You are on page 1of 34

Articles in PresS. Am J Physiol Heart Circ Physiol (September 10, 2010). doi:10.1152/ajpheart.00168.

2010

H-00168-2010_R4/1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Correspondence: Peter M. Kang, MD, Cardiovascular Institute, Beth Israel Deaconess Medical Center, 3 Blackfan Circle, CLS 910, Boston, MA 02215. Tel: (617) 735-4290; Fax: (617) 735-4202; E-mail: pkang@bidmc.harvard.edu Running title: Caspase-independent apoptosis in heart failure Soochan Bae, Parco M. Siu, Sangita Choudhury, Qingen Ke, Jun H. Choi, Young Y. Koh, Peter M. Kang Cardiovascular Institute, Beth Israel Deaconess Medical Center and Harvard Medical School, Boston, MA. Delayed activation of caspase-independent apoptosis during heart failure in transgenic mice overexpressing caspase inhibitor, CrmA

Copyright © 2010 by the American Physiological Society.

H-00168-2010_R4/2 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 Key words: AIF, PARP-1, doxorubicin, mortality, cardiomyopathy Abstract Although caspase activation is generally thought to be necessary to induce apoptosis, recent evidence suggests that apoptosis can be activated in the setting of caspase inhibition. In this study, we test the hypothesis that caspase-independent apoptotic pathways contribute to the development of heart failure in the absence of caspase activation. METHODS AND RESULTS: Acute cardiomyopathy was induced using a single dose of doxorubicin (DOX, 20 mg/kg) injected into male wild-type (WT) and transgenic (Tg) mice with cardiac-specific expression of CrmA, a known caspase inhibitor. Early (6 day) survival was significantly better in CrmA Tg (81%) than WT mice (38%). Twelve days after DOX injection, however, the mortality benefit had dissipated, and increased cardiac apoptosis was observed in both groups. There was, however, a significantly greater release of apoptosis inducing factor (AIF) from mitochondria to cytosol in CrmA Tg compared to WT mice, which suggests that an enhancement of activation in caspase-independent apoptotic pathways had occurred. Administration of a polyADP ribose polymerase 1 (PARP-1) inhibitor, 4-AN, to DOX treated mice resulted in significantly improved cardiac function, a significant blockade of AIF released from mitochondria, and decreased cardiac apoptosis. There were also significantly improved survival in WT (18% no 4-AN vs 89% with 4-AN) and CrmA Tg (13% no 4-AN vs 93% with 4-AN) mice 12 days after DOX injection. CONCLUSIONS: These findings suggest that apoptosis can be induced in the heart lacking caspase activation via caspase-independent pathways, and that enabling the inhibition of AIF activation may provide a significant cardiac benefit.

H-00168-2010_R4/3 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 Introduction Apoptosis is a tightly regulated, cell deletion process known to play an important role in various cardiovascular diseases, such as myocardial infarction, reperfusion injury, and the development of heart failure (15, 19). Although the caspases, a family of cysteine proteases, have been thought of as the critical enzymes in the induction and execution of apoptosis, there is accumulating evidence to suggest that caspase independent pathways play a significant role in cardiac cell death (3). The potential importance of caspase-independent pathways in the heart is highlighted by the fact that cardiomyocytes contain high levels of endogenous caspase inhibitors, which renders them relatively resistant to caspase-dependent apoptosis (20). Although some studies have shown that caspase inhibition reduces the acute loss of myocardium in various animal models (17, 38), other studies indicate that caspase inhibition might not be able to completely inhibit apoptosis (7, 25). Because of its potentially significant contribution to cell death in the heart, it is important to define the role of the caspase-independent pathway in cardiac apoptosis more fully. The best studied example of caspase-independent apoptosis involves apoptosis inducing factor (AIF) (5, 8, 9, 28, 34). AIF is an NADH-oxidase produced as a 67-kDa protein containing an N-terminal mitochondrial localization signal sequence (28, 34). It is processed into a 57-kDa mature form by calpain in mitochondria, released into the cytosol in response to apoptotic stimulation and is able to translocate into the nucleus and induce DNA fragmentation without caspase activation (20). This sequence of events is supported by evidence that AIF microinjected into cells can induce apoptotic changes, such as chromatin condensation, that cannot be blocked by caspase inhibition alone, as, for instance, by zVAD.fmk or the over-expression of Bcl-2 (5, 20, 28). Furthermore, AIF can trigger DNA fragmentation in Apaf-1 and caspase-9 deficient cells (5), an

In the heart. a highly conserved 116-kDa nuclear enzyme. 30. CrmA Tg mice were identified by the appearance of a effect that is probably mediated through the direct activation of caspase-3 (16) by AIF. In the present study. 13. involved in DNA repair (40). we used alpha myosin heavy chain (αMHC) promotor to generate transgenic (Tg) mice with cardiac-specific expression of cytokine response modifier A (CrmA). Using acute doxorubicin (DOX)-induced cardiomyopathy with significant cardiac apoptosis (26.8-naphthalimide (4-AN). Cardiac specific expression was achieved using αMHC promoter. 40). 32). PARP-1 facilitates both the release of AIF from mitochondria and AIF nuclear translocation without the mediation of Bcl-2 proteins and caspase activation (1. Several studies have shown that AIF is regulated by polyADP ribose polymerase 1 (PARP-1). AIF has been implicated in apoptosis induced by oxidative stress and heart failure (6. we sought to define the contribution of caspase-independent apoptosis. and to investigate its role in the development of heart failure by administering 4-Amino-1. and reverse MHC: 5'ACTGACGAGATTGACGGTGGAG -3'. The genotypes of CrmA transgenic mice were identified by polymerase chain reaction (PCR) with PCR primers as follows: forward MHC: 5'-CGGTGTAAAAGAGGCAGGG AAG-3'. . to determine whether caspase-independent apoptosis is activated in the setting of caspase inhibition in vivo. together with cytochrome c.H-00168-2010_R4/4 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 Materials and Methods Generation of CrmA transgenic (CrmA Tg) mice A schematic diagram of the construct used to generate Tg mice is shown in Figure 1A. 41). from mitochondria to the cytosol in ischemic neonatal cardiomyocytes characterized by caspase-independent DNA degradation (4). 29. a potent (PARP-1) inhibitor. Its mature form is released. 31). a known inhibitor of caspases (10.

