A NEW HIGHLY EFFICIENT BETA

-
GLUCOSIDASE FROM THE NOVEL SPECIES,
ASPERGILLUS SACCHAROLYTICUS



ANNETTE SØRENSEN































Section for Sustainable Biotechnology
Aalborg University, Copenhagen
Ph.D. Dissertation, 2010
A

N
E
W

H
I
G
H
L
Y

E
F
F
I
C
I
E
N
T

B
E
T
A
-
G
L
U
C
O
S
I
D
A
S
E

F
R
O
M

T
H
E

N
O
V
E
L

S
P
E
C
I
E
S
,

A
S
P
E
R
G
I
L
L
U
S

S
A
C
C
H
A
R
O
L
Y
T
I
C
U
S
ISBN 978-87-90033-73-6
A NEW HIGHLY EFFICIENT BETA-
GLUCOSIDASE FROM THE NOVEL SPECIES,
ASPERGILLUS SACCHAROLYTICUS


ANNETTE SØRENSEN
































Section for Sustainable Biotechnology
Aalborg University, Copenhagen
Ph.D. Dissertation, 2010














































Printed in Denmark by
UNIPRINT, Aalborg University, November 2010
ISBN 978-87-90033-73-6

Cover:
Ribbon cartoon representation of the homology model of the catalytic module of beta-glucosidase
BGL1 from Aspergillus saccharolyticus. The figure was provided by Dr. Wimal Ubhayasekera
ACKNOWLEDGEMENTS 
I  would  like  to  thank  my  supervisors  Birgitte  K.  Arhing  and  Peter  S.  Lübeck  for  support,  not  only  during 
my  Ph.D  study,  but  also  as  initial  inspiration  and  introduction  into  the  field  of  sustainable  and  fungal 
biotechnology. I would likewise like to express my great appreciation to the contribution of Mette Lübeck, 
who has acted as supervisor though she was not officially so. Furthermore I would like to thank all other 
co‐authors  for  their  contributions  to  the  papers  in  this  thesis:  Philip  J.  Teller,  Jens  C.  Frisvad,  Kristian  F. 
Nielsen, Wimal Ubhayasekera, Kenneth S. Bruno, and David E. Culley. 
During  this  Ph.D.  study,  a  lot  of  my  research  has  been  carried  out  at  the  Bioproducts,  Sciences,  and 
Engineering  Laboratory  in  collaboration  with  Washington  State  University  and  the  Pacific  Northwest 
National Laboratory. It was a great experience and I highly appreciate the help and guidance I was given 
by my co‐scientists at both WSU and PNNL.  
I  am  grateful  for  the  enthusiastic,  encouraging,  and  joyful  atmosphere  my  colleagues  at  Section  for 
Sustainable  Biotechnology,  Aalborg  University,  provide  every  day  –  especially  during  this  last  phase  of 
thesis writing; I value your support.  
Finally I would like to thank my family and friends for their enormous support during my Ph.D. study and 
their interest in my work. I doubt many parents have read and understood their daughter’s Ph.D. thesis – 
you are a great inspiration; love and thanks to both of you! Most of all I would like to thank Philip Teller 
for  strong  support,  encouragement,  and  guidance  throughout  the  whole  period  –  thank  you  for  your 
shoulder to cry at, your happy face to smile with, and especially your loving heart that cares deeply.  
  
 
 
 
Annette Sørensen  
August 2010, Denmark 
 
 
 
 
 
THESIS STRUCTURE 
Please  notice  that  the  thesis  has  been  organized  as  a  short  summary  in  the  beginning  followed  by  a 
collection of journal manuscripts, consisting of a review paper and four research papers, ending with brief 
concluding  remarks.  The  individual  manuscripts  are  printed  in  a  layout  form  consistent  with  the  journal 
for  which  the  individual  manuscripts  are  intended.  The  work  carried  out  during  this  Ph.D.  study  has 
resulted in a patent application, of which the summary and claims are included in the thesis.  
 
 
 
THESIS CONTENT 
 
 
Summary (English)  i‐ii
Summary (Danish)  iii‐iv
 
Review paper  1‐18
Fungal  beta‐glucosidases  and  their  applications for  production 
of biofuels and bioproducts 
 
Research paper I  I.1‐I.9
On‐site  enzymeproduction  during  bioethanol  production  from 
biomass: screening for suitable fungal strains 
 
Research paper II  II.1‐II.12
Screening  for beta‐glucosidase  activity  amongst  different  fungi 
capable  of  degrading  lignocellulosic  biomasses:  discovery  of  a 
new prominent beta‐glucosidase producing Aspergillus sp. 
 
Research paper III  III.1‐III.11
Aspergillus  saccharolyticus  sp.  nov.,  a  new  black 
Aspergillusspecies isolated from treated oak wood in Denmark. 
 
Research paper IV  IV.1‐IV.10
Cloning,  expression,  and  characterization  of  a  novel  highly 
efficient beta‐glucosidase from Aspergillus saccharolyticus 
 
Patent 
Summary of the invention v‐vi
Claims  vii‐ix
 
Concluding remarks  x
 
 
 
 
 
 
‐ i ‐ 
 
SUMMARY 
In  a  biorefinery  concept,  biomass  polymers  of  cellulose  and  hemicellulose  are  converted  into  sugars, 
which  can  be  used  for  production  of  biofuels  and  biochemicals,  which  could  act  as  platform  molecules 
serving  as  building  blocks  in  the  synthesis  of  chemicals  and  polymeric  materials.  This  is  a  sustainable 
solution that is expected to replace today’s oil refineries.  
Main  components  of  lignocellulosic  biomass,  primarily  consisting  of  plant  cell  walls,  are  cellulose, 
hemicellulose,  and  lignin.  Prior  to  enzymatic  hydrolysis  for  generating  sugar  monomers,  the  biomass  is 
pretreated. The pretreatment mainly opens up the cell wall structure and partly hydrolyzes hemicellulose, 
so that cellulose is the main target for enzyme hydrolysis. Beta‐glucosidases (EC 3.2.1.21) play an essential 
role  in  efficient  hydrolysis  of  cellulose.  By  hydrolysis  of  cellobiose,  beta‐glucosidases  relieve  inhibiting 
conditions,  allowing  for  increased  hydrolysis  of  cellulose  by  cellobiohydrolases  and  endoglucanases. 
Efficient  hydrolysis  requires  high  conversion  rates  throughout  the  hydrolysis.  The  major  factors 
influencing this are product inhibition and temperature stability.  
Traditionally,  the  commercial  enzyme  preparations  Novozym  188  (mainly  beta‐glucosidase  activity)  and 
Celluclast 1.5L (mainly cellobiohydrolase and endoglucanase activity) (Novozymes A/S) have been used in 
combination  for  hydrolysis  of  pretreated  biomass,  and  recently  complete  enzyme  cocktails  have  been 
launched, Cellic CTec (Novozymes A/S) and AcceleraseDUET (Genencor A/S). The enzyme preparations by 
Novozymes A/S are used as benchmarks in the following research.   
Superior  enzymes  can  be  obtained  either  by  discovery  of  new  enzymes  through  different  screening 
strategies or by improvement of known enzymes mainly by different molecular methods.  
Initially,  we  employed  a  screening  strategy  using  different  lignocellulosic  materials  for  discovery  of  new 
enzymes to be used in an onsite enzyme production concept during bioethanol production. Different fungi 
were applied in this screening, mainly fungi isolated from different woody habitats. A low value stream of 
a  cellulosic  ethanol  production  was  explored  as  enzyme  production  medium,  finding  Aspergillus  niger  as 
well  as  an  unidentified  strain  AP  as  promising  candidates  for  the  utilization  of  the  filter  cake  for  growth 
and  enzyme  production.  The  filter  cake  inoculated  with  the  respective  fungi  could,  combined  with 
Celluclast 1.5L, substitute the use of Novozym 188 in hydrolysis of pretreated biomass. In the wake of this, 
focus was placed on beta‐glucosidases.  
A  screening  for  beta‐glucosidase  activity  was  conducted,  using  wheat  bran  as  substrate  in  simple 
submerged  fermentation,  testing  selected  strains  from  the  previous  screening  as  well  as  new  isolated 
strains  and  strains  from  our  in‐house  strain  collection,  including  A.  niger.  The  strain  AP  showed 
significantly  greater  potential  in  beta‐glucosidase  activity  than  all  other  fungi  screened.  The  beta‐
glucosidase  activity  of  a  solid  state  fermentation  extract  of  strain  AP  was  compared  with  Novozym  188 
and  Cellic  CTec.  In  terms  of  cellobiose  hydrolysis,  the  extract  of  strain  AP  was  found  to  be  a  valid 
substitute  for  Novozym  188,  corresponding  to  the  previous  result  where  filter  cake  inoculated  with  the 
fungus  was  directly  used  in  hydrolysis  of  pretreated  biomass.  The  Michaelis  Menten  kinetics  affinity 
constants of strain AP extract and Novozym 188 were approximately the same, and the two preparations 
performed equally well in cellobiose hydrolysis with regard to product inhibition. However, the extract of 
strain  AP  showed  higher  specific  activity  (U/total  protein)  as  well  as  increased  thermostability.  The 
significant  thermostability  of  strain  AP  beta‐glucosidases  was  further  confirmed  when  compared  with 
Cellic  CTec.  The  extract  of  strain  AP  facilitated  hydrolysis  of  cellodextrins  with  an  exo‐acting  approach, 
and  was,  when  combined  with  Celluclast  1.5L,  able  to  contribute  to  the  generation  of  a  sugar  platform 
from pretreated bagasse, by hydrolyzing the biomass to monomeric sugars.    
 
