. Această metodă de colorare este utilizată frecvent ca metodă de screening.
2. Dacă fluorescenţa fondului este prea intensă pentru a distinge fungii, aceasta se poate
atenua prin tratare cu hemalaun (1 minut) sau cu soluţie apoasă 0,5% de
permanganat de potasiu (1 minut). Această atenuare se realizează înainte de
deshidratarea finală, cu precauţie pentru a nu reduce excesiv fluorescenţa fungilor.

6.4.7.9. Coloraţia Gomori-Grocott (Methenamine silver - modificată)

Scop
Evidenţierea fungilor în ţesuturi. Este o coloraţie superioară pentru depistarea
filamentelor aspergilare, a chiştilor de Pneumocystis, a elementelor tipice pentru
Tehnici de histopatologie


140
Candida, zygomicete, Cryptococcus, Histoplasma, Blastomyces, Paracoccidioides,
Coccidioides, Lacazia loboi, Penicillium marneffei, Rinosporidium, Emmonsia. De
asemenea, evidenţiază actinomicetele, Nocardia şi algele de tipul Prototheca sau
Chlorela.

Fixator
Fragmentele de ţesut se fixează în soluţie de formol 10 % tamponat pH 6,8.

Tehnica de secţionare
Secţiuni din fragmente de ţesut incluse în parafină, cu grosimea de 4-5 µm

Echipamente
Sticlărie de laborator, cuptor cu microunde

Reactivi

Acid cromic 2%

Trioxid de crom ............................................. 10,0 g
Apă distilată ............................................. ad 500 ml

După solubilizare, soluţia se transferă într-un recipient etanş în care poate fi
stocată până la 6 luni.
Atenţie! Acidul este coroziv, posibil carcinogen, se evită contactul şi
inhalarea.

Metabisulfit de sodiu 1%

Metabisulfit de sodiu ....................................... 5,0 g
Apă distilată ............................................. ad 500 ml

Soluţia este stabilă 6 luni.

Borax 5%

Borat de sodiu .................................................. 5,0 g
Apă distilată ............................................. ad 100 ml

Soluţia este stabilă 3 luni.

Metenamină-argint, soluţia stoc

Metenamină 3%
(hexametilentetraamină) ........................... .100,0 ml
Nitrat de argint 5% ........................................ 5,0 ml

Petru Cazacu


141
C
a
p
i
t
o
l
u
l
 
6
 
Cele două soluţii se amestecă într-un recipient brun de sticlă, tratat în prealabil
cu amestec sulfo-cromic, clătit în apă distilată şi uscat. Soluţia este stabilă 3 luni, la
temperaturi de refrigerare.
Atenţie! Corozivă, posibil carcinogenă.

Clorură de aur 0,5%

Clorură de aur .................................................. 0,5 g
Apă distilată .......................................... ad 100,0 ml

Se păstrează la frigider, în recipiente tratate cu amestec sulfo-cromic, clătite şi
uscate. Soluţia este stabilă 1 an.
Atenţie! Se evită contactul şi inhalarea.

Verde luminos 0,2%

Verde luminos (Light Green SF yellow) ......... 0,2 g
Apă distilată ............................................... 100,0 ml
Acid acetic glacial ......................................... 0,2 ml

Soluţia este stabilă 6 luni.
Atenţie! Se evită contactul şi inhalarea.

Tehnica de colorare
1. Deparafinare şi hidratare în apă distilată;
2. Lamele cu secţiuni se transferă în soluţia de acid cromic 2% şi se menţin în
cuptorul cu microunde la o treaptă superioară, 45 secunde; alternativ, se pot
menţine şi 5 minute, dar la o treaptă inferioară (în metoda convenţională,
acidul cromic 5%, se menţine pe baie de apă la 60°C, timp de 1 oră);
3. Se spală lamele în apă de robinet şi apoi se clătesc cu apă distilată;
4. Urmează tratarea cu soluţia de metabisulfit de sodiu 1%, 1 minut, la temperatura
camerei;
5. Spălare în apă de robinet, apoi clătire în 3 băi succesive de apă distilată;
6. Se introduc lamele cu secţiuni în soluţia de metenamină-argint, la cuptorul cu
microunde (treaptă superioară), 70 secunde: ţesuturile trebuie să capete o
coloraţie brună, asemănătoare hârtiei de ambalaj. Se agită preparatul în soluţia
fierbinte (în metoda convenţională soluţia de argint se încălzeşte pe baie de apă
la 60°C, pentru o oră sau până la apariţia unei coloraţii brune);
7. Clătire în 2 băi de apă distilată;
8. Tratare cu clorură de aur 5% , 1 minut sau până la apariţia unei coloraţii gri;
9. Spălare în apă distilată;
10. Tiosulfat de sodiu 5%, 3 minute;
11. Spălare în apă de robinet şi clătire în apă distilată;
12. Verde luminos 1 minut;
13. Clătire în apă distilată;
14. Preparatele se deshidratează, se clarifică şi apoi se montează lamela.
Tehnici de histopatologie


142
Rezultatul colorării
Fungii – brun-negri
Fondul – verde

Note:
1. Componentele mucopolizaharidice ale peretelui celulelor fungice sunt oxidate până la
punerea în libertate a grupărilor aldehidice. Grupările aldehidice reacţionează
ulterior cu nitratul de argint, reducându-l până la argint metalic.
2. În cazul în care culoarea acidului cromic virează în brun, atunci este necesar ca acesta
să fie schimbat. De notat că soluţia 2% este mai indicată decât cea 5%, utilizată în
metoda convenţională, acidul cromic mai concentrat provocând desprinderea ţesutului
de pe lamă când se utilizează tehnica cu microunde.
3.Când culoarea fungilor nu virează în negru, se verifică prospeţimea acidului cromic, a
metabisulfitului de sodiu şi a boraxului.
4. Când lucrăm cu soluţia de nitrat de argint, dacă se observă o tulburare a sa sau un
aspect de “oglindă” pe faţa paharului, atunci este necesară prepararea unei noi
soluţii.
5. Pentru protecţie se vor purta mănuşi, ochelari de protecţie şi halat de laborator. Se
respectă modul de lucru cu soluţiile sub hotă. Se evită contactul şi inhalarea. Acidul
cromic: coroziv pentru piele şi mucoase. Foarte toxic! Organul ţintă este rinichiul.
Carcinogen. Metabisulfitul de sodiu: toxic prin ingestie, poate cauza gastroenterite.
Iritant pentru piele, ochi şi mucoase. Nitratul de argint: iritant sever pentru piele şi
ochi, oxidant. Posibil carcinogen. Tiosulfatul de sodiu: toxic prin ingestie, poate irita
stomacul. Iritant pentru piele, ochi şi tractul respirator. Verde luminos SF yellow:
posibil carcinogen.
6. Există în comerţ şi kit-ul de colorare GMS Staining Kit, produs de Ventana, nr. catalog
860-007 ; informaţii: Europe Ventana Medical Systems, S.A. Parc d’Innovation – BP
30 144 Rue G. de Kaysersberg F - 67404 Illkirch Cedex France 33 (0) 3 90 40 52 00.

6.4.7.10. Coloraţia fluorescentă cu acid periodic Schiff
(PAS - fluorescentă)

Scop
Această metodă de colorare pune în evidenţă fungii, prin microscopia cu
fluorescenţă.

Fixator
Fragmentele de ţesut sunt fixate în soluţie de formol 10% tamponată pH 6,8,
dar pot fi folosiţi şi alţi fixatori.

Tehnica de secţionare
Secţiuni din fragmente de ţesut incluse în parafină, cu grosimea de 5 µm

Echipamente
Sticlărie de laborator, microscop cu fluorescenţă



Petru Cazacu


143
C
a
p
i
t
o
l
u
l
 
6
 
Reactivi

Soluţie de acid periodic
Vezi coloraţia Schmorl (6.4.7.6.).

Reactiv Schiff fluorescent
Vezi coloraţia Gridley fluorescentă (6.4.7.8.).

Alcool - acid 5%
Vezi coloraţia hemalaun – eozină (6.4.7.1.).

Tehnica de colorare
1. Se deparafinează şi se hidratează secţiunile;
2. Tratare cu acid periodic, 10 minute;
3. Spălare în apă de robinet;
4. Clătire cu apă distilată;
5. Tratare cu reactiv Schiff fluorescent, 20 minute;
6. Spălare în apă de robinet;
7. Alcool - acid, două băi a 5 minute fiecare;
8. Spălare cu apă de robinet;
9. Lamele cu secţiuni se deshidratează, se clarifică şi apoi se montează lamela cu o
răşină nefluorescentă.

Rezultatul colorării
Se utilizează filtrele BG 12, OG 4 (galben) şi / sau OG 5 (portocaliu). Fungii
apar coloraţi în galben-fluorescent cu acriflavină şi verde-roşu cu acridină orange.

Note:
1. Unele formaţiuni fluorescente vor apare colorate în roşu sau roz la coloraţia PAS.
2. Dacă fluorescenţa fondului este prea intensă pentru a distinge fungii, aceasta se poate
atenua prin tratare cu hematoxilină 1 minut sau cu soluţie apoasă 0,5% de
permanganat de potasiu 1 minut. Fluorescenţa se atenuează înaintea deshidratării
finale. Aceasta atenuare a fluorescenţei de fond trebuie să se facă cu precauţie pentru
a nu reduce fluorescenţa fungilor.

6.4.7.11. Coloraţia cu acid periodic Schiff

Scop
Coloraţia cu acid periodic Schiff (engl. Periodic Acid Schiff, PAS) se poate
utiliza pentru colorarea fungilor din preparatele histologice.

Fixator
Probele de ţesut sunt fixate în soluţie formol 10% tamponată pH 6,8, dar se pot
utiliza şi alţi fixatori (însă glutaraldehida trebuie evitată).

Tehnica de secţionare
Secţiuni din fragmente de ţesut incluse în parafină cu grosimea de 4-5 µm
Tehnici de histopatologie


144

Echipamente
Sticlărie de laborator, cuptor cu microunde

Reactivi

Acid periodic 0,5 %, după McManus

Acid periodic ................................................... 0,5 g
Apă distilată ............................................... 100,0 ml

După completa solubilizare a acidului periodic, soluţia se etichetează cu data
preparării şi iniţialele denumirii. Soluţia este stabilă 1 an.
Atenţie! Se va evita contactul şi inhalarea.

Reactivul Schiff (Lillie, la rece)

Fucsină bazică .............................................. 10, 0 g
Metabisulfit de sodiu ..................................... 18,0 g
Apă distilată ............................................. 1000,0 ml
Acid clorhidric ............................................. 10,0 ml

Se adaugă fucsina şi metabisulfitul în acidul clorhidric. Se agită soluţia timp de
2 ore, apoi se menţine la întuneric, la temperaturi de 8°-10°C. Soluţia devine limpede,
de culoare brun-deschis până la galben-deschis. A doua zi se adaugă:
Cărbune activat (pulbere) ................................ 5,0 g

Se omogenizează 1-2 minute, apoi se filtrează prin hârtie de filtru Whatman nr.
2 într-un cilindru gradat de 1000 ml. Hârtia de filtru se va înlocui frecvent. Se readuce
volumul la 1000 ml cu apă distilată. Soluţia finală trebuie să fie incoloră sau de
culoarea chihlimbarului, dar foarte pal. Soluţiile brune vor produce frecvent coloraţii
necorespunzătoare. De obicei, aceste soluţii au fost preparate cu fucsină bazică ce
conţine o cantitate mică de pararosanilină. Se păstrează la frigider, soluţia fiind stabilă
timp de 6 luni. La prepararea reactivului se vor purta mănuşi, ochelari de protecţie,
mască şi halat de protecţie. Se lucrează sub hotă, recipientul cu reactiv se păstrează
acoperit, iar soluţiile de preparare în nişa chimică.
Atenţie! Reactivul este carcinogen şi corosiv, se evită inhalarea. Acidul
clorhidric este caustic, se va utiliza cu atenţie!








Petru Cazacu


145
C
a
p
i
t
o
l
u
l
 
6
 
Hematoxilina Gill

Hematoxilină ................................................... 4,0 g
Sulfat de aluminiu.......................................... 70,4 g
Apă distilată .............................................. 750,0 ml
Etilenglicol ................................................ 250,0 ml
Iodat de sodiu ................................................. 4,0 g
Acid acetic glacial ....................................... 20,0 ml

Se amestecă etilenglicolul cu apa distilată, se adaugă hematoxilina, iodatul de
sodiu, apoi sulfatul de aluminiu şi acidul acetic glacial. Se agită o oră la temperatura
camerei. Se filtrează înainte de utilizare. Soluţia poate fi utilizată imediat şi este stabilă
pentru aproximativ un an. Hematoxilina trebuie să fie anhidră; dacă este hidratată
(C
16
H
14
O
6
x 3H
2
O) se utilizează o cantitate de 4,72 g.

Tehnica de colorare
1. Deparafinarea şi hidratarea secţiunilor cu apă distilată;
2. Se introduc apoi lamele în acid periodic 0,5 %, timp de 5 minute;
3. Clătire în apă distilată;
4. Se introduc lamele cu secţiuni în reactivul Schiff, la cuptorul cu microunde
(treaptă superioară), pentru 45-60 secunde; preparatul va căpăta o culoare
magenta (în metoda convenţională, reactivul Schiff se menţine la temperatura
camerei, timp de 30 minute);
5. Se spală continuu în apă de robinet, timp de 5 minute;
6. Tratare cu hematoxilină, timp de 3 minute;
7. Se spală în apă de robinet, apoi în apă distilată;
8. Se deshidratează în alcool, se clarifică şi se montează lamela.


Rezultatul colorării
Glicogenul şi fungii: magenta (fig. nr. 6-2 vezi Anexa)
Nucleii celulelor somatice: albaştri

Note:
1. Pentru a verifica calitatea reactivului Schiff, se adaugă în 10 ml de formaldehidă câteva
picături de reactiv Schiff; culoarea trebuie să vireze imediat în roşu-purpuriu.
2. Dacă în timpul păstrării la frigider a reactivului culoarea acestuia virează în roz,
reactivul Schiff se înlocuieşte.
3. Dacă se observă un precipitat alb în recipientul cu reactiv Schiff, acesta se poate
redizolva prin încălzirea uşoară a rectivului şi agitarea soluţiei.

6.4.7.12. Coloraţia Ziehl - Neelsen

Scop
Această coloraţie este utilizată pentru evidenţierea bacteriilor din genul
Mycobacterium, diferenţierea filamentelor de Nocardia (Ziehl pozitive) şi actinomicete
Tehnici de histopatologie


146
(Ziehl negative). De asemenea, se pot pune în evidenţă elemente fungice caracteristice
speciilor de Histoplasma şi Blastomyces.

Fixator
Fragmentele de ţesut se fixează în soluţie de formol 10 % tamponată pH 6,8.

Tehnica de secţionare
Secţiuni din fragmente de ţesut incluse în parafină, cu grosimea de 4-5 µm

Echipamente
Sticlărie de laborator, cuptor cu microunde

Reactivi

Fenol-Fucsină Ziehl - Neelsen

Fucsină bazică ................................................. 2,5 g
Apă distilată ............................................... 250,0 ml
Etanol absolut ............................................. 25,0 ml
Cristale de fenol topite ................................. 12,5 ml

Se omogenizează, se filtrează şi se păstrează într-un recipient brun de sticlă.
Acesta se etichetează cu data preparării şi cu timpul de stabilitate al soluţiei (cca. 1 an).
Atenţie! Carcinogenă şi toxică.

Alcool - acid 1%

Acid clorhidric ................................................ 10 ml
Etanol 70 % .................................................. 990 ml

Se omogenizează şi se etichetează cu data preparării şi timpul de stabilitate al
soluţiei (1 an).
Atenţie! Corozivă.

Albastru de metilen, soluţia stoc

Albastru de metilen .......................................... 0,7 g
Apă distilată ................................................. 50,0 ml

Se omogenizează, se filtrează şi se păstrează într-un recipient etanş. Se
etichetează menţionându-se data preparării şi perioada de stabilitate a soluţiei (1 an).

Albastru de metilen, soluţia de lucru

Albastru de metilen sol. stoc ............................ 5 ml
Apă distilată .................................................... 45 ml
Petru Cazacu


147
C
a
p
i
t
o
l
u
l
 
6
 

Soluţia se păstrează într-un recipient de sticlă, fiind stabilă timp de 2 luni. Se
va evita contactul şi inhalarea.

Tehnica de colorare
1. Deparafinare, apoi hidratare cu apă distilată a secţiunilor etalate pe lame;
2. Lamele se introduc în soluţia de fenol-fucsină, care apoi se menţine în cuptorul
cu microunde (treaptă intermediară), 45 secunde. Lamele se vor lăsa în soluţia
fierbinte timp de încă 5 minute. Soluţia se filtrează o dată pe săptămână;
3. În metoda convenţională, preparatele se menţin la etuvă, la 60°C timp de 1 oră;
4. Spălare cu apă de robinet;
5. Tratare cu alcool - acid 1% până la apariţia culorii roz-deschis, persistente;
6. Spălare cu apă de robinet, 5 minute;
7. Clătire cu apă distilată;
8. Albastru de metil, soluţie de lucru, 30 secunde;
9. Clătire cu apă de robinet;
10. Se deshidratează, se clarifică şi se montează lamela cu balsam de Canada.

Rezultatul colorării
Structurile acido-rezistente – roşii strălucitoare
Fondul – albastru

Note:
1. Componenta lipoidică a bacteriilor acido-rezistente se colorează cu fenol-fucsină,
rezistentă la decolorarea cu acid diluat.
2. Se utilizează filtre „Millipore
TM
” pentru filtrarea apei necesare în procesul colorării.
3. În timpul preparării soluţiilor se vor purta mănuşi, ochelari de protecţie şi halat. Se
evită contactul şi inhalarea soluţiilor.
4. Fucsina bazică este carcinogenă.
5. Acidul clorhidric: iritant puternic pentru piele, ochi şi aparatul respirator.

6.4.7.13. Reactivi suplimentari

Amestec sulfo-cromic (pentru tratarea sticlăriei)

Scop
Curăţarea sticlăriei utilizate la colorare şi pentru proceduri care necesită
sticlărie perfect igienizată.



Echipamente
Balon de 4000 ml, agitator magnetic, un recipient de sticlă cu volum de 6-7
litri, cu capac



Tehnici de histopatologie


148
Reactivi

Soluţie acidă de curăţare

Bicromat de potasiu ....................................... 400 g
Apă distilată ................................................ 4000 ml
Acid sulfuric ................................................. 400 ml

Se dizolvă bicromatul de potasiu în apă. Se toarnă soluţia într-un recipient de
6-7 litri, apoi se adaugă încet acidul sulfuric. Soluţia se păstrează până când culoarea sa
devine maro-închis (depinde de frecvenţa utilizării). Se etichetează şi se datează.

Soluţie acidă de spălare a sticlăriei 1,5%

Apă distilată .................................................. 985 ml
Acid clorhidric ................................................ 15 ml

Se omogenizează şi se etichetează.

Note:
Pentru protecţie se vor utiliza mănuşi, ochelari şi halat. Acidul sulfuric: vaporii sunt
toxici, nu se inhalează. Afectează pielea, aparatul respirator, reproducător şi ţesuturile fetale.
Este iritant pentru piele, ochi şi aparatul respirator. Acidul sulfuric concentrat se adaugă lent
în apă şi soluţii apoase, nu invers. Bicromatul de potasiu: toxic prin inhalare şi ingestie.
Afectează sistemul reproducător şi ţesuturile fetale. Coroziv pentru piele, ochi şi mucoase.
Acidul clorhidric: puternic iritant pentru piele, ochi şi aparatul respirator. Este coroziv.

6.5. Montarea

Montarea presupune în prealabil deshidratarea şi clarificarea secţiunilor.
Înainte de introducerea lamelor cu secţiuni în prima baie de etanol, acestea se
usucă prin compresare uşoară cu hârtie de filtru pe ambele feţe. De asemenea, lamele
se şterg pe verso cu un tifon curat pentru a îndepărta resturile de colorant.
Urmează deshidratarea:

1. Etanol 95 %, 5 minute;
2. Etanol 95 %, 5 minute;
3. Etanol 100 %, 5 minute;
4. Etanol 100%, 5 minute;
5. Toluen, 10 minute.

Dacă secţiunile nu sunt complet deshidratate, la introducerea lor în toluen va
apare o turbiditate albicioasă. Aceasta va limita conservabilitatea preparatelor.




Petru Cazacu


149
C
a
p
i
t
o
l
u
l
 
6
 
Medii de montare

Balsamul de Canada

Este o răşină a coniferului Abies balsamea, dizolvată în proporţie de 55 % în
xilol. Prin învechire capătă o coloraţie gălbuie, iar unele coloraţii nu se conservă
corespunzător (ex. coloraţiile cu fucsină acidă, verde luminos).

D.P.X.

Distiren 80 ..................................................... 10,0 g
Dibutilftalat ................................................. 80,5 ml
Xilol ............................................................. 35,0 ml

Este o răşină sintetică, neutră chimic, ceea ce asigură o conservare mai bună a
coloranţilor şi implicit a preparatelor.


Pe lama umectată cu toluen se pune o picătură de mediu de montare, iar
deasupra se aşează o lamelă:
1. Lamela se aşează pe lamă, sub o incidenţă de 45º, atingând cu marginea picătura
de mediu de montare; după ce picătura s-a extins pe toată lungimea marginii ce
formează unghiul diedru cu lama, aceasta se presează uşor (fig. nr. 6-3 a, b).
Fig. nr. 6-3
Montarea secţiunilor în medii
anhidre (a, b) şi
în medii apoase (c, d).
Tehnici de histopatologie


150
2. Se depune o picătură de mediu de montare pe lamă şi una pe lamelă, apoi
acestea se aduc paralel până când cele două picături confluează, apoi lamela se
presează uşor (fig. nr. 6-3 c, d).
Se îndepărtează eventualele bule de aer de sub lamelă cu ajutorul unui ac de
disociere. Excesul de mediu de montare se îndepărtează cu ajutorul unui tifon îmbibat
în benzen. Preparatele histologice astfel obţinute se menţin în poziţie orizontală la
temperatura camerei, timp de 2-3 zile.

6.6. Etichetarea şi arhivarea

După ce excesul de mediu de montare este îndepărtat, preparatele se pot
eticheta. Preparatele histologice se etichetează prin plasarea unor mici etichete
dreptunghiulare adezive la capătul mat al lamei. Această etichetă se completează cu
ajutorul unei tuş rezistent la apă şi va cuprinde instituţia, numărul din registrul
laboratorului, anul, natura probei, coloraţia etc.
Arhivarea preparatelor histologice trebuie să asigure în primul rând protejarea
acestora de şocuri mecanice, de lumină, umiditate şi praf. După interpretarea
microscopică şi fotografierea aspectelor morfologice de interes, preparatele histologice
permanente se arhivează în cutii speciale în ordinea seriei, în fante numerotate, iar
cutiile se introduc în sertarele histotecii. Blocurile de parafină se vor păstra în plicuri
care vor avea aceleaşi însemnări ca şi preparatele şi vor fi depozitate în rafturile unor
dulapuri special destinate acestui scop. În registrul de laborator, în dreptul fiecărei
probe de ţesut, se vor nota datele de identificare şi locul de depozitare al preparatelor
şi blocurilor (Histoteca nr…., sertarul nr……, cutia nr….., rândul nr…...). Ele se
menţin minim 10 ani şi sunt refăcute când este necesar. Pentru o mai bună conservare,
preparatele histologice permanente se vor luta. Lutarea se poate realiza cu lac de
unghii, parafină topită sau cu amestecul 3:6:1 format din colofoniu, ceară de albine şi
seu. Acestea se aplică cu o pensulă fină pe marginea lamelei, de jur împrejur, astfel
încât să se realizeze etanşeizarea secţiunii.

















Petru Cazacu


151
C
a
p
i
t
o
l
u
l
 
6
 
Bibliografie selectivă

1. Bancroft J, Stevens A (1982) - Theory and Practice of Histological
Techniques, 2
nd
ed., Churchill Livingstone, N.Y.
2. Bancroft, J D, Stevens A (1982) - Theory and practice of histological
techniques 2
nd
ed., Churchill Livingstone, Edinburgh & London, UK.
3. Carson F (1990) - Histotechnology: A Self-Instructional Text, 1
st
ed., ASCP,
III.
4. Crookham J, Dapson R (1991) - Hazardous Chemicals in the Histopathology
Laboratory, 2
nd
ed., Anatech.
5. Culling C F A (1974) - Handbook of histopathological and histochemical
techniques; 3
nd
ed., Butterworth, London, UK.
6. Golăescu M (1997) - Diagnosticul şi tratamentul micozelor interne; Ed. Viaţa
Medicală Românească; Bucureşti.
7. Gray P (1954) - The Microtomist's Formulary and Guide. The Blakiston
Co. Robert E. Krieger Publishing.
8. Hayashi I , Tome Y, Shimosato Y (1989) - Thiosemicarbazide used after
periodic acid makes methenamine silver staining of renal glomerular
basement membranes faster and cleaner; Stain Technology.
9. Humason G L (1967) - Animal tissue techniques, 2
nd
ed., W H Freeman &
Company, San Francisco, Ca, USA.
10. Lillie R D (1954) - Histopathologic technique and practical histochemistry 2
nd

ed., Blakiston, New York, USA.
11. Lillie R D, Glenner G G (1957) - Journal of Histochemistry and
cytochemistry; 5:311.
12. Luna L (1968) - Manual of Histologic Staining Methods of the AFIP, 3
nd
ed.,
McGraw-Hill, NY.
13. McManus J F A, Mowry R W (1960) - Staining Methods Histologic and
Histochemical; Harper & Row, New York, NY, USA.
14. Sheehan D, Hrapchak B (1980) - Theory and practice of Histotechnology; 2
nd

ed., Battelle Press, Ohio.
15. http://www-medlib.med.utah.edu/WebPath/webpath.html


Ingrid Apetrei, Mihai Mareş


153
C
a
p
i
t
o
l
u
l
 
7
 





Ingrid Apetrei, Mihai Mareş

7.1 Fungitell™ (Cape Code Inc. SUA)
Test de detecţie rapidă a (1,3)-β-D-glucan-ului

7.1.1. Principiul testului

ungitell este un test cromogen, sensibil şi rapid, ce poate detecta (1,3)-β-D-
glucanul din serul de analizat în circa o oră. (1,3)-β-D-glucanul este un
constituent al peretelui celor mai importanţi fungi de interes medical precum Candida
sau Aspergillus. Abilitatea testului de a detecta în ser (1,3)-β-D-glucanul cu exprimare
în picograme, reprezintă un „balon de oxigen” pentru clinicieni, privind identificarea
precoce a infecţiilor fungice invazive. (1,3)-β-D-glucanul se regăseşte în doze mici în
sângele indivizilor sănătoşi, dar valorile serice de 80 pg/ml sau mai mari, la pacienţii
cu risc crescut vor putea fi corelate cu infecţii fungice invazive. Analiza seriată a
probelor prelevate de la pacienţii cu risc pentru infecţii fungice a relevat utilitatea
diagnostică a acestui test, rezultatele fiind verificate prin metode alternative de
diagnostic.
Fungii care nu sintetizează (1,3)-β-D-glucan, precum specii din genul
Cryptococcus sau aparţinând clasei Zygomycetes, respectiv Absidia, Mucor sau
Rhizopus, nu vor pozitiva testul. Un rezultat pozitiv nu va indica şi clasa fungică a
speciilor incriminate, testul fiind recomandat pentru stabilirea unui diagnostic
prezumtiv în colaborare cu alte proceduri de diagnostic, precum examenul micologic al
prelevatelor clinice, tehnicile de histopatologie în cazul prelevatelor biopsice sau
analiza imagistică (Rx, CT, RMN). Testul poate decela (1,3)-β-D-glucanul produs de
fungii primar patogeni sau de cei oportunişti aparţinând genurilor: Candida,
Aspergillus, Fusarium, Trichosporon, Saccharomyces, Acremonium, Coccidioides,
Histoplasma, Sporothrix, Blastomyces şi Pneumocystis.
Rezultatele testului sunt cuantificate în pg/ml ser, cu valori minime de detecţie
stabilite la 31,25 pg/ml. Cu toate acestea, intervalul de detecţie a fost încadrat în limite
superioare pentru o mai bună acurateţe a testării şi pentru evitarea unor posibile
interferări antigenice. Valori ale (1,3)-β-D-glucanului mai mici de 60 pg/ml sunt
considerate a fi negative, iar depăşirea acestei valori (pozitivarea testului) nu va putea
fi automat corelată cu prezenţa evolutivă a bolii fără o serie de investigaţii clinice /
F
7

Tehnici de seromicologie
Tehnici de seromicologie


154
paraclinice complementare, în vederea stabilirii unui diagnostic cât mai exact. Valori
mai mari sau egale cu 80 pg/ml sunt interpretate ca fiind net pozitive, cu valoare mare
de diagnostic pentru evoluţia unei afecţiuni invazive cu etiologie fungică.
Valorile cuprinse în intervalul 60-79 pg/ml sugerează o posibilă infecţie
fungică, dar acestea au valoare diagnostică incertă, fiind recomandată retestarea serică
a pacienţilor la intervale de timp prestabilite (2-3 ori pe saptămână). Rezultate fals
pozitive au fost înregistrate la pacienţii hemodializaţi, în cazul folosirii membranelor
celulozice sau administrării unor produse de origine sangvină precum albumina sau
imunoglobulinele, în timp ce utilizarea pentru hemodializă a unor membrane
confecţionate din celuloză triacetat sau polimetil-metacrilat nu au provocat creşteri ale
valorilor de (1,3)-β-D-glucan seric. Fiind un test cromogen rezultatele obţinute mai pot
fi interferate de prezenţa bilirubinei serice sau de turbiditatea serului de analizat
cauzată de hiperlipemie.

7.1.2. Materiale furnizate împreună cu testul Fungitell

Fungitell este destinat diagnosticului in vitro. Următoarele materiale (libere de
orice urmă de 1,3-β-D-glucan) sunt furnizate împreună cu kitul şi suficiente pentru 2
plăci de microtitrare:
1. Reactivul Fungitell - (1,3)-β-D-glucan liofilizat, specific LAL (Limulus
Amebocyte Lysate) sau lizat din amebocitele unei specii de crab;
2. Tampon Pyrosol (Tris HCl 2M pH 7,4);
3. Glucan standard liofilizat ce conţine între 250 şi 350 pg s.a. / fiolă şi solvent
inert;
4. Apă - reactiv conform standardului ISO 3696:1987;
5. Microplăci de titrare cu 96 godeuri, cu fund plat;
6. KCl 1,2 M
7. KOH 0,25 M

7.1.3. Materiale necesare dar nefurnizate împreună cu kitul

Toate materialele şi sticlăria trebuie să fie libere de interferare glucanică.
Sticlăria trebuie să fie uscată la cald, depirogenată la 235°C timp de 7 ore, pentru a fi
adecvată folosirii. Toate recipientele din material plastic vor fi libere de orice tipuri de
interferări. Materialele de unică folosinţă sunt de preferat.
1. Vârfuri pipete 10-100 µl, 250 µl, 1000 µl;
2. Micropipete pentru volume de 20µl, 200 µl şi 1000 µl;
3. Micropipetă multipas pentru volume de 100 µl;
4. Tuburi de testare pentru diluţia probelor şi pregătirea mixului de extracţie serică;
5. Incubator-cititor cu fluorescenţă, lungime de undă 405 nm monocromă, cu 2500
unităţi densitate optică şi software pentru interpretare asistată de PC;
6. Tuburi sterile de plastic cu dop, pentru mixarea probelor;
7. Tuburi de colectare a serului.
Atenţie! Vârfurile de pipetă cu filtru de bumbac pot constitui sursă de glucan.
Toate produsele furnizate de Cape Code. Inc. sunt certificate ca fiind libere de
interferare glucanică.
Ingrid Apetrei, Mihai Mareş


155
C
a
p
i
t
o
l
u
l
 
7
 
7.1.4. Atenţionări şi precauţii

Testul Fungitell necesită o atenţie sporită din punct de vedere tehnic şi
procedural.
1. Specii nedetectate de test. Unele specii fungice produc cantităţi reduse de (1,3)-β
-D-Glucan şi nu sunt de regulă detectate de test. Din această categorie fac parte
specii ale genului Cryptococcus, precum şi specii din categoria zygomycetelor,
ca Absidia, Mucor şi Rhizopus;
2. Nu se pipetează nici o substanţă cu gura, nu se fumează, nu se consumă alimente
în spaţiul destinat testărilor;
3. Se utilizează reactivi şi materiale care sunt certificate ca fiind libere de glucani,
ştiut fiind că apa, hainele, praful pot fi surse de glucan;
4. Nu se utilizează reactivi cu termenul de valabilitate depăşit, seruri hiperlipemice
sau care conţin bilirubină;
6. Se utilizează echipament de protecţie şi mănuşi fără talc în manoperele ce
implică prelevatele;
7. Pacienţii hemodializaţi pot acumula un nivel ridicat de (1,3)-β-D-glucan când
sunt utilizate membrane celulozice. Cele de tipul triacetat sau polimetil-
metacrilat nu par a afecta concentraţia sanguină de glucan;
8. Anumite manopere chirurgicale ce implică utilizarea unor materiale absorbante
sau de sutură derivate din bumbac sau mătase pot conduce postoperator la
acumularea unui nivel ridicat de (1,3)-β-D-glucan, care să contribuie la falsa
pozitivare a rezultatelor testării acestor pacienţi.

7.1.5. Păstrarea reactivilor

Toate substanţele se vor păstra la 2°-8°C, ferite de lumină. Reactivul Fungitell
reconstituit va fi păstrat la 2°-8°C şi utilizat în maxim 2 ore. Pe termen mai îndelungat,
soluţia reconstituită poate fi congelată o singură dată la -20°C, pentru circa 20 zile.

7.1.6. Recoltarea / Stocarea / Marcarea probelor

1. Probele de ser se vor recolta în tuburi vidate (tip Venoject) care să permită o
rapidă formare a coagulului şi centrifugarea ulterioară în vederea separării cât
mai nete a serului de analizat, la 1800 rpm timp de 10 minute. Serul astfel
obţinut, se transferă în condiţii aseptice în fiole sterile şi se stochează;
2. Stocarea probelor înaintea începerii testării se realizează la 2°-8°C pentru maxim
48 de ore sau se pot congela la -20°C;
3. Marcarea prelevatelor constă în notarea numelui şi prenumelui pacientului
alături de data recoltării sau se utilizează sisteme de identificare unică.

7.1.7. Tehnică de lucru

1. Prepararea glucanului standard furnizat odată cu kitul
a. Se dizolvă o fiolă de glucan standard într-un volum corespunzător de apă
standard preîmbuteliată, pentru obţinerea unei soluţii cu 100 pg/ml (soluţia 1);
Tehnici de seromicologie


156
Se vortexează cel puţin 10 secunde pentru omogenizarea soluţiei. Soluţia astfel
preparată va fi stocată la 2°-8°C şi utilizată în maxim 3 zile;
b. Se prepară apoi o soluţie standard cu 50 pg/ml prin mixarea a 400 µl apă
reactiv cu 400 µl din soluţia 1,î ntr-un tub liber de glucan (soluţia 2);
c. Din soluţia 2 se prepară un nou standard cu 25 pg/ml prin mixarea a 400 µl
apă reactiv şi 400 µl din soluţia 2, într-un tub liber de glucan (soluţia 3);
d. Pornind de la soluţia anterioară, se prepară un standard cu 12.5 pg/ml prin
mixarea a 400 µl apă reactiv cu 400 µl din solutia menţionată, într-un tub liber
de glucan (soluţia 4);
e. Se prepară apoi un ultim standard cu 6.25 pg/ml prin mixarea 400 µl apă
reactiv cu 400 µl din soluţia 4, într-un tub liber de glucan (soluţia 5);
2. Prepararea reagentului de tratare a serului
Tratarea alcalină a serului va desface triplul helix al glucanului conferindu-i o
reactivitate mai mare în timpul testului. Un pH mai alcalin va inactiva serin-
proteazele precum şi inhibitorii acestora, care pot da rezultate fals positive sau
fals negative.
a. Pregătirea reagentului de tratare a serului (0.6 M KCl şi 0.125 M KOH) prin
transferarea a 400 µl din soluţia 0.25 M KOH într-un tub liber de glucan şi adiţia
a 400 µl din soluţia 1.2 M KCl. Soluţia se omogenizează uşor şi se utilizează în
cel mult 30 de minute. Fiolele se acoperă cu parafilm, putând fi stocate la 2°-8°C
pentru a fi utilizate mai târziu, cu cea de-a doua microplacă.

Notă: Când se trasează curba de etalonare, se multiplică pg/ml cu cinci, astfel încât
limita să fie încadrată în intervalul 31.25 - 500 pg/ml. Volumul standard din testare este de 25
µl pentru fiecare godeu, adică de cinci ori volumul probei de ser. Placa de microtitrare are
zonă standard (st), zonă martor (blank = blk) şi zonă test (unknowns = uk) cu fiecare variantă
în triplu exemplar, după următorul model (fig. Nr. 7-1).

Fig. nr. 7-1 Zonele standard (st), martor (blk) şi test (uk) ale plăcii de microtitrare

3. Tratarea serului cu reactivul de tratare a serului. Notă: Pentru evitarea
contaminării accidentale se păstrează microplăcile acoperite pe parcursul
desfăşurării manoperelor, capacul îndepărtându-se pentru citire.
Ingrid Apetrei, Mihai Mareş


157
C
a
p
i
t
o
l
u
l
 
7
 
a. Decongelarea probelor de ser se realizează la temperatura camerei, iar
omogenizarea lor se realizează prin vortexare timp de 10 secunde;
b. Se transferă 5 µl din proba de ser în fiecare din cele trei godeuri desemnate
(uk). Operaţiunea se repetă pentru fiecare probă de ser;
c. Se adiţionează 20 µl din reagentul de tratare a serului în fiecare godeu ce deja
conţine cei 5µl de ser;
d. Se agită placa 5 secunde şi se incubează 10 minute la 37°C în cititor;
4. Pipetarea blanc-ului şi a standardelor. Se îndepărteză microplaca din cititor şi:
a. Se adaugă 25 µl din soluţia standard 1 în godeurile notate B2, B3, B4;
b. Se adaugă 25 µl din soluţia standard 2 în godeurile notate C2, C3, C4;
c. Se adaugă 25 µl din soluţia standard 3 în godeurile notate D2, D3, D4;
d. Se adaugă 25 µl din soluţia standard 4 în godeurile notate E2, E3, E4;
e. Se adaugă 25 µl din soluţia standard 5 în godeurile notate F2, F3, F4;
f. Se distribuie câte 25 µl apă standard în godeurile notate G2, G3, G4;
5. Prepararea reagentului Fungitell şi conduita procedurală
a. Se reconstituie o fiolă de reagent Fungitell cu 2,8 ml apă standard şi se
aditivează cu 2,8 ml de Pyrosol tampon, cu ajutorul micropipetei de 1000 µl;
b. Se agită uşor fiola pentru dizolvarea completă a conţinutului; nu se
vortexează. Se adaugă apoi 100 µl de reagent Fungitell în fiecare godeu cu
ajutorul micropipetei multicanal. Se îndepărtează capacul de pe microplacă şi se
aşează în cititor odată cu setarea temperaturii la 37°C. Îndepărtarea capacului
este opţională, excepţie făcând situaţiile când acesta ar putea împiedica
vizualizarea probei. Microplaca se agită timp de minim 5 secunde înaintea citirii.
Citirea are loc la 405 nm, la intervale de 15-30 secunde, timp de 40 minute, la
37°C;
c. Colectarea rezultatelor şi analiza acestora: se calculează rata medie de variaţie
a densităţii optice (mili-unităţi de absorbanţă/minut) pentru toate punctele, între
0 şi 40 minute;
d. Se înregistrează concentraţia de glucan a probelor testate.

7.1.8. Interpretarea rezultatelor

Rezultatele testului Fungitell vor fi utilizate în diagnosticul infecţiilor invazive
fungice doar în coroborare cu alte date. Rezultatele sunt exprimate în pg/ml ser,
începând cu valori considerate a fi nedetectabile (< 31,25 pg/ml) până la valori mai
mari de 500 pg/ml, acestea fiind printate cu ajutorul softului furnizat sau sunt citite pe
curba etalon. Pentru acurateţea aprecierilor, în cazul valorilor de peste 500 pg/ml, se
recomandă diluarea probei de ser cu apă standardizată şi retestarea acesteia.
Laboratorul care efectuează testările are obligaţia de a informa clinicianul că sfera de
detecţie a kitului nu cuprinde specii ale genului Cryptococcus (produc cantităţi infime
de (1,3)-β-D-glucan) sau specii de zygomycete precum Absidia, Mucor sau Rhizopus
care nu produc (1,3)-β-D-glucan.

Rezultate negative: un rezultat negativ înseamnă că (1,3)-β-D-glucanul nu a fost
detectat sau că valorile s-au încadrat sub limita de detecţie a kitului. Valori ale (1,3)-β-
D-glucanului mai mici de 60 pg/ml sunt interpretate ca fiind negative.
Tehnici de seromicologie


158

Rezultate pozitive: un rezultat pozitiv înseamnă că (1,3)-β-D-glucanul a fost detectat,
dar acest rezultat nu este definitoriu pentru prezenţa bolii şi trebuie interpretat în
coroborare cu rezultatele metodelor complementare de diagnostic. Valorile mai mari
sau egale cu 80 pg/ml sunt considerate pozitive.

Rezultate incerte: valorile cuprinse în intervalul 60-79 pg/ml sugerează o posibilă
infecţie fungică. Pentru certitudine, sunt necesare probe seriate şi testări adiţionale
pentru o interpretare corectă a rezultatelor.

7.1.9. Controlul calităţii

Ghidul controlului de calitate al standardelor de laborator poate fi accesat la
adresa URL www.nccls.org (documentul C24-A).
- Curba etalon cu cele cinci concentraţii de glucan serveşte drept model de control
pozitiv a kitului Fungitell. Coeficientul de corelaţie al curbei standard
(ordonată / abscisă) ar trebui să fie mai mare de 0,980;
- Blanc-ul (25 µl de apă standard) reprezintă controlul negativ, cu valori mai mici
cu 50% decât cea mai mică valoare incertă indicată de standard. Dacă nu se
îndeplinesc aceste condiţii, testarea trebuie repetată cu înlocuirea tuturor
reagenţilor;
- Dacă se observă că probele de ser sunt hemolizate, prezintă turbiditate sau dau
prin citire la densitatea optică de 405 nm o valoare mai mare de 0,06, acestea
vor fi diluate cu reagentul bază şi retestate. O bună practică de laborator
înseamnă că ambele verificări de pozitivare sau negativare a probelor vor fi
puse în practică, în vederea verificării reagenţilor şi tehnicii de lucru. Fiecare
laborator care utilizează aceast test de diagnostic va stabili şi o serie de criterii
proprii privind controlul de calitate.

7.1.10. Limite

1. Localizarea tisulară a infecţiilor fungice, încapsularea şi nivelul de (1,3)-β-D-
glucan produs de anumiţi fungi influenţează concentraţia serică de antigen.
Cryptococcus spp. produce un nivel scăzut de (1,3)-β-D-glucan. Specii
aparţinând genurilor Absidia, Mucor şi Rhizopus, nu produc (1,3)-β-D-glucan;
2. Anumiţi indivizi sănătoşi au concentraţii serice detectabile de (1,3)-β-D-glucan
ceea ce poate conduce spre o zonă de incertitudine privind calitatea
diagnosticului. În astfel de cazuri sunt recomandate testările suplimentare;
3. Frecvenţa testării pacienţilor se va stabili în funcţie de riscul la care aceştia sunt
expuşi, cu o rată de cel puţin 2-3 ori pe săptămână;
4. Rezultate pozitive datorate creşterii valorilor de (1,3)-β-D-glucan seric au fost
evidenţiate la pacienţii hemodializaţi al căror tratament constă în administrarea
unor produse de origine sanguină, albumină serică sau imunoglobuline;
5. Intervalul de detecţie al testului este între 31,25 şi 500 pg/ml.


Ingrid Apetrei, Mihai Mareş


159
C
a
p
i
t
o
l
u
l
 
7
 
7.1.11. Interferarea cu alte substanţe

În următoarele situaţii pot avea loc interferări privind acurateţea rezultatelor:
• Hemoliza;
• Turbiditatea probei cauzată de hiperlipemie;
• Prezenţa vizuală a bilirubinei;
• Turbiditatea serului.

7.1.12. Valori aşteptate

Valorile crescute de β-glucan sunt relevante într-o varietate de infecţii fungice.
Când semnele / simptomele sunt prezente la nivelul de 80 pg/ml sau mai mare,
valoarea predictivă la care subiectul este pozitiv pentru infecţii fungice se încadrează în
intervalul 74,4% - 91,7%. În absenţa semnelor clinice şi mai puţin de 60 pg/ml,
predicţia negativă se încadrează în intervalul 65,1% - 85,1%.































Tehnici de seromicologie


160
7.2. Platelia
®
Aspergillus

7.2.1. Principiul testului

Kitul Platelia Aspergillus este un test imuno-enzimatic de tip sandwich care
permite detecţia galactomananului (GM) în serul uman. Acest test utilizează anticorpi
monoclonali (Ac) de şobolan EBA-2, dirijaţi contra GM aspergilar. Aceşti anticorpi
permit o marjă de detecţie de 1 ng GM/ml. Calitatea şi acurateţea rezultatelor depind
de maniera de lucru a fiecărui laborator în parte, de reactivii utilizaţi, de urmarea cu
stricteţe a specificaţiilor privind protocolul de lucru. Se vor utiliza seruri de control
pozitiv şi negativ pentru validarea rezultatelor.
Încălzirea serului în prezenţa EDTA are rolul de a disocia complexele imune şi
de a precipita proteinele serice care ar putea interfera rezultatele testării, crescând astfel
sensibilitatea reacţiei. După tratarea serului şi centrifugare, supernatantul este recuperat
şi analizat rapid (în aceeaşi zi). Dacă se doreşte retestarea unei probe de ser,
întotdeauna se depozitează serul ca atare şi nu prelevatul tratat.
Se vor incuba simultan serul şi conjugatul în godeurile microplăcii
sensibilizate în prealabil cu anticorpii monoclonali, permiţându-se astfel formarea
complexelor de tip Ac – GM – Ac – peroxidază. După spălare, complexele sunt
evidenţiate prin adiţia substratului. Rezultatul reacţiei este detectat la un
spectrofotometru cu lungime de undă 450 / 620 nm, după 30 minute de incubare la
temperatura ambiantă, reacţia fiind stopată prin adăugarea acidului sulfuric 1,5N.
Din cauza problemelor de falsă pozitivitate, serurile intermediare sau pozitive
vor fi sistematic retestate; este recomandat să se recolteze o nouă probă de ser de la
pacienţii cu risc, pentru a fi testată suplimentar. Datorită caracterului ubicuitar al
conidiilor de Aspergillus şi Penicillium, în vederea evitării contaminării accidentale a
serului sau reactivilor, se vor utiliza doar materiale sterile, ferite de praf.
Galactomananul fiind termostabil, sterilizarea nu poate garanta absenţa GM
contaminant, de aceea se va limita la maxim contactul serului sau al reactivilor cu aerul
ambiant. Se recomandă manipularea în hotă cu flux de aer laminar clasă II.

7.2.2. Materiale furnizate odată cu kitul

• Microplăci cu 96 godeuri sensibilizate cu anticorpi monoclonali EBA–2
antigalactomanan, 1 buc;
• Soluţie concentrată de spălare – soluţie concentrată (10X); Tampon TRIS-
NaCl (pH 7,41), Tween 20 sol.1%; conservant: 0,01% tiomersal – 1x 100ml;
• Control negativ – ser de control negativ (liofilizat): ser uman liber de
galactomanan, negativ la testarea pentru anticorpi anti-HIV1 şi anti-HIV2,
pentru antigene HBs şi anticorpi anti-HCV; 2 x 1ml;
• Ser de calibrare – ser standard (liofilizat): ser uman cu conţinut în
galactomanan (1ng/ml), negativ pentru anticorpi anti–HIV1 şi anti–HIV2,
antigene HBs şi anticorpi anti – HCV; 2 x 1ml.
• Control pozitiv – ser de control pozitiv (liofilizat): ser uman conţinând
galactomanan, negativ pentru anticorpii anti-HIV1 şi anti-HIV2, pentru
antigene HBs şi anticorpi anti-HCV; 2 x 1ml;
Ingrid Apetrei, Mihai Mareş


161
C
a
p
i
t
o
l
u
l
 
7
 
• Conjugat – conjugat gata de utilizare: anticorpi monoclonali anti-galactomanan
marcaţi cu peroxidază; conservant: 0,01% tiomersal – 1 x 8ml;
• Soluţie de tratare a serului (gata de utilizare): soluţie acidă EDTA, fără
conservanţi; 1 x 10,5 ml;
• TMB (Tetra-Metil-Benzidină) tampon substrat – tampon substrat pentru
peroxidază (gata de utilizare): soluţie de acid citric şi acetat de Na, pH 5,2
conţinând 0,009% H
2
O
2
şi 4% dimetilsulfoxid (DMSO); 1x 60 ml;
• Soluţie cromogenă TMB – soluţie cromogenă (concentrată): soluţie DMSO
90% cu 0,6% Tetra-Metil-Benzidină (TMB); 1 x 1 ml;
• Soluţie de stopare (gata de utilizare): soluţie de acid sulfuric 1,5 N.

7.2.3. Materiale necesare, dar nefurnizate odată cu kitul

• Apă distilată sau perfect demineralizată pentru soluţia de spălare;
• Apă purificată sterilă pentru reconstituirea serurilor de control;
• Hârtie absorbantă;
• Mănuşi de unică folosinţă;
• Ochelari de protecţie;
• Hipoclorit de Na (apă Javel) şi bicarbonat de Na;
• Pipete simple şi multicanal, reglabile sau fixe, pentru măsurarea şi distribuirea a
50µl, 100 µl, 300 µl şi 1000 µl;
• Tuburi Eppendorf conice, de 1,5 ml capacitate, cu închidere ermetică, capabile
să suporte temperaturi de minim 100°C;
• Centrifugă pentru tuburi Eppendorf conice de 1,5 ml, care să dezvolte minim
10000 rpm;
• Agitator tip Vortex;
• Baie de apă cu termostatare la 100
0
C;
• Incubator de microplăci cu termostatare la 37°C;
• Sistem de spălare automat, semiautomat sau manual pentru microplăci;
• Sistem de citire a microplăcilor echipat cu filtre de 450 / 620 nm.

7.2.4. Conservarea reactivilor desigilaţi şi a celor reconstituiţi

• Microplăcile – după deschiderea pachetului vidat, pot fi păstrate la 2°-8°C în
ambalajul original, timp de până la 5 săptămâni, verificându-se periodic în
privinţa desicării;
• Soluţia concentrată de spălare – după diluare, aceasta se poate conserva 15 zile
la 2°-8°C. După utilizare, dacă nu a suferit contaminări, poate fi păstrată la 2°-
25°C până la data înscrisă pe ambalaj;
• Soluţia cromogenă, după ce a fost diluată, este stabilă cca. 6 ore la temperatura
ambiantă (18° – 30°C) şi la întuneric;
• Serurile de control negativ, pozitiv şi soluţia de calibrare – după reconstituire,
pot fi imediat congelate la – 20°C.

Tehnici de seromicologie


162
Se vor incuba simultan serul şi conjugatul în godeurile microplăcii
sensibilizate în prealabil cu anticorpii monoclonali, permiţându-se astfel formarea
complexelor de tip Ac – GM – Ac – peroxidază. După spălare, complexele sunt
evidenţiate prin adiţia substratului. Rezultatul reacţiei este detectat la un
spectrofotometru cu lungime de undă 450 / 620 nm, după 30 minute de incubare la
temperatura ambiantă, reacţia fiind stopată prin adăugarea acidului sulfuric 1,5N.
Din cauza problemelor de falsă pozitivitate, serurile intermediare sau pozitive
vor fi sistematic retestate; este recomandat să se recolteze o nouă probă de ser de la
pacienţii cu risc, pentru a fi testată suplimentar. Datorită caracterului ubicuitar al
conidiilor de Aspergillus şi Penicillium, în vederea evitării contaminării accidentale a
serului sau reactivilor, se vor utiliza doar materiale sterile, ferite de praf.
Galactomananul fiind termostabil, sterilizarea nu poate garanta absenţa GM
contaminant, de aceea se va limita la maxim contactul serului sau al reactivilor cu aerul
ambiant. Se recomandă manipularea în hotă cu flux de aer laminar clasă II.

7.2.5. Tehnica de lucru

Se va urma întocmai protocolul de lucru. Înaintea utilizării, toţi reactivii vor fi
lăsaţi să atingă temperatura mediului ambiant.

7.2.5.1. Reconstituirea reactivilor

• Soluţia concentrată de spălare se diluează de 10 ori în apă distilată sterilă,
obţinând astfel soluţia gata de utilizare. Vor fi necesari 160 ml pentru spălarea
a 2 barete cu câte 8 godeuri;
• Controlul negativ, soluţia de calibrare şi controlul pozitiv – conţinutul unui astfel
de flacon va fi reconstituit cu 1000 µl de apă sterilă extrapură, va fi lăsat 2-3
minute pentru rehidratare şi omogenizat uşor. Se vor repartiza 3 x 300 µl, în
tuburi Eppendorf, iar dacă două tuburi nu se utilizează în aceeaşi zi pot fi
congelate la – 20°C. Această reconstituire trebuie să se realizeze înaintea
utilizării serurilor în reacţia imunoenzimatică şi tratate ca toate serurile
provenite de la pacienţi (300 µl de ser + 100 µl soluţie de tratare);
• Nu se conservă serurile de control după tratare;
• Se va dilua de 50 de ori soluţia cromogenă în substratul tampon pentru
peroxidază. Se vor prepara 4 ml soluţie de revelare pentru fiecare baretă de
reacţie (e.g. 200 µl de soluţie cromogenă + 10 ml de reactiv substrat
peroxidază).

7.2.5.2. Tratarea serurilor

• Se introduc 300 µl ser de testat într-un tub Eppendorf de 1,5 ml;
• Se adaugă 100 µl din soluţia de tratare a serului;
• Se omogenizează cu ajutorul vortexului;
• Se închide ermetic tubul;
• Tubul va fi plasat 3 minute pe baie de apă la 100
0
C;
• Se centrifughează la 10000 rpm timp de 10 minute;
Ingrid Apetrei, Mihai Mareş


163
C
a
p
i
t
o
l
u
l
 
7
 
• Supernatantul obţinut va fi utilizat pentru detecţia antigenului – galactomanan.
Odată ce serul a fost tratat, va trebui testat în cel mai scurt timp posibil;
• Dacă după analiza rezultatelor se decide retestarea unui ser, se va lucra cu serul
de origine şi nu cu cel deja tratat;
• Stricta respectare a condiţiilor de temperatură reprezintă un factor esenţial pentru
reuşita reacţiei, de aceea se recomandă ca pe tot parcursul desfăşurării
operaţiunilor să se utilizeze un termometru tip sondă;
• Nu se conservă serul după tratare, nici cel de control, nici cel provenit de la
pacienţi.

7.2.5.3. Reacţia imunoenzimatică

• Se stabileşte un plan de distribuţie a serurilor de analizat provenite de la pacienţi,
precum şi a celor de control şi calibrare;
• Baretele necesare testului se scot din ambalaj, restul fiind păstrate conform
condiţiilor amintite;
• Se omogenizează flaconul ce conţine conjugatul;
• Dacă se utilizează o pipetă multicanal, se va preleva doar volumul necesar
realizării unei serii, adică 2 ml pentru 16 godeuri;
• Se vor distribui succesiv în godeuri, cu respectarea regulilor de mai jos:
¾ 50 µl conjugat;
¾ 50 µl din supernatantul serului tratat;
¾ un godeu va fi destinat serului de control negativ, două pentru cel de
calibrare şi încă unul pentru serul de control pozitiv, distribuţia
acestora pe placă făcându-se la alegere;
• Se acoperă microplaca cu un film adeziv ce să asigure o bună etanşeizare;
• Incubarea microplăcii pe baie de apă cu termostat sau într-un incubator, timp de
90 minute la 37
0
C;
• Prepararea soluţiei de spălare (diluată);
• Se îndepărtează filmul adeziv, se aspiră conţinutul tuturor godeurilor şi se
depune în soluţia decontaminantă. Apoi se procedează la spălarea succesivă a
acestora de cinci ori. Ulterior, baretele sunt lăsate să se usuce prin întoarcere
pe o foaie absorbantă, pentru absorbţia soluţiei de spălare;
• Prepararea soluţiei revelatoare - soluţia cromogenă diluată 1/50 în soluţia
tampon pentru substratul peroxidazei şi distribuirea rapidă a câte 200 µl în
fiecare godeu. Operaţiunea se va desfăşura în lumină puternică. Se lasă ca
reacţia să se desfăşoare apoi în obscuritate, timp de 30 minute la temperatura
laboratorului (18 – 30
0
C), fără a se proteja godeurile cu filmul adeziv;
• Se stopează reacţia enzimatică prin adăugarea a 100 µl soluţie de stopare în
fiecare godeu, în ordinea în care a fost adăugată şi soluţia revelatoare;
• Se va citi densitatea optică la 450 / 620 nm cu ajutorul unui cititor de plăci, pe
parcursul celor 30 de minute de după stoparea reacţiei;
• Înainte de transcrierea rezultatelor ne asigurăm că există concordanţă între
valorile citite, aferente fiecărui godeu / microplăci şi planul de distribuţie
prestabilit al acestora.
Tehnici de seromicologie


164
7.2.6. Interpretarea rezultatelor

Rezultatele sunt exprimate prin densitatea optică (DO) a eşantionului vs.
valoarea standard. Acest calcul permite limitarea variaţiilor de DO între testări, cât şi
între rezultatele raportate între diferite laboratoare.
Testul este valid dacă:
• Valoarea de referinţă este mai mare sau egală cu valori cuprinse în intervalul
0,3 – 0,8 DO;
• Valoarea serului pozitiv este mai mare de 2 DO;
• Valoarea serului negativ este mai mică de 0,5 DO;
Un ser este:
• negativ, dacă indicele este mai mic de 1 DO;
• intermediar, dacă se încadrează în intervalul 1 – 1,5 DO;
• pozitiv, dacă valorile sunt mai mari sau egale cu 1,5 DO.
































Ingrid Apetrei, Mihai Mareş


165
C
a
p
i
t
o
l
u
l
 
7
 
7.3. Platelia
®
Candida Ac
Detecţia anticorpilor serici anti-manan
prin metoda imunoenzimatică

7.3.1. Introducere

Incidenţa crescută a infecţiilor fungice invazive reprezintă o constantă a
patologiei umane în ultimele două decenii. Infecţiile produse de diverse specii
aparţinând genului Candida au rangul de infecţii nosocomiale, oportuniste grave,
caracterizate printr-o morbiditate accentuată asociată mediului spitalicesc, traduse prin
prelungirea perioadei de spitalizare a pacienţilor şi creşterea consumului de antifungice
sistemice. Mortalitatea directă atribuabilă acestor infecţii se plasează în jurul valorii de
40%. Diagnosticul se stabileşte cu dificultate ca urmare a lipsei unor semne clinice cu
caracter patognomonic. În practica clinică, la stabilirea unui diagnostic concură o serie
de tehnici - radiologice, micologice etc., care permit evaluarea riscului instalării unei
candidoze invazive.
În acest context, dozarea anticorpilor anti-Candida, bisăptămânal, va ajuta la
orientarea diagnosticului etiologic prin completarea examenelor micologice de rutină.
Seroconversia şi nivelul ridicat al anticorpilor sunt în general asociate unui focar de
candidoză profundă.
Chiar dacă apariţia anticorpilor şi cuantificarea acestora se realizează tardiv,
acestea sunt elemente preţioase în vederea stabilirii unui diagnostic, fie el chiar şi
retrospectiv în cazul în care pacienţii au fost trataţi empiric, fără o examinare
micologică anterioară. Observarea unui nivel ridicat de anticorpi poate pune în discuţie
existenţa unei candidoze evolutive. În practica clinică, este recomandat ca reacţia de
evidenţiere a anticorpilor anti-Candida să fie dublată şi de detecţia antigenelor
circulante (GM). În fapt, numeroasele studii efectuate au demonstrat că pacienţii care
au fost diagnosticaţi cu o candidoză profundă au prezentat pe parcursul infecţiei o
antigenemie crescută în absenţa anticorpilor sau un nivel ridicat al anticorpilor în
absenţa antigenelor detectabile, astfel încât cele două teste sunt complementare.

7.3.2. Principiul testului

Platelia Candida Ac este o tehnică imunoenzimatică de tip indirect, în doi
timpi, ce permite detecţia anticorpilor anti-manan (izotip A, G şi M) în serul uman.
Acest test automatizabil se pretează practicii medicale într-un laborator spitalicesc de
micologie clinică.

7.3.3. Materiale furnizate împreună cu kitul

- Soluţie de lavaj concentrată, care se va dilua de 10 ori în apă distilată sterilă : 10
ml soluţie de lavaj la 90 ml apă distilată;
- Conjugat (gata de utilizare) - anticorpi de capră anti-Ig (A, G, M) umane marcaţi
cu peroxidază;
- Diluant pentru eşantioane (gata de utilizare);
Tehnici de seromicologie


166
- Tampon pentru substrat de peroxidază (gata de utilizare) - soluţie de acid citric şi
acetat de sodiu pH 5,2 conţinând 0,009% H
2
O
2
şi 4% DMSO;
- Soluţie cromogenă (concentrată) - soluţie de DMSO 90% conţinând tetra-metil
benzidină (TMB);
- Soluţie de stopare (gata de utilizare) - soluţie de acid sulfuric 1,5N;
- Film adeziv.

7.3.4. Materiale necesare dar nefurnizate împreună cu kitul

- Apă distilată sau perfect demineralizată pentru pregătirea soluţiei de lavaj;
- Agitator tip Vortex;
- Centrifugă pentru tuburi Eppendorf conice, de 1,5 ml capacitate;
- Spălător de microplăci;
- Spectrofotometru echipat cu filtre de 450 / 620 nm;
- Incubator de microplăci (37
0
C);
- Kit comercial Platelia Candida Ac.

7.3.5. Tehnica de lucru

Înaintea utilizării, toţi reactivii vor fi aduşi la temperatura ambiantă (20 – 25
0
C).

Pregătirea gamei de etalonare :

Soluţia-mamă, gata de utilizare (se diluează R4 în raport 1/20).
• Exemplu : 40 µl de R4 Ac + 800 µl din soluţia diluant

Realizarea gamei de etalonare în 6 puncte (concentraţii variabile de anticorpi) :

• 80 UA (unităţi anticorpi) - diluţia soluţiei-mamă 1/5 : 100 µl soluţie-mamă
+ 400 µl diluant.....Tubul E1;
• 40 UA : diluţia soluţiei-mamă până la punctul 80 UA : 200 µl din tubul E1
+ 200 µl diluant.....Tubul E2;
• 20 UA : diluţia soluţiei-mamă până la punctul 40 UA : 200 µl din tubul E2
+ 200 µl diluant.....Tubul E3;
• 10 UA : diluţia soluţiei-mamă până la punctul 20 UA : 200 µl din tubul E3
+ 200 µl diluant.....Tubul E4;
• 5 UA : diluţia soluţiei-mamă până la punctul 10 UA : 200 µl din tubul E4
+ 200 µl diluant.....Tubul E5;
• 2,5 UA : diluţia soluţiei-mamă până la punctul 5 UA : 200 µl din tubul E5
+ 200 µl diluant.....Tubul E6.

Diluţia eşantioanelor (seruri de testat, seruri de control negativ şi pozitiv)

Se diluează extemporaneu eşantioanele - două diluţii succesive de 1/80 : 10 µl
ser + 790 µl de diluant rezultând 1/80, apoi 10 µl din diluţia precedentă + 790 µl
diluant rezultând diluţia finală 1/6400.
Ingrid Apetrei, Mihai Mareş


167
C
a
p
i
t
o
l
u
l
 
7
 

Reacţia imunoenzimatică

- Se stabileşte un plan de lucru privind distribuţia serului de control şi a etaloanelor
în funcţie de numărul eşantioanelor de testat;
- Se distribuie serul diluat (punctele de reper de la E1 – E6, eşantioanele de testat şi
cele de control) 100 µl per godeu;
- Se identifică baretele cu ajutorul unui marker permanent;
- Se acoperă microplaca cu ajutorul unui film adeziv, întinzându-se cât mai bine pe
toată suprafaţa în vederea asigurării unei bune etanşeizări;
- Se aşează placa în incubatorul de microplăci timp de 60 minute la 37
0
C;
- Se prepară soluţia de lavaj (prin diluare 1:10). Se pregătesc 200 ml pentru două
barete, respectiv 20 ml soluţie de lavaj concentrată la 180 ml de apă distilată;
- Se îndepărtează filmul adeziv şi se aspiră conţinutul tuturor godeurilor;
- Conţinutul aspirat se depune într-o soluţie de hipoclorit de sodiu 2%, iar spălarea
godeurilor se face de 4 ori, cu circa 300 µl soluţie de spălare / godeu;
- Se usucă baretele prin tamponare cu o hârtie absorbantă şi se lovesc uşor pentru
eliminarea în totalitate a soluţiei de spălare;
- Se omogenizează flaconul ce conţine conjugatul, apoi se distribuie câte 100 µl în
godeurile aferente;
- Se acoperă din nou microplaca cu filmul adeziv şi se incubează timp de 60
minute la 37
0
C;
- Se îndepărtează filmul adeziv şi se aspiră conţinutul tuturor godeurilor, în
maniera prezentată anterior;
- Prepararea soluţiei de revelare prin diluarea de 50 de ori a soluţiei cromogene
concentrate în soluţia tampon pentru peroxidază (e.g. 5 ml de reactiv tampon
substrat de peroxidază la 100 µl de soluţie cromogenă concentrată tetrametil-
benzidină) şi distribuirea rapidă a acesteia, în volum de câte 200 µl, în toate
godeurile;
- Reacţia este lăsată să se desfăşoare în obscuritate, timp de 30 minute, la
temperatura ambiantă;
- Se stopează reacţia enzimatică prin adăugarea a 100 µl soluţie de stopare în
fiecare godeu;
- Se citeşte densitatea optică la 450 / 620 nm pe parcursul a 30 de minute după
stoparea reacţiei.

7.3.6. Interpretarea rezultatelor

Valori ale densităţii optice aşteptate:

Densitate optică : 0,400 < DO la punctul din scala etalon 5 UA < 1,200

Raport :

- DO corespunzătoare punctului etalon 20 UA / DO înseamnă 5 UA > 2
- DO corespunzătoare punctului etalon 10 UA / DO înseamnă 5 UA > 1,4
Tehnici de seromicologie


168
- DO corespunzătoare punctului etalon 2,5 UA / DO înseamnă 5 UA < 0,8
Concentraţia în anticorpi;
- C3 < 2,5 UA/ml
- C5 = concentraţia indicată pe flacon ± 2,5 UA/ml

Curba etalon este realizată în baza a 6 repere / etaloane - 2,5, 5, 10, 20, 40, 80
UA/ml preparate pe baza R4, etalonul etichetat şi furnizat odată cu kitul. Se va opta
pentru trasarea sigmoidă a curbei de etalonare care să permită extrapolarea pe abscisă a
concentraţiilor în UA/ml (interpretare logaritmică) şi pe ordonată DO (liniar). Dacă
cititorul nu permite acest tip de trasare, se poate opta doar pentru o trasare de reliefare
a etaloanelor.

- < 0,5 UA/ml: ser negativ
- între 5 – 10 UA/ml: ser intermediar (rezultat incert)
- ≥ 10 UA/ml: ser pozitiv































Ingrid Apetrei, Mihai Mareş


169
C
a
p
i
t
o
l
u
l
 
7
 
7.4. Platelia
®
Candida Ag
Detecţia mananului seric prin metoda imunoenzimatică

7.4.1. Introducere

Antigenul Candida, în acest caz mananul - polizaharid major de perete,
reprezintă markerul principal în identificarea unei candidoze invazive. Eliberarea
acestui polizaharid în organism are loc intermitent, iar prezenţa serică a acestuia este de
multe ori pasageră. Detecţia rapidă a acestui compus depinde de o serie de factori,
precum captarea de către anticorpii specifici circulanţi şi degradarea de către
manozidazele serice. Deci evidenţierea mananului seric va trebui corelată cu cea a
anticorpilor antimanan circulanţi. Tandemul celor două tipuri de teste va concura atât
la ameliorarea gradului de sensibilitate cât şi la cea a precocităţii stabilirii unui
diagnostic integrat.

7.4.2. Principiul testului

Platelia
®
Candida Ag este o tehnică imunoenzimatică de tip sandwich ce
permite detecţia semicantitativă a mananului în serul uman. Această metodă se bazează
pe utilizarea anticorpilor monoclonali de şobolan (EBCA-1) dirijaţi contra unui penta–
manozid - exprimat prin manan şi manoproteine, existent la pricipalele specii de interes
clinic ale genului Candida. Aceşti anticorpi sunt utilizaţi în dublu sens: agenţi de
sensibilizare a plăcii de microtitrare şi revelatori după cuplarea cu peroxidaza.

7.4.3. Materiale furnizate odată cu kitul

- Soluţie de lavaj concentrată care se va dilua de 10 ori în apă distilată;
- Conjugat (gata de utilizare) - anticorpi monoclonali anti-manan, marcaţi cu
peroxidază;
- Soluţie de tratare a serului (gata de utilizare) - soluţie acidă EDTA fără
conservanţi;
- Tampon pentru substratul peroxidazei (gata de utilizare) - soluţie de acid citric şi
acetat de sodiu pH 5,2 conţinând 0,009% H
2
O
2
şi 4% DMSO;
- Soluţie cromogenă (concentrată) - soluţie de DMSO 90% conţinând tetra-metil-
benzidină (TMB);
- Soluţie de stopare (gata de utilizare) - soluţie de acid sulfuric 1,5N.

7.4.4. Materiale necesare dar nefurnizate odată cu kitul

- Apă distilată sau perfect demineralizată pentru pregătirea soluţiei de lavaj;
- Agitator tip Vortex;
- Centrifugă pentru tuburi Eppendorf conice, de 1,5 ml capacitate;
-Baie uscată cu dispozitiv de încălzire (temperatura preconizată 120
0
C) sau baie
de apă reglabilă la 100
0
C;
- Spălător de microplăci;
- Spectrofotometru echipat cu filtre de 450 / 620 nm;
Tehnici de seromicologie


170
- Incubator de microplăci (37°C);
- Tuburi Eppendorf conice, de 1,5 ml capacitate;
- Kit comercial Platelia Candida Ag.

7.4.5. Tehnica de lucru

Înaintea utilizării, toţi reactivii vor fi lăsaţi să ajungă la temperatura ambiantă
(20° – 25°C).
Pregătirea curbei etalon:
- Etalon: concentraţia în manan - 2ng/ml, 1ng/ml, 0,5ng/ml şi 0,25ng/ml;
- Ser control negativ - 150µl, 225µl şi 262,5µl;
- Ser etalon de 2ng/ml - 300 µl, 150 µl, 75 µl şi 37,5 µl.

7.4.5.1. Tratarea serului de control şi a celui etalon

Serurile de control (negativ şi pozitiv) şi concentraţiile etalon vor trebui tratate
concomitent cu eşantioanele prelevate de la pacienţi după modelul următor :
- Se repartizează 300 µl ser de testat într-un tub Eppendorf de 1,5 ml;
- Se adaugă 100 µl soluţie de tratare;
- Se omogenizează energic la Vortex;
- Se închide ermetic tubul (prin apăsarea capacului sau ataşarea unui dispozitiv de
siguranţă);
- Tubul va fi plasat 6 min la 120
0
C în vederea distrugerii complexelor imune deja
existente în ser (Ag-Ac);
- Centrifugare la 10000 rpm timp de 10 minute;
- Testarea supernatantului.

7.4.5.2. Reacţia imunoenzimatică

- Se stabileşte un plan de lucru privind distribuţia serului de control şi a etaloanelor
în funcţie de numărul eşantioanelor de testat;
- Se omogenizează flaconul ce conţine conjugatul prin întoarceri repetate înainte de
utilizare şi se prelevează doar volumul necesar realizării seriei (e.g. pentru
două barete a câte 8 godeuri sunt necesari 2 ml);
- Se distribuie succesiv în godeuri, cu respectarea ordinii de distribuţie a
reactivilor, 50 µl conjugat şi 50 µl supernatant din serul de testat tratat în
prealabil;
- Se acoperă microplaca cu ajutorul unui film adeziv, acesta întinzându-se cât mai
bine pe toată suprafaţa în vederea asigurării unei bune etanşeizări;
- Se aşează placa în incubatorul de microplăci timp de 90 minute la 37°C;
- Se prepară soluţia de lavaj prin diluare 1:10. Se pregătesc 200 ml pentru două
barete, respectiv 20 ml de soluţie de lavaj concentrată la 180 ml de apă
distilată;
- Se îndepărtează filmul adeziv şi se aspiră conţinutul tuturor godeurilor;
- Conţinutul aspirat se depune într-o soluţie de hipoclorit de sodiu 2%, iar spălarea
godeurilor se repetă de 5 ori cu cca. 300 µl soluţie de spălare / godeu;
Ingrid Apetrei, Mihai Mareş


171
C
a
p
i
t
o
l
u
l
 
7
 
- Se usucă baretele prin întoarcere pe o hârtie absorbantă şi se lovesc uşor pentru
eliminarea în totalitate a soluţiei de spălare;
- Prepararea soluţiei revelatoare prin diluarea de 50 ori a soluţiei cromogene
concentrate în soluţia tampon – peroxidază ( e.g. 160 µl soluţie cromogenă în 8
ml de reactiv tampon substrat de peroxidază) şi distribuirea rapidă a acesteia,
200 µl în toate godeurile. Reacţia este lăsată să se desfăşoare în obscuritate
timp de 30 minute, la temperatura ambiantă;
- Se stopează reacţia enzimatică prin adăugarea a 100 µl soluţie de stopare în
fiecare godeu;
- Se citeşte densitatea optică la 450 / 620 nm pe parcursul celor 30 de minute de la
stoparea reacţiei.