.) injection of 20 mg/kg DOX (Bedford labs. which is just prior to the time point at which the most significant DOX-induced mortality is observed. 23). This method uniquely provides measures of left ventricular (LV) performance that are more specific to the heart and less affected by vascular loading conditions (27). 4-AN (3mg/kg/day. . Plymouth Meeting. revised 1996). PA) starting 1 day before the DOX injection. we used the left ventricular (LV) pressurevolume loop measurement. Biomol. 85-23. which may be particularly important in our acute heart failure model. and were approved by the Institutional Animal Care and Use Committee at Beth Israel Deaconess Medical Center. 525-bp band (Figure 1B). For cardiac functional analysis 10 days after DOX injection. and all animals were observed daily for signs of heart failure. a dose shown to induce significant acute heart failure in 1-2 weeks (18. Western blot analysis for CrmA was performed with anti-CrmA antibody (BD Pharmingen. San Diego. WT and CrmA mice were treated daily with PARP-1 inhibitor. male CrmA Tg mice and wild type (WT) littermates were treated with a single intraperitoneal (ip.. OH). CA).H-00168-2010_R4/5 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 Hemodynamic measurements Baseline cardiac function was analyzed using echocardiography. ip. To determine the effect of PARP inhibition. micro-tip DOX-induced cardiomyopathy and 4-AN treatment Twelve-week old.4 Fr. Pressure-volume parameters were measured under isoflurane (2%) inhalant anesthesia using a 1. Bedford. The investigations conform to the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH publication no. Control mice were treated with an equal volume of vehicle ip.

pressure-volume catheter (Scisense Inc. Biochemical and histological analyses Western immunoblot analyses. More detailed descriptions of the analyses are outlined in the Online Supplementary Information. but not late. CA). CO). afterload. Beat by beat pressure-volume parameters including stroke work (SW). 14. Houston. preload. Data was recorded using a Powerlab system (ADInstruments. . Probability (p) values of <0. and contractility were measured and analyzed using CardioSoft Pro software (CardioSoft.H-00168-2010_R4/6 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 Results Improvement in early. but no morphological or echocardiographic differences Statistical analyses All data are expressed as mean ±SEM. Ontario. and terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) staining. Survival rates after doxorubicin were analyzed with the Wilcoxon test or log-rank test. survival in CrmA Tg mice after DOX administration CrmA transgenic mice showed cardiac specific expression of CrmA as determined by protein expression (Figure 1C and 1D). Colorado Springs.05 were considered significant. the assays for caspase-3. and -9. To test the significance of hemodynamic changes. cardiac output (CO).0 (San Diego. we conducted two-way ANOVAs followed by Bonferroni post hoc analysis using GraphPad Prism5. Statistical analyses between two groups were performed with unpaired Student t tests. 32). Canada) inserted into the right common carotid artery and advanced into the left ventricle. TX). and immunohistochemistry for AIF were preformed as described previously (11. -8.

but DOX caused a significant increase in mortality in both WT and Crm Tg mice. Six days after DOX injection.H-00168-2010_R4/7 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 from WT mice at baseline. (Supplement Table 1 and Supplement Table 2) Initially. 2) WT+DOX. The survival benefit associated with cardiac-specific . after 10 days. However. DOX. after 10 days. and both groups showed a significant and similar decrease in cardiac function compared with controls (Table 2). We compared four groups of mice: 1) WT+Vehicle. there was no longer any difference between WT and CrmA Tg mice. (Figure 1E) Furthermore. This finding suggests that the early survival benefit in CrmA Tg mice noted at 6 days was associated with less severe cardiac dysfunction measured a day earlier. however. Since changes in molecular and hemodynamic parameters precede changes in mortality. to determine whether the cardiac-specific inhibition of caspase has an effect on mortality. As expected. survival was significantly greater in CrmA Tg (81%) compared to WT mice (38%). 3) CrmA Tg+Vehicle. mice 5 days after DOX treatment (Table 1). at 12 days CrmA Tg mice no longer displayed a relative survival benefit (5% CrmA Tg vs 10% WT. p=not significant). Although baseline cardiac function in untreated WT and CrmA Tg mice was similar. was injected into WT and CrmA Tg mice. We also measured cardiac function using the LV pressure-volume loop 5 and 10 days after DOX or control vehicle injection. there were no deaths associated with vehicle injection (Figure 1E). a significant decrease in cardiac function was evident in WT. WT and CrmA Tg mice showed similar degrees of DOX-induced cardiac dysfunction and correspondingly similar mortality. where the peak mortality difference is found. and 12 days. but not CrmA Tg. the hemodynamic and molecular analyses performed at 5 and 10 days correspond to the mortality findings at 6 days. and 4) CrmA Tg+DOX. The increase in mortality was not uniform. which has been shown to induce acute cardiac dysfunction and death associated with the activation of cardiac apoptosis. (Supplement Table 2). However.