 
‐ ii ‐ 
 
Strain AP was from a polyphasic taxonomic approach identified as a yet undescribed uniseriate Aspergillus 
species  belonging  to  section  Nigri.  Morphologically,  at  first  glance  strain  AP  resembles  A.  japonicus. 
However,  in  detailed  phenotypic  analysis,  strain  AP  distinguished  itself  from  the  other  uniseriate  aspergilli, 
both in terms of growth characteristics on different media as well as temperature tolerance. Futhermore, the 
extrolite  production  of  strain  AP  differed  significantly  from  other  known  aspergilli  in  section  Nigri,  as  several 
well‐known  compounds  from  this  series  were  not  present,  and  the  peaks  detected  did  not  match  the 
approximately  13500  fungal  extrolites  in  the  natural  product  chemist’s  database,  Antibase2010.  Genotypic 
analysis  of  the  ITS  region,  partial  beta‐tubuline  gene,  and  partial  calmodulin  gene  placed  strain  AP  on  a 
separate  branch  in  phylogenetic  trees  prepared  with  other  black  aspergilli,  and  universally  primed  PCR 
furthermore  readily  distinguished  strain  AP  data  from  other  black  aspergilli.  We  named  the  novel  species  A. 
saccharolyticus,  referring  to  its  ability  to  hydrolyze  cellobiose  and  cellodextrins,  and  it  was  deposited  in 
the strain collection of Centraalbureau voor Schimmelcultures (CBS 127449
T
).  
Identification,  isolation,  and  characterization  of  the  most  prominent  beta‐glucosidase  from  A. 
saccharolyticus were undertaken.  The extract from this fungus, mentioned above, was fractionated by ion 
exchange  chromatography,  obtaining  fractions  pure  enough  that  a  specific  SDS‐page  gel  protein  band  of 
high beta‐glucosidase activity could be excised and analyzed by LC‐MS/MS. Using the peptide matches for 
design of degenerate primers, the beta‐glucosidase gene, bgl1, of A. saccharolyticus was cloned. The 2919 
bp genomic sequence encodes a 680 aa polypeptide which has  91% and 82% identity with BGL1 from A. 
aculeatus  and  BGL1  from  A.  niger,  respectively.  BGL1  of  A.  saccharolyticus  was  identified  as  belonging  to 
GH family 3. A three dimentsional structure was proposed through homology modeling, finding retaining 
enzyme  characteristics  and,  interestingly,  a  more  open  catalytic  pocket  compared  to  other  beta‐
glucosidases. A cloning vector for heterologous expression of bgl1 in Trichoderma reesei was constructed, 
combining  promoter,  gene,  and  terminator  of  different  eukaryotic  origin.  Codons  coding  for  histidine 
residues  were  included  in  the  3’end  of the  gene  to assist purification.  The  purified BGL1  was assayed for 
beta‐glucosidase  activity,  studying  enzyme  kinetics,  temperature  and  pH  profiles,  glucose  tolerance,  and 
cellodextrin  hydrolysis.  A  striking  similarity  was found when  comparing  the data  of  purified  BGL1  to the 
data  previously  reported  of  the  crude  extract,  indicating  that  we  have  successfully  cloned  and  expressed 
the  protein  mainly  contributing  to  the  beta‐glucosidase  activity  observed  in  the  crude  extract,  thus  the 
most prominent beta‐glucosidase of A. saccharolyticus. 
   
 
 