7.4.6. Maniera de calcul şi interpretarea rezultatelor

Valori ale densităţii optice aşteptate:
- la 0,5 ng/ml, DO va fi de 0,300 – 1,100;
- pentru concentraţia de manan a controlului pozitiv, valorile sunt cele indicate pe
flacon ± 20%;
- raportul DO privind etaloanele trebuie să fie mai mare de 2,1.

Trasarea curbei etalon

Curba etalon este realizată în baza a patru repere: 2, 1, 0,5, 0,25 ng/ml. Astfel
se trasează o curbă cu diferite puncte reprezentate de cantităţile amintite, pe abscisă
concentraţiile de manan în ng/ml şi pe ordonată densitatea optică.

Determinarea concentraţiei în manan a serurilor de testat şi interpretarea
rezultatelor

Având ca punct de plecare valorile prestabilite trasate de curba etalon se poate
determina pentru fiecare probă de ser concentraţia în manan exprimată în ng/ml.
- Mananemia cu valori mai mici de 0,25 ng/ml se consideră rezultat negativ;
- În intervalul 0,25 ng/ml – 0,5 ng/ml vorbim de un rezultat echivoc, altfel spus
incert;
- Dacă valorile constatate depăşesc sau sunt egale cu pragul de 0,5 ng/ml, rezultatul
este pozitiv.

Toate rezultatele pozitive vor trebui confruntate cu simptomatologia observată
clinic şi corelate cu alte tehnici în vederea stabilirii unui diagnostic fără echivoc de
candidoză invazivă, fapt ce va fi urmat de instituirea unei medicaţii antifungice.






Tehnici de seromicologie


172
Fig. nr. 7-2. Testul de latex-aglutinare
BICHRO-DUBLI. Aspectul testului
pozitiv (C.dubliniensis) şi negativ
(C.albicans).
7.5. Identificarea speciei Candida dubliniensis prin latex-aglutinare
(BICHRO-DUBLI, Fumouze)


Un test expeditiv, perfect adaptat pentru utilizarea în laboratoarele clinice în
vederea diferenţierii speciilor C. albicans şi C. dubliniensis, este testul de latex-
aglutinare Bichro-Dubli (Fumouze – Franţa). Acest test foloseşte particule de latex
„sensibilizate” cu anticorpi monoclonali specifici unui antigen de suprafaţă întâlnit
doar la C. dubliniensis.

Tehnica de lucru
- Se depun câte 20 µl reactiv în fiecare cerc al cardului de testare;
- Se stabilesc prin numerotare locurile pentru martorul pozitiv (o tulpină de C.
dubliniensis), martorul negativ (o tulpină de C. albicans) şi proba de testat (o
tulpină de interes clinic, pozitivă la testul de filamentare);
- Cu ajutorul unei anse microbiologice se prelevează pe rând câte 2-3 colonii din
tulpinile respective;
- Se suspensionează coloniile în reactivul adăugat în prealabil astfel încât să se
obţină un amestec omogen;
- Se imprimă cardului de testare o mişcare circulară lentă, timp de 3-5 minute;
- Se notează eventuala apariţie a aglutinării la proba de testat (similar martorului
pozitiv);
-Proba pozitivă este indicată de apariţia unui aspect granular (aglomerări bleu pe
fond roz sau violet) datorat particulelor de latex care au aderat la celulele de C.
dubliniensis.




Ingrid Apetrei, Mihai Mareş


173
C
a
p
i
t
o
l
u
l
 
7
 
Bibliografie selectivă

1. Aketagawa J, Tanaka S, Tamura H, Shibata Y, Saito H (1993) - Activation
of Limulus coagulation factor G by several (1,3)-β-D-glucans: Comparison
of the potency of glucans with identical degree of polymerization but
different conformations; J Biochem; 113:683-686.
2. Alexander B (2002) - Diagnosis of fungal infection: new technologies for
the mycology laboratory; Transpl Infectious Dis; 4 (Suppl. 3):32-37.
3. Becker M J, de Marie S, Willemse D, Verbrugh H A, Bakker-
Woudenberg I A J M (2000) - Quantitative galactomannan detection is
superior to PCR in diagnosing and monitoring invasive pulmonary
aspergillosis in an experimental rat model; J Clin Microbiol; 38:1434-
1438.
4. Bretagne S, Costa J-M, Marmorat-Khuong A et al. (1995) - Detection of
Aspergillus species DNA in bronchoalveolar lavage samples by
competitive PCR; J Clin Microbiol; 33:1164-1168.
5. Bretagne S, Costa J-M, Bart-Delabesse E et al. (1997) - Comparison of
serum galactomannan antigen detection and competitive polymerase chain
reaction for diagnosing invasive aspergillosis; J Clin Infect Dis; 26:1407-
1412.
6. Chambon-Pautas C, Costa J-M, Chaumette M-T, Cordonnier C, Bretagne
S (2001) - Galactomannan and polymerase chain reaction for the
diagnosis of primary digestive aspergillosis in a patient with acute myeloid
leukaemia; J Infect; 43:213-214.
7. Costa C, Costa J-M, Desterke C, Botterel F, Cordonnier C, Bretagne S
(2002) - Real-time PCR coupled with automated DNA extraction and
detection of galactomannan antigen in serum by enzyme-linked
immunosorbent assay for diagnosis of invasive aspergillosis; J Clin
Microbiol; 40:2224-2227.
8. Erjavec Z, Verweij P E (2002) - Recent progress in the diagnosis of fungal
infections in the immunocompromised host; Drug Resist; 5:3-10.
9. Faille C, Mackenzie D W, Michalski J C, Poulain D (1992) - Evaluation
of an enzyme immunoassay using neoglycolipids constructed from
Candida albicans oligomannosides to define the specificity of anti-mannan
antibodies; Eur J Clin Microbiol Infect; 11:438-446.
10. Fishman J A , Rubin R H (1998) - Infection in organ-transplant recipients;
New England Journal of Medicine; 338(24):1741-1751.
11. Freydiere A M, Guinet R, Boiron P (2001) - Yeast identification in the
clinical microbiology laboratory: phenotypical methods; Med Mycol;
39:9-33.
12. Fukazawa Y (1989) - Antigenic structure of Candida albicans.
Immunochemical basis of the serological specificity of the mannans in
yeasts; Immunol Ser; 47:37-62.
13. Georges E, Garrigues M L, Stynen D, Poirot J L (1991) - Spécificité in
vitro d'un anticorps monoclonal (Acm) anti-mannane et du latex sensibilisé
Tehnici de seromicologie


174
par cet anticorps au cours de la candidose disséminée expérimentale; J
Mycol Med; 118:21-24.
14. Hashiguchi K, Niki Y, Soejima R (1994) - Cyclophosphamide induces
false-positive results in detection of Aspergillus antigen in urine; Chest;
105:975-976.
15. Hashimoto A , Yamakami Y, Kamberi P et al. (1998) - Comparison of
PCR, (1-3)-beta-D-glucan and galactomannan assays in sera of rats with
experimental invasive aspergillosis; J Clin Lab Anal; 12:257-262.
16. Hebart H, Loeffler J, Kanz L, Einsele H (2000) - Molecular methods in
the diagnosis of infections in the immunocompromised host; Curr Opin
Infect Dis; 13:355-359.
17. Hyams K C (1998) - Developing case definitions for symptom-based
conditions: the problem of specificity; Epidemiol Rev; 20:148-156.
18. Iwanaga S, Morita T, Nakamura T, Aketagawa J (1986) - The hemolymph
coagulation system in invertebrate animals; J. Protein Chem; 5: 255-268
19. Jacquinot P M , Plancke Y, Sendid B, Strecker G, Poulain D (1998) -
Nature of Candida albicans-derived carbohydrate antigen recognized by a
monoclonal antibody in patient sera and distribution over Candida species;
FEMS Microbiol Lett;169:131-138.
20. Jacquinot P M, Plancke Y, Sendid B, Strecker G, Poulain D (1998) -
Nature of Candida albicans-derived carbohydrate antigen recognized by a
monoclonal antibody in patient sera and distribution over Candida species;
FEMS Microbiol Lett;169:131-138.
21. Jarvis W R (1995) - Epidemiology of nosocomial fungal infections, with
emphasis on Candida species; Clin Infect Dis; 20:1526-1530.
22. Kappe R (1989) - Coexistence of free antigens, free antibodies and
immune complexes in sera from patients with suspected deep-seated
candidosis; Mycoses; 32:24-32.
23. Kato A, Takita T, Furuhashi M et al. (2001) - Elevation of blood (1,3)-β-
D-glucan concentrations in hemodialysis patients; Nephron; 89:15-19.
24. Kawamura S, Maesaki S, Noda T et al. (1999) - Comparison between
PCR and detection of antigen in sera for diagnosis of pulmonary
aspergillosis; J Clin Microbiol; 37:218-220.
25. Kontoyiannis D P, Vaziri I, Hanna H A et al. (2001) - Risk factors for
Candida tropicalis fungemia in patients with cancer; Clin Infect Dis;
33:1676-1681.
26. Kurzai O, Heinz W J, Sullivan D J et al. (1999) - Rapid PCR test for
discriminating between Candida albicans and Candida dubliniensis
isolates using primers derived from the pH-regulated PHR1 and PHR2
genes of C.albicans; J Clin Mircobiol; 37:1587-1590.
27. Latge J P (1999) - Aspergillus fumigatus and aspergillosis; J Clin
Microbiol; 12:310-340.
28. Lescher-Bru V, Cavalier A, Pernot-Marino E et al. (1998) - Aspergillus
galactomannan antigen detection with Platelia
®
Aspergillus: multiple
positive antigenemia without Aspegillus infection; J Mycol Med; 8:112-
113.
Ingrid Apetrei, Mihai Mareş


175
C
a
p
i
t
o
l
u
l
 
7
 
29. Loeffler J, Herbart H, Sepe S (1998) - Detection of PCR - amplified
fungal DNA by using a PCR-ELISA system; Med Mycol; 36:275-279.
30. Loeffler J, Schmidt K, Hebart H, Schumacher U, Einsele H (2002) -
Automated extraction of genomic DNA from medically important yeast
species and filamentous fungi by using the MagNA Pure LC system; J
Clin Microbiol; 40:2240-2243.
31. Maertens J, Verhaegen J, Lagrou K, Van Eldere J, Boogaerts M (2001) -
Screening for circulating galactomannan as a noninvasive diagnostic tool
for invasive aspergillosis in prolonged neutropenic patients and stem cell
transplantation recipients: a prospective validation; Blood; 97:1604-1610.
32. Maertens J, Van Eldere J, Verhaegen J et al. (2002) - Use of circulating
galactomannan screening for early diagnosis of invasive aspergillosis in
allogeneic stem cell transplant recipients; J Infect Dis; 186:1297-1306.
33. Manso E, Montillo M, De Sio G et al (1994) - Value of antigen and
antibody detection in the serological diagnosis of invasive aspergillosis in
patients with haematological malignancies; Eur J Clin Microbiol Infect
Dis; 13:756-760.
34. Mitsuya M, Wada K, Yamaguchi H (1994) - In vitro studies on the release
of G Test-positive (1,3)-β-D-glucans from various fungal pathogens; In
Committee on Organic Dusts, ICOH, Report 1/94, Rylander R, Goto H.
(eds.); 29-37.
35. Miyazaki T, Kohno S, Mitsutake K et al. (1995) - Plasma (1-3)-β-d-
glucan and fungal antigenemia in patients with candidemia, aspergillosis,
and cryptococcosis; J Clin Microbiol; 33:3115-3118.
36. Morace G, Pagano L, Sanguinetti M et al. (1999) - PCR-restriction
enzyme analysis for detection of Candida DNA in blood from febrile
patients with haematological malignancies; J Clin Microbiol; 37:1871-
1875.
37. Morace G, Sanguinetti M, Posteraro B, Lo Cascio G, Fadda G (1997) -
Identification of various medically important Candida species in clinical
specimens by PCR-restriction enzyme analysis; J Clin Microbiol; 35:667-
672.
38. Obayashi T (1995) - Plasma (1,3)-beta-glucan measurement in diagnosis
of invasive deep mycosis and fungal febrile episodes; Lancet; 345:17-20.
39. Obayashi T, Yoshida M, Mori T, et al. (1995) - Plasma measurement in
diagnosis of invasive deep mycosis and fungal febrile episodes; Lancet;
345: 17-20.
40. Odabasi Z , Mattiuzzi G, Estey E, et al. (2004) - β-D-glucan as a
diagnostic adjunct for invasive fungal infections: Validation, cutoff
development, and performance in patients with Acute Myelogenous
Leukemia and Myelodysplastic Syndrome; Clin Infect Dis; 39:199-205.
41. Pfaller M A, Jones R N, Doern G V et al. (1999) - International
surveillance of blood stream infections due to Candida species in the
European SENTRY program: species distribution and antifungal
susceptibility including the investigational triazole and echinocandin
agents; Diagn Microbiol Infect Dis; 35:19-25.
Tehnici de seromicologie


176
42. Pfaller M A, Jones R N, Doern G V et al. (2000) - Bloodstream infections
due to Candida species: SENTRY antimicrobial surveillance program in
North America and Latin America, 1997-1998; Antimicrob Agents
Chemother; 44:747-751.
43. Pinel C, Fricker-Hidalgo H, Lebeau B et al. (2003) - Detection of
circulating Aspergillus fumigatus galactomannan: value and limits of the
Platelia test for diagnosing invasive aspergillosis; J Clin Microbiol;
41:2184-2186.
44. Podzorski R P, Gray G R, Nelson R D (1990) - Different effects of native
Candida albicans mannan and mannan-derived oligosaccharides on
antigen-stimulated lymphoproliferation in vitro; J Immunol; 144:707-716.
45. Ponton J, Quindos G (2002) - Non-culture-based diagnostics, In R. A.
Calderone (ed.), Candida and candidiasis; American Society for
Microbiology; 393-425.
46. Reiss E, Morrison C J (1993) - Nonculture methods for diagnosis of
disseminated candidiasis; Clin Microbiol Rev; 6:311-323.
47. Richardson M D, Kokki M H (1999) - New Perspectives in the diagnosis
of systemic fungal infections; Ann Med; 31:327-333.
48. Saito H, Yoshioka Y, Uehara N (1991) - Relationship between
conformation and biological response for (1,3)-β-Dglucans in the
activation of coagulation factor G from Limulus amebocyte lysate and
host-mediated antitumor activity. Demonstration of single-helix
conformation as a stimulant; Carbohydrate Res; 217:181-190.
49. Sanguinetti M, Posteraro B, Pagano L et al. (2003) - Comparison of real-
time PCR, conventional PCR and galactomannan antigen detection by
enzyme-linked immunosorbent assay using bronchoalveolar lavage fluid
samples from hematology patients for diagnosis of invasive pulmonary
aspergillosis; J Clin Microbiol; 41:3922-3925.
50. Sendid B, Poirot J L, Tabouret M et al. (2002) - Combined detection of
mannanaemia and antimannan antibodies as a strategy for the diagnosis of
systemic infection caused by pathogenic Candida species; J Med
Microbiol; 51:433-442.
51. Sendid B, Tabouret M, Poirot J L et al. (1999) - New enzyme
immunoassays for sensitive detection of circulating Candida albicans
mannan and antimannan antibodies: useful combined test for diagnosis of
systemic candidiasis; J Clin Microbiol; 37:1510-1517.
52. Sendid B, Tabouret M, Poirot J L, Mathieu D, Fruit J, Poulain D (1999) -
New enzyme immunoassays for sensitive detection of circulating Candida
albicans mannan and antimannan antibodies: useful combined test for
diagnosis of systemic candidiasis; J. Clin. Microbiol; 37:1510-1517.
53. Skladny H, Buchheidt D, Baust C et al. (1999) - Specific detection of
Aspergillus species in blood and bronchoalveolar lavage samples of
immunocompromised patients by two-step PCR; J Clin Microbiol;
37:3865-3871.
54. Stynen D, Sarfati J, Symoens F, Goris A, Nolard N, Latge J-P (1991) -
Rat monoclonal antibodies against exocellular carbohydrate antigens of
Ingrid Apetrei, Mihai Mareş


177
C
a
p
i
t
o
l
u
l
 
7
 
Aspergillus and dermatophytes; Latge J-P, Boucias D (eds.), Fungal cell
wall and immune response; Springer - Verlag; 181-193.
55. Sulahian A,Touratier S, Ribaud P (2003) - False positive test for
Aspergillus antigenaemia related to concomitant administration of
piperacillin and tazobactam; N Engl J Med; 349:2366-2367.
56. Suzuki S (1997) - Immunochemical study on mannans of genus Candida. I.
Structural investigation n of antigenic factors 1, 4, 5, 6, 8, 9, 11, 13, 13b
and 34. Curr. Top; Med Mycol; 8:57-70.
57. Swanink C, Meis J F G, Rijs A J M M, Donnelly J P, Verweij P E (1997) -
Specificity of a sandwich enzyme-linked immunosorbent assay for
detecting Aspergillus galactomannan; J Clin Microbiol; 35:257-260.
58. Tamura H, Tanaka S, Obayashi T, Yoshida M, Kawai T (1992) - A new
sensitive microplate assay of plasma endotoxin; J Clin Lab Anal;
6(4):232-238.
59. Tanaka S, Aketagawa J, Takahashi S, Tsumuraya Y, Hashimoto Y (1991) -
Activation of a Limulus coagulation factor G by (1,3)-β-D-glucans;
Carbohydrate Res; 218:167-174.
60. Trinel P A, Faille C, Jacquinot P M, Cailliez J C, Poulain D (1992) -
Mapping of Candida albicans oligomannosidic epitopes by using
monoclonal antibodies; Infect Immun;60:3845-3851.
61. van Burik J, Myerson D, Schreckhise R, Bowden R (1998) - Panfungal
PCR assay for detection of fungal infection in human blood specimens; J
Clin Microbiol; 36:1169-1175.
62. Verweij P E, Figueroa J, van Burik J, Holdom M D, Del-Cas E, Gómez B-
L, Mendes-Giannini M-J (2000) - Clinical applications of non-culture
based methods for the diagnosis and management of opportunistic and
endemic mycoses; Med Mycol; 38:(Suppl. 1):161-171.
63. Verweij P E, Meis J F (2000) - Microbiological diagnosis of invasive
fungal infections in transplant recipients; Transplant Infect Dis; 2:80-87.
64. Walsh T J, Groll A H (1999) - Emerging fungal pathogens: evolving
challenges to immunocompromised patients for the twenty-first century;
Transpl Infectious Dis;1:247-261.
65. Yeo S F, Wong B (2002) - Current status of non-culture methods for
diagnosis of invasive fungal infections; Clin Microbiol Rev;15:465-484.
66. Yera H, Sendid B, Francois N, Camus D, Poulain D (2001) - Contribution
of serological tests and blood culture to the early diagnosis of systemic
candidiasis; Eur J Clin Microbiol Infect Dis; 20:864-870.


Mihai Mareş, Olimpia Bazgan


179
C
a
p
i
t
o
l
u
l
 
8
 




Mihai Mareş, Olimpia Bazgan

ungii prezintă o serie de însuşiri metabolice şi eco-fiziologice care pot fi
utile în demersul de identificare a speciei, în special pentru discriminarea
între specii cu caractere culturale şi aspecte microscopice similare. Evaluarea prezenţei
sau absenţei acestor însuşiri se realizează prin punerea în practică a unor teste cum ar fi
cele biochimice şi cele fiziologice.
Aceste teste sunt mijloace absolut necesare în laboratorul clinic, în special
pentru identificarea levurilor de interes medical. Deşi importanţa lor este covârşitoare
şi unanim recunoscută, aceste teste nu reuşesc de fiecare dată să elucideze cu exactitate
apartenenţa taxonomică a unei anumite tulpini şi sunt necesare teste suplimentare, în
principal de biologie moleculară, pentru identificarea acesteia. Deoarece testele de
biologie moleculară bazate pe analiza ADN-ului sunt accesibile doar laboratoarelor din
Centrele de Referinţă şi sunt relativ costisitoare, utilizarea profilul biochimic şi a
caracterelor morfologice reprezintă o soluţie acceptabilă pentru laboratoarele clinice,
răspunzând de manieră satisfăcătoare cerinţelor de diagnostic din spitale şi ambulatorii
de specialitate. Profilul biochimic cuprinde datele obţinute prin efectuarea unei
multitudini de teste, între care cele mai importante sunt redate în continuare.

8.1. Fermentarea zaharurilor

Utilizarea metabolică a zaharurilor în condiţii de anaerobioză presupune
cultivarea levurilor pe medii minimale conţinând 0,3% extract de drojdie şi 0,5%
peptonă, aditivate cu un anumit substrat glucidic în proporţie de 2%. Interpretarea se
face pe baza dioxidului de carbon acumulat în tubuleţele Durham introduse în mediu.
Cele mai utilizate zaharuri sunt: D-glucoza, D-galactoza, maltoza, sucroza, rafinoza,
trehaloza şi D-xiloza. Acest test este util în diferenţierea diverselor specii aparţinând
genului Candida, dar nu şi a levurilor din genurile Cryptococcus şi Rhodotorula care
sunt nefermentative.





F
8
Teste biochimice şi fiziologice
Teste biochimice şi fiziologice


180
8.2. Capacitatea de asimilare a surselor de carbon

Abilitatea levurilor de a creşte pe diverse medii în prezenţa anumitor substanţe
chimice adăugate ca unică sursă de carbon, poartă numele de auxanogramă.
Substanţele folosite pentru acest test sunt mai numeroase şi mai diverse în ceea ce
priveşte complexitatea structurală:
- hexoze: D-glucoză, D-galactoză, L-ramnoză, L-sorboză;
- pentoze: D-xiloză, D-riboză, L-arabinoză, D-arabinoză;
- dizaharide: sucroză, maltoză, celobioză, trehaloză, lactoză, melibioză;
- trizaharide: rafinoză, melezitioză;
- polizaharide: amidon solubil, inulină;
- alcooli: eritritol, adonitol, D-manitol, m-inozitol, metanol, etanol, glicerol, glicol,
1,2-propandiol, 2,3-butandiol, dulcitol, D-sorbitol;
- acizi organici: succinat, citrat, DL-lactat, D-gluconat, D-glucuronat, 2-ceto-D-
gluconat, 5-ceto-D-gluconat;
- alţi compuşi: D-glucozamină HCl, N-acetil-glucozamină.

8.3. Capacitatea de asimilare a surselor de azot

Principiul acestui test este similar cu cel al testului anterior. Sursele de azot
testate sunt: nitraţii, etilamina, L-lizina, cadaverina, nitriţii, creatina, creatinina. Testul
de asimilare a nitratului de sodiu este important pentru diferenţierea levurilor
aparţinînd genurilor Cryptococcus şi Rhodotorula prin determinarea activităţii nitrat-
reductazei cu anumiţi agenţi revelatori de tipul acidului sulfanilic şi alfa-naftilaminei.

8.4. Testul de hidroliză a ureei (producerea de urează) la levuri

Scop
Acest test pune în evidenţă capacitatea unor levuri de a produce enzima numită
urează. Se foloseşte pentru identificarea prezumtivă a levurilor aparţinând genurilor
Cryptococcus, Rhodotorula şi Trichosporon.

Tehnică de lucru
Se folosesc medii lichide care conţin uree şi un indicator (roşu-fenol): bulion
Christensen preparat în laborator, medii gata de utilizare comercializate de diverse
firme (BD Diagnostics, BioMérieux, Remel etc.). În urma scindării ureei de către
ureaza secretată de levuri, se produce o creştere a pH-ului prin eliberarea amoniacului,
fapt semnalat de virarea culorii indicatorului de la galben-chihlimbar la roz-roşu.
Se însămânţează 0,5 ml mediu de testare cu o ansă încărcată de celule,
prelevată din cultura levurii de identificat. În paralel, se însămânţează obligatoriu un
martor pozitiv (Cryptococcus neoformans) şi unul negativ (Candida albicans).
Rezultatele se citesc după 3, respectiv 24 ore de incubare la 37°C. Interpretare: testul
este pozitiv pentru genurile Cryptococcus, Rhodotorula, Trichosporon şi negativ
pentru Blastoschizomyces, Candida şi Geotrichum.


Mihai Mareş, Olimpia Bazgan


181
C
a
p
i
t
o
l
u
l
 
8
 
Precauţii
Tulpina de testat trebuie să fie necontaminată bacterian, deoarece se pot
produce erori prin interferarea reacţiei.

8.5. Testul de hidroliză a ureei (producerea de urează) la dermatofiţi

Scop
Pune în evidenţă producerea de urează de către dermatofiţi, prin cultivare pe
bulion sau agar Christensen. În cazul producerii acestei enzime, ureea din mediu este
descompusă cu generare de amoniac care va modifica pH-ul mediului (alcalinizare),
fenomen indicat de schimbarea culorii indicatorului; astfel, culoarea mediului va vira
de la galben-orange la roz-roşu (fig. nr. 8-1, vezi Anexa).

Tehnică de lucru
Mediul solid, turnat în pantă, se inoculează într-un singur punct, cu tulpina de
analizat. În paralel, se inoculează un martor pozitiv (e.g. T. mentagrophytes) şi un
martor negativ (e.g. T. verrucosum). După inoculare, mediul se incubează la 25°-30°C,
timp de până la 7 zile.

Testul ureazei este:
- pozitiv pentru următoarele specii de dermatofiţi – M. canis, M. cookei, M.
gypseum, M. nanum, M. persicolor, M. praecox, T. ajelloi, T. mentagrophytes
(ambele varietăţi) şi T. Terrestre;
- slab pozitiv pentru următoarele specii de dermatofiţi – E. floccosum şi rar M.
canis;
- variabil (inconstant pozitiv sau negativ, în funcţie de tulpină) pentru următoarele
specii de dermatofiţi – M. audouinii, T. rubrum, T. schoenleinii, T. tonsurans şi
T. violaceum;
- negativ pentru următoarele specii de dermatofiţi – M. ferrugineum, T.
concentricum şi T. verrucosum.

Precauţii
Este obligatorie absenţa contaminării bacteriene a culturii dermatofitului din
care se fac pasajele pe mediul Christensen.

8.6. Testarea rezistenţei la cicloheximidă

Testul se referă la abilitatea levurilor de a se dezvolta pe medii de cultură
conţinând două concentraţii de cicloheximidă – 0,01%, respectiv 0,1%. Aceste
concentraţii pot fi critice pentru anumite specii, supresându-le total sau parţial
dezvoltarea, sau dimpotrivă, pot fi permisive pentru altele, creşterea lor nefiind deloc
stânjenită.




Teste biochimice şi fiziologice


182
8.7. Producerea de fenol-oxidază

Producerea acestei enzime este detectată cu ajutorul unor discuri impregnate
cu acid cafeic (Caffeic Acid Disk, Remel – SUA) sau prin cultivarea levurilor pe medii
bogate în polifenoli de tip acid cafeic (Agar pe bază de extract din seminţe de Niger
sau Agar cu acid cafeic şi citrat feric) şi permite identificarea speciei Cryptococcus
neoformans pe baza unei reacţii de culoare. Sub acţiunea fenol-oxidazei, care
catalizează oxidarea polifenolilor şi transformarea lor în pigment melanic, apare o
brunificare a discului într-un interval de aproximativ 4 ore de incubare la 30°C,
respectiv colonii brune pe mediile amintite, după 48-72 ore (fig. nr. 8-2, vezi Anexa).

8.8. Testarea producerii altor enzime

Enzime cum ar fi β-galactozaminidaza, L-prolin-aminopeptidaza etc., sunt
evidenţiabile prin cultivarea levurilor pe medii cromogene: CandiSelect™ 4 (fig. nr. 8-
3, vezi Anexa), Candichrom
®
II, Albicans ID2 agar, CHROMagar Candida (fig. nr. 8-4,
vezi Anexa), Oxoid Chromogenic Candida Agar (fig. nr. 8-5, vezi Anexa).
Diferite combinaţii ale acestor însuşiri biochimice au fost folosite pentru
conceperea unor teste comercializabile, utile pentru identificarea rapidă a speciilor
levurice de interes medical în laboratoarele clinice. Aceste teste pot identifica un
număr diferit de specii, după cum urmează:
- o singură specie: Caffeic Acid Disk (Remel), C. albicans Screen (Remel), Rapid
Trehalose Assimilation (Remel), RTT Glabrata (Fumouze);
- câteva specii: CandiSelect (Bio-Rad), CHROMagar Candida (BD Sciences),
Candida ID2 (bioMérieux), Candichrom II (International Microbio),
Chromogenic Candida Agar (Oxoid);
- specii multiple (zeci de specii din câteva genuri): ID 32C (bioMérieux), RapID
Yeast Plus Panel (Remel), Uni-Yeast Tek Plates (Remel), Auxacolor 2 (Bio-
Rad) (fig. nr. 8-6 şi 8-7, vezi Anexa), Microplate (Biolog) (fig. nr. 8-8, vezi
Anexa).

8.9. Testul de depistare a necesităţilor nutritive speciale

Unele specii de dermatofiţi au exigenţe nutritive particulare, reclamând
prezenţa în mediile de cultură a unor factori trofici ca vitaminele (acid nicotinic,
inozitol, tiamină) sau aminoacizii (histidină). Testul presupune cultivarea suşei de
identificat pe un set de 7 medii (Trichophyton Agar) notate 1...7:

1. mediu bazal ce conţine cazeină, fără vitamine;
2. 1 + inozitol;
3. 1 + inozitol + tiamină;
4. 1 + tiamină;
5. 1 + acid nicotinic;
6. mediu bazal conţinând nitrat de amoniu, fără aminoacizi;
7. 6 + histidină.

Mihai Mareş, Olimpia Bazgan


183
C
a
p
i
t
o
l
u
l
 
8
 
Acest set de medii este disponibil comercial: Trichophyton Agar 1-7 (Remel,
BD Diagnostics).
Tuburile cu cele 7 medii se însămânţează prin transferul unui mic fragment din
colonia de testat, având grijă să nu se preleveze şi porţiuni de mediu. Ele se incubează
apoi la 25°-30°C sau la 37°C (când se suspicionează T. verrucosum), timp de 14 zile.
Interpretarea rezultatelor se face după 7, respectiv 14 zile, ţinând cont de eventuala
stimulare a creşterii pe mediile aditivate cu vitamine sau aminoacizi comparativ cu cea
observată pe mediile bazale (tabelul 8-1).

Tabelul 8-1
Comportamentul dermatofiţilor pe setul de 7 medii aditivate cu factori trofici
Specia 1 2 3 4 5 6 7
E. floccosum + + + + + ± ±
M. audouinii + + + + + + +
M. canis + + + + + + + + + + + + + +
M. cookei + + + + + + +
M. ferrugineum + + + + + + + +
M. gypseum + + + + + + +
M. nanum + + + + + + + +
M. persicolor + + + + + + +
M. praecox + + + + + + +
T. ajelloi + + + + + + +
T. concentricum - + + + + + - ±
T. mentagrophytes
var. interdigitale
+ + + + + + + + + + + + + +
T. mentagrophytes
var. mentagrophytes
+ + + + + + + + + + + + + +
T. rubrum + + + + + + + + + + +, - + +
T. schoenleinii + + + + + + + +
T. terrestre + + + + + + +
T. tonsurans +, - +, - +, - + +, - + +, - ±, -
T. verrucosum - ± + + + - - -
T. violaceum +, - + + + + + + +
Legendă: + (creştere normală), - (absenţa creşterii), + + (creştere stimulată), ± (creştere disgonică)

8.10. Testul de cultivare pe Agar BCP – lapte – glucoză.

Scop
Permite observarea schimbărilor de pH datorită indicatorului (bromcrezol
purpur) inclus în mediu şi ajută la diferenţierea speciilor de dermatofiţi de interes
clinic.

Tehnică de lucru
Mediul, turnat în plăci Petri sau flacoane cu capacitate de 25-30 ml (înclinat în
acest caz), se însămânţează cu tulpina dermatofitului de identificat într-un singur punct.
Recipientele însămânţate se incubează la 30°C timp de 5-10 zile, funcţie de viteza de
creştere a fiecărei tulpini în parte. Alcalinizarea mediului în urma dezvoltării culturii
Teste biochimice şi fiziologice


184
dermatofitului va antrena virarea culorii acestuia, de la albastru-pal la violet-purpuriu.
Speciile capabile să alcalinizeze mediul sunt: E. floccosum, M. audouinii, T.
mentagrophytes (var. interdigitale), T. schoenleinii, T. terrestre, T. verrucosum, T.
violaceum. Unele specii (T. verrucosum) sunt capabile să hidrolizeze cazeina din lapte,
producând o clarificare a mediului în jurul coloniei.

Precauţii
Trebuie să ne asigurăm că tulpina de testat nu este impurificată cu alte
microorganisme (bacterii sau fungi) care ar putea da reacţii pozitive eronate.

8.11. Testul de perforare a firului de păr in vitro

Scop
Diferenţierea speciilor de dermatofiţi de interes clinic pe baza producerii
organelor perforatoare in vitro.

Tehnică de lucru
Se utilizează fire de păr de copil, care se cupează în fragmente de 0,5-1 cm şi
se autoclavează în plăci Petri timp de 10 minute la 121°C. După autoclavare, se adaugă
în fiecare placă câte 25 ml apă distilată sterilizată şi câteva picături extract de drojdie
10%. Plăcile astfel pregătite se însămânţează cu câteva fragmente din colonia
dermatofitului de identificat, apoi se incubează la 25°C, timp de 21 zile. La fiecare 7
zile, utilizând fragmente de păr inoculate, se pregătesc preparate extemporanee (cu
lichid clarificant, între lamă şi lamelă). O altă variantă, ar fi etalarea unor fragmente de
0,5-1,5 cm din firele de păr autoclavate direct pe suprafaţa coloniilor dezvoltate pe
Agar Sabouraud şi continuarea incubării timp de 21 zile. Testul pozitiv este indicat de
prezenţa organelor perforatoare care străbat tija pilară din loc în loc, având traiect
perpendicular pe aceasta (fig. nr. 8-9, vezi Anexa). Comportamentul speciilor de
dermatofiţi la acest test este prezentat în tabelul 8-2.

Tabelul 8-2
Comportamentul speciilor de dermatofiţi la testul de perforare a firului de păr
Test de perforare pozitiv Test de perforare negativ Test de perforare variabil
M. canis M. audouinii E. floccosum
M. cookei M. praecox T. erinacei
M. gypseum T. equinum T. tonsurans
M. persicolor T. concentricum
T. ajelloi M. ferrugineum
M. galinae T. rubrum
M. nanum T. schoenleinii
T. terrestre T. verrucosum
T. mentagrophytes T. violaceum
T. soudanense




Mihai Mareş, Olimpia Bazgan


185
C
a
p
i
t
o
l
u
l
 
8
 

8.12. Testul de cultivare pe boabe de orez

Scop
Este util pentru diferenţierea M. audouinii (creştere restrictivă, pigment brun-
maroniu, absenţa sporulării) de M. canis (creştere abundentă, pigment galben,
sporulare intensă) (fig. nr. 8-10, vezi Anexa). Această metodă este utilă şi pentru
inducerea sporulării unor tulpini dermatofitice nesporulate, disgonice sau cu sporulare
atipică.

Tehnică de lucru
Mediul se prepară în flacoane Erlenmeyer cu capacitate de 100 ml, în care se
adaugă 8 g orez decorticat şi 25 ml apă distilată. Se sterilizează prin autoclavare la
121°C timp de 15 minute. După inoculare, flacoanele se incubează la 25°-30°C timp de
până la 2 săptămâni.

8.13. Testul de filamentare (testul de blasteză sau germ-tube test)

Scop
Test tip screening pentru trierea izolatelor de levuri în laboratorul clinic şi
identificarea prezumtivă a tulpinilor de C. albicans şi C. dubliniensis.

Tehnică de lucru
Ca medii pentru blasteză se utilizează serul sanguin de cal, serul sanguin uman
(Atenţie! Risc crescut de contaminare cu HIV, HVB) sau medii artificiale
comercializate de diverse firme (Germ Tube Solution – Remel, SUA). În fiole cu
capacitatea de 2 ml se pun în contact 0,5 ml suspensie levurică şi 0,5 ml ser sanguin de
cal. Fiolele se menţin apoi în baia de termostatare la 36ºC timp de 2 ore. Suspensia
levurică se prepară în soluţie salină fiziologică, densitatea acesteia ajustându-se la 0,5
Mc Farland (cca. 10
5
-10
6
celule/ml). După expirarea celor 2 ore, fiolele se agită şi din
fiecare amestec se prelevează un volum de 25 µl care se etalează apoi între lamă şi
lamelă. Preparatul extemporaneu astfel obţinut se examinează la microscop în vederea
decelării tubilor germinativi caracteristici tulpinilor de Candida albicans şi Candida
dubliniensis – filamente scurte care emerg din blastospor fără ştrangulare (fig. nr. 8-11,
vezi Anexa). Ca martor al filamentării, se utilizează de fiecare dată o tulpină-tip de
Candida albicans. Se va avea în vedere că şi alte levuri pot produce formaţiuni
similare de tipul pseudofilamentelor, însă ele se diferenţiază de adevăraţii tubi
germinativi prin existenţa unei ştrangulări la locul de emergenţă din blastospor.

Precauţii
Nu se recomandă suspensionarea levurilor direct în mediul de blasteză,
deoarece concentraţia mare a acestora pe unitatea de volum scade sensibilitatea reacţiei
prin diminuarea drastică a numărului de celule care vor produce tubi germinativi.
Nivelul rezultatelor fals negative este în mod normal de cca. 5%, însă el tinde să
crească odată cu mărirea densităţii suspensiei levurice.

Teste biochimice şi fiziologice


186

8.14. Testul de termotoleranţă / termostimulare

Scop
Testul este folosit în special pentru diferenţierea speciilor de dermatofiţi, dar
este aplicabil şi în cazul altor fungi filamentoşi sau levuriformi. Are la bază faptul că
unele specii de dermatofiţi tolerează temperatura de 37°C pentru dezvoltare (E.
floccosum, T. mentagrophytes, T. rubrum, T. schoenleinii, T. tonsurans, T. verrucosum,
T. violaceum), altele nu (T. ajelloi, T. terrestre etc.); în plus, pentru unele specii (T.
verrucosum, T. soudanense), temperatura de 37°C acţionează chiar stimulativ asupra
dezvoltării coloniilor comparativ cu temperaturile mai scăzute (25°C, 30°C).

Tehnică de lucru
În vederea studierii acestor caracteristici, se însămânţează perechi de tuburi
conţinând Agar Sabouraud solidificat în pantă cu tulpinile în cauză şi se incubează
diferenţiat la 25° sau 30°C şi 37°C (în cazul dermatofiţilor), la 30°C, 37°C, 40°C, 42°C
şi 45°C (în cazul levurilor) şi la 30°C, 37°C, 40°C, 42°C, 45°C, 52°C şi 54°C (în cazul
fungilor filamentoşi) . Interpretarea testului se realizează în momentul când coloniile
ajung la maturitate pe mediile incubate la temperatura cea mai scăzută (25°-30°C sau
37°C). Principalele aspecte privind permisivitatea dezvoltării la aceste temperaturi în
cazul unor specii de fungi de interes clinic sunt prezentate în tabelul 8-3.




























Mihai Mareş, Olimpia Bazgan


187
C
a
p
i
t
o
l
u
l
 
8
 
Tabelul 8-3
Comportamentul diverselor specii de fungi la testul de termotoleranţă
Nr. crt. Specia 37°C 40°C 42°C 45°C 52°C 54°C
1 Absidia corymbifera + + + + + -
2 Cunninghamella bertholletiae + + + + + -
3 Mucor circinelloides + - - + - -
4 Mucor indicus + + + - - -
5 Rhizomucor variabilis + - - - - -
6 Rhizomucor pussilus + + + - - +
7 Rhizomucor miehei + + + + + +
8 Rhizopus azygosporus + + + + + -
9 Rhizopus microsporus + + + + - -
10 Rhizopus oryzae + + ? + + -
11 Saksenaea vasiformis + + + - - -
12 Syncephalastrum racemosum + + - - - -
13 Malassezia furfur + + - - - -
14 Malassezia pachydermatis + + - - - -
15 Malassezia sloofiae + + - - - -
16 Malassezia sympodialis + + - - - -
17 Arxiozyma telluris + + - - - -
18 Candida albicans + + + + - -
19 Candida chiropterorum + + - - - -
20 Candida dubliniensis + + + - - -
21 Candida glabrata + + + - - -
22 Candida kefyr + + - - - -
23 Candida krusei + + - - - -
24 Candida lusitaniae + + + - - -
25 Candida tropicalis + + - - - -
26 Geotrichum capitatum + + - - - -
27 Pseudoalescheria boydii + - - - -
28 Acremonium alabamense + + + + - -
29 Coccidioides immitis + + + - - -
30 Cladophialophora arxii + + - - - -
31 Cladophialophora bantiana + + - - - -
32 Emmonsia parva + + - - -
33 Epidermophyton floccosum + - - - - -
34 Exophiala dermatitidis + + - - - -
35 Trichophyton mentagrophytes + - - - - -
36 Trichophyton rubrum + - - - - -
37 Trichophyton schoenleinii + - - - - -
38 Trichophyton tonsurans + - - - - -
39 Trichophyton verrucosum + - - - - -
40 Trichophyton violaceum + - - - - -
41 Scedosporium prolificans + + - - - -
42 Sporothichum pruinosum + + + + - -
43 Aspergillus fumigatus + + + + v v
44 Bipolaris specifera + + - - - -
Legendă: + (dezvoltare normală), ? (nu sunt date disponibile), v (răspuns variabil), - (absenţa dezvoltării)
Teste biochimice şi fiziologice


188
Bibliografie selectivă

1. Artal M E (2004) - Diagnóstico histopatológico de las micosis; Rev
Iberoam Micol; 21:1-9.
2. Barnett J A, Payne R W, Yarrow D (2000) - Yeasts: Characteristics and
Identification; 3
nd
edition; Cambridge University Press; Cambridge.
3. Bosnea D, Diaconescu V, Colar L et al. (2003) - Particularităţile izolatelor
din hemoculturi la Centrul de Cardiologie Iaşi (2001-2003); Rev Med
Chir; 107-3(Supl.1):176-179.
4. Buiuc D (1998) - Microbiologie clinică; Ed. Didactică şi Pedagogică RA;
Bucureşti.
5. Buiuc D, Neguţ M (1999) - Tratat de microbiologie clinică; Ed. Medicală;
Bucureşri.
6. Coman I, Mareş M (2000) - Micologie medicală aplicată; Ed. Junimea;
Iaşi.
7. Fidel P L, Vazquez J A, Sobel J D (1999) - Candida glabrata: review of
epidemiology, pathogenesis and clinical disease with comparison to
Candida albicans; Clin Microbiol Rev ; 12(1):80-96.
8. Freydière A-M, Guinet R (1997) - Rapid methods for identification of the
most frequent clinical yeasts; Rev Iberoam Micol; 14:85-89.
9. Giammanco G M, Pizzo G, Pecorella S, Distefano S, Pecoraro V, Milici M
(2002) - Identification of Candida dubliniensis among oral yeastisolates
from an Italian population of human immunodeficiency virus-infected
(HIV+) subjects; Oral Microbiol Immunol; 17:89-94.
10. Golăescu M (1997) - Diagnosticul şi tratamentul micozelor interne; Ed.
Viaţa Medicală Românească; Bucureşti.
11. Gorka B Z (2002) - Vulvovaginitis candidiasica; Rev Iberoam Micol;
19:22-24.
12. Grillot R (1996) - Les mycoses humaines – démarche diagnostique;
Elsevier; Paris.
13. Hazen K C, Howell S A (2003) - Candida, Cryptococcus and other yeasts
of medical importance; In Murray P (ed.) - Manual of clinical
microbiology; 8
th
edition.; ASM Press; Washington.
14. Hoog G S de, Guarro J (1995) - Atlas of clinical fungi; Centraalbureau
voor Schimmelcultures; Baarn.
15. Hoog G S de, Guarro J, Gené J, Figueras M J (2000) - Atlas of clinical
fungi; 2
nd
edition; Centraalbureau voor Schimmelcultures / Universitat
Rovira i Virgili.
16. Jabra-Rizk M A, Ferreira S M S, Sabet M et al.(2001) - Recovery of
Candida dubliniensis and other yeasts from human immunodeficiecy
virus-associated periodontal lesions; J Clin Microbiol ; 39(12):4520-4522.
17. Ribes J A, Vanover-Sams C L, Baker D J (2000) - Zygomycetes in Human
Disease; Clin Microbiol Rev; 13(2):236-301.
18. Salkin I F, Gordon M, Samsonoff W, Rieder C (1985) - Blastoschizomyces
capitatus, a new combination; Mycotaxon; 22:375-380.
Mihai Mareş, Olimpia Bazgan


189
C
a
p
i
t
o
l
u
l
 
8
 
19. Samaranayake Y H, Samaranayake L P (1994) - Candida krusei: biology,
epidemiology, pathogenicity and clinical manifestations of an emerging
pathogen; J Med Microbiol; 41:295-310.
20. Silva V, Cabrera M, Diaz C M, Abarca C, German H (2003 a) -
Prevalencia de serotipos de Candida albicans en aislamientos de
hemocultivo en Chile y primer caso de candidemia por Candida
dubliniensis; Rev Iberoam Micol; 20:46-51.
21. Silva V, Zepeda G (2003 b) - First chilean report of nosocomial urinary
tract infection due to Trichosporon asahii, in 2 patients; Rev Med Chil;
131(4):461-463.
22. Smith A (2004) - Identifying Candida species - An increasing cause of
serious systemic infections; Eur Clin Lab; 23(6):12-15.
23. Sullivan D J, Westerneng T J, Haynes K A, Bennett D E, Coleman D C
(1995) - Candida dubliniensis sp. nov: phenothypic and molecular
characterisation of a novel species associated with oral candidosis in HIV-
infected individuals; Microbiol; 141:1507-1521.
24. Sullivan D, Moran G, Donnelly S, Gee S, Pinjon E et al. (1999) - Candida
dubliniensis: An update; Rev Iberoam Micol; 16:72-76.
25. Sutton D A, Fothergill A W, Rinaldi M G (1998) - Guide to clinically
significant fungi; Williams & Wilkins; Baltimore.
26. Warren G, Hazen K C (1995) - „Candida, Cryptococcus and other yeasts
of medical importance” în Fromtling R A - Mycology; VII
th
section;
Murray P R, Baron E J, Pfaller M A, Tenover F C, Yolken R A (eds.):
Manual of Clinical Microbiology; VI
th
ed.; ASM Press; Washington DC.




















Mihai Mareş


191
C
a
p
i
t
o
l
u
l
 
9
 



Mihai Mareş

9.1. Extracţia ADN-ului pentru PCR

e preferă folosirea kit-urilor comercializate (e.g. High Pure PCR Template
Preparation Kit, Roche Diagnostics GmbH, Mannheim, Germany)
metodelor artizanale de extracţie a ADN-ului. Recomandabil este ca fiecare laborator
să se familiarizeze şi să folosească de rutină unul, cel mult două metode / kit-uri de
extracţie.

9.2. Extracţia ADN-ului cu ajutorul kit-ului
High Pure Template Preparation Kit (levuri)

Principiul metodei
Reactivii acestui kit permit lizarea celulelor într-o scurtă perioadă de timp de
coincubare cu proteinaza K, în prezenţa unui inactivator al nucleazelor (guanidina
hidroclorică). Acizii nucleici precipită şi aderă la suprafaţa unor fibre de sticlă
existente într-un microtub, ceea ce ulterior va permite prezervarea lor în timpul
operaţiunilor de spălare-centrifugare destinate îndepărtării moleculelor indezirabile. Nu
sunt necesare precipitări sau extracţii suplimentare cu solvenţi organici.

Etape

1) din cultura tulpinii levurice (pe medii solide uzuale, veche de 24-48 ore)
se prelevează o ansă de 10 µl bine încărcată (aproximativ 10
8
- 10
9
celule);
2) se suspensionează levurile prelevate într-un ml apă purificată / distilată
sterilizată;
3) se centrifughează suspensia obţinută 5 minute la 10000 rpm;
4) se îndepărtează supernatantul, apoi se adaugă peste sediment 200 µl
Tissue lysis buffer (TLB);
5) se adaugă 40 µl proteinază K;
6) se vortexează energic;
7) se incubează la 55ºC timp de 30 de minute;
8) se centrifughează imediat pentru a readuce în supernatant picăturile de
condens apărute pe buşon;
9) se adaugă 200 µl Lyis Binding Buffer (LBB);
S
9
Tehnici de micologie moleculară
Tehnici de micologie moleculară


192
10) se vortexează;
11) se incubează la 70ºC timp de 15 minute;
12) se repetă etapa nr. 8;
13) se adaugă 100 µl izopropanol;
14) se vortexează;
15) se transferă în microcoloană (disponibilă în kit);
16) se centrifughează 1 minut la 8000 rpm;
17) se înlocuieşte tubul colector pentru microcoloană;
18) se adaugă 450 µl Inhibitor Removal Buffer;
19) se centrifughează 1 minut la 8000 rpm;
20) se repetă etapa nr. 17;
21) se adaugă 450 µl Washing Buffer;
22) se centrifughează 2 minute la 13000 - 14000 rpm;
23) se aşează microcoloana pe un tub Eppendorf de 1,5 ml;
24) se adaugă exact în centrul microcoloanei 50 µl Elution Buffer preîncălzit
la 70ºC;
25) se centrifughează 1 minut la 8000 rpm;
26) se marchează corespunzător şi se păstrează la + 4ºC.

9.3. Extracţia ADN-ului prin crioprecipitare (fungi filamentoşi)

Principiul metodei
Celulele sunt lizate cu ajutorul cloroformului, după care ADN-ul este precipitat
prin menţinerea la temperaturi scăzute.

Etape

1) într-un tub Eppendorf de 1 ml capacitate, conţinând 40-100 mg Kieselgel-
2, se introduc 300 µl CTAB buffer;
2) se adaugă apoi cu ajutorul unei spatule, o mică porţiune din colonia de
analizat, care se fragmentează în porţiuni cât mai mici;
3) se adaugă 200 µl CTAB buffer;
4) se vortexează;
5) se incubează la 65ºC, timp de 10 minute;
6) se adaugă 500 µl cloroform;
7) se vortexează;
8) se centrifughează 5 minute la 14000 rpm;
9) se transferă stratul superior într-un nou tub Eppendorf;
10) se adaugă un volum dublu (aprox. 800 µl) de alcool etilic absolut prerăcit
(+ 4ºC);
11) se agită uşor;
12) se menţine amestecul la – 20ºC, minim 30 minute (chiar şi până a II-a zi),
pentru precipitarea ADN-ului;
13) se centrifughează 5-10 minute la 14000 rpm;
14) se lasă în repaus pentru decantare;
15) se spală precipitatul cu alcool etilic 70% rece;
Mihai Mareş


193
C
a
p
i
t
o
l
u
l
 
9
 
16) se usucă timp de 10 minute într-o instalaţie de vacuum;
17) se resuspendă precipitatul în 97,5 µl TE buffer cu 2,5 µl ribonuclează.

9.4. Controlul calităţii acizilor nucleici extraşi

Indicaţii
Confirmarea calităţii acizilor nucleici obţinuţi în urma extracţiei şi a lipsei
degradării acestora

Metoda
Electroforeză în gel de agaroză

Etape

1 - Prepararea gelului de agaroză 1% în TAE 1x
a) se adaugă pulberea de agar în soluţia TAE, apoi se încălzeşte amestecul pe
o plită electromagnetică sau într-un cuptor cu microunde până la
solubilizarea totală;
b) se răceşte câteva minute sub agitare continuă;
c) se toarnă gelul în suport, evitând formarea de bule care pot afecta
migrarea ADN-ului şi se lasă în repaus până la solidificarea sa completă.
2 - Pregătirea probelor de ADN şi a markerilor de greutate moleculară
a) probe: 10 µl extract ADN + 2 µl albastru de bromfenol 2x;
b) markeri de greutate moleculară (500 µg/ml):
1 µl marker 1 kb + 9 µl apă distilată sterilă + 2 µl albastru de
bromfenol 6 x;
c) pipetarea probelor de ADN şi a markerilor de greutate moleculară pe linia
de start a gelului de agaroză (12 µl);
3 - Electroforeza : ca tampon se foloseşte TBE 0,5x, iar migrarea va dura 20 minute la
100 V;
4 - Colorarea: după încheierea migrării, blocul de gel se imersionează timp de cel puţin
15 minute într-o baie de colorare conţinând bromură de etidiu în TAE 1x (10
µg/ml).
Atenţie !!! Bromura de etidiu este o substanţă cu potenţial carcinogen. Se va
manipula doar cu mănuşi de protecţie !
5 - Vizualizarea gelului în lumină ultravioletă (folosind un transluminator) şi
fotografierea acestuia; ADN-ul de calitate se prezintă sub forma unei benzi
compacte, cu greutate moleculară mare (fig. nr. 9-1)
Tehnici de micologie moleculară


194

Fig. nr. 9-1 Controlul calităţii ADN-ului


9.5. Identificarea speciei Candida dubliniensis prin PCR duplex

Diferenţierea cu acurateţe a speciilor Candida albicans şi Candida dubliniensis
exclusiv pe baza caracterelor fenotipice este discutabilă datorită rezultatelor
inconstante. În vederea identificării corecte a speciei Candida dubliniensis, este
preferabilă, pentru siguranţa şi expeditivitatea ei, o tehnică de biologie moleculară care
presupune folosirea a două perechi de primeri (amorse): una de amorse specifice unui
intron al genei codante pentru actină (DUBF / DUBR) şi alta de amorse universale
pentru ADN-ul ribozomal (ITS1 / ITS4). Dintre cele două specii amintite, doar
Candida dubliniensis generează în urma amplificării două benzi - una de 288 perechi
de baze (pb) cu setul DUBF / DUBR şi una de cca. 600 pb, cu amorsele universale (fig.
nr. 9-2). Candida albicans va genera o singură bandă, pe cea de 600 pb, cu amorsele
universale.

ITS 1: 5´TCCTGAGGTGAACCTGCGG3´
ITS 4: 5´TCCTCCGCTTATTGATATGC3´
DUBF: 5´GTATTTGTCGTTCCCCTTTC3´ (nucleotidele 251-270)
DUBR: 5´GTGTTGTGTGCACTAACGTC3´ (nucleotidele 519-538)

Reactivi necesari

- ADN Candida albicans (martor pozitiv 1)
- ADN Candida dubliniensis (martor pozitiv 2)
- ADN-ul tulpinii de identificat
- soluţii stock ale reactivilor destinaţi PCR
- apă purificată (martor negativ)
Mihai Mareş


195
C
a
p
i
t
o
l
u
l
 
9
 

Fig. nr. 9-2 Aspectul celor două tipuri de
benzi după developarea gelului de agaroză în
bromură de etidiu şi fotografiere în UV; în
ordine, de la stânga la dreapta: Candida
albicans – martor, Candida dubliniensis –
martor şi o tulpină de identificat (1B5D - C.
dubliniensis).

Mod de lucru

1 - Se calculează cantităţile de reactivi necesare preparării mixului (conform
tabelului 9-1) având în vedere cele patru eşantioane ce vor fi folosite (martor
pozitiv 1, martor pozitiv 2, martor negativ, proba de testat). Se vor adăuga în
plus cantităţile de reactivi necesare pentru încă un eşantion, astfel încât în
momemtul divizării mix-ului, cantităţile necesare pentru cele patru eşantioane să
fie suficiente.
Tabelul 9-1
Prepararea mixului
Număr de eşantioane: 4+1
MIX Volum / eşantion (µl) Volum / Mix (µl)
PCR Buffer 10x 2 10
MgCl
2
25 Mm 2 10
dTTP, dATP, dCTP, dGTP 2,5 mM 2 10
Amorse
DUBF (20 µM) 0,5 2,5
DUBR (20 µM) 0,5 2,5
ITS 1 (20 µM) 0,5 2,5
ITS 4 (20 µM) 0,5 2,5
Amplitaq gold
5 U/µl
0,25 1,25
Apă purificată
ad 20 µl
10,5 52,5
ADN 1 µl

Tehnici de micologie moleculară


196
2. Se decongelează reactivii (cu excepţia Amplitaq gold) şi se menţin la gheaţă
până la utilizare;
3. Se prepară mixul, se adaugă enzima şi apoi se vortexează;
4. Se distribuie mixul în tuburi PCR de 0,2 ml;
5. Se adaugă:
- 1 µl ADN Candida albicans în eşantionul pentru martorul pozitiv 1;
- 1 µl ADN Candida dubliniensis în eşantionul pentru martorul pozitiv 2;
- 1 µl ADN tulpină de identificat în eşantionul probei de testat;
- 1 µl apă purificată în eşantionul martorului negativ.
6. Se introduc tuburile în thermocycler şi se supun următorului regim termic:
50ºC/5 minute
95ºC/ 10 minute

apoi, 94ºC/ 30 sec.
58ºC/ 30 sec.
72ºC/ 30 sec.

30 cicluri


apoi, 72ºC/ 10 minute

7. După încheierea amplificării, eşantioanele se menţin la + 4ºC până la
vizualizarea pe gel de agaroză.


9.6. Identificarea moleculară a levurilor prin PCR
şi secvenţializarea regiunilor ITS

Reactivii necesari acestei tehnici constau în:
- matricea ADN care conţine regiunea de amplificat (în cazul de faţă :
ITS 1 şi ITS 4 din cadrul ADN-ului codant al ARN-ului ribozomal);
- doi primeri (amorse) specifici care identifică începutul şi sfârşitul
regiunii de amplificat;
- ADN-polimeraza care copie regiunea de amplificat;
- nucleotide, cu ajutorul cărora ADN-polimeraza va genera noul ADN;
- soluţia tampon care asigură condiţiile de reacţie necesare activităţii
ADN-polimerazei;

Primeri pentru regiunile ITS

ITS 1 : 5´-TCC GTA GGT GAA CCT GCGG (3´)
ITS 4 : 5´-TCC TCC GCT TAT TGA TAT GC (3´)
ITS 5: 5´-GGA AGT AAA GTC GTA ACA AGG (3´)
LR6: 5´-CGC CAG TTC TGC TTA CC (3´)
V9D: 5´-TTA AGT CCC TGC CCT TTG TA (3´)
LS266: 5´- GCA TTC CCA AAC AAC TCG ACTC (3´)


Mihai Mareş


197
C
a
p
i
t
o
l
u
l
 
9
 


Tehnica de lucru

1. Se decongelează reactivii necesari (cu excepţia enzimei Taq) şi apoi se menţin la
gheaţă până în momentul utilizării;
2. Se calculează cantităţile necesare pentru amplificarea numărului de eşantioane
luate în lucru (conform tabelului 9-2), adăugând totdeauna un supliment pentru
un eşantion în plus (în vederea suplinirii pierderilor din timpul pipetării
ulterioare a mix-ului). Volumul final al fiecărui eşantion va fi de 50 µl. Astfel,
dacă avem doar o singură probă de ADN pentru identificare, vom pregăti un
mix pentru 3+1 eşantioane: proba ADN pentru identificare, un martor pozitiv,
un martor negativ şi un eşantion suplimentar; în cazul a două probe pentru
identificare: 4+1 ş.a.m.d.

Tabelul 9-2
Prepararea mixului
Reactivi
Volum/eşantion
(µl)
Volum/ total mix (µl)
Concentraţia
finală
Tampon PCR 10x 5 (nr. eşantion+supliment)x5 1x
MgCl
2
25 mM 5 (nr. eşantion+ supliment)x5 2,5 mM
dNTP 2,5 mM 5 (nr. eşantion+ supliment)x5 0,25 mM
Primer ITS 1 20µM
sau primer V9D 20
µM
1,25
(nr. eşantion+
supliment)x1,25
25 p mol
Primer ITS 4 20 µM
sau primer LS 266
20 µM
1,25
(nr. eşantion+ supliment)x
1,25
25 p mol
Amplitaq Gold 5U/
µl
0,25
(nr. eşantion+
supliment)x0,25
1,25 U
Apă distilată sterilă
ad 45 µl
27,25
(nr. eşantion+
supliment)x27,25
-
ADN * 5 µl -
* fiecare eşantion cu ADN-ul său, exceptând martorul negativ şi eşantionul
suplimentar

3. Se vortexează mix-ul şi se repartizează câte 45 µl în tuburi PCR cu volum de
0,2 ml;
4. Se adaugă în fiecare tub (martor pozitiv, probe de analizat) 5 µl ADN,
omogenizând apoi conţinutul cu ajutorul pipetei;
5. Se plasează tuburile în thermocycler şi se supun următorului regim termic:
95ºC/ 10 min
apoi, 94ºC/ 30 sec.
58ºC/ 30 sec.
72ºC/ 30 sec.

30 cicluri
apoi, 72ºC/ 10 min.
Tehnici de micologie moleculară


198

6. Purificarea produşilor PCR obţinuţi, cu ajutorul kit-urilor comercializate (de tip
QIAquick, Qiogen)
Această etapă este necesară pentru îndepărtarea primerilor, nucleotidelor,
enzimelor, sărurilor, agarozei, bromurii de etidiu şi a altor impurităţi restante în
eşantioanelor de ADN şi obţinerea în stare pură a regiunilor amplificate prin PCR.
- se transferă produşii de PCR într-un tub Eppendorf de 1,5 ml;
- se adaugă un volum de 5 ori mai mare de tampon PB şi se omogenizează (225 µl
tampon PB pentru 45 µl);
- se introduce amestecul într-o coloană QIAquick;
- se centrifughează apoi timp de 30-60 sec la 13000 rpm pentru fixarea ADN-ului
pe coloană;
- se îndepărtează faza lichidă, plasându-se coloana pe acelaşi tub colector;
- se spală ADN-ul fixat pe coloană adăugând 0,75 ml tampon PE şi se
centrifughează apoi 30-60 sec la 13000 rpm;
- se îndepărtează lichidul şi se recentrifughează;
- se aşează coloana pe un tub Eppendorf de 1,5 ml;
- se eluează ADN-ul prin depunerea strictă în centrul membranei a 50 µl tampon
EB (10 mM Tris Cl, pH 8,5);
- se menţine 1 minut la temperatura camerei;
- se centrifughează 1 minut la 13000 rpm;
7. Verificarea produşilor de PCR prin migrare în gel de agaroză.
Precizări importante
- gel de agaroză 3% în TAE 1x;
- eşantioanele ce urmează a fi pipetate se compun din 5 µl produs PCR şi 2 µl
albastru de bromfenol;
- martorii de greutate moleculară ce urmează a fi co-pipetaţi (500 µg/ml) se prepară
din 1 µl marker 100 pb, 9 µl apă distilată sterilă şi 2 µl albastru de bromfenol
6x;
- migrare timp de o oră la 100 V;
- developare în baie cu bromură de etidiu, timp de minim 15 minute;
- vizualizarea gelului în lumină UV (la transluminator şi fotografierea benzilor de
ADN).
8. Secvenţializarea fragmentelor de ADN amplificate prin PCR (de preferat
utilizând un secvenţializator de tip BigDye – Perkin Elmer, SUA)
9.Analiza secvenţelor cu ajutorul unui soft specializat (e.g. CHROMAS – fig. nr.
9-3) şi compararea cu secvenţele dintr-o bază de date în vederea detectării
speciilor cu un înalt grad de omologie a secvenţelor. Sistemul BLAST (Basic
Local Alignment Search Tool) (fig. nr. 9-4) şi baza de date GenBank a National
Center for Biotechnology Information (NCBI) - Bethesda (SUA) sunt cele mai
utilizate mijloace pentru identificarea fungilor (adresa URL:
www.ncbi.nlm.nih.gov/blast).
Mihai Mareş


199
C
a
p
i
t
o
l
u
l
 
9
 


Fig. nr. 9-3. Interfaţa de lucru a software-ului CHROMAS



Fig. nr. 9-4. Pagina de lucru pentru analiza secvenţelor de ADN








Tehnici de micologie moleculară


200


9.7. Reactivi utilizaţi în tehnicile de biologie moleculară


- CTAB tampon

Tris ............................................ 2,42 g
Clorură de sodiu .......................... 8,2 g
EDTA sodic .............................. 0,74 g
Bromură de cetil-amoniu ............ 2,0 g
Apă bidistilată .......................... 100 ml


Se ajustează pH-ul la valoarea 7,5
cu ajutorul unei soluţii HCl 1N.
Se autoclavează 15 minute la
121°C. Se păstrează la temperatura camerei.

- Proteinaza K

Proteinază K .......................... 10 U/ml
Tris (pH 7,4) .............................. 0,24 g
Clorură de calciu dihidrat ........ 3,0 mg
Apă bidistilată .......................... 100 ml

Se sterilizează prin filtrare şi se
păstrează în fiole la -20°C.

- TAE tampon 50x (Tris-acetate
EDTA buffer 50x)

Tris-HCl ...................................... 240 g
Acid acetic glacial .................. 57,1 ml
EDTA disodic 0,5 M ............... 100 ml
Apă bidistilată ................... ad 1000 ml

Se sterilizează prin autoclavare timp
de 15 minute la 121°C. Se stochează la
temperatura camerei. Se diluează cu apă
bidistilată în momentul folosirii.





- TE tampon (Tris-EDTA buffer)

Tris ............................................ 0,12 g
Na-EDTA .................................. 0.04 g
Apă bidistilată ..................... ad 100 ml

Se ajustează pH-ul la valoarea 8,0 cu
soluţie NaCl 1 N. Se sterilizează prin
autoclavare timp de 15 minute la 121°C. Se
stochează la temperatura camerei.

- TBE tampon (Tris Borate ETDA
buffer)

Tris ............................................ 108 g
Acid boric ..................................... 55 g
EDTA tetrasodic ......................... 9,3 g
Apă bidistilată ................... ad 1000 ml
pH 8,3

- PB tampon (Phosphate Buffer 0,2 M)

Fosfat disodic anhidru ............... 21,8 g
Fosfat monosodic anhidru ........... 6,4 g
Apă bidistilată .................. ad 1000 ml

Se ajustează pH-ul la 7,4; se
stochează la temperatura camerei.

- PE tampon (Phosphate Elution
Buffer)

Constă într-o soluţie 4mM de fosfat
monopotasic care se prepară prin diluarea cu
apă bidistilată a unei soluţii stoc de fosfat
monopotasic 1M.




Mihai Mareş


201
C
a
p
i
t
o
l
u
l
 
9
 
Bibliografie selectivă

1. Donnely S M, Sullivan D J, Shanley D B, Coleman D C (1999) - Phylogenetic
analysis and rapid identification of Candida dubliniensis based on analysis of
ACT 1 intron and exon sequences; Microbiol; 145(8):1871-1882.
2. Hoog de G S, Guarro J, Gené, Figueras M J (2000) - Atlas of clinical fungi; 2
nd

edition ; Centraalbureau voor Schimmelcultures / Universitat Rovira i Virgili.
3. Kawasaki M, Aoki M (2006) - Application of molecular biological techniques to
medical mycology; In Topley & Wilson’s, Microbiology and Microbial
Infections 10
th
edition; Hodder Arnold.
4. Kurtzman C P, Boekhout T, Robert V, Fell W, Deak T (2003) - Methods to
identify yeasts; In: Boekhout T, Robert V (eds) - Yeasts in Food; B.Behr’s
Verlag GmbH & Co; Hamburg; Germany.
5. Peman J, Martin-Mazuelos E, Rubio Calvo M C (eds) (2001) - Guia Practica de
Identificacion y Diagnostico en Micologia Clinica; Rev Iberoam Micol; Bilbaos.































Mihai Mareş


203
C
a
p
i
t
o
l
u
l
 
1
0
 





Mihai Mareş

Tabelul 10-1
Codul şi intervalul concentraţiilor de antifungic al benzilor E-test
(AB Biodisk, Solna-Suedia)

Cod Denumire antifungic Intervalul concentraţiilor
(µm /ml)
AP Amfotericină B 0,002 – 32
FC 5 Flucitozină 0,002 – 32
FL Fluconazol 0,016 – 256
IT Itraconazol 0,002 – 32
VO Voriconazol 0,002 – 32
CS Caspofungină 0,002 – 32
POS Posaconazol 0,002 - 32

10.1. Tehnica de lucru pentru levuri
(fungi din genurile Candida, Cryptococcus, Rhodotorula, Trichosporon)

1 - Prepararea inoculului
Pornind de la culturi efectuate pe Agar Sabouraud sau PDA, vechi de 24 ore
(Candida spp.) sau 48-72 ore (Cryptococcus neoformans) se prepară o suspensie în ser
fiziologic sterilizat utilizând ansa microbiologică.
Densitatea suspensiei se ajustează la valoarea 0,5 McFarland pentru levurile genului
Candida şi 1 McFarland în cazul tulpinilor de C.neoformans.
2 - Însămânţarea mediului
Ca mediu de testare se foloseşte Agar RPMI – MOPS – glucoză 2%, cu grosime de 4
± 0,5 mm. În cazul amfotericinei B, pentru depistarea cu acurateţe a rezistenţei este
recomandat mediul AM3.
În vederea însămânţării mediului, se depun în centrul plăcii cca. 200 µl inocul (pentru
cele cu ø 90 mm) sau 400 µl (pentru cele cu ø 150 mm). Inoculul se dispersează apoi în trei
direcţii cu ajutorul unui tampon. Plăcile se lasă în repaus la 35°C timp de 10–15 minute,
10
Tehnici de evaluare a sensibilităţii la
antifungice
Tehnici de evaluare a sensibilităţii la antifungice


204
pentru uscarea suprafeţei mediului (o alternativă ar fi expunerea suprafeţei mediului la fluxul
de aer laminar dintr-o hotă microbiologică cls. II).
3 - Alegerea antifungicelor
În funcţie de tulpinile testate vom alege benzile E-test cu antifungice (tabelul 10-2).

Tabelul 10-2
Alegerea antifungicelor pentru testare
Trichosporon spp. Candida spp. Cryptococcus spp. Rhodotorula spp.
AP (CMI-uri
obişnuit crescute)
FL
IT
VO
AP
CS (frecvent CMI-uri
crescute pentru
C.parapsilosis)
FC
FL (rezistenţă
primară pentru
C.krusei)
IT
VO
AP
FL
VO
AP
FL(frecvent CMI-uri
crescute)
IT
VO

4 - Aplicarea benzilor E-test
- Numărul optim al benzilor ce vor fi aplicate este de 5/placă ø 150 mm şi 1/placă ø
90 mm, dispuse radiar, concentraţia maximă fiind plasată excentric;
- Benzile se stochează la -20°C şi se lasă la temperatura camerei 15 – 20 de minute,
înainte de a fi utilizate;
- Benzile se pot aplica cu ajutorul unei pense, cu aplicatorul manual, cu stiloul
vacuumatic Nema C88 sau cu aplicatorul automat Simplex C76. După aplicare, se verifică
contactul între benzi şi mediu, eliminând prin presare eventualele bule de gaz;
- Benzile se aplică cu scala gradată înspre capacul plăcii şi cu concentraţia maximă
spre periferia acesteia;
- Odată aplicate, benzile nu se mişcă.
5 - Incubarea plăcilor se face cu capacul în jos, timp de 24-48 ore (Candida spp.) şi 48-72 de
ore (C.neoformans).
6 - Citirea concentraţiei minime inhibitorii (CMI) se face luând în considerare punctul în care
elipsa zonei de inhibiţie intersectează banda E-test.

Reguli de citire a CMI în cazul levurilor

- AP: se va ţine cont de toate coloniile ; citire la 100% inhibiţie (fig. nr. 10-1);
- FL, IT, VO: citire la 80 % inhibiţie; se ţine cont de prima schimbare în modul de creştere a
coloniilor (diminuarea dimensiunilor acestora). Nu se va ţine cont de microcolonii (chiar
semiconfluente) care pot apare în interiorul zonei de inhibiţie. În schimb, dacă sunt prezente
macrocolonii – ele semnifică heterorezistenţă (prezenţa unei clone rezistente pe lângă cea
sensibilă) şi se va raporta CMI-ul maxim (fig. nr. 10-2);
Atenţie! Plăcile se citesc sistematic la 24 şi 48 de ore.
- FC: citire la 90- 95 % inhibiţie. Nu se ţine cont de microcoloniile ce pot apare la periferia
zonei de inhibiţie (fig. nr. 10-3);
Mihai Mareş


205
C
a
p
i
t
o
l
u
l
 
1
0
 
- CS : citire la 100 % inhibiţie. Poate apare uneori efecul paradoxal de creştere - microcolonii
în jurul concentraţiilor maxime: nu va fi luat în considerare la lectura CMI (fig. nr. 10-4);
În cazul asimetriilor (concentraţii diferite pe cele două laturi ale benzii E-test) se va raporta
drept CMI concentraţia cea mai mare.




Fig. nr. 10-1. Aspectul zonei de inhibiţie în
cazul AP (CMI: 0,064 mg/l)



















Fig. nr. 10-2. Aspectul zonei de inhibiţie în
cazul FC (CMI: 0,064 mg/l)


Tehnici de evaluare a sensibilităţii la antifungice


206


Fig. nr. 10-3. Aspectul zonei de inhibiţie
în cazul unei tulpini de C. krusei
(rezistenţă la FL); CMI: > 256 mg/l




Fig. nr. 10-4. Aspectul zonei de inhibiţie
în cazul CS (CMI: 0,094 mg/l)

10.2. Tehnica de lucru pentru fungi filamentoşi
(fungi din genurile Aspergillus, Fusarium, Rhizopus, Scedosporium)

1- Prepararea inoculului
Peste culturile de 5-7 zile dezvoltate pe SDA sau PDA înclinat, se adaugă 1-2
ml ser fiziologic steril şi cu ajutorul unei pipete Pasteur sau anse microbiologice se
realizează o suspensie de spori şi hife care se transferă într-un tub steril. Acesta se
vortexează uşor şi apoi se lasă în repaus cca. 15-20 minute pentru sedimentarea
particulelor grosiere. După expirarea acestui interval de timp, supernatantul se
recuperează şi se transferă în alt tub steril. Turbiditatea acestuia se ajustează cu ser
fiziologic la 0,5 McFarland sau se corectează astfel încât să se obţină o transmitanţă de
cca. 70% prin citire la spectrofotometru (530 nm). Concentraţia obţinută va fi de cca.
10
6
UFC/ml inocul.
2- Inocularea plăcilor
Se realizează în mod similar celui prezentat pentru levuri.
3- Alegerea antifungicelor (tabelul 10-3)






Mihai Mareş


207
C
a
p
i
t
o
l
u
l
 
1
0
 
Tabelul 10-3
Alegerea antifungicelor pentru testare
Aspergillus spp. Fusarium spp. Rhizopus spp. Scedosporium spp.
AP (A.terreus
rezistenţă primară)
CS
IT
POS
VO
AP
VO
POS
AP
POS
CS
*
POS
*
VOR
*
*doar pentru S. apiospermum şi S.aurantiacum

4 - Aplicarea benzilor E-test
Se realizează în mod similar celui prezentat la levuri.
5 - Incubarea plăcilor
Se realizează la 35°C timp de 24-48-72 de ore în funcţie de dinamica dezvoltării
fiecărei tulpini. Pentru tulpinile de Fusarium spp. plăcile se incubează la 35°C timp de
24-48 de ore, apoi se menţin la 25°C pentru 24-48 ore în vederea clarificării CMI.
6 - Citirea CMI:
- Rhizopus spp. - la 18-24 ore;
- celelalte specii- 24-48 (chiar 72 ore pentru tulpinile cu creştere lentă) .