In contract. We also confirmed caspase inhibition in CrmA Tg mouse hearts. Next. In contrast. CrmA.H-00168-2010_R4/8 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 Delayed activation of AIF in CrmA Tg mice after DOX injection To determine the mechanisms that might contribute to mortality differences in WT and CrmA Tg mice after DOX injection. in CrmA Tg mouse heart. caspase-8 and caspase-9 activities in WT mice compared to vehicle at both 5 and 10 days (Figure 2A . To confirm that CrmA overexpression resulted in the inhibition of caspase activation. was no longer evident 10 days after DOX injection. . there were significantly fewer TUNEL positive cells in CrmA Tg than WT mice 5 days after DOX injection.2C). rather than the later. caspase-8 and caspase-9 activities were nearly completely inhibited at 5 and 10 days after DOX injection. caspase-3. expression of the caspase inhibitor. caspase-8 and caspase-9 in heart lysates from WT and CrmA Tg mice after DOX and vehicle injection. we assessed cardiac apoptosis using TUNEL staining. to determine if caspase inhibition in CrmA Tg mice inhibits cardiac apoptosis. by measuring the cleavage of ICAD (inhibitor of caspase-activated DNase). We found significant ICAD cleavage in WT mouse hearts after DOX injection. biochemical and histological analyses. however. However. stages of DOX-induced cardiomyopathy. Doxorubicin significantly increased TUNEL positive cardiomyocytes at both 5 and 10 days in both WT and CrmA Tg mice compared to vehicle injected mice (Figure 2E). We found that DOX induced significant activation of caspase-3. we measured the activities of caspase-3. we harvested hearts at 5 days and 10 days for molecular. This early protection against apoptosis in the CrmA Tg group. thus appears to be associated with the earlier. ICAD cleavage was completely attenuated both at 5 and 10 days after DOX injection in CrmA Tg mouse hearts (Figure 2D).

4-AN. caspase-independent apoptotic pathways. . and 4) CrmA Tg+DOX+4-AN. there was significant release of AIF in both WT (p<0. 3) CrmA Tg+DOX+Vehicle. To inhibit AIF. In contrast. that 4-AN effectively reduced PARP-1 activation by DOX to the baseline level in both WT and suggesting that a significant increase in cardiac apoptosis occurred in response to DOX despite a complete inhibition of caspase (Figure 2E). and that this event may explain the loss of the early survival benefit conferred by caspase inhibition. WT mice showed no significant increase in the release of AIF from mitochondria to the cytosol 5 days after DOX injection (Figure 3A and 3B). including its translocation from the mitochondria to the nucleus (29. We therefore examined the activation of AIF-induced apoptosis. PARP-1 has been shown to regulate AIF. as expected. starting 1 day before DOX injection using the following groups: 1) WT+DOX+Vehicle.05 vs vehicle) and CrmA Tg mice (p<0. 40). Significant cardiac apoptosis in the absence of caspase activation in CrmA Tg heart raises the possibility of increased activity in alternative. and. 2) WT+DOX+4-AN. We found that DOX significantly increased PARP-1 activity in both WT and Tg mice 10 days after injection. a significant release of AIF in CrmA Tg mice at 5 days suggested an early activation of AIF.H-00168-2010_R4/9 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 PARP-1 inhibition significantly improved mortality by inhibiting AIF-induced apoptosis We next sought to determine whether we could improve survival in DOX-induced cardiomyopathy by inhibiting AIF-induced apoptosis. AIF translocation from mitochondria is an early hallmark of AIF activation.05 vs vehicle and 5 day DOX) but AIF release in CrmA Tg was significantly greater at 64% than in WT mice. Ten days after DOX injection. mice were thus treated daily with a potent inhibitor of PARP-1 activation. This finding suggests that an activation of AIF may play a role in the late stage of DOX-induced cardiomyopathy.

6 ± 1. Next. These findings suggest that PARP-1 inhibition effectively blocks DOX-induced PARP-1 activation as well as AIF translocation. Vehicle treatment was associated with very low levels of baseline cardiac apoptosis (<0.6%) and CrmA Tg (5.0%) compared to untreated hearts. Ten days after DOX injection. PARP-1 inhibitor alone did not exert any significant effect on hemodynamic parameters in vehicle mice. we determined survival rates for both WT and CrmA Tg mice after DOX injection with or without 4-AN. In this experiment. Consistent with these results. We next examined the question of whether inhibiting AIF translocation via PARP-1 inhibition affects the rate of DOX-induced cardiac apoptosis.8 ± 1. to determine if the inhibition of AIF induced apoptosis by 4-AN translates into improved survival in mice treated with DOX. Finally. but the increase was significantly smaller after 4-AN treatment in both WT (6. we examined AIF translocation from the mitochondria to the cytosol. to determine whether pre-treatment with 4-AN attenuates AIF-induced apoptosis. We also observed significant AIF translocation to the nucleus after DOX injection in both WT and CrmA Tg mouse hearts.H-00168-2010_R4/10 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 CrmA Tg mice hearts (Figure 4A). Caspase-3 activity was not significantly inhibited by 4-AN alone (Figure 4B). These findings suggest that the attenuation of AIF activation by PARP inhibition significantly reduced cardiac apoptosis and improved cardiac function in DOXinduced cardiomyopathy. We found that 4-AN significantly blocked DOX-induced AIF translocation in both WT and CrmA Tg mouse hearts (Figure 4C – 4D). which were blocked by 4-AN (Figure 4E). there were 55% .1%) in both WT and CrmA Tg mice hearts (Figure 5A and 5B). the number of TUNEL positive cardiomyocytes was significantly increased in both WT and Crma Tg groups. we also found that treatment with 4-AN significantly mitigated the DOX-induced impairment of cardiac function in both groups (Table 1).