‐ iii ‐ 
 
DANSK SAMMENFATNING 
Værdien af lignocelluloseholdig biomasse bliver i et bioraffinaderikoncept maksimeret ved frembringelse 
af  en  sukkerplatform  fra  biomassens  kulhydrater.  Denne  sukkerplatform  kan  anvendes  til  produktion  af 
biobrændstoffer  og  biomolekyler,  som  kan  være  byggesten  i  syntesen  af  kemikalier  og  polymere 
materialer. Dette er en bæredygtig løsning, som kan erstatte nutidens olieraffinaderier. 
Lignocelluloseholdig  biomasse  består  primært  af  plantecellevægge.  Hovedkomponenterne  er  cellulose, 
hemicellulose  og  lignin.  For  at  danne  en  sukkerplatform  fra  biomasse,  forbehandles  biomassen  og 
hydrolyseres  derefter.  Forbehandlingen  åbner  primært  cellevægstrukturen  op  og  hydrolyserer  delvist 
hemicellulosen,  således  at  cellulose  er  primær  genstand  for  den  efterfølgende  enzymatiske  hydrolyse. 
Beta‐glucosidaser  (EC  3.2.1.21)  spiller  en  vigtig  rolle  i  effektiv  hydrolyse  af  cellulose.  Ved  at  hydrolysere 
cellobiose fjerner beta‐glucosidase de inhiberende forhold, der ellers ville begrænse cellobiohydrolase‐ og 
endoglucanase‐aktiviten,  og  muliggør  derved  øget  hydrolyse  af  cellulose.  Effektiv  hydrolyse  kræver  høj 
omsætningsrate  under  hele  hydrolysen.  Faktorer,  der  særligt kan  influere  på  dette,  er  produktinhibering 
og temperaturstabilitet. 
Traditionelt set har de kommercielle enzymprodukter Novozym 188 (primært beta‐glucosidase‐aktivitet) 
og Celluclast 1.5L (primært cellobiohydrolase‐ og endoglucanase‐aktivitet) (Novozymes A/S) været brugt 
i  kombination  til  at  hydrolysere  forbehandlet  biomasse,  og  for  nyligt  er  nye  komplette  enzymblandinger 
blevet  lanceret:  Cellic  CTec  (NovozymesA/S)  og  AcceleraseDUET  (Genencor  A/S).  Enzymprodukterne  fra 
Novozymes A/S vil løbende blive brugt som sammenligningsgrundlag i den her præsenterede forskning.  
Bedre  enzymer  kan  fremskaffes  enten  ved  opdagelse  af  nye  enzymer  gennem  forskellige 
screeningsstrategier  eller  ved  forbedring  af  kendte  enzymer  primært  ved  forskellige  molekylære 
teknikker. 
Indledningsvist  benyttede  vi  en  screeningsstrategi,  hvor  forskellige  lignocelluloseholdige  komponenter 
blev  anvendt  til  at  lede  efter  nye  enzymer  til  brug  i  et  on‐site  enzymproduktionskoncept  indenfor 
biobrændstofproduktion. Forskellige svampe blev testet i denne screening, hvoraf de fleste var isoleret fra 
naturens  biomasseholdige  habitater.  Et  restprodukt,  filterkage,  fra  cellulose  ethanolproduktion  af  lav 
kommerciel  værdi  blev  undersøgt  som  enzymproduktionsmedie.  Aspergillus  niger  så  vel  som  en 
uidentificerbar  stamme  AP  viste  sig  at  være  lovende  kandidater  for  anvendelsen  af  filterkagen  til  vækst‐ 
og  enzymproduktion.  Filterkagen  inokuleret  med  de  respektive  svampe  kunne  i  kombination  med 
Celluclast  1.5L  erstatte  brugen  af  Novozym  188  i  hydrolyse  af  forbehandlet  biomasse.  Som  følge  af  dette 
blev fokus rettet på beta‐glucosidaser. 
Screening  for  beta‐glucosidase‐aktivitet  blev  udført  ved  brug  af  hvedeklid  som  substrat  i  simpel 
væskefermentering.  Isolater  fra  den  tidligere  screening,  nyligt  isolerede  stammer  samt  isolater  fra  vores 
egen  stammesamling  blev  testet,  inkluderende  A.  niger.  Stammen  AP  viste  betydeligt  større  beta‐
glucosidase‐aktivitetspotentiale  end  alle  andre  testede  stammer.  Beta‐glucosidase‐aktiviteten  af  et 
fermenteringsekstrakt  af  stammen  AP  er  sammenlignet  med  Novozym  188  og  Cellic  CTec.  Vi  fandt,  at 
stammen  AP kan  erstatte  Novozym  188  inden  for  hydrolyse  af  cellobiose,  hvilket  stemmer  over  ens  med 
de  tidligere  resultater,  hvor  filterkage  inokuleret  med  svampen  direkte  blev  brugt  i  hydrolyse  af 
forbehandlet  biomasse.  Michaelis‐Menten  kinetik  affinitetskonstanten  for  ekstraktet  fra  strammen  AP  og 
for Novozym 188 var cirka ens, og med hensyn til produktinhibering var effekten af øget glucosemængde 
omtrent den samme. Ekstraktet fra stammen AP viste dog højere specifik aktivitet (U/total protein) såvel 
som  øget  termostabilitet.  Den  signifikante  termostabilitet  af  beta‐glucosidaser  fra  stammen  AP  blev 
yderligere  bekræftet  ved  sammenligning  med  Cellic  CTec.  Ekstraktet  fra  stammen  AP  kunne  via  exo‐
 
 
‐ iv ‐ 
 
aktivitet  hydrolysere  cellodextriner  og  kunne  sammen  med  Celluclast  1.5L  hydrolysere  forbehandlet 
bagasse til sukkermonomerer og derved danne en sukkerplatform fra biomasse.  
Stammen  AP  blev  taksonomisk  identificeret  som  en  hidtil  ubeskrevet  uniseriat  Aspergillus  art  tilhørende 
sektion  Nigri.  Morfologisk  ligner  stammen  AP  ved  første  øjekast  A.  japonicus,  men  ud  fra  detaljeret 
fænotypisk  analyse  adskilte  stammen  AP  sig  fra  de  andre  uniseriate  aspergilli,  både  i  forhold  til 
vækstkarakteristika  på  forskellige  medier  samt  temperaturtolerance.  Ydermere  adskilte  stammen  AP  sig 
signifikant  fra  andre  kendte  aspergilli  i  sektion  Nigri  ved  dens  sekundære  metabolitproduktion,  da 
adskillige  kendte  stoffer  inden  for  denne  sektion  ikke  kunne  detekteres,  og  de  toppe,  som  var  til  stede, 
matchede  ikke  de  omtrent  13500  metabolitter  fra  svampe,  der  findes  i  databasen  for  naturprodukt 
kemikere,  Antibase2010.  Genotypisk  analyse  af  ITS  regionen,  det  partielle  beta‐tubulin  gen,  og  det 
partielle  calmodulin  gen  placerede  stammen  AP  på  en  separat  gren  i  de  fylogenetiske  træer,  som  var 
udarbejdet med andre sorte aspergilli. Universal‐primed PCR adskilte yderligere data for stammen AP fra 
andre  sorte  aspergilli.  Vi  navngav  den  nye  art  A.  saccharolyticus,  hvilket  refererer  til  dens  evne  til  at 
hydrolysere cellobiose og cellodextriner. Stammen blev deponeret i stammesamling Centraalbureau voor 
Schimmelcultures (CBS 127449
T
).  
Identificering, isolering og karakterisering af den fremstående beta‐glucosidase fra A. saccharolyticus blev 
iværksat. Ekstraktet fra svampen, beskrevet og analyseret ovenfor, blev ved ionkromatografi fraktioneret, 
hvorved  rene  nok  fraktioner  blev  opnået,  således  at  et  specifikt  proteinbånd  med  høj  beta‐glucosidase‐
aktivitet kunne skæres ud fra SDS‐page gel og analyseres ved LC‐MS/MS. Ved at benytte peptid‐matchene 
til  design  af  degenererede  primere  blev  beta‐glucosidase  genet,  bgl1,  klonet.  Den  2919  bp  genomiske 
sekvens koder for et 680 aa polypeptid, der har hhv. 91% and 82% identitet med BGL1 fra A. aculeatus og 
BGL1  fra  A.  niger.  BGL1  fra  A.  saccharolyticus  blev  identificeret  til  at  tilhøre  GH  familie  3.  En 
tredimensionel struktur blev foreslået ud fra homologimodellering, hvor ”retaining” enzymkarakteristika 
blev  bestemt.  Det  er  bemærkelsesværdigt,  at  en  mere  åben  katalytisk  lomme  blev  sandsynliggjort  for 
BGL1  relativt  til  andre  beta‐glucosidaser.  En  kloningsvektor  blev  konstrueret  til  benyttelse  indenfor 
heterolog  ekspression  af  bgl1  i  Trichoderma  reesei,  hvor  promoter,  gen  og  terminator  af  forskellig 
eukaryotisk  oprindelse  var  kombineret.  Codons,  som  koder  for  aminosyren  histidin,  blev  inkluderet  i 
3’enden af genet for at lette oprensning af genet. Det oprensede BGL1 blev undersøgt for beta‐glucosidase 
aktivitet,  hvor  enzymkinetik,  temperatur‐  og  pH‐profil,  glukosetolerance  samt  hydrolyse  af  cellodextrin 
blev studeret. En påfaldende ensartethed blev fundet ved sammenligning af data for det oprensede BGL1 
og  de  data,  der  tidligere  blev  rapporteret  for  råekstraktet  fra  svampen.  Dette  indikerer,  at  vi  med  succes 
har  klonet  og  ekspresseret  det  protein,  som  primært  kontribuerer  til  den  beta‐glucosidase‐aktivitet,  der 
var observeret i råekstraktet fra A. saccharolyticus.   
 