Reguli de citire a CMI în cazul fungilor filamentoşi
- AP: citire la 100% inhibiţie; elipsa zonei de inhibiţie trebuie să fie clară (fig. nr. 10-5)
- IT, VO, POS : citire la 100% inhibiţie (fig. nr. 10-6)
- CS : citire la inhibiţie parţială (fig. nr.10-7)




















Fig. nr. 10-5 Aspectul zonei de
inhibiţie în cazul AP
(CMI: 16 mg/l)

Tehnici de evaluare a sensibilităţii la antifungice


208






































10.3. Testarea sensibilităţii la antifungice prin metoda difuzimetrică Kirby-Bauer
(cu discuri)

Pentru testarea sensibilităţii la voriconazol şi fluconazol a levurilor din genul
Candida şi Cryptococcus se poate folosi şi metoda recomandată de CLSI (M44-A). În
acest scop, se utilizează ca mediu de testare Agarul Müeller-Hinton aditivat cu 2%
glucoză (ca agent de stimulare a creşterii) şi 0,5 µg/ml albastru de metilen (pentru
evidenţierea optimă a conturului zonelor de inhibiţie a creşterii), volumul repartizat în
Fig. nr. 10-6. Aspectul zonei
de inhibiţie în cazul IT
(CMI: 0,75 mg/l)
Fig. nr. 10-7. Aspectul zonei de
inhibiţie în cazul CS
(CMI: 0,047 mg/l)

Mihai Mareş


209
C
a
p
i
t
o
l
u
l
 
1
0
 
placa Petri fiind de aproximativ 25 ml/placă cu ø 90 mm şi 67-70 ml/placă cu ø 150
mm. Mediul se inoculează cu 200 µl (400 µl în cazul plăcilor cu ø 150 mm) suspensie
levurică 0,5 McFarland care se distribuie uniform prin strieri în 3 direcţii cu ajutorul
unui tampon steril. Suprafaţa plăcilor astfel însămânţată se usucă la fluxul de aer
laminar al unei hote microbiologice după care se etalează în centrul acestora câte un
disc de voriconazol (1 µg) sau fluconazol (25 µg).
Plăcile se incubează 20-24 ore la 36° ± 1°C, după care se măsoară diametrul
zonei de inhibiţie (fig. nr. 10-8). Se consideră că procentul de 80% inhibare a creşterii
este aplicabil şi în cazul acestor 2 derivaţi azolici, de aceea microcoloniile apărute la
limita sau în interiorul zonei de inhibiţie nu vor fi luate în considerare. Pentru
interpretarea semnificaţiei diametrului zonei de inhibiţie a creşterii se utilizează
recomandările prezentate în tabelul 10-4 şi tabelul 10-5.


Fig. nr. 10-8. Aspectul zonei de inhibiţie pentru voriconazol
în cazul unei tulpini de Candida albicans

Tabelul 10-4
Recomandări de interpretare a susceptibilităţii la fluconazol
Sensibil Sensibil dependent de doză Rezistent
≥ 19 mm 15 – 18 mm ≤ 14 mm
≤ 8µg/ml 16 – 32 µg/ml ≥ 64 µg/ml

Tabelul 10-5
Recomandări de interpretare a susceptibilităţii la voriconazol
Sensibil Sensibil dependent de doză Rezistent
≥ 17 mm 14 – 16 mm ≤ 13 mm
≤ 1µg/ml 2 µg/ml ≥ 4 µg/ml



Tehnici de evaluare a sensibilităţii la antifungice


210
Bibliografie selectivă

1. Espinel-Ingroff A, Rezusta A (2002) - E-Test Method for Testing
Susceptibilities of Aspergillus spp. to the New Triazoles Voriconazole and
Posaconazole and to Established Antifungal Agents: Comparison with
NCCLS Broth Microdilution Method; J Clin Microbiol; 40(6):2101-2107.
2. Groll A. H, Kolve H (2004) - Antifungal Agents: In Vitro Susceptibility
Testing, Pharmacodynamics, and Prospects for Combination Therapy, Eur
J Clin Microbiol Infect; 23(3):256-270.
3. John H R, Pfaller, M A, Walsh T J et al. (2001) - Antifungal Susceptibility
Testing: Practical Aspects and Current Challenges; Clin Microbiol Rev;
14(4): 643-658.
4. Pfaller M A , Boyken L, Messer S A et al. (2005) - Comparison of Results
of Voriconazole Disk Diffusion Testing for Candida Species with Results
from a Central Reference Laboratory in the ARTEMIS Global Antifungal
Surveillance Program; J Clin Microbiol; 43(10):5208-5213.
5. Pfaller M A, Messer S A, Boyken L et al. (2004) - Evaluation of the
NCCLS M44-P Disk Diffusion Method for Determining Susceptibilities of
276 Clinical Isolates of Cryptococcus neoformans to Fluconazole; J Clin
Microbiol; 42(1):380-383.
6. Peman J, Martin-Mazuelos E, Rubio Calvo M C (2001) - Guia Practica de
Identificacion y Diagnostico en Micologia Clinica; Rev Iberoam Micol;
Bilbao.
Ingrid Cezara Apetrei


211
C
a
p
i
t
o
l
u
l
 
1
1
 









Ingrid Cezara Apetrei

gamă variată de metode analitice este astăzi disponibilă pentru a studia
agenţii biologici din spatele uşilor închise. Din moment ce nu există la ora
actuală o metodă standardizată, universal acceptată, în plan naţional şi internaţional
pentru determinarea / cuantificarea fungică de macro / microclimat, studierea
comparativă a mai multor metode sau tehnici de recoltare şi analiză va servi unei mai
bune aprecieri ambientale, dezideratul final constând în scăderea încărcăturii
microbiologice în ansamblu. În general, încărcătura fungică de microclimat ar trebui să
aibă corespondenţă cu cea exterioară în privinţa genurilor / speciilor identificate şi să
fie mai redusă din punct de vedere cantitativ.
Fungii aeropurtaţi sunt factori antisanogeni binecunoscuţi, producând alergeni,
substanţe cu efect iritant şi/sau toxic. Inhalarea sau contactul direct cu aceste subtanţe
pot induce la indivizii mai sensibili un răspuns alergic amplu cu episoade febrile,
strănut, congestie conjunctivală, rinoree, dermatită etc. În funcţie de particularităţile
imunitare ale fiecărui caz în parte, răspunsul alergic poate fi imediat sau întârziat.
Cercetările privind influenţa sporilor fungici din habitate asupra sănătăţii umane sau
animale sunt în continuă desfăşurare. Dacă se constată un nivel fungic mai ridicat în
spaţiile închise decât în exterior, atunci sigur se poate vorbi de existenţa unor factori
care favorizează această schimbare a raportului de forţe. În plus, identificarea anumitor
genuri / specii fungice, chiar în cuantum scăzut, la nivel de microclimat, impune
efectuarea unor evaluări ulterioare ce să conducă la interpretări statistice. Scopul
recoltării probelor este acela de a aprecia întregul prin analiza subseturilor
populaţionale ale acestuia. La ora actuală există o multitudine de metode de testare ce
pot fi utilizate pentru detecţia fungilor aflaţi în aerosuspensie sau sedimentaţi şi a celor
care se dezvoltă pe diverse suporturi / substraturi inerte din diverse spaţii.







O
11
Tehnici de aeromicologie
Tehnici de aeromicologie


212
11.1. Caseta AIR-O-CELL™
2


Principii procedurale
Caseta Air-O-Cell™ destinată colectării probelor de aer este un dispozitiv
destinat analizării rapide a unei game variate de particule aerosolizate (aeroparticule),
precum spori fungici, pollen, celule epiteliale, fibre, particule anorganice sau porţiuni
din corpul unor insecte (fig. nr. 11-1).
Aerul pătrunde în casetă absorbit cu ajutorul unei pompe, iar particulele sunt
impactate pe un substrat incolor şi aderent, într-o cameră numită „capcană de spori”, ca
apoi acesta să fie eliberat printr-un orificiu de evacuare.
Designul şi construcţia casetei sunt gândite de o aşa manieră încât particulele
aspirate să fie distribuite şi depozitate uniform pe suprafaţa aderentă a lamei de sticlă
din interior.

Beneficii
Acest instrument de recoltare este util pentru testările iniţiale, mai ales atunci
când creşterea fungică nu este vizibilă. Este o tehnică rapidă, simplă şi ferită de
contaminările ce pot surveni în timpul manoperelor clasice.

Dezavantaje
Fungii nu vor putea fi identificaţi cu uşurinţă la nivel de specie prin utilizarea
acestei metode, deoarece ei nu sunt cultivabili. De exemplu, Aspergillus spp. şi
Penicillium spp. sunt de cele mai multe ori identificate împreună ca urmare a
similitudinilor privind morfologia sporilor. Viabilitatea sporilor nu va putea fi de
asemenea analizată. Calibrarea fluxului de aer nu va putea fi modificată decât la cerere,
depinzând de posibilităţile firmei producătoare, iar caseta va fi utilizată doar cu
minipompa furnizată la livrare (fig. nr. 11-2).











Fig. nr. 11-1 Caseta AIR-O-CELL

Prelevarea probelor
Caseta este destinată pentru un debit de aspirare de 15 l/minut. Dacă rata de
absorbţie scade, sporii se pot pierde iar repartizarea particulelor în ansamblu se va

2
Air-O-Cell™ este marcă înregistrată a Zefon International. EMSL Analytical
Fig. nr. 11-2. Mini pompă
ZEFON, adaptată
Casetei AIR-O-CELL
Ingrid Cezara Apetrei


213
C
a
p
i
t
o
l
u
l
 
1
1
 
realiza de o manieră neuniformă, în timp ce creşterea acesteia poate duce la deprecierea
materialului recoltat.

1. Se calibrează pompa la 15 l/minut;
2. Se îndepărteză şi se reţine banda adezivă ce obturează orificiile de intrare şi
ieşire ale casetei Air-O-Cell™;
3. Se ataşează capacul la tubul adaptor (valabil la cerere/comandă).
4. Se deschide pompa de aspirare pentru o perioadă variabilă de timp;
5. După expirarea timpului de aspirare, se îndepărtează caseta Air-O-Cell™ de la
conexiunea cu tubul de absorbţie şi se resigilează cu benzile adezive originale;
6. Proba astfel obţinută se trimite spre analiză unui laborator.

Durata de recoltare
Timpul de expunere al casetei este dependent de densitatea estimată a
particulelor în spaţiul analizat. Este important să se ţină seama că supraîncărcarea
casetei va face imposibilă o identificare cu precizie a tipurilor de spori sau a altor tipuri
de particule prezente. Timpii următori sunt recomandaţi funcţie de spaţiul vizat, pentru
obţinerea unei cât mai bune dispersii a sporilor:

- Spaţiu închis curat sau spaţiul ambiental: 10 minute;
- Spaţiu închis cu activitate susţinută şi personal prezent: 5 minute;
- Spaţiu în amenajare, industrial sau murdar, cu miros sesizabil de mucegai: un
minut.

Recomandări privind controlul de calitate
- O interpretare judicioasă a rezultatelor se va realiza în urma comparării datelor
obţinute prin colectarea probelor de exterior cu cele de interior. Prelevarea şi
analiza probelor de exterior va oferi o bază de calcul / raportare privind
amplificarea fungică din spaţiile închise;
- Se vor preleva spre comparare şi probe din zonele adiacente celor supuse
controlului;
- Rata de aspirare trebuie respectată cu stricteţe pentru acurateţea rezultatelor,
aceasta va fi calibrată şi reglată după fiecare recoltare (15 l/minut);
- Nu se utilizează casete expirate sau uzate.












Tehnici de aeromicologie


214
11.2. Caseta MICRO-5

Principii procedurale
Micro-5 (fig. nr. 11-3), prin utilizarea unei camere de
impactare de 360° a reprezintat o premieră în maniera de colectare a
aeroalergenilor precum polenul, sporii fungici, praful şi alte
particule animate sau inerte.
Caseta este destinată să opereze la o viteză de impactare de
5 l/minut în vederea obţinerii unei eficienţe maxime a colectării.
Caseta trebuie stocată la 20°-27°C. Ca principiu de funcţionare,
caseta conţine o lamă de sticlă acoperită cu o substanţă adezivă
pentru capturarea sporilor. Eficienţa colectării la 5 l/minut este de
50% pentru o dimensiune a particulelor de 0,8 microni şi un volum
total de aspirare de 25 litri.

Dezavantaj
Inconvenientul utilizării acestui dispozitiv este acela că
timpul de expunere este prea scurt şi probele astfel obţinute nu pot
fi reprezentative.

Prelevarea probelor
1. Se îndepărtează capacul din partea inferioară a
casetei Micro-5;
2. Dacă se utilizează o pompă de aspiraţie
convenţională se va conecta tubul de aspirare
la orificiul inferior al casetei, descoperit după
îndepărtarea capacului, nefiind necesari alţi
adaptori (fig. nr. 11-4);
3. Se conectează apoi celălalt capăt al tubului la
pompa de aspirare precalibrată la o rată de 5
l/minut;
4. Se îndepărtează capacul superior conic al
casetei;
5. Se porneşte pompa şi se prelevează proba de aer;
6. După recoltare, se repun capacele casetei Micro-5, atât cel superior cât şi cel
inferior.

Durata de recoltare
- Spaţiu închis, curat sau spaţiu ambiental: 8-10 minute;
- Spaţiu închis cu activitate susţinută şi personal prezent: 5 minute;
- Spaţiu în amenajare, industrial sau murdar, cu miros sesizabil de mucegai: 1-3
minute;
- Spaţiile cavitare, cu adaptor special (guri de aerisire, hote): 1-2 minute;
A nu se utiliza la temperaturi mai mici de 0
0
C !


Fig. nr. 11-3
Caseta
Micro5
Fig. nr. 11-4.
Adaptarea casetei la
pompa de aspiratie
Ingrid Cezara Apetrei


215
C
a
p
i
t
o
l
u
l
 
1
1
 
11.3. Caseta CYCLEX-D

Atât maniera de recoltare a probelor, cât şi modul de utilizare a casetei Cyclex-
D sunt asemănătoare cu cele întâlnite în cazul modelelor comerciale mai sus amintite.
Diferenţele sunt legate de viteza aerului pompat în casetă, în cazul de faţă 20 l/minut.

Durata de recoltare
- Spaţiu închis curat sau spaţiu ambiental: 10 minute;
- Spaţiu închis cu activitate susţinută şi personal prezent: 5-8 minute;
- Spaţiu în amenajare, industrial sau murdar cu miros, sesizabil de mucegai: 1-2
minute.

11.4. Caseta BIOCELL

Din punct de vedere procedural, pentru caseta BIOCELL (fig. nr. 11-5) se
urmăresc instrucţiunile precizate la caseta Air-O-Cell.

Durata de recoltare
- Spaţiu deschis (15 l/minut): 8-10 minute;
- Spaţiu curat, fără depuneri de praf observabile (15
l/minut) : 5-8 minute ;
- Spaţiu închis, cu activitate susţinută şi personal prezent
(15 l/minut): 3-5 minute ;
- Spaţiu în amenajare, industrial sau murdar, cu miros
sesizabil de mucegai (15 l/minut): 1-3 minute;
- Spaţiile cavitare, cu adaptor special (guri de aerisire,
hote) (15 l/minut): 30 secunde – 1 minut.
















Fig. nr. 11-5
Caseta
BioCELL
Tehnici de aeromicologie


216
11.5. Caseta LARO 100
3


Caseta LARO-100 (fig. nr. 11-6) poate absorbi în
procent de 100% particulele fungice din aer, precum şi orice
alte tipuri de
particule sau fibre, utilizând un filtru celulozic cu pori de 0,8
microni.
Durata de recoltare poate atinge 8 ore la un debit de
aspirare de 0,5-1 l/minut (pentru a obţine în final un volum total
de 240-480 litri). Supraîncărcarea dispozitivului prin depăşirea
perioadei de recoltare va îngreuna mult analiza ulterioară.
Probele obţinute mai pot fi analizate şi prin imersarea filtrului
în apă, după recoltare, urmată de colectarea lichidului de spălare
şi însămânţarea acestuia pe medii de cultură.



Principii procedurale
Caseta LARO-100 produce presiune negativă astfel încât este necesară
utilizarea unui rotametru calibrat deja la standardele indicate de producător, între
pompă şi dispozitivul de recoltare. Pompa va fi amplasată la capătul de descărcare al
casetei, iar producătorul recomandă setarea acesteia la un volum de aspirare de 4-5
l/minut. Prelevarea probelor şi stabilirea volumului de aer aspirat depind de condiţiile
de micro / macroclimat constatate. Gradul de vizibilitate în interiorul casetei este mare,
astfel încât observarea nivelului de recoltare pe filtru se poate realiza cu uşurinţă.

Beneficii
Caseta, concepută ca un vortex, prezintă un spaţiu îngust, rectangular, prevăzut
cu un filtru de captură, fiind metoda ideală sub raport preţ / calitate pentru analiza
individuală a gradului de expunere la poluarea aeromicrobiologică. Probele astfel
recoltate pot fi analizate imediat prin microscopie optică.

Durata de recoltare
- Interior/exterior, fără prezenţă fungică vizibilă (4 l/minut): 10 minute sau mai
mult ;
- Monitorizare personală [8 ore] (1–2 l/minut): timpul necesar pentru a obţine 300
– 480 l ;
- Zone comune de acces (4 l/minut): 3–6 minute;
- Suprafeţe plane (4 l/minut): se eşantionează suprafeţe de 10-100 cm
2
.






3
Environmental Monitoring Solutions www.emssales.net • EMSL Analytical
Fig. nr. 11-6
Caseta
LARO 100
Ingrid Cezara Apetrei


217
C
a
p
i
t
o
l
u
l
 
1
1
 
11.6. Impactorul Zefon Z-A6
4


Particulele aerosolizate, solide sau lichide, pot avea dimensiuni cuprinse între
0,1 şi 100 microni diametru, putând fi individuale, neataşate sau agregate. Aceste
caracteristici particulare produc dificultăţi în obţinerea unor probe de aer reprezentative
care să poată fi utilizate în vederea aprecierii din punct de vedere microbiologic a
calităţii aerului. Mai întâi, microorganismele vor recoltate din aer, pentru ca apoi,
particulele viabile, capabile de multiplicare, să poată fi analizate, iar rezultatele
interpretate statistic.

Principii procedurale
Zefon Z-A6 este un dispozitiv din aluminiu, format din două părţi metalice
susţinute lateral de trei cleme (fig. nr. 11-7) Dispozitivul este prevăzut cu un tub lateral
de circulaţie a aerului, un con superior cu o bază plată şi 400 orificii. Când aerul este
aspirat în aparat sub forma jeturilor multiple, particulele din aer sunt direcţionate spre
suprafaţa mediului de colectare din dispozitiv. Această metodă de recoltare implică
impactarea unui volum de aer cunoscut pe suprafaţa mediului de cultură dintr-o placă
Petri. Ulterior, plăcile sunt incubate astfel încât microorganismele impactate să se
poată multiplica şi genera colonii cuantificabile, atât din punct cantitativ, cât şi
calitativ.
Părţile componente livrate odată cu aparatul :
• Pompă de vacuum
• Rotametru
• Tub flexibil

Beneficii
• Cultivarea prelevatelor poate determina gradul de
viabilitate fungică şi permite ulterior
identificarea la nivel de gen şi specie.

Dezavantaje
• Dezvoltarea culturilor urmată de identificarea microorganismelor poate dura o
perioadă îndelungată de timp (6-10, chiar 30 zile);
• Chiar dacă sunt prezente aeroparticule neviabile care nu se vor dezvolta pe
mediile de cultură, acestea pot juca un rol semnificativ în instalarea unor reacţii
alergice sau iritative;
• Există posibilitatea ca unele microorganisme să nu poată fi identificate ca urmare
a absenţei corpilor fructificanţi sau să nu mai fi fost caracterizate anterior din
punct de vedere al apartenenţei taxonomice. De asemenea, particulele neviabile
de origine fungică nu pot fi identificate.

Prelevarea probelor
1. În vederea evitării supracontaminării probelor se vor utiliza mănuşi de protecţie;

4
EMSL Analytical, Inc. www.emssales.net

Fig. nr. 11-7
Dispozitiv Zefon Z-A6
Tehnici de aeromicologie


218
2. Se conectează tubul flexibil la pompă şi apoi la dispozitivul lateral al
colectorului;
3. Înaintea începerii recoltării se porneşte şi se calibrează pompa de vacum la 1
ACFM (28.3 l/minut) cu ajutorul rotametrului;
4. După calibrare, se şterge dispozitivul pe întreaga sa suprafaţă cu alcool
izopropilic, utilizând un tampon steril;
5. După pregătirea aparatului, se îndepărtează partea superioară a acestuia în
vederea introducerii în interior, pe fundul plat, a unei plăci cu mediu solid ce
va servi drept suprafaţă de recoltare. Placa a fost lăsată în prealabil acoperită
pentru a ajunge la temperatura camerei. Se fixează componentele aparatului cu
cele trei cleme metalice prin răsfrîngerea acestora, acoperindu-se astfel imediat
placa cu mediu prin ataşarea părţii superioare a dispozitivului;
6. Se porneşte pompa de vacuum pentru 2-5 minute. Aerul este aspirat prin conul
superior şi dirijat prin orificiile de precizie, fiind apoi impactat pe suprafaţa de
recoltare – placa Petri cu mediu solid. Exhaustarea se realizează prin
împingerea aerului spre tubulatura de la baza aparatului unde va fi colectat de o
cameră de vid ataşată pompei de vacuum;
7. După recoltare, se va îndepărta dispozitivul de închidere şi se va înlocui placa
substrat, aceasta fiind acoperită, sigilată şi trimisă laboratorului spre analiză în
cel mai scurt timp;
8. Înainte de a se recolta o altă probă, dispozitivul de recoltare va trebui
dezinfectat, iar manipularea se va face rapid şi doar cu mănuşi de protecţie.

Mediile de cultivare şi manipularea lor
În principiu, pot fi utilizate pentru recoltare cu acest impactor diverse medii de
cultivare, turnate în prealabil în plăci Petri standard de 15 x 90 mm. Mediile de
cultivare recomandate prelevării şi analizei fungice sunt:
• PDA (Agar cu extract de cartof glucozat)
• MEA (Agar cu extract de malţ)
• DG – 18 (Agar dicloran glicerol-18%)

- Plăcile cu medii agarizate vor fi păstrate la temperatura de refrigerare până în
momentul utilizării, când vor fi lăsate (aproximativ 20 minute) să ajungă la
temperatura mediului ambiant;
- Capacul plăcii Petri se îndepărtează doar în momentul recoltării;
- După recoltarea probelor, capacul plăcii se repune iar placa se va sigila cu
Parafilm sau bandă adezivă şi se va trimite laboratorului spre analiză în cel
mult 24 de ore;
- Dacă placile se transportă cu o geantă frigorifică acestea nu vor fi lăsate să vină
în contact direct cu gheaţa pentru a se preveni degradarea mediului, testarea în
acest caz fiind invalidată.

Recomandări
- Se vor purta mănuşi de latex pe tot parcursul desfăşurării manoperelor de
recoltare;
Ingrid Cezara Apetrei


219
C
a
p
i
t
o
l
u
l
 
1
1
 
- Se va folosi alcoolul izopropilic 70% pentru decontaminarea dispozitivului de
recoltare după fiecare prelevare;
- Pe parcursul recoltării, capacul plăcii Petri se va păstra într-un sac steril de
plastic;
- Pompa de vacuum trebuie să fie calibrată cu ajutorul unui rotametru, cu atât mai
des cu cât nu sunt întotdeauna întrunite condiţiile optime de presiune şi
temperatură. O placă martor, neexpusă recoltării, va servi la fiecare prelevare
drept control negativ. Probele prelevate din mediul ambiant vor fi comparate
cu cele de microclimat. De asemenea, vor trebui recoltate probe şi din zonele
adiacente celei de interes. Niciodată nu se vor utiliza medii de cultivare
expirate sau contaminate.

11.7. Dispozitivul CIP 10M

CIP 10 este un dispozitiv de dimensiuni reduse
destinat colectării particulelor aerosolizate şi a prafului
din aer (fig. nr. 11-8). A fost schiţat ca şi concept în
anii ’80 la CHERCHAR (Centre d’Études et de
Recherches de Charbonnage de France) actualmente
INERIS (Institut National de l’Environnement
Industriel et des Risques) de către Paul Courbon. În
prezent este produs şi comercializat cu licenţă INERIS
de către ARELCO A.R.C.
În 2003, a fost perfectat un nou subansamblu
destinat recoltării microorganismelor, dispozitivul
schimbându-şi denumirea din CIP 10 în CIP 10 M.
Pentru recoltare, în mod normal este amplasat
cât mai aproape de căile respiratorii, la nivelul
toracelui, dar poate fi amplasat şi în diverse zone ale
spaţiului de lucru considerate a fi puncte critice. Mai mult, scopul utilizării
dispozitivului este acela de a recolta particulele ce reprezintă o reală ameninţare la
adresa sănătăţii umane (cantonabile la nivel alveolar, bronşic, sinusal ), în conformitate
cu CEN 481 şi standardul ISO 7708. Particulele astfel recoltate pot fi cântărite graţie
interschimbabilităţii selectorilor, determinându-se totodată şi greutatea probei recoltate,
urmată când se impune şi de analiza compoziţiei probei.
Dispozitivul are formă alungită, de bloc compact prevăzut cu un selector
cilindric, o incintă rotativă în partea superioară - destinată colectării particulelor, şi o
bază plată de separare a circuitului electric din partea inferioară – motor, baterii şi
circuit electric. Forma ergonomică a dispozitivului facilitează ataşarea acestuia cu un
sistem de curele cât mai aproape de căile respiratorii sau purtarea acestuia într-un
buzunar.





Fig. nr. 11-8
Dispozitivul CIP 10M
Tehnici de aeromicologie


220
Beneficii
- Este de dimensiuni mici, compact, uşor, silenţios;
- Arhitectura modulară permite aprecierea tuturor fracţiilor respiratorii conform
standardelor, prin utilizarea la recoltare a selectorilor şi a unui debit de aer
prestabilit;
- Supapa omnidirecţională protejată de capac blochează pătrunderea accidentală pe
parcursul aspirării, a unor particule de mari dimensiuni sau a picăturilor de apă;
- Aparatul nu este afectat de schimbarea poziţiei sau de mişcări bruşte, având o
construcţie internă robustă şi un exterior din plastic antistatic;
- Debitul este constant, iar filtrele sunt reutilizabile;
- Colectorul prezintă o serie de elemente de siguranţă precum şuruburi speciale de
închidere, întrerupător magnetic, led de funcţionare este compus din materiale
conforme standardelor europene privind utilizarea aparaturii de recoltare în
medii ostile;
- Înălţime totală : 175 mm, diametru : 45 mm, greutate totală 300 g.

CIP 10 este echipat cu selectori de recoltare pentru aerosoli şi praf, conform
standardelor europene în vigoare NF EN 481, existând abateri doar în cazul
particulelor foarte fine.
CIP 10 sau varianta CIP 10 M nu necesită pe parcursul timpului de funcţionare
un control extern sau ajustări suplimentare. Se remarcă printr-o remarcabilă stabilitate
a fluxului de aer în corelaţie cu viteza de rotaţie a cupei menţinută constantă de către
un regulator de viteză.
Porii filtrului poliuretanic au câteva sute de microni diametru şi cu toate
acestea, rămân larg deschişi pe parcursul recoltării până în momentul când praful
colectat atinge valoarea de 50 mg în cupa de rotaţie şi câteva sute de miligrame la
nivelul selectorului destinat fracţiilor respirabile alveolare.

1. Selectorul de particule destinat fracţiilor respirabile alveolar

Această selecţie a particulelor respirabile alveolar se realizează cu aspirare în
unghi de 45° prin două filtre poliuretanice. Fracţiile aerosolizate obţinute astfel,
întrunesc condiţiile impuse de standardele europene CEN AFNOR 481 şi ISO 7708.

2. Selectorul de particule destinat fracţiilor respirabile toracic

CIP 10 T sau CIP 10 MT reprezintă două variante constructive ale
dispozitivului destinat selecţiei particulelor ce pot pătrunde bronşic, printr-o serie de
fante de dirijare a aerului în unghi de 90° către opt orificii dispuse radiar în
extremitatea superioară a tubului de inox. Întrucât particulele de dimensiuni mari
exercită forţe gravitaţionale sporite acestea nu sunt deviate, fiind capturate la baza
selectorului (filtrului).




Ingrid Cezara Apetrei


221
C
a
p
i
t
o
l
u
l
 
1
1
 
3. Selectorul de particule destinat fracţiilor inhalabile

CIP 10 I sau CIP 10 MI servesc selecţiei particulelor inhalabile prin
direcţionarea supapei de admisie şi prezenţa orificiilor de selecţie, tubul conic
ghidându-le în continuare spre cupa rotativă de colectare.

4. Un nou selector destinat fracţiilor inhalabile

O nouă metodă de selectare a fracţiilor inhalabile a fost dezvoltată pentru a
diminua depunerile nedorite pe suprafaţa interioară / superioară a peretelui capsulei de
colectare şi pentru o mai bună satisfacere a cerinţelor standardului EN 481. Fluxul de
aer va fi forţat să urmeze un traseu concentric convergent spre un punct de retur care să
imprime apoi o direcţionare verticală.

5. Selectorul de praf total – fracţii maximale

Cu ajutorul dispozitivului CIP 10 se pot aprecia fracţiile maximale / praful
total, în acest scop fiind indicată utilizarea unui cap alveolar cu păstrarea camerei de
recoltare şi a duzei aferente. Astfel, toate particulele suspendate în aer, inclusiv cele
recent depuse vor fi aspirate de dispozitiv.

Prelevarea probelor
CIP 10 include o cupă de rotaţie echipată cu un filtru poliuretanic montat pe
axul de rotaţie al motorului ce funcţionează la turaţie mare într-o incintă, cu fluxul de
intrare axial şi cel de ieşire tangenţial. Datorită rotaţiei cupei, se generează un flux de
aer asemănător cu efectul unui ventilator, asigurându-se astfel captura particulelor ce
au scăpat de selecţia filtrelor anterioare.
Motorul este acţionat de acumulatori, iar viteza sa este setată de către un
circuit de control electromagnetic. Debitul de aer este direct proporţional cu viteza de
rotaţie. Aerul este aspirat prin supapa omnidirecţională, iar în interior acesta urmează o
cale sau alta în funcţie de dimensiunea particulelor ce urmează a fi studiate. Fracţiile
nedorite din punct de vedere dimensional vor fi oprite de selectoarele superioare.
Particulele care străbat selectorul rămân în suspensie în lichidul de eluare, iar aerul
astfel filtrat se reîntoarce în atmosferă prin fantele laterale ale cupei de rotaţie.
Dispozitivul CIP 10M este dotat cu o cupă de rotaţie prevăzută în partea
superioară cu lame orizontale care în mişcare imprimă aerului aspirat efectul de rotaţie
centrifugală. Frecarea aerului de partea superioară a lichidului conţinut de cupă,
precum şi de pereţii laterali ai acesteia va genera o zonă de presiune scăzută ce
facilitează direcţionarea aerului dincolo de lichidul de recoltare. În acest mod, aerul
astfel aspirat va urma o mişcare de rotaţie helicoidală pentru captarea uşoară a celulelor
în lichidul colector, garantându-se astfel viabilitatea acestora. Înaintea începerii
colectării cupa trebuie sterilizată prin autoclavare sau tratare cu solvenţi speciali şi
alimentată cu 2-2,5 cm
3
lichid de colectare - apă distilată sau soluţie peptonată etc.
Dacă soluţia este adăugată în exces, aceasta va fi eliminată în momentul începerii
recoltării.

Tehnici de aeromicologie


222
Colectarea probelor în atmosferă uscată

Umiditatea relativă scăzută a mediului ambiant poate limita eficienţa recoltării
în sensul epuizării rapide a lichidului de recoltare, reducându-se astfel şi perioada de
recoltare.

Colectarea sporilor sau a miceliului

Luând în considerare natura hidrofobă a sporilor sau a miceliului, se poate
anticipa o rată scăzută de capturare a acestora, de aceea este recomandată adăugarea în
lichidul colector a unui agent surfactant tensioactiv pentru forţarea mixării
bioaerosolilor cu lichidul camerei de compactare (de obicei Tween 80 în proporţie de
0,05-0,1‰).
1211
Transportul probelor

CIP 10 nu necesită precauţii speciale privind transportul probelor. Este
recomandată totuşi, transportarea în poziţie verticală a dispozitivului atunci când cupa
de recoltare nu a fost îndepărtată.

Manipularea în laborator după colectare

După recoltare, aparatul CIP 10 (sau CIP 10M) este menţinut în poziţie
verticală, i se îndepărtează capacul şi se scoate cupa colectoare cu un extractor special.
Se recoltează lichidul din cupă, cupa spălându-se de trei ori, lichidul de spălare
păstrându-se de asemenea în vederea analizării prin cultură, identificare PCR,
determinare ATP, epifluorescenţă.

Ajustarea şi controlul debitului de aer

Reglarea debitului de aer între 7 şi 10 l/minut, în funcţie de necesităţi,
reprezintă singura ajustare necesară pentru funcţionarea dispozitivului CIP 10M şi se
realizează cu ajutorul unui potenţiometru plasat în interiorul carcasei. Operaţiunile
procedurale implică urmatorii paşi: verificarea gradului de încărcare a bateriilor,
îndepărtarea clemelor de fixare ale cupei de rotaţie şi îndepărtarea acesteia pentru a
avea acces la locaţia potenţiometrului.
Se plasează apoi cupa de rotaţie ce conţine filtrul poliuretanic deasupra
motorului, se aşează capacul, se porneşte aparatul, potenţiometrul ajustându-se pentru
ca cititorul manometrului să indice 0 Pa şi astfel să existe un echilibru între debitul de
aer ce pătrunde în aparat şi cel evacuat, fără pierderi de aer, urmărindu-se gradul de
etanşeizare al aparatului. Cu ajutorul unui tahometru se va aprecia, după îndepărtarea
capacului, viteza cupei de rotaţie fără ca aceasta să fie atinsă de dispozitiv pentru a se
evita încetinirea acesteia (între 6800 - 7000 rpm în funcţie de varianta constructivă).
Doar în cazul în care se observă o deviaţie mai mare de 150 rpm de la standard se poate
interveni cu ajustări suplimentare asupra dispozitivului. În caz contrar orice valoare
observată sub cea amintită este considerată valoare nominală.
Ingrid Cezara Apetrei


223
C
a
p
i
t
o
l
u
l
 
1
1
 

Determinarea greutăţii probei recoltate

Determinarea masei prafului colectat se realizează prin cântărirea cupei de
rotaţie ce conţine filtrul poliuretanic, atât înainte cât şi după colectarea probelor,
utilizându-se o balanţă electronică de laborator cu o deviaţie standard admisă de maxim
0,1 mg. Filtrul poliuretanic este sensibil la umiditatea aerului, de aceea formula finală
de calcul va ţine cont de schimbările majore privind umiditatea relativă a zonei de
microclimat unde are loc recoltarea.

INRS recomandă următoarea succesiune procedurală:

- Pregătirea cupei se va realiza cu atenţie: va fi spălată cu o soluţie decontaminantă
fierbinte şi clătită de mai multe ori, de preferat numai cu apă distilată sterilă;
- Va fi lăsată 12 ore să se usuce la temperatura de 50°C - 60°C;
- Filtrul se va pregăti separat şi se va păstra într-un loc uscat ferit de praf sau alte
impurităţi;
- Se vor purta mănuşi de protecţie pe toată durata desfăşurării manoperelor de
recoltare.

Procesarea probelor după recoltare

După recoltare, cupele sunt recondiţionate de maniera amintită anterior, fiind
totuşi recomandată plasarea lor, după înlăturarea capacului protector, într-un termostat
la 50 – 60°C timp de 4 ore, dacă prelevarea a avut loc într-un spaţiu cu umiditate
relativă prea ridicată. După condiţionare, se determină masa probei colectate cu
formula:

H = H
m
-H
¡

unde:

H
m
- reprezintă diferenţa de greutate a cupelor înainte şi după recoltare;
H
¡
- reprezintă cea mai mare valoare de diferenţă înregistrată între cele două cântăriri,
înainte şi după recoltarea probelor.

Determinarea concentraţiei particulelor

Concentraţia se calculează în mg/m
3
fiind determinată prin formula :

C [
mg
m
3

¸ =
M
F


unde :
M - reprezintă masa probei colectate, după specificaţiile amintite (în mg);
V - reprezintă volumul de aer filtrat (în m
3
).

Tehnici de aeromicologie


224
Manipularea filtrului poliuretanic al dispozitivul CIP 10

Filtrul poliuretanic este deosebit de rezistent la acţiunea agenţilor chimici şi
stabil din punct de vedere structural. Poate fi spălat prin metode uzuale, incinerat sau
mineralizat funcţie de tipul analizei ce urmează a fi realizată.
Următoarele operaţiuni de spălare sunt permise asupra filtrului poliuretanic, în
vederea recuperării prafului recoltat:
- Se lasă filtrul într-o soluţie caldă de spălare,15 minute;
- Se extrage din soluţie cu mâna protejată de mănuşi;
- Se clăteşte cu apă distilată de mai multe ori până când soluţia de spălare rămâne
clară;
- Se recuperează şi praful depus la baza cupei de recoltare tot prin spălare şi se
adaugă lichidului deja obţinul prin spălarea filtrului;
- Urmează filtrarea şi centrifugarea în vederea recuperării depozitului de analizat,
pierderile ce apar pe parcursul desfăşurării manoperelor fiind neglijabile

11.8. Aprecierea încărcăturii fungice aeropurtate
prin tehnica sedimentării Koch

Se utilizează plăci Petri sterilizate, cu diametrul de 90 mm, în care se
repartizează câte 15-20 ml mediu agarizat special destinat cultivării fungilor
(Sabouraud cloramfenicol agar, PDA, Agar cu extract de malţ). Se opreşte instalaţia de
climatizare şi în absenţa personalului de lucru se expun plăcile cu mediu, fără capac, în
anumite puncte prestabilite, un interval de timp variabil între 5 şi 15 minute.
În fiecare punct de recoltare se expun câte 2 plăci din fiecare mediu. Pe
capacul fiecărei plăci se inscripţionează tipul de mediu, data şi ora recoltării, poziţia
plăcii, timpul de expunere. După expirarea timpului de expunere stabilit, plăcile se
acoperă cu capacele proprii, se învelesc în hârtie şi se transportă în caserole de plastic
la laborator, unde se incubează, la temperatura de 25
o
C. Obligatoriu, în paralel se
incubează câte o placă martor conţinând aceleaşi medii, fără a fi deschise în prealabil.
După 5 zile se monitorizează eventuala dezvoltare a coloniilor şi se calculează
nr. UFC /m
3
aer.

N¡.0PC
m
3
uc¡
=
N ×10 000
S×K



N - media numărului de colonii dezvoltate pe suprafaţa mediului din cele 2 plăci
expuse;
S - suprafaţa plăcii (cm
2
) – (3,14 x R
2
);
K - coeficientul timpului de expunere: pentru 5 minute este egal cu 1, pentru
10minute este egal cu 2, iar pentru 15minute este egal cu 3.





Ingrid Cezara Apetrei


225
C
a
p
i
t
o
l
u
l
 
1
1
 
11.9. Tehnici de recoltare/examinare directă a probelor
de pe suprafeţe

Examinarea directă permite detectarea rapidă a prezenţei sporilor fungici într-
un spaţiu examinat precum şi genurile incriminate într-o astfel de contaminare,
contribuind astfel alături de alte metode de analiză la acurateţea rezultatelor obţinute.

11.9.1. Banda adezivă BIO TAPE
TM
(Zefon International)

Acest tip de bandă reprezintă varianta standardizată de recoltare a
specimenelor de pe suprafeţe. Probele se mai pot recolta şi prin utilizarea unei benzi
adezive tip scoth. În vederea examinării microscopice a particulelor colectate, banda
adezivă trebuie să aibă proprietăţi optice superioare şi să suporte toate tipurile de
coloranţi ce pot fi utilizaţi în practica de laborator funcţie de speciile suspectate.

Prelevarea probelor

1. Se pregăteşte lama prin exteriorizarea benzii adezive duble, evitându-se
atingerea părţii ce serveşte pentru colectarea probei (fig. nr. 11-9);














2. Se aplică zona centrală a benzilor pe suprafaţa de recoltare, prin apăsare
moderată (fig. nr. 11-10);
3. Se desprind uşor benzile şi se reataşează una de alta
sau se lipesc de suprafaţa interioară a unui sac de
plastic steril (ziplock), având grijă ca acesta să nu
prezinte cute;
4. În fiecare ambalaj va fi transportată o singură probă.



Recomandări
• Benzile se vor utiliza doar în scopul pentru care au fost
concepute şi nu la temperaturi mai mici de 5°C;
Se îndepărtează celofanul
protector
Se înscriu elementele de
identificare a probei
Mijlocul zonei adezive,
de recoltare a probei
Fig. nr. 11-9 Componentele lamei Bio-Tape
Fig. nr. 11-10.
Recoltarea probelor
Tehnici de aeromicologie


226
• Nu se vor trimite către laborator, benzi ataşate unei lame sau acoperite cu o
lamelă, ci doar în ambalajul special destinat transportului, furnizat odată cu
pachetul standard.

11.9.2. Recoltarea fragmentelor inerte

Aceste probe sunt reprezentate de porţiuni din diverse materiale ce ar putea fi
contaminate, constituind astfel substrat al dezvoltării fungice (secţiuni de tapet,
covoare, mochete, filtre de aer, fragmente de mobilier, de instalaţie sanitară ). Dacă
specimenul are dimensiuni mari, se vor alege fragmente de recoltat reprezentative,
evitându-se contaminarea prin manopere suplimentare.
Scopul acestui tip de recoltare este acela de a obţine porţiuni din materialele de
analizat, suficient de mici pentru a putea fi uşor transportate şi manipulate, dar
reprezentative sub aspectul încărcăturii fungice. Analiza probelor se va realiza prin
cultivarea pe medii speciale sau prin microscopie directă.

11.9.3. Recoltarea cu ajutorul tamponului tip exsudat

Principiul de lucru este foarte asemănător cu cel al benzii adezive. Tija cu
tamponul steril este găzduită de o eprubetă / un tub cu soluţie tampon pH 7,0 sau
soluţie de eluare a sporilor (ser fiziologic cu 0,05% Tween 80). Probele astfel obţinute
pot fi analizate prin cultivare sau prin microscopie directă.

Beneficii
• Examinarea directă este necostisitoare şi poate fi rapid efectuată.
• Reprezintă un test preliminar de valoare şi poate indica sursele generatoare de
spori aeropurtaţi.

Dezavantaje
• Zona de recoltare fiind redusă ca dimensiuni, nu va oferi o imagine de ansamblu
asupra gradului de contaminare fungică a unui habitat, de aceea se recomandă
recoltarea din mai multe puncte.
• Problemele de sănătate cauzate de multiplicarea fungică din habitate sunt corelate
cu inhalarea unui număr substanţial de spori aeropurtaţi, uneori perioade
îndelungate de timp. Prezenţa microorganismelor sub formă de depozite pe
diverse suprafeţe nu poate constitui un indicator direct al aeropoluării.
• Prin intermediul acestor tehnici se pot detecta atât sporii viabili, cât şi cei
neviabili, fără a se putea face o distincţie între cele două tipuri. Dacă testările
interesează în mod special cunoaşterea viabilităţii recoltatului este indicată
combinarea tehnicilor directe cu cele de cultivare.
• De cele mai multe ori, fungii nu pot fi identificaţi la nivel de specie şi nici chiar la
nivel de gen prin intermediul tehnicilor directe, în absenţa corpilor de
fructificare.



Ingrid Cezara Apetrei


227
C
a
p
i
t
o
l
u
l
 
1
1
 
Bibliografie selectivă

1. Barry S L, Wegman D H (2000) - Occupational Health: Recognizing &
Preventing Work - Related Disease & Injury, 4
th
edition; Lippincott
Williams & Wilkins.
2. EMSL Analytical (2003) - LARO-100 Sampling Guide.
3. Goddish Thad (2002) - Indoor Environment Notebook: Everything You
Wanted to Know About Indoor Air Pollution and More; Ball State
University, Department of Natural Resources and Environmental
Management; LARO-100 Product Information.
4. Grinshpun Surgey A (2002) - Collection and Enumeration of Airborne
Spores Using Aerosol Impactors with Low Jet-To-Plate Distance, Project
3, Micro5 Microcell (5 lpm); University of Cincinnati Environmental
Health Foundation.
5. * * * - Minnesota Department of Health (2003) - Environmental Health in
Minnesota: Testing for Mold; Sampling methodology for fungal
bioaerosols and amplifiers in cases of suspected indoor mold proliferation.
6. * * * - Qualité de l’air. Air des lieux de travail - Détermination du dépôt
alvéolaire de la pollution particulaire. Méthode de la coupelle rotative.
(Air-Quality: Workplace Air - Gravimetric determination of particulate
pollution deposits. Rotating disk method); NF X43-262.
7. * * * - Atmosphères sur les lieux de travail - Définition des fractions de
taille pour le mesurage des particules en suspension dans l’air. (Workplace
Atmospheres - Size fraction definitions for measurement of airborne
particles.); NF EN 481 X43-276.
8. * * * - Air des lieux de travail - Détermination par rayons X de la
concentration de dépôt alvéolaire de silice cristalline- Échantillonnage par
dispositif à coupelle rotative. (Workplace Air - X-Rays Determination of
the conventional alveolate fraction of crystalline silica - Sampling using a
rotating cup device); NF X43-295.
9. * * * - Qualité de l’air - Définitions des fractions de taille des particules
pour l’échantillonnage lié aux problèmes de santé. (Air Quality - Particle
size fraction definitions for health related sampling); NF ISO 7708.
10.* * * - Air des lieux de travail - Dosage par spectrométrie infrarouge à
transformée de Fourier de la silice cristalline - Échantillonnage par
dispositif à coupelle tournante ou sur membrane filtrante. (Workplace Air -
Fourier Transform Infrared Spectrometric determination of crystalline
silica - Sampling using a rotating cup device or filtering membrane); XP
X43-243.



Luminiţa-Iuliana Malic


229
C
a
p
i
t
o
l
u
l
 
1
2
 













Luminiţa-Iuliana Malic

12.1. Clasificarea fungilor în funcţie de clasele de risc biologic

n funcţie de gradul de risc biologic pe care microorganismele îl prezintă
pentru om, acestea se clasifică în trei clase:
- Clasa I – cuprinde acele microorganisme care rareori pot manifesta risc de
îmbolnavire la om şi animale;
- Clasa II – cuprinde acele microorganisme care pot cauza apariţia de afecţiuni la
om şi animale şi pot reprezenta un pericol pentru personalul din laborator – risc
individual redus, risc colectiv neglijabil. Profilaxia şi tratamentul folosite în
afecţiunile cauzate de aceste microorganisme sunt eficace. Cuprinde
majoritatea fungilor de interes clinic (tabelul 12-1);
- Clasa III – cuprinde acele microorganisme care pot cauza afecţiuni la om şi care
reprezintă un real pericol pentru personalul din laboratoarele de micologie –
risc individual mare, risc colectiv semnificativ. De asemenea, există riscul
diseminării în colectivitate. Tratamentul şi profilaxia sunt eficace;
- Clasa IV – cuprinde acele microorganisme care pot cauza afecţiuni grave la om şi
care reprezintă un pericol pentru personalul din laborator – risc individual
crescut, risc colectiv crescut. De asemenea, există riscul de contaminare a
colectivităţilor, iar de cele mai multe ori, nu există un tratament eficace al
afecţiunilor cauzate de aceste microorganisme











Î
12
Norme generale de biosecuritate în
laboratoarele de micologie medicală
Norme generale de biosecuritate în laboratoarele de micologie medicală


230
Tabel 12-1
Clasificarea principalelor specii de fungi în funcţie de grupa de risc biologic şi
capacitatea alergizantă
Specia
Clasa de
risc
biologic
Capacitatea
alergizantă
Aspergillus fumigatus 2 X
Blastomyces dermatitidis 3
Candida albicans 2 X
Cladophialophora bantiana 3
Candida tropicalis 2
Coccidioides immitis 3 X
Cryptococcus neoformans var. neoformans 2 X
Cryptococcus neoformans var. gattii 2 X
Emmonsia parva var. parva 2
Emmonsia parva var. crescens 2
Epydermophyton floccosum 2 X
Fonsecaea compacta 2
Fonsecaea pedrosoi 2
Histoplasma capsulatum var. capsulatum 3
Histoplasma capsulatum var. duboisii 3
Madurella grisea 2
Madurella mycetomatis 2
Microsporum spp. 2 X
Paracoccidioides brasiliensis 3
Penicillium marneffei 2 X
Scedosporium apiospermum 2
Scedosporium prolificans 2
Sporothrix schenckii 2
Trichophyton rubrum 2

12.2. Norme generale de biosecuritate

- Accesul în laborator este permis doar personalului autorizat;
- Personalul din laborator trebuie să participe la implementarea şi respectarea
normelor de biosecuritate;
- Pardoseala laboratorului va fi confecţionată din materiale rezistente acoperite cu
răşini epoxidice sau linoleu antistatic, netedă, uşor lavabilă;
- Pe uşile de acces în Laboratorul de Micologie Medicală se va aplica semnul
internaţional Pericol biologic (Biohazard) care, în cazul acestor laboratoare
corespunde nivelului 2 de securitate microbiologică (fig. nr. 12-1). Cu acelaşi
semn se vor marca frigiderele şi congelatoarele folosite pentru păstrarea
microorganismelor cu risc biologic 2;


Luminiţa-Iuliana Malic


231
C
a
p
i
t
o
l
u
l
 
1
2
 


Fig. nr. 12–1. Semnul convenţional pentru risc biologic (Biohazard)

- Uşile şi ferestrele laboratorului trebuie sa fie în permanenţă închise pentru
asigurarea izolării spaţiului;
- Laboratorul va fi separat de zona de circulaţie a personalului cu ajutorul unui sas;
- Laboratorul trebuie să fie în permanenţă ventilat forţat. Aportul de aer va fi de
cca. 60 m
3
per persoană per oră;
- Toate suprafeţele de lucru se vor spăla şi dezinfecta zilnic. Toate reziduurile vor
fi incinerate în incinte speciale, autorizate, iar depozitarea şi transportul
acestora se va face în cutii închise ermetic, rezistente şi impermeabile, în
funcţie de fiecare tip de reziduu, marcate de asemenea cu semnul de risc
biologic;
- Laboratorul trebuie să beneficieze de un lavoar pentru spălarea mâinilor, care să
funcţioneze prin acţionarea cu ajutorul cotului sau cu o pedală;
- Transportul probelor de la şi între laboratoare se va realiza cu ajutorul lăzilor
izoterme, ermetice, rigide, rezistente la lovituri, uşor de curăţat şi dezinfectat;
- Personalul din laborator va evita contactul direct cu materialele potenţial
patogene. În acest scop se va folosi echipament de protecţie adecvat în
momentul manevrării probelor sau a culturilor fungice. Echipamentul de
protecţie va fi îndepărtat în momentul părăsirii zonei de lucru. Mâinile se vor
spăla în mod repetat cu săpun lichid antiseptic, după fiecare îndepărtare a
mănuşilor de protecţie;
- Este interzisă pipetarea materialului patologic cu gura;
- În zona de lucru nu se vor depozita cărţi sau hârtii, deoarece sunt dificil de
sterilizat;
- În laboratoarele de micologie medicală sunt strict interzise:
• Consumarea de alimente sau băuturi de orice fel;
• Depozitarea de alimente şi băuturi;
• Folosirea lentilelor de contact;
Norme generale de biosecuritate în laboratoarele de micologie medicală


232
• Aplicarea de produse cosmetice;
- Plăgile se vor acoperi cu bandaj înainte de aplicarea echipamentului de
protecţie.

12.2.1. Tehnici de laborator folosite în zona de lucru

- Toate culturile fungice (în special la speciile cu miceliu aerian sporulat) şi
prelevatele clinice se vor manevra de preferat în interiorul unei hote de
protecţie biologică clasă II, pentru evitarea contaminăriii personalului şi
incintei laboratorului;
- Plăcile ce conţin mediu de cultivare pentru fungi se vor închide şi se vor aşeza cu
capacul în jos pentru evitarea deschiderii accidentale şi contaminării;
- Incubarea plăcilor se va face în termostate cu umidificatoare;
- În cazul utilizării mediilor de cultivare repartizate în tuburi, acestea trebuie să
beneficieze de dopuri fixe, sigure;
- Deschiderea plăcilor şi tuburilor ce conţin medii de cultivare se va face doar sub
protecţia unei hote microbiologice de clasă II sau în vecinătatea flăcării unui
bec de gaz;
- În cazul fungilor dimorfici se impune analizarea acestora sub protecţia unei hote
de securitate biologică grad III. Plăcile cu astfel de culturi se etanşeizează
obligatoriu cu Parafilm.

12.3. Metode de protecţie primară

Aceste metode se referă la echipamentele de protecţie a personalului şi la
aparatura utilizată în vederea realizării protecţiei microbiologice.

12.3.1. Hote de protecţie biologică

Hotele sau cabinetele de protecţie sunt incinte în care fluxul de aer este filtrat
şi dirijat astfel încât să se obţină diferite grade de protecţie biologică. Există trei tipuri
de astfel de incinte specializate, în funcţie de domeniul în care sunt folosite: hote fizico
– chimice, hote cu flux laminar verical sau orizontal, hote de protecţie biologică clasa
I, clasa II, clasa III şi cabinete destinate aplicaţiilor PCR.
Hotele fizico – chimice sunt folosite pentru reţinerea fumului şi vaporilor
chimici ce apar în urma manipulării diferiţilor reactivi, dar nu realizează protecţia
biologică.
Hotele cu flux laminar de aer sunt dotate cu filtre principale HEPA (High
Efficiency Particulate Air) aflate în spatele zonei de lucru, aerul fiind întotdeauna
filtrat înainte de a trece peste probe. Fluxul de aer poate fi verical sau orizontal. Aceste
hote oferă protecţie doar pentru materialul care se află în interior, operatorul nefiind
protejat microbiologic. Aceste hote sunt recomandate pentru protecţia în momentul
manevrării mediilor de cultivare şi a reactivilor sterilizaţi.
Hotele de protecţie biologică sunt incinte puternic ventilate, destinate limitării
riscului de contaminare a personalului din laborator ce lucrează cu agenţi patogeni.
Aceste echipamente sunt destinate limitării zonei de lucru şi evitării diseminării
Luminiţa-Iuliana Malic


233
C
a
p
i
t
o
l
u
l
 
1
2
 
particulelor patogene pe calea aerului spre operator şi în spaţiul laboratorului. Hotele
de protecţie biologică dispun de două sisteme care împiedică diseminarea agenţilor
patogeni: bariera de aer şi filtrele. Bariera de aer se realizează prin recircularea aerului
din incinta hotei într-o singură direcţie, cu viteză constantă, fără turbulenţe şi poartă
numele de flux de aer laminar. Filtrele au ca scop reţinerea particulelor existente în
fluxul de aer. Cele mai uzitate sunt filtrele tip HEPA care reţin particulele cu diametrul
de până la 0,3 microni, în proporţie de 99,9%.
Există trei tipuri de hote de protecţie biologică: clasa I, clasa II şi clasa III.
• Hotele de protecţie biologică clasă I
Sunt incinte închise, cu deschidere frontală, ce permit accesul braţelor
operatorului. Aerul pătrunde frontal în spaţiul de lucru şi este evacuat în exterior după
trecerea prin filtrele HEPA. Viteza fluxului de aer este de cca. 4,4 m/s. Acest tip de
hotă este recomandat pentru manipularea microorganismelor de clasă 1, 2 şi 3.
Dezavantajul acestui tip de hotă de protecţie biologică este acela că nu asigură
protecţia materialului biologic, existând riscul contaminării acestuia. Din acest motiv,
hotele de protecţie biologică clasă I nu se recomandă a fi folosite în laboratoarele de
micologie medicală.
• Hotele de protecţie biologică clasă II
Se diferenţiază de cele prezentate anterior prin gradul ridicat de protecţie oferit
utilizatorului, mediului ambiental, dar mai ales materialului biologic analizat, faţă de
posibilii agenţi contaminanţi.
Spaţiul de lucru este ventilat utilizându-se aer filtrat prin filtrele HEPA. De
asemenea, evacuarea aerului se realizează după o filtrare ulterioară prin alte filtre
HEPA. Acest tip de hotă este recomandat pentru manevrarea microorganismelor din
clasa de risc biologic tip 1, 2 şi 3, în care sunt incluşi şi fungii.
În funcţie de caracteristicile de fabricaţie, fluxul de aer şi sistemul de evacuare,
hotele de protecţie biologică clasă II sunt clasificate în:
- Hote de protecţie biologică clasa II-A: evacuează aerul filtrat în incinta
laboratorului sau în afara acestuia. Aerul poate fi recirculat în proporţie de
70%;
- Hote de protecţie biologică clasa II-B1: evacuează aerul filtrat în afara
laboratorului. Recircularea aerului se realizează în proporţie de 30%;
- Hote de protecţie biologică clasa II-B2: evacuează aerul filtrat în afara
laboratorului fară ca acesta să fie recirculat;
- Hote de protecţie biologică clasa II-B3: evacuează aerul filtrat în afara
laboratorului după o recirculare în proporţie de 70%.

12.4. Substanţe decontaminante folosite în laboratoarele de micologie medicală

Capacitatea antifungică (fungicidă şi fungistatică) a substanţelor
decontaminante este diferită în funcţie de structura chimică a acestora şi de clasa de
fungi asupra căreia dorim să acţionăm. Astfel, gama este destul de limitată, existând
doar câteva opţiuni utilizabile eficient (tabelul 12-2).



Norme generale de biosecuritate în laboratoarele de micologie medicală


234
Tabel 12 – 2
Capacitatea antifungică a substanţelor decontaminante
Substanţa
dezinfectantă
Exemple
Nivelul
de
acţiune
Mod de acţiune
Concentraţii
recomandate
Fenoli / Bi-fenoli
Triclosan,
Hexaclorofen
+ + +
Acţionează
asupra
membranei
citoplasmatice
1 – 3%
Hipocloriţi
Hipoclorit de Na,
K, Ca
+ Efect oxidant
0,5 – 1%
Cl activ
Alcooli
Alcool etilic
Alcool izopropilic
-
Nu manifestă
efect fungicid
60- 90%
Aldehide Glutaraldehida + + +
Acţionează
asupra peretelui
fungic
interacţionând
cu chitina
2%
Stocarea la
pH acid,
potenţare la
pH alcalin
Formaldehidă + + +
Efect fungicid
mai redus decât
al
glutaraldehidei
4 %
Biguanidine
Clorhexidina
gluconat
+ +
Acţiune
levuricidă prin
coagularea
constituenţilor
citoplasmatici
0,2 – 0,5%
Iodofori Povidonă iod + + +
Acţiune asupra
nucleotidelor,
acizilor graşi şi
a unelor
proteine
1 – 10%
Compuşi
cuaternari de
amoniu
Clorură de
benzalkoniu
Clorură de
cetilpiridiniu
+
Acţiune prin
dezorganizarea
membranei
plasmatice
0,5%

- Zilnic, după terminarea programului, se va efectua curăţirea suprafeţelor cu
hipocloriţi, în concentraţie de 0,5% Cl activ.
- Suprafeţele de lucru se vor şterge cu detergent lichid şi prosoape de hârtie pentru
îndepărtarea substanţelor organice cu potenţial contaminant, după care pot fi
aplicaţi compuşi pe bază de iod. Datorită coloraţiei imprimate de iod
suprafeţelor tratate, se recomandă utilizarea derivaţilor iodoforici, de exemplu
povidonă-iod (polivinilpirolidonă-iod) în concentraţie de 2%, datorită efectului
antifungic imediat, şi clătirea cu apă după câteva minute pentru eliminarea
coloraţiei reziduale.
Luminiţa-Iuliana Malic


235
C
a
p
i
t
o
l
u
l
 
1
2
 
- În cazul contaminării accidentale cu suspensie fungică, suprafaţa respectivă se va
acoperi cu hârtie de filtru pentru evitarea extinderii ei, se va pulveriza
hipoclorit cu o concentraţie superioară faţă de concentraţia uzuală. Timpul de
acţiune va fi de minim 20 minute. De asemenea, pot fi folosiţi şi compuşi pe
bază iod. Toate materialele care intră în contact cu suprafaţa contaminată vor fi
aruncate într-o cutie specială pentru materiale patogene şi se trimit spre
incinerare.

12.5. Măsuri de protecţie împotriva substanţelor chimice

- Hipocloritul de sodiu - produsele dezinfectante care conţin în compoziţia lor
hipoclorit de sodiu sunt agenţi oxidanţi puternici care eliberează clor gazos;
eliberarea acestuia este accelerată în mediul acid.
- Compuşii cuaternari de amoniu - sunt substanţe încorporate în multiple produse
dezinfectante, datorită gradului redus de periculozitate. Se va ţine însă seama
de capacitatea iritativă pentru tegument şi de cea alergizantă;
- Formaldehida şi glutaraldehida - sunt produse cu un înalt grad de toxicitate;
formaldehida poate fi stocată în laborator în forma gazoază, lichidă (soluţie de
formalină) sau solidă (paraformaldehida). Aceste substanţe pot produce, în
urma contactului direct, iritaţii oculare şi ale tractului respirator superior, iar
contactul prelungit duce la apariţia dermatitelor, alergiilor cutanate şi
respiratorii. Ambele substanţe posedă efect cancerigen. Din acest motiv,
manipularea acestora se va face doar cu mască şi ochelari de protecţie;
- Coloranţii - sunt substanţe folosite pentru diagnostic, în cantităţi foarte mici. Cu
toate acestea, se va evita contactul direct cu aceştia, în special cu produşii
derivaţi din acridină cunoscuţi ca substanţe cancerigene.




















Norme generale de biosecuritate în laboratoarele de micologie medicală


236
Bibliografie selectivă

1. Block S S (1991) - Desinfection, sterilization and preservation;
Pennsylvania; Lea & Febiger.
2. Borell N, Mesquida X, Alomar P (2001) - Normas de seguridad; In Peman
J, Martin-Mazuelos E, Rubio Calvo M C (eds) - Guia Practica de
Identification y Diagnostico en Micologia Clinica; Rev Iberoam Micol,
Bilbao.
3. Collins C H (1993) - Laboratory-acquired; History, incidence, causes and
prevention; Oxford, Butterworth - Heinemann.
4. Hoog G S de, Guarro J, Gené J, Figueras M J (2000) - Atlas of clinical
fungi; 2
nd
edition; Centraalbureau voor Schimmelcultures / Universitat
Rovira i Virgili.
5. Loza E, Alomar P, Bernal A, et al. (1999) - Seguridad en el Laboratorio
de Microbiologia clínica; Procedimientos en Microbiologia clínica;
Recomendaciones de la Sociedad Espanola de Enfermedades infecciosa y
Microbiologia Clinica; Madrid, SEIMC.
6. McDonnell G, Russell A D (1999) - Antiseptics and desinfectants: activity,
action and resistance; Clin Microbiol Rev; 12:147-179.
7. Sewell D L (1995) - Laboratory-associated infections and biosafety; Clin
Microbiol Rev; 8:389-405.
8. Warnock D W (2000) - Mycotic agents of human disease; In Fleming D O,
Hunt D L (eds.) Biological safety principles and practices; American
Society for Microbiology Press;
Washington D C.
Anexă


237
A
n
e
x
ă
 
Anexă
Fig. nr. 2-1.
Zygomicoză cerebrală experi-
mentală; examen microscopic
direct; frotiu prin amprentă,
coloraţie cu calcofluor, x 200.
Fig. nr. 2-2.
Frotiu secreţie vaginală;
col. Gram, x 400.
Fig. nr. 2-3.
Frotiu sediment LCR; col. tuş
de India, x 400.
Anexă


238




Fig. nr. 2-4.
Frotiu măduvă osoasă
hematogenă;
Col. May-Grunwald-Giemsa,
x 400.

Fig. nr. 2-5.
Frotiu hemocultură;
necolorat, x 900.
Fig. nr. 2-6.
Preparat extemporaneu cu
bandă adezivă; lactofenol cu
albastru de metilen, x 900.
Anexă


239
A
n
e
x
ă
 










































Fig. nr. 4-1.
Însămânţarea hemoculturii în picătură.
Fig. nr. 5-1.
Lutarea preparatelor extemporanee.

Fig. nr. 6-1.
Zygomicoză pulmonară;
Col. Fontana-Mason, x 400.

Anexă


240





Fig. nr. 6-2.
Candidoză renală;
col. PAS, 400.
Fig. nr. 8-1.
Testul de hidroliză a ureei – negativ
(stânga), pozitiv (dreapta)

Fig. nr. 8-2.
Colonii de C. neoformans pe Agar cu
extract din seminţe de Niger

Anexă


241
A
n
e
x
ă
 




Fig. nr. 8-3.
Aspectul coloniilor aparţinând
speciilor levurice identificabile
prin cultivare pe CandiSelect
™ 4.

Fig. nr. 8-4.
Aspectul coloniilor aparţinând
speciilor levurice identificabile
prin cultivare pe CHROMagar
Candida.
Fig. nr. 8-5.
Aspectul coloniilor aparţinând
speciilor levurice identificabile
prin cultivare pe Chromogenic
Candida Agar.