a potent PARP inhibitor. improved cardiac function. caspase-independent apoptosis likely contributes significantly to DOX-induced cardiomyopathy even in WT mice. Both WT and CrmA Tg mice showed a significant benefit. 13%) mice compared to those without 4-AN 12 days after DOX injection (Figure 6). since treatment with 4-AN. CrmA Tg mice showed an initial survival benefit associated with the inhibition of caspase activation in response to DOX-induced acute heart failure compared to WT littermates. a potent PARP inhibitor. there was a delayed but significant activation of AIF-induced. and increased survival in both CrmA Tg and WT mice compared and 75% survival rate 6 days after DOX injection. However. significantly decreased AIF-induced apoptosis. in comparison to CrmA Tg mice. 18 %) and CrmA Tg (93% vs. . Nevertheless. and the overall mortality rate was ultimately similar to wild-type mice. Treatment with 4-AN. since there was both a significant increase in apoptosis and activation of caspases. which showed no significant apoptosis at 5 days and no caspase activation. caspaseindependent apoptosis. and 18% and 13% survival rate 12 days after DOX injection in WT and CrmA Tg mice. we showed a significant activation of caspase-independent apoptosis in DOX-induced cardiomyopathy in Tg mice with cardiac-specific caspase inhibition via overexpression of CrmA. suggesting that the inhibition of AIF activation by 4-AN may play an essential role in protecting against DOX-induced cardiac dysfunction. and increased survival in both CrmA Tg and WT mice compared to those without 4-AN after DOX injection.H-00168-2010_R4/11 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 Discussion In this study. We conclude that caspase-dependent apoptosis plays an important role in WT mice at 5 days. significantly decreased AIF-induced apoptosis. improved cardiac dysfunction. We found that pretreatment with 4-AN significantly improved survival in both WT (89 % vs. respectively.

nuclear DNA fragmentation was present. which negated the initial benefit of caspase inhibition by CrmA overexpression. Caspase inhibition has been shown to reduce the acute loss of myocardium in various animal models (17. and significant tissue damage still observed (12. However. These novel findings suggest the potentially significant role of caspase-independent apoptosis in the development of heart failure in this model. . It thus appears that caspase-independent pathways. other studies indicate that caspase inhibition alone might not be sufficient to eliminate apoptosis completely (25). they both activate apoptotic programs. however. and contribute significantly to apoptotic cell death in heart. Our current findings suggest. -8 and -9 activation in CrmA Tg mice after DOX exposure suggesting that this is an effective strategy for inhibiting caspase activation in a cardiac-specific manner in vivo. In addition. that caspase-dependent and caspase-independent apoptosis have different and distinct time courses. 40). However. but when released from mitochondria. and the overall mortality rate was ultimately similar to that of wild-type mice.fmk. In this study. such as those mediated by PARP-1/AIF. AIF and cytochrome c are important for cell viability when they are located in mitochondria. by 12 days after DOX injection the CrmA Tg survival rate had fallen to the WT level. Several studies have shown that even in the presence of complete caspase inhibition. we showed that caspase inhibition using CrmA successfully blocked caspase-3. 38). such as pharmacological caspase inhibition by zVAD. Although we observed an initial survival benefit after 6 days in response to acute heart failure induced by DOX in CrmA Tg mice compared to WT littermates.H-00168-2010_R4/12 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 to those without 4-AN after DOX injection. the initial improvement in survival was followed by a delayed but exaggerated increase in mortality. may play an important role in the induction of apoptosis.

29. and is further enhanced in the setting of caspase inhibition (2. AIF mediates large-scale DNA fragmentations by enhancing the activity of endonuclasese G (Endo G) (21. 36). Other investigators have shown that in a murine model of heart failure. is activated. After translocating to the nucleus. 40) that has been shown to facilitate both the release of AIF from mitochondria and AIF nuclear translocation (1. numerous studies have reported that mitochondrial release of AIF takes place downstream of cytochrome c release. such as AIF-induced apoptosis. In the present studies. caspase-independent apoptosis. 13. 21. we can’t exclude the possibility that PARP-1 inhibition may be involved in caspasedependent as well as caspase-independent pathways. the extent of AIF’s mitochondrial-to-nuclear translocation was reduced by the inhibition of PARP-1 . there was a significant release of AIF in both WT and CrmA Tg heart without a change in total AIF. we demonstrated that PARP-1 inhibition significantly attenuates the DOX-induced AIF release from mitochondria in both WT and CrmA Tg mice.H-00168-2010_R4/13 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 at 10 days after DOX injection. 40). 35). Indeed. Since apoptosis is a highly orchestrated process involving multiple pathways. PARP inhibition attenuates the development of hypertrophy and the mitochondrial-to-nuclear translocation of AIF. PARP-1 is a highly conserved. In a mouse model of heart failure induced by transverse aortic banding. This result further supports the idea that PARP-1 activation is most likely the main mechanism of AIF activation and AIF may be an essential downstream effector in the cell death program initiated by PARP-1. 116-kDa nuclear enzyme involved in DNA repair (29. Molnar et al has demonstrated an activation of PARP-1 in the failing heart by showing an increased abundance of poly-ADP ribosylated proteins (22). In fact. PARP1/AIF activation may also play an important role in the induction of apoptosis in WT mice with DOX-induced heart failure. These findings also support the notion that in the setting of caspase inhibition.