 
 
Review papei


Fungal beta‐glucosidases and their applications for production 
of biofuels and bioproducts 
 
 
Annette Søiensen, Petei S. Lübeck, Nette Lübeck, anu Biigitte K. Ahiing


Intended for submission to FEMS microbiology reviews 
 
Review paper 
‐ 1 ‐ 
 
REVIEW ARTICLE 
Fungal  beta‐glucosidases  and  their  applications  for  production  of 
biofuels and bioproducts 
Annette Sørensen
1,2
, Peter S. Lübeck
1
, Mette Lübeck
1
, and Birgitte K. Ahring
1,2 
1
Section for Sustainable Biotechnology, Copenhagen Institute of Technology, Aalborg University, Ballerup, Denmark. 
2
Center for Biotechnology and 
Bioenergy, Washington State University, Richland, WA, USA.  
Introduction 
The evei‐incieasing eneigy consumption, the uepletion of
fossil iesouices, as well as a giowing enviionmental
concein have laiu the founuation foi a shift towaius
sustainable biofuels anu biopiouucts fiom ienewable
souices.
The seaich foi ienewable eneigy in the foim of
bioethanol fiom plant biomasses emeigeu in the 197us in
iesponse to the oil ciisis (NREL National Renewable Eneigy
Laboiatoiy, 2uuu). Especially seconu geneiation bioethanol
piouuction has incieaseu in inteiest uuiing this uecaue
with focus on the use of lignocellulosic wastes foi fuel
piouuction, as lignocellulosic biomass is an abunuant anu
inexpensive ienewable eneigy iesouice (Knauf &
Noniiuzzaman, 2uu4). Similaily, attention has been uiawn
towaius piouuction of platfoim molecules foi new
biopiouucts by miciobial feimentation fiom glucose oi
othei simple caibohyuiates. Especially oiganic acius aie
key builuing block chemicals that can be piouuceu by
miciobial piocesses (Sauei et al., 2uu8).
Touay, with the iecent oil uisastei in the Nexican gulf,
the awaieness in the public has again incieaseu towaius
alteinatives foi fossil fuels. 0il is cuiiently the piimaiy
souice of eneigy foi the tianspoitation sectoi anu foi
piouuction of chemicals anu plastics. A bioiefineiy concept
coulu ieplace the oil iefineiies, maximizing the value
ueiiveu fiom biomass by piouucing fuels anu platfoim
molecules that can be useu as builuing blocks in the
synthesis of chemicals anu polymeiic mateiials (Cheiubini,
2u1u). 0ne of the goals of the bioiefineiy is the combineu
piouuction of high‐value low‐volume piouucts togethei
with low‐value high‐volume piouucts such as fuels
(Feinanuo  et  al., 2uu6). Sugai platfoim bioiefineiies focus
on piouuction of a platfoim of simple sugais extiacteu fiom
biomass. These sugais can biologically be feimenteu into
fuels (e.g. ethanol), builuing block chemicals (e.g. uiffeient
oiganic acius) as specifieu by 0S Bepaitment of Eneigy
Repoit (2uu4a), as well as othei high value piouucts.
Abstract 
Beta‐glucosiuases (EC S.2.1.21) play an essential iole in efficient hyuiolysis of
cellulosic biomasses. By hyuiolysis of cellobiose, beta‐glucosiuases ielieve
inhibiting conuitions, allowing foi incieaseu hyuiolysis of cellulose by
cellobiohyuiolases anu enuoglucanases. In a bioiefineiy concept, polymeis of
cellulose anu hemicellulose in the biomass mateiials aie conveiteu into sugais,
which can be useu foi piouuction of biofuels anu biochemicals, which coulu act as
platfoim molecules seiving as builuing blocks in the synthesis of chemicals anu
polymeiic mateiials. Bioiefineiies aie expecteu to ieplace oui uay’s oil iefineiies.
This ieview focuses on beta‐glucosiuases applieu foi biomass hyuiolysis, an
application wheie all commeicial enzymes aie of fungal oiigin. Efficient
hyuiolysis iequiies high conveision iates thioughout the hyuiolysis piocess. The
majoi factois influencing this aie piouuct inhibition anu tempeiatuie stability.
Bettei beta‐glucosiuases can be obtaineu eithei by uiscoveiy of new beta‐
glucosiuases thiough uiffeient scieening stiategies oi by impiovement of known
beta‐glucosiuases foi instance by piotein engineeiing. With the bioiefineiy
application in minu, beta‐glucosiuases shoulu be incluueu as pait of a complete
enzyme cocktail, eithei maue fiom a sepaiate fungal feimentation oi as pait of a
consoliuateu biopiocess.
Correspondence: Birgitte K. Ahring, Section 
for Sustainable Biotechnology, Copenhagen 
Institute of Technology, Aalborg University, 
Lautrupvang 15, 2750 Ballerup, Denmark. 
Tel.: +45 99402591; email: bka@bio.aau.dk 
 
 
 
 
 
 
 
 
 
Keywords 
Beta‐glucosidases; biofuels & bioproducts; 
biomass hydrolysis; enzyme discovery, 
characterization, improvement, and 
application 
 