Anexă


242




Fig. nr. 8-6.
Kitul Auxacolor 2

Fig. nr. 8-7.
Aspectul galeriei Auxacolor 2
în cazul speciei C. tropicalis
Fig. nr. 8-8.
Aspectul galeriei de
identificare -Microplate
(Biolog)
Anexă


243
A
n
e
x
ă
 



Fig. nr. 8-9.
Aspect microscopic, preparat
extemporaneu, x 1000 – fir de
păr - organe perforatoare in
vitro.
Fig. nr. 8-10.
Cultură de M. canis pe boabe
decorticate de orez

Fig. nr. 8-11.
Candida albicans
Tubi germinativi, preparat
extemporaneu cu lactofenol şi
albastru de anilină; x 400


Index


245
I
n
d
e
x
 
Index


(1,3)‐β‐D‐glucan, ........................................... 153 

5 flucitozină .................................................. 203 

abces subcutanat ............................................ 12 
acid cafeic ..................................................... 182 
acid nicotinic ................................................. 182 
acridină ......................................................... 235 
ADN‐polimeraza ........................................... 196 
Agar 
acetat Fowell ............................................. 46 
acetat McClary .......................................... 46 
acid acetic dicloran extract de drojdie ...... 59 
apă de robinet ........................................... 76 
BCG Candida .............................................. 47 
BIGGY ........................................................ 47 
Blasto "D" .................................................. 48 
Borelli ........................................................ 64 
Bromcrezol purpur cazeină glucoză .......... 49 
Christensen ............................................... 50 
Ciocolat ..................................................... 49 
cireşe ......................................................... 79 
cu acid cafeic şi citrat feric ........................ 51 
cu amidon .................................................. 76 
cu extract de cartof şi glucoză ................... 52 
cu extract de drojdie şi cloramfenicol ....... 52 
cu extract de drojdie şi fitonă .................... 53 
cu extract de malț ..................................... 81 
cu extract de orez ...................................... 53 
cu extract de paprika ................................. 54 
cu extract de sol ........................................ 54 
cu extract de tutun .................................... 55 
cu făină de ovăz ......................................... 66 
cu făină de porumb ................................... 55 
cu făină de porumb şi Tween 80 ............... 56 
cu frunze de garoafă ................................. 56 
cu infuzie de Niger ..................................... 74 
cu L‐canavanină glicină albastru de 
bromtimol ............................................ 57 
cu sucroză şi creatină ................................ 58 
cu sucroză, creatină şi dicloran ................. 59 
Czapek‐Dox ............................................... 86 
Dicloran ‐  Rose  Bengal ‐  cloramfenicol ... 91 
dicloran, extract de drojdie 18 % glicerol .. 60 
diferențiere Aspergillus ............................. 60 
Dixon ................................................... 61, 62 
glicerină ..................................................... 79 
glucoză ‐ peptonă ‐ drojdie ....................... 62 
infuzie  cord ‐ creier .................................. 63 
izolare Candida ......................................... 63 
Lactrimel ................................................... 64 
Leeming..................................................... 65 
Littman ...................................................... 65 
malț ........................................................... 80 
Mueller – Hinton ‐ glucoză 2 % ................. 66 
Nickerson .................................................. 47 
Pal  ............................................................. 67 
pentru studierea morfologiei  levurilor ..... 68 
peptonă ‐ glucoză ‐ fluconazol .................. 69 
peptonă 3% ............................................... 94 
RPMI ‐ MOPS ‐ glucoză .............................. 90 
SABHI ........................................................ 71 
Sabouraud cicloheximidă .......................... 71 
Sabouraud cloramfenicol .......................... 72 
Sabouraud diluat ....................................... 75 
Sabouraud Emmons .................................. 72 
Sabouraud TTC .......................................... 87 
sânge ‐ glucoză ‐ cisteină .......................... 73 
selectiv cu triptofan .................................. 74 
Staib .......................................................... 74 
Takaschio .................................................. 75 
Trichophyton ..................................... 92, 182 
Trichophyton 1 .......................................... 92 
Trichophyton 2 .......................................... 92 
Trichophyton 3 .......................................... 93 
Trichophyton 4 .......................................... 93 
Trichophyton 5 .......................................... 93 
Trichophyton 6 .......................................... 94 
Trichophyton 7 .......................................... 94 
Tween 80 ............................................ 56, 75 
albastru de metilen 3% .................................. 22 
alcalinizare ................................................... 183 
alcool etilic ................................................... 234 
alcool izopropilic .......................................... 234 
alcooli ........................................................... 234 
aldehide........................................................ 234 
AM3 ................................................................ 83 
amfotericină B .............................................. 203 
amorse ......................................................... 196 
amplitaq gold ............................................... 195 
antibiotic medium 3 ....................................... 83 
Index

246
Antifungigrama 
alegerea antifungicelor ................... 204, 206 
aplicarea benzilor E‐test .......................... 204 
Aspergillus ............................................... 206 
Candida ................................................... 203 
CLSI M44‐A .............................................. 208 
Cryptococcus ........................................... 203 
Fusarium .................................................. 206 
heterorezistență ...................................... 204 
metoda difuzimetrică Kirby‐Bauer .......... 208 
prepararea inoculului ...................... 203, 206 
recomandări de interpretare .................. 209 
reguli de citire a CMI ....................... 204, 207 
Rhizopus .................................................. 206 
Rhodotorula ............................................ 203 
Scedosporium .......................................... 206 
tehnica de lucru pentru fungi  
  filamentoşi ......................................... 206 
tehnica de lucru pentru levuri ................. 203 
Trichosporon............................................ 203 
aparate protetice amovibile ........................... 12 
artrospori ........................................................ 85 
ascospori ........................................................ 46 
asimilarea surselor de azot ........................... 180 
asimilarea surselor de carbon ...................... 180 
aspiratul endotraheal ..................................... 10 
aspiratul prostatic ........................................... 15 
aspiratul pulmonar ......................................... 11 
aspiratul traheostomic ................................... 10 

bandă adezivă ................................................. 22 
banda adezivă BIO TAPE ............................... 225 
BHI .................................................................. 63 
bi‐fenoli ........................................................ 234 
biguanidine ................................................... 234 
biopsia pulmonară .......................................... 11 
biopsia testiculară .......................................... 15 
biosecuritate ................................................. 229 
Blankophor ..................................................... 21 
Blast .............................................................. 198 
blastoconidii ................................................... 85 
bromcrezol purpur ....................................... 183 
bromură de etidiu ......................................... 193 
bronhoscopia .................................................. 11 
Bulion 
cu uree ...................................................... 77 
Czapek‐Dox ................................................ 86 
Sabouraud ................................................. 78 

C. albicans .................................................... 185 
C. dubliniensis ....................................... 185, 194 
calcofluor ....................................................... 21 
capacitate alergizantă .................................. 230 
Caseta 
AIR‐O‐CELL .............................................. 212 
BIOCELL ................................................... 215 
CYCLEX‐D ................................................. 215 
LARO 100 ................................................ 216 
MICRO‐5 .................................................. 214 
caspofungină ................................................ 203 
cateter .............................................................. 3 
cerneală Parker .............................................. 21 
CHROMagar Candida ................................ 45, 78 
Chromas ....................................................... 198 
clamidospori .................................. 55, 67, 85, 87 
clarificarea cu KOH şi dimetil sulfoxid ............ 25 
clase de risc biologic ..................................... 229 
clorhexidina gluconat ................................... 234 
clorură de benzalkoniu ................................. 234 
clorură de cetilpiridiniu ................................ 234 
coloranți ....................................................... 235 
Colorația 
albastru Alcian – pentru mucopolizaharide 
acide .................................................. 126 
Bauer ....................................................... 128 
Chick ........................................................ 130 
cu acid periodic Schiff ............................. 143 
cu calcofluor alb şi KOH 10% ..................... 26 
cu hidroxid de potasiu şi cerneală Parker . 25 
cu lactofenol şi albastru de anilină ............ 24 
cu mucicarmin Southgat ........................... 35 
fluorescentă cu acid periodic Schiff ........ 142 
Fontana‐Masson ..................................... 135 
Giemsa ...................................................... 31 
Gomori‐Grocott ...................................... 139 
Gram ......................................................... 28 
Gram ‐ calcofluor alb ................................. 30 
Gridley ..................................................... 131 
Gridley fluorescentă ................................ 138 
Hemalaun – Eozină ................................. 123 
May‐Grunwald‐Giemsa ............................. 32 
methenamine silver‐modificată .............. 139 
Musto ........................................................ 36 
negativă cu mercurochrom 2 % şi tuş de 
India ..................................................... 23 
negativă cu tuş de India ............................ 22 
PAS .......................................................... 143 
PAS flourescentă ..................................... 142 
Schmorl ................................................... 133 
Wright ....................................................... 34 
Index


247
I
n
d
e
x
 
Ziehl ‐ Neelsen ......................................... 145 
compoziția mediilor de cultură ....................... 42 
compuşi cuaternar de amoniu ...................... 234 
conservare dermatofiți ................................... 95 
controlul calității acizilor nucleici ................. 193 
controlul de calitate ....................................... 44 
cromomicoză .................................................. 12 
cultivare submersă ....................................... 105 
cultivarea în „picătură suspendată” ............. 106 
cultivarea pe bloc de geloză ......................... 106 
cultivarea pe lamă ........................................ 106 
cultivarea pe suporturi transparente ........... 105 

dermatofiți ................................................... 184 
detecția CO
2
 ...................................................... 4 
diferențiere ................................................... 185 
dispozitive intravasculare ................................. 3 
dispozitivul CIP 10M ..................................... 219 
DTM ................................................................ 88 
durata incubării ................................................ 7 

electroforeza în gel de agaroză .................... 193 
endodontite .................................................... 12 
epuizare pe medii solide ............................... 101 
etalare în puncte izolate ............................... 101 
evidențierea capsulei ...................................... 22 
examen microscopic direct ............................. 21 
expectorație indusă ........................................ 10 
expectorație spontană .................................... 10 
extract de cartofi ............................................ 80 
extracția ADN ............................................... 191 
extracția ADN‐ului prin crioprecipitare......... 192 

fenoli............................................................. 234 
fermentarea zaharurilor ............................... 179 
filtre HEPA .................................................... 232 
fire de păr ......................................................... 9 
fixarea ........................................................... 113 
Fixatori 
Bouin ............................................... 114, 116 
Hollande .......................................... 114, 116 
soluția de formol 10% tamponată ... 114, 115 
flacoane de hemocultură .................................. 2 
fluconazol ..................................................... 203 
fluidele intraoculare ......................................... 9 
formaldehidă ................................................ 234 
formular de cerere ........................................... 1 
fragmente tisulare biopsice ............................ 15 
fragmente unghiale .......................................... 9 
frotiu citobacteriologic ................................... 14 
frotiu colorat May‐Grunwald‐Giemsa ............ 22 
fungi aeropurtați .......................................... 211 
Fungitell ........................................................ 153 
controlul calității ..................................... 158 
interpretarea rezultatelor ....................... 157 
limite ....................................................... 158 
tehnică de lucru ...................................... 155 
valori aşteptate ....................................... 159 

galactomanan ............................................... 160 
gel de agaroză 1% ......................................... 193 
GenBank ....................................................... 198 
germ‐tube test ............................................. 185 
glutaraldehida .............................................. 234 
Guizotia abyssinica ......................................... 74 

Hemocultura 
volumul de sânge ........................................ 4 
hexaclorofen ................................................ 234 
hidroliza cazeinei .......................................... 184 
hife ................................................................. 85 
hipoclorit de Ca ............................................ 234 
hipoclorit de K .............................................. 234 
hipoclorit de Na ............................................ 234 
hipocloriți ..................................................... 234 
histidină ........................................................ 182 
Histidină HCl ................................................... 94 
hote de protecție biologică .......................... 232 
hotele de protecție biologică ....................... 233 

impactorul Zefon Z‐A6 .................................. 217 
impetigo ........................................................... 9 
imunofluorescență ......................................... 22 
infuzie de cartofi ...................................... 52, 80 
înglobare ...................................................... 101 
inozitol.......................................................... 182 
Index

248
inozitol ............................................................ 93 
iodofori ......................................................... 234 
itraconazol .................................................... 203 
ITS 1 ...................................... 194, 195, 196, 197 
ITS 4 ...................................... 194, 195, 196, 197 

kit‐uri de extracție ADN ................................ 191 

latex‐aglutinare C. dubliniensis ..................... 172 
lavajul bronhoalveolar .................................... 11 
LBA .................................................................. 11 
lichid pericardic .............................................. 11 
lichid peritoneal .............................................. 11 
lichid pleural ................................................... 11 
lichid sinovial .................................................. 11 
lichidul cefalo‐rahidian ..................................... 8 
L‐prolin‐aminopeptidaza .............................. 182 
Lutare 
preparate extemporaneu ........................ 111 

M. audouinii ................................................. 185 
M. canis ........................................................ 185 
măduva osoasă hematogenă ............................ 8 
manan seric .................................................. 169 
markeri de greutate moleculară ................... 193 
medii cromogene............................................ 45 
medii de cultivare ........................................... 46 
medii difazice .................................................... 5 
medii diferențiale ........................................... 43 
medii hipertone ................................................ 6 
Mediu 
bază pentru levuri ..................................... 82 
cu lapte diluat............................................ 84 
cu pâine ..................................................... 85 
cu sol ......................................................... 85 
de conversie .............................................. 86 
pentru izolarea dermatofiților ................... 88 
sintetic pentru testul de filamentare ........ 83 
mediul 
Christensen ............................................. 181 
Mediul 
Bilai ............................................................ 84 
Kurung‐Yegian ........................................... 86 
Nikersen‐Mankovski .................................. 87 
Pagano‐Levin ............................................. 87 
RPMI 1640 ........................................... 70, 89 
RPMI 1640 MOPS (CLSI) ............................ 89 
RPMI 1640 MOPS (EUCAST) ...................... 89 
metoda Dalmau ............................................ 105 
metoda lizei cu centrifugare ............................. 5 
micetom ......................................................... 12 
momentul prelevării ......................................... 4 
mucoasa orală ................................................ 12 
mucopolizaharide capsulare ........................ 126 
Musto ............................................................. 22 

NCBI .............................................................. 198 
negru clorazol ................................................. 21 

organe perforatoare ..................................... 184 

păstrarea mediilor .......................................... 44 
PCR ............................................................... 191 
PCR duplex ................................................... 194 
PDA ..................................................... 42, 52, 80 
periajul bronşic ............................................... 11 
Pityriasis versicolor ................................... 10, 22 
plăgi deschise ................................................. 12 
Platelia
 ® 
Aspergillus ...................................... 160 
Platelia Aspergillus 
interpretarea rezultatelor ....................... 164 
principiul testului .................................... 160 
tehnica de lucru ...................................... 162 
Platelia Candida AC 
interpretarea rezultatelor ....................... 167 
principiul testului .................................... 165 
tehnica de lucru ...................................... 166 
Platelia Candida Ag 
interpretarea rezultatelor ....................... 171 
principiul testului .................................... 169 
tehnica de lucru ...................................... 170 
Platelia
®
 Candida Ac ..................................... 165 
Platelia
®
 Candida Ag ..................................... 169 
posaconazol.................................................. 203 
povidonă iod ................................................ 234 
prelevate balano‐prepuțiale ........................... 15 
prelevatul otic .................................................. 9 
prepararea mediilor ....................................... 43 
Index


249
I
n
d
e
x
 
preparat extemporaneu ........................... 21, 22 
Preparatul extemporaneu 
cu bandă adezivă ..................................... 110 
cu lactofenol şi albastru de anilină .......... 109 
primeri .......................................................... 196 
principiul impregnării argentică ..................... 38 
probele biopsice transbronhiale ..................... 11 
procesarea țesuturilor .................................. 117 
Procesarea țesuturilor 
clarificarea ............................................... 119 
colorarea ................................................. 123 
deshidratarea .......................................... 118 
etalarea secțiunilor ................................. 121 
etichetarea şi arhivarea ........................... 150 
impregnarea cu parafină ......................... 119 
includerea ............................................... 120 
montarea ................................................. 148 
secționarea .............................................. 120 
producerea altor enzime .............................. 182 
producerea de fenol‐oxidază ........................ 182 
producerea de urează................................... 180 
proteinaza K .................................................. 191 
pseudohife ...................................................... 85 
puncție rahidiană .............................................. 8 
puncție sternală ................................................ 8 
puncție venoasă periferică ............................... 3 
pungi parodontale .......................................... 12 
purificarea izolatelor levurice ....................... 103 

raclatul cornean ................................................ 9 
Recoltare 
precauții ...................................................... 1 
rezistența la cicloheximidă ........................... 181 
risc colectiv ................................................... 229 
risc individual ................................................ 229 

sânge ................................................................ 2 
scotch ........................................................... 110 
scuame cutanate .............................................. 9 
secreția prostatică .......................................... 15 
secreții purulente ........................................... 12 
secreții respiratorii joase ................................ 10 
secreții vaginale .............................................. 14 
secvențializarea fragmentelor amplificate ... 198 
secvențializarea regiunilor ITS ...................... 196 
secvențializator ............................................ 198 
semințe de Niger .......................................... 182 
semnificația hemoculturilor pozitive ................ 8 
ser sanguin ................................................... 185 
sisteme automate ............................................ 4 
sisteme semiautomate ..................................... 4 
spălătura bronşică .......................................... 11 
speculum ........................................................ 14 
sporothricoză ................................................. 12 
sputa .............................................................. 10 
sterilizarea mediilor ....................................... 43 
substanțe cancerigene ................................. 235 
substanțe decontaminante .......................... 233 

Tehnica 
însămânțării levurilor pe Agarul cu  
făină de porumb şi tween 80 .................. 105 
tehnica aspirației cu ac fin .............................. 16 
tehnica sedimentării Koch ............................ 224 
Tehnici 
de aeromicologie .................................... 211 
de evaluare a sensibilității 
   la antifungice .................................... 203 
de examinare microscopică a fungilor 
   din culturi .......................................... 109 
de histopatologie .................................... 113 
de însămânțare ....................................... 101 
de microscopie directă .............................. 21 
de procesare primară .................................. 1 
de recoltare ................................................. 1 
de seromicologie ..................................... 153 
de transplantare ............................. 101, 107 
de transport ................................................ 1 
test de opacifiere ........................................... 75 
test urează ...................................................... 77 
teste biochimice ........................................... 179 
teste fiziologice ............................................ 179 
Testul 
de blasteză .............................................. 185 
de cultivare pe Agar BCP‐lapte‐glucoză .. 183 
de cultivare pe boabe de orez ................. 185 
de depistare a necesităților nutritive 
speciale .............................................. 182 
de filamentare......................................... 185 
de hidroliză a ureei la dermatofiți ........... 181 
de hidroliză a ureei la levuri .................... 180 
de perforare a firului de păr in vitro ....... 184 
de termostimulare .................................. 186 
de termotoleranță .................................. 186 
tiamină ......................................................... 182 
tiamină HCl ..................................................... 93 
tinea ................................................................. 9 
Index

250
transluminator .............................................. 193 
triclosan ........................................................ 234 
tub germinativ .............................................. 185 
tubi germinativi .............................................. 84 
tuş de India ..................................................... 22 

Urina 
cateterism vezical ...................................... 13 
cateterizare vezicală .................................. 13 
recoltare la bărbați .................................... 13 
recoltare la femei ...................................... 12 
recoltarea pe cateter preexistent.............. 13 
recoltarea prin puncție suprapubiană ....... 13 

valve ............................................................... 14 
vizualizarea gelului ....................................... 193 
voriconazol ................................................... 203 

Yeast Carbon Base .......................................... 82 

zygomicete ..................................................... 85 
zygomicoza ..................................................... 15 
Β 
β‐galactozaminidaza..................................... 182 


w
w
m





P

V

A

Se

Tr



www.fungi.ro
www.journal.fu
micologiemedi
OP 6, C
Iaşi, Ro
Consil
Preşedinte:
Vicepreşedinte
dministrator p
ecretar:
Trezorier:

fungi.ro
icala@gmail.c
CP 1356
omânia
liul director
e:
publicaţii:
de M

251


com
:
Dr. M
mih
Dr. Bo
bogd
Ing. Io
ionu
Dr. In
ingr
Dr. Lu
lum
Soci
Micologie M
1
Mihai Mareş
aimares@fun
ogdan Dorofte
dandoroftei@
onuţ Ailincăi
utailincai@fun
ngrid Cezara A
ridapetrei@fun
uminiţa Malic
initamalic@fu
ietatea Rom
Medicală şi M
ngi.ro
ei
@fungi.ro
ngi.ro
Apetrei
ngi.ro
c
fungi.ro
mână
Micotoxicoloogie

Copyright © 20 C 007 Societatea Rom mână de Mic cologie Medic cală şi Micoto oxicologie Nici o p parte a acestei publicaţii nu poate fi repro i u odusă, transm misă, stocată sa difuzată în orice formă sau prin orice mijloace, fără acordul scris al au s ă s S.R.M.M.M. T Toate cererile de reproducer a materialel publicate v fi d re lor vor ad dresate în scri pe adresa: is Societa Română de Micologie M atea d Medicală şi M Micotoxicolog gie OP 6, C 1356 CP Iaşi – R România Editor v volum şi desig copertă: gn ing. Ion Ailincăi nuţ Comenz la: zi Societa Română de Micologie M atea d Medicală şi M Micotoxicolog gie OP 6, C 1356 CP Iaşi – R România e-mail: comenzi@fungi.ro www.fu ungi.ro

Descr rierea CIP a Bibliotecii Na B aţionale a Ro omâniei Tehni de laborat în micolo ici tor ogia medicală / sub red.: ă Mihai Mare – Iaşi : PIM 2007 eş. M, Bibliogr. Index. ISBN 978-9 973-716-677-7 I. Mar Mihai (ed reş, d.) 543.06 582.28

Editura PIM Şo Ştefan cel Mare nr. 11 os. www.pimcopy.ro w Ia România aşi

II

Autori • Ingrid Cezara Apetrei Doctor medic veterinar, doctorand Laboratorul de Microbiologie – Imunologie Departamentul de Sănătate Publică Facultatea de Medicină Veterinară Universitatea de Ştiinţe Agricole şi Medicină Veterinară “Ion Ionescu de la Brad”, Iaşi Olimpia Bazgan Doctor medic veterinar, doctor în Medicină Veterinară Profesor universitar Laboratorul de Micologie - Micotoxicologie Departamentul de Sănătate Publică Facultatea de Medicină Veterinară Universitatea de Ştiinţe Agricole şi Medicină Veterinară “Ion Ionescu de la Brad”, Iaşi Petru Cazacu Doctor medic veterinar, doctorand Laboratorul de Histologie Departamentul de Ştiinţe Fundamentale Facultatea de Medicină Veterinară Universitatea de Ştiinţe Agricole şi Medicină Veterinară “Ion Ionescu de la Brad”, Iaşi Maria Dan Doctor medic, doctor în Medicină Laboratorul de Microbiologie Institutul de Boli Cardiovasculare “G. Georgescu” Iaşi Bogdan Doroftei Doctor medic, doctor în Medicină Preparator universitar Clinica II Obstetrică - Ginecologie Facultatea de Medicină Universitatea de Medicină şi Farmacie “Gr. T. Popa” Iaşi

III

Luminiţa - Iuliana Malic Doctor medic veterinar, doctorand Laboratorul de Micologie - Micotoxicologie Departamentul de Sănătate Publică Facultatea de Medicină Veterinară Universitatea de Ştiinţe Agricole şi Medicină Veterinară “Ion Ionescu de la Brad”, Iaşi Magdalena Mareş Medic dentist, doctorand Preparator universitar Departamentul de Protetică Facultatea de Medicină Dentară Universitatea “Petre Andrei”, Iaşi SC Dentomedica SRL Mihai Mareş Medic dentist, doctor medic veterinar, doctor în Medicină Şef de lucrări Departamentul de Microbiologie Facultatea de Medicină Dentară Universitatea “Petre Andrei”, Iaşi Laboratorul de Micologie – Micotoxicologie Departamentul de Sănătate Publică Facultatea de Medicină Veterinară Universitatea de Ştiinţe Agricole şi Medicină Veterinară “Ion Ionescu de la Brad”, Iaşi

IV

Volum editat cu sprijinul BRD-GSG
V

...8 1.................. Coloraţia Wright ...............11 1....3 1............... 2 Tehnici de microscopie directă ...................................10 1...........1....................................................8...........11..........................24 2....... Fluidele intraoculare ............11..11 1..............................................4........30 2....... Volumul de sânge ce urmează a fi însămânţat.................18 Cap............. Coloraţia Gram ...................2 1.............36 Bibliografie selectivă .........9............................................................................9 1........28 2...12 1................. 1 Tehnici de recoltare.....................9 1............1.......................19.................. Raclatul cornean ...................15............................22 2....5..........................1....14 1.............6................................ Recoltarea sângelui pentru hemocultură .calcofluor alb ..... Fragmentele unghiale şi scuamele cutanate ....................1......4 1.......................................... Prelevatul otic ................8....15 1...................... Coloraţia Giemsa....9 1......15 Bibliografie selectivă ............ Lichidul cefalo-rahidian .....12........................13..............11 1...15 1..................1..................................................................................... Coloraţia cu hidroxid de potasiu şi cerneală Parker ........................................... Clarificarea cu hidroxid de potasiu şi dimetil sulfoxid ................. Coloraţia negativă cu mercurochrom 2% şi tuş de India ..... Coloraţia Musto ............................................................3........................21 2.....................2...................................................................1............6..... Măduva osoasă hematogenă.......... Urina .............................. Biopsia pulmonară .................................. Tehnica aspiraţiei cu ac fin ...................................23 2................................39 VI ..................... Coloraţia May-Grunwald-Giemsa...........................9..10.........................25 2........13............................ Fragmentele tisulare biopsice........................................... Secreţiile respiratorii joase ...................................... Numărul de hemoculturi şi momentul prelevării ..5............................35 2............................................................................................... Coloraţia negativă cu tuş de India . Medii de cultură .. transport şi procesare primară a prelevatelor clinice.....14..................7........... Secreţiile vaginale ........................1............................32 2...4 1...........4................................. Aspiratul pulmonar .5................. Semnificaţia hemoculturilor pozitive cu fungi saprobioţi .......................12...........3.... Alte fluide organice normal sterile...................31 2...........................12 1..... Firele de păr ........ Coloraţia cu mucicarmin Southgat ..........................9 1......25 2.........1 1..... Coloraţia Gram.....................................................16.................12 1.............10............... Coloraţia cu calcofluor alb şi KOH 10% ......................................................... Durata incubării şi prelucrarea hemoculturilor .................4..............................26 2.......................................1............................................................................6...........7 1....18...............7................. Sângele ..4 1.2....... Coloraţia cu lactofenol şi albastru de anilină ...................................................8 1....8 1.............Cuprins Cap......................................1........................34 2........9 1......17..3....................... Produsele patologice de la nivelul mucoasei orale...... Produse patologice de la nivelul tractului genital masculin .................................................................................2....................................... Secreţiile purulente din abcese subcutanate sau din plăgi deschise ......................

.........................2................7....116 6.......................113 6...............43 3........... Examenul macroscopic .......41 3..8 ..............101 4....... Tehnica însămânţării levurilor pe Agarul cu făină de porumb şi tween 80 .123 6...........................4...................................................................... Formol soluţie 10% tamponată pH 6......112 Cap............2.................................4...... Tehnica de cultivare pe suporturi transparente ...........96 Cap.......................... Includerea ................................................................4...................3.................................................. Tehnica de cultivare în „picătură suspendată” ............3..........4.2.........................................................................119 6..3................................................................4........................................ Controlul de calitate şi păstrarea mediilor ...........109 5....101 4.. 5 Tehnici de examinare microscopică a fungilor din culturi .......1.........113 6.....105 4.........................................120 6.......2........5.................2....................3............................. Preparatul extemporaneu cu lactofenol şi albastru de anilină (fungi filamentoşi) ...................... Tehnici speciale..................................................120 6.........................................1.................................110 5...... Compoziţia mediilor de cultură.................3............................... Clarificarea ................. Colorarea ............2....... Obţinerea probelor ....................44 Medii de cultivare ...........................3..... Fixarea .......................... Prepararea şi sterilizarea mediilor ................................. Impregnarea cu parafină ....107 Bibliografie selectivă ............. Deshidratarea ..................................108 Cap.................103 4....................................................113 6...................4.....1...4......... Lutarea preparatelor extemporanee ...110 5...........3...42 3......... Preparatul extemporaneu cu bandă adezivă .......................113 6........... Tehnici uzuale .............. Tehnici de transplantare ..2...2.... Preparatul extemporaneu cu lactofenol şi albastru de anilină (levuri) ..................................................................................................1.....46 Bibliografie selectivă .... Secţionarea...............................................................................................................115 6.................................. 6 Tehnici de histopatologie ................................1.....................................................................................2....116 6.....1...................106 4.....3................................................................................................. 4 Tehnici de însămânţare şi transplantare ............5.........................................................................................3......4... Generalităţi .5........41 3..........................1............. Fixatorul Hollande ....4.................. Tehnica de cultivare pe bloc de geloză ....................6......................2....................................... Procesarea ţesuturilor .2.................. Montarea ..................105 4......... Etalarea secţiunilor .....106 4.............................148 VII ..............119 6..2.....103 4...........................................................4....3........ 3 Medii de cultivare ....111 Bibliografie selectivă ....117 6......................................................................... Fixatorul Bouin ...4....................4...............Cap.109 5.............. Tehnica de purificare a izolatelor levurice ....................................................................................................118 6.............................................121 6..........

......................................3....................................4.........................3............ Materiale furnizate odată cu kitul ..............6...................................................................................160 7....................................................... Platelia® Candida Ag .................2......................................1........................................... Limite ........................................1.6........4............1......4.........4..2...... Controlul calităţii ....................... Conservarea reactivilor desigilaţi şi a celor reconstituiţi ..........155 7.......... 8 Teste biochimice şi fiziologice ..................... Materiale necesare dar nefurnizate împreună cu kitul ........ Fermentarea zaharurilor ..4............ Platelia ® Aspergillus ......................................2.................... Capacitatea de asimilare a surselor de carbon.2................................3..6......... Materiale necesare.153 7.......................159 7.........3......................................1..3. Atenţionări şi precauţii ................................................................................................ Platelia® Candida Ac ...................1....................... Introducere ........2................................................162 7............153 7..........................180 8...................................169 7....................10.......9... Materiale furnizate odată cu kitul ....154 7....................169 7.1.2.........12.......................4.1............... Valori aşteptate .....................................6..............161 7....173 Cap.................179 8.....165 7............1...........11.4..............3...... Principiul testului.................................... Recoltarea / Stocarea / Marcarea probelor....................................................................171 7......................................................3...3............167 7... Interpretarea rezultatelor...................... Capacitatea de asimilare a surselor de azot ...........166 7.......... Păstrarea reactivilor ........ Tehnică de lucru ............. Etichetarea şi arhivarea ....... Principiul testului...2.............4.............154 7.....1.........6.............4... Introducere ......4....4..................150 Bibliografie selectivă .......5....172 Bibliografie selectivă .....................2....161 7..................................................................................165 7.............155 7....1.............. Principiul testului........3.......157 7.................................................. Materiale necesare dar nefurnizate odată cu kitul ............2... Identificarea speciei Candida dubliniensis prin latex-aglutinare ......................................153 7..................166 7........151 Cap................5..................155 7.................... Principiul testului..........5. Materiale necesare dar nefurnizate impreună cu kitul . Materiale furnizate împreună cu kitul...........................170 7........................3..158 7............................... Tehnica de lucru .........Index 6........180 VIII .8....... Interpretarea rezultatelor.........................159 7.......5................................ Tehnica de lucru .....1..........3..169 7...... Maniera de calcul şi interpretarea rezultatelor. Materiale furnizate împreună cu testul Fungitell .155 7..5..........1.............. dar nefurnizate odată cu kitul ..................165 7..7...1.........3.....169 7........1..2...........................................1........................................2..............1 Fungitell™ ..................158 7......................164 7..............................179 8.....165 7..............169 7.....1.2........................ Tehnica de lucru ....... Interferarea cu alte substanţe .................................160 7..... Interpretarea rezultatelor.............................. 7 Tehnici de seromicologie .......................................1......160 7..............................

...... ................... Identificarea moleculară a levurilor prin PCR şi secvenţializarea regiunilor ITS ............. Caseta MICRO-5...... 8........................ 8...5.... Caseta AIR-O-CELL™ ...................................191 9.........................227 IX .................................................224 11......12.. Testarea sensibilităţii la antifungice prin metoda difuzimetrică Kirby-Bauer ........... Tehnica de lucru pentru levuri ......................... Aprecierea încărcăturii fungice aeropurtate ...4...........1...................................................................... Testul de hidroliză a ureei (producerea de urează) la levuri ...................203 10.....................226 11..193 9..196 9.......... Caseta LARO 100 ........................................214 11...........216 11...........................11...10....5..........2......................6..............182 Testul de depistare a necesităţilor nutritive speciale ....210 Cap........................................2........9................................................3...188 Cap.....1........ Tehnica de lucru pentru fungi filamentoşi ............... Impactorul Zefon Z-A6 . 11 Tehnici de aeromicologie ............................7..226 Bibliografie selectivă ....................... Controlul calităţii acizilor nucleici extraşi ...............8.............. 8...................201 Cap..180 Testul de hidroliză a ureei (producerea de urează) la dermatofiţi ...................7..................8........................6.......................................... 8...............................217 11..9.......3.......186 Bibliografie selectivă ...... Caseta BIOCELL ...... Reactivi utilizaţi în tehnicile de biologie moleculară ........191 9........................ Identificarea speciei Candida dubliniensis prin PCR duplex ............13............ 10 Tehnici de evaluare a sensibilităţii la antifungice ...................8.................................................................................................................................................................4..........1....206 10...................181 Testarea rezistenţei la cicloheximidă .200 Bibliografie selectivă .....................208 Bibliografie selectivă ......................................9............................ Extracţia ADN-ului pentru PCR ........185 Testul de termotoleranţă / termostimulare ......215 11...................225 11................................... 8.................................. 8..............................212 11......................9................. Recoltarea fragmentelor inerte .....3..................................3.................. Tehnici de recoltare/examinare directă a probelor ...............6........211 11...... 8...............................9.................................182 Testarea producerii altor enzime ............. Extracţia ADN-ului prin crioprecipitare (fungi filamentoşi) ........5.............................................192 9... 8............................225 11...................4..............182 Testul de cultivare pe Agar BCP-lapte-glucoză....... 8.183 Testul de perforare a firului de păr in vitro.........................185 Testul de filamentare (testul de blasteză sau germ-tube test)............2.......14.........194 9... Extracţia ADN-ului cu ajutorul kit-ului High Pure Template Preparation Kit (levuri) ...................7. Caseta CYCLEX-D .215 11.....................2..........................191 9.........................................184 Testul de cultivare pe boabe de orez ......219 11................203 10...........181 Producerea de fenol-oxidază .................... ...............1.... Recoltarea cu ajutorul tamponului tip exsudat ........... Dispozitivul CIP 10M .. 8.............. Banda adezivă BIO TAPETM (Zefon International) .......................................................... 9 Tehnici de micologie moleculară ........................

................. Tehnici de laborator folosite în zona de lucru .................... Metode de protecţie primară ....3................. Substanţe decontaminante folosite în laboratoarele de micologie medicală.......2.......................1........1.. Clasificarea fungilor în funcţie de clasele de risc biologic ........ 12 Norme generale de biosecuritate în laboratoarele de micologie medicală ...1.....232 12.........2..235 Bibliografie selectivă .................230 12..... Norme generale de biosecuritate ...................3............................................ Hote de protecţie biologică ........................................................................................................................................................245 X ...236 Anexă ......237 Index .........................................................Index Cap.......4..................................................................... Măsuri de protecţie împotriva substanţelor chimice ...................233 12......................................5.....229 12..............................232 12................229 12..232 12..................................................

Scopul prezentului volum este de a pune la dispoziţia medicului de laborator şi clinicianului o suită de tehnici utile în diagnosticarea şi managementul ulterior al micozelor. de la prelevarea probelor până la testele de sensibilitate la antifungice. în prima jumătate a secolului trecut. unele tehnici sau proceduri au fost omise. într-o manieră cât mai comprehensibilă. au apărut date din ce în ce mai certe privind implicarea fungilor într-o serie de entităţi nosologice care pot fi grupate în micoze (superficiale. au reprezentat argumentele primordiale ale acestui demers publicistic. oriunde” este cât se poate de veridică. Micoze precum aspergiloza invazivă. micotoxicoze şi alergoze. atât din punct de vedere epidemiologic (augmentarea incidenţei micozelor invazive). sunt astăzi recunoscuţi ca agenţi patogeni redutabili în cazul gazdelor imunocompromise. existând în mediul ambiant doar ca banali contaminanţi. Se consideră că aproximativ 5% dintre decesele intraspitaliceşti se datorează unei cauze sau complicaţii fungice. sistemice). Autorii Iaşi. singurele manifestări induse de aceştia – candidozele superficiale şi dermatofitozele – având un prognostic vital favorabil. Odată cu individualizarea micologiei medicale ca ştiinţă de sine stătătoare în cadrul microbiologiei. când organismele umane sunt supuse intervenţiei a numeroşi factori agresivi care le destabilizează homeostazia şi le induc modificări reactive detrimentale. a autorilor. Am încercat prezentarea acestora în succesiunea lor logică. dintre colonizare şi oportunism. şi intensificării investigaţiilor în acest domeniu. neexistând practic o delimitare strictă. Salvarea şi ameliorarea calităţii vieţii pacienţilor critici. dar mai ales a celor invazive. urmărind toate etapele demersului diagnostic. Inevitabil. este extrem de labilă. Speranţa noastră. În condiţiile actuale. iar sugestiile cititorilor avizaţi vor sta la baza unei eventuale noi ediţii. este ca acest ghid să aducă o viziune unitară în micologia clinică din România şi să contribuie la ameliorarea capacităţii de diagnostic şi control a micozelor. printr-un diagnostic etiologic corect şi o monitorizare riguroasă a terapiei antifungice. 1 – 2 decenii în urmă ca nepatogeni. cu prognostic infaust.Prefaţă Fungii – microorganisme familiare tuturor prin omniprezenţa şi diversitatea lor. cât şi diagnostic sau terapeutic. Bineînţeles. De asemenea. referindu-ne la posibilitatea implicării unei specii fungice sau a alteia în determinarea unor entităţi morbide. fie pentru a nu supraîncărca textul cu informaţie redundantă. am imprimat lucrării un caracter de ghid practic. varianta propusă este perfectibilă. au fost consideraţi mult timp inofensivi pentru om. reducând la maxim consideraţiile teoretice. putem întâlni orice. zygomicozele sau scedosporiozele sunt responsabile de un număr crescând de decese prin diagnosticarea adeseori dificilă şi terapia extrem de costisitoare şi de multe ori ineficace. Fungi consideraţi cu cca. atât a celor superficiale. Limita dintre patogen şi nepatogen. iulie 2007 XI . fie din cauza performanţelor reduse ale acestora. profunde. Fungii patogeni reprezintă astăzi o provocare pentru lumea medicală. aserţiunea că “practic.

.

Cantitatea / volumul prelevatului trebuie să fie suficient de mare pentru a permite efectuarea examenului microscopic direct. Formularul de cerere pentru analize microbiologice Probele prelevate vor fi însoţite obligatoriu de un formular de cerere pentru analize microbiologice care va cuprinde datele de identificare ale pacientului. cultivarea şi eventual examenul histopatologic pe biopsie. Bogdan Doroftei. Magdalena Mareş. probele se introduc în pungi din plastic tip ziplock. transport şi procesare primară a prelevatelor clinice Maria Dan. Tratamentele recente cu antifungice trebuie imperios specificate pentru a ajuta microbiologul la interpretarea rezultatelor testelor şi la efectuarea antifungigramei. Mihai Mareş 1 R Tehnici de recoltare. 1 Capitolul 1   . Unele date anamnetice (profesie. Rezultatele serologice şi culturale anterioare trebuie de asemenea specificate dacă au fost efectuate. Se urmează precauţiile standard pentru recoltarea şi manipularea produselor biologice. special instruit în acest scop. Se tratează toate probele ca fiind potenţial periculoase.) ca şi unele informaţii clinice relevante sunt importante pentru medicul de laborator în procesarea optimă a probelor şi vor fi furnizate de către clinician în acelaşi formular. Precauţii 1. Magdalena Mareş. Bogdan Doroftei. tipul prelevatului. cu buzunar lateral (pentru formularul de cerere). Petru Cazacu. ora recoltării şi examenele de laborator necesare. Modul de prelevare a probelor şi operaţiunile ulterioare la care acestea vor fi supuse sunt specifice fiecărui situs de recoltare şi pot reprezenta tot atâţia factori limitativi pentru un diagnostic eficient în cazul executării lor incorecte. Mihai Mareş ecoltarea sau prelevarea probelor este o acţiune deosebit de importantă pentru diagnosticul diverselor micoze interne sau superficiale. pentru a fi contactat în cazul unor rezultatele critice sau urgente. ea fiind o etapă critică a acestui demers. călătorii în zone endemice etc. numărul de telefon. După recoltare în recipiente adecvate. Formularul de cerere va conţine şi numele medicului.Maria Dan. Se recomandă ca prelevarea probelor să fie realizată de personalul laboratorului de micologie. 2. Petru Cazacu. clar indicate. Procesarea probelor va începe cât mai curând posibil după recoltare. fără a depăşi timpul maxim de aşteptare.

Colectarea probelor se va face în recipiente ermetice. 5. 6. de aceea metodele de hemocultură variază şi sunt aproape proprii fiecărui laborator. Printre factorii cheie pe care şeful de laborator trebuie să-i stabilească se numără şi metoda de hemocultură. urmat de o soluţie pe bază de iod (1-2% tinctură de iod sau 10% soluţie de povidonă-iod). Dacă din probele fluide s-au executat frotiuri imediat după recoltare. BD BACTECTM . însămânţarea acestuia pe un mediu lichid. Prelevarea se face direct în flacoanele de hemocultură de tipul Hemoline Performance Duo. probele se recoltează înaintea administrării agenţilor antimicrobieni. Acestea se vor fixa imediat prin pulverizarea frotiului cu un fixator citologic sau se introduc în etanol 95 % pentru 20 minute. pentru a preveni eventualele iritaţii. 9. cu capac filetat. este esenţială prelevarea sângelui în condiţii strict aseptice. Se recomandă trimiterea a 1-5 frotiuri pentru evaluare citologică. 4. 7. Histoplasma 2 . Excesul de tinctură de iod se îndepărtează cu ajutorul unui tampon îmbibat în alcool. Sângele Hemocultura este o importantă metodă de diagnostic care poate orienta sau reorienta terapia antimicrobiană în cazul bolilor infecţioase grave. mai recomandat. cantitatea şi compoziţia mediului de cultură. volumul de sânge care urmează a fi însămânţat. frecvenţa subcultivărilor şi interpretarea rezultatelor. astfel încât în cursul procesării în laborator să fie selectat mediul de cultură adecvat.Tehnici de recoltare. numărul şi momentul prelevării hemoculturilor. transport şi procesare primară a prelevatelor clinice Recoltarea 1. data şi ora de colectare. Probele obţinute prin aspiraţie cu ac fin trebuie transferate într-un tub steril sau flacon de transport înainte de a fi trimise la laborator.g.1. 3. 1. acestea vor fi individualizate corespunzător prin notare pe capătul mat al lamei. 8. În cazul suspectării unor infecţii fungice cu localizare intracelulară a microorganismului (e. Se indică când un microorganism particular este căutat în mod special în probă. sterile şi rezistente. Dacă o probă este recoltată prin traversul pielii intacte. folosirea unor metode pentru depistarea creşterii microorganismelor în mediu lichid şi o fază finală de subcultivare pe un mediu solid pentru identificarea şi testarea sesibilităţii la antifungice. Se identifică sursa probei şi se specifică corect zona. aceasta se va dezinfecta cu alcool etilic 70%. Indiferent de metoda aleasă.Mycosis IC/F Medium (BD Diagnostics). care nu permit crearea de aerosoli în momentul deschiderii. Când este posibil. Obiectivul major al tuturor metodelor de hemocultură este reprezentat de depistarea unui număr mic de microorganisme în sânge. Se etichetează clar recipientul de transport cu numele pacientului. numărul de identificare. 2. Pentru recoltarea din situsuri normal sterile se utilizează echipament sterilizat şi tehnică aseptică pentru a preveni contaminarea cu microorganisme în timpul procedurilor invazive. BacT/ALERT®FA (bioMérieux) sau.

Se aşteaptă să se usuce şi nu se mai palpează vena. Se antiseptizează tegumentul cu alcool 70%.1. Recoltarea sângelui pentru hemocultură Sângele pentru hemoculturi trebuie recoltat prin puncţie venoasă periferică. tehnica de liză-centrifugare şi utilizarea flacoanelor BD BACTECTM – Myco/F Lytic Medium (BD Diagnostics) cresc esenţial şansa de izolare a agentului patogen. reducând astfel şi riscul accidentelor prin înţepare.7% când nu se realizează schimbarea acului. Pe de altă parte. Cu toate acestea. există un consens asupra faptului că orice hemocultură pozitivă necesită şi interpretarea clinicianului. Se recoltează sângele. Se palpează vena. 3 Capitolul 1 capsulatum). pentru recoltarea hemoculturilor. apoi cu tinctură de iod 1-2% (sau iodofori 10%). 3. hemoculturile prelevate prin puncţie periferică sunt mai fidele în evidenţierea bacteriemiilor / fungemiilor adevărate faţă de cele prelevate pe cateter. 5. Majoritatea studiilor arată că nu există nici o diferenţă semnificativă statistic între cele două metode. Alte studii arată că. ar trebui să se apleze la personal special calificat (flebotomişti). se aşteaptă 1 minut. O antiseptizare atentă a tegumentului este mai importantă decât schimbarea acului. faţă de 3. astfel: 1. este o problemă controversată.0% când se schimbă acul.1.   . 2. Recoltarea sângelui prin dispozitive intravasculare. Se dezinfectează flaconul de hemocultură cu alcool izopropilic 70%. iar după puncţie se înlătură iodul de pe tegument cu alcool (acest pas nu mai este necesar dacă se utilizează iodofori). O meta-analiză a studiilor care au comparat rata contaminării hemoculturilor cu şi fără schimbarea acului înainte de inoculare a arătat că această rată este de 2. iar acesta trebuie avertizat cu privire la particularităţile hemoculturilor pozitive prelevate pe cateter. astfel că schimbarea acului nu ar fi necesară. Petru Cazacu. atunci când rezultatele între cele două prelevări sunt discordante. La modul ideal. reducerea contaminării hemoculturilor prin schimbarea acului ar determina o economie de aproximativ 85000 $ pentru fiecare 1000 de hemoculturi. Multe dispute a ridicat şi problema înlocuirii sau nu a acului după flebotomie pentru inocularea sângelui în flaconul de hemocultură. arteriale sau venoase.Maria Dan. 4. începând din centru. Factorii care influenţează acest rezultat favorabil sunt durata scurtă a menţinerii cateterului şi tehnicile stricte de asepsie. Bogdan Doroftei. Unele studii comparative arată că nu există diferenţe semnificative între sensibilitatea şi specificitatea hemoculturilor prelevate de pe cateter şi prin puncţie venoasă periferică. Magdalena Mareş. Mihai Mareş 1. concentric.

Trei prelevări intermitente în 24 ore. MD.. 2-3 ml la sugari şi 3-5 ml la copii. cu excepţia tulpinilor de Histoplasma capsulatum care au fost izolate doar în sistemul Isolator. 1.Tehnici de recoltare. aminoglicozidele. transport şi procesare primară a prelevatelor clinice 1. NC) creşterea este semnalizată tot prin detecţia CO2. Sistemul BACTEC (Becton Dickinson Intruments Systems. dar timpii de izolare sunt echivalenţi. Medii de cultură Mediile pentru hemocultură prezintă variaţii în compoziţie şi de aceea studiile comparative realizate sunt greu de interpretat. iar în camera de citire prezenţa CO2 este depistată cu ajutorul luminii infraroşii. În sistemul BacT/Alert (Organon Teknika Corp. Recoltarea a peste 30 ml de sânge per set de hemocultură îmbunătăţeşte foarte puţin sensibilitatea hemoculturii şi contribuie la instalarea anemiei iatrogene. din zone de puncţie diferite. Hemoculturile trebuie prelevate pe cât posibil înaintea instituirii antibioticoterapiei (dacă au fost administrate antibiotice. cresc sensibilitatea izolării aproape de 100%. în timp scurt. Durham.1. BACTEC 4 . în special levuri şi fungi dimorfici.1. Majoritatea autorilor recomandă ca această diluţie să fie între 1:5 şi 1:10.. În comparaţie cu sistemul Isolator. Majoritatea sistemelor de hemocultură conţin polianetol sulfonat de sodiu.3. respectiv 30 ml sânge. care pe lângă efectul anticoagulant inactivează şi anumiţi agenţi antimicrobieni (e. ultraviolete sau radiometric. 1. Sistemele de hemocultură automate şi semiautomate computerizate pentru detecţia rapidă a microorganismelor în hemoculturi sunt utilizate în multe laboratoare.1. dar cu ajutorul unui detector colorimetric.g. polimixinele).2. iar unii au arătat că un raport de diluţie de 1:10 este superior celui de 1:5 în ceea ce priveşte rapiditatea şi sensibilitatea izolării. Se recomandă 1-2 ml de sânge per set la nou-născuţi. SUA) se bazează pe detecţia directă a producerii de CO2 prin prelevare seriată de eşantioane de gaz din flaconul de cultură. Însămânţarea a 20. această informaţie trebuie luată în consideraţie la interpretarea rezultatelor) şi conform evoluţiei predictive a curbei febrile sau / şi în momentul când bolnavul semnalează apariţia frisoanelor.4. mediile BACTEC pentru fungi (BACTEC MYCO/F Lytic bottle şi BACTEC high-blood-volume fungal medium) au avantajul monitorizării automate continue. creşte sensibilitatea cu 38% şi 68% faţă de însămânţarea a 10 ml de sânge. La copii este necesar un volum mai mic de sânge datorită bacteriemiilor cu un număr mai mare de UFC/ml faţă de adulţi. Numărul de hemoculturi şi momentul prelevării Majoritatea cercetătorilor sunt de acord că peste trei hemoculturi în 24 ore nu determină o creştere semnificativă a rezultatelor pozitive. Sparks. O raţie optimă de diluţie a sângelui în bulion nu a fost încă stabilită. Câteva studii comparative au arătat că sistemul BACTEC identifică o gamă largă de microorganisme. Volumul de sânge ce urmează a fi însămânţat Majoritatea autorilor recomandă să se recolteze la adulţi 10-30 ml de sânge pentru fiecare set de hemoculturi.

Sistemul Oxoid Signal (Oxoid USA. similare în compoziţia bulionului pe bază de tripticază-soia şi cazeină. BACTEC este superior bulionului cu supliment de peptonă şi sistemului VITAL în depistarea bacteriemiilor şi fungemiilor. Nocardia spp. bacililor gram-negativi nonfermentativi. Flacoanele speciale pentru fungi ar trebui luate în considerare în anumite situaţii particulare (pacienţi HIV infectaţi). astfel încât timpul de depistare a microorganismelor poate fi comparabil cu al sistemelor automate. diferă în suplimentele nutritive şi în concentraţia de polianetol sulfonat de sodiu. a infecţiilor cu micobacterii la pacienţii cu SIDA şi a oportuniştilor (Bartonella henselae). în prezent este comercializată de Wampole Laboratories. de asemenea şi în izolarea bacteriilor (metoda lizei cu centrifugare fiind mai rapidă).Maria Dan. studiile ulterioare au arătat că furnizează un număr crescut de rezultate fals pozitive şi are dificultăţi în semnalizarea creşterii bacteriilor anaerobe. iar această superioritate nu se datorează metodei de detecţie. Malassezia furfur). apoi centrifugat. a Hemophillus influenzae. în care presiunea CO2 degajat de creşterea microorganismelor. Hemoline Performance Duo: BioMerieux. Deşi evaluările iniţiale au fost favorabile. Vacutainer agar slant: Becton Dickinson) sunt de asemenea larg utilizate. Însămânţarea frecventă a pantei poate să furnizeze cultură suficientă pentru testarea sensibilităţii şi identificare. NJ) izolează majoritatea microorganismelor. deoarece fungii filamentoşi şi dimorfici necesită o atenţie specială. Nutely.. au dovedit proprietăţi superioare în izolarea microorganismelor. Inc. Columbia.. Studii recente arată că flacoanele pentru izolarea bacteriilor sunt foarte potrivite pentru cultivarea levurilor genului Candida. MD) este format dintr-un singur flacon de cultură. faţă de folosirea izolată a sistemului BACTEC. Folosite în asociaţie cu sistemul BACTEC s-a observat o creştere cu 25% a depistării episoadelor bacteriemice. Bogdan Doroftei. Neisseria meningitidis. Au calităţi superioare bulionului suplimentat cu peptonă. Noile modele care au îmbunătăţit compartimentul de semnalizare (creşterea volumului) şi beneficiază de agitare. Petru Cazacu. Studiile comparative ale celor două sisteme au arătat că sistemul BacT/Alert este superior în izolarea microorganismelor. datorită ratei crescute de rezultate fals pozitive. Unii autori nu recomandă această metodă în investigaţia de rutină a episoadelor febrile la pacienţii neutropenici. Mediile difazice (Septi-Chek: Roche Diagnostic Systems. a majorităţii levurilor. Magdalena Mareş. Metoda este echivalentă sistemului difazic în izolarea fungilor (chiar superioară în izolarea Histoplasma capsulatum ). NJ. Mihai Mareş şi BacT/Alert. în special a stafilococilor şi levurilor. Cranbury. dar este indicată în special pentru depistarea fungemiilor. de unde poate fi examinat microscopic şi subcultivat. iar sedimentul este însămânţat pe medii solide adecvate. Sângele. (mai ales cu fungi dimorfici. Metoda lizei cu centrifugare ( denumită anterior DuPont Isolator tube. forţează fluidul de cultură să treacă într-un compartiment semnal. sunt avantajoase pentru izolarea micobacteriilor şi brucelelor. 5 Capitolul 1   . prelevat în tuburi cu „liquoid” (polietilenglicol şi saponină) este lizat. şi Corynebacterium jeikeium. fungi filamentoşi.

Utilizarea acestora a demonstrat îmbunătăţirea izolării microorganismelor în comparaţie cu mediile standard. Calif. În concluzie.. celulite. transport şi procesare primară a prelevatelor clinice Hemoculturile anaerobe.bioMerieux Vitek. Noile metode rapide de identificare şi testare a sensibilităţii la antibiotice (Vitek . folosirea de rutină a flaconului cu incubare anaerobă poate determina scăderea sensibilităţii hemoculturii.. West Sacramento. poate fi utilă în evidenţierea creşterii. Pe de altă parte. neutropenii. Pseudomonas aeruginosa) şi fungilor. Date asemănătoare au fost găsite la copii şi având în vedere cantitatea mică de sânge care se poate recolta de obicei de la aceşti pacienţi. tot în această perioadă s-a produs o creştere a incidenţei fungemiilor. dar pe de altă parte producerea unor mari cantităţi de gaz de către anumite bacterii. utilizarea flacoanelor anaerobe determină o creştere semnificativă a izolării bacteriilor strict anaerobe. Câteva studii au arătat că în ultimii 20 de ani s-a produs o scădere a incidenţei infecţiilor sistemice determinate de bacteriile anaerobe. îmbunătăţind astfel izolarea bacteriilor şi fungilor cu perete defectiv din sângele pacienţilor care au primit antibioticoterapie. infecţii orale.. Mediile hipertone cu 10% sucroză sunt utilizate pentru a crea un mediu osmotic protector. În general.Tehnici de recoltare. pe piaţă au apărut produse care încearcă să înlăture posibilele efecte inhibitorii ale creşterii. este indicat ca întreaga cantitate să se însămânţeze în flacoane aerobe şi doar în cazurile cu risc crescut să se utilizeze flaconul anaerob. Valoarea acestor medii în depistarea bacteriemiilor şi fungemiilor este controversată.g. Aceste schimbări în etiologia infecţiilor sistemice au început să pună sub semnul întrebării utilitatea folosirii de rutină a flaconului anaerob. afecţiuni intraabdominale. iar noua formulă a mediului a optimizat şi microscopia directă din hemocultură. autoSCAN-W/A . Unii autori au arătat că folosirea a două flacoane aerobe şi doar în cazuri selecţionate a flaconului anaerob. bacililor gram-negativi (Enterobacteriaceae. pe de altă parte. la ora actuală este indicată folosirea a două flacoane aerobe per set şi în circumstanţe bine selecţionate (e. MO. muşcătură de om) şi pe cea a flaconului anaerob. Hazelwood. Sistemul BacT/Alert are variante FAN pentru flacoanele aerobe şi anaerobe. Datorită frecventei recoltări a sângelui pentru hemoculturi de la pacienţi aflaţi sub terapie antimicrobiană.W/A. Unele studii arată o îmbunătăţire a izolării stafilococilor. Studiile comparative ale sistemelor BacT/Alert FAN şi BACTEC cu rezină au arătat că performanţele celor două medii sunt echivalente. dar o reducere şi o întârziere în izolarea bacteriilor anaerobe şi a Neisseria gonorrhoeae. Dade Behring Microscan Inc. 6 . USA. Setul standard de hemoculturi conţine un flacon aerob şi unul cu incubare anaerobă. PCR) a microorganismelor direct din hemoculturile pozitive. aceste medii au fost evitate în laboratoarele care utilizează citirea vizuală a creşterii datorită rezultatelor fals pozitive date de efectul hemolitic. BD PHOENIX Automated Microbiology System. Neutralizarea şi inactivarea substanţelor antimicrobiene. în comparaţie cu practica standard (un flacon aerob şi unul anaerob). a dus la creşterea cu 6% a izolării microorganismelor cu semnificaţie clinică. Deoarece există o şansă mică de a izola fungi sau bacterii strict aerobe în flaconul anaerob.

În situaţia în care nu sunt depistate microorganisme pe frotiu. Mihai Mareş furnizează rezultate corecte în aproximativ 2-6 ore şi pot determina iniţierea antibioticoterapiei. sângele (7. iar apoi se centrifughează 15 minute la 3000 rpm pentru concentrarea microorganismelor. Unii autori au comunicat o creştere de 16.5. iar hemoculturile ar trebui incubate peste 7 zile.8% în depistarea rapidă a septicemiilor prin examinarea cu acridină orange a hemoculturilor negative macroscopic. 1. tuburile se agită de câteva ori pentru liza completă.Maria Dan. incubează hemoculturile 5-7 zile. Sedimentul este aspirat şi însămânţat astfel: o placă cu Agar sânge-ciocolat şi o placă cu Agar tripticază-soia. schimbarea terapiei de primointenţie cu o terapie mai eficientă sau mai puţin costisitoare. apoi 18 zile la 30°C. ar trebui să evalueze cu atenţie necesitatea subcultivărilor terminale. Laboratoarele care deservesc spitale în care fungii. Unii autori au estimat o economie de aproximativ 158 $ per pacient. se incubează 3 zile la 37°C. Coloraţia cu acridină orange este mai sensibilă.1. în cazul suspiciunii fungemiilor. Pseudomonas aeruginosa şi grupul HACEK sunt izolaţi frecvent din sângele pacienţilor. Durata incubării şi prelucrarea hemoculturilor Majoritatea laboratoarelor care utilizează sisteme automate. pe Agar Sabouraud. Bogdan Doroftei. până la 30 de zile. apreciată la pacienţii la care s-a administrat un antibiotic mai ieftin sau la care a fost întreruptă antibioticoterapia. Rata contaminărilor accidentale poate fi controlată printr-o bună tehnică aseptică în incinta hotei de siguranţă microbiologică de clasă II. Magdalena Mareş. proba este examinată microscopic (frotiu colorat Gram) şi subcultivată pe medii solide în funcţie de categoria microscopică observată. cu incubare la 30°C. ar trebui realizate subcultivări „oarbe” la 48 ore şi apoi săptămânal. a hemoculturilor negative macroscopic după 24-48 ore de incubare este controversată şi puţin indicată. iar flaconul reintrodus la incubat. cu ajutorul coloraţiei Gram. Petru Cazacu. După recoltare. trebuie realizate subcultivări oarbe. În cazul observării fungilor este indicată subcultivarea pe Agar Sabouraud cu incubare la 30° sau 37°C. datorită numărului mic de microorganisme care pot fi detectate utilizând frotiul colorat Gram (aproximativ 105 UFC/ml). 7 Capitolul 1   . 4 săptămâni la 30°C. prin primirea rezultatelor cu 24-48 de ore mai devreme. detectând între 103 şi 104 UFC/ml. Dacă apare semnalizarea creşterii în timpul incubării. Metodele moleculare au o sensibilitate şi o specificitate de aproximativ 100% în identificarea bacteriilor şi levurilor din hemoculturile monomicrobiene şi furnizează rezultatele în aproximativ 2 ore. Pentru metoda lizei-centrifugare. Pentru sistemele manuale de depistare a creşterii.5-10 ml) este recoltat în tuburi cu saponină (lizează hematiile şi globulele albe). o placă cu Agar Sabouraud şi una cu Agar infuzie cordcreier. Examinarea microscopică de rutină.

Lichidul cefalo-rahidian Lichidul cefalo-rahidian (fluidul cerebro-spinal sau LCR) se recoltează prin puncţie rahidiană în spaţiile intervertebrale L3-L4.1.şi Paecilomyces spp. reprezentând până la 10% dintre infecţiile sistemice nosocomiale. Fusarium spp. se consideră că hemoculturile pozitive pentru Aspergillus. 1. cu reală semnificaţie clinică. L4-L5 sau L5-S1. cu toate acestea aproximativ 50% din hemoculturi rămân negative la pacienţii cu candidemie. Timp de aşteptare în vederea procesării: maxim 15 minute.6. Alternaria spp. în sistemul lizei cu centrifugare. dar este rar izolat din sânge. iar în faţa unei asemenea situaţii trebuie căutate argumentele clinice şi radiologice pentru stabilirea semnificaţiei clinice a izolatului. Totuşi. LCR se colectează prin curgere liberă.. Printre fungii emergenţi implicaţi tot mai des în infecţii invazive. în tuburi sterile. Înainte de examinare. iar prezenţa leucemiei sau transplantului medular reprezintă un factor de risc important. Puncţia se realizează respectând cele mai severe măsuri de asepsie şi decontaminarea zonei cu povidonă-iod 2%.5-1 ml. în volum de minim 0. sunt foarte rare. Nu se refrigerează! 8 . Aspiratul medular. este izolat în 6070% din hemoculturile pacienţilor cu fusarioză diseminată. În literatură sunt doar puţine cazuri documentate din punct de vedere clinic. proba se concentrează prin centrifugare la 1500 rpm timp de 10 minute. O singură hemocultură pozitivă.3. Semnificaţia hemoculturilor pozitive cu fungi saprobioţi Aspergillus spp.2. Cele mai frecvente cauze de fungemii adevărate sunt determinate de Scedosporium spp. reprezintă în mod obişnuit un indicator al pseudoaspergilemiei. prelevatul se menţine la temperatura camerei.. iar sedimentul pentru cultură şi microscopie directă. Supernatantul se păstrează pentru testarea antigenică. 1. histologic şi microbiologic pentru evidenţierea aspergilozei invazive cu hemocultură pozitivă certă. reprezintă cea mai frecventă cauză a infecţiilor fungice invazive. În cazul hemoculturilor pozitive cu Candida spp. calea de acces fiind creată prin puncţie sternală sau puncţia crestei iliace. inclusiv în fungemii. Candida spp (în particular Candida albicans) este frecvent izolată în hemoculturi. Puncţia se realizează respectând cele mai severe măsuri de asepsie. Pe de altă parte. După poziţionarea în spaţiul subarahnoidian a cateterului de puncţie. este încă neclară. iar cateterele intravasculare înlocuite. Semnificaţia hemoculturilor pozitive cu Aspergillus spp.Pe parcursul acestui interval de timp.Tehnici de recoltare. se transferă într-un tub steril cu dop de cauciuc şi se expediază la laborator în maxim 2 ore. transport şi procesare primară a prelevatelor clinice 1. în volum de 3-5 ml. trebuie depistată posibila sursă a infecţiei. chiar şi la pacienţii cu hemopatii maligne reprezintă o provocare. se numără Scedosporium spp. Măduva osoasă hematogenă Se recoltează prin aspiraţie cu seringă heparinizată. determinarea semnificaţiei clinice a hemoculturilor pozitive cu fungi. Candiduria poate apare secundar candidemiei. Cu excepţia fungemiilor asociate cu prezenţa cateterelor venoase centrale.

totodată. Mihai Mareş Se instilează 1-2 picături de anestezic topic. Volumul recomandat este de cca. Se expediază la laborator în plicuri de hârtie. Timp maxim de aşteptare: 72 ore la temperatura camerei. 1.8. Timp maxim de aşteptare: 72 ore la temperatura camerei. în curs de detaşare este adesea nesatisfăcătoare pentru diagnostic.4. 1. prin înţepare. Magdalena Mareş. Timp maxim de aşteptare: 2 ore la temperatura camerei sau 24 ore la 4°C. se va utiliza un bisturiu neascuţit. apoi cu ajutorul unei microchiurete oftalmologice / spatule Kimura sterile. Raclarea se realizează de obicei pe partea inferioară a tablei unghiale. 9 Capitolul 1 1. raclarea va interesa suprafaţa superioară a unghiei. Firele de păr Se recoltează cu ajutorul unei pense. printr-o mişcare scurtă.5 ml.Maria Dan. 0. Raclatul cornean   . Prelevatul otic Din conductul auditiv extern se pot preleva probe cu ajutorul tampoanelor sterile (secreţiile) sau prin raclare cu o chiuretă (scuamele). apoi se transferă la laborator în maxim 15 minute pentru procesare. La pacienţii suspectaţi de tinea sau impetigo. se pregătesc frotiuri pentru examenul microscopic direct. Timp maxim de aşteptare: 15 minute la temperatura camerei. după toaletarea zonei cu apă şi săpun.6. Materialul recoltat se expediază la laborator în plicuri de hârtie. Bogdan Doroftei. o chiuretă Vidal sau un careu rectangular de mochetă. deoarece raclarea scuamelor vechi. Fluidele intraoculare Se recoltează prin aspiraţie cu un ac fin steril sau prin vitrotomie. Pentru recoltare. În cazul leziunilor de leuconichie superficială. Petru Cazacu. se va alege pentru prelevarea de probe cea mai recentă.7. prin raclare cu o chiuretă sterilă sau prin cupare cu ajutorul unui foarfece. Nu se recomandă decontaminarea cu alcool deoarece diminuează şansa de izolare a dermatofiţilor prin cultivare. o pensă. Prelevatul se însămânţează direct pe medii de cultură cu ajutorul instrumentului de recoltare. se raclează zone multiple din segmentul ulcerat. unguentele sau alte preparate aplicate în prealabil trebuie îndepărtate prin ştergere cu alcool. la joncţiunea zonei normale cu cea modificată. de preferat sub lumină UV. Dacă leziunile sunt multiple. Scuamele tegumentare se recoltează prin raclarea zonei active a leziunii (de obicei cea periferică) cu ajutorul unei chiurete sterile sau prin ştergere apăsată şi repetată cu un tampon steril preumezit în ser fiziologic steril. 1. distal sau lateral.5. 1. în cameră obscură. Fragmentele unghiale şi scuamele cutanate Fragmentele unghiale se recoltează de la nivelul joncţiunii ţesutului sănătos cu cel afectat.

de obicei lactofenol cu albastru de anilină. cu capac filetat. b) În cazul expectoraţiei induse. fesier. de aceea rezultatele trebuie să fie corelate cu constatările clinice şi cu datele imagistice. Când leziunile sunt localizate la nivelul unor pliuri (axilar. recoltarea fiind indoloră. pacientul va fi sfătuit să-şi clătească cavitatea bucală cu apă distilată sterilă sau cu o soluţie slab antiseptică (apă de gură) anterior colectării sputei. Rezultatele trebuie corelate cu datele clinice şi imagistice. se utilizează un cateter de sucţiune nou. aerosolizată prin intermediul unui nebulizator ultrasonic. Extremităţile inferioare ale tuburilor endotraheale nu reprezintă probe acceptabile. La pacienţii cu Pityriasis versicolor. e) Prelevatele bronhoscopice 10 . Careurile de mochetă se aplică direct pe suprafaţa mediului de cultivare. pacientul va inhala aproximativ 30-50 ml de soluţie cloruro-sodică 3-10%. 1. după care se îndepărtează . recoltarea se va face cu ajutorul unui tampon pentru exsudate umectat în prealabil cu ser fiziologic. transport şi procesare primară a prelevatelor clinice Recoltarea cu tamponul este recomandată în cazul leziunilor de epidermofiţie circinată şi presupune însămânţarea imediată a prelevatului pe medii de izolare. iar secreţia aspirată se stochează într-un captator de spută steril. iar sputa astfel obţinută se colectează în recipienţi sterili. c) Aspiratul traheostomic Canula de traheostomie este colonizată într-un interval de cca.9. se va adăuga între lamă şi banda adezivă o picătură de colorant. pacientul va fi instruit să nu expectoreze saliva. Pentru inducerea expectoraţiei. pacientul va fi îndrumat să-şi perieze dinţii. Volumul minim recoltat va fi de 2 ml. d) Aspiratul endotraheal Pentru recoltare. a) În cazul expectoraţiei spontane. Aspirarea probelor se realizează cu catetere de sucţiune. pentru efectuarea examenului microscopic direct. crescând astfel şansele de izolare în cultură. Sputa obţinută prin expectoraţia astfel indusă se colectează într-un recipient steril. 5-10 minute. Recoltarea cu ajutorul mochetei este mai eficientă deoarece asigură concomitent abrazarea leziunii şi reţinerea sporilor. Colectarea probelor se va realiza prin tuse profundă urmată de expectorarea secreţiei într-un recipient steril. Secreţiile respiratorii joase Sputa poate fi prelevată prin expectoraţie spontană (neprovocată) şi prin expectoraţie indusă (provocată).Tehnici de recoltare. apoi să se clătească riguros cu apă. mucoasa linguală şi gingiile. mamar. se lasă în contact cu acesta cca. cu capac etanş. scuamele se recoltează cel mai bine utilizând un fragment de bandă adezivă transparentă (tip scotch) cu care se amprentează leziunea şi care apoi se etalează pe o lamă de microscopie. în laborator. Tubul endotraheal este frecvent colonizat cu bacterii şi levuri. crural etc. De asemenea.) şi sunt umede / inflamate. 24 ore după inserţie. Proba se trimite la laborator în maxim 2 ore (dacă se menţine la temperatura camerei) sau în 24 ore (dacă este pastrată la temperatura de refrigerare).

Timp de aşteptare: 15 minute la temperatura camerei. 11 Capitolul 1   . Biopsia pulmonară Se efectuează în serviciile de chirurgie toracică şi vizează obţinerea unei piese de 1-3 cm3 ţesut. Alte fluide organice normal sterile (pericardic.Maria Dan. spălătura bronşică. Probele se concentrează prin centrifugare. sub ghidaj radiologic sau computer-tomografic. Aspiratul se transferă într-un recipient steril şi se expediază imediat la laborator. Probele se trimit la laborator în recipienţi sterili. 1. peritoneal. în volume de minim 5-10 ml.Se instilează fracţionat soluţie de NaCl 0. protejate într-o compresă umectată cu ser fiziologic steril.Probele recoltate în flacoane sterile. Bogdan Doroftei. Se înaintează cu bronhoscopul până la nivelul unei bronhii segmentare (pentru spălătura bronşică) sau a unei bronhii subsegmentare (pentru LBA). 1. stocându-se în flacoane sterile.Bronhoscopul se introduce transnazal sau transoral la pacienţii neintubaţi sau prin sonda endotraheală la pacienţii intubaţi. Petru Cazacu. Dacă leziunea este de dimensiuni mari sau dacă leziunile sunt multiple. Timp maxim de aşteptare: 2 ore la temperatura camerei sau 24 ore la 4°C. cu o seringă prin canalul bronhoscopului. Se aspiră materialul din leziune.11. de obicei în volum total de până la 150 ml. Se consideră că lavajul obţinut reprezintă secreţiile de la nivelul a cca. fără formol. Se aspiră uşor soluţia salină într-un recipient steril înaintea administrării următoarei fracţii. se recomandă recoltarea mai multor probe din zonele reprezentative. Timp maxim de aşteptare: 15 minute la temperatura camerei sau 24 ore la 4°C. Principalele etape ale bronhoscopiei: . .10.85% sterilă. în volume suficiente.12. Mihai Mareş Acestea includ lavajul bronhoalveolar (LBA). periajul bronşic şi probele biopsice transbronhiale. un milion de alveole şi bronhiolele aferente şi conţine aproximativ 1 ml secreţie. se vor colecta mai multe probe din zonele reprezentative. sinovial) Se recoltează prin puncţie. sedimentul însămânţându-se pe medii solide de izolare sau se transferă ca atare în flacoane conţinând medii pentru hemocultură. 1. . Magdalena Mareş. se tratează cu substanţe mucolitice de tipul N-acetil-cisteinei şi se centrifughează timp de 20 minute la 1500 rpm. Aspiratul pulmonar Se recoltează prin inserarea transtoracică a unui ac în infiltratul pulmonar. Dacă leziunea este de dimensiuni mai mari sau dacă se decelează leziuni multiple. pleural.

De la pacienţii suspecţi de cromomicoză se recoltează exsudat sau cruste din leziuni pentru efectuarea de frotiuri sau preparate extemporanee în vederea decelării corpilor fumagoizi prin examen microscopic direct. oro-distală şi oro-mezială. examenul microscopic direct şi cultură.14. 12 . frotiul obţinut colorându-se Gram. Fiecare tampon se utilizează o singură dată. . În cazul ulcerelor şi nodulilor se urmează paşii: se decontaminează suprafaţa cu soluţie de povidonă-iod. prin spălare cu apă şi săpun. preumezit în ser fiziologic.Tehnici de recoltare. Timp maxim de aşteptare: 2 ore la temperatura camerei. orală. fie prin tamponament profund.Persoana care recoltează proba trebuie să-şi igienizeze mâinile în prealabil. Înainte de recoltare. vestibulo-mezială. prelevarea probelor se realizează de pe faţa mucozală a acestora – zona predilectă de apariţie a biofilmelor levurice. Alternativ. în cazul leziunilor pseudo-membranoase sau ulcerate. prin trecerea repetată a acestuia. De la pacienţii cu sporothricoză se recoltează probe prin amprentarea leziunilor cu ajutorul unei lame de microscopie. probele se prelevează cu ajutorul conurilor de hârtie sterile. se recomandă recoltarea de probe biopsice sau raclate din leziunile cutanate în vederea efectuării de frotiuri pentru examenul microscopic direct. se îndepărtează detritusurile suprapuse şi se chiuretează baza ulcerelor sau a nodulilor. cu aceleaşi mişcări din faţă către spate. Secreţiile purulente din abcese subcutanate sau din plăgi deschise Se prelevează fie prin aspiraţie. funcţie de dimensiunea canalelor radiculare. peste zonele cu leziuni. labiile se îndepărtează. se toaletează zona vulvo-vaginală şi deschiderea uretrei cu apă şi săpun lichid. 1. Produsele patologice de la nivelul mucoasei orale Se recoltează cu ajutorul unui tampon steril. În cazul criptococozei diseminate sau a celei cutanate. . Musto sau cu calcofluor alb.Se clăteşte zona cu apă sau se şterge cu un tifon umed. de diferite diametre. acesta se colectează cu o seringă sau cu un tampon steril. În cazul aparatelor protetice amovibile. Timp maxim de aşteptare: 2 ore la temperatura camerei. De la pacienţii cu suspiciune de micetom. Dacă exsudatul este prezent. 1. se poate recurge la raclarea uşoară a acestora cu ajutorul unei chiurete sterile. . Urina Tehnici de recoltare (fracţiunea mijlocie în timpul micţiunii spontane): a) la femei: . folosind un tampon de tifon.15.În timpul micţiunii. Se recomandă folosirea sistemelor de transport pentru tampoane. Din pungile parodontale prelevarea probelor se efectuează cu sonda parodontală. în vederea prevenirii desicării materialului patogen. pacientul va fi instruit în detaliu asupra manoperelor ce vor urma. transport şi procesare primară a prelevatelor clinice 1. de minim 10 ori.Se îndepărtează lenjeria intimă. vestibulo-distală. se recoltează puroi din leziuni pentru studierea culorii granulelor. din faţă către spate.13. în zonele vestibulară. În endodontite.

în dreptul simfizei pubiene superioare. lăsând să curgă primii mililitri de urină. .Persoana care va recolta proba trebuie să fie corect igienizată prin spălarea mâinilor cu apă şi săpun. Timp maxim de aşteptare: 2 ore la temperatura camerei. 50-100 ml urină şi se descarcă seringa într-un recipient steril.Se aspiră urina şi apoi se descarcă seringa într-un recipient steril. . într-un recipient steril. Pacientul nu-şi va întrerupe emisia de urină.Se elimină un volum de aproximativ 40-50 ml urină. într-un recipient steril. atunci când probele de urină sunt dificil de obţinut.Maria Dan. .Se colectează urina din fracţiunea mijlocie sau terminală.Se dezinfectează peretele cateterului cu alcool 70%. Se poate totuşi utiliza când urina se nu se poate obţine altfel sau când pacientul se află în stare critică.Se îndepărtează fracţiunea iniţială. b) la bărbaţi: . Bogdan Doroftei.Se toaletează glandul penisului şi meatul urinar prin retractarea prepuţului (dacă nu este circumcis) şi spălare cu apă şi săpun lichid. . de 30-50 ml urină.Se toaletează deschiderea uretrei pacientului şi a zonei adiacente.Se rade pilozitatea din zona suprapubiană (dacă este necesar) şi se dezinfectează tegumentul cu soluţie de povidonă-iod. . c) Recoltarea prin cateterizare vezicală Inserarea cateterului pentru colectarea unei probe de urină este în general descurajată.Se aspiră prin acul de puncţie cca. d) Recoltarea pe cateter preexistent Trebuie de obicei evitată datorită colonizării uneori masive cu microorganisme a cateterelor. Magdalena Mareş. . având grijă ca deschiderea acestuia să nu vină în contact cu suprafeţe posibil contaminate.Se colectează apoi urina din jetul urinar mijlociu. cu apă şi săpun lichid. 13 Capitolul 1   . . fără ca pacienta săşi întrerupă apoi micţiunea. el trebuie să primească în prealabil instrucţiuni detaliate.Se introduce cateterul până în vezică prin tehnica recomandată. . funcţie de sexul pacientului. Petru Cazacu. cu ajutorul unui ac ataşat la o seringă. . se începe micţiunea. . Aspiraţia suprapubiană este de asemenea utilizată la pacienţii pediatrici. apoi se clăteşte cât mai riguros.Se puncţionează vezica. pe linia mediană. . Mihai Mareş . Niciodată se va recolta urina din punga de colectare ! . Dacă pacientul este cel ce colectează urina. e) Recoltarea prin puncţie suprapubiană Aspiraţia suprapubiană se practică pentru diagnosticarea infecţiilor urinare la adulţi.Se recoltează apoi urina din jetul urinar mijlociu.Se puncţionează cateterul. în condiţii de asepsie. . într-un recipient steril.Menţinându-se prepuţul retractat. în cazul în care se suspectează o infecţie şi rezultatele procedurilor de rutină au fost nerelevante. .

vegetaţii. În caz de inflamaţii. forma. Secreţiile vaginale Se recoltează cu ocazia examinării pereţilor vaginali şi a porţiunii vaginale a colului uterin. chisturi. iar în sarcină este de culoare violacee (semnul Jaquemier). Valvele se aleg în funcţie de mărimea vaginului pacientei. flexate pe abdomen. Pe suprafaţa colului se mai pot observa chişti Naboth. coapsele în abducţie. cu lame inegale. Nu se foloseşte lubrifiant dacă se recoltează probe pentru frotiu citobacteriologic sau cultură. imprimându-se ulterior introducerii o mişcare de rotaţie şi împingere. 14 . Folosirea serului fiziologic steril ca lubrifiant poate fi utilă în cazul examinării unor paciente cu vagin atrofic. cu lame egale. cu diverse denumiri (Cusco. mărimea. eventuale cicatrici. prezenţa unor leziuni. prezenţa unor secreţii patologice. menţinându-se tracţiunea asupra valvei. Valva anterioară se introduce direct cu lama situată orizontal până în fundul de sac vaginal anterior. în infecţiile cu Trichomonas este spumoasă. Ele sunt inegale una mai mare şi alta mai mică. mucoasa vaginală este de culoare roztrandafirie. Sunt de mai multe tipuri. fie cu lamele vertical. iar gonococul produce o secreţie galben-verzuie. aerată. abundentă. Normal.Tehnici de recoltare. mari. După introducerea speculumului. deoarece facilitează introducerea valvelor şi nu modifică rezultatele testelor de laborator. atrofiată după menopauză. Se va efectua întotdeauna înaintea tuşeului vaginal pentru a evita modificarea secreţiilor cervicale sau vaginale prin contaminare sau manevre septice. Graves. ulceraţii. Normal. Vizualizarea pereţilor vaginali se poate obţine şi prin folosirea unui speculum instrument ginecologic care poate fi confecţionat din plastic sau din metal şi este alcătuit din două valve care sunt articulate printr-un şurub sau ecartor. focare endometriozice sau noduli fibromatoşi. Se mai are în vedere troficitatea mucoasei vaginale. Collin). se îndepărtează lamelele cu ajutorul ecartorului şi se examinează fundurile de sac vaginale şi colul. Extragerea valvelor se face în ordine inversă introducerii lor. extrăgându-se iniţial valva anterioară şi ulterior valva posterioară. Se îndepărtează cu policele şi indexul mâinii stângi labile mici şi se introduce mai întâi valva posterioară cu lama situată vertical. Introducerea valvelor în vagin trebuie să fie indoloră. în poziţie ginecologică (decubit dorsal. mucoasa este hiperemiată. Se efectuează cu pacienta pe masa ginecologică. malformaţii şi nu în ultimul rând secreţiile patologice. Acestea diferă în funcţie de agentul patogen. Se exercită o tracţiune divergentă asupra valvelor pentru a împiedica prinderea peretelui vaginal între valve şi pentru a evidenţia colul şi fundurile de sac vaginale. Poate deveni violacee în sarcină sau palidă. După introducerea valvelor sau a speculumului se observă şi se noteză starea mucoasei vaginale şi a colului. uniformă. Pentru a fi cât mai concludentă. în candidoze. transport şi procesare primară a prelevatelor clinice 1. Introducerea speculumului se face fie cu lamele situate orizontal (mai uşor la multipare). noduli endometriozici. apoi printr-o mişcare de rotaţie şi înaintare se aduce lama orizontal. secreţia este albă. orientarea. fetidă. colul este de culoare roz.16. gambele flexate pe coapse şi sprijinite în suporturi). mici. Extragerea speculumului se face apropiind lamele şi efectuând mişcarea în sens invers introducerii. aspectul exocolului.prelevarea se face înaintea instituirii tratamentului antimicrobian sau antifungic. grunjoasă. prelevarea trebuie să respecte anumite condiţii: . Pederson. Examenul colului va obiectiva situarea. după menopauză este palid.