While further studies are needed to determine whether caspase-independent apoptosis plays a significant role in other models of cardiomyopathy. DOX-induced cardiomyopathy was chosen to test our hypothesis in an in vivo animal model of cardiac apoptosis during the progression of heart failure because apoptotic cell death is a key component in DOX-induced cardiotoxicity (26. we may be able to significantly improve cardiac function and mortality in this model. Although death associated with the administration of DOX in experimental animals may be multifactorial. such as myocardial infarction. Studies suggest that DOX induces caspaseindependent as well as caspase-dependent apoptosis. current studies suggest that the caspase independent apoptotic route is also involved in the death of cardiomyocytes by DOX. cardiomyopathy is the most important cause of mortality after DOX injection (26. Our findings provide further clarification of the role of caspase-independent apoptosis in the heart. Our results suggest that by inhibiting apoptosis. and contribute . 31).H-00168-2010_R4/14 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 activation. The mechanism responsible for PARP-1-dependent release of AIF from mitochondria remains to be identified. While the inhibition of apoptosis promises to be an important target for therapeutic intervention. 39). 39). better defining the significance of specific apoptotic mechanisms will be critical in understanding how the myocardium is lost during heart failure. In the present study. through the use of either isoindolinone-based PARP inhibitor (INO-1001) or PARP-1 genetic deficient mice (37). but it has been proposed that the cell death pathway initiated by PARP-1 activation may be mediated by AIF (40). and showed that apoptosis is initiated via both caspase-3 activation and AIF nuclear translocation by mitochondrial damage after DOX exposure (33. we used a well-established mouse model of DOX-induced acute heart failure that shows a good correlation between the degree of myocardial apoptosis and the severity of DOX-induced heart failure (24).

H-00168-2010_R4/15 325 326 to a better understanding of the molecular mechanisms that are involved in AIF-induced cardiac apoptosis. .

H-00168-2010_R4/16 327 328 329 330 Acknowledgments This study was supported in part by the grants from National Institutes of Health RO1 HL091998 (PMK). .

Cregan SP. Ameisen JC. Alonso M. 2002. Sanchis D. Cardiovasc Res 85: 28-37. Estaquier J. 8. Bahi N. 2004. 2010. Dawson VL. J Biol Chem 281: 22943-22952. Mitochondrial release of apoptosis-inducing factor occurs downstream of cytochrome c release in response to several proapoptotic stimuli. Flavopiridol induces apoptosis in glioma cell lines independent of retinoblastoma and p53 tumor suppressor pathway alterations by a caspase-independent pathway. 5. J Cell Biol 159: 923-929. Comella JX. Role of AIF in caspase-dependent and caspase- independent cell death. Kirshenbaum LA. Zsengeller Z. Cande C. Switch from caspase-dependent to caspase-independent death during heart development: essential role of endonuclease G in ischemia-induced DNA processing of differentiated cardiomyocytes. Role of AIF in cardiac apoptosis in hypertrophic cardiomyocytes from Dahl saltsensitive rats. Martinou JC. Newcomb EW. Antonsson B. 6. Yalamarti B. Oncogene 23: 2785-2796. 2008. Mitochondrial-to-nuclear translocation of apoptosis-inducing factor in cardiac myocytes during oxidant stress: potential role of poly(ADPribose) polymerase-1. 2003. Mol Cancer Ther 2: 139-150. 2002. Choi JH. Llovera M. 3. Kang PM. 2006. 7. Front Biosci 13: 2495-2503. Role of caspase-independent apoptosis in cardiovascular diseases. Xiao CY. . 2004. Ke Q. Chen M. Kumar SR. Choudhury S. Miller DC.H-00168-2010_R4/17 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 References 1. Ballester M. Bae S. Szabo C. Cecconi F. 4. Bae S. Cardiovasc Res 63: 682-688. Arnoult D. Kroemer G. Tamasdan C. Kang PM. Zhang J. 2. Apoptosis-inducing factor (AIF): key to the conserved caspase-independent pathways of cell death? J Cell Sci 115: 4727-4734. Parone P. Slack RS. Yalamarti B. Dessen P.

Dawson VL. Circulation 103: 1984-1991. 2000. Gurevich RM. Lewensohn R. Usheva A. Nuclear and mitochondrial conversations in cell death: PARP-1 and AIF signaling. Regula KM. Han Y. Overexpression of HAX-1 protects cardiac myocytes from apoptosis through caspase-9 inhibition. Chen YS. Park DS. Dawson VL. Trends Pharmacol Sci 25: 259-264. J Cell Biol 158: 507-517. 2004. Booth CJ. Flavell RA. Kang PM. Serpin protein CrmA suppresses hypoxia-mediated apoptosis of ventricular myocytes. Hong SJ. Dawson TM. 2006.H-00168-2010_R4/18 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 9. Inayat I. 2001. 13. 10. Liu Z. Bodyak N. Haunstetter A. Yu SW. Aoki H. Zhivotovsky B. 2003. 15. Masud A. Dawson TM. Cecconi F. Kang PM. 2002. Porter GA. Mehal WZ. Trends Mol Med 9: 177-182. Circ Res 87: 118-125. Lakhani SA. Apoptosis-inducing factor is involved in the regulation of caspase-independent neuronal cell death. Joseph B. Izumo S. Bisping E. Marchetti P. 12. Izumo S. Formstecher P. Mitochondrial dysfunction is an essential step for killing of non-small cell lung carcinomas resistant to conventional treatment. Pu WT. Kirshenbaum LA. 11. . Science 311: 847-851. Fortin A. Cregan SP. Jr. 14. Apoptosis in heart: basic mechanisms and implications in cardiovascular diseases. Kroemer G. Callaghan SM. MacLaurin JG. 16. 2006. Morphological and molecular characterization of adult cardiomyocyte apoptosis during hypoxia and reoxygenation. 2002. Rigor D.. Caspases 3 and 7: key mediators of mitochondrial events of apoptosis. Kuida K. Oncogene 21: 65-77. Kroemer G. Kang PM. Circ Res 99: 415-423. Slack RS.