Review paper 
‐ 2 ‐ 
 
The majoi constituent of plant biomass is lignocellulose.
Lignocellulose consists mainly of polysacchaiiues such as
cellulose anu hemicelluloses that togethei with the phenolic
lignin polymei foim a complex anu iigiu stiuctuie. Pioteins,
wax, oils anu ash make up the iemaining fiaction of the
biomass. The biomass composition uepenus on the
plant¡ciop type, with cellulose most often being the most
abunuant component, typically constituting Su‐Su%
accoiuing to the Biomass Feeustock Composition uatabase
(0.S. Bepaitment of Eneigy, 2uu4b).
Cellulose, is a homogenous lineai polymei of beta‐B‐
glucosyl units linkeu by 1,4‐beta‐B‐glucosiuic bonus with
the uegiee of polymeiization of native cellulose being in the
iange of 7,uuu‐1S,uuu. The cellulose chains aie assembleu
in laigei iigiu units helu togethei by both intiachain anu
inteichain hyuiogen bonus anu weak van uei Wall’s foices.
Thiough paiallel oiientation, the chains foim a highly
oiueieu ciystalline uomain, but aie inteispeiseu with
amoiphous iegions of moie uisoiueieu stiuctuie (Beguin &
Aubeit, 1994; Beig et al., 2uu2; Lynu et al., 2uu2)
The seconu most abunuant component, hemicellulose, is
a heteiogeneous, highly biancheu, polymei of pentoses,
hexoses, anu sugai acius. The uegiee of heteiogeneity, the
uistiibution of the uiffeient sugais, as well as the extent of
bianching is plant uepenuent. Xylan, which have a backbone
of B‐xylose linkeu by 1,4‐beta bonus, is the most abunuant
hemicellulose. Besiues of xylose, hemicellulose may contain
aiabinose, glucuionic aciu oi its 4‐O‐methyl ethei, acetic
aciu, feiulic aciu, anu p‐coumaiic aciu. About 8u% of the
xylan backbone is highly substituteu with monomeiic siue‐
chains of aiabinose linkeu to O‐2 anu¡oi O‐S of the xylose
units of the backbone (Saha, 2uuS).
The thiiu main component, lignin, is composeu of
aiomatic phenyl‐piopanoiu compounus that aie eithei ui‐,
mono‐, oi non‐methoxylateu, foiming a thiee‐uimensional
netwoik that is highly iesistant towaius biological anu
chemical uegiauation (Naitinez et al., 2uuS).
The complex stiuctuie of the cellulose fibiils embeuueu
in the amoiphous matiix of lignin anu hemicellulose
piotects the plant against attack fiom miciooiganisms anu
enzymatic uegiauation as well as othei natuially occuiiing
enviionmental stiess such as weathei conuitions thiough
covalent cioss‐links that stiengthen the plant cell wall. In
oiuei to piouuce a sugai platfoim fiom plant biomass,
pietieatment is ciucial as a fiist step foi bieaking this iigiu
stiuctuie followeu by enzymatic hyuiolysis. Pietieatment
aims at incieasing the accessibility of the polymeis foi the
enzyme hyuiolysis. Seveial uiffeient pietieatment
stiategies have been suggesteu ovei the last yeais, ianging
fiom extieme tempeiatuies, piessuies, anu aciu¡base
conuitions to the miluei biological appioaches. Seveial
ieviews on uiffeient pietieatment methous anu factois
influencing the following enzymatic hyuiolysis exist (Sun &
Cheng, 2uu2; Nosiei  et  al., 2uuS; Alviia  et  al., 2u1u), with
commonly useu methous incluuing (but not excluuing
otheis) alkali‐, aciu‐, oi oiganosolvent pietieatement,
steam‐, ammonia fibei‐ oi C02 explosion, anu wet‐oxiuation.
The chaiacteiistics of the lignocellulosic substiate foi
enzyme hyuiolysis, with iegaiu to cellulose accessibility,
uegiee of polymeiization, hemicellulose content, lignin
content, anu othei potential inteifeiing compounus, will
vaiy to a gieat extent uepenuing on the plant mateiial anu
the pietieatment applieu. Theiefoie, the sugai yielus fiom
hyuiolysis of the biomass will eviuently uepenu on type anu
seveiity of the pietieatment (Chang & Boltzapple, 2uuu;
Zhang  et  al., 2uu6; Kabel  et  al., 2uu7). Such vaiiation in
biomass chaiacteiistics will influence the composition
iequiiements foi an optimal enzyme cocktail foi the
bieakuown of lignocellulosic biomasses (Neyei  et  al.,
2uu9). Bowevei, in geneial teims, the enzymes mentioneu
below aie iequiieu foi the bieakuown of cellulose,
hemicellulose, anu lignin, iespectively.
The thiee main categoiies of playeis in cellulose
hyuiolysis aie cellobiohyuiolases (oi exo‐1,4‐beta‐
glucanases) (EC S.2.1.91), enuo‐1,4‐beta‐glucanases (EC
S.2.1.4), anu beta‐glucosiuases (EC S.2.1.21). Cellulose
polymeis aie thiough sequential anu coopeiative actions of
these enzymes uegiaueu to glucose. The geneial consensus
is that cellobiohyuiolases (CBBs) hyuiolyze the cellulose
polymei fiom the enus, ieleasing cellobiose as piouuct in a
piocessive fashion, with CBBIs acting on the ieuucing enus
anu CBBIIs acting on the non‐ieuucing enus. Enuo‐
glucanases (Eus) ianuomly hyuiolyze the inteinal 1,4‐beta‐
linkages in piimaiily the amoiphous iegions of cellulose,
iapiuly uecieasing the uegiee of polymeiization anu
cieating moie fiee enus foi attack by the cellobiohyuiolases
(Lynu et al., 2uu2; Zhang & Lynu, 2uu4; Zhang et al., 2uu6).
Such syneigism of cellobiohyuiolases anu enuoglucanases
was alieauy stuuieu uecaues ago in Trichoderma  reesei
(Beniissat et al., 198S). Finally, beta‐glucosiuases hyuiolyze
the cellobiose anu in some cases the cellooligosacchaiiues
to glucose. Cellobiohyuiolases anu enuoglucanases aie
often inhibiteu by cellobiose, making beta‐glucosiuases
impoitant in teims of avoiuing uecieaseu hyuiolysis iates
of cellulose ovei time uue to cellobiose accumulation. 0n
the othei hanu beta‐glucosiuases aie often themselves
inhibiteu by theii piouuct, glucose (Shewale, 1982; Xiao  et 
al., 2uu4), anu maintaining high hyuiolysis iates will
theiefoie ultimately uepenu on the beta‐glucosiuases,
making them key enzymes foi efficient hyuiolysis of
cellulose.
The geneial concept of polysacchaiiue hyuiolysis has
been agieeu on foi seveial yeais. Noie iecently, attention
has been paiu to accessoiy enzymes that aie coiegulateu oi
coexpiesseu by miciobes uuiing giowth on cellulosic
substiates. Pioteins have been uiscoveieu that by
themselves lack measuiable hyuiolytic activity, yet aie able
to significantly enhance the activity of cellulases on
pietieateu biomass. Some of these pioteins have since been
iefeiieu to as uB61 pioteins (Baiiis et al., 2u1u).
 