18. Secreţia se recoltează cu ajutorul valvelor sau a speculumului. . Biopsia testiculară se efectuează în servicii chirurgicale. Fragmentele de ţesut suspectate a proveni dintr-un focar de zygomicoză nu se mojarează. pentru a preveni contaminarea probelor. Bogdan Doroftei. Detectarea ecografică a abceselor prostatice permite recoltarea de probe prin aspiraţie cu ac fin. . Aspiratul de prostată se trimite în recipienţi sterili. În cazul leziunilor balano-prepuţiale. Petru Cazacu. .evitarea contactului cu substanţe antimicrobiene a produsului patologic.produsul va fi însoțit de un bilet de trimitere completat corect. Probele se expediază la laborator în maxim 2 ore (stocare la temperatura camerei).în unele cazuri trebuie folosite medii de transport sau lichide conservante.17. folosind mici tampoane de vată montate pe pense port-tampon sau pipete absorbante. Timp maxim de aşteptare: 15 minute la temperatura camerei. Produsul recoltat se etalează pe o lamă în strat subţire. A doua prelevare se realizează în acelaşi mod. 1. iar probele se trimit la laborator în recipiente sterile (cele pentru cultură) sau conţinând fixator Bouin (cele pentru diagnostic histopatologic).Maria Dan. secreţia prostatică. Magdalena Mareş. Instrumentarul trebuie să fie steril. . umectat în prealabil cu ser fiziologic. apoi lamela. recoltarea probelor se realizează facil prin ştergere repetată cu un tampon steril de vată. 15 Capitolul 1   . iar după etalarea pe lamă se aplică o picătură de KOH 10%. aspiratul prostatic şi biopsia testiculară.nu se folosesc irigaţii vaginale cu cel puţin 24 de ore înainte. nu se triturează. . . . Fragmentele tisulare biopsice Se recoltează în timpul intervenţiilor chirurgicale şi se transportă învelite în tifon steril umectat cu ser fiziologic. deoarece se distruge miceliul şi creşte enorm riscul de a obţine culturi negative. Secreţia prostatică se obţine prin efectuarea unui masaj digital transrectal.probele vor fi etichetate şi transportate la laborator în cel mai scurt timp posibil. eventual o picătură de albastru de metilen şi apoi o lamelă. în containere sterile.prelevarea nu se realizează în prezenţa sângelui în vagin. nelubrifiate. se aplică o picătură de ser fiziologic. -recipientele de transport se închid ermetic pentru a preveni contaminarea mediului şi a personalului care manipulează produsul biologic.se folosesc recipiente sterile. Produse patologice de la nivelul tractului genital masculin În această grupă includem prelevatele balano-prepuţiale (pseudo-membranele candidozice). Mihai Mareş .nu se folosesc creme vaginale sau ovule cu cel puţin 2 zile înainte. A treia recoltare se realizează cu o baghetă sterilă sau cu un tampon pentru exsudate şi presupune ştergerea fundului de sac posterior cu vârful acestora. 1. Prima recoltare se face din fundul de sac posterior. Tampoanele de vată pot fi iniţial umezite în ser fiziologic. în condiţii de asepsie şi antisepsie depline. Colectarea probelor se realizează în tuburi sterile sau cu ajutorul unui tampon steril şi va fi precedată obligatoriu de toaletarea peniană.

Seringile trebuie să fie de calitate. fiind necesară o premedicaţie cu tranchilizante. Un factor important este adaptarea etanşă a acului la capătul seringii. Pentru leziunile subcutanate mici. iar cu cealaltă se fixează leziunea.5 cm sunt ideale. Poziţionarea pacientului: orice poziţie poate fi aleasă. Procedura trebuie să fie clar explicată pacientului şi consimţită de acesta. Lungimea şi calibrul acului trebuie să fie adecvate mărimii. şi pentru organele vascularizate. ne vom asigura că tot echipamentul necesar. 3. tiroidă. instrumentarul şi accesoriile sunt disponibile. Anestezia locală este uneori necesară. cu pielea uşor tensionată. capabile să producă o presiune negativă adecvată aspirării. 16 . O potrivire neglijentă a acestuia poate compromite procedura. Efectuarea unei anamneze riguroase şi a unui examen clinic detaliat. Se va alege în consecinţă acul cel mai adecvat. zonei şi consistenţei „ţintei”.5-4 cm. Leziunea ce urmează să fie aspirată este palpată şi fixată pentru a aprecia punctul optim de abordare. cum ar fi excrescenţele pielii.19. Aspiraţia ghidată prin tehnici imagistice cum ar fi computer-tomografia sau ultrasonografia permite obţinerea de probe şi în cazul leziunilor organelor interne ca pulmonul. transport şi procesare primară a prelevatelor clinice 1. prostata etc. AAF este indicată şi la pacienţii debilitaţi. fiind o tehnică minim invazivă. leziunile deformante ale ţesutului subcutanat. cu volum util de 10 ml. Imobilizarea leziunii: leziunea este fixată între policele şi indexul mâinii stângi. Penetrarea leziunii: se puncţionează leziunea printr-o mişcare atentă şi rapidă. 5. Tehnica aspiraţiei cu ac fin Aspiraţia cu ac fin (AAF) este utilă pentru diagnosticul leziunilor care sunt uşor palpabile. ţinându-se bineînţeles cont de confortul pacientului şi asigurarea căii de abord. organele abdominale şi retroperitoneale. cum ar fi tiroida. Înainte de începerea procedurii. profunzimii. Acele pentru puncţie vor avea un calibru standard de 22-24 G şi lungime de 2. Acele fine sunt de asemenea recomandate pentru copii. limfonoduri. Seringile cu capacitate de 5 ml pot fi utilizate pentru organele vascularizate precum tiroida. Seringile recomandate în această tehnică sunt cele single-use. Manipularea pistonului seringii se realizează cu o mână.Tehnici de recoltare. deşi în leziunile profunde sunt necesare ace mai lungi şi cu diametru mai mare. cu leziuni multiple. Se încearcă evitarea interpunerii maselor musculare importante. Pielea se dezinfectează ferm cu un tampon de vată îmbibat în soluţie iodată. cu revederea rezultatelor radiologice şi stabilirea diagnosticul prezumtiv. Tehnica aspiraţiei Înaintea executării aspiraţiei trebuie urmate etapele: 1. unghiul şi profunzimea penetrării variind după caz. 7. Trasarea cu ajutorul unui marker a zonei corporale în care se va executa aspiraţia. glande salivare şi sâni. Pentru formaţiunile mici. 4. acele de calibru 23G şi lungime de 2. Riscul scăzut al complicaţiilor permite executarea ei în ambulatoriu. 6. Pacientul poate prezenta o stare de anxietate. 2. AAF este de obicei executată cu pacientul aşezat în decubit dorsal pe un pat de examinare.

Crearea vacuumului şi obţinerea materialului biologic: aspiraţia este executată după pătrunderea în leziune şi se menţine în timp ce acul este acţionat viguros prin multiple mişcări de . În AAF la nivelul tiroidei. AAF poate fi repetată imediat. de la periferie. Rezultatul aspiraţiei este extragerea de fragmente de ţesut şi celule dislocate de bizoul acului. Petru Cazacu. se eliberează din tensiune pistonul seringii. care pot avea necroze. În situaţii excepţionale.Maria Dan. pacientul trebuie instruit să nu înghită sau să vorbească când acul este plasat în interiorul formaţiunii. în câteva direcţii diferite dar convergente. aspiraţia poate fi executată şi de la periferie. Aceasta se realizează cu scopul de a preveni formarea unui hematom în zonele intens vascularizate. Nu se roteşte acul şi nici nu se fac mişcări de pompare a pistonului seringii (înăuntruînafară). Eliberarea vacuumului şi retragerea acului: când materialul biologic este observat la baza acului. Magdalena Mareş. fără al înclina. Notă: Dacă suprafaţa zonei de execuţie a AAF este localizată lângă cutia toracică (formaţiuni nodulare axilare sau supraclaviculare). Dacă se aspiră numai puroi sau material necrotic din leziunile mari. ceea ce-l va face dificil de recuperat. de preferat de către un asistent. Pentru formaţiunile mai mari. Dacă acul se plasează tangenţial în cazul unei formaţiuni mici sau dacă penetrează dincolo de formaţiune. Înaintea retragerii acului. Bogdan Doroftei. încet (fără a fi împins). aspiraţia se va executa într-un plan paralel faţă de cutia toracică pentru a evita penumotoraxul. pe zona puncţionată se aplică un tampon îmbibat cu dezinfectant şi se presează câteva minute. Mihai Mareş este indicată aspiraţia din zona centrală . apoi acul se scoate din formaţiune. procedura se întrerupe. 17 Capitolul 1   . modificări chistice sau hemoragice centrale. 8. seringa şi acul pot fi clătite cu ser fiziologic sau fixator care apoi se va centrifuga pentru a prepara un frotiu.. Întreaga procedură trebuie să dureze maxim 6-8 secunde. Imediat după retragerea acului.vino”. materialul nu va putea fi recoltat. Pistonul revine singur.du-te . O eliberare insuficientă a presiunii negative în interiorul formaţiunii va cauza aspirarea materialului biologic la intrarea în seringă. 9. drept.

Bates D W. Paris.Baterial Translocation in Humans.A 25-year study of nosocomial bacteremia in an adult intensive care unit. Bucureşti. Cook E F. Peţeanu V. Hampton J R. Hoog G S de. Harrison M J G (1964) . Journal of Pediatric Gastroenterology & Nutrition. 10 (10):922-926. (1997) . 7(1):32-33. Figueras M J (2000) . QJ Med. Golăescu M (1997) . 2. Bucureşti. Pasculle W. 14. Ed.Cost Effective Blood Cultures . Arango C. Ann Intern Med.Sterile blood cultures in bacterial endocarditis. Buiuc D.Les mycoses humaines . Bucureşti.Endocarditis Due to Rare and Fastidious Bacteria. Elsevier.The significance of blood cultures positive for emerging saprophytic moulds in cancer pacients. 3. (1990) . 18. Jaimes F. Clin Microbiol Rev. et al. Medicală. Brouqui P.démarche diagnostique. 3(1):281287. 25:989-994. Cicalese L (1999) . Gené J. Eykyn S J (1999) . Clinical Infectious Diseases. 24(1): 177-207. Baltă M (1997) .Is It Possible or Impossible to Modify Behavior? Infection Control. transport şi procesare primară a prelevatelor clinice Bibliografie selectivă 1. 7. Goldman L. Clin Lab Med. Crit Care Med.Atlas of clinical fungi. Ann Periodontol. Maoxin W. Grillot R (1996) . 36:167-174. Debelian G J (1998) . 9. Ed. Treacher D F. Darby J M. 22(4).Manual blood culture systems and the antimicrobial removal device.Diagnosticul şi tratamentul micozelor interne.Predicting bacteremia in hospitalized patients: a prospectively validated model.Utilization and diagnostic yield of blood cultures in a surgical intensive care unit. 6. Lionaskis M S (2004) . 10. Viaţa Medicală Românească. Harlod C N (1986) . Raoult D (2001) . Guarro J. Crit Care Med. 12. Neguţ M (1999) . 27:1421-1428. 13. 67(9): S589. 2nd edition. Rev Iberoam Micol. Linden P. 14:133-147. et al. Lichtman Steven M (2001) . Ed. 17. 21:1-9.Diagnóstico histopatológico de las micosis. 19. Centraalbureau voor Schimmelcultures / Universitat Rovira i Virgili. Artal M E (2004) .Bacterial translocation in intestinal transplant recipients. Clin Microb Infect. 4. 33(1):1-10. David E B (2004) .Fine Needle Aspiration.Examene şi investigaţii în ginecologie şi obstetrică. Transplantation. 11.Anaerobic bacteremia and fungemia in patients undergoing endodontic therapy: an overview. 15. 113:495-500.Predicting Bacteremia at the Bedside. Ruiz G et al (2004) . Cancer Investigation. Doern G V (1994) . Peţeanu V.Tratat de microbiologie clinică. 16. 38:357-362. Edgeworth J D. 5. Ex Ponto. 8.Tehnici de recoltare. 18 .

Jans B. Bogdan Doroftei. Elward A. (2005) . transport. Zack J. Varghese C. 33:1329-1335. 19 Capitolul 1   . 23. ASM Press. Fraser V (2001) .). 17: 695-700. 21.Manual for Cytology. 2:1659-1667. 25.Fungal infections after bone marrow transplant. Biol Blood Marrow Transplant. 22. Magdalena Mareş.Nosocomial primary bloodstream infections in intensive care unit patients in a nonteaching community medical center: a 21-month prospective study. Directorate General of Health Services Ministry of Health and Family Welfare. (eds. In Murray P R et al. Warnock D W (2003) . Manual of clinical microbiology. 24. India.Diagnosis and Management. Sutton D A (2003) . Bhagwat S et al. 5(2):55-68. Warran D. Mihai Mareş 20. Richardson M D. Blackwell Publishing. Washington D C.Specimen collection. Carasauw H (1998) . Ronveaux O. Clin Infect Dis. Suetens C. Eur J Clin Infect Dis. Wingard J R (1999) . Venkataraman K.Fungal infection . 8th edition. Cox M.Epidemiology of Bloodstream infections in Belgium 1992-1996. Petru Cazacu.Maria Dan. and processing: Mycology.

.

după care se acoperă cu o lamelă. cu mult timp înainte de pozitivarea culturii.1%) care prin „digerarea” keratinei şi a celulelor somatice va permite observarea la microscop a diverselor formaţiuni 21 Capitolul 2   . sinusale. hemoculturi. se omogenizează pe o lamă de microscopie volume egale din materialul patologic şi soluţia clarificantă. Petru Cazacu.): lavaj bronhoalveolar (după centrifugare).preparat extemporaneu cu soluţie 20% KOH + substanţă fluorescentă sau frotiu colorat cu aceeaşi substanţă fluorescentă (Calcofluor. auriculare. fragmente unghiale. Giemsa etc. Calcofluor – în proporţie de 0. 2-1 vezi Anexa). spută (după tratare cu N-acetil-cisteină). . Se efectuează pe prelevate în stare proaspătă. Maria Dan 2 E Tehnici de microscopie directă Mihai Mareş. sensibilitatea metodei este relativ scăzută.). dar necesită microscopie în lumină ultravioletă (fig. Decelarea formaţiunilor fungice în prelevate este mult ameliorată dacă la soluţia clarificantă se adaugă un colorant – negru clorazol. depinzând de abilitatea şi experienţa anterioară a examinatorului. prelevate superficiale – cutanate. În acest scop. conjunctivale. El este obligatoriu pentru orice tip de prelevat cu excepţia sângelui şi are valoare diagnostică intrinsecă deoarece permite confirmarea rapidă a suspiciunii de infecţie micotică şi informarea timpurie a clinicianului. astfel încât să se evite formarea bulelor de aer. secreţii linguale. Bogdan Doroftei. Maria Dan xamenul microscopic direct al produselor patologice recent recoltate poate orienta diagnosticul către o infecţie fungică şi uneori poate chiar oferi indicii importante privind etiologia acesteia prin evidenţierea unor formaţiuni sau elemente caracteristice. Petru Cazacu. Blankophor etc. Produsele patologice pentru care există suspiciunea că ar conţine fungi se pot examina microscopic prin una dintre următoarele forme: . este metoda optimă de detecţie a fungilor în prelevate datorită unei sensibilităţi şi specificităţi excelente.preparat extemporaneu între lamă şi lamelă. într-o picătură de lichid clarificant (soluţie 10-20% KOH cu adaos de calcofluor 0. cu sau fără colorare prealabilă (calcofluor. unghiale. Câteva fragmente din prelevatul recoltat de la pacient se depun pe o lamă de sticlă. cu soluţie 20% KOH (scuame.Mihai Mareş. vaginale). Bogdan Doroftei. nr. biopsii (frotiuri prin amprentă). cerneală Parker sau o substanţă fluorescentă cu afinitate pentru glicanul din peretele fungilor (Blankophor.1%). Utilizarea substanţelor fluorescente incumbă examinarea preparatului la un microscop cu fluorescenţă.

Elementele morfologice identificabile prin examen microscopic direct sunt levurile (burjeonate sau nu. fără însă a-l aduce la fierbere.frotiu colorat May-Grunwald-Giemsa: metodă de rutină pentru depistarea levurilor intracelulare de tip Histoplasma. nr. 2-5 vezi Anexa) . aspergiloză etc. pseudohifele. etc. nr.elemente sferice. după caz. septate longitudinal şi transversal. urinar. cu sau fără capsulă). neoformans în sedimentul unor fluide biologice (LCR. În general. nr.). (fig. însă alte tehnici cu specificitate mai ridicată sunt recomandate (fig. colorat cu albastru de metilen în lactofenol: metodă expeditivă de diagnostic tip „one-step” a leziunilor de Pityriazis versicolor (fig. LBA sau biopsiile) care apoi se colorează Musto sau cu calcofluor şi se examinează în vederea decelării aspectelor particulare care ar pleda pentru o zygomicoză. septate sau nu. melanizate. nr.frotiuri obţinute prin etalare sau amprentă (pornind de la prelevate ca aspiratul bronşic. Coloraţia negativă cu tuş de India Scop Se recomandă pentru decelarea levurilor aparţinând speciei C.Tehnici de microscopie directă caracteristice fungilor. Acţiunea lichidului clarificant poate fi intensificată prin încălzirea lamei la flacăra unui bec de gaz. 1 mm diametru. cu obiectivele 10. lama se acoperă cu o lamelă şi se examinează la microscop.1. de 4-12 µm diametru. Echipamente Lame şi lamele de microscopie. urină. în sedimentul LCR. . celulele fumagoide . uneori ramificate. granulele (numite şi scleroţi .sau extracelulare. intra. dure. dar poate fi utilizată şi pentru detectarea levurilor prin microscopie directă (fig. 10-15 minute (eventual mai îndelungat în cazul fragmentelor unghiale). însă este inadecvată pentru detecţia celulelor levurice de dimensiuni mici – de exemplu.frotiu necolorat sau colorat cu albastru de metilen 3%: metoda se poate folosi pentru detectarea levurilor din hemoculturi. 2-4 vezi Anexa) . de cca. etc. artrosporii şi blastosporii de dimensiuni mari.celule cu aspect muriform. mănuşi de unică folosinţă.preparat extemporaneu colorat cu tuş de India: pune în evidenţă levurile capsulate din genul Cryptococcus. lama se poate examina când opacitatea preparatului s-a diminuat vizibil.preparat extemporaneu cu bandă adezivă. 2-3 vezi Anexa) . pipete 22 . rar structurile de fructificare ale unor fungi filamentoşi.frotiu pregătit pentru imunofluorescenţă prin tratare cu anticorpi monoclonali cuplaţi cu markeri fluorescenţi (în special pentru detecţia Pneumocystis jiroveci în prelevatele respiratorii) . După un contact de cca. Candida glabrata (fig. nr. formate la nivelul micetoamelor prin întreţeserea densă a hifelor).frotiu colorat Gram: pune cu uşurinţă în evidenţă filamentele. 20 şi 40. fragmentele hifale. 2-2 vezi Anexa) . 2-6 vezi Anexa) . 2.

permiţând vizualizarea a trei zone în componenţa capsulei şi a unor corpusculi în interiorul celulelor levurice la C. mănuşi de unică folosinţă. Se acoperă cu o lamelă de sticlă evitând formarea bulelor de aer. x1000). 3. în interiorul celulelor levurice sunt adesea observabili corpusculi de formă rotundă. Echipamente Lame şi lamele de microscopie. Se acoperă cu o lamelă. 23 Capitolul 2   . înconjurate de o capsulă clară. metoda mai poartă denumirea de “coloraţia negativă cu tuş de India”. Rezultatul colorării Cryptococcus neoformans se prezintă sub formă de celule levurice rotunde. 2. 2. Bogdan Doroftei. Datorită necolorării capsulei polizaharidice. Rezultatul colorării Cryptococcus neoformans se prezintă sub formă de celule levurice rotunde. x400. necolorat. 3. înmugurite sau nu. Petru Cazacu. formată din 3 zone concentrice. o picătură sol. înconjurate de un halou clar. 2. Pe o lamă de sticlă degresată se depun şi se amestecă o picătură din sedimentul probei de analizat şi o picătură tuş de India.Mihai Mareş. Maria Dan Reactivi Tuş de India sau tip Parker Mod de lucru 1. x400). Preparatul extemporaneu astfel obţinut se examinează la microscop (x100. Se examinează la microscop (x100.7-dibrom-4(hidroxomercurio)-fluoresceinei) Tuş India (sau tuş negru tip Parker) Mod de lucru 1. ceea ce creşte considerabil specificitatea examenului microscopic direct. facil de vizualizat pe fondul maron-negru al preparatului. pipete Reactivi Soluţie 2% mercurochrom (C20H8Br2HgNa2O6 – sarea disodică a 2. 2% mercurochrom şi o picătură tuş de India. Coloraţia negativă cu mercurochrom 2% şi tuş de India Scop Reprezintă o variantă îmbunătăţită a metodei anterioare. neoformans.2. Pe o lamă de sticlă degresată se depun succesiv şi se omogenizează o picătură din sedimentul probei de analizat. înmugurite sau nu.

00 ml Acid lactic.................... 0......... Reactivi Lactofenol cu albastru de anilină Albastru de anilină ............ AIIa zi..00 ml Apă distilată .... Remel................. se adaugă cristalele de fenol în acidul lactic.....3. hârtie de filtru.05 g Fenol......... În prima zi.......... 1...Tehnici de microscopie directă 2. 3. 20..... Se filtrează soluţia de albastrul de anilină şi se adaugă în soluţia de fenol / glicerol / acid lactic... două zile: 1....00 ml Prepararea acestei soluţii durează cca..... Se adaugă glicerolul.. Se omogenizează apoi folosind un agitator magnetic până la dizolvarea completă a fenolului...... Mod de lucru Se etalează pe o lamă o cantitate suficientă de probă.......... Se amestecă şi se păstrează la temperatura camerei în flacoane cu dop picurător..00 g Glicerol .. purtând mănuşi de protecţie.... cristale .... 4........ pahar Berzelius.. curate şi degresate... 40....... 3.............. 4........ Se lasă peste noapte pentru decantarea colorantului insolubil........ se dizolvă albastrul de anilină în apa distilată. Becton-Dickinson (Lactophenol blue solution) 24 ....................... Se omogenizează uşor. 2..... mănuşi de protecţie............ 20. 2...... Echipamente Lame şi lamele de microscopie.. Rezultatul colorării Fungii – albastru-închis Notă: Soluţia de lactofenol şi albastru de anilină este disponibilă comercial: Merck. pâlnie.. agitator magnetic.. Coloraţia cu lactofenol şi albastru de anilină (Lactophenol Cotton Blue) Scop Metodă destinată colorării şi evidenţierii prin microscopie a fungilor din unele prelevate clinice şi culturi.... Se adaugă 1-2 picături soluţie de lactofenol şi albastru de anilină............... într-un pahar Berzelius. Se acoperă cu o lamelă şi se examinează la microscop..... 20...... ansă de însămânţare...

10 ml Cerneală Parker Quink Permanent Blue ....... 2.... Bogdan Doroftei. Rezultatul colorării Elementele fungice apar colorate în albastru pal..... curate şi degresate..... Notă: 1....5.. apoi se adaugă glicerol şi cerneala Parker... 2... Glicerolul previne cristalizarea reactivului şi deshidratarea probei... evitându-se fierberea............. 10 ml Apă distilată .......... Echipamente Lame şi lamele de microscopie. Petru Cazacu. prin examen microscopic direct........ Coloraţia cu hidroxid de potasiu şi cerneală Parker Scop Evidenţierea elementelor fungice în raclatele tegumentare. După clarificarea preparatelor (15-20 minute pentru raclatele pielii şi câteva ore pentru raclatele unghiale)........ Clarificarea cu hidroxid de potasiu şi dimetil sulfoxid Scop Evidenţierea elementelor fungice prin examenul microscopic direct al raclatelor tegumentare............ 2.........Mihai Mareş... Preparatele se pot păstra până când rezultatele culturii sunt cunoscute............. Maria Dan 2.... Mod de lucru 1. ansă de însămânţare.. 80 ml Se dizolvă KOH în apă. Această tehnică este frecvent utilizată.. Probele negative la prima citire trebuie păstrate şi reexaminate în ziua următoare pentru a evita raportarea unor rezultate fals negative... păr şi fragmente unghiale...... Se acoperă cu o lamelă şi apoi se comprimă preparatul cu ajutorul capătului unei anse de însămânţare pentru îndepărtarea excesului de fluid..... 3..... pe o lamă de microscopie........... pensă Reactivi Hidroxid de potasiu ........ datorită întârzierii clarificării şi colorării probei... dar timpul necesar pentru clarificarea şi colorarea completă poate fi mai îndelungat. Se utilizează o ansă de însămânţare sau pensă pentru îndepărtarea unei mici porţiuni din proba de ţesut.. Aceasta se etalează într-o picătură de colorant. acestea se vor examina la microscop (x10. 25 Capitolul 2   . Se încălzeşte uşor preparatul prin trecerea acestuia de 2-3 ori prin flacără..... în special din zonele necrotice sau purulente. x40) pentru punerea în evidenţă a elementelor fungice.............. păr şi unghii (în special detecţia dermatofitozelor)..4..... x20.. 10 g Glicerol .

Echipamente Lame şi lamele de microscopie.. Se utilizează o ansă de însămânţare sau o pensă pentru recoltarea unei mici porţiuni din prelevat... 60 ml Hidroxid de potasiu . Aceasta se etalează apoi într-o picătură de KOH-DMSO pe o lamă de microscopie.. 2........... 2..... pensă Reactivi Dimetil sulfoxid (DMSO)...6...... necolorate.......... cu diafragma semideschisă pentu a surprinde mai uşor elementele fungice refringente. 1.. Se examinează la microscop. 2........ 26 ... ansă de însămânţare.. 3................ se comprimă uşor preparatul cu ajutorul capătului unei anse de însămânţare şi apoi se îndepărtează excesul de fluid........ Coloraţia cu calcofluor alb şi KOH 10% Scop Evidenţierea elementelor fungice din diverse prelevate......... 40 ml Apă distilată ..... Preparatele nu se vor păstra după examinare.. ansă de însămânţare....... curate şi degresate.......... pensă.. Se acoperă cu o lamelă........... Preparatul nu se încălzeşte.Tehnici de microscopie directă Echipamente Lame şi lamele de microscopie. prin microscopie cu fluorescenţă.. Mod de lucru 1.... Note: DMSO permite o macerare şi o clarificare mult mai rapide decât hidroxidul de potasiu singur.... 10 g Se adaugă dimetil sulfoxidul în apa distilată şi apoi se dizolvă KOH în soluţia respectivă......... curate şi degresate..

....... Calcofluorul alb (M2R pulbere . 27 Capitolul 2 Soluţia A   .... Alternativ......................... Soluţie B Calcofluor alb .. Bogdan Doroftei.....Mihai Mareş................ 3.............1 g Apă distilată ...... 4.......... Se amestecă o picătură din fiecare soluţie (A şi B) în centrul unei lame de microscopie....... comprimând preparatul cu capătul unei anse de însămânţare............ în funcţie de filtrele utilizate........Polysciences sau Blankophor BA ......... 400 nm..... Mod de lucru 1. 10 g Glicerol ............... Maria Dan Reactivi Hidroxid de potasiu .............. 2........ 0. Rezultatul colorării Elementele fungice prezente în preparat vor apare colorate în albastru fluorescent sau verde-deschis..... totuşi este necesar ca microscopul cu fluorescenţa să fie dotat cu filtre care să determine o sensibilizare la lumina ultravioletă.. 100. Este o metodă expeditivă şi sensibilă... cu o lungime de undă joasă... care se tratează apoi cu soluţiile reunite menţionate............................... Petru Cazacu......... Este un colorant fluorescent pentru fungi. Note: 1...... 2. Excesul de lichid se elimină....... Se încălzeşte uşor lama şi se examinează la microscopul cu fluorescenţă echipat cu filtre adecvate...0 ml Se dizolvă calcofluorul alb pulbere în apa distilată uşor încălzită........... 90 ml Se dizolvă KOH în apă şi apoi se adaugă glicerolul. de cca....Bayer) este utilizat ca agent de albire în industria hârtiei........ legându-se selectiv de celuloză şi chitină..... 10 ml Apă distilată ...... Se etalează proba de ţesut în soluţie şi apoi se acoperă cu o lamelă..... în funcţie de natura prelevatului se pot obţine şi frotiuri prin amprentă sau ştergere...

.. e) foarfece sterile..... Soluţia iod-iodurată Gram (soluţia Lugol) Iod .............................. anse de însămâţare microbiologică................ depinzând de sursa probelor şi de protocolul laboratorului: a) plită încălzitoare............ recipiente pentru depozitarea de deşeuri biologice Materiale opţionale....... 275 ml Se adaugă iodul peste iodura de potasiu.............. * vezi coloraţia Gram-calcofluor alb 28 ................. pipete Pasteur.... bisturie........... ace de inoculare................................................... b) centrifugă..................... Se lasă soluţia de oxalat de amoniu peste noapte pentru solubilizare completă sau se încălzeşte uşor până la dizolvare.................... 20 ml Oxalat de amoniu ........ Reactivi Soluţia de cristal violet Cristal violet .. Coloraţia Gram* Scop Identificarea fungilor prin examenul microscopic al frotiurilor executate din diverse lichide biologice.......... în aproximativ 25 ml apă distilată.......................... 80 ml Se dizolvă cristalul violet în etanol şi oxalatul de amoniu în apă... 60ºC....... 2 g Etanol 95% .............Tehnici de microscopie directă 2... c) agitator tip Vortex............................................... d) tuburi sterile cu dop filetat......... ingestia sau contactul cu pielea...... Fixator Metanol absolut Echipamente Lame de sticlă pentru microscopie (25/75 mm) cu un capăt mat...... Se amestecă cele două soluţii şi apoi se filtrează... 1 g Iodură de potasiu . Atenţie! Iodul este coroziv.. pense.. Se evită inhalarea................7.8 g Apă distilată ... 0...... Când solubilizarea este completă se adaugă restul de apă................ 2 g Apă distilată .

Mihai Mareş, Bogdan Doroftei, Petru Cazacu, Maria Dan

Soluţia de alcool-acetonă Etanol 95% ................................................... 100 ml Acetonă ......................................................... 100 ml Se omogenizează şi se păstrează într-un recipient brun, etichetat cu data preparării, la temperatura camerei. Soluţia este stabilă 1 an. Atenţie! Etanolul şi acetona sunt inflamabile. Safranină O 0,4 % Safranină O ......................................................... 1 g Apă distilată .................................................. 250 ml Mod de lucru 1. Frotiurile pot fi fixate prin încălzire sau cu metanol; 2. Frotiurile se pot usca în aer sau se menţin pe o platină încălzitoare electrică, la 60ºC, până la uscare: 3. Dacă frotiurile sunt uscate în aer se vor trece de două sau trei ori printr-o flacără. Pentru a evita denaturarea frotiului, acesta nu se supraîncălzeşte. 4. Se lasă lama să se răcescă înainte de colorare; 5. Fixarea cu metanol previne liza eritrocitelor. De asemenea, fixarea cu metanol este recomandată pentru toate prelevatele clinice lichide, în special pentru urină, deoarece previne spălarea probelor în timpul colorării. Metanolul se stochează în sticle brune cu dop etanş. O cantitate de lucru poate fi păstrată în recipienţi de plastic, dacă aceasta se înlocuieşte la fiecare 2 săptămâni. Pentru fixare, se adaugă câteva picături de metanol pe lamă, se lasă în contact timp de 1 minut, apoi se varsă şi se lasă lama să se usuce la aer; 6. Se inundă frotiul astfel fixat, cu soluţie de cristal violet. Se lasă în contact 60 secunde; 7. Se varsă soluţia de cristal violet şi se clăteşte lama uşor cu apă de robinet. Atenţie! Clătirea excesivă poate determina îndepărtarea cristalului violet din celulele gram-pozitive. Apa se varsă pe unul din capetele lamei, oblic, pentru a asigura o curgere lentă peste frotiu. 8. Se clăteşte apoi cu soluţie Lugol, timp de 3 secunde; 9. Se inundă frotiul cu soluţie Lugol şi se lasă în contact 30 secunde; 10. Se spală cu apă de robinet; 11. Se toarnă soluţie alcool-acetonă peste frotiu, într-un capăt al lamei, oblic, până când soluţia care se scurge la capatul opus devine clară. Timpul de decolorare variază în funcţie de grosimea frotiului (în general 8-10 secunde); 12. Se spală cu apă de robinet; 13. Se inundă lama cu soluţie de safranină 0,4 %, timp de 30 secunde; 14. Se îndepărtează colorantul (safranină 0,4%) cu un jet de apă de robinet ; 15. Se usucă lama în aer, în poziţie verticală, iar apoi se şterge reversul acesteia cu un şerveţel îmbibat în alcool sau acetonă.

29

Capitolul 2

 

Tehnici de microscopie directă

Rezultatul colorării Fungii sunt Gram-pozitivi, deci se vor colora în violet.
Note: 1.Dacă soluţia de cristal violet prezintă precipitat sau sediment, se refiltrează înainte de utilizare. Unii coloranţi, în special safranina, se pot contamina. Când se suspectează acest lucru, se înlocuiesc. 2. Evaporarea poate altera eficacitatea reactivilor; soluţiile de lucru trebuie schimbate regulat. 3. Zilnic sau când se foloseşte un nou lot de reactivi se realizează controlul de calitate prin executarea unui frotiu din Escherichia coli (ATCC 25922) şi Staphylococcus epidermidis (ATCC 12228) sau Staphylococcus aureus (ATCC 25923). Acesta se fixează şi se colorează după tehnica descrisă mai sus. Rezultatele colorării frotiului de control: a) coco-bacili Gram-negativi: roz; b) coci Gram-pozitivi: violet intens. 4. Câteva dintre cauzele cele mai frecvente care duc la obţinerea unor rezultate nesatisfăcătoare ale coloraţiei Gram: a) utilizarea unor lame de microscopie insuficient degresate. Pentru acest lucru, se păstrează lamele într-un pahar cu etanol 95%. Excesul de alcool se îndepărtează prin ştergerea sau flambarea lamelor înainte de utilizare; b) executarea unor frotiuri prea groase; c) supraîncălzirea frotiului când acesta este fixat prin căldură; d) spălarea excesivă pe durata procedurii de colorare.

2.8. Coloraţia Gram - calcofluor alb Scop Uneori, fungii nu se pot distinge cu acurateţe în frotiurile colorate Gram sau pot rămâne mascaţi de alte materiale din probă. În această situaţie, calcofluorul alb poate fi utilizat pentru supracolorarea frotiurilor colorate Gram în vederea unei mai bune evidenţieri a elementelor fungice. Echipamente Lame şi lamele pentru microscopie, hârtie de filtru, beţişoare din lemn, microscop cu fluorescenţă, sticlărie de laborator Reactivi Xilen Metanol absolut Soluţie de hidroxid de potasiu 10 sau 20% Calcofluor alb Mod de lucru 1. Se colorează frotiul prin tehnica de colorare Gram; 2. Se aplică peste frotiul colorat Gram un fragment de hârtie absorbantă, pentru a-l usca;
30

Mihai Mareş, Bogdan Doroftei, Petru Cazacu, Maria Dan

3. Se inundă lama cu xilen pentru 1-2 ore, în funcţie de grosimea frotiului; 4. Se clătesc lamele în metanol absolut pentru a îndepărta resturile tisulare; 5. Se inundă lama cu soluţie KOH 10-20% pentru 1-2 ore, în funcţie de grosimea frotiului; 6. Se îndepărtează KOH, se adaugă o picătură de calcofluor alb 0,1% şi se omogenizează uşor cu un beţişor de lemn; 7. Se aplică apoi o lamelă prin presare uşoară. Preparatul se examinează la microscopul cu fluorescenţă folosind filtre speciale (490-520 nm); 8. Elementele fungice care în prealabil nu sunt vizibile sau sunt neidentificabile în frotiurile colorate Gram, pot fi distinse mai facil ca structuri fluorescente.
Notă: Multe din prelevatele clinice trimise laboratoarelor de microbiologie pentru examinare pot conţine şi elemente fungice, care de multe ori sunt nedetectate sau confundate. De aceea este imperios necesară o instruire a personalului în vederea creşterii performanţelor examenului microscopic direct şi în ceea ce priveşte detectarea elementelor fungice pe frotiuri colorate Gram.

2.9. Coloraţia Giemsa Scop Evidenţierea trofozoiţilor şi a corpilor intrachiştici (nu şi a chiştilor) la Pneumocystis carinii, prin examenul microscopic al frotiurilor executate din prelevate respiratorii joase. Fixator Metanol absolut Echipamente Lame şi lamele pentru microscopie, curate şi degresate, sticlărie de laborator, hârtie de filtru Reactivi Soluţia Giemsa stoc Colorant Giemsa, pulbere ................................ 0,8 g Glicerol ........................................................ 50,0 ml Metanol absolut ........................................... 50,0 ml Se dizolvă pulberea de colorant Giemsa în glicerol, apoi se încălzeşte soluţia pe baie de apă până la 56°-60ºC, timp de 90-120 minute. Se adaugă metanolul, se omogenizează şi se filtrează. Soluţia stoc se va păstra la temperatura camerei într-un recipient închis. Soluţie Giemsa de lucru Soluţia stoc se diluează în proporţie de 1:50 cu soluţie de fosfat Sorensen.
31

Capitolul 2

 

Tehnici de microscopie directă

Soluţie fosfat Sorensen pH 6,4 Fosfat de potasiu monobazic ......................... 6,63 g Fosfat de potasiu dibazic anhidru .................. 2,56 g Apă distilată ................................................ 1000 ml Mod de lucru 1. Se usucă frotiul în aer; 2. Se fixează cel puţin 30 secunde (uzual 3-4 minute) în metanol absolut; 3. Se îndepărtează metanolul prin înclinarea lamei sau prin scoaterea acesteia din paharul cu fixator, apoi se usucă în aer; 4. Se introduc lamele complet uscate într-un pahar Berzelius sau se aşează orizontal în suportul unei baterii de colorare care conţine soluţie Giemsa de lucru, pentru 20-30 minute; 5. Se spală lama cu apă distilată; 6. Se şterge pe verso, apoi se usucă în aer; 7. Se montează sau nu, apoi se examinează la microscop. Înainte de montare, lamela se introduce în xilen pentru a evita apariţia bulelor. Rezultatul colorării Trofozoiţii – apar de obicei în plaje, aglomeraţi, cu nucleul colorat în roşuviolet şi citoplasma în gri.
Note: 1. Prelungirea imersiei în soluţia Giemsa diluată poate face ca materialul biologic de pe lamă să se desprindă. 2. Colorantul Giemsa este disponibil comercial.

2.10. Coloraţia May-Grunwald-Giemsa (MGG) Scop Este o coloraţie de elecţie pentru depistarea intramacrofagică a formei levurice aparţinând speciei Histoplasma capsulatum var. capsulatum. Fixator Metanol absolut Echipamente Lame şi lamele pentru microscopie, curate şi degresate, sticlărie de laborator, hârtie de filtru

32

Mihai Mareş, Bogdan Doroftei, Petru Cazacu, Maria Dan

Reactivi Soluţia de colorare I (May- Grünwald) May-Grünwald pulbere ................................... 0,3 g Metanol absolut ......................................... 100,0 ml După preparare se păstrează într-un recipient etanş, la temperatura camerei timp de 24 ore. Se filtrează înainte de utilizare. Soluţia de colorare II (Giemsa) Colorant Giemsa pulbere .................................... 1 g Glicerol ........................................................... 66 ml Metanol absolut .............................................. 66 ml Colorantul Giemsa se dizolvă în glicerol şi apoi se încălzeşte la 56ºC timp de 90-120 minute. Se adaugă metanolul agitând pentru omogenizare. Soluţia finală se păstrează la temperatura camerei într-un recipient închis. Se filtrează înainte de utilizare. Soluţia tampon Sörensen pH 6,8 Fosfat de sodiu dibazic .................................... 0,3 g Fosfat de sodiu monobazic .............................. 0,7 g Apă distilată ............................................... 100,0 ml După preparare, soluţia se păstrează la frigider; este stabilă timp de 1 an. Mod de lucru 1. Se fixează frotiurile în metanol absolut, timp de 30 secunde; 2. Se îndepărtează metanolul; 3. Se aplică soluţia de colorare I proaspăt diluată 1:1 cu soluţie tampon, timp de 5 minute (lama va fi poziţionată orizontal sau introdusă într-un pahar); 4. Se transferă lamele fără spălare prealabilă în soluţia de colorare II diluată recent cu 9 părţi de soluţie tampon, pentru 10-15 minute; 5. Se imersează lamele în soluţie tampon pentru îndepărtarea colorantului; 6. Se spală lamele cu apă de robinet din abundenţă; 7. Se transferă într-un pahar cu apă pentru 2-5 minute; 8. Se usucă apoi într-o poziţie oblică. Nu se usucă prin ştergere; 9. Se poate monta o lamelă, însă nu este neapărat necesar. Rezultatul colorării Fungii – nuanţe de roz, albastru, violet

33

Capitolul 2

 

...... 6.......... Este important ca lamele să nu se usuce în timpul colorării................63 g Na2HPO4 anhidru ........Tehnici de microscopie directă Note: 1.0 ml După preparare..... 2. Se lasă amestecul în contact cu frotiul timp de 3 minute.. 3... Soluţie tampon Sorensen pH 6... 2... Se clăteşte lama cu apă distilată timp de 30 secunde......................3 g Metanol absolut .Soluţia stoc May-Grunwald şi colorantul Giemsa sunt disponibile comercial 2...... 0.. curate şi degresate..... sticlărie de laborator............. soluţia se menţine într-un recipient etanş la temperatura camerei timp de 24 ore şi se filtrează înainte de utilizare..56 g Apă distilată .... Mod de lucru 1. peste lama poziţionată orizontal......11...... 2.. timp de 2 minute. Se aplică soluţia de colorare..................... numărând picăturile....... 6... Se omogenizează atent colorantul şi soluţia tampon fără a atinge suprafaţa filmului de lichid (va apare o strălucire metalică la suprafaţa amestecului)... Coloraţia Wright Scop Evidenţierea formelor levurice la Histoplasma capsulatum var......... 5...... capsulatum prin examen microscopic al frotiurilor executate din sânge şi măduvă osoasă hematogenă Fixator Metanol absolut Echipamente Lame şi lamele pentru microscopie..... 34 ...... 100.. Se îndepărtează metanolul prin înclinarea lamei....... ad 1000 ml. Se adaugă peste colorant aceeaşi cantitate din soluţia tampon. 4..... pentru a preveni apariţia artefactelor sau formarea de precipitate......... Se usucă frotiul şi se fixează apoi cel puţin 30 secunde în metanol absolut..........4 KH2PO4 anhidru .............. hârtie de filtru Reactivi Soluţie de colorare (care poate fi achiziţionată ca soluţie gata preparată sau ca pulbere din diverse surse comerciale) Colorant Wright pulbere .

. 2.. baie de apă Reactivi Roşu Carmin .................... 3.. Maria Dan 7.. 1.. 8....5% Vezi coloraţia hemalaun-eozină Mod de lucru 1... Dacă se doreşte.. 0. frotiul se poate monta prin acoperire cu o lamelă........ 2.. 100.. hârtie de filtru....0 g Etanol 50% ... Coloraţia cu mucicarmin Southgat Scop Coloraţia se utilizează pentru detectarea materialului capsular la Cryptococcus neoformans Echipamente Lame şi lamele de microscopie...... Se completează până la volumul iniţial cu etanol 50% şi apoi se filtrează... pahare Berzelius.. 5.........0 g Hidroxid de aluminiu pulbere . Petru Cazacu..........Mihai Mareş.... pâlnie de filtrare.. clarificare şi montare. Se hidratează secţiunile sau se execută un frotiu (după caz)..... Hematoxilina Ehrlich Vezi coloraţia hemalaun-eozină Alcool acid 0............ în soluţie se adaugă: Clorură de aluminiu anhidră ... 1. 35 Capitolul 2 Rezultatul colorării Fungii – culoare violetă   ...... Clătire în apă distilată. deshidratare...... Nu se vor şterge... curate şi degresate....0 ml După omogenizarea acestor substanţe.. apoi se lasă să se răcească......... ansă de însămânţare.... Se colorează cu hematoxilină timp de 15 minute....12.. Lamele se usucă în poziţie verticală.. Se diferenţiază cu alcool-acid şi apoi se clătesc cu apă de robinet.... 4...5 g Se fierbe pe baia de apă pentru 2-3 minute....... Soluţia stoc este stabilă câteva luni.......... Se colorează pentru 30 minute în soluţia roşu carmin......... Bogdan Doroftei.

.... 25 ml Metenamină soluţie stoc .... sticlărie de laborator..... 36 ............................................ Se vor evita contactul şi inhalarea................ Atenţie! Corozivă....... Coloraţia Musto Scop Punerea în evidenţă a elementelor fungice prin examenul microscopic al frotiurilor Echipamente Lame şi lamele pentru microscopie............soluţie de lucru Borax 5% ............... plită electrică..... Soluţia finală este stabilă 3 luni şi se păstrează la 4ºC. posibil carcinogenă...... Acid cromic 5% Trioxid de crom ........... 5 g Apă distilată ...................................... Atenţie! Acidul este coroziv................. Metenamină ........... 25 ml Se adaugă soluţia de borax în apă distilată....... care va dispare prin agitarea paharului....... posibil carcinogen......... Se prepară extemporaneu..... curate şi degresate....................... 2 ml Apă distilată ...................... se va forma un precipitat alb...soluţie stoc Metenamină 3 % . 100 ml Soluţia se poate păstra 6 luni........... 100 ml Azotat de argint 0....13..............15 % . apoi se omogenizează cu soluţia stoc de metenamină........ 5 ml În momentul adaugării soluţiei de metenamină peste soluţia de azotat de argint.......................Tehnici de microscopie directă Rezultatul colorării Mucicarminul colorează mucinele acide în roz (capsula va deveni astfel colorată) 2..... vase din sticlă Pyrex Reactivi Metenamină ......

.......Mihai Mareş........ riguros igienizate în prealabil.......... 2 g Apă distilată .................................. 5 picături După preparare se păstrează la frigider. Clorură de aur 0.....................................0 ml Soluţia este stabilă 3 luni..................... Mod de lucru 1...... 4................... Bisulfit de sodiu 1% Bisulfit de sodiu............ 100........................... ad 100.............................0 g Apă distilată .......... 0.. Soluţia este stabilă 1 an.......... 3... Petru Cazacu............................2 g Apă distilată .. Atenţie! Se evită contactul şi inhalarea......... ad 200 ml Se păstrează la 4ºC........ Tiosulfat de sodiu 2 % Tiosulfat de sodiu .2% Clorură de aur ...................... timp de 1 minut... Verde luminos 1% Verde luminos SF yellow .............. 4 g Apă distilată ................. 5.0 ml Se păstrează la frigider în recipiente etanşe...... Maria Dan Borax 5% Borat de sodiu ........................................ ad 200 ml Se păstrează la 4ºC..... Clătire de două ori în apă distilată .. 1 g Apă distilată ............. Atenţie! Se evită contactul şi inhalarea. Fixarea: se încălzeşte acidul cromic 5% până la 65ºC pe o plită electrică şi apoi se imersează imediat lamele timp de 1 minut....... ad 100 ml Acid acetic glacial . 2............................................................ Se clătesc lamele în apă distilată 37 Capitolul 2   ........ Bogdan Doroftei.............................. Se introduc preparatele în bisulfitul de sodiu....

Această metodă comportă în principal trei faze: • fixarea cu acid cromic • colorarea cu nitrat de argint . Frotiurile sero-fibrinoase (lichid pleural. Clătire de trei ori în apă distilată. Oxidarea grupării hidroxil a polizaharidelor fungice parietale şi complexarea lor cu reactivul argentic. timp de 1 minut.Tehnici de microscopie directă 5. Soluţiile din bateria de colorare se reînnoiesc după 4 etape sau din 2 în 2 săptămâni. 11. Această tehnică prezintă mai multe avantaje: • reproductibilitate excelentă şi rapiditate (aproximativ 20 minute) • costuri moderate • posibilitatea de aplicare pentru o varietate largă de probe biologice. Se introduc lamele în xilen sau metil-ciclohexan câteva secunde. dar dacă frotiul nu s-a desprins în totalitate se poate recurge la o metodă de examinare microscopică directă între lamă şi lamelă. inclusiv pentru prelevatele bronho-alveolare în investigarea pentru pneumocistoză • simplitatea tehnicii şi uşurinţa cu care se detectează elementele fungice. Imersare în tiosulfat de sodiu. 13.metenamină • contra-colorare cu verde luminos 4. Pentru reuşita coloraţiei trebuie respectate trei condiţii esenţiale: • indicaţiile tehnice • folosirea unei lame-martor la fiecare serie de colorare • reînnoirea regulată a reactivilor 7. 9. pentru clarificare. 10.) prezintă uneori inconvenientul că se desprind de pe lamă în cursul colorării. Coloraţia Musto este versiunea rapidă a metodei Gomori-Grocott. articular etc. apoi în alcool absolut. 3. 38 .2% timp de 1 minut. Se montează lamele în Eurik. chiar dacă acestea sunt foarte rare 6. timp de 1 minut. Clătire cu apă distilată. 14. Contra-colorarea cu verde luminos. timp de 2 minute. determină coloraţia brun-negricioasă a fungilor pe un fond verde al preparatului. utilizând tot principiul impregnării argentice. 7. Se încălzeşte rapid la 90-95ºC timp de 2-3 minute: soluţia îşi schimbă culoarea de la cenuşiu la negru. 6. Rezultatul colorării Fungii – culoare brun-negriciosă Fondul – verde Notă: 1. de două ori timp de câteva secunde. Impregnarea argentică: soluţia de lucru se transferă într-un vas de sticlă Pyrex şi apoi se imersează lamele. 2. Lamele se introduc în clorură de aur 0. Clătire cu apă de robinet. 5. 12. Clătire cu apă distilată. Deshidratare în etanol 95% câteva secunde. Acest inconvenient nu poate fi remediat. iar lamele devin maro. 15. 8.

Blood Film Preparation and Staining Procedures. Ed. Ed. Bucureşti. Buiuc D. Guillen A (1996) . Washington University School of Medicine. Figueras M J (2000) .démarche diagnostique. Neguţ M (1999) . 2nd ed. 6. St. 34(9):22902291. Bridgman C P (1992) . Warnock D W (2003) . Petru Cazacu. Missouri. Elsevier.neoformans in cerebrospinal fluid specimens. Viaţa Medicală Românească.Fungal infection .Les mycoses humaines . 7. 3.Atlas of clinical fungi. Paris. Carden Jennings Publishing Co Ltd. 39 Capitolul 2   . Bucureşti. J Clin Microbiol. 8. 4. Houwen B (2000) . Laboratory Hematology. Guarro J. Maria Dan Bibliografie selectivă 1. 2. HuiHuicho L. Golăescu M (1997) . Gené J. Zerba R. Grillot R (1996) . Hoog G S de.Diagnosis and Management.Micoscopic Anatomy Laboratory Manual. 5.Diagnosticul şi tratamentul micozelor interne. Blackwell Publishing. Bogdan Doroftei. Ed.Modified India ink preparation for C. Medicală.Mihai Mareş. Centraalbureau voor Schimmelcultures / Universitat Rovira i Virgili. Richardson M D. Louis.Tratat de microbiologie clinică.

.

care oferă generoase posibilităţi de folosire în demersul diagnostic al bolilor infecţioase induse de fungi. care permit identificarea mai facilă a acestor microorganisme din prelevatele patologice. deoarece orice încercare în acest sens va tinde să satisfacă mai curând legile semanticii decât rigorile practicii medicale.1. Astăzi. produce o gamă extrem de diversificată de substraturi nutritive şi medii de cultivare. care să corespundă dezideratelor de eficienţă. indiferent de natura lor. susţinută de o intensă activitate de cercetare. o adevărată industrie. de substraturi organice şi minerale cu un grad mai redus de puritate. imitând pe cât posibil condiţiile trofico-habituale din organismele gazdă sau din biotopurile naturale specifice. justifică includerea în mediile de cultură a unei game largi şi variate de nutrienţi care să asigure izolarea şi/sau identificarea lor în condiţii optime. putem defini mediile de cultură ca un complex de substanţe chimice pure sau dimpotrivă. Mihai Mareş 3. a făcut posibilă în ultimul timp formularea unor medii de cultură mai complexe. precizie şi expeditivitate din micologia clinică. este o încercare destul de dificilă pentru microbiologul practician. Investigarea particularităţilor biochimice ale fungilor. în contextul varietăţii covârşitoare a entităţilor taxonomice microbiene şi a exigenţelor nutritive extrem de diverse pe care acestea le reclamă în dezvoltarea lor. Olimpia Bazgan. Mihai Mareş Medii de cultivare Luminiţa Malic. este o necesitate indiscutabilă pentru înţelegerea procesului morbid infecţios şi pentru iniţierea terapiei etiotrope. Acest demers rămâne în domeniul speculativ. Generalităţi efinirea mediilor de cultură într-o manieră completă şi complexă. care să ofere microorganismelor posibilitatea dezvoltării şi multiplicării. în special a profilului lor enzimatic. Totuşi. Diversitatea fungilor. Au fost formulate astfel o multitudine de medii de cultivare incluzând ingrediente cu grade diferite de specificitate. Olimpia Bazgan. Izolarea în condiţii de laborator a fungilor din prelevatele patologice.Luminiţa Malic. D 41 Capitolul 3 3   . ca bioentităţi cu potenţial patogen.

galactoza. Zn. streptomicină. Co. lactoza. uree • în cazul promotorilor de creştere: 1. monozaharide (glucoza sau dextroza. inozitol etc. Factorii inhibitori sunt reprezentaţi de substanţe ce pot supresa dezvoltarea unor categorii de microorganisme. nutrienţii pot fi: • în cazul surselor de carbon: 1. Pentru anihilarea dezvoltării bacteriilor. a unor substanţe din grupa antibioticelor (penicilină. oxalic. rafinoza) 3. Substanţele nutritive sau nutrienţii sunt reprezentate de o grupare pletorică de substanţe chimice care sunt incluse în medii pentru a oferi fungilor: o sursă de carbon. Ca. di. acid nicotinic. gelatină. xiloza. chitină etc. nitriţi. tobramicină) sau a coloranţilor (cristal violet. vitamine (tiamină. cloramfenicol.Medii de cultivare 3. Mg. maltoza. manoza. Se recomandă ca în mediile de cultură solide destinate izolării fungilor. raportul C:N să fie de 9-12:1.a. ovalbumină) 3.a. apa şi agenţii de solidificare (în cazul mediilor solide). Din punct de vedere al structurii chimice. cazeină. Czapek. În general.) 4.şi oligozaharide (zaharoza sau sucroza. principalele componente ale mediilor de cultură sunt reprezentate de substanţele nutritive. în principal. polizaharide (amidon. Fe. P. Cu. acizi graşi etc. săruri de amoniu) 2. compun în mod obişnuit microflora diverselor prelevate recoltate din situsuri normal nesterile. ciprofloxacin. celobioza. factorii inhibitori. hidrolizat de cazeină. mai ales a celor contaminante. PDA) permit totuşi dezvoltarea unui număr mare de entităţi taxonomice aparţinând mai multor genuri.).2. keratină. vitamine. acizi graşi cu lanţ lung de atomi de carbon (C12-C24).) 2. S ş. substanţe minerale (sub formă de săruri care să conţină Na. triptofan.) 5. agenţii revelatori. necesari pentru dezvoltarea levurilor lipodependente ale genului Malassezia. indezirabile în manoperele de izolare şi identificare a fungilor cu semnificaţie clinică. lipide • în cazul surselor de azot: 1. histidină ş. ramnoza. se recomandă înglobarea în mediile de cultură destinate izolării fungilor. Rose Bengal). malonic etc. glutamină. substanţe anorganice azotate (nitraţi. o sursă de azot şi promotori de creştere (substanţe minerale. glicogen. trehaloza. gentamicină. Unele formule (Sabouraud. arabinoza) 2.) 4. făcând practic imposibilă obţinerea unui mediu standard pentru toate speciile de interes medical. 42 . peptide şi proteine (peptonă. Compoziţia mediilor de cultură Particularităţile metabolice şi numărul apreciabil al fungilor incumbă folosirea unor substraturi nutritive variate. aminoacizi (glicină. ubicuitari.) 3. celuloză. care alături de fungii patogeni sau condiţionat patogeni. Este vorba. K. citric. acizi organici (tartric. de bacterii şi fungi saprobioţi. fructoza.

în marea lor majoritate. În general. de preferat încălzită la 70º-80ºC. urmată apoi de fierberea amestecului până la dizolvarea completă a tuturor ingredientelor. Mihai Mareş Izolarea fungilor patogeni este favorizată de însămânţarea prelevatelor pe medii solide ce conţin cicloheximidă.Luminiţa Malic. permiţând chiar izolarea şi identificarea simultană. se va renunţa la etapa de fierbere. au fost mediul Nickerson şi mediul Pagano-Levin. Olimpia Bazgan. fără a fi necesară utilizarea suplimentară a altor medii. Ele conţin substratul fluorogen sau cromogen pentru una sau două enzime (β-D-galactozaminidază şi/sau L-prolin-aminopeptidază). aceştia sunt substraturi ale diverselor enzime produse în special de micromiceţii levuriformi. timp de 15-20 minute la 121ºC (sau respectând parametrii recomandaţi de 43 Capitolul 3   . atât ca spectru de microorganisme identificabile. Paleta acestor medii diferenţiale este destul de largă. replicarea şi exprimarea fenotipică plenară a tuturor caracterelor culturale ale fungilor. succesiunea adăugării lor. În prezent. care să asigure o bună discriminare între diferitele specii de fungi potenţial prezente în diverse prelevate. într-o singură etapă. cât şi ca grade de specificitate şi sensibilitate ale metodei. modul de solubilizare a acestora. a presupus includerea unor agenţi revelatori în compoziţia mediilor de cultură. Formularea unor medii diferenţiale. la prepararea mediilor de cultivare comercializate se vor respecta riguros instrucţiunile firmei producătoare. Prepararea şi sterilizarea mediilor Prepararea mediilor este o etapă extrem de importantă. Primele medii diferenţiale cromogene. 3. prin a căror scindare se formează compuşi fluorescenţi (identificabili în lumina ultravioletă) sau compuşi caracterizaţi printr-o culoare specifică. fiind disponibile comercial nu mai puţin de 6 astfel de medii (tabelul 1-1). În general. iar rezultatele obţinute prin cultivarea fungilor sunt reproductibile. utilizate pentru identificarea prezumtivă a diverselor specii de Candida. condiţionate sub formă de pulbere. mediile deshidratate sunt reconstituite prin solubilizarea unor cantităţi precise de pulbere în apă distilată sau apă de robinet. comercializate de diferite firme. mediile repartizate în flacoane sau tuburi se vor steriliza prin autoclavare. doar în cazul speciei Candida albicans şi a altor câtorva levuri. Însă numărul redus de specii identificabile a determinat în timp renunţarea la aceste medii şi înlocuirea lor cu altele mai performante. agenţii revelatori folosiţi fiind reprezentaţi de sulfitul de bismut. Calitatea ingredientelor. În cazul mediilor ce conţin ingrediente care nu suportă încălzire la temperaturi crescute.3. Prin utilizarea unor astfel de medii standardizate sunt eliminate inconvenientele legate de procurarea unor ingrediente de calitate. ajustarea pH-ului şi repartizarea mediilor în vederea sterilizării pot reprezenta tot atâţia factori limitativi ai demersului diagnostic. respectiv sărurile de trifenil-tetrazoliu. substanţă capabilă să inhibe parţial sau total dezvoltarea fungilor contaminanţi. care condiţionează hotărâtor dezvoltarea. După preparare. dacă nu li se acordă importanţa cuvenită. în laboratoarele de diagnostic microbiologic este cvasigeneralizată prepararea mediilor de cultură prin hidratarea asocierilor complete de ingrediente standardizate. a levurilor din diverse prelevate.

sterilitatea şi performanţele mediului. cu capac filetabil. .Mediile selective se verifică prin însămânţarea unor tulpini tip rezistente şi a unora sensibile la agenţii inhibitori existenţi în mediu. mediile condiţionate în plăci Petri se pot păstra până la 3 luni. degradabile. iar cele în tuburi cu dop etanş până la 6 luni. 44 . Performanţele de creştere se verifică utilizând tulpini tip din colecţia laboratorului. iar tuburile vor fi etanşeizate cu dopuri confecţionate din material neporos pentru a preveni desicarea. Controlul de calitate şi păstrarea mediilor Fiecare nou lot de medii de cultură.Mediile de izolare neselective se verifică prin evaluarea capacităţii lor de a asigura dezvoltarea optimă a tulpinilor însămânţate. Conservarea mediilor de cultură preparate în laborator şi a celor reconstituite prin rehidratare se face de preferinţă la temperaturi de refrigerare (2º-8ºC). În aceste condiţii. se vor prepara separat şi se vor adăuga la mediul de bază după sterilizarea acestuia. Excepţie fac unele medii ce conţin ingrediente perisabile. respectiv 37ºC. pH-ul. . tip Deltalab . Componentele ce nu pot fi autoclavate datorită termolabilităţii lor. alese în funcţie de tipul de mediu şi de recomandările privind aplicabilitatea acestuia în diagnostic: . plăcile Petri plasându-se în pungi de polietilenă sau cutii închise ermetic. a căror stocare în timp este limitată. gradate. Aspectul (culoare. indiferent de provenienţa sa (medii gata de folosire.Medii de cultivare producător). transparenţă.4. repartizate în plăci sau tuburi “single-use” livrate de diverse firme sau medii preparate în laborator) va fi supus unui control de rutină care vizează analiza unor însuşiri esenţiale cum ar fi aspectul. Absenţa dezvoltării unor colonii bacteriene sau fungice indică o corectă sterilizare a mediului. Cele mai indicate sunt cele confecţionate din sticlă Pirex. 3. consistenţă) şi pH-ul trebuie să corespundă parametrilor standard specifici pentru respectivul mediu de cultivare.Spania. Starea de sterilitate a mediilor se verifică prin incubarea câtorva recipiente la temperaturile de 30ºC.Calitatea mediilor diferenţiale se evaluează prin modul de reacţie al acestora în urma însămânţării cu tulpini producătoare de reacţii pozitive şi negative. În vederea autoclavării eficiente se recomandă repartizarea mediilor în flacoane cu o capacitate care să nu depăşească 400-500 ml. timp de 24-48 ore.

tropicalis CandiSelect ™ 4 (Bio-Rad) Aspectul coloniilor Culoare roz-violet. krusei C. lusitaniae C. glabrata C. mate. plate. Olimpia Bazgan. contur neregulat Culoare galben-bej Culoare brună Culoare verde-smarald Culoare violet-deschis (lila). tropicalis C. strălucitoare. albicans C. mate Culoare roz-pal. kefyr C. krusei C. Culoare verde-turcoaz. Culoare turcoaz mai estompată. tropicalis Chromogenic Candida Agar (Oxoid) C. albicans C. glabrata C.krusei C. colonii lucioase. de tip R Culoare albastră-verzuie până la albastru-metalizat Culoare albastră Culoare roz Culoare alb -crem. contur neregulat. bombate. tropicalis Candida ID2 (bioMérieux) Candichrom II (Elitech. de tip S. contur regulat. contur regulat Culoare turcoaz intensă.Luminiţa Malic. Franţa) C. contur regulat. albicans C. mate. glabrata CHROMagar Candida (BD Sciences) C.albicans Agar cu extract de seminţe de Niger (Birdseed Agar) Alte levuri Cryptococcus neoformans Alte levuri 45 Capitolul 3   . albastre verzui Culoare albă Culoare brună Culoare alb – crem C. Mihai Mareş Tabelul 3-1 Utilitatea diagnostică a unor medii cromogene Denumirea mediului şi firma producătoare Specii identificate Candida albicans C. Culoare verde Culoare albastru-închis Culoare roz-închis. albicioase la periferie. de tip S. parapsilosis C. de tip R.

7 g 2. translucidă pH final la 25°C : 6. în plăci o lună la 2°-8°C Disponibil comercial: nu se comercializează.0 ± 0.8 g 1g 1. M02 Agar acetat McClary Compoziţie Acetat de potasiu Glucoză Clorură de sodiu Sulfat de magneziu heptahidrat Extract de drojdie Agar Apă purificată Preparare: 9. înainte de a adăuga agarul. la 121°C timp de 15 minute.2 Controlul calităţii: Saccharomyces cerevisiae ATCC 9763 – dezvoltare cu producere de ascospori Utilizare: stimularea producerii formelor sexuate la levuri Stocare: în eprubete 4 luni la 2°-8 °C. Se încălzeşte amestecul până la completa solubilizare a agarului. Aspect: geloză translucidă pH final la 25°C : 6. Se încălzeşte amestecul până la completa solubilizare a agarului. după care se ajustează pH-ul între 6. 46 .2 g 0.5-7 Controlul calităţii: Saccharomyces cerevisiae ATCC 9763 – dezvoltare cu producere de ascospori Utilizare: stimularea producerii formelor sexuate la levuri Stocare: în eprubete.5 g 15 g ad 1000 ml se dizolvă ingredientele în apa preîncălzită. Se sterilizează prin autoclavare.5-7 înainte de a adăuga agarul. Aspect: geloză gălbuie. 4 luni la 2°-8 °C.Medii de cultivare Medii de cultivare M01 Agar acetat Fowell Compoziţie Acetat de sodiu x 3H2O Agar Apă purificată Preparare: 5g 20 g ad 1000 ml se dizolvă acetatul de sodiu trihidrat în apă. la 121°C timp de 15 minute. Se sterilizează prin autoclavare. în plăci o lună la 2°-8°C Disponibil comercial: nu se comercializează.

glucoză .0 g 3.glicină . Mihai Mareş M03 Agar BCG Candida Compoziţie Peptonă Extract de drojdie Dextroză Agar Verde de bromcrezol Apă distilată Preparare: 10.02 g ad 1000 ml ingredientele se dizolvă în apa distilată şi se fierb un minut până la completa dizolvare. Plăcile Petri însămânţate se incubează 72 ore la o temperatură de 30° ± 2 0C. după care se 47 Capitolul 3   .0 g 15. Stocare: 2°–8 °C Disponibil comercial: Difco (SUA) M04 Agar BIGGY (Agar bismut .0 g 16.0 g 10.drojdie) Agar Nickerson Compoziţie Citrat amoniacal bismut Sulfat de sodiu Dextroză Glicină Extract de drojdie Agar Apă distilată Preparare: de 5. uşor opalescentă pH final la 250C: 6.sulfit .0 g 1.0 g 10.Luminiţa Malic.1 ± 0. Mediul se răceşte la 45 .0 g 1. Olimpia Bazgan. Utilizare: mediu diferenţial şi selectiv folosit pentru izolarea primară şi detecţia speciilor genului Candida din prelevatele clinice. sub agitare continuă. Se autoclavează la 1210C timp de 15 minute. Candida tropicalis ATCC 9968: virarea culorii mediului spre galben.50°C.0 g ad 1000 ml ingredientele se dizolvă în apa distilată preîncălzită. după răcirea mediului la o temperatură de 50-550C.1 Controlul calităţii: Candida albicans ATCC 10231: virarea culorii mediului spre galben.0 g 40. Aspect: geloză albastru-verzuie. Escherichia coli ATCC 25922: virarea culorii mediului spre verde.0 g 0. Se adaugă neomicină 500 mg/l.

6 ± 0.5 g 1.5 g 5g 5g 3g 0.2 ml 0.2 Utilizare: transformarea formei filamentoase în formă levurică la specia Blastomyces dermatitidis.2 Controlul calităţii: Candida albicans ATCC 10231 ++ Candida kefyr ATCC 8553 ++ Candida tropicalis ATCC 1369 ++ Utilizare: mediu recomandat pentru izolarea şi identificarea speciilor aparţinând genului Candida.8 ± 0. opalescent. Aspect: mediu omogen. 18-24 ore (3-5 zile dacă este necesar) Stocare: 2°-8°C Disponibil comercial: Becton – Dickenson (SUA) M05 Agar Blasto "D" Compoziţie Glucoză Tween 80 Sulfat de potasiu Citrat de magneziu Fosfat dipotasic Asparagină Aminoacizi de tipul "Casamino" Clorură de sodiu Agar Apă deionizată Preparare: 7g 0.Medii de cultivare repartizează în plăci Petri. alb-gălbui pH final la 250C: 6. Se sterilizează prin autoclavare la 121°C timp de 15 minute. Înainte de utilizare se recomandă verificarea sterilităţii şi a pH-ului. în plăci o lună la 2°-8°C Disponibil comercial: nu se comercializează. transparentă pH final la 250C: 6. Aspect: geloză clară. 48 . Stocare: în eprubete 2 luni la 2°-8 °C. Inocularea se realizează din culturi proaspete. Nu se autoclavează. iar incubarea are loc la o temperatură de 25° ± 2°C. prin incubare la 370C.85 g 15 g ad 1000 ml ingredientele se adaugă în apa purificată preîncălzită şi se fierb apoi sub agitare până la completa lor dizolvare.

Luminiţa Malic. moment în care se 49 Capitolul 3 Lapte ecremat Soluţie etanolică de Bromcrezol purpur 1. Mediul se repartizează (câte 90 ml) în flacoane şi se sterilizează prin autoclavare la 121°C timp de 15 minute. A . După sterilizare. M07 Agar Ciocolat (Agar Chocolate) Compoziţie Triptonă Peptonă din soia Clorură de sodiu Agar Apă distilată Sânge defibrinat ovin Preparare: 15. se omogenizează. Mihai Mareş M06 Agar Bromcrezol purpur – cazeină .15 minute la 121°C.glucoză (Bromcresol purple casein glucose Agar ) Compoziţie soluţie A 2 ml ad 1000 ml Compoziţie soluţie B Glucoză Agar Apă distilată Preparare: 40 g 30 g ad 1000 ml după solubilizarea ingredientelor în apa distilată preîncălzită. sol. B . Trichophyton mentagrophytes ATCC 9533: dezvoltare cu alcalinizare (virarea culorii în violet-purpuriu). opacă pH final la 25°C : 6.0 g 5.6 şi apoi se repartizează în tuburi sterile. bleu pal. în pantă. Utilizare: test de identificare a speciilor de dermatofiţi o lună la temperatura de refrigerare Stocare: Disponibil comercial: nu se comercializează. se ajustează pH-ul la valoarea 6.8 minute la 115°C. cele două soluţii se sterilizează separat astfel: sol.6 ± 0.6% Apă distilată 80 g   .0 g 15. După răcire la 45°50°C. Olimpia Bazgan.0 g ad 1000 ml 5-10 % se dizolvă ingredientele în apa distilată preîncălzită şi se fierb un minut. cele două soluţii se amestecă. Aspect: geloză în pantă.0 g 5.2 Controlul calităţii: Trichophyton rubrum ATCC 28188: dezvoltare fără alcalinizare (mediul nu îşi modifică nuanţa). mediul se răceşte la 75°-80°C.

Medii de cultivare adaugă câte 10 ml de sînge defibrinat ovin în fiecare flacon.aspect stelat) Candida parapsilosis ATCC 22019 ++ (colonii netede.3 ± 0.2 Candida albicans ATCC 10231 – dezvoltare fără modificarea culorii mediului. după răcirea amestecului la 50°C. Biokar Diagnostics (Franţa) M08 Agar Christensen Compoziţie soluţia A Peptonă Glucoză Fosfat monopotasic Clorură de sodiu Uree Roşu fenol Apă distilată Compoziţie soluţia B Agar Apă distilată Preparare: 15 g 900 ml 1g 1g 2g 5g 20 g 0. 50 . Soluţia B se sterilizează prin autoclavare la 121°C timp de 15 min. iar după răcire la 50°C se adaugă soluţia A preîncălzită. opacă pH final la 25°C : 7.Becton Dickenson (SUA). transparentă 6. geloză galben-orange. timp de 48 ore Stocare: 2°-8°C Disponibil comercial: mediul bază . Aspect: geloză brun-roşcată. până la apariţia culorii brun-ciocolatii.2 Controlul calităţii: Candida albicans ATCC 10231 ++ (colonii gri.012 g 100 ml Aspect: pH final la 25°C : Controlul calităţii: se pregăteşte soluţia A şi se sterilizează prin filtrare. Remel (SUA). fără filametare periferică) Utilizare: identificarea tulpinilor de Candida albicans prin incubare la 37°C. apoi se fierbe agarul cu apa distilată până la dizolvare. în atmosferă cu 6% CO2. Soluţia A se poate steriliza şi prin autoclavare. Mediul astfel obţinut se repartizează în tuburi şi se lasă să se solidifice în poziţie înclinată. în acest caz ureea adăugându-se sub formă de soluţie sterilă. Cryptococcus albidus ATCC 66030 – dezvoltare cu virarea culorii mediului spre roz-roşu. cu filamentare evidentă la periferie . Se agită sub protecţia unei hote bacteriologice de clasă II.8 ± 0. de consistenţă cremoasă.