Li Y. 18. Ischemia/reperfusion injury at the intersection with cell death. Papp Z. Picard MH. 2006. Seyfarth M. Gero D. Szabo C. Czifra N. Blocking caspase-activated apoptosis improves contractility in failing myocardium. Minatoguchi S. Molnar A. Logue SE. Cell Death Differ 6: 516-524. Laugwitz KL. Jassal DS. Zsengeller Z. Li L. Gustafsson AB. Gottlieb RA. Kroemer G. 22. Gillitzer A. Hum Gene Ther 12: 2051-2063.H-00168-2010_R4/19 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 17. 1999. J Mol Cell Cardiol 38: 21-33. Pragst I. Bagi Z. Neilan TG. 23. Moretti A. Pinkernell K. Gerard NP. Batkai S. Mol Med 12: 143-152. Weig HJ. 2007. Papp JG. 2001. 2006. 2006. Kunos G. Mukhopadhyay P. Harvey-White J. Esaki M. Bloch KD. Kanamori H. Hasko G. Okada H. Takemura G. Blake SL. Ott T. Fujiwara T. Apoptosis-inducing factor: vital and lethal. Khai NC. 19. Giordanetto F. Stadele C. Janssens SP. Lorenzo HK. Penninger J. Ichinose F. Rajesh M. Buys ES. Szuts V. Susin SA. J Am Coll Cardiol 50: 528-536. Galajda Z. Miyata S. Activation of the poly(ADP-ribose) polymerase pathway in human heart failure. . Graveline A. Modjtahedi N. 20. Vaszily M. Varro A. Pharmacological inhibition of CB1 cannabinoid receptor protects against doxorubicin-induced cardiotoxicity. Ungerer M. Fujiwara H. Preventive effect of erythropoietin on cardiac dysfunction in doxorubicin-induced cardiomyopathy. caspase-independent effector of cell death. Furutani E. Lacza Z. Samali A. Raher MJ. Toth A. Liaudet L. Trends Cell Biol 16: 264-272. Pacher P. Edes I. Apoptosis inducing factor (AIF): a phylogenetically old. Circulation 113: 535-543. Maruyama R. Madeo F. 2005. Kroemer G. Ogino A. 24. Perez- Sanz TM. Schomig A. 21. Scherrer-Crosbie M.

Brat DJ. Pieper AA. Szabo C. 1998. Mabley JG. Kawamura S. Kronheim SR. Nat Cell Biol 5: 97-99. Penninger JM. Activation of poly(ADP-ribose) polymerase contributes to development of doxorubicin-induced heart failure. Krug DK. Verma A. Batkai S. 2007. Gupta A. Cell 69: 597-604. Effect of caspase inhibitors on myocardial infarct size and myocyte DNA fragmentation in the ischemia-reperfused rat heart. Blackshaw S. Liaudet L. Pickup DJ. Kroemer G. Miura T. 26. Nagayama T. Sleath PR. 29. Matsuzaki M. Virag L. Watkins CC. 28. 1999. Takemura G. 2000. Cardiovasc Res 45: 642-650. Hasko G. J Pharmacol Exp Ther 300: 862-867. 25. Pacher P. 1992. Doxorubicin-induced cardiomyopathy. 27. dysfunction. Black RA. Ray CA. 2008. Ikeda Y. Kimura M. Iwatate M. Circulation 116: 506-514. 30. Nat Protoc 3: 1422-1434. Pacher P.H-00168-2010_R4/20 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 Disruption of nitric oxide synthase 3 protects against the cardiac injury. Iliskovic N. Bai P. Singal PK. . Kass DA. Fujiwara H. Greenstreet TA. 31. N Engl J Med 339: 900- 905. Snyder SH. Iwamoto H. Mitochondria. 2003. Proc Natl Acad Sci U S A 96: 3059-3064. Viral inhibition of inflammation: cowpox virus encodes an inhibitor of the interleukin-1 beta converting enzyme. AIF and caspases--rivaling for cell death execution. and mortality induced by doxorubicin. Mukhopadhyay P. Salvesen GS. Okamura T. Measurement of cardiac function using pressure-volume conductance catheter technique in mice and rats. Wang ZQ. Poly(ADP-ribose) polymerase-deficient mice are protected from streptozotocin-induced diabetes. 2002.

Lee YJ. Rigor DL. Jacotot E. Chai J. Kim HS. The CO/HO system reverses inhibition of mitochondrial biogenesis and prevents murine doxorubicin cardiomyopathy. Science 298: 1587-1592. Larochette N. Response of caspase-independent apoptotic factors to high salt diet-induced heart failure. Ali AS. Maehara K. 38. Circulation 97: 276-281. Lee JH. Uren RT. Carraway MS. Dewson G. Susin SA. 35. Lorenzo HK. J Biol Chem 280: 2266-2274. Xue D. Lithgow T. 1998. Newmeyer DD. 36. Zsengeller Z. Poly(ADP-Ribose) polymerase promotes cardiac remodeling. Piantadosi CA. Wang X. 1999. Mechanisms of AIF-mediated apoptotic DNA degradation in Caenorhabditis elegans. Maruyama Y. Mitochondrial release of pro-apoptotic proteins: electrostatic interactions can hold cytochrome c but not Smac/DIABLO to mitochondrial membranes. . Molecular characterization of mitochondrial apoptosisinducing factor. Lee JH. Yang C. 2005. 34. Siderovski DP. Bae S. 2007. Marzo I. 37. Snow BE. 2005. Siu PM. Penninger JM. 2005. Xiao CY. Zamzami N. contractile failure. Kollai M. J Pharmacol Exp Ther 312: 891-898. J Clin Invest 117: 3730-3741. Loeffler M. J Mol Cell Cardiol 42: 678-686. 2002. 39. 33.H-00168-2010_R4/21 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 32. and translocation of apoptosisinducing factor in a murine experimental model of aortic banding and heart failure. Seo YJ. Kiss L. Brothers GM. Suliman HB. Kroemer G. Shi Y. Yaoita H. Chen M. Aebersold R. Induction of caspase- independent apoptosis in H9c2 cardiomyocytes by adriamycin treatment. Mol Cell Biochem 270: 13-19. Kang PM. Bodyak N. 2007. Goodlett DR. Bonzon C. Li H. Welty-Wolf KE. Nature 397: 441-446. Youn HJ. Szabo C. Attenuation of ischemia/reperfusion injury in rats by a caspase inhibitor. Mangion J. Jeon MH. Ogawa K. Kluck RM. Reynolds CM. Costantini P.