Review paper 
‐ 3 ‐ 
 
Bue to the heteiogeneous stiuctuie of hemicellulose, a
combination of main enzymes acting on the backbone as
well as uiffeient accessoiy enzymes acting on the siue‐
chains must contiibute to its hyuiolysis. Foi hyuiolysis of
the xylan backbone, enuo‐1,4‐beta‐xylanases anu beta‐
xylosiuases aie key playeis hyuiolyzing inteinal 1,4‐beta‐
linkages anu xylobiose, iespectively. Neanwhile accessoiy
enzymes such as alpha‐L‐aiabinofuianosiuase, alpha‐
glucuionisiuase acetylxylan esteiase, feiulic aciu esteiase,
anu p‐coumaiic aciu esteiase iemove substituents fiom the
xylan backbone, which is often necessaiy befoie the
backbone itself can be hyuiolyzeu (Saha, 2uuS).
Lignin uepolymeiization is catalyzeu by unspecific
oxiuative enzymes that libeiate unstable compounus which
subsequently take pait in many uiffeient oxiuative
ieactions, a piocess iefeiieu to as enzymatic combustion
(Kiik & Faiiell, 1987). Peioxiuases anu laccases aie the two
majoi families involveu in ligninolysis, geneiating aiomatic
iauicals by oxiuizing the lignin polymei. These aiomatic
iauicals then evolve in uiffeient non‐enzymatic ieactions
contiibuting to the bieakuown of the lignin stiuctuie (Peiez 
et al., 2uu2; Naitinez et al., 2uuS).
It appeais fiom the above mentioneu enzyme systems
that efficient enzymatic uegiauation of lignocellulose
iequiies coopeiative anu syneigistic inteiactions of
enzymes iesponsible foi cleaving uiffeient linkages in
uiffeient polymeis anu within the same polymei. The
founuation foi both biofuels anu biopiouucts is a sugai
platfoim of monomeiic sugais such as glucose anu xylose
which aie conveiteu to the uesiieu piouucts (Cheiubini,
2u1u). The piimaiy challenge in making a sugai platfoim
foi biopiouucts anu biofuels is to get a cost‐competitive
piouuct, ielative to e.g. fossil‐baseu fuels. The costs ielateu
to cieating a sugai platfoim fiom lignocellulosic biomass
involve biomass abunuance, location anu tianspoit of the
biomass to the piouuction facility, pie‐tieatment stiategies,
anu efficient hyuiolytic enzymes (Knauf & Noniiuzzaman,
2uu4). Evaluating on the oveiall piouuction cost, the piice
of enzymes typically contiibutes to a laige pait of the total
cost (Neiino & Cheiiy, 2uu7). Efficient enzymes foi
lignocellulose uegiauation aie, theiefoie, of high uemanu.
As most of the cuiiently useu pietieatment methous
iemove lignin fiom the sugai polymeis anu in many cases
also hyuiolyze most of the hemicellulose, the main taiget
foi enzyme tieatment is cellulose. As beta‐glucosiuases aie
key in teims of final cellulose hyuiolysis foi obtaining
sugais, anu commeicial beta‐glucosiuases oiiginate fiom
fungi, we have chosen to focus this ieview on fungal beta‐
glucosiuases.
This papei will piesent the chaiacteiization, uiscoveiy,
piouuction, anu use of fungal beta‐glucosiuases foi
piouuction of sugais foi biofuel anu biopiouuct piouuction.
It focuses on some of the featuies that aie impoitant to
consiuei foi inuustiial application within piouuction of
biofuels anu biopiouucts as well as uesciibes uiffeient
methous to uiscovei new beta‐glucosiuases anu methous to
impiove beta‐glucosiuases. Besiues uiscussing the
application of beta‐glucosiuases foi geneiation of
monomeiic sugais, integiation of enzymatic
sacchaiafication anu feimentation in a single oiganism in a
consoliuateu biopiocess is uiscusseu.
 
Sequence,  structure,  and  action  of  beta‐
glucosidases 
Classification 
Beta‐glucosiuases aie classifieu as glycosiue hyuiolases in
the I0B Enzyme Nomenclatuie (1984) baseu on the type of
ieaction they catalyze. ulycosiue hyuiolase enzymes have
been assigneu the numbei EC S.2.1.X, which uenotes theii
ability to hyuiolyze O‐glycosyl linkages, such as the 1,4‐
beta‐linkage of cellobiose, with the “X” iepiesenting the
substiate specificity. In the case of beta‐glucosiuases, the
full numbei is EC S.2.1.21`. This uefines hyuiolysis of
teiminal, non‐ieuucing beta‐B‐glucosyl iesiuues with
ielease of beta‐B‐glucose. A wiue specificity foi beta‐B‐
glucosiues is founu anu theie aie examples of some beta‐
glucosiuases hyuiolyzing beta‐B‐galactosiues, alpha‐L‐
aiabinosiues, beta‐B‐xylosiues, oi beta‐B‐fucosiues
(Baiioch, 2uuu). Baseu on substiate specificity, beta‐
glucosiuases have tiauitionally been uiviueu into
cellobiases (high specificity towaius cellobiose), aiyl‐ beta‐
glucosiuases (high specificity towaius substiates such as p‐
nitiophenyl‐beta‐B‐glucopyianosiue (pNPu)), oi bioau
specificity beta‐glucosiuases (Shewale, 1982; Eyzaguiiie  et 
al., 2uuS).
A classification baseu on substiate specificity cannot
sufficiently accommouate enzymes that act on seveial
substiates, an issue that is paiticulaily ielevant foi
glycosiue hyuiolases that fiequently uisplay bioau
oveilapping specificities. Beniissat (1991) pioposeu a
classification system baseu on sequence anu stiuctuial
featuies that coulu complement the I0B system foi bettei
uesciiption of the glycosiue hyuiolases. Thiough sequence
alignment of the known glycosiue hyuiolases, uB families
weie uefineu when at least two sequences showeu
significant amino aciu similaiity oi no significant similaiity
coulu be founu with othei families. The sequence iuentity of
a family coulu be as low as 1u% but with conseiveu
sequence motifs spanning the active site being iecognizeu.
Natuially, as moie sequence uata of uiffeient oiganisms
become available the total numbei of families is likely to
inciease (Beniissat, 1991; Beniissat & Baiioch, 199S;
Beniissat & Baiioch, 1996) anu at piesent (}uly 2u1u) theie
aie 118 families. The stiength of this system especially lies
in the investigation of the active site of the enzymes, with
significant similaiity of sequences being a stiong inuication
of similaiity in the folu of the stiuctuie. Nembeis of the
same uB family, theiefoie, most likely shaie the same
 
Review paper 
‐ 4 ‐ 
 
foluing chaiacteiistics anu analysis of theii piimaiy
stiuctuie can assign potential conseiveu active‐site
iesiuues, which will be uiscusseu in gieatei uetail in the
following paiagiaph. The EC anu uB systems complement
each othei anu aie at the same time inteilinkeu in the way
that many of the sequence baseu families aie polyspecific in
teims of containing enzymes with uiffeient substiate
specificities, implying evolutionaiy uiveigence, while at the
same time enzymes with similai specificities aie sometimes
founu in uiffeient families, implying conveigent evolution
(Beniissat & Bavies, 1997).
The CAZY uatabase (http:¡¡www.cazy.oig¡) has since
1998 been a uatabase specifically ueuicateu to list the
infoimation on Caibohyuiate‐Active enZYmes, containing
genomic, stiuctuial anu biochemical infoimation. The
uatabase compiises glycosiue hyuiolases (uBs), glycosyl
tiansfeiases (uTs), polysacchaiiue lyases (PLs), anu
caibohyuiate esteiases (CEs). Seaiching the CAZY uatabase,
beta‐glucosiuases aie founu in families 1, S, 9, Su, anu 116;
howevei fungal beta‐glucosiuases aie iepiesenteu only in
families 1 anu S. ueneially, family 1 enzymes mainly incluue
bacteiial, aichaeal, plant, animal, anu some fungal beta‐
glucosiuases, while family S incluues some bacteiial, all
yeast, anu seveial fungal beta‐glucosiuases (Cantaiel  et  al.,
2uu9). Nost family 1 enzymes, besiues of beta‐glucosiuase
activity, also show significantly beta‐galactosiuase activity
(Cantaiel et al., 2uu9).
Foi uB1 anu uBS which contain fungal beta‐
glucosiuases, the active site consensus patteins aie uefineu
as wiitten in Box 1, wheie the glutamate (E) anu aspaitate
(B) aie the active site iesiuues (unueilineu), iespectively.
These iegions aie useu as a signatuie pattein in the uB
classification of the enzymes (Baiioch, 1992; Baiioch,
2uuu).