18 g 0. Rhodotorula spp. la 121°C timp de 15 minute. Se sterilizează prin autoclavare.. Stocare: în eprubete 2 luni la 2°-8 °C.Luminiţa Malic. Olimpia Bazgan. Trichosporon spp. în plăci o lună la 2°-8°C Disponibil comercial: nu se comercializează.05 g 0.8 g 0.002 g 15 g ad 1000 ml ingredientele se adaugă în apa purificată preîncălzită şi se fierb apoi sub agitare până la completa lor dizolvare. 51 Capitolul 3 M09 Agar cu acid cafeic şi citrat feric   . Mihai Mareş Utilizare: identificarea speciilor fungice ureazo-pozitive (Cryptococcus spp. Aspect: geloză maron deschis. şi unii dermatofiţi) Stocare: 2 luni la temperatura de refrigerare Disponibil comercial: un mediu-bază care se aditivează după autoclavare cu soluţie sterilă de uree Merck (Germania).7 g 0. Compoziţie Sulfat acid de sodiu Glucoză Extract levuric Fosfat dipotasic Sulfat de magneziu hidratat Acid cafeic Cloramfenicol Citrat feric Agar Apă distilată Preparare: 5g 5g 2g 0. Utilizare: mediu pentru izolarea şi identificarea speciei Cryptococcus neoformans. Remel (SUA).. translucidă 0 pH final la 25 C: nu se determină Controlul calităţii: Cryptococcus neoformans ATCC 14116: colonii brune cu aspect mucoid.

în plăci o lună la 2°-8°C Disponibil comercial: Difco (SUA). translucidă pH final la 25ºC: 6. translucidă pH final la 25°C : 5.6 ± 0. Aspect: geloză galben pal.6 ± 0.2 Controlul calităţii: Aspergillus niger ATCC 16404 ++ Candida albicans ATCC 10231 ++ Saccharomyces cerevisiae ATCC 9763 ++ Trichophyton mentagrophytes ATCC 9533 + Utilizare: mediu folosit pentru cultivarea şi identificarea levurilor şi fungilor filamentoşi Stocare: în eprubete 2 luni la 2°-8 °C. după care se fierb un minut.Medii de cultivare M10 Agar cu extract de cartof şi glucoză (PDA) Compoziţie Glucoză (dextroză) Infuzie de cartofi pulbere Agar Apă purificată Preparare: 20 g 4g 20 g ad 1000 ml ingredientele se adaugă în apa purificată preîncălzită şi se fierb apoi sub agitare până la completa lor dizolvare. Biokar Diagnostics (Franţa).1 g 13.2 Controlul calităţii: Aspergillus niger ATCC 16404 ++ Candida albicans ATCC 10231 ++ Escherichia coli ATCC 25922 Saccharomyces cerevisiae ATCC 9763 + Utilizare: cultivarea şi identificarea fungilor levuriformi şi filamentoşi Stocare: în eprubete 4 luni la 2°-8 °C. M11 Agar cu extract de drojdie şi cloramfenicol (Yeast Extract Glucose Chloramphenicol Agar) Compoziţie Extract de drojdie Glucoză Cloramfenicol Agar Apă distilată Preparare: 5. Se autoclavează la 121ºC timp de 15 minute. 52 . la 121°C timp de 15 minute Aspect: geloză alb-gălbuie. în plăci o lună la 2°-8°C Disponibil comercial: Merck (Germania). Se sterilizează prin autoclavare.0 g 0.0 g 20.0 g ad 1000 ml ingredientele se dizolvă în apa distilată preîncălzită. Remel (SUA).

translucidă 6. Autoclavarea are loc la o temperatură de 121oC timp de 15 minute.0 g 20.6 ± 0. cu menţinerea temperaturii de fierbere timp de un minut. Aspect: geloză gălbuie.2 Candida albicans ATCC 10231 + Candida albicans ATCC 60193 + formarea clamidosporilor la speciile de Candida în eprubete 2 luni la 2°-8 °C.05 g 17.0 g 5. translucidă pH final la 25ºC: 6.Luminiţa Malic. în plăci o lună la 2°-8°C 53 Capitolul 3 Peptonă din soia Extract de drojdie Dextroză Cloramfenicol Agar Apă distilată 10. în special a dermatofiţilor din specia Trichophyton verrucosum în eprubete 2 luni la 2°-8 °C. geloză de culoare galben-pal. Mihai Mareş M12 Agar cu extract de drojdie şi fitonă (Phytone Yeast Extract Agar) Compoziţie ingredientele se dizolvă în apa distilată preîncălzită. amestecând continuu.2 Controlul calităţii: Aspergillus niger ATCC 16404 + Candida albicans ATCC 10231 + Penicillium roqueforti ATCC 9295 + Saccharomyces cerevisiae ATCC 25923 – Trichophyton verrucosum ATCC 38485 + Utilizare: mediu pentru izolarea şi identificarea fungilor din prelevatele clinice. Olimpia Bazgan. amestecând continuu.0 g 0.0 g ad 1000 ml   .0 g ad 1000 ml Preparare: Aspect: pH final la 25ºC: Controlul calităţii: Utilizare: Stocare: ingredientele se dizolvă în apa distilată preîncălzită. în plăci o lună la 2°-8°C Stocare: Disponibil comercial: Difco (SUA). Autoclavarea are loc la o temperatură de 121oC timp de 15 minute.6 ± 0. M13 Agar cu extract de orez Compoziţie Extract de orez Agar Apă distilată Preparare: 5. cu menţinerea temperaturii de fierbere timp de un minut.0 g 40.

în plăci o lună la 2°-8°C Disponibil comercial: nu este disponibil comercial.8°C Disponibil comercial: nu se comercializează. Aspect: geloză opacă. Mediul este recomandat pentru obţinerea de cleistoteci la specii de Arthroderma (formele teleomorfe ale dermatofiţilor). apoi se sterilizează prin autoclavare la 116°C timp de 30 minute. se încălzeşte 30 de minute.9 Controlul calităţii: Cryptococcus neoformans var. neoformans – colonii albcremoase după 48 ore de incubare la 30°C. care se pigmentează în brun după această perioadă Utilizare: izolarea şi identificarea prezumtivă a tulpinilor de Cryptococcus neoformans Stocarea: 2°. M15 Agar cu extract de sol 1 kg sol de grădină se amestecă cu 1000 ml apă de robinet. 1 g extract de drojdie. se filtrează şi se completează la 1000 ml cu apă distilată.6 g de păr uman tocat şi sterilizat. se decantează. cu miros de paprika pH final la 25°C: 4. 15 g agar şi 6.0 g 15. La 1000 ml extract de sol se adaugă 2 g glucoză.0 g 4.0 g ad 1000 ml ingredientele se adaugă în apa distilată şi se aduc la punctul de fierbere. Stocare: în eprubete 4 luni la 2°-8 °C. de culoare brun-roşcată. Prepararea extractului de sol: 54 . M14 Agar cu extract de paprika (Ground red hot pepper agar) Compoziţie Paprika Glucoză Agar Apă distilată Preparare: 40.Medii de cultivare Disponibil comercial: Becton Dickinson (SUA).

M17 Agar cu făină de porumb (Cornmeal agar) Compoziţie Făină de porumb Glucoză Agar Apă distilată Preparare: 40 g 10 g 15 g ad 1000 ml Aspect: pH final la 25°C : se amestecă făina de porumb cu apa distilată şi se încălzeşte amestecul la 52°C timp de o oră sau la 121°C timp de 10 minute. Olimpia Bazgan. În filtratul obţinut se introduc agarul şi glucoza. mediul se repartizează în plăci Petri sterile (ø 90 mm).1 Controlul calităţii: Candida dubliniensis CBS 7987 (formare de clamidospori în urma însămânţării prin tehnica Dalmeau şi incubare la 30°C) Utilizare: mediu destinat identificării tulpinilor de Candida albicans şi Candida dubliniensis pe baza stimulării producerii de clamidospori (C. apoi prin hârtie de filtru.0 ± 0. C.0 ± 0. se ajustează pH-ul la valoarea 6 şi se readuce volumul la 1000 ml cu apă distilată. După tratamentul termic.Luminiţa Malic. Mediul se sterilizează prin autoclavare la 121°C timp de 15 minute. Extractul obţinut se filtrează. Se readuce volumul la 1000 ml. amestecul se încălzeşte până la dizolvarea completă a acestuia.dubliniensis 100% dintre tuplini) 2°-8°C Stocare: Disponibil comercial: nu se comercializează. apoi se sterilizează la 121°C timp de 15 minute. de culoare galben-maronie pH final la 25°C: 6. translucidă 6. După sterilizare. amestecul se filtrează prin tifon şi vată.2 55 Capitolul 3   . albicans 96% dintre tulpini. fierbându-se până la topirea acestora. câte 25 ml/placă. După adăugarea agarului. Aspect: geloză translucidă. geloză albicioasă. Mihai Mareş M16 Agar cu extract de tutun (Tobacco Agar) Compoziţie Extract din frunze de tutun Agar Preparare: 1000 ml 20 g 50 grame frunze de tutun se fierb timp de 30 minute într-un litru de apă distilată.

mentagrophytes. În locul frunzelor de garoafă se pot folosi de asemenea şi bucăţi de hârtie de filtru sterile. uscate şi sterilizate prin expunerea la radiaţii gamma sau oxid de etilenă.5% agar nesolidificat.Medii de cultivare Controlul calităţii: Trichophyton rubrum ATCC 28188: pigment roşu în mediul subiacent Trichophyton mentagrophytes ATCC 9533: pigment brun sub colonie Utilizare: stimulează pigmentogeneza la suşele de T. în plăci o lună la 2°-8°C Disponibil comercial: Remel (SUA).8 ± 0. M18 Agar cu făină de porumb şi Tween 80 (Cornmeal Agar Tween 80) Compoziţie Făină de porumb Tween 80 Agar Apă distilată 40 g 10 ml 20 g ad 1000 ml făina de porumb se adaugă în 500 ml apă distilată şi se macerează timp de o oră la 65°C. Aspect: geloză albicioasă. la 30°C timp de 48 ore Stocare: în eprubete 4 luni la 2°-8 °C.2 Controlul calităţii: Candida albicans ATCC 10131 ++ Candida albicans ATCC 60193 (cu apariţia clamidosporilor prin cultivare submersă) Utilizare: identificarea diferitelor specii ale genului Candida prin studierea caracterelor morfologice microscopice etalate de acestea în urma cultivării submerse. rubrum şi le diferenţiază de tulpinile aparţinând speciei T. Stocare: în eprubete 4 luni la 2°-8 °C. în plăci o lună la 2°-8°C Disponibil comercial: Becton Dickenson (SUA). Preparare: 56 . Remel (SUA) M19 Agar cu frunze de garoafă Preparare: frunzele de garoafă sunt tăiate în bucăţi. Se ajustează pH-ul la 6.6. Câteva bucăţi sterile sunt introduse în 1. Acest mediu este recomandat pentru cultivarea şi identificarea speciilor aparţinând genului Fusarium.6 . translucidă pH final la 25°C : 6.8 şi apoi se sterilizează prin autoclavare la 121°C timp de 20 minute. soluţia astfel obţinută se amestecă cu agarul în prealabil solubilizat în 500 ml apă distilată şi cu 10 ml Tween 80. după filtrare şi reajustarea volumului la 500 ml.

apoi se repartizează în plăci Petri. incubarea se realizează la 25°C timp de 5 zile. apoi se adaugă apa distilată.1 Cryptococcus neoformans var.Luminiţa Malic. gattii are capacitatea de a cultiva în prezenţa L-canavaninei şi de a folosi glicina ca unică sursă de carbon.8 ± 0.8 la aproximativ 7. adică schimbarea de pH (de la 5. pentru obţinerea unui litru de mediu. cu virarea culorii mediului de la galben-verzui la albastru-cobalt. Compoziţie soluţia B Albastru de bromtimol Hidroxid de sodiu 0. După însămânţarea tulpinilor de testat. fără modificarea culorii mediului.albastru de bromtimol (CGB Agar) Compoziţie soluţia A Glicină Fosfat monopotasic Sulfat de magneziu Tiamină HCl L-canavanină sulfat Apă distilată 10 g 1g 1g 1 mg 30 mg ad 100 ml După solubilizarea completă a ingredientelor enumerate.01 N Apă distilată 0. geloză translucidă de culoare galben-verzuie 5. timp de 15 minute. Aceste particularităţi metabolice determină pozitivarea testului pe Agar CGB. Mihai Mareş M20 Agar cu L-canavanină – glicină .0) şi modificarea culorii mediului (de la galben-verzui la albastru-cobalt).6 şi amestecul se sterilizează prin filtrare utilizând filtre cu porozitate de 0. în plăci o lună la 2°-8°C 57 Capitolul 3   . se adaugă 100 ml soluţie A şi se omogenizează. După răcirea mediului la 48°C. se ajustează pH-ul la 5. mediul este recomandat pentru diferenţierea celor două varietăţi ale speciei Cryptococcus neoformans (var.dezvoltare eugonică. gattii . gattii). neoformans – dezvoltare disgonică. Sterilizarea se realizează prin autoclavare la 121°C. Doar var.22 µm. neoformans şi var.4 g 64 ml 36 ml Preparare: Aspect: pH final la 25°C : Controlul calităţii : Utilizare: Stocare: Albastrul de bromtimol se dizolvă în soluţia de hidroxid de sodiu. se amestecă 880 ml apă distilată cu 20 ml soluţie B şi 20 g pulbere de agar. Cryptococcus neoformans var. Olimpia Bazgan. Soluţia astfel obţinută se păstrează la frigider (+4°C).

0 ± 0. Se autoclavează la 121ºC timp de 15 minute.05 g 15 g ad 1000 ml ingredientele se introduc în apa distilată preîncălzită şi se omogenizează până la completa dizolvare.2 Controlul calităţii: Aspergillus niger ATCC 1015 ++ Utilizare: mediu destinat izolării şi identificării fungilor filamentoşi Stocare: 2°-8°C Disponibil comercial: nu se comercializează.Medii de cultivare Disponibil comercial: nu se comercializează.3 g 0. Se ajustează pH-ul la valoarea 6. M21 Agar cu sucroză şi creatină Compoziţie Creatină Sucroză KCl MgSO4 FeSO4 K2HPO4 Bromcrezol purpur Agar Apă distilată Preparare: 3g 30 g 0. Aspect: geloză opalescentă.0 ± 0. de culoare roz pH final la 25 ºC: 6.01 g 1. 58 .5 g 0.2.5 g 0.

se autoclavează la 121 ºC timp de 15 minute.002 g 0.01 g 0. după care se adaugă 0. geloză translucidă.5 g 1g 0.002g 20 g ad 1000 ml ingredientele se dizolvă în apa distilată preîncălzită.05 g 0.acid acetic – dicloran .8.05 g 0. creatină şi dicloran (Creatine Sucrose Dichloran Agar) Compoziţie Creatină Sucroză KCl KH2PO4 MgSO4 FeSO4 K2HPO4 Cloramfenicol Dicloran Bromcrezol purpur ZnSO4 CuSO4 Agar Apă distilată Preparare: 3g 30 g 0. Mihai Mareş M22 Agar cu sucroză. Olimpia Bazgan.8 Controlul calităţii: Aspergillus niger ATCC 1015 + Utilizare: mediu destinat izolării şi identificării fungilor filamentoşi Stocare: 2°-8°C Disponibil comercial: nu se comercializează.005 g 20 g ad 1000 ml ingredientele se dizolvă în apa distilată preîncălzită.5 g 0.extract de drojdie (Acetic Acid Dichloran Yeast Extract Agar) Compoziţie Extract de drojdie Sucroză MgSO4 x 7 H2O Dicloran Agar Apă distilată Preparare: Aspect: 20 g 150 g 0. de culoare gălbuie 59 Capitolul 3   .Luminiţa Malic. uşor opalescentă pH final la 25 ºC: 4. M23 Agar . se sterilizează prin autoclavare la temperatura de 121ºC timp de 15 minute.5 % acid acetic glacial.05 g 0.05 g clortetraciclină şi se ajustează pH-ul la valoarea 4.5 g 0. Aspect: geloză de culoare roz. Se adaugă 0.01 g 0.

01 g 0. Se adaugă 0. translucidă 7.05 g 1 ml 0. flavus produc virarea culorii mediului în galben -portocaliu.5 g 0. 60 .parasiticus. uşor opalescentă pH final la 25 ºC: nu se determină Controlul calităţii: Aspergillus niger ATCC 1015 + mediu destinat izolării şi identificării fungilor filamentoşi Utilizare: Stocare: 2°-8°C Disponibil comercial: nu se comercializează. flavus.18 % glicerol (Dichloran Yeast Extract 18% Glycerol Agar) Compoziţie Extract de drojdie Sucroză K2HPO4 MgSO4 Cloramfenicol Dicloran (0. se sterilizează prin autoclavare la temperatura de 121ºC timp de 15 minute.05 g clortetraciclină.5 tulpinile de A.Medii de cultivare Controlul calităţii: Utilizare: Stocare: Disponibil comercial: Aspergillus niger ATCC 1015 ++ mediu destinat izolării şi identificării fungilor filamentoşi 2°-8°C nu se comercializează. M24 Agar – dicloran .extract de drojdie .005 g 20 g 220 g ad 1000 ml ingredientele se dizolvă în apa distilată preîncălzită.0 ± 0.2% în etanol) ZnSO4 CuSO4 Agar Glicerol Apă distilată Preparare: 20 g 150 g 1g 0. M25 Agar diferenţiere Aspergillus Compoziţie Mediu deshidratat Becton – Dickenson Preparare: Aspect: pH final la 250C: Controlul calităţii: conform recomandărilor firmei producătoare geloză gălbuie. thomii) produc de asemenea modificări ale culorii mediului de cultivare. sclerotiorum. A. Alte specii de Aspergillus (A. Aspect: geloză de culoare gălbuie. dar acestea sunt distincte faţă de cele produse de A. A.

la 121°C timp de 15 minute. Se sterilizează prin autoclavare. Aspect: geloză închisă la culoare. Stocare: 2°-8°C Disponibil comercial: Difco (SUA). aminoacizi.5 ml ad 1000 ml glicerolul mono-oleat se emulsionează cu Tween 40 apoi se adaugă treptat. Mihai Mareş M26 Agar Dixon Compoziţie Agar cu extract de malţ Bilă de bou deshidratată Tween 40 Glicerol mono-oleat Apă distilată Preparare: 60 g 20 g 10 ml 2. Utilizare:   . flavus de alte specii cu semnificaţie clinică ale aceluiaşi gen. mediul preparat prin amestecarea celorlalte ingrediente. pentru a permite virarea culorii spre diferite nuanţe de galben. Cu ajutorul unei anse sterile.Luminiţa Malic. extract de drojdie îmbogăţit cu complex vitaminic B. sub agitare continuă. translucidă pH final la 25°C : 5. se etalează pe suprafaţa mediului câteva colonii după care se incubează la 25°C timp de 10 zile. Olimpia Bazgan.2 Controlul calităţii: Malassezia furfur ATCC 12078 ++ Utilizare: izolarea levurilor lipofile aparţinând genului Malassezia Stocare: în eprubete 4 luni la 2°-8 °C. 61 Capitolul 3 acest mediu de cultură conţine cazeină.6 ± 0. în plăci o lună la 2°-8°C Disponibil comercial: nu se comercializează. Citratul feric este esenţial pentru producerea pigmentului galben care ajută la diferenţierea speciei A.

în plăci o lună la 2°-8°C Disponibil comercial: nu se comercializează. Se sterilizează prin autoclavare. sub agitare continuă. uşor opalescentă pH final la 25°C : nu se determină Controlul calităţii: Candida albicans ATCC 10231 ++ Saccharomyces cerevisiae ATCC 9763 ++ Utilizare: cultivarea levurilor în vederea conservării Stocare: în eprubete 4 luni la 2°-8 °C. 62 . Aspect: geloză gălbuie. sterilizează prin autoclavare la 121°C timp de 15 minute. mediul preparat prin amestecarea celorlalte ingrediente. M28 Agar glucoză .drojdie (Glucose Peptone Yeast Extract Agar) Compoziţie Glucoză Peptonă Agar Extract de drojdie Apă distilată Preparare: 20 g 5g 20 g 5g ad 1000 ml Se ingredientele se solubilizează în apa preîncălzită.Medii de cultivare M27 Agar Dixon modificat Compoziţie Extract de malţ Bilă de bou deshidratată Tween 40 Peptonă Glicerol Acid oleic Agar Apă distilată Preparare: 36 g 20 g 10 ml 6g 2 ml 2 ml 15 g ad 1000 ml glicerolul şi acidul oleic se emulsionează cu Tween 40.peptonă .0 ± 0. în plăci o lună la 2°-8°C Disponibil comercial: nu se comercializează. Aspect: geloză închisă la culoare pH final la 25°C : 6. la 121°C timp de 15 minute. apoi se adaugă treptat.2 Controlul calităţii: Malassezia furfur ATCC 12078++ Utilizare: izolarea levurilor lipofile din prelevate patologice Stocare: în eprubete 4 luni la 2°-8 °C.

apoi amestecul se fierbe sub agitare până la completa dizolvare a acestora.0 g 0. Olimpia Bazgan. la 121°C timp de 15 minute.Luminiţa Malic.0 g 20. Reţeta se poate modifica prin îmbunătăţirea cu 510% sânge defibrinat de berbec sau prin adaos de cloramfenicol şi/sau gentamicină (500 mg/l).0 g 5.0 g 10.1 g ad 1000 ml 63 Capitolul 3   . Aspect: geloză transparentă.2 Controlul calităţii: Candida albicans ATCC 10231 ++ Streptococcus pyogenes ATCC 19615 ++ ( . de culoare galben-pal.4 ± 0.5 g 15 g ad 1000 ml ingredientele se adaugă în apa distilată preîncălzită. geloză opacă de culoare roşie (varianta aditivată cu sânge) pH final la 25 °C: 7. Mediul astfel obţinut se repartizează în eprubete sau flacoane şi se sterilizează prin autoclavare.0 g 3. M30 Agar izolare Candida Compoziţie Extract de drojdie Extract de malţ Peptonă Dextroză Agar Albastru de anilină Apă distilată 3. cum ar fi fungii dimorfici Stocare: eprubete 4 luni la 2°-8 °C. bioMérieux (Franţa). Mihai Mareş M29 Agar infuzie cord .în cazul variantei aditivate cu antibiotice) izolarea unei game largi de microorganisme cu exigenţe Utilizare: nutritive particulare. în plăci o lună la 2°-8°C (Franţa).creier (Brain Heart Agar BHI ) Compoziţie Infuzie de cord Infuzie de creier Peptonă Glucoză Clorură de sodiu Fosfat disodic Agar Apă distilată Preparare: 250 ml 200 ml 10 g 2g 5g 2. Becton Disponibil comercial: Remel (SUA). Biokar Diagnostics Dickinson (SUA).

5 g ad 1000 ml Preparare: ingredientele se amestecă cu apa distilată preîncălzită. în plăci Petri la 2°-8°C Disponibil comercial: nu se comercializează. canis şi T. Aspect: Geloză opacă. 64 . După autoclavare se repartizează în plăci Petri.2 Controlul calităţii: Microsporum canis ATCC 1162: dezvoltare cu sporulare intensă şi pigmentogeneză Utilizare: favorizează sporularea marii majorităţi a dermatofiţilor şi stimulează producerea pigmentului specific în cazul M. M. Se sterilizează prin autoclavare la 105°C timp de 10 minute. de culoare albă pH final la 25°C: 6.Medii de cultivare ingredientele se adaugă în apa distilată şi se fierb un minut până la completa solubilizare. opalescentă pH final la 250C: 6.2 ± 0.8 ± 0. Aspect: geloză de culoare albastră. Se autoclavează la 1210C timp de 15 minute. Stocare: 2°–8°C Disponibil comercial: Becton – Dikinson (SUA). sub agitare continuă. rubrum Stocare: o lună.2 Controlul calităţii: Candida albicans ATCC 10231: produce fluorescenţă bleu– verzuie la 354 nm. Utilizare: izolarea şi identificarea speciei Candida albicans din prelevate clinice. M31 Agar Lactrimel (Borelli) Compoziţie Făină de grâu Lapte praf ecremat Miere Agar Cloramfenicol Cicloheximidă Apă distilată Preparare: 14 g 14 g 7g 20 g 0. Escherichia coli ATCC 25922 : nu produce fluorescenţă. audouinii. până la completa lor solubilizare.5 g 0. Plăcile Petri însămânţate se incubează 72 ore la o temperatură de 30 ± 2 0C. Bacillus subtilis ATCC 6633: nu produce fluorescenţă.

acesta putându-se adăuga chiar înaintea autoclavării. cu menţinerea temperaturii de fierbere timp de un minut.5 g 10 ml 0.5 g 12 g ad 1000 ml glicerolul şi glicerolul mono-stearat se emulsionează cu Tween 60.01 g 30. sub agitare continuă. în plăci o lună la 2°-8°C Disponibil comercial: nu se comercializează. Olimpia Bazgan.1 g 0. cu răcire la 47ºC pentru adăugarea antibioticului. Se sterilizează prin autoclavare. apoi se adaugă treptat.Luminiţa Malic. la 121°C timp de 15 minute.0 g 10. mediul preparat prin amestecarea celorlalte ingrediente.5 ml 1 ml 0. Mihai Mareş M32 Agar Leeming Compoziţie Peptonă Glucoză Bilă de bou deshidratată Tween 60 Glicerol Glicerol mono-stearat Lapte integral Extract de drojdie Cloramfenicol Agar Apă distilată Preparare: 10 g 5g 4g 0.0 g 20.2 Controlul calităţii: Malassezia furfur ATTC 12078 ++ Utilizare: izolarea levurilor lipofile din prelevate patologice Stocare: în eprubete 4 luni la 2°-8 °C. streptomicina se poate înlocui cu cloramfenicol.0 g 0. uşor opalescentă 65 Capitolul 3   . amestecând continuu.0 mg ad 1000 ml Aspect: ingredientele se dizolvă în apa distilată. Autoclavarea are loc la o temperatură de 121oC timp de 15 minute.0 g 15. geloză de culoare bleu-cenuşie. Aspect: geloză închisă la culoare pH final la 25°C : 6 ± 0. M33 Agar Littman (Littman Oxgall Agar) Compoziţie Peptonă Dextroză Bilă de bou deshidratată Agar Cristal violet Streptomicină Apă distilată Preparare: 10.

Becton Dickinson (SUA). amestecând continuu.9 . cu menţinerea temperaturii de fierbere timp de un minut.5 mg ad 1000 ml pH final la 25ºC: Controlul calităţii: ingredientele se solubilizează în apa distilată preîncălzită. Se recomandă ca grosimea stratului de mediu să fie de 4 ± 0.0 ± 0. în special a celor dermatofiţi Stocare: în eprubete 2 luni la 2°-8 °C. timp de 20 minute. bioMérieux (Franţa).2 Candida albicans ATCC 10231 + Escherichia coli ATCC 25922 ± Trichophyton mentagrophytes ATCC 9533 ++ Utilizare: mediu pentru cultivarea şi identificarea fungilor. 25 ml/ placă Petri cu ø 90mm sau cca. Stocare: 2°-8°C Disponibil comercial: mediul bază (fără glucoză) este comercializat de Remel (SUA). Difco (SUA). 66 . Se repartizează în tuburi sau flacoane şi se sterilizează prin autoclavare la 110°C. 60 ml / placă Petri cu ø 150 mm).glucoză 2% Compoziţie Extract de carne pulbere Cazeină Amidon Agar Glucoză Albastru de metilen Apă distilată Preparare: 2g 17.0 g 18.5 g 1.1 Utilizare: mediul se foloseşte pentru testarea susceptibilităţii la antifungice (voriconazol şi fluconazol) prin metoda CLSI M44-A (metodă difuzimetrică cu discuri). sub agitare continuă. M34 Agar Mueller – Hinton .0 g ad 1000 ml ingredientele se dizolvă în apa distilată. M35 Agar cu făină de ovăz (Oatmeal Agar) Compoziţie Făină de ovăz Agar Apă distilată Preparare: 60.5 mm (cca. în plăci o lună la 2°-8°C Disponibil comercial: Remel (SUA).7.Medii de cultivare 7.5 g 15 g 20 g 0. Aspect: geloză opalescentă pH final la 250C: 6. Biokar Diagnostics (Franţa).

5 şi se sterilizează apoi prin autoclavare la 110°C timp de 20 minute. cu ajutorul unui blender şi se fierb timp de 30 minute într-un litru de apă distilată. Mihai Mareş M36 Agar Pal Compoziţie Glucoză Fosfat monopotasic Creatinină Agar Extract apos din seminţe integrale de floareasoarelui Preparare: 1g 1g 1g 15 g ad 1000 ml se mărunţesc 50 g seminţe de floarea-soarelui nedecorticate. se ajustează pH-ul la 5. Aspect: geloză albicioasă. 67 Capitolul 3 Autoclavarea are loc la o temperatură de 121oC timp de 15 minute. stimulează sporularea Stocare: în eprubete 2 luni la 2°-8 °C. prin incubare la 30°C timp de 48-72 ore.5 Controlul calităţii: Candida albicans ATCC 10231 ++ Candida dubliniensis CBS 7987 ++ Utilizare: diferenţierea speciilor C. pH final la 25°C: 5. dubliniensis produce clamidospori şi colonii cu filamentare periferică evidentă.0 ± 0.2 Controlul calităţii: Aspergillus niger ATCC 16404 + Candida albicans ATCC 10231 + Saccharomyces cerevisiae ATCC 9763 + Utilizare: mediu pentru cultivarea şi studierea caracterelor morfologice ale fungilor filamentoşi. C. în timp ce C. albicans nu. Stocare: 2°-8°C Disponibil comercial: nu este disponibil comercial.   . nesărate. albicans şi C. Se filtrează. dubliniensis pe baza morfologiei coloniilor şi producerii de clamidospori.Luminiţa Malic. în plăci o lună la 2°-8°C Disponibil comercial: Difco (SUA). Olimpia Bazgan. uşor opalescentă pH final la 25ºC: 6. se adaugă restul ingredientelor.

0 µg 1. după care se fierb un minut. Se autoclavează la 121ºC timp de 15 minute.0 µg 400.0 g 0.5 g 10.0 µg 400.0 g ad 1000 ml ingredientele se dizolvă în apa distilată preîncălzită.0 µg 2000.0 g 10.0 µg 40.0 µg 200. în plăci o lună la 2°-8°C Disponibil comercial: Difco (SUA) 68 .0 µg 100.1 g 0.5 g 0.0 mg 20.0 µg 200.0 µg 400.0 µg 400.0 mg 20.1 g 18.2 Controlul calităţii: Kloeckera apiculata ATCC 9774 + Saccharomyces cerevisiae ATCC 9080 + Candida albicans ATCC 10231 + Utilizare: cultivarea şi identificarea levurilor pe baza caracterelor culturale şi a celor morfologice Stocare: în eprubete 4 luni la 2°-8 °C.0 µg 200.Medii de cultivare M37 Agar pentru studierea morfologiei levurilor (Yeast Morphology Agar) Compoziţie Sulfat de amoniu Asparagină Dextroză L-histidină HCl LD-metionină LD-triptofan Biotină Calciu pantotenat Acid folic Inizitol Niacin Acid p-aminobenzoic Piridoxină HCl Riboflavină Tiamină HCl Acid boric Sulfat de cupru Iodură de potasiu Clorură ferică Sulfat de magneziu Molibdat de sodiu Sulfat de zinc Fosfat monopotasic Sulfat de magneziu Clorură de sodiu Clorură de calciu Agar Apă distilată Preparare: 3. opalescentă pH final la 25ºC: 5.0 µg 200.0 µg 400.6 ± 0.5 g 1.0 mg 2. Aspect: geloză galben-pal.0 µg 400.0 µg 500.0 µg 2.

Luminiţa Malic. Aspect: geloză gălbuie. Se ajustează valoarea pH-ului la 7. translucidă 6.8-7.0 pH final la 250C: Controlul calităţii: Aspergillus flavus ATCC 10124 ++ Candida albincans ATCC 66027 ± Utilizare: mediu destinat izolării precoce a fungilor filamentoşi din prelevate contaminate cu levuri (ex. în plăci o lună la 2°-8°C Disponibil comercial: nu se comercializează.0. spută) Stocare: în eprubete 2 luni la 2°-8 °C. Olimpia Bazgan. Se autoclavează la 121°C timp de 15 minute.glucoză .fluconazol Compoziţie Peptonă Glucoză Agar Cloramfenicol Gentamicină Fluconazol Apă distilată Preparare: 10 g 20 g 20 g 40 mg 25 mg 5 mg ad 1000 ml ingredientele se solubilizează în apa distilată preîncălzită. 69 Capitolul 3   . Mihai Mareş M38 Agar peptonă .

2 mg 1 mg 0.3 mg ad 1000 ml 70 . glucoză 0.25 mg 3 mg 1 mg 35 mg 1 mg 1 mg 1 mg 0.2 mg 20 mg 300 mg 10 mg 15 mg 20 mg 50 mg 40 mg 15 mg 15 mg 20 mg 30 mg 20 mg 5 mg 28.lizină hidroclorică L.2 mg 0.fenilalanină L-prolină L-serină L-treonină L-triptofan L-tirozină disodică L-valină Biotină Acid D-pantotenic Colină HCl Acid folic Mio-inozidol Niacinamidă PABA Piridoxină HCl Riboflavină Tiamină HCl Vitamina B12 Nitrat de calciu monohidrat Clorură de potasiu Sulfat de magneziu Clorură de sodiu Fosfat disodic anhidru D-glucoză Glutation redus Roşu fenol Apă distilată 200 mg 50 mg 20 mg 65.hidroxiprolină L-izoleucină L. fără bicarbonat) Compoziţie L-arginină L-asparagină anhidră Acid L-aspartic L-cistină hidroclorică Acid L-glutamic L-glutamină Glicină L-histidină L.83 mg 20 mg 0. roşu fenol.2%.metionină L.Medii de cultivare M39 Mediul RPMI 1640 (cu glutamină.005 mg 100 mg 400 mg 48.84 mg 6000 mg 800 mg 2000 mg 1 mg 5.

Olimpia Bazgan. Aspect: bulion transparent de culoare roşiatică Utilizare: pentru utilizare. transparentă 6. Autoclavarea are loc la o temperatură de 115oC timp de 15 minute.0 g 10.0 convenabil dezvoltării microorganismelor ce vor fi testate. geloză de culoarea chihlimbarului.165 mol/litru. Pulberea se dizolvă în apă bidistilată în cantitate de 10. Gentamicină sau Cicloheximidă) obţinut prin amestecul unor cantităţi echivalente de Agar Sabouraud şi Agar infuzie cord .9 ± 0.Luminiţa Malic. cât şi sub formă de pulbere pentru prepararea în laborator.8 g pentru mediul dublu concentrat.5 g 0.2 Aspergillus niger ATCC 16404 ± Aureobasidium pullulans ATCC 9348 ± Blastomyces dermatitidis ATCC 56218 + Candida albicans ATCC 10231 + Escherichia coli ATCC 25922 ± Microsporum audouinii ATCC 9079 + 71 Capitolul 3   . Disponibil comercial: Remel (SUA). Se obţine astfel un pH cu valoarea 7. mediul se tamponează cu MOPS [3-(Nmorpholino) propanesulfonic acid]. Mihai Mareş mediul se găseşte sub formă „ready for use” (Sigma Aldrich).4 g pentru mediul uzual şi 20. M40 Agar SABHI Este un mediu de cultivare disponibil comercial în multiple variante (cu şi fără Cloramfenicol.0 g 15. amestecând continuu.creier. concentraţia finală a acestuia fiind 0. Stocare: 2°-8°C Disponibil comercial: Sigma Aldrich (Germania).4 g 0.05 g ad 1000 ml Preparare : Aspect: pH final la 25ºC: Controlul calităţii: ingredientele se dizolvă în apa distilată. cu menţinerea temperaturii de fierbere timp de un minut. Se recomandă pentru cultivarea şi izolarea selectivă a fungilor patogeni. M41 Agar Sabouraud cicloheximidă Compoziţie Peptonă Dextroză Agar Cicloheximidă Cloramfenicol Apă distilată Preparare: 10. Becton Dickinson (SUA).

Merck (Germania). Aspect: geloză de culoarea chihlimbarului. M43 Agar Sabouraud Emmons Compoziţie Peptonă Glucoză Agar Apă distilată 72 10 g 20 g 15 g ad 1000 ml . Biokar Diagnostics (Franţa). la 121°C timp de 15 minute. transparentă pH final la 25 °C: 5. Remel (SUA).6 ± 0. în plăci o lună la 2°-8°C Disponibil comercial: Remel (SUA). Becton Dickinson (SUA). bioMérieux (Franţa). M42 Agar Sabouraud cloramfenicol Compoziţie Peptonă Glucoză Cloramfenicol Agar Apă distilată Preparare: 10 g 40 g 0.Medii de cultivare Penicillium roquefortii ATCC 9295 ± Phialophora verrucosa ATCC 10223 + Staphylococcus aureus ATCC 25923 – Streptomyces rimosus ATCC 10970 ± Trichophyton mentagrophytes ATCC 9533 + Utilizare: mediu pentru izolarea selectivă a fungilor rezistenţi la cicloheximidă. Biokar Diagnostics (Franţa). în special a dermatofiţilor Stocare: în eprubete 2 luni la 2°-8 °C. apoi amestecul se fierbe sub agitare până la completa dizolvare a acestora. mediul astfel obţinut se repartizează în eprubete sau flacoane şi se sterilizează prin autoclavare. în plăci o lună la 2°-8°C Disponibil comercial: Becton Dickinson (SUA).2 Controlul calităţii: Candida albicans ATCC 10231 ++ Aspergillus niger ATCC 16404 ++ Trichophyton rubrum ATCC 28188 ++ Escherichia coli ATCC 25922 – Proteus vulgaris ATCC 13315 – Utilizare: izolarea unei game largi de fungi patogeni şi oportunişti din prelevatele patologice Stocare: în eprubete 4 luni la 2°-8 °C.5 g 15 g ad 1000 ml ingredientele se adaugă în apa distilată preîncălzită.

Cicloheximidă. opacă pH final la 250C: 7. Aspect: geloză de culoare roşie-vie. în plăci o lună la 2°-8°C Stocare: Disponibil comercial: nu se comercializează. în plăci o lună la 2°-8°C Disponibil comercial: există numeroase variante îmbunătăţite cu Cloramfenicol. apoi amestecul se fierbe sub agitare până la completa dizolvare a acestora. la 121°C timp de 15 minute. Olimpia Bazgan. mediul se răceşte lent la 45°-50°C. Mihai Mareş ingredientele se adaugă în apa distilată preîncălzită.glucoză . M44 Agar sânge .2 ± 0. Gentamicină. Aspect: geloză de culoarea chihlimbarului.cisteină Compoziţie Triptonă agar bază L-cisteină Sânge de berbec defibrinat Cloramfenicol Apă deionizată Preparare: 33 g 1g 50 ml 0.0.0 ± 0. apoi se autoclavează timp de 15 minute la 121°C. 73 Capitolul 3   . Blastomyces dermatitidis.2 Controlul calităţii: Candida albicans ATCC 10231 ++ Aspergillus niger ATCC 16404 ++ Trichophyton rubrum ATCC 28188 ++ Escherichia coli ATCC 25922 ± Proteus vulgaris ATCC 13315 ± Utilizare: izolarea unei game largi de fungi patogeni şi oportunişti din prelevatele patologice (variantele aditivate) Stocare: în eprubete 4 luni la 2°-8 °C.2 Controlul calităţii: Escherichia coli ATCC 25922 Utilizare: mediu de conversie (folosit pentru transformarea formei filamentoase în cea levurică) pentru identificarea tulpinilor de Histoplasma capsulatum. După autoclavare. transparentă pH final la 25 °C: 7.Luminiţa Malic. Paracoccidioides brasiliensis şi Sporothrix schenckii. moment în care se adaugă sângele şi se omogenizează. Mediul astfel obţinut se repartizează în eprubete sau flacoane şi se sterilizează prin autoclavare.5 g ad 1000 ml Preparare: ingredientele (cu excepţia sângelui) se solubilizează în apa preîncălzită. Se ajustează pH-ul la valoarea 7.

opalescentă pH final la 25°C : 5. mediul este util şi pentru diferenţierea speciilor Candida albicans (colonii de tip S.01%) şi o sursă lipidică. Utilizare: mediu diferenţial pentru Filobasidiella (Cryptococcus) neoformans. lucioase. majoritatea cu marginile franjurate).6. cu producerea unui pigment brun ce difuzează în substratul nutritiv subiacent. Aspect: geloză de culoare bej.5.0 Controlul calităţii: Cryptococcus neoformans ATCC 14116: colonii brune. incluzând ca ingrediente principale doar L-triptofan (0. apoi se filtrează. lucioase. În acest extract apos se adaugă restul ingredientelor şi se încălzeşte până la completa dizolvare a acestora. La pH 5 şi 37oC. în plăci o lună la 2°-8°C Disponibil comercial: Becton . similare celor de pe mediile uzuale de cultivare) şi Candida dubliniensis (colonii de tip R. permite dezvoltarea selectivă a speciei Malassezia furfur. cu aspect mucoid. Stocare: în eprubete 2 luni la 2°-8 °C. M46 Agar Staib (Agar cu infuzie de Niger) Bird seed Agar Compoziţie Extract apos din seminţe de Niger Glucoză Fosfat monopotasic Creatinină Agar Preparare: 1000 ml 10 g 1g 1g 15 g 50 g seminţe de Niger (Guizotia abyssinica) se autoclavează într-un litru de apă timp de 10 minute la 115°C. Candida albicans ATCC 10231 : colonii netede.Dickinson (USA) 74 . Se readuce volumul la 1000 ml şi se autoclavează la 121°C timp de 15 minute.Medii de cultivare M45 Agar selectiv cu triptofan Este un mediu solid cu o compoziţie simplă. Mediul se poate aditiva cu cloramfenicol (500 mg/l).

de culoare galben pai 6. Mediul se repartizează în plăci Petri sterile (ø 90 mm). Aspect: geloză translucidă.1 g 5 ml 15 g ad 1000 ml Aspect: pH final la 25°C: Controlul calităţii: Utilizare: ingredientele (cu excepţia Tween-ului) se dizolvă în apa distilată preîncălzită şi se fierb un minut. moment în care se adaugă Tween-ul. mediul este recomandat pentru diferenţierea tulpinilor de C. sub agitare continuă. Candida rugosa. albicans şi C. Candida tropicalis). cu apariţia unui halo opac în jurul coloniilor de levuri secretoare de esterază (Candida albicans. de culoare gălbuie pH final la 25°C: 6. câte 25 ml/placă.dezvoltare cu sporulare intensă Uitlizare: favorizează sporularea tulpinilor de dermatofiţi Stocare: în eprubete 4 luni la 2°-8 °C. Candida guilliermondii. Tulpinile de testat se inoculează în 75 Capitolul 3   . Se sterilizează prin autoclavare la 121°C timp de 15 minute. dubliniensis. Se sterilizează prin autoclavare la 121°C timp de 15 minute.8 permite dezvoltarea diferitelor specii ale genului Candida. în plăci o lună la 2°-8°C Disponibil comercial: nu se comercializează. Se răceşte la 50°C.2 ± 0.Luminiţa Malic. Mihai Mareş M47 Agar Takaschio (Agar Sabouraud diluat) Compoziţie Glucoză Neopeptonă Sulfat de magneziu Fosfat monopotasic Agar Apă distilată Preparare: 2g 1g 1g 1g 20 g ad 1000 ml ingredientele se amestecă cu apa distilată preîncălzită. geloză transparentă. Olimpia Bazgan.2 Controlul calităţii: Microsporum canis ATCC 11621 . M48 Agar Tween 80 (destinat testului de opacifiere) Compoziţie Bacto peptonă Clorură de sodiu Clorură de calciu Tween 80 Agar Apă distilată Preparare: 10 g 5g 0. până la completa lor solubilizare.

Medii de cultivare puncte separate. Tulpinile cu acţiune lipolitică secretă o esterază capabilă să scindeze Tween-ul şi să elibereze acizii graşi care se vor cupla cu ionii de Ca2+ formând săruri vizibile sub forma unei zone de opacifiere în jurul coloniilor. Aspect: geloză gălbuie.5-7.dezvoltare cu sporulare 76 . tropicalis determină apariţia unui halo opac în jurul coloniilor. geloză gălbuie. uşor opalescentă pH final la 25°C: 6. dubliniensis nu pozitivează testul nici în 10 zile post-inoculare. albicans. C. are valoarea 6. Stocare: 2°-8°C Disponibil comercial: nu se comercializează. Utilizare: mediu destinat stimulării sporulării la fungii filamentoşi Stocare: în eprubete 4 luni la 2°-8 °C. Tulpinile de C. translucidă nu se determină Fusarium solani ATCC 22278 . iar incubarea se realizează la 30°C timp de 10 zile.5-7 Controlul calităţii: Fusarium solani ATCC 22278 .dezvoltare cu sporulare intensă. comportament util în diferenţierea de C. Se pot adăuga paie de grâu sau boabe de orez sterilizate. în plăci o lună la 2°-8°C Disponibil comercial: nu este disponibil comercial. în timp ce tulpinile de C. M50 Agar – apă de robinet Compoziţie Agar Apă de robinet Preparare: Aspect: pH final la 25°C: Controlul calităţii: 15-25 g ad 1000 ml agarul se dizolvă în apa preîncălzită şi apoi se sterilizează 20 minute la 121°C. Nu este necesară ajustarea pH-ului care. dubliniensis este lipsită de acţiune lipolitică. la 2-3 zile post-inoculare. albicans şi C. M49 Agar cu amidon Compoziţie Amidon solubil Extract de drojdie Agar Apă distilată Preparare: 40 g 5g 20 g ad 1000 ml substanţele se introduc în apă şi se dizolvă pe baie de apă. după sterilizare.

Aspect: bulion transparent. Este utilizat atât pentru izolarea genului Pythium. transferul pe acest mediu a culturilor pleomorfe ale dermatofiţilor induce sporularea şi chiar revenirea la tipul „wild” a speciilor dezvoltate în prealabil pe mediul Sabouraud. Rhodotorula şi Trichosporon ) Stocare: .22 µm. de culoare gălbuie pH final la 25°C: 6.Luminiţa Malic. bulionul obţinut se repartizează în tuburi (câte 3 ml).ureazo pozitiv (roşu) Candida albicans ATCC 1023 . De asemenea. Mihai Mareş Utilizare: M51 Bulion cu uree ( test rapid pentru identificarea levurilor ) (Rapid Urea Broth Test for Yeasts) Compoziţie Peptonă NaCl Fosfat monopotasic Roşu fenol Glucoză Uree Apă distilată Preparare: 1g 5g 2g 0. utilizând membrane cu porozitate de 0.ureazo negativ (galben) Utilizare: diferenţierea tulpinilor levurice ureazo-pozitive de cele ureazonegative şi identificarea prezumtivă a unor genuri (Cryptococcus.2 Controlul calităţii : Cryptococcus neoformans ATCC 66031 . 77 Capitolul 3 mulţi fungi sensibili sporulează bine pe acest mediu. Stocare: în eprubete 4 luni la 2°-8 °C.   .8 ± 0. Olimpia Bazgan.20°C timp de 2 luni Disponibil comercial: Remel (SUA). cât şi pentru izolarea şi stimularea sporulării la speciile de Fusarium. Cele două soluţii astfel obţinute se răcesc la temperatura camerei şi se amestecă sub protecţia unei hote microbiologice de clasă II. Ureea se solubilizează în apa distilată rămasă şi se sterilizează prin filtrare. în plăci o lună la 2°-8°C Disponibil comercial: nu este disponibil comercial.012 g 1g 20 g ad 1000 ml ingredientele (cu excepţia ureei) se solubilizează în 500 ml apă distilată preîncălzită şi apoi se sterilizează prin autoclavare la 121°C timp de 15 minute.

6 ± 0. apoi mediul astfel obţinut se repartizează în eprubete. 78 . C.glabrata – colonii mate de culoare violet deschis (lila).5 g 15 g ad 1000 ml Aspect: pH final la 250C: Controlul calităţii: Utilizare: ingredientele se dizolvă în apa distilată şi se fierb un minut până la completa solubilizare. Se adaugă neomicină. albicans . 500 µg/ml. uşor opalescent 6. krusei . în volum de câte 5 ml. transparent.1 ± 0. C.colonii de culoare albastru-verzui până la albastru-metalizat. C. albicioase la periferie. Se sterilizează prin autoclavare.tropicalis . în acest caz mediul se aditivează cu acid clorhidric 1N Stocarea: o lună la temperatura de refrigerare Disponibil comercial: Remel (SUA). M53 CHROMagar Candida Compoziţie Peptonă Amestec cromogen Cloramfenicol Agar Apă purificată Preparare: 10 g 22 g 0. Se autoclavează la 121°C timp de 15 minute. transparent pH final la 25 °C: 5.bioMérieux (Franţa). la 121°C timp de 15 minute.2 Controlul calităţii: Candida albicans ATCC 10231 ++ Aspergillus niger ATCC 16404 ++ Utilizare: purificarea suşelor de fungi contaminate cu bacterii. Biokar Diagnostics (Franţa). în momentul răcirii mediului la o temperatură de 50°-55°C.Medii de cultivare M52 Bulion Sabouraud Compoziţie Peptonă Glucoză Apă distilată Preparare: 10 g 20 g ad 1000 ml ingredientele se solubilizează în apa distilată preîncălzită. Aspect: bulion de culoare gălbuie.colonii de culoare verde-smarald.1 Candida albicans ATCC 10231 ++ Candida tropicalis ATCC 1369 ++ Candida krusei ATCC 34135 ++ izolarea levurilor din prelevatele patologice şi identificarea speciilor: C.colonii de tip R de culoare roz-pal. Becton Dickinson (SUA).

0 g ad 1000 ml Aspect: pH final la 25°C: glicerina.5 g 7.Luminiţa Malic. Agarul se dizolvă în 600 ml apă şi apoi se amestecă cu celelalte soluţii. Mihai Mareş Stocare: în plăci. translucidă pH final la 25°C: 3. sucroza.06 g 4. Autoclavarea mediului se face la 121°C timp de 20 minute.6 Utilizare: favorizează sporularea la fungii filamentoşi superiori Stocare: în eprubete 4 luni la 2°-8°C. Se omogenizează peptona şi clorura de sodiu cu 200 ml apă preîncălzită la 60°C şi se adaugă peste prima soluţie. geloză gălbuie. Extractul se păstrează în flacoane. în plăci o lună la 2°-8°C Disponibil comercial: nu este disponibil comercial. Se dizolvă agarul în apă şi se adaugă extractul.5 . sulfatul de magneziu şi fosfatul de potasiu se adaugă în 200 ml apă. Olimpia Bazgan. la temperatura de refrigerare Disponibil comercial: Becton Dickinson (SUA) M54 Cireşe . Aspect: geloză roşiatică. 2 luni.5 g 5.4. Se distribuie în eprubete sterilizate şi se autoclavează 5 minute la 120°C.se scot sâmburii din fructele roşii.0 g 20. Nu se supraîncălzeşte deoarece reacţia acidă a mediului împiedică solidificarea. Nu se ajustează pH-ul. la 450 g pulpă de cireşe adăugându-se 1000 ml apă distilată. Amestecul se fierbe înnăbuşit 2 ore. la frigider. M55 Agar – glicerină Compoziţie Glicerină Sucroză Peptonă MgSO4 x 7H2O KH2PO4 NaCl Agar Apă distilată Preparare: 7.Agar Extract de cireşe Agar Apă distilată Preparare: 300 ml 20 g ad 1000 ml obţinerea extractului de cireşe .05 g 0. uşor opalescentă nu se determină 79 Capitolul 3   Compoziţie . Se filtrează prin tifon şi se sterilizează o oră la 110°C.0 g 0.

Biokar Diagnostics (Franţa). Mediul nu se va reîncălzi.5 ± 0. Aspect: lichid alb-gălbui. după care se filtrează şi se autoclavează infuzia 1 oră la 1100C. amestecând continuu. Aspect: geloză de culoarea chihlimbarului. 80 . timp de 24 de ore. Autoclavarea are loc la o temperatură de 121oC timp de 15 minute. cu menţinerea temperaturii de fierbere timp de un minut. uşor opalescentă pH final la 25ºC: 5. M56 Infuzie de cartofi Compoziţie Cartofi Apă de robinet Preparare: 300 g 900 ml se lasă cartofii taiaţi.0 g ad 1000 ml ingredientele se dizolvă în apa distilată. translucid pH final la 25°C : nu se determină Controlul calităţii: nu se realizează Utilizare: pentru prepararea mediului PDA Stocare: se recomandă utilizarea imediată Disponibil comercial: nu se comercializează.2 Controlul calităţii: Aspergillus niger ATCC 16404 ++ Candida albicans ATCC 10231 ++ Saccharomyces cerevisiae ATCC 9763 + Utilizare: mediu pentru conservarea fungilor şi pentru studierea caracterelor morfologice ale acestora în vederea identificării Stocare: în eprubete 2 luni la 2°-8 °C. în plăci o lună la 2°-8°C Disponibil comercial: Merck (Germania).Medii de cultivare Controlul calităţii: Utilizare: Aspergillus niger ATCC 16404 ++ cultivarea şi identificarea speciilor aparţinând genului Aspergillus. în apă. Remel (SUA).0 g 15. M57 Malţ agar (Malt Agar) Compoziţie Extract de malţ Agar Apă distilată Preparare: 30. la frigider.

Merck (Germania) 81 Capitolul 3   . Mihai Mareş M58 Malţ extract agar (Malt Extract Agar) Compoziţie Maltoză Dextrină Glicerol Peptonă Agar Apă distilată Preparare: 12. Aspect: geloză de culoarea chihlimbarului. Olimpia Bazgan. transparentă pH final la 25ºC: 4.0 g ad 1000 ml ingredientele se dizolvă în apa distilată.Luminiţa Malic. amestecând continuu. Becton Dickinson (SUA).7 ± 0. identificarea şi aprecierea cantitativă a fungilor filamentoşi şi levuriformi Stocare: în eprubete 2 luni la 2°-8°C. Autoclavarea are loc la o temperatură de 121oC timp de 15 minute.2 Controlul calităţii: Aspergillus niger ATCC 16404 ++ Candida albicans ATCC 10231 ++ Saccharomyces cerevisiae ATCC 9763 + Utilizare: mediu pentru cultivarea. cu menţinerea temperaturii de fierbere timp de un minut.75 g 2.78 g 15.35 g 0.75 g 2. în plăci o lună la 2°-8°C Disponibil comercial: Remel (SUA).

8°C Disponibil comercial: Difco (SUA) 82 .0 g 2.0 mg 2.0 g 0.0 µg 400.0 µg 200.0 µg 500.0 mg 2.0 µg 1.Medii de cultivare M59 Mediu bază pentru levuri (Yeast Carbon Base) Compoziţie Dextroză L-histidină monohidroclorică LD-metionină LD-triptofan Biotină Calciu pantotenic Acid folic Inozitol Niacină Acid p-amino benzoic Piridoxină hidroclorică Riboflavin Tiamină hidroclorică Acid boric Sulfat de cupru Iodură de potasiu Clorură ferică Sulfat de mangan Molibdat de sodiu Sulfat de zinc Fosfat monopotasic Sulfat de magneziu Clorură de sodiu Clorură de calciu Apă distilată Preparare: 10.0 µg 200.5 g 0.0 µg 2.0 µg 100. Apoi se filtrează utilizând filtre cu porozitate de 0.0 µg 2000.0 µg 400.0 g 1.0 µg 400.2 µm.0 µg 400.1 g ad 1000 ml în vederea sterilizării prin filtrare se prepară o soluţie de concentraţie 10 x prin dizolvarea a 11.0 µg 40.7 g pulbere în 100 ml apă distilată preîncălzită. Varianta de lucru se prepară prin adăugarea de apă distilată sterilizată în proporţie de 9 volume la un volum mediu concentrat.2 Utilizare: mediu bază pentru auxonograma levurilor Stocare: 2°.5 ± 0.0 µg 200. de culoare galben-pai pH final la 25°C: 5.0 µg 400.1 g 0.0 µg 400.0 µg 200. Aspect: bulion transparent.

0 g 1. transparent 6.0 g 0.Luminiţa Malic. pH-ul se ajustează la 6.05 g 0.32 g ad 1000 ml ingredientele se dizolvă în apă distilată preîncălzită sub agitare continuă. Se repartizează în tuburi sau flacoane şi se autoclavează la 121°C timp de 15 minute.80 Candida albicans ATCC 10231 ++ Candida parapsilosis ATCC 22019 ++ 83 Capitolul 3   .5 g 3.05 g 0.0 g 1.68 g 1. Mihai Mareş M60 AM3 (Antibiotic medium 3) Compoziţie Extract de carne pulbere Extract de drojdii Peptonă Dextroză Clorură de sodiu Fosfat dipotasic Fosfat monopotasic Apă distilată Preparare: 5.0 g 3. Olimpia Bazgan.75-6.5 g 5.5 g 2. Aspect: mediu transparent de culoarea chihlimbarului pH final la 250C: 7. Stocare: 2°-8°C Disponibil comercial: Becton Dickenson (SUA) M61 Mediu sintetic pentru testul de filamentare Compoziţie Glucoză Fosfat monopotasic Clorură de calciu Sulfat de magneziu Sulfat de amoniu Apă distilată Preparare: Aspect: pH final la 25°C: Controlul calităţii: 0.75 cu ajutorul unei soluţii de hidroxid de potasiu 2M şi amestecul se sterilizează prin autoclavare mediu lichid.5 Controlul calităţii: incubare la 350C ± 20C / 24 ore Escherichia coli ATCC 10536 + Staphylococcus aureus ATCC 6538 + Candida albicans ATCC 10231 + Utilizare: mediu destinat depistării rezistenţei la amfotericină prin metoda benzilor E-test.5 g ad 1000 ml după solubilizarea glucozei şi a tuturor sărurilor.0 ± 0.

deoarece este steril. se fierb un minut. opalescentă pH final la 25°C: nu se determină Controlul calităţii: Fusarium solani ATCC 22278 .2 g 18. M62 Mediul Bilai Compoziţie KH2PO4 KNO3 MgSO4 x 7H2O KCl Amidon pudră Glucoză Sucroză Agar Apă distilată Preparare: 1g 1g 0. de culoare albă. opac 84 . albicans şi C.5 g 0. Stocare: în eprubete 4 luni la 2°-8°C. la 37°C timp de 4 ore.2 g 0. în plăci o lună la 2-8°C Disponibil comercial: nu este disponibil comercial.Medii de cultivare permite producerea de tubi germinativi la tulpinile de Candida albicans. apoi se autoclavează la 121°C timp de 15 minute. în plăci o lună la 2°-8°C Disponibil comercial: nu este disponibil comercial.0 g ad 1000 ml Utilizare: ingredientele se dizolvă în apa distilată preîncălzită. M63 Mediu cu lapte diluat Compoziţie Lapte natural pasteurizat Cloramfenicol Apă distilată sterilă Preparare: 170 ml 0. dubliniensis (diferenţierea între acestea necesită teste suplimentare). Este utilizat pentru trierea selectivă a tulpinilor levurice şi identificarea prezumtivă a speciilor C.5 g 0.250 g ad 1000 ml Aspect: ingredientele se omogenizează sub protecţia unei hote cu flux laminar de clasă II şi se repartizează în flacoane.2 g 0. prin incubare pe baia de apă. Aspect: geloză albicioasă. Este obligatorie folosirea laptelui pasteurizat UHT. mediu lichid.dezvoltare cu sporulare intensă Utilizare: mediul induce formarea conidiilor la Fusarium Stocare: în eprubete 4 luni la 2-8 °C.

Pentru sterilizare se încălzeşte treptat pentru a evita fărâmiţarea miezului. artrospori).Luminiţa Malic. în eprubete 4 luni la 2°-8°C. Olimpia Bazgan. Se incubează culturile 10-14 zile apoi se păstrează la 3°-6°C. apoi se incubează la 37°C). Penicillium şi Mucor. Stocare: 2°-8°C Disponibil comercial: nu se comercializează. După 7 zile se sterilizează din nou pentru a distruge toate microorganismele termorezistente care au supravieţuit primei sterilizări. hife. în plăci o lună la 2°-8°C Disponibil comercial: nu este disponibil comercial. În acest scop se suspensionează o colonie tânără în 3-4 ml mediu şi se incubează la 28°-30°C timp de 24-48 ore. 85 Capitolul 3 Candida albicans ATCC 10231 (dezvoltare abundentă. Se observă la microscop între lamă şi lamelă (x100 . M65 Mediu cu sol Solul (pământ de grădină cernut printr-o sită fină) se introduce în eprubete sau flacoane şi se sterilizează 30 de minute la 121°C. blastoconidii. Folosind cantităţi variabile de apă se obţine sporularea speciilor higrofile. în plăci o lună la 2°-8°C Stocare: Disponibil comercial: nu este disponibil comercial. xerofile. x400). cu producere de pseudomiceliu şi clamidospori) Utilizare: mediu recomandat pentru studierea caracterelor morfologice la levuri (clamidospori. Se inoculează solul şi se umezeşte în acelaşi timp cu 2-3 ml suspensie de spori. mediu utilizat de asemenea pentru izolarea zygomicetelor din infecţii cerebrale (fragmentele de ţesut cerebral cu dimensiuni de câţiva mm diametru se însămânţează în mai multe puncte. Mihai Mareş M64 Mediu cu pâine Felii de pâine se taie în formă de prisme de 5 cm lungime şi 1 cm lăţime. Se introduc în eprubete şi se adaugă apă. mezofile.. Stocare: în eprubete 4 luni la 2°-8°C. Mediul este recomandat pentru conservarea fungilor.. Controlul calităţii:   . în special la Aspergillus. pe fragmentele de pâine. pseudohife.

apoi se amestecă şi se repartizează în tuburi. Biokar Diagnostics (Franţa). amestecând continuu.5 g 0.Dox Broth / Agar) Compoziţie Zaharoză Nitrat de sodiu Fosfat dipotasic Sulfat de magneziu Clorură de potasiu Sulfat feric Apă distilată Preparare: 30. Se sterilizează prin autoclavare la 110°C timp de 10 minute. în plăci o lună la 2°-8°C Disponibil comercial: Merck (Germania).3 ± 0.0 g 1.01 g ad 1000 ml ingredientele se dizolvă în apa distilată. opac 86 . de culoare galbenă. Penicillium şi Paecilomyces din probele de apă conform unor standarde. uşor opalescent. cu menţinerea temperaturii de fierbere timp de un minut.5 g 0. mediu pentru identificarea tulpinilor de Aspergillus Stocare: în eprubete 2 luni la 2°-8 °C.2 Controlul calităţii: Aspergillus niger ATCC 9642 ++ Candida albicans ATCC 10231 ++ Candida tropicalis ATCC 750 ++ Saccharomyces cerevisiae ATCC 9763++ Utilizare: mediu utilizat pentru izolarea fungilor aparţinând speciilor Aspergillus. M67 Mediul Kurung-Yegian Compoziţie soluţia A Fulgi de cartofi Apă deionizată Compoziţie soluţia B Melanj de ouă Gălbenuş de ou Preparare: Aspect: 250 ml 500 ml 5g 500 ml se prepară separat cele două soluţii. Remel (SUA). Aspect: transparent.0 g 3. mediu în tuburi. Autoclavarea are loc la o temperatură de 121oC timp de 15 minute.0 g 0.Medii de cultivare M66 Bulion / Agar Czapek-Dox (Czapek . în cazul mediului solid se adaugă 15 g agar. turnat în pantă. uneori poate prezenta un uşor precipitat pH final la 25oC: 7.

10 g 15. Aspect: geloză opalescentă.0 g 15. cu menţinerea temperaturii de fierbere timp de un minut. de culoare bleu. M69 Mediul Pagano-Levin (TTC Sabouraud Agar) Compoziţie Peptonă Dextroză Agar Clorură de trifeniltetrazoliu sol. Olimpia Bazgan. amestecând continuu.0 g 1.Luminiţa Malic.1% (TTC) Neomicină sau Cloramfenicol Apă distilată Preparare: 10. Se sterilizează prin autoclavare la 121°C timp de 15 minute.0 g 0. Compoziţie Fosfat monopotasic Sulfat de amoniu Biotină Albastru de tripan Agar Apă distilată Preparare: 1. Mihai Mareş pH final la 25°C : Utilizare: 6.0 g 5.0 g 10 ml 0.5 g ad 1000 ml ingredientele se dizolvă în apa distilată.pal Controlul calităţii: Candida albicans ATCC 10231 dezvoltă clamidospori în 2448 de ore de incubare la 25°C Utilizare: mediu destinat stimulării producerii de clamidospori la levuri Stocare: 2°-8°C Disponibil comercial: nu se comercializează. Mediului răcit (la 50°C) i se adaugă 20 g glicogen sau amidon purificat şi sterilizat prin tindalizare.6 ± 0.2 asigură conversia la forma levurică în cazul speciilor Histoplasma capsulatum şi Blastomyces dermatitidis Stocare: în eprubete o lună la 2°-8°C Disponibil comercial: nu se comercializează.0 g 40.0 g ad 1000 ml se solubilizează toate substanţele în apa distilată preîncălzită. Autoclavarea are loc la o temperatură de 115oC timp de 15 87 Capitolul 3 M68 Mediul Nikersen-Mankovski   .

în plăci o lună la 2°-8°C Disponibil comercial: Remel (SUA). de diferite nuanţe.0 g 10. în timp ce alte specii din genul Candida prezintă colonii roz.2 Controlul calităţii: Aspergillus niger ATCC 16404 ± Microsporum audouinii ATCC 9079 ++ Pseudomonas aeruginosa ATCC 10145 ± Trichophyton mentagrophytes ATCC 9533 ++ Utilizare: mediu selectiv şi diferenţial pentru izolarea şi identificarea dermatofiţilor din prelevatele clinice Stocare: în eprubete 2 luni la 2°-8 °C. de culoare slab gălbuie. Stocare: în plăci o lună la 2°-8°C Disponibil comercial: bioMérieux (Franţa). opalescentă pH final la 250C: 5. Tulpinile acestei specii prezintă pe mediul Pagano-Levin culoarea albdeschis.5 ± 0.6 ± 0. amestecând continuu.5 g 0.0 g ad 1000 ml ingredientele se dizolvă în apa distilată. M70 Mediu pentru izolarea dermatofiţilor (DTM) Compoziţie Peptonă din soia Dextroză Roşu fenol Cicloheximidă Cloramfenicol Agar Apă distilată Preparare: 10. La temperatura de 50°-55°C se adugă sol. Aspect: geloză transparentă. Autoclavarea are loc la o temperatură de 121oC timp de 15 minute Aspect: agar galben-portocaliu. 1% TTC şi antibioticul. cu menţinerea temperaturii de fierbere timp de un minut.1 g 20.0 g 0. uşor opalescent pH final la 25ºC: 5.Medii de cultivare minute.2 g 0. Becton – Dickinson (SUA) 88 .2 Controlul calităţii: Candida albicans ATCC 26790 ++ Candida albicans ATCC 36232 ++ Candida krusei ATCC 34135 ++ Escherichia coli ATCC 25922 – Utilizare: acest mediu diferenţial este recomandat pentru identificarea speciei Candida albicans din prelevatele patologice.

53 g ad 1000 ml se amestecă ingredientele sub agitare continuă până la completa dizolvare. utilizând un filtru cu porozitate 0.2 µm. amestecându-se continuu până la dizolvarea lor completă. La 250C se ajustează pH-ul la valoarea 7. Se stochează la 4°C până la utilizare.4 g 34. M72 Mediul RPMI 1640 . Înainte de utilizare. Se sterilizează prin filtrare utilizând un filtru cu porozitate 0.8 g 69.4 g 34. 89 Capitolul 3   .7. Olimpia Bazgan.53 g 18 g ad 1000 ml Compoziţie mediu dublu concentrat 2X Mediu RPMI 1640 MOPS Glucoză Apă distilată Preparare: 20.0 cu ajutorul unei soluţii de NaOH 1M. se testează sterilitatea mediului şi se verifică pH-ul. Înainte de utilizare se testează sterilitatea şi pH-ul .MOPS (CLSI) Compoziţie Mediu RPMI 1640 MOPS Apă distilată Preparare: 10.22 µm.1 Controlul calităţii: trebuie să se obţină CMI-urile recomandate pentru tulpinile test.9 . Mihai Mareş M71 Mediul RPMI 1640 . de culoare roşiatică pH final la 250C: 6.06 g 36 g ad 1000 ml se adaugă ingredientele în apă bidistilată. Utilizare: mediu destinat testării susceptibilităţii la antifungice prin tehnicile CLSI Stocare: 2°C–8°C Disponibil comercial: nu se comercializează. Aspect: bulion transparent. Se păstrează la 4°C până în momentul folosirii. Se sterilizează prin filtrare.MOPS ( EUCAST) Compoziţie mediu concentraţie uzuală 1X Mediu RPMI 1640 MOPS Glucoză Apă distilată 10. se completează cu apă bidistilată până la 1 litru.0 folosind NaOH soluţie 1 M.Luminiţa Malic. Se ajustează pH-ul la valoarea 7.

sub protecţia lămpii UV.9. şi se aduce volumul final al amestecului la 1000 ml. fără bicarbonat) MOPS Glucoză Agar pulbere NaOH soluţie 1M Apă distilată Preparare: Aspect: pH final la 250C: Controlul calităţii: Utilizare: 8. Se toarnă mediul în plăci Petri (cca. se răceşte apoi amestecul la 45°-50°C.0 g 80-90 ml ad 1000 ml Aspect: pH final la 250C: Controlul calităţii: se dizolvă pulberile de RPMI şi MOPS în cca.4 g 34.2 µm. Se solubilizează glucoza şi agarul în cca.9-7. 45°C şi se amestecă cu cea care conţine glucoza şi agarul.5 g 20. de culoare roşiatică 6.MOPS . geloză translucidă. utilizând o hotă microbiologică de clasă II.0 g 15. Se încălzeşte lent soluţia conţinând RPMI şi MOPS la cca.1 se realizează cu benzi E-Test la 48 ore 90 . Se stochează la 4°C.0 utilizând soluţie NaOH 1M. 450 ml apă distilată şi se sterilizează prin autoclavare timp de 15 minute la 121°C.7. M73 Agar RPMI . 60 ml/ placă ø 150 mm sau cca 25 ml / placă Petri ø 90 mm.glucoză 2 % Compoziţie Mediu RPMI 1640 (cu L-glutamină şi roşu fenol. Se ajustează pH-ul amestecului la valoarea 7. sub protecţia unei hote microbiologice de clasă II.1 trebuie să se obţină CMI-urile recomandate pentru tulpinile test mediu destinat testării susceptibilităţii la antifungice prin tehnicile EUCAST Stocare: 2°-8°C Disponibil comercial: nu se comercializează. 450 ml apă distilată şi se sterilizează prin filtrare utilizând un filtru cu porozitate 0.Medii de cultivare bulion transparent de culoare roşiatică 6.

064 0.parapsilosis ATCC 22019 0.0 g ad 1000 ml Utilizare: Aspect: ingredientele se dizolvă în apa distilată.258 0.5 .25 0.2 0.0 m g 0.125 -0.albicans ATCC 90028 0.5 0.5 0.0 g 10. Autoclavarea are loc la o temperatură de 121oC timp de 15 minute geloză de culoare roz.0 g 1.0 m g 25.Rose Bengal . transparentă sau uşor opalescentă 91 Capitolul 3   .1 0.125 -0.016 0.25 .25 . Mihai Mareş Intervalul CMI (µg/ ml) Tulpina test FC AP FL IT VO C.krusei ATCC 6258 ≥ 32 0.004 0.064 0.0 g 0.1 C. Olimpia Bazgan.2 128 -≥256 0.064 C.064 0.4 (rar colonii izolate la 8) 0.25 0. cu menţinerea temperaturii de fierbere timp de un minut.Luminiţa Malic.cloramfenicol (DRBC Agar) Compoziţie Peptonă proteazică 3 Dextroză Fosfat monopotasic Sulfat de magneziu Dicloran Roz Bengal Cloramfenicol Agar Apă distilată Preparare: 5.1 g 15. amestecând continuu.25 .5 g 2.016 mediu destinat testării susceptibilităţii la antifungice cu benzi E-test Stocare: 2°-8°C Disponibil comercial: AES Laboratoire (Franţa) M74 Agar Dicloran .1 1 .5 .

1 g 15.0 g ad 1000 ml * Trichophyton Agar 2 Compoziţie Aminoacizi Casamino Difco Dextroză Fosfat monopotasic Sulfat de magneziu Agar Inozitol Apă distilată 2.colonii roz.8 g 0.8 g 0.Medii de cultivare pH final la 25ºC: Controlul calităţii: 5.0 g 1.6 ± 0.0 g 1.1 g 15.colonii albe Candida albicans ATCC 10231 .2 Aspergillus niger ATCC 1015 . M75 Trichophyton Agar 1-7 * Trichophyton Agar 1 Compoziţie Aminoacizi Casamino Difco Dextroză Fosfat monopotasic Sulfat de magneziu Agar Apă distilată 2. Biokar Diagnostics (Franţa). Escherichia coli ATCC 25922 Micrococcus luteus ATCC 10240 Utilizare: mediu pentru cultivarea şi identificarea fungilor filamentoşi Stocare: în eprubete 2 luni la 2°-8°C.0 mg ad 1000 ml 92 . în plăci o lună la 2°-8°C Disponibil comercial: Remel (SUA).5 g 40.0 g 50.5 g 40.

0 g 200 µg ad 1000 ml 2.8 g 0.1 g 200 µg 15. Olimpia Bazgan.5 g 40.0 g 1.1 g 15.Luminiţa Malic.0 g ad 1000 ml 2.0 g 50.1 g 15.5 g 40. Mihai Mareş * Trichophyton Agar 3 Compoziţie Aminoacizi Casamino Difco Dextroză Fosfat monopotasic Sulfat de magneziu Agar Inozitol Tiamina HCL Apă distilată * Trichophyton Agar 4 Compoziţie Aminoacizi Casamino Difco Dextroză Fosfat monopotasic Sulfat de magneziu Agar Tiamină HCl Apă distilată * Trichophyton Agar 5 Compoziţie Aminoacizi Casamino Difco Dextroză Fosfat monopotasic Sulfat de magneziu Acid nicotinic Agar Apă distilată 2.8 g 0.0 mg 200 µg ad 1000 ml 93 Capitolul 3   .0 g 1.8 g 0.5 g 40.0 g 1.