1997. Poirier GG. Muzio M. Poitras MF. Dawson VL. Zhou Q. Wang H. 41. J Biol Chem 272: 7797-7800. Science 297: 259-263. Orth K. Mediation of poly(ADP-ribose) polymerase-1-dependent cell death by apoptosis-inducing factor. Coombs C. Dixit VM. Bowers WJ. Yu SW.H-00168-2010_R4/22 443 444 445 446 447 448 449 450 40. Analysis of five caspases. Dawson TM. Target protease specificity of the viral serpin CrmA. Snipas S. Salvesen GS. 2002. . Federoff HJ.

Figure Legends Figure 1. DOX: 5 and 10 days after DOX injection. (n=5-7/group) D. The early term survival of WT/DOX mice was significantly less than CrmA/DOX mice (at day 6. (n = 5-7/group). caspase-8-like (B). Caspase-3-like (A).H-00168-2010_R4/23 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 Figure 2. Cardiac specific expression was achieved using αMHC promoter. C. n=6/group (vehicle) and 21/group (DOX). Schematic diagram of the construct used to generate Tg mice with cardiac specific overexpression of CrmA. A. GAPDH was used as an internal control. Representative Western immunoblot analysis of different tissues from CrmA Tg mouse. E.05.05. Generation of CrmA Tg mice and survival of DOX-induced cardiomyopathy in WT and CrmA Tg mice. Representative Western immunoblots of ICAD of WT and CrmA Tg mice 5 (D5) and 10 (D10) days after DOX injection. E. B. GADPH is the internal loading control. Representative Western immunoblot analysis of heart tissues from WT and CrmA Tg mice hearts. NS=not significant. Genotyping of CrmA Tg mice. TUNEL staining in WT and CrmA Tg mice 5 and 10 days after DOX injection. Veh: Vehicle.C. Twelve day survival curves for WT and CrmA Tg mice after DOX (20 mg/kg) or vehicle injection. V=Vehicle injected control at 10 days. * P < 0.05 by Wilcoxon’s test) but the DOX groups did not differ at day 12. and caspase-9-like (C) activities in WT and CrmA Tg mice 5 and 10 days after DOX injection. A . P <0. CrmA transgenic mice were identified by the appearance of a 525-bp band in tail genomic DNA. D. . Caspase inhibition in DOX-induced cardiomyopathy in WT and CrmA Tg mice. * P < 0. NS=not significant.

A. Figure 3. *P < 0. (n=6-8) Figure 4. The two rightmost columns of blots represented the DOX+4-AN conditions for the WT and CrmA groups. The effect of PARP inhibition on AIF release 10 days after DOX injection with or without 4-AN. (n = 4). *P<0.05. α-Actinin = red.H-00168-2010_R4/24 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 Figure 5. TUNEL staining of WT and CrmA Tg mice 10 days after DOX injection with or without 4-AN.05. C. Quantification of TUNEL staining. Representative Western immunoblots of AIF in the mitochondria-free cytosolic fraction and total AIF in WT and CrmA Tg mice 5 and 10 days after DOX injection. . * P < 0. Magnification: 60x. Nuclei= blue. B. B. PARP activity assay in WT and CrmA Tg mice 10 days after DOX injection. α-Actinin = red. GAPDH was used as an internal control.05. (n =4). Quantification of cytosolic protein content of AIF. DOX or DOX plus 4-AN administration. E. The purity of the cytosolic proteins was examined by immunoblots of (cytosolic specific) GAPDH and (mitochondrial specific) COX IV. * P < 0.05. cytosolic fraction of WT or CrmA heart after vehicle. (n = 4). AIF release in DOX-induced cardiomyopathy in WT and CrmA Tg mice. Nuclei= blue. Quantification of cytosolic protein content of AIF. A. (n = 4). AIF Immunofluorescent staining of WT and CrmA Tg mice 5 days after DOX injection with or without 4-AN. Representative Western immunoblots of AIF in the mitochondria-free. B. Representative images of TUNEL staining in WT and CrmA Tg mice with or without 4-AN. Individual representative images are identified by a line between images. * P < 0. NS=not significant. TUNEL= green. D.05. AIF= green. Caspase-3-like activities assay in WT and CrmA Tg mice 10 days after DOX injection. A. NS=not significant. Magnification: 60x.

(n=6/vehicle groups. Survival graph of WT and CrmA Tg mice with 4-AN (3mg/kg) administration after DOX injection. Survival was monitored for up to 12 days. 10-18/DOX groups) . *P<0.05.H-00168-2010_R4/25 497 498 499 500 501 Figure 6.