Structure 
The topology of the active sites of all glycosiue hyuiolases
falls into only thiee geneial classes, (i) pocket oi ciatei, (ii)
cleft oi gioove, anu (iii) tunnel. Beta‐glucosiuases anu non‐
piocessive exo‐acting enzymes have the pocket oi ciatei
topology that is well suiteu foi iecognition of a sacchaiiue
non‐ieuucing extiemity (Bavies & Beniissat, 199S), with
the uepth anu shape of the pocket oi ciatei ieflecting the
numbei of subsites that contiibute to substiate binuing anu
the length of the leaving gioup (Bavies et al., 1997).
Seveial uB1 beta‐glucosiuase ciystal stiuctuies have
been ueteimineu fiom uiffeient oiganisms, e.g. Trifolium 
repens  (clovei) (Baiiett  et  al., 199S), Bacillus  polymyxa 
(eubacteiium) (Sanz‐Apaiicio  et  al., 1998), Bacillus 
circulans (Bakulinen et al., 2uuu), Zea mays (maize) (Czjzek 
et  al., 2uu1), Thermus  nonproteolyticus  (eubacteiium) 
(Wang  et  al., 2uuS), Triticum  aestivum (wheat) anu Secale 
cereale (iye) (Sue  et  al., 2uu6), Phanerochaete 
chrysosporium (white iot fungus) (Nijikken et al., 2uu7), anu
Oryza  sativa (iice) (Chuenchoi  et  al., 2uu8), which have
helpeu unueistanuing theii mechanism anu bioau substiate
specificity.
The uBS enzymes, which aie abunuant in the fungal
genomes, aie less well chaiacteiizeu with only a few ciystal
stiuctuies having been solveu: beta‐glucoasiuase fiom
Hordeum  vulgare (bailey) (vaighese  et  al., 1999),
Kluyveromyces  marxianus  (a yeast), anu Thermotoga 
neapolitana  (a hypeitheimophilic bacteiium)

(Pozzo  et  al.,
2u1u). Bowevei, at piesent theie aie no ciystal stiuctuies
available fiom filamentous fungi (Cantaiel et al., 2uu9).
Bomology moueling has been the methou of choice foi
obtaining the stiuctuial infoimation fiom fungal beta‐
glucosiuases uue to unavailability of the stiuctuies. We
have moueleu the beta‐glucosiuase fiom the newly
iuentifieu A.  saccharolyticus in collaboiation with NAX‐lab,
Sweuen. Even though the sequence iuentity was ielatively
low, it was obvious that the iesiuues impoitant foi
substiate binuing anu catalysis weie conseiveu (Reseaich
papei Iv, this thesis). Similaily, }eya et  al.  (2u1u) have
moueleu the enzyme fiom Penicillium  purpugenum, wheie
they founu that the uistance between the conseiveu
catalytic iesiuues is similai to that of the enzyme fiom
bailey, concluuing a compaiable function.
Stiuctuially uB1s anu uBSs uiffei gieatly, e.g. sequence
iuentity, folu anu the active site iesiuues as illustiateu
above. These stiuctuial uiffeiences altei the functional
piopeities of the enzymes such as substiate specificity,
binuing anu catalytic mechanism anu iate. The catalytic
pocket of uB1s is a tight, ueep pocket like a naiiow tunnel
with a ueau enu. Neanwhile, uBSs have a shallow, open
pocket. The stiuctuie of uB1s will most likely place gieatei
constiaints on the substiate confoimation compaieu to
uBSs (Baivey et al., 2uuu; peis.com. Wimal 0bhayasekeia).
Evolution anu enviionmental factois effect on these
uiffeiences in stiuctuie. Beniissat & Bavies (1997)
pioposeu conveigent evolution to explain the uistiibution
of beta‐glucosiuases in uiffeient uB families, in othei
woius, they have auapteu towaius the same kinu of
enviionment.
Box 1. Active site signatuies
uB1 active site signatuie
|LIvNFSTCj – |LIvFYSj – |LIvj – |LIvNSTj – E – N – u – |LIvNFARj – |CSAuNj

uBS active site signatuie
|LIvNj(2) – |KRj – X – |EQKRBj – X(4) – u – |LIvNFTCj – |LIvTj – |LIvNFj – |STj – B – X(2) – |SuABNITj
 
Review paper 
‐ 5 ‐ 
 
 
 
 
 
Fig. 1. Catalytic mechanism of 
beta‐glucosidases. Reprintet from 
McCarter & Withers (1994). 
Catalytic mechanism 
Byuiolysis of beta‐1,4‐glycosiuic bonus by beta‐
glucosiuases is caiiieu out by an oveiall ietaining uouble‐
uisplacement mechanism (Sinnott, 199u). Two catalytic
caiboxylic aciu iesiuues at the active site sepaiateu by
appioximately SÅ facilitate the ieaction with one caiboxylic
aciu acting as a nucleophile anu the othei as an aciu¡base
catalyst (Fig. 1). With substiate locateu at the active site, the
uepaituie of the aglycone is initially facilitateu by geneial
aciu catalysis, wheie the aciu¡base catalyst uonates a
pioton to the linking beta‐1,4‐oxygen of the scissile bonu,
bieaking the bonu, anu cieating an oxocaibenium‐ion‐like
tiansition state with a builu‐up of positive chaige on the
anomeiic caibon. The caiboxylic aciu nucleophile attacks
the anomeiic caibon, geneiating a covalent inteimeuiate.
This inteimeuiate is hyuiolyzeu by nucleophile attack of a
watei molecule fiom the bulk solvent, which by abstiaction
of a pioton has been activateu by the uepiotonateu
aciu¡base catalyst (Koshlanu, 19SS; Nccaitei & Witheis,
1994; White & Rose, 1997).
The siue‐chain of eithei a glutamate oi an aspaitate acts
as the catalytic nucleophile in uB1 anu uBS beta‐
glucosiuases, iespectively (Baiioch, 1992; Baiioch, 2uuu).
Iuentification of the active site nucleophile in beta‐
glucosiuases has been achieveu thiough the foimation of a
stabilizeu glycosyl‐enzyme inteimeuiate using glycosiuase
inhibitois such as 2‐fluoio‐glycosiues to tiap the covalent
inteimeuiate (Witheis  et  al., 1987; Witheis  et  al., 1988;
Witheis & Aebeisolu, 199S). In the Aspergillus  niger beta‐
glucosiuase, the Asp‐261 was iuentifieu as the catalytic
nucleophile by the use of 2‐ueoxy‐2‐fluoioglucosyl (Ban  et 
al., 2uuu). The inhibitoi inteiacts with the enzyme, wheie
the positive chaige, uevelopeu at C1 in the tiansition state,
will be significantly uestabilizeu uue to piesence of the
fluoiine substituent at C2 as fluoiine is much moie
electionegative than hyuioxyl. This will ueciease the iate of
both the glycosylation anu ueglycosylation. Incoipoiation of
a goou leaving gioup to the substiate such as 2,4‐
uinitiophenolate oi fluoiiue will speeu up the glycosylation
step anu allow foi the “captuie” of the inhibitoi at the active
site, obtaining a time‐uepenuent inactivation via
accumulation of the ielative stable 2‐ueoxy‐2‐
fluoioglycosyl‐enzyme inteimeuiate (Witheis  et  al., 1987;
Witheis & Aebeisolu, 199S). Ban et  al. (2uuu) useu this
methou to label the nucleophile, anu compaie it with a non‐
inhibiteu enzyme thiough peptic uigestion, BPLC
sepaiation, anu tanuem mass spectiometiic analysis, which
alloweu foi iuentification of the peptiue to which the
inhibitoi hau bounu. In this case, Asp‐261 of the A.  niger
beta‐glucosiuase was the only possible nucleophile
canuiuate piesent in the specifieu peptiue.
No tagging methou of the aciu¡base catalyst has been
uesciibeu, iathei has the iole of pioposeu catalysts been
veiifieu by mutagenesis anu kinetic analysis (Svensson &
Sogaaiu, 199S). ueneially, seveial site‐uiiecteu
mutagenesis stuuies have been caiiieu out on glycosiue
hyuiolases in teims of unueistanu in theii mechanism
bettei. 0ne example is site‐uiiecteu mutagenesis stuuies
wheie a pioposeu nucleophile catalyst is ieplaceu by othei
amino acius that will not change the confoimation of the
active site, but cannot act as a catalyst. This can give insight
to the necessity anu function of that paiticulai ieplaceu
amino aciu. This was uone by Li et  al. (2uu1) on a uBS
beta‐glucosiuase, pioviuing eviuence that Asp‐247 plays an
impoitant iole in the enzymatic ieaction catalyzeu by that
paiticulai beta‐glucosiuase anu most likely functions as the
nucleophile. Stiuctuial stuuies of beta‐glucosiuases give
conciete eviuence on active site iesiuues, which aie
possible to confiim by site‐uiiecteu mutagenesis. The uBS
glycosiuase of T. neapolitana is a goou example to show this
piocess; the nucleophile Asp‐242 anu aciu¡base ulu‐4S8
weie iecognizeu fiist by sequence alignment evaluation,
then compaieu with thiee uimensional stiuctuie anu
confiimeu by site‐uiiecteu mutagenesis (Pozzo et al., 2u1u).
Not only catalytic iesiuues, but also the iesiuues
impoitant foi substiate binuing can be iuentifieu fiom the
stiuctuie of the enzyme. Foi example, foi the uBS beta‐
glucosiuase fiom T.  neapolitana, seven amino acius (BS8,
R1Su, K16S, B164, R174, Y21u, anu ES48) in the active site
have been pointeu out to be involveu in hyuiogen bonuing
with the glucopyianosiue iesiuue, wheie van uei Walls
inteiactions occui between atoms C4, CS, anu C6 anu amino
aciu iesiuues W24S, N2u7, anu SSu7