Medii de cultivare * Trichophyton Agar 6 Compoziţie Nitrat de amoniu Dextroză Fosfat monopotasic Sulfat de magneziu Agar Apă distilată * Trichophyton Agar 7 Compoziţie Nitrat de amoniu Histidină HCl Dextroză Fosfat monopotasic Sulfat de magneziu Agar Apă distilată Preparare: 1.5 g 40.1 g 15.0 g ad 1000 ml ingredientele se dizolvă în apa distilată. uşor opalescentă pH final la 25ºC: 6. amestecând continuu. 94 .0 g ad 1000 ml 1. Aspect: geloză gălbuie. cu menţinerea temperaturii de fierbere timp de un minut.2 Controlul calităţii: Trichophyton concentricum ATCC 9358 ++ Trichophyton schoenleinii ATCC 4822 ++ Trichophyton verrucosum ATCC 34470 ++ Utilizare: cultivarea şi identificarea speciilor aparţinând genului Trichophyton Stocare: în eprubete 4 luni la 2°-8°C.8 g 0. Se autoclavează la 121ºC timp de 12 minute.0 g 1. în plăci o lună la 2°-8°C Disponibil comercial: Difco (SUA) M76 Agar peptonă 3% (Agar Sabouraud conservare) Compoziţie Peptonă Agar Apă distilată Preparare: 30.8 g 0.1 g 15.0 mg 40.0 g 1.0 g 20.8 ± 0.5 g 30.0 g ad 1000 ml ingredientele se amestecă cu apa distilată până la completa dizolvare şi se fierb un minut.

în plăci o lună la 2°-8°C Disponibil comercial: nu se comercializează   . Mihai Mareş 95 Capitolul 3 Autoclavarea are loc la o temperatură de 121oC timp de 15 minute. Aspect: geloză de culoare galben-pal. persicolor . persicolor de T. translucidă pH final la 25ºC: nu se determină Controlul calităţii: M. Olimpia Bazgan.Luminiţa Malic.colonii cu tentă roz-lila Utilizare: mediu pentru diferenţierea M. mentagrophytes şi pentru conservarea suşelor de dermatofiţi Stocare: în eprubete 2 luni la 2°-8°C.

St. 8. 34:456-465.A selective medium for the isolation and enumeration of Mucor species.Tratat de microbiologie clinică. Berthier J. 6. Office International des Epizooties. Collins G F (1996) .Bailay & Scott’s diagnostic microbiology. Paris. 11. Acha P N. In Methods in Microbiology. Hocking A D. Academic Press. Barr F S.Les dermatophytes. 96 . In Modern Methods in Food Mycology. Chabasse D (Editor) (2004) . Bensignore E. Appl Environ Microbiol. Abildgren M P. 5. Guiguettaz C. 9nd edition.A rapid method for isolation and identification of Candida.Metode şi tehnici în micologie. 14. Junimea. ENV d’Alfort. Cahier de formation en Biologie médicale. 2. 15. Revue française des laboratoires. Amsterda. Bucureşti. Pitt J I. Constantinescu O (1974) .Abrégé de parasitologie vétérinaire. Mareş M (2000) . Andrews S.Selective medium for the isolation of Fusarium species and dematiaceous Hyphomycetes from cereals. 10(228):77-83. Fasc. Buiuc D. 31.Micologie medicală aplicată. Bussieras J (1993) . Ed. 351-355. Pitt J I (1986) . 95:373-374. Samson R A. Valla G (1989) .Differentiation of Alternaria species isolated from cereals on dichloran malt extract agar. Cimon B. Peterson L R. 3. Paris. Gentile L.Medii de cultivare Bibliografie selectivă 1. Ed. Szyfrer B (1989) . 2nd edition. Louis. 175(1-2):45-60. Bioforma. Mycological Research. 51:1235-1238. 59:694-695. Baron E J. Coman I. 4. Chabasse D. 16. Elsevier. J Southern Med Assoc. Ceres. 10. Lund F.). 13. J Clin Microbiol.Fungal culture media. Medicală. Chermette R.O. 9. Bucureşti. Lett Appl Microbiol. Mycologie vétérinaire. ed. V.Direct identification and recognition of yeast species from clinical material by using Albicans ID and CHROMagar Candida plates. Mosby-Year Book. 12. 5:83-86. Ed.Les mycoses transmisées d’animal à l’homme. M. Iaşi. Inc. 7. Neguţ M (1999) . Elmhold S (1987) . 49-94. Booth C. King A D (eds. Rec Méd Vét. Paris. London. Finegold S M (1994) . Ed. Baumgartner C.Czapek-Dox agar containing iprodione and dicloran as a selective medium for the isolation of Fusarium species.Microsporum persicolor (Sabouraud) Guiard et Grigorakis 1929 chez l’animal et chez l’homme: etude in vitro et revue de la littérature. Booth C (1971) . No.Zoonoses et maladies transmissibles communes à l’homme et aux animaux. Feuilhade de Chauvin M (1999) . Freydiere A-M. Gille Y (1996) . Bouchara J P (1991) . Baertschi C. Andrews S (1992) . Thrane U.

87:428-431.Rapid methods for identification of the most frequent clinical yeasts. 37:959-964. Hopfer R L.Evaluation of a molybdenum culture medium as selective and differential for yeasts.Atlas of clinical fungi. Rousselle P. Garcia-Agudo R. 18. Med Mycol. Viaţa Medicală Românească. 20.Importance des levures du genre Malassezia en dermatologie vétérinaire.Tobacco agar: a new medium for chlamydosporulation in Candida albicans and Candida dubliniensis. Gené.Les Mycoses humaines: demarche diagnostique. 14:85-89. 15:131-135. Janssen Researchers Foundation. Elsevier. Hocking A D. 69:337-355. 5:190-191. Golăescu M (1997) . Guinet R (1997) . Guillot J (1996) . Le point Vétérinaire. Paris. 26.Molina J M et al. 97 Capitolul 3   . Midgley G. Kane J (1984) . 43(5):473-475.Dichloran-sucrose agar. Pitt J I (1980) . J Clin Microbiol.Apport des milieux d’identification rapide de Candida albicans: Fluoroplate et Albicans ID. Mialot M. de Lourdes Branco C (1964) . Appl Environ Microbiol. Guillot J. Cutsem Van J. 29:691-701. King A D. 29. J Med Mycol. Paris. 22.The genus Malassezia with description of four new species. Rev Iberoam Micol. Gueho E. Blank F (1975) . Garcia-Martos P. Ed. Gille P (1995) .Conversion of Balstomyces dermatitidis to the yest form at 37ºC and 26ºC. Pitt J I (1979) . 28. 27. J Pathol Bacteriol. Appl Environ Microbiol. 20:594-596. 2:11581200. J Clin Microbiol. 24. 19. Jacquemin J L (1974) . Chermette R (1998) .Dichloran-rose bengal medium for enumeration and isolation of moulds from foods. 31. Masson et Cie. Guarro J. Centraalbureau voor Schimmelcultures / Universitat Rovira i Virgili. Costa S O. Jacquemin P.containing medium for identification of Cryptococcus neoformans. Hoog de G S. Freydière A M. 30. Gueho E. J Appl Bacteriol. 39:488-492. Hermandez. 23. (1998) Identificacion de levadudas de interes clinico en el medio de cultivo CHROMagar Candida. Rev Iberoam Micol. a differential medium for enumeration of xerophilic fungi from low-moisture foods. 2nd edition. Bucureşti. Jarvis B (1973) .Mycoses des animaux domestiques. Mihai Mareş 17. 25. Kumar Girish C P. Grillot R (1996) . Figueras M J (2000) . 36:723-727. Antonie van Leeuwenhoek.Hocking A D. Freydiere A-M.Abrégé de parasitologie clinique. 32.Luminiţa Malic. Ed. 33. Rochette F (1992) .Diagnosticul şi tratamentul micozelor interne. Menon T (2005) .Comparison of an improved rose bengal-chlortetracycline agar with other media for the selective isolation and anumeration of moulds and yeasts in foods.Caffeic acid . Olimpia Bazgan. 21.

In BB Wentworth (ed. Boekhout T. Robert V (eds) . Am J Clin Pathol. Am J Clin Pathol. Martin M V. Schneidau J D (1970) . 42(1):380-383.Medium for maintenance and conversion of Histoplasma capsulatum to the yeast like phase. Moser S A. Yegian D (1954) . Richardson E S. Salkin I F et al. Germany. Sullivan D.Evaluation of the NCCLS M44-P Disk Diffusion Method for Determining Susceptibilities of 276 Clinical Isolates of Cryptococcus neoformans to Fluconazole. In Boekhout T. Washington DC. Kwon-Chung K J. Martin-Mazuelos E.) .Introduction à une etude des dermatophytes. Bilbao. Bennett J E (1992) . Ed. 38.(2004) . Boyken L et al. Peman J. 41. Imkampe A. Lea & Febiger. 39. J Clin Microbiol.Improved methods for isolation and enumeration of Malassezia furfur from human skin. Thoma W et al. 39(1):323-327. Mc Ginnis M R (1980) . Robert V. Notman F H (1987) .Improved detection of Malassezia species in lipid-supplemented Peds Plus Blood Culture Bottles.. 40. Matlow A (1995) . J Clin Microbiol. Mayser P. 44.Guia Practica de Identificacion y Diagnostico en Micologia Clinica. 47. Nancy.Sistemic mycoses.Diagnostic procedures for mycotic and parasitic infection.A simple and reliable assimilation test for the identification of Candida species.Yeasts in Food.Medical Mycology. (1998) . J Clin Microbiol.Methods to identify yeasts. Randhawa H S. Pfaller M A.Synthesis of fluorchromes and pigments in Malassezia furfur by use of triptophane as single nitrogen sourse. 173-238. Rev Iberoam Micol.(2001) .Laboratory handbook of medical mycology. American Public Health Association. Yau Y C W. 43. Lyon F L. 45. J Clin Microbiol. 41:265-271. Mosaid al A. Leeming J P. 35. New York. Fell W. Bucureşti. 42. Percebois G (1973) . Rubio Calvo M C (eds) (2001) . Coleman D C (2003) . Mosaid al A. Greer D L (1988) . B Behr’s Verlag GmbH & Co. Kurung J M. 24:505-508. Kurtzman C P. Deak T (2003) .Medii de cultivare 34.Differentiation of Candida dubliniensis from Candida albicans on Pal’s Agar. J Clin Microbiol. Academic Press. Société d’Impressions Typographiques. 46. Sullivan D. Mycoses. Messer S A. 48.Evaluation of peptone glucose fluconazole agar as a selective medium for rapid and enhanced isolation of Aspergillus fumigatus from the respiratory tract of 98 . 36. Sinha K P et al. Mitroiu P (1976) . 37. 25:2017-2019.Ferric Citrate Agar. Ceres. Nelson C S. (2006) . Philadelphia. 41(10): 4787-4789. 49. 53:875879. Wille G.Micoze şi micotoxicoze la animale. Hamburg. Chowdhary A.Differentiation of Candida dubliniensis from Candida albicans on Staib Agar and Caffeic Acid. 33:1005-1007.

In Muray P R. 55. 61. Yu R J. 723-737. 54.Chlamydospore formation on Staib Agar.Evaluation d’un nouveau milieu d’isolement des levures et de diagnostic rapide de Candida albicans. 39:3793-3795. 26(11): 2279-2282. Strachan A A. Debruyne.Pagano-Levin Candida test medium. Antweiler E et al. 58. (2002) . Reed G L (1975) . 51. J Clin Microbiol. American Society for Microbiology. Med Mycol. Kelley L M.Candida. 56. Contant (1993) . Baker E M et al. Staib F. Drouhet E. J Clin Microbiol. Staib P. Observations made before Candida dubliniensis was described. Pfaller M A et al. Sinski J T. in comparison to CHROMagar Candida.Luminiţa Malic. Slifkin M (2000) . Seibold M. Zentralbl Bakteriol Microbiol Hyg A. 52. Selitsch B (2001) . 252:89-92. Segretain G. Willinger B. 53. Johnson E. 1:206-211.Tween 80 opacity test responses of various Candida species. Mycoses. Mycoses . Mycoses. Staib F. 44:23-27. Cryptococcus and other yeasts of medical importance. Mariat F (1987) . Rosenthal A S. evaluation using vaginal samples. 44(4):343-348.The brown color effect (BCE) of Cryptococcus neoformans in the diagnosis. Baron E J. (1987) .Pigment production of Cryptococcus neoformans grow with extracts of Guizotia abyssinica. Warren N G. 45:384-388. 45:521-524. 59. 57. Arastéh K (2000) . 6nd edition. control and epidimiology of Cryptococcus neoformans infections in AIDS patiens. (1994) . J Clin Microbiol. Blank F (1971) . Radonjić I et al. bronchopulmonary aspergillosis patients colonized by Candida albicans.Performance of Candida ID. a new chromogenic medium for presumptive identification of Candida species. (2005) . 62. 43(8):735738. Couillerot P J et al. 22:478-179.Ground red hot pepper agar in the isolation and presumption identification of Cryptococcus neoformans. 32:3034-3036. 38(12):4626-4628. Paris. Revue Française de Laboratoire. (eds) Manual of clinical microbiology. Waller J. Olimpia Bazgan. Hazen K C (1995) .Rapid identification of Candida albicans by using Albicans ID and Fluoroplate agar plates. Washington D C. Trichophyton mentagrophytes. Kane J (1988) . Sheth C C. Mihai Mareş 50. Stepanović S. 60. Rousselle P.Chlamidospore formation on Staib agar as a species-specific characteristic of Candida dubliniensis. Vuković D. 99 Capitolul 3   . Morschhauser J (1999) . Summerbell R C. J Clin Microbiol. Med Mycol.Diagnostic de laboratoire en micologie médicale.Phenotypic identification of Candida albicans by growth on chocolate agar. Hillowoth. Freydiere A-M.Rapid method for differentiation of Trichophyton rubrum. Appl Microbiol. Maloin. 63. J Clin Microbiol. 266:167-177. Koenig H. and related dermatophyte species.

Yamane N.Method for the determination of minimum inhibitory concentration (MIC) by broth diluation of fermentative yeasts (E. Manafi M. Willinger B.Quality assurance for commercially prepared microbiological culture media.Comparison of rapid methods using flourogenic assays for detecting Candida albicans. Manafi.1). J Clin Microbiol.Bewetung von CHROMagar Candida zum schnellachweis von Candida . Approved Standard: M22-A2. Villanova.Medii de cultivare 64. 21:276-277.Arten aus Klinischer Untersuchungsmaterial.Isolation and detection of multiple yeasts from a sigle clinical sample by use of Pagano-Levin agar medium. 7. 65. 100 . Lett Appl Microbiol. 67. Dis. Mycoses. 66. * * * Subcommittee on Antifungal Susceptibility Testing (AFST) of the ESCMID European Committee for Antimicrobial Susceptibility Testing (EUCAST) (2002) . Selitsch B. P. Hillowoth C (1999) . Willinger B. Saitoh Y (1985) . Rotter M L (1994) . 68. 18:47-49.A. 42:61-65. * * * CLSI (2002) .

Se evită conversaţia şi orice mişcare în jurul operatorului. însămânţarea prelevatelor se poate face prin mai multe tehnici uzuale: . pipetă etc. nr. . . C 101 Capitolul 4 4 Tehnici de însămânţare şi transplantare   . . Tehnici uzuale a regulă generală. masă de lucru ). scuame. scuame. cât mai aproape de orinzontalitate şi cu deschiderea în imediata apropiere a flăcării becului de gaz. .1. Însămânţarea prelevatelor provenite din situsuri normal sterile se va face preferabil sub protecţia unei hote microbiologice clasă 2. vor fi ţinute într-o poziţie oblică. fragmente unghiale. sedimente. pentru a reduce la minim contactul materialului de însămânţat cu atmosfera ambiantă.înglobare în medii solide pretopite şi răcite la 45°C: la fire de păr. 4-1 vezi Anexa). diverse raclate. pentru a preveni eventuala lor contaminare cu spori fungici ambientali. denumirea abreviată a mediului de cultivare şi data însămânţării.) nu se va atinge de obiecte nesterilizate (halat. Olimpia Bazgan 4. fragmente de ţesut şi prin înţepare: la fire de păr. În timpul însămânţărilor se va ţine seama de următoarele reguli: .Operatorul trebuie să poarte mască de protecţie. . care se pot steriliza periodic şi nu permit formarea de curenţi de aer în timpul lucrului. pasaje din hemoculturi (fig.etalare în puncte izolate – prin spotare: la unele prelevate paucibacilare sub formă de lichide organice – LCR. ac de însămânţare. . . fără a omite numărul probei.Instrumentul utilizat la însămânţare (ansă microbiologică.epuizare pe medii solide condiţionate fie în plăci Petri.Mihai Mareş. .Însămânţările se vor executa în boxe sau hote speciale.Tuburile şi plăcile Petri însămânţate se notează cu markerul.În timpul cât tuburile de cultură sunt deschise. Olimpia Bazgan Mihai Mareş. fie în tuburi (în pantă) – asigură separarea fungilor cu semnificaţie clinică de cei contaminanţi şi inhibă prin diluare eventualele substanţe antimicrobiene cu rol antifungic.Însămânţările se vor executa într-un timp scurt.

incubarea se va face atât la 37°C. însămânţarea prelevatelor se face pe Agar Sabouraud aditivat cu cloramfenicol. pentru a surprinde toate caracterele culturale.Tehnici de însămânţare şi transplantare Însămânţarea se execută în faţa flăcării unui bec de gaz care asigură condiţii de antisepsie în timpul acţiunii. se va alege temperatura de 37°C pentru incubare. de aceea ideal ar fi ca însămânţarea prelevatelor să se facă pe un mediu diferenţial cromogen. Paralel se face şi examenul morfologic al fragmentelor de colonii. deoarece se distruge miceliul şi cultura va fi fals negativă. iar cicloheximida (Actidione) inhibă multiplicarea fungilor contaminanţi. cât şi identificarea levurii / levurilor incriminate. Pe mediile de izolare. urmărindu-se aspectul macroscopic (suprafaţa. cât şi la 30°C. relieful. cultivarea prelevatelor se face fie pe Agarul Sabouraud cu cloramfenicol pe suprafaţa căruia s-a etalat prin striere o fină peliculă de ulei de măsline sterilizat prin autoclavare. În micologia medicală. Din aceeaşi probă. Se realizează astfel într-o singură etapă. În timpul dezvoltării. Pe Agar Sabouraud cu cloramfenicol. deoarece atât însămânţarea cât şi manoperele ulterioare sunt mult facilitate. Culturile se examinează zilnic. Pentru levurile lipodependente ale genului Malassezia. în puncte separate. levurile de interes medical se dezvoltă în 24-72 ore de incubare. Temperatura de incubare după însămânţare este de 36°-37°C pentru prelevatele interne / profunde şi de 30°C pentru cele superficiale. care pe lângă discriminarea între speciile levurice poate aduce informaţii esenţiale pentru identificarea agentului etiologic. apoi se ia un fragment de produs patologic ce aderă de ac şi se depune pe suprafaţa mediului de cultură. atât izolarea. Leeming). Aspectele coloniilor se notează periodic. se însămânţează mai multe plăci sau tuburi. facilitând izolarea dermatofiţilor. consistenţa şi viteza creşterii). culturile mixte apărute prin asocierea a două sau mai multe specii de levuri sunt uneori dificil de observat. Atenţie! Fragmentele biopsice recoltate din leziuni suspecte de zygomicoză nu se omogenizează cu diluant prin mojarare sau fragmentare. Temperatura de incubare recomandată este 37°C. Acest mediu permite o bună dezvoltare a levurilor şi supresează multiplicarea eventualelor bacterii contaminante. Şansele de izolare a fungilor cu semnificaţie clinică cresc direct proporţional cu numărul probelor însămânţate. Mediul de elecţie pentru izolarea dermatofiţilor este Agarul Mycobiotic (Agar Sabouraud aditivat cu cloramfenicol şi cicloheximidă). Acul de însămânţare / ansa se flambează şi se răceşte în ser fiziologic sterilizat. fie pe medii speciale (Dixon. se recomandă ca primocultura să se efectueze în plăci Petri şi nu în tuburi. produsele patologice se însămânţează în mod similar cu cel din bacteriologie. deoarece unele levuri cultivabile la 30°C dar necultivabile la 37°C. În funcţie de provenienţa prelevatului se va face şi alegerea temperaturii de incubare. Pentru prelevatele provenind din situsuri în care în mod normal temperatura este identică cu cea a organismului. cîte 3 – 4 fragmente de cercetat. prezenţa pigmentării. culoarea. pot avea semnificaţie clinică fiind cauza unor micoze superficiale. Pentru izolarea levurilor. În cazul dermatofitozelor. prezenţa cloramfenicolului suprimă dezvoltarea bacteriilor care pot contamina prelevatul. În cazul celor provenind de la nivelul tegumentului sau unghiilor. Materialul patologic se însămânţează în mai multe puncte pentru a creşte probabilitatea izolării dermatofiţilor şi a putea acorda semnificaţie 102 . coloniile îşi schimbă aspectele macroscopice.

verrucosum. cu obiectivul de imersie. La unele specii de dermatofiţi apar aşa-numitele „formaţiuni ornamentale” care reprezintă de fapt hife cu aspect modificat. hife pectinate. caracterele morfologice macro. Incubarea se realizează la 25°-30°C. Se recomandă observarea culturilor de 2 ori / săptămână pentru a surprinde în dinamică aspectele caracteristice coloniilor de dermatofiţi. se va verifica obligatoriu puritatea acesteia deoarece contaminarea bacteriană este indezirabilă în acţiunea ulterioară de identificare a speciei.2. organe nodulare.1. agar peptonă 3%. Cu cât numărul punctelor de însămânţare pozitivate este mai mare. 4. timp de cca. Importante din punct de vedere diagnostic sunt viteza de creştere. În acest scop. 103 Capitolul 4   . conform schemei prezentate în fig. Tehnici speciale 4. cu atât implicarea clinică a tulpinii izolate este mai sigură.Mihai Mareş. pe suprafaţa unui Agar Sabouraud cu cloramfenicol în vederea obţinerii coloniilor purificate. nr. se epuizează 0. Tehnica de purificare a izolatelor levurice După obţinerea primoculturii. 4 săptămâni. PDA. plăcile se vor incuba la 37°C (creştere accelerată). După incubare şi reverificare prin coloraţia Gram.2. se recurge la pasarea tulpinii în bulion Sabouraud aditivat cu acid clorhidric soluţie 1N. candelabre favice. tulpinile se pot pasa pe medii speciale care favorizează producerea macroconidiilor şi pigmentogeneza: mediul Lactrimel (Borelli). al căror rol nu este încă elucidat: hife „în rachetă” sau cu aspect de „tijă de bambus”. fie frotiuri colorate Gram care se examinează la microscop. În cazul prezenţei bacteriilor. Când se suspicionează o infecţie cu T. În cazul absenţei sporulării în primocultură.şi microscopice. hife spiralate (vrile).1 ml din tubul cu numărul maxim de picături de HCl care a permis dezvoltarea levurilor. Este posibilă şi însămânţarea prin înglobarea prelevatului în mediul de cultură. se pregătesc fie preparate între lamă şi lamelă. Olimpia Bazgan clinică tulpinii izolate. 4-2. celule osiforme (aspect de „ganteră”). însă interpretarea semnificaţiei clinice devine mai dificilă.

Purificarea izolatelor levurice – metodologie de lucru 104 . nr.Tehnici de însămânţare şi transplantare Fig. 4-2.

Olimpia Bazgan 4. catalaza. artrospori. Miceliul va creşte peste lamelă. asimilarea diverselor surse de carbon sau azot. nr. mediul nu se acoperă cu lamelă. 105 Capitolul 4   . forma şi mărimea pseudohifelor.Mihai Mareş. 4. Tehnica de lucru: se pregătesc plăci Petri cu o grosime a mediului de 4-5 mm (cca. ele se coroborează obligatoriu cu rezultatele profilului biochimic al tulpinii în cauză (fermentarea zaharurilor.2. 4-3). după însămânţare. Alternativ. Porţiunea de agar astfel însămânţată se acoperă cu o lamelă sterilizată. nr. aceste formaţiuni apar sau nu şi prezintă anumite caracteristici utile identificării. iar pentru examinare se prelevează cu ajutorul ansei un bloc de geloză de pe linia de însămânţare şi se etalează prin strivire între lamă şi lamelă.5 cm. fenol-oxidaza. clamidospori. modul de dispunere a blastosporilor (blastoconidiilor) de-a lungul acestora. de obicei.3. pseudohife (pseudofilamente). Tehnica de cultivare pe suporturi transparente Metoda constă în plasarea unei lamele sterilizate pe suprafaţa gelozei. ansa se menţine înclinată sub o incidenţă de cca. cu ajutorul ansei microbiologice cu care s-a prelevat în prealabil o mică porţiune din colonia levurii de identificat.2. placa Petri se examinează direct la microscop. foarte aproape de colonia activă. după solidificare. 25-30 ml mediu / placă cu ø 90 mm). după cum urmează: primele două – paralele între ele. 60°-70° faţă de orizontală. Tehnica însămânţării levurilor pe CMA (cultivare submersă). producerea unor enzime ca ureaza. care la un anumit interval de timp poate fi ridicată şi examinată la microscop. la distanţă de cca. se practică 3 „incizii” ale mediului. Se examinează apoi la microscop. ascospori. hexozaminidaza. În funcţie de gen şi specie. Fig. Rezultatele acestui test pot fi doar rareori utilizate singular. 1-1.2. filamente (hife). În timpul însămânţării mediului. formaţiunile dezvoltate în mediu fiind observabile prin traversul lamelei. fără colorare suplimentară. levurile îşi exprimă plenar toate detaliile morfologice: blastospori. După o incubare de 48-72-96 ore la 25°C-30°C. urmărindu-se prezenţa clamidosporilor. apoi o aIIIa – perpendiculară pe celelalte (fig. L-prolin-aminopeptidaza. Tehnica însămânţării levurilor pe Agarul cu făină de porumb şi tween 80 (metoda Dalmau) Prin cultivare submersă pe acest mediu. 4-3.

Fig. Lamela se examinează la microscop după câteva zile de incubaţie. sterilizate prin autoclavare.2. iar după dezvoltarea miceliului. Tehnica de cultivare pe bloc de geloză (cultivarea pe lamă) Cultura pe bloc de geloză (pe lamă) este recomandată pentru studierea în dinamică a morfologiei structurilor de fructificare (generatoare de conidii) la fungii filamenoşi septaţi (nu însă la cei din genurile Aspergillus şi Penicillium). Lamela de sticlă se flambează şi în zona centrală se depune o picătură de bulion Sabouraud. În acest scop. pelicula de celofan se montează pe lamă şi se examinează la microscop. 5 ml apă distilată). 4. se obţin prin adăugare de lactofenol şi montare.4. 4. 4-4. fapt constatat în urma examinării microscopice.Tehnici de însămânţare şi transplantare În locul lamelelor se pot folosi pătrate de celofan de mărimea lamelelor. După însămânţare. până la apariţia pe lamă a structurilor de fructificare cu morfologie caracteristică. nr. respectiv lamelă. În interiorul inelului de sticlă se pune o picătură de apă distilată sterilizată.5 cm etalat pe o lamă de sticlă. Marginea superioară a inelului de sticlă se gresează cu lanolină. se trece prin flacără pentru sterilizare şi se aplică apoi lamela cu picătura însămânţată în jos. în care se însămânţează materialul de cercetat. acesta se acoperă cu o lamelă. 4-4) se incubează la 25°30°C. iar lama se aşează pe o baghetă de sticlă în formă de „U” plasată într-o cameră umedă (de fapt. blocul de geloză se îndepărtează. Aceste două preparate obţinute se pot păstra. iar din lamă. Camera umedă (fig. În final. fungul de identificat se însămânţează în două puncte opuse ale unui bloc de geloză (PDA) de 1 x 1 x 0. un timp variabil.5. 106 . nr. timp de aproximativ cinci ani. Cameră umedă pentru cultivarea fungilor pe bloc de geloză. două preparate extemporanee.2. dacă vor fi lutate. Tehnica de cultivare în „picătură suspendată” Inele de sticlă cu diametrul de 2 cm şi înălţimea de 1 cm se imersează în parafină topită şi imediat se aşează pe o lamă de sticlă sterilizată. o placă Petri ce conţine un fragment de hârtie de filtru umectat cu cca. Inoculul se depune în mijlocul pătratului de celofan.

Olimpia Bazgan 4.Mihai Mareş. transplantarea se face cu ansa sau cu o microspatulă. se introduce ansa sterilizată în cultura veche. din care se însămânţează câteva picături în mediul lichid şi câteva picături pe suprafaţa mediului solid. Agar cu extract de malţ etc. În cazul transplantării cu ansa. Acest material biologic se transferă pe bulion şi pe un mediu agarizat (Agar Sabouraud. apoi se face însămânţarea pe mediile proaspete (întâi pe mediul lichid şi apoi în trei puncte pe mediul solid). 107 Capitolul 4   . Cu pipeta Pasteur se recoltează o cantitate din cultura veche.3. Din culturile pe medii solide.). Agar Czapek – Dox. luând o cantitate redusă de miceliu de la periferia coloniei vechi. Tehnici de transplantare Prin transplantări sau pasaje se urmăreşte izolarea în stare pură a fungilor de interes medical din culturile mixte sau menţinerea lor în timp. PDA. Din culturile pe medii lichide. în condiţii de laborator (tulpini de colecţie) şi obţinerea de colonii monosporale. recoltarea materialului de transplantat se poate face cu pipeta Pasteur sau cu ansa de însămânţare.

Grillot R (1996) . Ed. Vanover-Sams C L.Tratat de microbiologie clinică. Constantinescu O (1974) . Midgley G. 13(2): 236-301. 2. Ribes J A. Ed. Ed. 4.Metode şi tehnici în micologie. Bucureşti. Viaţa Medicală Românească. 2(13):236-301. Bucureşti. Iaşi. Col Rev. Elsevier. Ed.Atlas of clinical fungi. Antonie van Leeuwenhoek. vol. 10. 3. Baker D J (2000)– Zygomycetes in Human Disease. 5. Baker D J (2000) . Centraalbureau voor Schimmelcultures / Universitat Rovira i Virgili.Diagnostic de laborator şi igiena alimentelor de origine animală. 2nd edition. Iaşi. Col Rev . Ribes J A. Figueras M J (2000) . Bazgan O (1999) . Ed. Moldogrup. 69:337-355. Gené J. Coman I. Medicală.Micologie medicală aplicată. Bucureşti. Guarro J. Mareş M (2000) . Guillot J (1996) . Golăescu M (1997) . 108 .Tehnici de însămânţare şi transplantare Bibliografie selectivă 1.Les mycoses humaines démarche diagnostique. Paris.The genus Malassezia with description of four new species. 6. Buiuc D. 9. Guého E. Junimea.Diagnosticul şi tratamentul micozelor interne. 7. Hoog G S de. Vanover-Sams C L. Ceres. 8. Neguţ M (1999) .Zygomycetes in Human Disease.

este importantă cantitatea de material biologic prelevat din colonie. x40. mai ales în cazul levurilor din primoculturi. . se depune o picătură de lactofenol cu albastru de anilină în care se va suspensiona apoi cu mişcări cât mai fine. Olimpia Bazgan   . aranjarea (îmbinarea) conidioforilor şi a sporangioforilor. pe o lamă de microscopie curată şi degresată. forma.fungi filamentoşi – preparate extemporanee cu lactofenol şi albastru de anilină. preparate cu bandă adezivă sau preparate obţinute prin cultivare pe lamă. stoloni. ascospori.Aspectul miceliului . în funcţie de tipul acestora: .) sau preparate extemporanee (între lamă şi lamelă) cu tuş de India sau lactofenol şi albastru de anilină. 5. cu ajutorul unei anse microbiologice. însă este uneori preferată pentru expeditivitatea sa. aceasta trebuie să fie cat mai redusă. .Prezenţa şi tipul unor structuri particulare: rizoizi. Preparatul extemporaneu cu lactofenol şi albastru de anilină (levuri) Este o metodă mai rar utilizată pentru studierea morfologiei levurilor. Suspensia astfel obţinută se acoperă cu o lamelă şi se examinează la microscop (x10. . 109 Capitolul 5 Mihai Mareş.septate sau nu. incolor.zigospori. x100 – după caz).Aspectul hifelor .difuz. mărimea şi eventuala septare a sporului.levuri .Prezenţa şi tipul sporilor sexuaţi . În acest scop. . colorat. Pentru reuşita preparatului. Olimpia Bazgan 5 E Tehnici de examinare microscopică a fungilor din culturi xamenul microscopic al fragmentelor de colonii fungice urmăreşte: .frotiuri (colorate Gram. x20. gros. culoarea. . astfel încât densitatea suspensiei obţinute să fie mică. o mică porţiune din colonia levurică de studiat. celule Hülle.Mihai Mareş.1. cu albastru de metilen etc. scleroţi. Pentru studiul morfologiei microscopice a fungilor obţinuţi în urma însămânţării prelevatelor se utilizează mai multe tehnici.Prezenţa corpilor fructificanţi asexuaţi (tipul şi aspectul sistemului sporal.

2.se prelevează cu ajutorul unui ac sau al unei microspatule metalice un fragment de dimensiuni milimetrice din colonia de examinat. prelevarea structurilor fungice de la nivelul coloniilor se face cu ajutorul unui fragment de bandă adezivă transparentă (tip scotch). lamă scotch lamelă 180° Fig. se presează.în cazul în care se doreşte păstrarea preparatului în lamotecă. . 5.5 x 2. utilizând două ace. peste bandă se pot etala o nouă picătură de lactofenol şi apoi o lamelă. Penicillium spp.0 cm. 5-2.3.se examinează la microscop. x40. .se acoperă cu o lamelă curată. x20.) se recomandă pregătirea a 2-3 preparate cu bandă adezivă din acelaşi loc – prima va fixa sporii. în vederea ameliorării vizibilităţii la examinarea microscopică ulterioară. . Obţinerea preparatului extemporaneu cu bandă adezivă 110 . cu care se amprentează marginea coloniei. iar următoarele vor recolta conidioforii. pentru conservarea sa. nr. 5-1 vezi Anexa). se încălzeşte uşor la flacără pentru a obţine un film cât mai fin de lactofenol şi a elimina eventualele bule de gaz. Opţional. În cazul coloniilor care sporulează intens (Aspergillus spp.0-1. 5-2).5-3. acesta se poate luta (fig. Preparatul extemporaneu cu bandă adezivă În acest caz.. nr. eventual x100. astfel încât prin examinarea ulterioară să fie surprinse toate aspectele utile încadrării taxonomice. . Preparatul extemporaneu cu lactofenol şi albastru de anilină (fungi filamentoşi) Se obţine parcurgând următoarele etape: . nr. cu dimensiuni de 1. Acest fragment de bandă adezivă se lipeşte apoi pe o lamă pe care s-a etalat în prealabil o picătură de lactofenol (fig. folosind succesiv obiectivele x10.Tehnici de examinare microscopică a fungilor din culturi 5.se depune o picătură de lactofenol pe o lamă de microscopie. se etalează în picătura de lactofenol şi se dilacerează cu mişcări fine miceliul. curată şi degresată. etc.

. Lutarea preparatelor extemporanee Etanşarea sau lutarea preparatelor este necesară pentru a evita evaporarea lichidului de montare... 20... Amestecul de ceară galbenă de albine şi colofoniu 20 g ceară de albine se topesc într-o capsulă de porţelan.... Se îndepărtează excesul de lichid de montare de pe lamă şi lamelă...... Preparatul se roteşte apoi cu 180° pentru a-l aduce în poziţia de examinare. 4.... pe care se aplică substanţele de etanşare..... Amestecul se aplică cu o spatulă pe marginile lamei şi lamelei montate... balsamul de Canada...4.. guma arabică.ulei polimerizat . Răşinile naturale Se pot folosi pentru lutare colofoniul.. Cu un penson se aplică un strat subţire de lac peste marginea lamelei şi suprafaţa lamei din imediata apropiere a acesteia. Prin acest procedeu. Se foloseşte similar cu celelalte lichide de lutare. Se lasă să se usuce.....41 ml .. cunoscut sub denumirea de „Glyceel” este format din: . apoi se adaugă treptat 80 g colofoniu şi se încălzesc până la topirea completă... 111 Capitolul 5   .. Lacul pentru unghii este cel mai utilizat la etanşarea preparatelor deoarece se usucă repede şi se manipulează uşor.Mihai Mareş.. 5.. trebuie să fie perfect uscate şi curate. Substanţele folosite la etanşare nu trebuie să reacţioneze cu lichidul de montare. respectiv 40%) Se omogenizează prin topire.toluen (fără sulf) ..75 ml ...... Suprafeţele lamei şi lamelei...41 ml Glyceelul este un lichid siropos... se lichefiază cu ajutorul aplicatorului încălzit la flacără... Înainte de fiecare folosire. prin ştergere cu un fragment de hârtie de filtru.. se usucă repede.acetat de butil . În momentul folosirii..alcool metilic industrial .. apoi se distribuie în plăci Petri şi se lasă la solidificare.. nu şi banda scotch ca în tehnicile anterioare. şerlacul... elastice.. Olimpia Bazgan O altă variantă a tehnicii presupune etalarea fragmentului de bandă adezivă pe o lamelă cu o picătură de lactofenol........ apoi se poate stoca.. persisente şi să adere de suprafaţa sticlei.. claritatea imaginii este maximă datorită faptului că între ochiul examinatorului şi structurile fungice se interpune doar lamela.. rezistentă şi care aderă bine de sticlă.... incolor.... amestecul se retopeşte... 20..........76 ml .... Amestecul de colofoniu şi lanolină (60%. 31. să fie impermeabile.... adăugarea peste aceasta a unei alte picături de colorant şi apoi a lamei de microscopie.. formând o peliculă elastică.. Cimentul Thorner...

Bucureşti. J Clin Microbiol. Ed.Diagnostic de laborator şi igiena alimentelor de origine animală. Medicală.Metode şi tehnici în micologie. Coman I. Mareş M (2000) . Figueras M J (2000) . 5. Moldogrup.Diagnosticul şi tratamentul micozelor interne. Ceres.Micologie medicală aplicată. Bucureşti. Ed. Centraalbureau voor Schimmelcultures / Universitat Rovira i Virgili. Iaşi. Constantinescu O (1974) . Junimea. 3. Bazgan O (1999) . Neguţ M (1999) . 6. 7. 2. Golăescu M (1997) . Viaţa Medicală Românească. Guarro J.Tehnici de examinare microscopică a fungilor din culturi Bibliografie selectivă 1. 4. low-distortion tape touch method for fungal mounts. Buiuc D. Iaşi. 112 . Gené J. Ed.Safe. Ed.Tratat de microbiologie clinică. Harris J (2000) . Ed. 2nd edition. 38(12):4683-4684. Hoog G S de.Atlas of clinical fungi. Bucureşti.

casetele sunt plasate într-un fixator. 6. care se vor folosi în funcţie de tipul de ţesut. unde vor sta pe toată durata procesării iniţiale. 113 Capitolul 6 ragmentele de ţesut recoltate de la pacient în vederea diagnosticului trebuie procesate în laboratorul de histopatologie pentru a obţine preparate permanente care vor fi examinate microscopic de către morfopatolog. Iniţial.Petru Cazacu 6 F Tehnici de histopatologie Petru Cazacu 6. Fixarea Fixarea are scopul de a conserva morfologia ţesuturilor aşa cum se prezintă ea în momentul recoltării. prin exereză chirurgicală şi prin autopsie.2. deşi formaldehida este considerată aproape un „gold standard”. până în momentul includerii în parafină. precum şi descrierea zonei de origine a fragmentului de ţesut. Procesarea ţesuturilor în vederea diagnosticului histopatologic presupune o suită de operaţiuni şi tehnici care vor permite vizualizarea elementelor fungice intratisulare şi / sau a leziunilor specifice determinate de acestea.   . Probelor primite li se va atribui un număr care va identifica fiecare probă pentru fiecare pacient. Fixarea trebuie realizată cât mai curând posibil după prelevarea probelor de ţesut pentru a preveni autoliza. Acest număr va corespunde cu numărul de ordine din registrul laboratorului.3. Fragmentele de ţesut pot fi recoltate prin biopsie. Nu există un fixator perfect. 6.1. Există o varietate de fixatori. Examenul macroscopic Examinarea macroscopică constă în descrierea probelor. Obţinerea probelor Probele de ţesut primite în laboratorul de histopatologie trebuie să fie însoţite de un formular de cerere a examenului de laborator în care vor fi specificate datele pacientului şi istoricul bolii. alegerea zonelor relevante pentru diagnostic şi introducerea lor (totală sau parţială) în mici casete din plastic.

fixatorul Bouin şi fixatorul Hollande. se vor umezi cu ser fiziologic. Creşterea temperaturii. Formolul este utilizat pentru toate ţesuturile recoltate chirurgical şi necropsic. De asemenea. O posibilitate de a rezolva acest inconvenient este secţionarea cât mai fină a ţesuturilor (2-3 mm grosime). Aciditatea favorizează formarea de pigment hem . Formolul şi alcoolul penetrează foarte bine. iar glutaraldehida foarte prost. ca în cazul tuturor reacţiilor chimice. volumul fixatorului. -penetrarea. Formolul este cel mai activ la 10%. După fixare.Tehnici de histopatologie Factorii care influenţează procesul fixării: -soluţia-tampon. Formolul este cel mai puţin pretenţios dintre toţi fixatorii atunci când condiţiile de fixare nu sunt cele ideale. Datorită hipoxiei ţesuturilor. Penetrarea ţesuturilor depinde de difuzibilitatea fiecărui fixator. când se doreşte obţinerea unor preparate colorate H-E. fixatorul trebuie să aibă capacitatea de a tampona aciditatea acestora prevenind dehiscenţa lizozomală şi autoliza tisulară consecutivă acesteia. Pentru fixarea ţesuturilor în vederea procesării lor pentru diagnosticul histopatologic al micozelor profunde se folosesc frecvent următorii fixatori: soluţia de formol 10% tamponată pH 6. adică între 6 şi 8. Volumul de fixator este de asemenea extrem de important. cocodilatul de sodiu şi veronalul. el dăunând aproape neglijabil ţesutului respectiv. va creşte viteza de fixare. dar se va avea totuşi în vedere să nu degradeze ţesuturile. Fixarea trebuie realizată la un pH aproape de neutralitate. -intervalul de timp. Formolul comercial este o soluţie de formaldehidă în tampon fosfat cu pH 7. -volumul piesei vs. probele vor fi prelucrate rapid deoarece prin deshidratare se vor produce artefacte. Acesta trebuie să fie în raport de 10:1 (fixator-ţesut). Agitarea probelor în fixator va intensifica fixarea. -concentraţia fixatorului. deoarece penetrarea unei secţiuni subţiri va fi mult mai rapidă decât cea a unei secţiuni mai groase. Formolul fierbinte va fixa ţesuturile mai repede şi acesta este adesea primul pas în procesarea automatizată a ţesuturilor. bicarbonatul de sodiu. Se recomandă schimbarea fixatorului la diferite intervale de timp pentru a evita o eventuală scădere a volumului acestuia. glutaraldehida este în general activă la concentraţii de 0.8. foarte important este intervalul de timp recomandat pentru menţinerea probelor în afara fixatorului. Ceilalţi fixatori au un grad intermediar de penetrabilitate tisulară. Concentraţia fixatorului va fi cea mai redusă concentraţie activă. Ţesuturile menţinute temporar în afara vasului cu fixator.25-4%. Concentraţiile prea ridicate pot avea efect advers asupra ţesuturilor producând artefacte asemănătoare cu cele ale creşterii temperaturii fixatorului.formol care apare colorat în negru. Pentru fixarea frotiurilor 114 . prin depuneri polarizate în ţesuturi. Soluţiile-tampon includ fosfatul de sodiu. Tipul fixatorului indicat este dat de tipul de ţesut şi de detaliile histologice care urmează a fi vizualizate. acest fapt reprezentând şi un avantaj economic. -temperatura.

.5 mg Formaldehidă 37%.. Fixativii de păr (e. Tehnica fixării 1.. Probele pot fi păstrate în formol 10% indefinit sau sunt transferate în etanol 70%..g. Este toxică prin ingestie şi inhalare.... 4.0 ml Se omogenizează..... Timpul de fixare Fragmentele biopsice ar trebui fixate timp de minim 1-4 ore... Deoarece frotiurile nu sunt groase.1.. Distanţa optimă de pulverizare a fixatorilor este de 25-30 cm. Formol soluţie 10% tamponată pH 6... înaintea colorării.. acestea nu prezintă inconvenientul friabilităţii........ 6.0 mg Fosfat de sodiu dibazic ..........8 Scop Este un fixator larg utilizat....Petru Cazacu 6. Note: 1. Diaphine Spray)... Parafinele şi uleiurile din spray-urile fixative de păr modifică reacţiile de colorare dacă nu sunt îndepărtate adecvat.. 3... Alături de imersie.. 100. Piesele recoltate de chirurgi sunt păstrate în acest tip de fixator. Un timp mai îndelungat se recomandă pentru piesele mai mari......0 ml Apă distilată .... Se lucrează într-un spaţiu ventilat...... Alcoolii sunt fixatori rapizi şi ieftini.. Este sensibilizantă (prin contact) pentru piele şi aparatul respirator.. 900......... ............... etanolul 90% şi acidul cromic 5%.8 Reactivi Fosfat de sodiu monobazic ... cu un conţinut ridicat de alcool şi un minimum de lanolină sau ulei.. Are 115 Capitolul 6   citologice cu importanţă în diagnosticul micologic se folosesc: metanolul absolut.. cu pH 6. mănuşi şi halat.3.. Fixatorii care se pulverizează sunt compuşi dintr-un alcool care fixează celulele şi parafină care formează un strat protector subţire peste acestea (Carbowax .. Primele două staţii ale tuturor procesatoarelor de ţesuturi conţin formol 10%. Astfel........conţine polietilenglicol).... Alcoolii nu se recomandă pentru fixarea frotiurilor obţinute din fluide biologice sau patologice. apoi se etichetează şi se datează..................... Formaldehida este puternic iritantă pentru ochi şi piele. 2. sunt de asemenea fixatori eficace... fixarea frotiurilor se poate realiza şi prin pulverizarea fixatorului peste frotiu.... Atenţie! Carcinogen.. Se vor purta ochelari de protecţie.. Fixarea cu fixatori aerosolizabili nu este recomandată pentru frotiurile de sânge sau a celor executate din lichide hemoragice pentru că determină clumping eritrocitar (aglutinare)......... acestea nu pun probleme de contractare şi întrucât frotiurile nu sunt secţiuni... lamele trebuie menţinute peste noapte în etanol 95% pentru a îndepărta fixatorul de acoperire........ 2..

. Este sensibilizantă prin contact....0 ml Formaldehidă ..... halat şi ochelari de protecţie... iar probele de dimensiuni mari pot rămâne în fixator până la trei zile. pentru piele şi aparatul respirator. Se îndepărtează acidul picric din ţesut înainte de colorare prin: a) spălare cu apă de robinet....Tehnici de histopatologie acţiune corozivă şi FORMALDEHIDĂ! carcinogenă.. Note: 1.. 2. Fixatorul Bouin Scop Se utilizează pentru fixarea pieselor biopsice. Timpul de fixare Probele biopsice de dimensiuni mici....3............ de asemenea este un mordantant în diferite tehnici de colorare.. 1000...0 ml Atenţie! Soluţia este carcinogenă.. Are acţiune corozivă şi carcinogenă... Formaldehida este puternic iritantă pentru ochi şi piele...2. Se etichetează cu inscripţia: ATENŢIE 6. Este toxic de contact. Reactivi Acid picric saturat.... 116 ...... 2-4 ore.. Se etichetează cu inscripţia: ATENŢIE FORMALDEHIDĂ! 4. 2.... iritantă şi toxică. Acidul picric lizează hematiile. b) tratare cu etanol 50%.... 200..... Este toxică prin ingestie şi inhalare.. c) sau soluţie saturată de etanol 70% cu carbonat de litiu... Fixatorul Hollande Scop Acest fixator conferă o strălucire coloraţiilor care utilizează hematoxilină eozină şi reduce consistenţa ţesuturilor evitând astfel obţinerea unor secţiuni casante... Ţesuturile fixate pot rămâne în formol 10% sau etanol 70%..3.......... Este coroziv........ Se evită contactul şi inhalarea. Se lucrează în spaţii bine ventilate. se vor purta mănuşi... Tehnica fixării 1........3...... 6. 3.. 3000. Acidul picric poate deveni exploziv dacă se usucă........0 ml Acid acetic glacial ........... Acidul acetic: aparatul respirator este organul ţintă afectat....

Petru Cazacu

Reactivi Acetat de cupru .............................................. 75 mg Apă distilată ................................................ 3000 ml Acid picric ................................................... 120 mg Formaldehidă ................................................ 300 ml Acid acetic glacial .......................................... 45 ml Se dizolvă acetatul de cupru în apă fără încălzire, apoi se adaugă treptat acidul picric. Se amestecă până se dizolvă complet. Se adaugă formaldehida şi acidul acetic. Se etichetează şi se datează. Atenţie! Soluţia este carcinogenă, iritantă şi corozivă. Timpul de fixare Probele de dimensiuni mici 2-4 ore, iar cele mai mari până la 3 zile. Tehnica fixării 1. Probele biopsice sunt imersate imediat în fixatorul Hollande, notându-se timpul pe recipient; 2. Când fixarea este completă, proba de ţesut se trece apoi în etanol 70%; 3. Nu se permite ca probele fixate cu Hollande să vină în contact cu soluţia de formol 10%, deoarece poate determina apariţia unui precipitat albastru.
Note: 1. Se lucrează într-un spaţiu bine ventilat sau în nişa chimică, se poartă mănuşi, halat şi ochelari de protecţie. Se evită contactul şi inhalarea. 2. Acidul picric poate exploda dacă se usucă. Este toxic prin expunere cutanată. 3. Formaldehida este iritantă puternic pentru ochi şi piele. Este toxică prin ingestie şi inhalare. Afectează aparatul respirator. Este corozivă şi carcinogenă. Se etichetează cu: ATENŢIE FORMALDEHIDĂ ! 4. Acidul acetic afectează aparatul respirator. Este coroziv.

6.4. Procesarea ţesuturilor Odată ce ţesuturile au fost fixate, ele trebuie înglobate într-o formă care să permită manipularea şi efectuarea unor secţiuni seriate foarte subţiri. Cel mai folosit material în acest scop este parafina. Ţesuturile incluse în parafină pot fi secţionate în fragmente cu grosimi de la 3 la 10 µm, uzual 4-6 µm. Tehnica de includere în parafină a ţesuturilor fixate se numeşte „Procesarea ţesuturilor”. Paşii principali ai acestui proces sunt deshidratarea şi clarificarea. - Ţesuturile fixate umed (în soluţii apoase) nu pot fi direct impregnate cu parafină deoarece aceasta nu este miscibilă cu apa. De aceea, ţesuturile trebuie deshidratate. Aceasta se realizează de obicei cu ajutorul unor soluţii de etanol, de concentraţii crescânde - 70%, 95% şi 100%. Uneori, primul pas este tratarea cu un amestec format din formol şi etanol. Pot fi utilizaţi şi alţi deshidratanţi, dar unii prezintă dezavantaje majore: acetona deşi este foarte rapidă, este inflamabilă, de aceea se poate utiliza doar pentru mici seturi de ţesuturi
117

Capitolul 6

 

Tehnici de histopatologie

procesate manual. Dioxanul poate fi utilizat fără clarificare, dar vaporii săi sunt toxici. - Etapa următoare se numeşte „Clarificare” şi constă în îndepărtarea deshidratantului cu o substanţă care va fi miscibilă cu mediul de includere (adică cu parafina). Xilenul este agentul de clarificare cel mai frecvent întrebuinţat. Toluenul clarifică bine şi este mult mai tolerant faţă de cantităţile mici de apă rămase în ţesuturi, dar este de 3 ori mai costisitor decât xilenul. Cloroformul acţionează lent şi este periculos pentru cei care-l manipulează. Salicilatul de metil este rar utilizat datorită costului ridicat. În final, proba de ţesut este impregnată cu agentul de includere care aproape întotdeauna este parafina. Parafina poate avea diferite puncte de topire, ceea ce permite obţinerea unor grade variate de duritate. Un produs numit Paraplast conţine un adaos de plastifianţi care fac ca blocurile de parafină să fie mai uşor de procesat de către tehnologi în vederea secţionării. Pentru a asigura o mai bună penetrare a ţesutului de către agentul de includere, în interiorul procesatorului de ţesuturi se poate crea o presiune negativă cu ajutorul unei pompe de vacuum. Procedurile de mai sus sunt aproape întotdeauna automatizate pentru un volum mare de probe ce trebuie procesate de rutină. Automatizarea constă într-un dispozitiv circular, programabil, care imersează succesiv probele de ţesut în diferite băi de deshidratare şi clarificare, după o scală de timp presetată. După procesarea probelor în procesatorul de ţesuturi, acestea sunt încă în casete, urmând a fi incluse în parafină lichidă. Procesul este foarte important deoarece ţesuturile trebuie orientate corespunzător în momentul includerii pentru a asigura obţinerea ulterioară a unor secţiuni de calitate. O alternativă pentru includerea în parafină este folosirea diverselor mase plastice care permit obţinerea unor secţiuni subţiri. Astfel de mase plastice sunt meta-acrilatul de metil, meta-acrilatul glicol şi eponul. Materialele plastice necesită reactivi speciali pentru deshidratare şi clarificare, de obicei foarte costisitori. Pentru secţionarea acestor blocuri este necesar un microtom special. Blocurile trebuie să fie mici, tehnica pretându-se de exemplu pentru biopsiile hepatice sau cerebrale. 6.4.1. Deshidratarea 1. Dacă piesa de ţesut a fost imersată în apă după scoaterea din fixator, ea trebuie să fie transferată în etanol 30%, 1-2 ore; 2. Etanol 50%, 1-2 ore; 3. Etanol 70%, 1-2 ore; 4. Etanol 95%, 1-2 ore; 5. Etanol 100%, 1-2 ore; 6. Etanol 100%, 1-2 ore; 7. Ţesuturile deshidratate vor fi pregătite pentru clarificare, adică se scot piesele histologice din etanol şi se trec în toluen.
Notă: Etanolul absolut produce o deshidratare foarte rapidă a ţesuturilor: pentru a avea această siguranţă, flacoanele cu etanol se vor păstra închise etanş. 118

Petru Cazacu

6.4.2. Clarificarea 1. Se transferă piesele histologice din etanol 100% într-un amestec constituit din o parte toluen şi 3 părţi etanol 100%, 1 oră; 2. Se trec apoi în amestecul de 1:1 toluen-etanol 100%, 1 oră; 3. Apoi în amestecul de 3:1 toluen-etanol 100%, 1 oră; 4. Toluen 100%, 3-4 ore; 5. Toluen 100%, 3-4 ore; 6. După clarificare, ţesuturile sunt gata pentru impregnare cu parafină.
Notă: Agenţii de clarificare, cum ar fi etanolul, trebuie introduşi lent pentru a preveni degradarea ţesuturilor. Aceste amestecuri de toluen şi etanol permit în plus şi îndepărtarea oricăror urme de apă. Flacoanele se închid etanş. Apariţia unei turbidităţi a soluţiilor sau a unor pete opace pe ţesuturi sunt indicatori siguri ai deshidratării incomplete. În ambele cazuri, lamele cu secţiuni se reintroduc în etanol 100% pentru o deshidratare suplimentară, apoi se continuă cu băile de toluen - etanol. Insuficienta îndepărtare a alcoolului va determina imposibilitatea impregnării cu parafină în zonele respective ale ţesutului, ceea ce va produce dificultăţi de secţionare. Actualmente, există numeroşi agenţi de clarificare disponibili comercial (Histosolve, Americlear etc.) care sunt mai puţin toxici şi au un miros mai plăcut decât toluenul sau xilenul.

6.4.3. Impregnarea cu parafină 1. Se transferă ţesuturile din agentul de clarificare într-un nou flacon cu un amestec preîncălzit de parafină - toluen 1:2. Se acoperă etanş flaconul şi se lasă la etuvă, la 45ºC, timp de 1 oră; 2. Se transferă ţesuturile într-un al doilea flacon care conţine un amestec încălzit de parafină - toluen 1:2. Se acoperă flaconul şi se meţine la 45ºC timp de 1 oră; 3. Se transferă piesele apoi în prima baie de parafină pură. Aceasta este un flacon cu parafină lichidă care se menţine în etuvă setând o temperatură superioară punctului de topire al parafinei. Piesele se menţin în această baie timp de 2-4 ore; 4. Se transferă piesele în a doua baie de parafină, unde se menţin încă 2-4 ore; 5. Se includ (pasul următor).
Notă: O alternativă a metodei de impregnare: 1. Se introduce piesa histologică în agentul clarificator proaspăt şi apoi se adaugă parafină până la saturarea clarificatorului. Se lasă în repaus 1 oră la 30ºC – 60ºC, apoi se mai adaugă parafină şi se lasă peste noapte. În dimineaţa următoare, se adaugă parafină până când amestecul conţine aproximativ 75 % parafină, apoi se menţine 1 oră la 45ºC. 2. Se trece piesa apoi direct prin 2 băi de parafină pură.

119

Capitolul 6

 

Tehnici de histopatologie

6.4.4. Includerea 1. Se lubrifiază interiorul barelor Leuckart, al sticlelor de ceas sau al diferitelor tăviţe metalice cu un amestec de etanol 60% - glicerină 9:1. Acesta va preveni aderarea parafinei la recipientul ce constituie forma de turnare a blocurilor. Acest lucru nu este necesar dacă se utilizează matriţe de hârtie. 2. Se răceşte matriţa prin menţinerea părţii sale inferioare pe gheaţă câteva minute. 3. Se scoate recipientul cu parafină topită din etuvă şi se varsă în matriţă. 4. Se introduce ţesutul în matriţă cu ajutorul unei pense hemostatice încălzite şi se verifică dacă piesa a fost orientată corect. În funcţie de dimensiunea matriţei, se pot include simultan mai multe piese (1-10) obţinându-se un număr echivalent de blocuri. Etichetele din hârtie sunt ataşate în parafină, la marginea matriţei, în dreptul piesei histologice. 6.4.5. Secţionarea După includere, ţesuturile trebuie secţionate pentru a putea fi etalate pe lamă. Secţionarea se realizează cu un microtom, la grosimi de 4-6 µm. Pentru realizarea unor secţiuni corespunzătoare este necesar ca lama cuţitului să fie perfect ascuţită; se preferă utilizarea cuţitelor single use. Odată obţinute secţiunile, acestea se depun pe suprafaţa apei dintr-o baie de apă preîncălzită, fapt care ajută la deplierea panglicii secţionate. Fragmentele de panglică sunt recuperate cu ajutorul unei lame de microscopie. Lama cu secţiunea etalată este apoi plasată într-o etuvă timp de aproximativ 15 minute pentru ca, prin topirea parţială a parafinei, secţiunile să adere mai bine la lamă. 1. Blocurile de parafină cu piesele incluse, se secţionează rectangular pe lângă ţesut, lăsându-se câţiva milimetri de parafină pe fiecare faţă a blocului; 2. Urmează o nouă fasonare a blocului cu ajutorul unei lame de ras. Se va îndepărta mai întâi parafina de pe faţa de secţionare la microtom, cât mai aproape de ţesutul din bloc. Următoarele secţionări se vor face pe celelalte feţe ale blocului, în aşa fel ca acestea să devină paralele una cu alta. Se va lăsa suficientă parafină la baza blocului astfel încât acesta să poată fi ataşat la obiectiv. Tăierea bazei blocului se va face în aşa fel încât ea să fie paralelă cu faţa de secţionare; 3. Se ataşează blocul de parafină la discul obiectiv. Se depune un mic fragment de parafină pe discul obiectiv şi se modelează cu o spatulă încălzită prin flambare la un bec de gaz. Se lasă ca stratul de parafină să se răcească, apoi se pregătesc cele două suprafeţe (baza blocului şi suprafaţa obiectului) în vederea aderării prin topirea stratului superficial de parafină (se ating cele două suprafeţe timp de câteva secunde cu spatula bine încălzită). Se presează apoi blocul de parafină pe discul obiectiv şi se lasă în repaus pentru solidificare; 4. Se fixează discul obiectiv cu blocul ataşat în mandrina microtomului, se ajustează poziţia în aşa fel ca blocul să fie paralel cu tăişul cuţitului de microtom; 5. Ajustarea unghiului cuţitului se face prin încercări succesive. Unghiul diedru format de faţa cuţitului şi faţa blocului trebuie să fie de aproximativ 5 grade.
120

Petru Cazacu

6.4.6. Etalarea secţiunilor Albumina Baker Albuş de ou .................................................. 50,0 ml Apă distilată ................................................. 50,0 ml NaCl................................................................. 0,5 g p-hidroxibenzoat de sodiu1 ............................... 0,1g În apa distilată încălzită la 90°C, se dizolvă clorura de sodiu şi conservantul (phidroxibenzoatul de sodiu). După răcire se adaugă albuşul, se centrifughează până când supernatantul devine clar, se filtrează prin vată ori se lasă în repaus până când stratul superior devine clar. Ca adeziv, se utilizează numai supernatantul clar. Pentru o bună conservare, acesta se păstrează la frigider. Albumina Baker diluată Albumină Baker........................................ 4 picături Apă distilată .................................................... 10 ml

1

Moldex, Tegosept, timolul sau salicilatul de sodiu se pot folosi ca substituenţi ai p-hidroxibenzoatului de sodiu. 121

Capitolul 6

6. Se alege grosimea de secţionare (4-6 µm pentru majoritatea ţesuturilor) şi se începe secţionarea cu viteză moderată. Se manevrează panglica rezultată prin înlănţuirea secţiunilor cu ajutorul unui penson, preferabil din păr de cămilă. Se secţionează aproximativ 25 de secţiuni, apoi se îndepărtează panglica de la cuţit şi se depune pe o coală de hârtie colorată în negru. 7. Dacă se vor practica secţiuni mai subţiri (de 2-4 µm) sau dacă ţesutul este dur, se pot obţine rezultate superioare prin răcirea blocului de parafină şi a cuţitului. În acest scop, se ia un cub de gheaţă şi se lasă să se topească în aşa fel ca gheaţa topită să se prelingă peste partea frontală a blocului. Alt cub de gheaţă se pune pe faţa anterioară a cuţitului. Se va folosi un material absorbant (lavete, prosoape de hârtie) pentru colectarea apei rezultate în urma topirii gheţii şi răcirii piesei / cuţitului. Cuburile de gheaţă se vor menţine cca. 1-2 minute, apoi se îndepărtează orice picătură de apă de pe cuţit şi bloc cu ajutorul unui prosop de hârtie şi se începe secţionarea. Răcirea blocului de parafină se poate face şi prin menţinerea sa timp de câteva minute în congelator. 8. Microtomul şi cuţitul de secţionare se toaletează după fiecare utilizare. Niciodată nu se lasă fixat cuţitul în microtom când nu este folosit.

 

Se plasează una sau două secţiuni pe suprafaţa apei într-o baie reglată la o temperatură cu 5-10ºC sub punctul de topire a parafinei. Se lasă lamele cu secţiuni în etuvă peste noapte pentru uscare... Ne vom asigura că secţiunile au fost montate pe faţa lamei cu capătul mat şi nu pe faţa cu capătul lucios.. Excesul se şterge cu pulpa degetului inelar.0 ml Soluţia trebuie încălzită şi corect omogenizată înainte de utilizare. sub secţiune şi folosind un ac de disociere se prinde şi se fixează fragmentul de panglică pe lamă. Se plasează secţiunile pe lamă cu ajutorul unor ace de disociere... Dezlipirea secţiunilor de pe lamă în timpul colorării este o problemă frecvent întâlnită la histotehnicienii debutanţi.......... se adaugă o picătură de adeziv nediluat pe lamă şi se etalează cu pulpa degetului mic prin mişcări circulare.. Se evită contactul degetelor cu suprafaţa lamelor. Procedura 2 1....Tehnici de histopatologie Albumina Baker comercială Adeziv . Secţiunile se plasează pe lama încălzită cu ajutorul unei platine încălzitoare reglată la o temperatură cu aproximativ 5-10ºC sub punctul de topire al parafinei........ Se va prepara extemporaneu.. 3..... Se introduce lama în baie. Degetele vor fi degresate în prealabil cu alcool acidifiat 95 %... 2... Secţiunile nu vor adera la lamă dacă acestea nu sunt complet degresate. menţinând panglica cu secţiuni cu ajutorul unor ace de disociere...... Mod de lucru Procedura 1 1.. 5. Acestea vor pluti la adăugarea câtorva picături de albumină diluată la marginea panglicii.5 ml Apă distilată .... 4....... 122 . Se utilizează lame degresate ca mai sus........ 3. Se transferă lamele cu secţiuni în etuvă...... Se degresează lamele şi lamelele prin imersia lor în alcool acidifiat 95% (1 ml HCl concentrat la 100 ml etanol) şi se şterg energic cu o pânză curată din bumbac..... 2.. 2... după care aceasta se scoate din baie..... Excesul de fluid se va îndepărta prin înclinarea lamei...... 100. fragmentul de panglică va adera la lamă. aceste incidente vor fi rare... Se lasă câteva minute pentru întinderea secţiunilor........... Dacă lamele sunt curate şi secţiunile sunt întotdeauna uscate complet după etalare.. Secţiunile se vor întinde şi netezi rapid...... 4......... la 30-40ºC şi se lasă peste noapte pentru a se asigura deshidratarea completă a acestora..

...4. 100 ml Glicerină ........ Colorarea Procesul de includere în parafină...... în exces ........ 20 g Acid acetic ................................ dar care necesită o execuţie atentă pentru a asigura obţinerea unor rezultate corecte şi uniforme...... celelalte metode de colorare sunt „coloraţii speciale”. aprox.................... folosind diverşi fixatori Tehnica de secţionare Secţiuni cu grosimea de 4-5 µm... Coccidioides........... 6.......... dar şi unele aspecte din cromomicoze. Coloraţia Hemalaun – Eozină Scop Aceasta este cea mai comună coloraţie histologică şi histopatologică utilizată pentru studierea de ansamblu a citoarhitectonicii tisulare..... Tehnicile de colorare sunt diverse şi se selectează în funcţie de abilitatea lor de a colora diferite componente celulare şi ţesuturi....................... Lamele cu secţiuni se deparafinează prin trecerea succesivă în băi de xilen (sau înlocuitori)........ 100 ml Apă distilată . adiaspiromicoză............ trebuie urmat de deparafinarea secţiunilor etalate pe lamă astfel încât să fie permisă penetrarea coloranţilor hidrosolubili....... Hemalaun-Eozină este o metodă de colorare de rutină. timer de laborator Reactivi Hematoxilina Ehrlich (1886) Hematoxilină . Coloraţia de rutină este Hematoxilină-Eosină (HE). 10 ml 123 Capitolul 6   .... Evidenţiază elemente fungice aparţinând genurilor Pneumocystis...........1......... 2 g Etanol 95% ... În cazul micozelor profunde. permite aprecierea leziunilor la nivel microscopic........ comparabile..... Fixator Se obţin rezultate excelente..... din fragmente de ţesut incluse în parafină Echipament Sticlărie de laborator............ ca şi fenomenul Splendore-Hoeppli sau culoarea originală a fungilor dematiacei (pigmentaţi).....7.. pentru că se utilizează în situaţii specifice conform nevoilor de diagnostic............ alcool etilic şi apă......... necesar secţionării pieselor.....4........... Blastomyces.............. 100 ml Alaun de potasiu...... rinosporidioză.............7...........Petru Cazacu 6..... însă are o valoare diagnostică redusă pentru decelarea speciei implicate.

...............................................0 ml Se dizolvă hematoxilina într-o cantitate redusă de apă...... violet).........................0 ml Alaun de potasiu ...... se adaugă 40 ml de acid acetic glacial... 1000 ml Se dizolvă sărurile separat..... Se continuă fierberea până când apare o culoare purpurie intensă (roşu-închis............ 20.... 5..... După răcire..............0 g Apă distilată ........ 3........... apoi alaunul în aproximativ 650 ml de apă distilată.......................... apoi se adaugă acidul acetic glacial şi glicerina.................................. 2...................5 % Etanol 70% ............. 20... 300..................4 g Acid acetic glacial ... Soluţia de albăstrire Scott Sulfat de magneziu ............................... Se amestecă cele două soluţii.................0 ml Alaun de potasiu ............. Se adaugă iodatul de sodiu în soluţie.acid 0........... 700....0 g Etanol 95% .......... 100.............. coloraţia va fi de calitate inferioară..... Soluţia poate fi utilizată imediat şi este stabilă 2-3 luni...........................0 ml HCl ..............0 g Apă distilată ....Tehnici de histopatologie Hematoxilina Harris Hematoxilină ...............0 ml Iodat de sodiu ...... după care aceasta se încălzeşte blând pentru a grăbi oxidarea hematoxilinei................ apoi se introduce recipientul într-o baie de apă până la răcirea completă.......0 g Glicerină ........ 1000 ml Oxid de mercur ......................................5 g Se dizolvă hematoxilina în etanol şi alaunul în apă cu ajutorul căldurii............. Amestecul se aduce la fierbere cât mai repede posibil şi apoi se adaugă oxidul de mercur...........0 g Bicarbonat de sodiu .............. 0............... Alcool .................... aceasta se filtrează.... Se amestecă cele două soluţii şi se completează până la 700 ml............ 50.......... 0....................................................... se filtrează. 50.......................... Când se observă o strălucire aurie a soluţiei. 100............ Soluţia se lasă la răcit pentru o jumătate de oră...5 ml sau 124 ....5 g Apă distilată .... 5................................................................ apoi se amestecă soluţiile şi se adaugă un cristal de timol.... Dacă această strălucire nu apare........................ Hematoxilina Mayer Hematoxilină ...

2.Petru Cazacu HCl .. Se repetă procesul de spălare de aproximativ 6 ori. 4.......... Se adaugă aproximativ 500 ml apă distilată peste precipitat şi se agită până când colorantul se află complet în suspensie...... apoi se lasă în repaus pentru sedimentare...5% pentru a îndepărta excesul de colorant din fond...... Se lasă precipitatul să se stabilizeze şi apoi se decantează supernatantul fluid. 7. 2.. un timp variabil... Se diferenţiază cu alcool ....... apoi se introduc în soluţia de albăstrire Scott pentru 1-2 minute.... Precipitatul rezultat este forma acidă a tetrabromfluoresceinei.. lăsând coloraţi numai nucleii..... 5..... Diferenţiere în alcool absolut până când se obţine o coloraţie optimă.... Colorare cu eozină alcoolică (se lasă lamele cu secţiuni în soluţia de colorare până când acestea sunt uşor supracolorate).. soluţia stoc Eosină Y....0 ml Acid clorhidric concentrat . insolubilă în apă...... 500........................... se va obţine un colorant cu o putere tinctorială mai mare... Se imersează preparatele într-una din soluţiile de hematoxilină. Ponderea pulberii de colorant dizolvate în 100 ml de etanol 95% este de 0.......5 g... Clătire în 2 băi de etanol 95%..alcoolică........... 3 ml Etanol 95% ........... Tehnica de colorare 1....... Tratând eozina astfel..... Se clătesc în apă distilată şi se examinează la microscop....... Deparafinarea şi hidratarea cu apă distilată a secţiunilor....... 3. Se filtrează şi apoi se lasă hârtia de filtru împreună cu colorantul la uscat în etuvă (max.......... 6.. 8........ 60ºC)... până dispar toate urmele de ioni de sodiu şi clor. Eozină Y .... colorantul fiind mult mai stabil în alcool... Secţiunea trebuie să fie supracolorată.... Pentru utilizare se diluează 1:5 în etanol 95%...... Se filtrează şi se stochează într-un recipient transparent cu dop rodat... Se spală lamele cu apă distilată.. 4 ml Se dizolvă eozina (tetrabromfluoresceină de sodiu) în apă şi se adaugă treptat acidul clorhidric care se va combina cu sodiul... Dacă secţiunea este insuficient diferenţiată atunci se repetă paşii 4 şi 5.. 10... 5 minute pentru hematoxilina Harris şi 15 minute pentru hematoxilina Ehrlich. 125 Capitolul 6   ........ conform variantei de hematoxilină întrebuinţate: 5-10 minute pentru hematoxilina Mayer. Clătire cu apă distilată şi apoi reimersare în soluţia de albăstrire Scott pentru încă 1-2 minute....... Spălare în apă de robinet 5-10 minute........ Se reexaminează la microscop şi dacă secţiunile sunt suficient decolorate se continuă cu pasul următor.5 g Apă distilată .. 97 ml Se adaugă acidul clorhidric peste alcool..... solubilă în apă şi alcool... 9....acid 0..........

... cu formă şi dimensiuni similare.. 100 ml Albastru Alcian 8GX ...... ad 100 ml Soluţia este stabilă 1 an.. 12........ Montarea lamelelor cu balsam de Canada.... Este o metodă destul de eficientă pentru diferenţierea criptococilor capsulaţi tipici de alţi patogeni yeast-like. cuptor cu microunde.....8.Tehnici de histopatologie 11......... 3 ml Apă distilată ... Fixator Formol 10% tamponat pH 6. microscop Reactivi Acid acetic 3% Acid acetic glacial ...... pH-metru..... Soluţie Albastru Alcian Acid acetic glacial 3% ..... 6........... Albastru Alcian pH 2.... din fragmente de ţesut incluse în parafină Echipamente Pahare Berzelius.. Se poate utiliza pentru evidenţierea mucopolizaharidelor capsulare la Cryptococcus neoformans..................7............ Bouin sau Hollande Tehnica de secţionare Secţiuni cu grosimea de 4 µm.........5 – pentru mucopolizaharide acide Scop Coloraţia cu Albastru Alcian pune în evidenţă mucopolizaharidele acide....... se poate folosi oricare din soluţiile de hematoxilină prezentate la reactivi...2. Deshidratare într-o baie de alcool absolut... Rezultatul colorării Nucleii – albastru purpuriu Hematiile – roşu Celulele musculare – roz intens Fibrele de colagen – roz Notă: Pentru realizarea coloraţiei Hematoxilină-Eozină........ Xam sau alte medii neutre de montare care sunt miscibile cu xilolul...... 13...................... Clarificare în câteva băi de xilol........... 1 g 126 ....4.........