6Kb) αMHC promotor (5. heart lung liver kidney D.4Kb) E E E P B.5kb) P E CrmA (1. WT Hearts CrmA Tg CrmA GAPDH CrmA C A GAPDH E.05 (Day 6) 0 1 2 3 4 5 6 7 8 9 10 11 12 P=NS (Day 12) Days after injection Figure 1 . 100 WT+Veh CrmA+Veh WT+DOX CrmA+DOX Survivial Rate (%) 80 60 40 20 0 P<0. hGH polyA (0.A. 500 bp CrmA C.

A. Ca aspase-3-like Activ vity (Arbitary Units) 25 20 15 10 5 0 B. TU UNEL + Cardiomyo ocytes (%) 5 days 40 30 20 10 0 Veh DOX 10 days p=NS CrmA Tg D5 D10 * * * Veh DOX Veh * * ICAD Cleaved form GAPDH DOX Veh DOX WT CrmA WT CrmA Figure 2 . WT V D5 D10 V E. 25 20 15 10 5 0 10 days Ca aspase-9-like activ vity (Arbitary Unit) * 5 days 10 days * * 5 days 20 * 15 5 days 10 days * NS NS NS NS 10 * 5 NS NS Veh Dox Veh Dox Veh Dox Veh Dox Veh Dox Veh Dox Veh Dox Veh Dox 0 Veh Dox Veh Dox Veh Dox Veh Dox WT CrmA WT CrmA WT CrmA D. Ca aspase-8-like Activ vity (Arbitary Units) C.

75 0.00 5 days 10 days * NS * * WT CrmA Figure 3 . A AIF Release (AIF cy ytosol/AIF total) 0 day 1.50 0.A.25 0.00 1 00 0. 0 day AIF (Cytosol) AIF (Total) GAPDH CP COXIV WT 5 days 10 days 0 day CrmA 5 days 10 days CP CP CP CP CP B.

AIF (cytosol) AIF (total) GAPDH AIF release (Fold of Vehicle e) * * * * 3 2 1 0 WT CrmA Figure 4. A-D . Veh WT DOX DOX DOX +4-AN +4-AN Veh CrmA DOX DOX DOX +4-AN +4-AN D. 20 Vehicle Dox Dox+4-AN NS NS * PAR Activity RP (Fold of Vehicle) o * * * * NS 2 10 1 0 0 WT CrmA WT Vehicle 4 CrmA DOX DOX+4-AN C. 3 Vehicle DOX DOX+4-AN B.Caspas se-3-like Activity y (Ar rbitary Unit) A.

E 4 . E Sham DOX DOX+4-AN WT CrmA Tg Figure 4.E.

A. A Vehicle DOX DOX+4-AN WT CrmA B. TUNEL + Cardiomyocyte es (%) 40 Vehicle DOX DOX+4-AN * * * * 30 20 10 0 WT CrmA Figure 5 .

100 WT Veh+4-AN CrmA Veh+4-AN WT:DOX CrmA:DOX WT:DOX+4-AN CrmA:DOX+4-AN Survival Rate (%) e 80 60 40 20 0 0 1 2 3 4 5 6 7 8 9 10 11 12 * * Days after injection Figure 6 .

5±2.4 DOX 5. SW.6±0.3±0. mmHgxμl WT CrmA CO.4 94. cardiac output.8±3.2 111.3±0.6 111. maximum and minimum first derivative of ventricular pressure with respect to time. LVSP. mmHg/s WT CrmA dP/dtmin.3 LVEDP. left ventricular systolic pressure.5 *† 1164±88. mmHg WT CrmA LVSP.4*† 4.5 3.8±0. . stroke work.1±0.4 5.9 5.1 9055±234 9043±339 7415±467 7238±564 1279±63.05 (DOX WT vs DOX CrmA). † P<0.5 3.7±0.4 6258±302 *† 8815±355 5152±229*† 7159±218 849±112.0±0. mmHg WT CrmA dP/dtmax.05 (DOX vs Veh).Table 1. * P<0. LV hemodynamic 5 days after DOX injection in WT and CrmA Tg mice Genotype LVEDP. dP/dtmax and dP/dtmin.3±1. N=5-6. CO. left ventricular end diastolic pressure. mmHg/s WT CrmA SW. ml/min WT CrmA Vehicle 3.5±0.0 1264±81.8 3.8*† 101.2±2.

5±1.2* 2.1* 23. dP/dtmax and dP/dtmin.8±0.6† 8102±461† 5816±1075* 8413±265† 4202±480* 3029±548* 2.2±0.3* 6914±246† 6026±359† 4. msec WT CrmA Vehicle 3. LV systolic pressure. ml/min WT CrmA Tau.2† LVEDP.4±3.8±3.05 (DOX vs DOX+4-AN).1±0. SW.8±2.9±2.2 111.2±0.8±0.3±0. stroke work. mmHg/s WT CrmA CO.1 11. cardiac output. mmHg/s WT CrmA dP/dtmin.5 12. ventricular isovolumic relaxation time constant. .5±0.0* 24.4 5.6* 6529±715* DOX+4-AN 4. † P<0. * P<0.2† 14.6±1. mmHg WT CrmA LVSP. LVSP.24±5. CO.1±0. Tau.0±1.2±6.8† 105.0±0.4±1.8 * 7. left ventricular end diastolic pressure.4±0. n=6-7.0±4.3±2.3 107.1 3.6 * 91.1±0.3±0.05 (DOX vs Veh). LV hemodynamic 10 days after DOX injection in WT and CrmA Tg mice Genotype LVEDP. mmHg WT CrmA dP/dtmax.5† 3. maximum and minimum first derivative of ventricular pressure with respect to time.7 DOX 7.Table 2.4† 4.7* 82.2 8693±304 8896±486 7282±530 6945±562 5.6† 13.5† 103.