Culoarea albastră se datorează prezenţei cuprului în moleculele sale. se menţine la temperatura camerei.……0. 127 Capitolul 6   . apoi se etichetează şi se datează. ochelari de protecţie şi halat. deoarece s-a constatat că peretele altor fungi ca Blastomyces dermatitidis.. 6. aceşti fungi nu pot fi confundaţi cu C.25. 2. Este de asemenea coroziv.500 ml Nuclear fast red……. Nu este o coloraţie specifică pentru capsula C. Nuclear fast red (Kernechtrot) Sulfat de aluminiu…. 5. 4. evitaţi contactul şi inhalarea. Pentru siguranţă se poartă mănuşi. utilizând acid acetic. Se introduc preparatele în soluţia de albastru Alcian. Soluţia este stabilă timp de 1 an. Atenţie! Iritant . în metoda convenţională. se clarifică şi se montează lamela. Tehnica de colorare 1.se va evita contactul şi inhalarea. Se introduc lamele în acid acetic 3%. Paracoccidioides brasiliensis sau Rhinosporidium seeberi pot fixa colorantul. datorită diferenţelor morfologice certe.. neoformans. Soluţia este stabilă 2 până la 6 luni. Coloraţia se face sub hotă. 5 minute..5) şi soluţia de albastru Alcian colorează mucopolizaharidele acide sulfatate şi carboxilate dar şi sialomucinele (glicoproteinele) sulfatate şi carboxilate. 3 minute. Se filtrează şi se adaugă un cristal de timol. Se spală lamele cu apă de robinet 2 minute şi apoi se clătesc în apă distilată. Rezultatul colorării Mucopolizaharidele acide: albastru Nucleii: roz-roşiatic Note: 1. la cuptorul cu microunde (la o treaptă superioară).…. timp de 30 secunde. însă.0 g Apă distilată……. Se filtrează şi se adaugă un cristal de timol. Se colorează cu Nuclear fast red. Albastru Alcian face parte din grupul coloranţilor bazici polivalenţi solubili în apă. Soluţia de acid acetic glacial 3% (pH 2. neoformans.. Atenţie! Conţine acid. Se crede că sărurile formează legături cu grupările acide ale acizilor mucopolizaharidici. 3.…. Se hidratează preparatul în apă distilată.Petru Cazacu Se amestecă cele două ingrediente apoi se ajustează pH-ul la 2. Se adăugă acidul acetic în apă. timp de 30 minute.5 g Se dizolvă sulfatul de aluminiu în apă.. Se deshidratează. Se adăugă Nuclear fast red şi se dizolvă prin încălzirea soluţiei. apoi se spală în apă de robinet. 2. Acidul acetic este iritant pentru aparatul respirator. soluţia de albastru Alcian cu lamele.5. Se evită contactul şi inhalarea coloranţilor.. 3.

din fragmente de ţesut incluse în parafină Echipament Sticlărie de laborator... 128 ..... Soluţia finală trebuie să fie incoloră sau de culoarea chihlimbarului............... Dacă soluţia nu este limpede.. se adaugă cărbune activat şi se agită pentru aproximativ un minut.. dar se pot folosi şi alţi fixatori. Formolul fixează bine ţesuturile...... Se lasă soluţia să se răcească până la 50°C....... într-un flacon de sticlă închis etanş. pentru că dizolvarea are loc cu efervescenţă......3....... ad 200 ml Metabisulfit de potasiu ................. fără a diminua calitatea coloraţiei.......Tehnici de histopatologie 6................................ cu grijă.4... Se agită până la dizolvarea colorantului....... 2 g Se încălzeşte apa distilată până la fierbere într-un flacon Erlenmeyer de dimensiuni mari........ Se închide flaconul cu dop etanş şi se păstrează la întuneric pentru 1-2 zile. microscop Reactivi Reactiv Schiff – de Tomasi Fucsină bazică ... Se păstrează la temperatura de refrigerare...8.... Se omogenizează din nou....... Metabisulfitul de potasiu se poate înlocui cu cel de sodiu.. 20 ml Cărbune activat (pulbere) .............. Coloraţia Bauer Scop Coloraţia Bauer pune în evidenţă glicogenul....7... Conform Indexului Merck.. diferite mucosubstanţe şi fungii Fixator Este recomandat formolul 10% tamponat pH 6.. 1 g Apă distilată..... acestea au fost realizate dintr-o fucsină bazică care conţine o cantitate inferioară de pararosanilină........ moment în care se adaugă metabisulfitul de potasiu... Se lasă în continuare soluţia la răcit până la 25°C.... bisulfitul de sodiu comercial este realizat predominant din metabisulfit de sodiu..... apoi se adaugă acidul clorhidric şi se omogenizează. Se filtrează soluţia.. dar pentru obţinerea unei coloraţii de calitate superioară se recomandă o fixare secundară cu lichidul Bouin.. dar foarte pal..... Tehnica de secţionare Secţiuni cu grosimea de 5 µm............. Soluţiile brune vor colora adesea foarte prost.......... Majoritatea coloraţiilor tricromice necesită ca fixatori acidul picric sau clorura mercurică... De obicei.. 1 g Acid clorhidric 1N ............ Se îndepărtează flaconul de pe sursa de căldură şi se adaugă imediat colorantul..

................ 9....... apoi în apă distilată............ apoasă . Se oxidează în acid cromic timp de 40-60 minute.... 1. Se deshidratează cu etanol.... 7......... soluţia fiind stabilă timp de un an........0 g Apă distilată ................... Se adaugă treptat restul substanţelor în ordinea dată................................... ad 1000 ml Iodat de sodiu ...............0 g Cloral hidrat ........ 50. 4 g Apă distilată ...... Trioxid de crom ... 2.......... se încălzeşte apoi şi se fierbe timp de 5 minute.. Se introduc secţiunile în apă distilată după ce au fost trecute prin băile cu xilen şi etanol. 1 minut..... Apoi în acid sulfuros........................................... Rezultatul colorării Glicogenul şi mucosubstanţele – roşii Fungii – roşii Nucleii celulelor somatice – albaştri 129 Capitolul 6 Acid cromic   .... 5........................... Supracolorare cu hemalaun.............................. Se face clarificarea cu xilen şi montare cu balsam de Canada. 1..... ad 100 ml Acid sulfuros Metabisulfit de sodiu 10% sol............. 50........... 3............................ 6 ml Acid clorhidric 1N . ad 100 ml Tehnica de colorare 1.............. Se etichetează cu iniţialele denumirii şi data preparării.. apoi se lasă soluţia pentru maturare timp de 10 minute........................ 0................ 3 băi a câte 2 minute fiecare..... dizolvând-o pe fiecare înainte de adăugarea celeilalte............. Langeron 1942) Hematoxilină ....0 g Se dizolvă hematoxilina în apa distilată.....................Petru Cazacu Hemalaun Mayer (hematoxilina Mayer...................... Atenţie! Se va evita contactul şi inhalarea................ Se îndepărtează recipientul de pe sursa de căldură şi se adaugă iodatul de sodiu.......... Se introduc preparatele în reactivul Schiff pentru 15 minute..2 g Acid citric ..... 5 ml Apă distilată ....0 g Alaun de potasiu ......... 8.......... 4......... 6....... Se clătesc lamele în apă de robinet.. Se spală cu apă de robinet....

.. din fragmente de ţesut incluse în parafină Echipament Sticlărie de laborator....... de obicei. la microscopul cu fluorescenţă. Soluţia este stabilă 1 an......... Fixator Formol 10% tamponat pH 6.... Soluţia este stabilă 1 an.......4.. Soluţia stoc B Clorură ferică 29% ............. Mucinele.. nu sunt aşa de intens colorate ca în coloraţia PAS....8 Tehnica de secţionare Secţiuni cu grosimea de 5 µm... Atenţie! Inflamabil............ În practica modernă se evită clătirea cu acid sulfuros.........0 g Etanol 95% .. notând iniţialele şi data preparării............ se evită contactul şi inhalarea........0 ml Se omogenizează..... 130 .. 5......... spălarea realizându-se cu cantităţi mari de apă de robinet.....0 ml Se omogenizează. Atenţie! Coroziv... 5. Menţinerea în acid cromic un timp mai îndelungat va reduce colorarea datorită continuării oxidării aldehidelor.. 3.............. microtom.........7..............4.................0 ml Apă distilată ......... apoi se etichetează.................... apoi se etichetează..... 2... Coloraţia Chick Scop Prin această coloraţie se pot pune în evidenţă fungii.. notând iniţialele denumirii şi data preparării. 6....... 20......0 ml Acid clorhidric ..... 500.... 475...... se evită contactul şi inhalarea........ microscop cu fluorescenţă Reactivi Hematoxilină ferică Weigert Soluţia stoc A Hematoxilină ...Tehnici de histopatologie Note: 1.........

25.. cu pH 6.. acestea se introduc într-o baie de apă....... din fragmente de ţesut incluse în parafină Echipament Sticlărie de laborator.......... degradate. Se spală în apă de robinet............ Soluţia va rămâne stabilă 3-4 zile... 5.. Se deshidratează... 2 minute..... Fungii vor apare coloraţi fluorescent verde-roşu.......0 ml Se omogenizează cât mai atent....... 0...8 Tehnica de secţionare Secţiuni cu grosimea de 5 µm........... Acridină orange Acridină orange ......5.0 ml Soluţia stoc B....... Coloraţia Gridley Scop Coloraţia Gridley pune în evidenţă fungii viabili din preparatele histologice obţinute din ţesuturi incluse în parafină şi secţionate. clarifică şi montează într-o răşină nefluorescentă........Petru Cazacu Soluţia de lucru Soluţia stoc A ...... 6... Se spală cu apă de robinet. 3..... Fixator Ţesuturile se fixează în soluţie tamponată de formol 10 %..4....... 4........ Hematoxilină ferică Weigert (soluţia de lucru)...... Notă: Aceasta este cea mai indicată metodă de screening.... După trecerea lamelor cu secţiuni prin xilen şi etanol..... 2. Rezultatul colorării Se utilizează filtrele BG 12 şi OG 4 (galben) şi / sau OG 5 (portocaliu).. microscop 131 Capitolul 6   ........ 30 minute...... 6........0 ml Tehnica de colorare 1.............................. Se introduc lamele în soluţia de acridină orange. Nu este satisfăcătoare pentru detecţia elementelor fungice neviabile. 100.......1 g Apă distilată ........ 5 minute..7... 25...

................. 5.. Se introduc lamele în reactivul Schiff. 4..... După trecerea secţiunilor prin băile cu xilen şi etanol........ 6........ Se spală cu apă de robinet. Se tratează cu soluţie de metabisulfit.... 9. pentru maturare........... 1 ml Etanol 70 % ... 400 ml Acid acetic glacial ..... apoi se adaugă paraldehida şi acidul clorhidric.......................7..... Se introduc apoi în acid cromic.............. Se spală cu apă de robinet....3)................... 1 minut............. 2... 1 g Paraldehidă............. Se clătesc cu apă distilată........ Se spală cu apă de robinet.. 3....... Acid cromic Trioxid de crom ........... soluţia fiind stabilă 2-3 luni...... 30 minute...................... 11............ 200 ml Se dizolvă colorantul în etanol...... 500 ml Metanil yellow (Galben metanil) Metanil yellow ......................... 500 ml Decolorant Metabisulfit de sodiu ......... 1 minut.... 1 g Apă distilată ..... Se clătesc cu etanol 70%.............. 12...... 132 . Se lasă la temperatura camerei timp de 48-72 ore........ Fucsin-aldehidă Fucsină bazică ..Tehnici de histopatologie Reactivi Reactiv Schiff – de Tomasi Vezi coloraţia Bauer (6.... Colorare cu fucsin-aldehidă............................ 20 minute.................................... 1 ml Acid clorhidric concentrat ........... 8... proaspătă ....... 10............... 5 g Apă distilată ...........................4.............................. Se păstrează la frigider....... 5 g Apă distilată ......................... Se spală cu apă de robinet...................... 2 picături Tehnica de colorare 1.. acestea se imersează în apă distilată.... Se clătesc cu etanol 95%......... 7.....

........4. 100 ml 133 Capitolul 6   ........ clarifică şi apoi se montează lamela cu balsam de Canada....................Petru Cazacu 13. 6.........8..... 15........ Rezultatul colorării Fungii – culoare purpurie Fondul – galben Notă: La pasul 2. menţinerea în soluţia de acid cromic 10% pentru 10 minute va da rezultate similare...........7.............. 100 ml Soluţia B Acid sulfuric . Tehnica de secţionare Secţiuni cu grosimea de 5 µm....... dar se pot folosi şi alţi fixatori.. 1 ml Apă distilată .. din fragmente de ţesut incluse în parafină Echipament Sticlărie de laborator Reactivi Decolorantul Mallory Soluţia A Permanganat de potasiu ......................... Preparatele colorate se deshidratează.............6..... Coloraţia Schmorl Scop Această metodă de colorare pune în evidenţă fungii din preparatele histologice obţinute din fragmente de ţesut incluse în parafină şi secţionate la microtom... Se clătesc cu apă distilată................. 1 minut..... 14.......... Fixator Fragmentele de ţesut se fixează în soluţie de formol 10 % tamponat 6..... Supracolorare cu metanil yellow................... 1 g Apă distilată ...........

..... 1 g Apă distilată ................. 10 ml Acid acetic glacial ............. 1 g Acid nitric 0........................................... 6 ml Soluţia trebuie să fie proaspătă.................................... acestea se introduc în apă distilată...................................... 100 ml Soluţia de lucru Soluţia A ....5% soluţie apoasă ....... 90 ml Tiosemicarbazidă Tiosemicarbazidă .... 100 ml Soluţie Schmorl Clorură ferică.................................... Acetanilină Anilină ... 1 g Apă distilată ........................ 100 ml Ambele soluţii de acid periodic dau aceleaşi rezultate........... apoasă 1% .................. • Se clătesc apoi în apă distilată.............. 1 volum Soluţie de acid periodic Se foloseşte soluţia de acid periodic 0................................................................. preparându-se înainte de utilizare............. 1 volum Soluţia B ............................................ Nu se reutilizează! Tehnica de colorare 1....... 2............Tehnici de histopatologie Soluţia C Acid oxalic .......... sol..................................5% (McManus) din coloraţia PAS sau următoarea variantă: Iodat de sodiu ....................... 4 ml Apă distilată ... sol...... Urmează decolorarea Mallory: • Lamele cu secţiuni etalate se introduc în soluţia de lucru timp de 10 minute.... apoasă 1% .... 134 . 30 ml Ferocianură de potasiu...................... După trecerea secţiunilor prin băile cu xilen şi etanol.......................................................................

îmbunătăţind contrastul. 135 Capitolul 6 Se introduc în soluţia C câteva minute. piele. Se clătesc cu apă de robinet. Totuşi. Se introduc lamele în soluţia proaspătă Schmorl. Se clătesc cu apă de robinet. se clarifică cu xilen şi se montează lamelele cu balsam de Canada.Petru Cazacu Rezultatul colorării Fungii – albaştri Nucleii celulelor somatice – roşii Fondul – roz Note: 1. 3. coloraţia poate fi utilizată pentru detecţia intratisulară a fungilor aparţinând genurilor Aspergillus. 10. Se deshidratează cu etanol.4. 12. retină. Se introduc lamele în tiosemicarbazidă. Se spală cu apă de robinet pentru îndepărtarea tuturor urmelor de tiosemicarbazidă. Gruparea tiocarbamilică (-CSNH2) este un agent reducător mult mai puternic decât sunt aldehidele şi reduce rapid fericianida la ferocianidă. 14. • Se clătesc cu apă.. De asemenea. 16. 5. Decolorantul Mallory clarifică uşor fondul. 8. Se readuc preparatele în acid periodic pentru încă 20 minute. Coloraţia Fontana-Masson Scop Această metodă de colorare se utilizează pentru a evidenţia melanina şi substanţele de tip melanin-like. 10 minute. supracolorare cu nuclear fast red sau eosină. Candida sau zygomicetelor. 13. Tratare cu acetanilină. Formula tiosemicarbazidei este H2NNHCSNH2. Se clătesc cu apă de robinet.7. Se oxidează în acid periodic pentru 10-20 minute. 6. Opţional. 3. • Se continuă cu următorii timpi ai tehnicii de colorare. 10 minute. 2. Grupul hidrazinic (H2NNH-) combinat cu orice aldehidă generează prin acidul periodic o reacţie de oxidare. tiosemicarbazida nu este o simplă azidă metalică. 15. în unele zone ale sistemului nervos central. Melanina este un pigment negru-brun prezent în mod normal în păr. 6. 30 minute. •   . Se spală cu apă de robinet. 7. 9. 11. 4. Se spală cu apă de robinet. cu formarea imediată a unui depozit de albastru de Prusia. iris. dar şi în peretele unor fungi (Cryptococcus spp. Este binecunoscut faptul că azidele metalelor pot fi explozive. El poate produce şi unele aldehide care vor fi îndepărtate în etapa 6. Se spală cu apă de robinet. până când se observă decolorarea secţiunilor. fungii dematiacei).7.

Tehnici de histopatologie

Fixator Fragmentele de ţesut se fixează în soluţie de formol 10 % tamponată 6,8 Tehnica de secţionare Secţiuni cu grosimea de 4 µm, din fragmente de ţesut incluse în parafină Echipamente Sticlărie de laborator, cuptor cu microunde (sau etuvă reglată la 60ºC), microscop Reactivi Argint amoniacal, soluţie stoc Nitrat de argint 10% .................................... 25,0 ml Se adaugă hidroxid de amoniu, picătură cu picătură, până la precipitarea soluţiei şi apoi limpezirea ei; Se adaugă apoi nitrat de agint 10% ............... 1,0 ml Soluţia va deveni puţin tulbure şi se va lăsa în repaus pentru 4-24 ore. După utilizare, soluţia se aruncă. Atenţie! Soluţie corozivă - se va evita contactul şi inhalarea. Argint amoniacal, soluţie de lucru Argint amoniacal, soluţie stoc ..................... 12,5 ml Apă distilată ................................................. 37,5 ml Se pipetează tot argintul amoniacal, lăsându-se apoi la decantat. Se filtrează. Soluţia nu se reutilizează. Atenţie! Soluţie corozivă - se va evita contactul şi inhalarea. Nitrat de argint 10% Nitrat de argint............................................... 20,0 g Apă distilată .......................................... ad 200,0 ml Se agită amestecul pentru solubilizare. Soluţia se păstrează la frigider într-un recipient brun de sticlă, tratat în prealabil cu amestec sulfo-cromic. Soluţia se poate folosi timp de 6 luni de la preparare. Atenţie! Se evită contactul şi inhalarea.

136

Petru Cazacu

Clorură de aur 0,1 % Clorură de aur 1%, soluţie stoc...................... 5,0 ml Apă distilată ................................................. 45,0 ml Atenţie! Se evită contactul şi inhalarea. Tiosulfat de sodiu 5% Tiosulfat de sodiu ........................................... 200 g Apă distilată .................................................... ad 4 l Se dizolvă tiosulfatul de sodiu în apa distilată. Se păstrează într-un recipient cu volum corespunzător, care se etichetează şi datează. Atenţie! Se evită contactul şi inhalarea.

Sulfat de aluminiu......................................... 25, 0 g Apă distilată .............................................. 500, 0 ml Nuclear-fast red ............................................... 0,5 g Se dizolvă sulfatul de aluminiu în apa distilată, apoi nucler fast red-ul, folosind căldura (fierbere pentru 5 minute). Se lasă soluţia să se răcească, apoi se filtrează, adăugându-se câteva cristale de timol pentru conservare. Se etichetează şi se datează. Soluţia este stabilă timp de 1 an. Atenţie! Iritantă, se evită contactul şi inhalarea. Tehnica de colorare 1. Secţiunile etalate se vor deparafina şi hidrata cu apă distilată; 2. Soluţia de lucru de argint amoniacal cu lamele se introduce în cuptorul cu microunde (la o treaptă superioară), timp de 2 minute. Se verifică lamele la microscop pentru a observa dacă intensitatea impregnării este adecvată, iar dacă este necesar, soluţia cu lame se va plasa suplimentar în cuptorul cu microunde timp de câteva secunde (în metoda convenţională soluţia se introduce în etuvă la 60ºC pentru 1 oră); 3. Clătire în apă distilată; 4. Clorură de aur 0,1%, 10 minute; 5. Clătire în apă distilată; 6. Tiosulfat de sodiu 5%, 5 minute; 7. Se spală lamele în apă de robinet şi apoi se clătesc în apă distilată; 8. Nuclear fast red, 5 minute; 9. Se spală în apă de robinet; 10. Se deshidratează, clarifică şi se acoperă cu lamelă.

137

Capitolul 6

Nuclear fast red (Kernechtrot)

 

Tehnici de histopatologie

Rezultatul colorării Melanina şi celulele argentafine – negre (fig. nr. 6-1 vezi Anexa) Nucleii celulelor somatice - roşii
Note: 1. O reacţie argentafină pozitivă este dată de faptul că celulele absorb argintul pe care îl reduc apoi la o formă metalică vizibilă, fără ajutorul unui agent reducător. 2. Atenţie! Se vor purta în timpul lucrului mănuşi, ochelari de protecţie şi halat de laborator. Se evită contactul şi inhalarea. Nitratul de argint: este iritant sever pentru piele şi ochi, oxidant, ingestia va produce un puternic disconfort gastrointestinal; posibil carcinogen. Soluţia de argint amoniacal poate fi explozivă; în caz de vărsare accidentală, se va îndepărta folosind un volum mare de apă de robinet. Hidroxidul de amoniu: este un iritant puternic pentru ochi şi aparatul respirator. Se manipulează în nişă chimică. Tiosulfatul de sodiu: toxic prin ingestie, iritant gastric, tegumentar, ocular şi respirator.

6.4.7.8. Coloraţia Gridley fluorescentă Scop Această metodă de colorare pune în evidenţă fungii din preparatele histologice, prin microscopia cu fluorescenţă Fixator Fragmentele de ţesut se fixează în formol 10% tamponat pH 6,8, dar se pot folosi şi alţi fixatori. Tehnica de secţionare Secţiuni din fragmente de ţesut incluse în parafină, cu grosimea de 5 µm Echipamente Sticlărie de laborator, microscop cu fluorescenţă Reactivi Reactiv Schiff fluorescent Acriflavină .......................................................... 1 g Apă distilată .................................................. 200 ml Metabisulfit de potasiu ....................................... 2 g Acid clorhidric 1N .......................................... 20 ml Se dizolvă colorantul în apă şi se omogenizează. Se adaugă apoi succesiv acidul clorhidric şi metabisulfitul, omogenizându-se cât mai atent. Se închide etanş recipientul, se lasă la întuneric pentru 48 ore, apoi se filtrează. Acridina orange poate fi de asemenea utilizată la prepararea acestei soluţii.

138

Petru Cazacu

Soluţia A Trioxid de crom ................................................ 50 g Apă distilată .................................................. 500 ml Soluţia B Sulfit de sodiu ..................................................... 5 g Apă distilată .................................................. 500 ml Soluţie C Etanol 70% ................................................... 495 ml Acid clorhidric .................................................. 5 ml Tehnica de colorare 1. După trecerea secţiunilor prin băile cu xilen şi etanol, acestea se introduc în apă distilată; 2. Imersare în soluţia A, 10 minute; 3. Clătire cu apă de robinet; 4. Decolorare în soluţia B, 1 minut; 5. Spălare cu apă de robinet; 6. Clătire cu apă distilată; 7. Tratare cu reactiv Schiff fluorescent, 20 minute; 8. Spălare cu apă de robinet; 9. Imersare în soluţia C, două băi, câte 5 minute fiecare; 10. Spălare cu apă distilată; 11. În final, preparatele se deshidratează, clarifică şi apoi se montează lamela cu o răşină nefluorescentă. Rezultatul colorării Pentru examinare se utilizează filtrele BG 12, OG 4 (galben) şi / sau OG 5 (portocaliu). Fungii apar coloraţi în galben-fluorescent cu acriflavină şi verde-roşu cu acridină orange.
Note: 1. Această metodă de colorare este utilizată frecvent ca metodă de screening. 2. Dacă fluorescenţa fondului este prea intensă pentru a distinge fungii, aceasta se poate atenua prin tratare cu hemalaun (1 minut) sau cu soluţie apoasă 0,5% de permanganat de potasiu (1 minut). Această atenuare se realizează înainte de deshidratarea finală, cu precauţie pentru a nu reduce excesiv fluorescenţa fungilor.

6.4.7.9. Coloraţia Gomori-Grocott (Methenamine silver - modificată) Scop Evidenţierea fungilor în ţesuturi. Este o coloraţie superioară pentru depistarea filamentelor aspergilare, a chiştilor de Pneumocystis, a elementelor tipice pentru
139

Capitolul 6

 

Tehnici de histopatologie

Candida, zygomicete, Cryptococcus, Histoplasma, Blastomyces, Paracoccidioides, Coccidioides, Lacazia loboi, Penicillium marneffei, Rinosporidium, Emmonsia. De asemenea, evidenţiază actinomicetele, Nocardia şi algele de tipul Prototheca sau Chlorela. Fixator Fragmentele de ţesut se fixează în soluţie de formol 10 % tamponat pH 6,8. Tehnica de secţionare Secţiuni din fragmente de ţesut incluse în parafină, cu grosimea de 4-5 µm Echipamente Sticlărie de laborator, cuptor cu microunde Reactivi Acid cromic 2% Trioxid de crom ............................................. 10,0 g Apă distilată ............................................. ad 500 ml După solubilizare, soluţia se transferă într-un recipient etanş în care poate fi stocată până la 6 luni. Atenţie! Acidul este coroziv, posibil carcinogen, se evită contactul şi inhalarea. Metabisulfit de sodiu 1% Metabisulfit de sodiu ....................................... 5,0 g Apă distilată ............................................. ad 500 ml Soluţia este stabilă 6 luni. Borax 5% Borat de sodiu .................................................. 5,0 g Apă distilată ............................................. ad 100 ml Soluţia este stabilă 3 luni. Metenamină-argint, soluţia stoc Metenamină 3% (hexametilentetraamină) ........................... .100,0 ml Nitrat de argint 5% ........................................ 5,0 ml

140

.... Clorură de aur 0.....5% Clorură de aur .......... Preparatele se deshidratează. posibil carcinogenă... Se agită preparatul în soluţia fierbinte (în metoda convenţională soluţia de argint se încălzeşte pe baie de apă la 60°C.. 2.. timp de 1 oră)....2 g Apă distilată .. 1 minut sau până la apariţia unei coloraţii gri.......2 ml   . 8............ se clarifică şi apoi se montează lamela....... se pot menţine şi 5 minute..... 5.... Urmează tratarea cu soluţia de metabisulfit de sodiu 1%...........5 g Apă distilată .. 10....... Soluţia este stabilă 3 luni.... Atenţie! Corozivă.... Spălare în apă de robinet şi clătire în apă distilată... alternativ......... Lamele cu secţiuni se transferă în soluţia de acid cromic 2% şi se menţin în cuptorul cu microunde la o treaptă superioară. în recipiente tratate cu amestec sulfo-cromic. acidul cromic 5%. 6. Atenţie! Se evită contactul şi inhalarea....... 3. 1 minut.... Clătire în 2 băi de apă distilată.... la temperatura camerei.. tratat în prealabil cu amestec sulfo-cromic. Tehnica de colorare 1...... Se introduc lamele cu secţiuni în soluţia de metenamină-argint. Deparafinare şi hidratare în apă distilată.... Tratare cu clorură de aur 5% .... Clătire în apă distilată..... apoi clătire în 3 băi succesive de apă distilată...2% Soluţia este stabilă 6 luni....0 ml Se păstrează la frigider... dar la o treaptă inferioară (în metoda convenţională. Atenţie! Se evită contactul şi inhalarea.. 9. 7. clătit în apă distilată şi uscat.. ad 100... Spălare în apă distilată..... Spălare în apă de robinet... Soluţia este stabilă 1 an. pentru o oră sau până la apariţia unei coloraţii brune). 12.....0 ml Acid acetic glacial . clătite şi uscate........ la cuptorul cu microunde (treaptă superioară)..... 4. Verde luminos 1 minut. Tiosulfat de sodiu 5%.. la temperaturi de refrigerare. 100......Petru Cazacu Cele două soluţii se amestecă într-un recipient brun de sticlă. Se spală lamele în apă de robinet şi apoi se clătesc cu apă distilată..... 0. se menţine pe baie de apă la 60°C.... asemănătoare hârtiei de ambalaj. 45 secunde. 13... 70 secunde: ţesuturile trebuie să capete o coloraţie brună. 0... 3 minute. 11......... 141 Capitolul 6 Verde luminos (Light Green SF yellow) .. 14........ 0.... Verde luminos 0.

Coloraţia fluorescentă cu acid periodic Schiff (PAS . Metabisulfitul de sodiu: toxic prin ingestie. dacă se observă o tulburare a sa sau un aspect de “oglindă” pe faţa paharului. Se evită contactul şi inhalarea. Parc d’Innovation – BP 30 144 Rue G.fluorescentă) Scop Această metodă de colorare pune în evidenţă fungii. microscop cu fluorescenţă 142 . poate cauza gastroenterite. Carcinogen.Tehnici de histopatologie Rezultatul colorării Fungii – brun-negri Fondul – verde Note: 1. 6. Foarte toxic! Organul ţintă este rinichiul. a metabisulfitului de sodiu şi a boraxului. Iritant pentru piele. Iritant pentru piele. Posibil carcinogen. prin microscopia cu fluorescenţă. Componentele mucopolizaharidice ale peretelui celulelor fungice sunt oxidate până la punerea în libertate a grupărilor aldehidice. poate irita stomacul. dar pot fi folosiţi şi alţi fixatori. Grupările aldehidice reacţionează ulterior cu nitratul de argint. ochi şi mucoase. Tehnica de secţionare Secţiuni din fragmente de ţesut incluse în parafină. oxidant. utilizată în metoda convenţională. Verde luminos SF yellow: posibil carcinogen. 6. În cazul în care culoarea acidului cromic virează în brun. atunci este necesar ca acesta să fie schimbat. De notat că soluţia 2% este mai indicată decât cea 5%.Când culoarea fungilor nu virează în negru. ochi şi tractul respirator.8. Pentru protecţie se vor purta mănuşi. 4. Acidul cromic: coroziv pentru piele şi mucoase.7. Există în comerţ şi kit-ul de colorare GMS Staining Kit. Tiosulfatul de sodiu: toxic prin ingestie. S. ochelari de protecţie şi halat de laborator. reducându-l până la argint metalic. de Kaysersberg F . se verifică prospeţimea acidului cromic. 2. Nitratul de argint: iritant sever pentru piele şi ochi.4. informaţii: Europe Ventana Medical Systems.A. cu grosimea de 5 µm Echipamente Sticlărie de laborator. acidul cromic mai concentrat provocând desprinderea ţesutului de pe lamă când se utilizează tehnica cu microunde. Se respectă modul de lucru cu soluţiile sub hotă. Fixator Fragmentele de ţesut sunt fixate în soluţie de formol 10% tamponată pH 6. 3. catalog 860-007 . Când lucrăm cu soluţia de nitrat de argint. nr.67404 Illkirch Cedex France 33 (0) 3 90 40 52 00. 5. produs de Ventana.10. atunci este necesară prepararea unei noi soluţii.

). 6.8. Rezultatul colorării Se utilizează filtrele BG 12. Note: 1.7. PAS) se poate utiliza pentru colorarea fungilor din preparatele histologice. 6. 10 minute.acid 5% Vezi coloraţia hemalaun – eozină (6. Tehnica de secţionare Secţiuni din fragmente de ţesut incluse în parafină cu grosimea de 4-5 µm 143 Capitolul 6   . dar se pot utiliza şi alţi fixatori (însă glutaraldehida trebuie evitată).7. Periodic Acid Schiff. Alcool . 5.).4. Fluorescenţa se atenuează înaintea deshidratării finale. Clătire cu apă distilată. Spălare în apă de robinet. Tehnica de colorare 1. 9. Unele formaţiuni fluorescente vor apare colorate în roşu sau roz la coloraţia PAS. se clarifică şi apoi se montează lamela cu o răşină nefluorescentă.7. Spălare în apă de robinet. Tratare cu acid periodic. Dacă fluorescenţa fondului este prea intensă pentru a distinge fungii.acid. Lamele cu secţiuni se deshidratează. Reactiv Schiff fluorescent Vezi coloraţia Gridley fluorescentă (6. 2. două băi a 5 minute fiecare. 7. 3. 2.4.4.5% de permanganat de potasiu 1 minut.1. 8. 20 minute.4. 4. Fungii apar coloraţi în galben-fluorescent cu acriflavină şi verde-roşu cu acridină orange. Coloraţia cu acid periodic Schiff Scop Coloraţia cu acid periodic Schiff (engl.11. OG 4 (galben) şi / sau OG 5 (portocaliu). Aceasta atenuare a fluorescenţei de fond trebuie să se facă cu precauţie pentru a nu reduce fluorescenţa fungilor. Alcool .6. Se deparafinează şi se hidratează secţiunile. aceasta se poate atenua prin tratare cu hematoxilină 1 minut sau cu soluţie apoasă 0.Petru Cazacu Reactivi Soluţie de acid periodic Vezi coloraţia Schmorl (6.8.).7. Tratare cu reactiv Schiff fluorescent. Spălare cu apă de robinet. Fixator Probele de ţesut sunt fixate în soluţie formol 10% tamponată pH 6.

........ apoi se filtrează prin hârtie de filtru Whatman nr....5 g Apă distilată ............. iar soluţiile de preparare în nişa chimică............... 5. Atenţie! Reactivul este carcinogen şi corosiv....... 18........ recipientul cu reactiv se păstrează acoperit...... 10. De obicei... soluţia se etichetează cu data preparării şi iniţialele denumirii............. A doua zi se adaugă: Cărbune activat (pulbere) .............. soluţia fiind stabilă timp de 6 luni.. după McManus Acid periodic ................Tehnici de histopatologie Echipamente Sticlărie de laborator..... mască şi halat de protecţie......... Soluţia devine limpede..... Se agită soluţia timp de 2 ore.............5 %......... cuptor cu microunde Reactivi Acid periodic 0.... la temperaturi de 8°-10°C...... 1000................... Se readuce volumul la 1000 ml cu apă distilată... Se lucrează sub hotă........0 g Apă distilată ... Soluţia este stabilă 1 an........0 ml Acid clorhidric ........ Reactivul Schiff (Lillie.... Soluţia finală trebuie să fie incoloră sau de culoarea chihlimbarului........ 0 g Metabisulfit de sodiu .. se evită inhalarea. 0.....0 ml După completa solubilizare a acidului periodic........... Soluţiile brune vor produce frecvent coloraţii necorespunzătoare... Acidul clorhidric este caustic.... la rece) Fucsină bazică ... 100.... apoi se menţine la întuneric... La prepararea reactivului se vor purta mănuşi......... aceste soluţii au fost preparate cu fucsină bazică ce conţine o cantitate mică de pararosanilină........ Hârtia de filtru se va înlocui frecvent.......0 g Se omogenizează 1-2 minute...... 2 într-un cilindru gradat de 1000 ml................ 10. ochelari de protecţie.. Atenţie! Se va evita contactul şi inhalarea............ dar foarte pal......... se va utiliza cu atenţie! 144 ... Se păstrează la frigider. de culoare brun-deschis până la galben-deschis....0 ml Se adaugă fucsina şi metabisulfitul în acidul clorhidric.........

..................0 g Acid acetic glacial ..... diferenţierea filamentelor de Nocardia (Ziehl pozitive) şi actinomicete 145 Capitolul 6   ... Se introduc lamele cu secţiuni în reactivul Schiff........................... se adaugă în 10 ml de formaldehidă câteva picături de reactiv Schiff.... nr....Petru Cazacu Hematoxilina Gill Hematoxilină ..4.. Se agită o oră la temperatura camerei...... 4...72 g.... 250........ Se introduc apoi lamele în acid periodic 0.. pentru 45-60 secunde..7............0 ml Iodat de sodiu .... preparatul va căpăta o culoare magenta (în metoda convenţională...........5 %. 7..........0 g Sulfat de aluminiu. 5..... Tratare cu hematoxilină. dacă este hidratată (C16H14O6 x 3H2O) se utilizează o cantitate de 4. Deparafinarea şi hidratarea secţiunilor cu apă distilată.. acesta se poate redizolva prin încălzirea uşoară a rectivului şi agitarea soluţiei.... timp de 3 minute.. culoarea trebuie să vireze imediat în roşu-purpuriu..................... timp de 30 minute). 4.. 750... se adaugă hematoxilina. 6...... la cuptorul cu microunde (treaptă superioară)................ Se deshidratează în alcool................ 6... apoi în apă distilată. Se spală în apă de robinet...12........ Se spală continuu în apă de robinet... 2.. 3...... Soluţia poate fi utilizată imediat şi este stabilă pentru aproximativ un an......... apoi sulfatul de aluminiu şi acidul acetic glacial.. Tehnica de colorare 1. Coloraţia Ziehl ....... reactivul Schiff se înlocuieşte..0 ml Etilenglicol .. timp de 5 minute... se clarifică şi se montează lamela.....0 ml Se amestecă etilenglicolul cu apa distilată. 3.. Dacă se observă un precipitat alb în recipientul cu reactiv Schiff. Rezultatul colorării Glicogenul şi fungii: magenta (fig.. Clătire în apă distilată... 8......... 4........ 6-2 vezi Anexa) Nucleii celulelor somatice: albaştri Note: 1.. Pentru a verifica calitatea reactivului Schiff....... reactivul Schiff se menţine la temperatura camerei..... Se filtrează înainte de utilizare.... 20.Neelsen Scop Această coloraţie este utilizată pentru evidenţierea bacteriilor din genul Mycobacterium. timp de 5 minute.. 2...... Hematoxilina trebuie să fie anhidră.... Dacă în timpul păstrării la frigider a reactivului culoarea acestuia virează în roz.4 g Apă distilată . iodatul de sodiu....... 70...

.......... 10 ml Etanol 70 % .......... 50..... se pot pune în evidenţă elemente fungice caracteristice speciilor de Histoplasma şi Blastomyces........ Alcool .....0 ml Etanol absolut ....... Acesta se etichetează cu data preparării şi cu timpul de stabilitate al soluţiei (cca................ 0.............. 45 ml 146 ....Neelsen Fucsină bazică ........ 1 an)....Tehnici de histopatologie (Ziehl negative).0 ml Cristale de fenol topite.........5 g Apă distilată ................ Atenţie! Corozivă.................................. soluţia stoc Albastru de metilen....5 ml Se omogenizează... Albastru de metilen............... cu grosimea de 4-5 µm Echipamente Sticlărie de laborator................................................... se filtrează şi se păstrează într-un recipient etanş......... Albastru de metilen....0 ml Se omogenizează. Fixator Fragmentele de ţesut se fixează în soluţie de formol 10 % tamponată pH 6... stoc ........................ 990 ml Se omogenizează şi se etichetează cu data preparării şi timpul de stabilitate al soluţiei (1 an). De asemenea........... Atenţie! Carcinogenă şi toxică.................acid 1% Acid clorhidric ........... 12......... se filtrează şi se păstrează într-un recipient brun de sticlă... soluţia de lucru Albastru de metilen sol.... Se etichetează menţionându-se data preparării şi perioada de stabilitate a soluţiei (1 an)................... 2......................... Tehnica de secţionare Secţiuni din fragmente de ţesut incluse în parafină..... 250............................ 25......... cuptor cu microunde Reactivi Fenol-Fucsină Ziehl ...... 5 ml Apă distilată ..............................8.........7 g Apă distilată ....................

Componenta lipoidică a bacteriilor acido-rezistente se colorează cu fenol-fucsină.Petru Cazacu Soluţia se păstrează într-un recipient de sticlă. Spălare cu apă de robinet. Acidul clorhidric: iritant puternic pentru piele. un recipient de sticlă cu volum de 6-7 litri.7. 10.4. 9. 5 minute. 8. Tratare cu alcool . ochelari de protecţie şi halat. Clătire cu apă distilată. Se utilizează filtre „MilliporeTM” pentru filtrarea apei necesare în procesul colorării. Fucsina bazică este carcinogenă. Se deshidratează. 2. 6. 4. 3. fiind stabilă timp de 2 luni. Lamele se introduc în soluţia de fenol-fucsină. 30 secunde. 5. Albastru de metil. Se va evita contactul şi inhalarea. Lamele se vor lăsa în soluţia fierbinte timp de încă 5 minute. soluţie de lucru. 7. Spălare cu apă de robinet. Echipamente Balon de 4000 ml. rezistentă la decolorarea cu acid diluat. Tehnica de colorare 1. 45 secunde. 5.13. apoi hidratare cu apă distilată a secţiunilor etalate pe lame.acid 1% până la apariţia culorii roz-deschis. persistente. Clătire cu apă de robinet. 3. În metoda convenţională. În timpul preparării soluţiilor se vor purta mănuşi. 2. Soluţia se filtrează o dată pe săptămână. Reactivi suplimentari Amestec sulfo-cromic (pentru tratarea sticlăriei) Scop Curăţarea sticlăriei utilizate la colorare şi pentru proceduri care necesită sticlărie perfect igienizată. Rezultatul colorării Structurile acido-rezistente – roşii strălucitoare Fondul – albastru Note: 1. 4. care apoi se menţine în cuptorul cu microunde (treaptă intermediară). ochi şi aparatul respirator. se clarifică şi se montează lamela cu balsam de Canada. agitator magnetic. la 60°C timp de 1 oră. 6. Se evită contactul şi inhalarea soluţiilor. preparatele se menţin la etuvă. Deparafinare. cu capac 147 Capitolul 6   .

........5% Apă distilată .. Etanol 100 %..... Etanol 100%.... Etanol 95 %......... Acidul sulfuric concentrat se adaugă lent în apă şi soluţii apoase...... 5 minute... Se toarnă soluţia într-un recipient de 6-7 litri... 4... Coroziv pentru piele. Este coroziv..................... Bicromatul de potasiu: toxic prin inhalare şi ingestie.... 2. Se etichetează şi se datează.... acestea se usucă prin compresare uşoară cu hârtie de filtru pe ambele feţe. Note: Pentru protecţie se vor utiliza mănuşi..... Acidul clorhidric: puternic iritant pentru piele..... De asemenea.... 15 ml Se omogenizează şi se etichetează...... Etanol 95 %.... 985 ml Acid clorhidric ............... 5 minute... 5 minute......Tehnici de histopatologie Reactivi Soluţie acidă de curăţare Bicromat de potasiu . 5 minute........... Aceasta va limita conservabilitatea preparatelor..... Înainte de introducerea lamelor cu secţiuni în prima baie de etanol..... nu se inhalează.. Afectează pielea..... ochi şi aparatul respirator. Urmează deshidratarea: 1.. 3.....5.... apoi se adaugă încet acidul sulfuric.. Afectează sistemul reproducător şi ţesuturile fetale..... Soluţia se păstrează până când culoarea sa devine maro-închis (depinde de frecvenţa utilizării). lamele se şterg pe verso cu un tifon curat pentru a îndepărta resturile de colorant........... Soluţie acidă de spălare a sticlăriei 1. Montarea Montarea presupune în prealabil deshidratarea şi clarificarea secţiunilor..... reproducător şi ţesuturile fetale.. la introducerea lor în toluen va apare o turbiditate albicioasă...... 6. 400 ml Se dizolvă bicromatul de potasiu în apă.... Toluen..... aparatul respirator. 148 .. 10 minute....... 400 g Apă distilată ........... Acidul sulfuric: vaporii sunt toxici... nu invers... ochi şi aparatul respirator... ochi şi mucoase.......... Dacă secţiunile nu sunt complet deshidratate.. 4000 ml Acid sulfuric .................... Este iritant pentru piele............ ochelari şi halat.. 5..

.......... b) şi în medii apoase (c... 80.... iar deasupra se aşează o lamelă: 1........ Fig... 149 Capitolul 6   ........ coloraţiile cu fucsină acidă.......... Pe lama umectată cu toluen se pune o picătură de mediu de montare..... d)......... după ce picătura s-a extins pe toată lungimea marginii ce formează unghiul diedru cu lama.... 6-3 a................ ceea ce asigură o conservare mai bună a coloranţilor şi implicit a preparatelor...... 35.... Prin învechire capătă o coloraţie gălbuie... verde luminos)..... 10.....X..... aceasta se presează uşor (fig... atingând cu marginea picătura de mediu de montare....P..... b)..... D.... nr.. dizolvată în proporţie de 55 % în xilol...0 g Dibutilftalat .....5 ml Xilol ... neutră chimic... 6-3 Montarea secţiunilor în medii anhidre (a......... sub o incidenţă de 45º...... iar unele coloraţii nu se conservă corespunzător (ex.... Distiren 80 ...... nr..... Lamela se aşează pe lamă..0 ml Este o răşină sintetică..Petru Cazacu Medii de montare Balsamul de Canada Este o răşină a coniferului Abies balsamea...............

în fante numerotate.. astfel încât să se realizeze etanşeizarea secţiunii. Arhivarea preparatelor histologice trebuie să asigure în primul rând protejarea acestora de şocuri mecanice. După interpretarea microscopică şi fotografierea aspectelor morfologice de interes. apoi acestea se aduc paralel până când cele două picături confluează. Se depune o picătură de mediu de montare pe lamă şi una pe lamelă. numărul din registrul laboratorului. Etichetarea şi arhivarea După ce excesul de mediu de montare este îndepărtat.6. cutia nr…. Excesul de mediu de montare se îndepărtează cu ajutorul unui tifon îmbibat în benzen. 6. umiditate şi praf. preparatele histologice permanente se vor luta. Se îndepărtează eventualele bule de aer de sub lamelă cu ajutorul unui ac de disociere. iar cutiile se introduc în sertarele histotecii. Acestea se aplică cu o pensulă fină pe marginea lamelei. preparatele se pot eticheta. d).Tehnici de histopatologie 2... de jur împrejur. sertarul nr…….. Blocurile de parafină se vor păstra în plicuri care vor avea aceleaşi însemnări ca şi preparatele şi vor fi depozitate în rafturile unor dulapuri special destinate acestui scop. timp de 2-3 zile. În registrul de laborator.. coloraţia etc. 6-3 c. rândul nr…. în dreptul fiecărei probe de ţesut. ceară de albine şi seu. de lumină. Pentru o mai bună conservare. se vor nota datele de identificare şi locul de depozitare al preparatelor şi blocurilor (Histoteca nr…. Această etichetă se completează cu ajutorul unei tuş rezistent la apă şi va cuprinde instituţia. Preparatele histologice se etichetează prin plasarea unor mici etichete dreptunghiulare adezive la capătul mat al lamei. Lutarea se poate realiza cu lac de unghii. nr.). natura probei. Ele se menţin minim 10 ani şi sunt refăcute când este necesar. apoi lamela se presează uşor (fig. anul. preparatele histologice permanente se arhivează în cutii speciale în ordinea seriei. Preparatele histologice astfel obţinute se menţin în poziţie orizontală la temperatura camerei. 150 . parafină topită sau cu amestecul 3:6:1 format din colofoniu.

12. 14. 3. 2nd ed. Stain Technology. Lillie R D (1954) . Sheehan D. USA. 2. 5. ASCP. London. Ed.Diagnosticul şi tratamentul micozelor interne.Hazardous Chemicals in the Histopathology Laboratory. Humason G L (1967) . New York. Krieger Publishing. Shimosato Y (1989) . Butterworth.. Stevens A (1982) . 7. Glenner G G (1957) . Culling C F A (1974) . 9.Histopathologic technique and practical histochemistry 2nd ed.html 151 Capitolul 6   .Theory and practice of Histotechnology.. Dapson R (1991) . Ca..Thiosemicarbazide used after periodic acid makes methenamine silver staining of renal glomerular basement membranes faster and cleaner. NY. 13. Bancroft. Tome Y. III. 3nd ed. USA.Histotechnology: A Self-Instructional Text. 1st ed.Handbook of histopathological and histochemical techniques. N.Staining Methods Histologic and Histochemical. Churchill Livingstone. UK.utah. Harper & Row. Battelle Press. 3nd ed.Theory and practice of histological techniques 2nd ed. Hrapchak B (1980) .Manual of Histologic Staining Methods of the AFIP. McGraw-Hill.med.Journal of Histochemistry and cytochemistry. 5:311. UK. Stevens A (1982) . http://www-medlib.The Microtomist's Formulary and Guide. Bancroft J. 11. Churchill Livingstone.Petru Cazacu Bibliografie selectivă 1. Blakiston. Crookham J. Luna L (1968) .edu/WebPath/webpath.. 2nd ed.. 4. Robert E. Anatech. Carson F (1990) . San Francisco. The Blakiston Co. NY.Animal tissue techniques. 15. 2nd ed. Hayashi I . New York.Y. 8. 2nd ed. W H Freeman & Company. Mowry R W (1960) . Bucureşti. Viaţa Medicală Românească. Ohio.. McManus J F A.Theory and Practice of Histological Techniques.. Golăescu M (1997) .. Lillie R D. Edinburgh & London. Gray P (1954) .. 6. USA. 10. J D.

.

(1.3)-β-D-glucan-ului 7.1 Fungitell™ (Cape Code Inc. Blastomyces şi Pneumocystis. Cu toate acestea. la pacienţii cu risc crescut vor putea fi corelate cu infecţii fungice invazive. sensibil şi rapid. precum examenul micologic al prelevatelor clinice. Histoplasma.25 pg/ml. SUA) Test de detecţie rapidă a (1. Un rezultat pozitiv nu va indica şi clasa fungică a speciilor incriminate. (1. cu valori minime de detecţie stabilite la 31. privind identificarea precoce a infecţiilor fungice invazive.3)-β-Dglucanul din serul de analizat în circa o oră. Mucor sau Rhizopus. reprezintă un „balon de oxigen” pentru clinicieni.3)-β-D-glucanul se regăseşte în doze mici în sângele indivizilor sănătoşi. Aspergillus.Ingrid Apetrei. Sporothrix. intervalul de detecţie a fost încadrat în limite superioare pentru o mai bună acurateţe a testării şi pentru evitarea unor posibile interferări antigenice. Testul poate decela (1. dar valorile serice de 80 pg/ml sau mai mari. precum specii din genul Cryptococcus sau aparţinând clasei Zygomycetes.1. Analiza seriată a probelor prelevate de la pacienţii cu risc pentru infecţii fungice a relevat utilitatea diagnostică a acestui test.3)-β-D-glucanul produs de fungii primar patogeni sau de cei oportunişti aparţinând genurilor: Candida. Fungii care nu sintetizează (1.1.3)-β-D-glucanul cu exprimare în picograme. rezultatele fiind verificate prin metode alternative de diagnostic. RMN).3)-β-D-glucan. Mihai Mareş 7. Fusarium. respectiv Absidia. Principiul testului ungitell este un test cromogen. ce poate detecta (1. Acremonium. Mihai Mareş 7 F Tehnici de seromicologie Ingrid Apetrei. Rezultatele testului sunt cuantificate în pg/ml ser. Trichosporon.3)-β-D-glucanului mai mici de 60 pg/ml sunt considerate a fi negative. testul fiind recomandat pentru stabilirea unui diagnostic prezumtiv în colaborare cu alte proceduri de diagnostic. Coccidioides. Abilitatea testului de a detecta în ser (1.3)-β-D-glucanul este un constituent al peretelui celor mai importanţi fungi de interes medical precum Candida sau Aspergillus. Valori ale (1. Saccharomyces. CT. tehnicile de histopatologie în cazul prelevatelor biopsice sau analiza imagistică (Rx. iar depăşirea acestei valori (pozitivarea testului) nu va putea fi automat corelată cu prezenţa evolutivă a bolii fără o serie de investigaţii clinice / 153 Capitolul 7   . nu vor pozitiva testul.

154 .2 M 7. Tuburi de colectare a serului. cu valoare mare de diagnostic pentru evoluţia unei afecţiuni invazive cu etiologie fungică. Toate recipientele din material plastic vor fi libere de orice tipuri de interferări. Apă . 2. cu fund plat. Valorile cuprinse în intervalul 60-79 pg/ml sugerează o posibilă infecţie fungică. 3. Toate produsele furnizate de Cape Code.Tehnici de seromicologie paraclinice complementare. Rezultate fals pozitive au fost înregistrate la pacienţii hemodializaţi. KCl 1. Micropipete pentru volume de 20µl. specific LAL (Limulus Amebocyte Lysate) sau lizat din amebocitele unei specii de crab. fiind recomandată retestarea serică a pacienţilor la intervale de timp prestabilite (2-3 ori pe saptămână).a. 5.4). dar acestea au valoare diagnostică incertă.reactiv conform standardului ISO 3696:1987. lungime de undă 405 nm monocromă. Glucan standard liofilizat ce conţine între 250 şi 350 pg s.3-β-D-glucan) sunt furnizate împreună cu kitul şi suficiente pentru 2 plăci de microtitrare: 1. 2. 4. Vârfuri pipete 10-100 µl. Micropipetă multipas pentru volume de 100 µl. 5. 3. Incubator-cititor cu fluorescenţă. depirogenată la 235°C timp de 7 ore. Fiind un test cromogen rezultatele obţinute mai pot fi interferate de prezenţa bilirubinei serice sau de turbiditatea serului de analizat cauzată de hiperlipemie.3)-β-D-glucan seric. 7. Materiale furnizate împreună cu testul Fungitell Fungitell este destinat diagnosticului in vitro.1. 200 µl şi 1000 µl. Valori mai mari sau egale cu 80 pg/ml sunt interpretate ca fiind net pozitive. 7. Tuburi de testare pentru diluţia probelor şi pregătirea mixului de extracţie serică. pentru mixarea probelor. Materialele de unică folosinţă sunt de preferat. / fiolă şi solvent inert. sunt certificate ca fiind libere de interferare glucanică.2.25 M 7.(1. Atenţie! Vârfurile de pipetă cu filtru de bumbac pot constitui sursă de glucan. pentru a fi adecvată folosirii. Inc.3)-β-D-glucan liofilizat.1. în timp ce utilizarea pentru hemodializă a unor membrane confecţionate din celuloză triacetat sau polimetil-metacrilat nu au provocat creşteri ale valorilor de (1. 1000 µl. în cazul folosirii membranelor celulozice sau administrării unor produse de origine sangvină precum albumina sau imunoglobulinele. Microplăci de titrare cu 96 godeuri. KOH 0. Reactivul Fungitell . 4. 6. 250 µl. Următoarele materiale (libere de orice urmă de 1. în vederea stabilirii unui diagnostic cât mai exact. Tuburi sterile de plastic cu dop. cu 2500 unităţi densitate optică şi software pentru interpretare asistată de PC. 1. Tampon Pyrosol (Tris HCl 2M pH 7. Sticlăria trebuie să fie uscată la cald.3. Materiale necesare dar nefurnizate împreună cu kitul Toate materialele şi sticlăria trebuie să fie libere de interferare glucanică. 6.

Cele de tipul triacetat sau polimetilmetacrilat nu par a afecta concentraţia sanguină de glucan. ştiut fiind că apa.1. 7.3)-β-D-glucan. 155 Capitolul 7   .1. Mucor şi Rhizopus. pentru circa 20 zile.4. 3.1.7.3)-β-D-glucan când sunt utilizate membrane celulozice. Mihai Mareş 7. Atenţionări şi precauţii Testul Fungitell necesită o atenţie sporită din punct de vedere tehnic şi procedural. 6. Din această categorie fac parte specii ale genului Cryptococcus. pentru obţinerea unei soluţii cu 100 pg/ml (soluţia 1). 1. Prepararea glucanului standard furnizat odată cu kitul a. 3. Serul astfel obţinut. Marcarea prelevatelor constă în notarea numelui şi prenumelui pacientului alături de data recoltării sau se utilizează sisteme de identificare unică. 2. Tehnică de lucru 1. Pe termen mai îndelungat. Specii nedetectate de test.3)-β -D-Glucan şi nu sunt de regulă detectate de test. 2. praful pot fi surse de glucan.6. la 1800 rpm timp de 10 minute. seruri hiperlipemice sau care conţin bilirubină. 7. ca Absidia. hainele. Reactivul Fungitell reconstituit va fi păstrat la 2°-8°C şi utilizat în maxim 2 ore.1. Se utilizează reactivi şi materiale care sunt certificate ca fiind libere de glucani. Anumite manopere chirurgicale ce implică utilizarea unor materiale absorbante sau de sutură derivate din bumbac sau mătase pot conduce postoperator la acumularea unui nivel ridicat de (1.5. ferite de lumină. Pacienţii hemodializaţi pot acumula un nivel ridicat de (1. Recoltarea / Stocarea / Marcarea probelor 1. nu se consumă alimente în spaţiul destinat testărilor. Nu se utilizează reactivi cu termenul de valabilitate depăşit. Probele de ser se vor recolta în tuburi vidate (tip Venoject) care să permită o rapidă formare a coagulului şi centrifugarea ulterioară în vederea separării cât mai nete a serului de analizat. se transferă în condiţii aseptice în fiole sterile şi se stochează. Nu se pipetează nici o substanţă cu gura. 7. Se utilizează echipament de protecţie şi mănuşi fără talc în manoperele ce implică prelevatele. Stocarea probelor înaintea începerii testării se realizează la 2°-8°C pentru maxim 48 de ore sau se pot congela la -20°C. care să contribuie la falsa pozitivare a rezultatelor testării acestor pacienţi. 4. Păstrarea reactivilor Toate substanţele se vor păstra la 2°-8°C. Unele specii fungice produc cantităţi reduse de (1. 7. soluţia reconstituită poate fi congelată o singură dată la -20°C. nu se fumează. precum şi specii din categoria zygomycetelor.Ingrid Apetrei. Se dizolvă o fiolă de glucan standard într-un volum corespunzător de apă standard preîmbuteliată. 8.

martor (blk) şi test (uk) ale plăcii de microtitrare 3. adică de cinci ori volumul probei de ser. Soluţia astfel preparată va fi stocată la 2°-8°C şi utilizată în maxim 3 zile.500 pg/ml.6 M KCl şi 0. Nr. zonă martor (blank = blk) şi zonă test (unknowns = uk) cu fiecare variantă în triplu exemplar. se prepară un standard cu 12. Notă: Când se trasează curba de etalonare.Tehnici de seromicologie Se vortexează cel puţin 10 secunde pentru omogenizarea soluţiei. Soluţia se omogenizează uşor şi se utilizează în cel mult 30 de minute. Tratarea serului cu reactivul de tratare a serului. după următorul model (fig. c. Fiolele se acoperă cu parafilm. Un pH mai alcalin va inactiva serinproteazele precum şi inhibitorii acestora. astfel încât limita să fie încadrată în intervalul 31.125 M KOH) prin transferarea a 400 µl din soluţia 0. Fig. 7-1). a. putând fi stocate la 2°-8°C pentru a fi utilizate mai târziu. care pot da rezultate fals positive sau fals negative. Din soluţia 2 se prepară un nou standard cu 25 pg/ml prin mixarea a 400 µl apă reactiv şi 400 µl din soluţia 2. într-un tub liber de glucan (soluţia 4).5 pg/ml prin mixarea a 400 µl apă reactiv cu 400 µl din solutia menţionată. Placa de microtitrare are zonă standard (st).25 pg/ml prin mixarea 400 µl apă reactiv cu 400 µl din soluţia 4.25 .2 M KCl. capacul îndepărtându-se pentru citire. Pornind de la soluţia anterioară.25 M KOH într-un tub liber de glucan şi adiţia a 400 µl din soluţia 1. Pregătirea reagentului de tratare a serului (0. Volumul standard din testare este de 25 µl pentru fiecare godeu. d. Prepararea reagentului de tratare a serului Tratarea alcalină a serului va desface triplul helix al glucanului conferindu-i o reactivitate mai mare în timpul testului.î ntr-un tub liber de glucan (soluţia 2). 156 . se multiplică pg/ml cu cinci. într-un tub liber de glucan (soluţia 3). Notă: Pentru evitarea contaminării accidentale se păstrează microplăcile acoperite pe parcursul desfăşurării manoperelor. Se prepară apoi un ultim standard cu 6. 2. într-un tub liber de glucan (soluţia 5). Se prepară apoi o soluţie standard cu 50 pg/ml prin mixarea a 400 µl apă reactiv cu 400 µl din soluţia 1. nr. cu cea de-a doua microplacă. b. 7-1 Zonele standard (st). e.

iar omogenizarea lor se realizează prin vortexare timp de 10 secunde.8. Rezultate negative: un rezultat negativ înseamnă că (1. Laboratorul care efectuează testările are obligaţia de a informa clinicianul că sfera de detecţie a kitului nu cuprinde specii ale genului Cryptococcus (produc cantităţi infime de (1. Se agită uşor fiola pentru dizolvarea completă a conţinutului. F3. 7. Prepararea reagentului Fungitell şi conduita procedurală a. 5. d. B3. Se adaugă 25 µl din soluţia standard 5 în godeurile notate F2. Se îndepărtează capacul de pe microplacă şi se aşează în cititor odată cu setarea temperaturii la 37°C. Se adaugă 25 µl din soluţia standard 3 în godeurile notate D2. în cazul valorilor de peste 500 pg/ml. Operaţiunea se repetă pentru fiecare probă de ser. d. începând cu valori considerate a fi nedetectabile (< 31. 157 Capitolul 7   . între 0 şi 40 minute.25 pg/ml) până la valori mai mari de 500 pg/ml. Se îndepărteză microplaca din cititor şi: a. c. c. F4.3)-β-D-glucan) sau specii de zygomycete precum Absidia. C4. Se adaugă 25 µl din soluţia standard 1 în godeurile notate B2. Colectarea rezultatelor şi analiza acestora: se calculează rata medie de variaţie a densităţii optice (mili-unităţi de absorbanţă/minut) pentru toate punctele. Pipetarea blanc-ului şi a standardelor. timp de 40 minute. f. D4. la 37°C. b. Mucor sau Rhizopus care nu produc (1.8 ml apă standard şi se aditivează cu 2. excepţie făcând situaţiile când acesta ar putea împiedica vizualizarea probei. Se înregistrează concentraţia de glucan a probelor testate. Îndepărtarea capacului este opţională. Valori ale (1. Se adaugă apoi 100 µl de reagent Fungitell în fiecare godeu cu ajutorul micropipetei multicanal.Ingrid Apetrei. Se transferă 5 µl din proba de ser în fiecare din cele trei godeuri desemnate (uk). Se adaugă 25 µl din soluţia standard 4 în godeurile notate E2. Se adaugă 25 µl din soluţia standard 2 în godeurile notate C2. cu ajutorul micropipetei de 1000 µl. E4. b.3)-β-D-glucanul nu a fost detectat sau că valorile s-au încadrat sub limita de detecţie a kitului. B4. Mihai Mareş a.1. E3. Pentru acurateţea aprecierilor. G3. c. la intervale de 15-30 secunde. Rezultatele sunt exprimate în pg/ml ser.3)-βD-glucanului mai mici de 60 pg/ml sunt interpretate ca fiind negative. Se agită placa 5 secunde şi se incubează 10 minute la 37°C în cititor. acestea fiind printate cu ajutorul softului furnizat sau sunt citite pe curba etalon. 4. Citirea are loc la 405 nm.8 ml de Pyrosol tampon.3)-β-D-glucan. Microplaca se agită timp de minim 5 secunde înaintea citirii. D3. e. Se reconstituie o fiolă de reagent Fungitell cu 2. nu se vortexează. G4. Se distribuie câte 25 µl apă standard în godeurile notate G2. se recomandă diluarea probei de ser cu apă standardizată şi retestarea acesteia. C3. b. Interpretarea rezultatelor Rezultatele testului Fungitell vor fi utilizate în diagnosticul infecţiilor invazive fungice doar în coroborare cu alte date. Se adiţionează 20 µl din reagentul de tratare a serului în fiecare godeu ce deja conţine cei 5µl de ser. d. Decongelarea probelor de ser se realizează la temperatura camerei.

Controlul calităţii Ghidul controlului de calitate al standardelor de laborator poate fi accesat la adresa URL www. prezintă turbiditate sau dau prin citire la densitatea optică de 405 nm o valoare mai mare de 0. albumină serică sau imunoglobuline. 5. Specii aparţinând genurilor Absidia. Valorile mai mari sau egale cu 80 pg/ml sunt considerate pozitive.3)-β-D-glucan seric au fost evidenţiate la pacienţii hemodializaţi al căror tratament constă în administrarea unor produse de origine sanguină.980. .Tehnici de seromicologie Rezultate pozitive: un rezultat pozitiv înseamnă că (1.org (documentul C24-A). O bună practică de laborator înseamnă că ambele verificări de pozitivare sau negativare a probelor vor fi puse în practică. cu valori mai mici cu 50% decât cea mai mică valoare incertă indicată de standard. 3.9. produce un nivel scăzut de (1. Cryptococcus spp.3)-β-D-glucanul a fost detectat. încapsularea şi nivelul de (1.3)-β-D-glucan ceea ce poate conduce spre o zonă de incertitudine privind calitatea diagnosticului.10. .1.06.Blanc-ul (25 µl de apă standard) reprezintă controlul negativ. dar acest rezultat nu este definitoriu pentru prezenţa bolii şi trebuie interpretat în coroborare cu rezultatele metodelor complementare de diagnostic. Mucor şi Rhizopus. 4. sunt necesare probe seriate şi testări adiţionale pentru o interpretare corectă a rezultatelor. testarea trebuie repetată cu înlocuirea tuturor reagenţilor. acestea vor fi diluate cu reagentul bază şi retestate.3)-β-D-glucan. cu o rată de cel puţin 2-3 ori pe săptămână. Localizarea tisulară a infecţiilor fungice. Rezultate pozitive datorate creşterii valorilor de (1.3)-β-D-glucan. Frecvenţa testării pacienţilor se va stabili în funcţie de riscul la care aceştia sunt expuşi. 7. Dacă nu se îndeplinesc aceste condiţii.nccls. Anumiţi indivizi sănătoşi au concentraţii serice detectabile de (1. . nu produc (1.Dacă se observă că probele de ser sunt hemolizate. Fiecare laborator care utilizează aceast test de diagnostic va stabili şi o serie de criterii proprii privind controlul de calitate. Intervalul de detecţie al testului este între 31. 2. în vederea verificării reagenţilor şi tehnicii de lucru. 7. Pentru certitudine. Rezultate incerte: valorile cuprinse în intervalul 60-79 pg/ml sugerează o posibilă infecţie fungică.1.25 şi 500 pg/ml. Coeficientul de corelaţie al curbei standard (ordonată / abscisă) ar trebui să fie mai mare de 0. Limite 1. 158 .3)-β-Dglucan produs de anumiţi fungi influenţează concentraţia serică de antigen. În astfel de cazuri sunt recomandate testările suplimentare.Curba etalon cu cele cinci concentraţii de glucan serveşte drept model de control pozitiv a kitului Fungitell.

11.91.12. 159 Capitolul 7   . • Turbiditatea probei cauzată de hiperlipemie.7%.1.85. valoarea predictivă la care subiectul este pozitiv pentru infecţii fungice se încadrează în intervalul 74.Ingrid Apetrei.1%.4% . predicţia negativă se încadrează în intervalul 65.1. • Prezenţa vizuală a bilirubinei. Când semnele / simptomele sunt prezente la nivelul de 80 pg/ml sau mai mare. Mihai Mareş 7. 7.1% . Valori aşteptate Valorile crescute de β-glucan sunt relevante într-o varietate de infecţii fungice. Interferarea cu alte substanţe În următoarele situaţii pot avea loc interferări privind acurateţea rezultatelor: • Hemoliza. În absenţa semnelor clinice şi mai puţin de 60 pg/ml. • Turbiditatea serului.

Tehnici de seromicologie 7. 2 x 1ml. permiţându-se astfel formarea complexelor de tip Ac – GM – Ac – peroxidază. ferite de praf.2. Tampon TRISNaCl (pH 7. Încălzirea serului în prezenţa EDTA are rolul de a disocia complexele imune şi de a precipita proteinele serice care ar putea interfera rezultatele testării. 2 x 1ml. de reactivii utilizaţi. După spălare. conservant: 0. • Ser de calibrare – ser standard (liofilizat): ser uman cu conţinut în galactomanan (1ng/ml). Din cauza problemelor de falsă pozitivitate. de urmarea cu stricteţe a specificaţiilor privind protocolul de lucru. • Soluţie concentrată de spălare – soluţie concentrată (10X). Se vor incuba simultan serul şi conjugatul în godeurile microplăcii sensibilizate în prealabil cu anticorpii monoclonali. Dacă se doreşte retestarea unei probe de ser. Calitatea şi acurateţea rezultatelor depind de maniera de lucru a fiecărui laborator în parte. după 30 minute de incubare la temperatura ambiantă. Rezultatul reacţiei este detectat la un spectrofotometru cu lungime de undă 450 / 620 nm.41). pentru antigene HBs şi anticorpi anti-HCV. serurile intermediare sau pozitive vor fi sistematic retestate.01% tiomersal – 1x 100ml.2.5N. este recomandat să se recolteze o nouă probă de ser de la pacienţii cu risc. • Control negativ – ser de control negativ (liofilizat): ser uman liber de galactomanan. antigene HBs şi anticorpi anti – HCV. negativ la testarea pentru anticorpi anti-HIV1 şi anti-HIV2. pentru a fi testată suplimentar. reacţia fiind stopată prin adăugarea acidului sulfuric 1. se vor utiliza doar materiale sterile. Materiale furnizate odată cu kitul • Microplăci cu 96 godeuri sensibilizate cu anticorpi monoclonali EBA–2 antigalactomanan. crescând astfel sensibilitatea reacţiei.2. Aceşti anticorpi permit o marjă de detecţie de 1 ng GM/ml. 1 buc.1. în vederea evitării contaminării accidentale a serului sau reactivilor. Tween 20 sol.2. După tratarea serului şi centrifugare. negativ pentru anticorpii anti-HIV1 şi anti-HIV2. • Control pozitiv – ser de control pozitiv (liofilizat): ser uman conţinând galactomanan. Galactomananul fiind termostabil. pentru antigene HBs şi anticorpi anti-HCV. dirijaţi contra GM aspergilar. întotdeauna se depozitează serul ca atare şi nu prelevatul tratat. Principiul testului Kitul Platelia Aspergillus este un test imuno-enzimatic de tip sandwich care permite detecţia galactomananului (GM) în serul uman. complexele sunt evidenţiate prin adiţia substratului. supernatantul este recuperat şi analizat rapid (în aceeaşi zi). Datorită caracterului ubicuitar al conidiilor de Aspergillus şi Penicillium.1%. Se recomandă manipularea în hotă cu flux de aer laminar clasă II. 2 x 1ml. sterilizarea nu poate garanta absenţa GM contaminant. negativ pentru anticorpi anti–HIV1 şi anti–HIV2. 160 . de aceea se va limita la maxim contactul serului sau al reactivilor cu aerul ambiant. Platelia ® Aspergillus 7. Acest test utilizează anticorpi monoclonali (Ac) de şobolan EBA-2. Se vor utiliza seruri de control pozitiv şi negativ pentru validarea rezultatelor. 7.

După utilizare. • Soluţie cromogenă TMB – soluţie cromogenă (concentrată): soluţie DMSO 90% cu 0. cu închidere ermetică. • Pipete simple şi multicanal.3.5 ml. • Hipoclorit de Na (apă Javel) şi bicarbonat de Na. 300 µl şi 1000 µl. de 1.5 ml capacitate. Conservarea reactivilor desigilaţi şi a celor reconstituiţi • Microplăcile – după deschiderea pachetului vidat. Mihai Mareş • Conjugat – conjugat gata de utilizare: anticorpi monoclonali anti-galactomanan marcaţi cu peroxidază.01% tiomersal – 1 x 8ml.Ingrid Apetrei. 6 ore la temperatura ambiantă (18° – 30°C) şi la întuneric. reglabile sau fixe.5 ml. dar nefurnizate odată cu kitul • Apă distilată sau perfect demineralizată pentru soluţia de spălare. Materiale necesare. • Hârtie absorbantă. 7. pot fi păstrate la 2°-8°C în ambalajul original. după ce a fost diluată. 100 µl. pentru măsurarea şi distribuirea a 50µl. timp de până la 5 săptămâni.5 N. • Ochelari de protecţie. • Apă purificată sterilă pentru reconstituirea serurilor de control. conservant: 0. 1 x 1 ml. • Centrifugă pentru tuburi Eppendorf conice de 1. capabile să suporte temperaturi de minim 100°C. este stabilă cca.2. • Soluţia cromogenă. 1 x 10.009% H2O2 şi 4% dimetilsulfoxid (DMSO). 161 Capitolul 7   . • Soluţie de tratare a serului (gata de utilizare): soluţie acidă EDTA. • Tuburi Eppendorf conice. • Agitator tip Vortex. aceasta se poate conserva 15 zile la 2°-8°C. • Serurile de control negativ. 7. 1x 60 ml. pot fi imediat congelate la – 20°C. semiautomat sau manual pentru microplăci.6% Tetra-Metil-Benzidină (TMB). • Sistem de citire a microplăcilor echipat cu filtre de 450 / 620 nm. pH 5.2. • Incubator de microplăci cu termostatare la 37°C. verificându-se periodic în privinţa desicării. pozitiv şi soluţia de calibrare – după reconstituire. fără conservanţi. poate fi păstrată la 2°25°C până la data înscrisă pe ambalaj. care să dezvolte minim 10000 rpm. • Soluţie de stopare (gata de utilizare): soluţie de acid sulfuric 1. • Soluţia concentrată de spălare – după diluare.2 conţinând 0. • Sistem de spălare automat. • Mănuşi de unică folosinţă. • TMB (Tetra-Metil-Benzidină) tampon substrat – tampon substrat pentru peroxidază (gata de utilizare): soluţie de acid citric şi acetat de Na. • Baie de apă cu termostatare la 1000C. dacă nu a suferit contaminări.4.

Se adaugă 100 µl din soluţia de tratare a serului. va fi lăsat 2-3 minute pentru rehidratare şi omogenizat uşor. Se recomandă manipularea în hotă cu flux de aer laminar clasă II. pentru a fi testată suplimentar. soluţia de calibrare şi controlul pozitiv – conţinutul unui astfel de flacon va fi reconstituit cu 1000 µ