(Pozzo  et  al., 2u1u).
Similaily, seven amino acius (B9S, R1S8, K2u6, B2u7, B28S,
Y2SS, anu E491) fiom the the bailey beta‐glucan
exohyuiolases have been iepoiteu to involve in hyuiogen
bonuing with the substiate.
Nost ietaining beta‐glucosiuases have tiansglycosiuic
 
Review paper 
‐ 6 ‐ 
 
activity. Such ieaction takes place aftei the glycosiuic bonu
has been cleaveu anu the aglycone ieleaseu. Insteau of a
nucleophilic attack by a watei molecule fiom bulk solvent
to pioceeu the hyuiolysis of the glycosyl‐enzyme
inteimeuiate, an acceptoi such as sugai oi alcohol binus.
The acceptoi competes with watei anu the extent of
tiansglycosiuic ieaction uepenus on the affinity,
concentiation, anu tenuency to ieact of the acceptoi
(Witheis, 1999). In A.  niger beta‐glucosiuase, Tip‐262 has
been founu to be a key iesiuue in teims of maintaining
hyuiolytic iathei than tiansglycosiuic activity. Tip‐262 is
locateu aujacent to the nucelophile catalyst, Asp‐261, in the
active site, anu substitution of Tip‐262 cause the ieaction to
be mainly tiansglycosiuic (Seiule & Bubei, 2uuS). 0n the
contiaiy, Tip‐49 of A.  niger beta‐glucosiuase has been
shown to be impoitant foi binuing acceptois anu thus
tiansglycosiuic activity; substitution of this iesiuue
piouuceu an enzyme with high iatio of hyuiolytic to
tiansglycosiuic activity (Seiule et al., 2uu6).

What is a good beta‐glucosidase? 
In ielation to inuustiial biomass conveision, a goou beta‐
glucosiuase facilitates efficient hyuiolysis at specifieu
opeiating conuitions. Key points to consiuei when
evaluating a beta‐glucosiuase aie conveision iate,
inhibitois, anu stability. Bigh conveision iates aie essential,
but issues such as piouuct inhibition anu theimal instability
can be a iestiiction foi maintaining high conveision iates
thioughout the hyuiolysis.
Enzyme activity is stanuaiuly measuieu in units, which is
equivalent to miciomoles hyuiolyzeu pei minute of the
ieaction unuei a given set of conuitions. Kinetic paiameteis
iepoiteu foi beta‐glucosiuases useu foi compaiison anu
geneial evaluation typically ielates to Nichaelis Nenten
kinetics.

Eq(1) NN kinetics : =
I
mux
|S]
|S] + K
M


wheie v is the initial iate of piouuct foimation, vmax is the
maximum ieaction iate, the iate obseiveu when the enzyme
is satuiateu with substiate, KN is the Nichaelis constant,
anu |Sj is the substiate concentiation. The kinetic constants
can be ueteimineu by uiffeient ieaiiangements of the NN
equation giving lineai equation, wheie the constants aie
ueiiveu fiom axis inteicepts oi line slope, oi by non‐lineai
iegiession aiueu by uiffeient computei piogiams. Pievious
ieviews on beta‐glucosiuases have summaiizeu publisheu
values of kinetic piopeities of uiffeient miciobial beta‐
glucosiuases (Bhatia et al., 2uu2; Eyzaguiiie et al., 2uuS) .
In teims of evaluating beta‐glucosiuase peifoimance
baseu on the kinetic paiameteis, vmax anu KN, the optimal
enzyme has high vmax anu low KN. Fiom the NN equation it
can be ueiiveu, that in situations wheie substiate
concentiation is much gieatei than KN, the velocity of the
ieaction, v, will equal vmax with no uepenuence on KN. So on
that note, vmax will be the bettei uesciiption in teims of
enzyme evaluation. In ielation to the application of beta‐
glucosiuases foi complete cellulose hyuiolysis, the
hyuiolysis of cellobiose by the beta‐glucosiuases shoulu not
just be evaluateu at satuiateu conuitions in an isolateu
fashion. The substiate concentiation foi the beta‐
glucosiuases will uepenu on the balance of the
cellobiohyuiolase, enuo‐glucanase, anu beta‐glucosiuase
enzyme mixtuie. The beta‐glucosiuases might efficiently
hyuiolyze the cellobiose piouuct as they aie foimeu by the
cellobiohyuiolases, wheieby substiate satuiation is nevei
ieacheu. The value of KN shoulu not be uiscieuiteu in such
situation.
The activity of beta‐glucosiuases is influenceu by seveial
factois incluuing inhibitois anu stability at piocess
conuitions. In ielation to beta‐glucosiuase activity in
hyuiolysis of biomass foi geneiating sugais the inhibition
type mostly uiscusseu anu often encounteieu is causeu by
the enu‐piouuct, glucose. Bowevei, compounus othei than
glucose aie potentially piesent that can influence the
activity of beta‐glucosiuases, incluuing (but not exclusive)
othei simple sugais, sugai ueiivatives, amines, anu phenols
(Bale et al., 198S). In case of piouuct inhibition, the effect is
natuially incieaseu uuiing the couise of the ieaction as
moie anu moie glucose is foimeu, anu foi beta‐glucosiuases
the enu‐piouuct is geneially not iemoveu uuiing hyuiolysis
so the actual ieaction iate will uiffei moie anu moie fiom
vmax. The accumulation of glucose has often been iepoiteu
to ueciease ieaction iates of beta‐glucosiuases as
hyuiolysis pioceeus, incluuing beta‐glucosiuases of
uiffeient oiigin. In teims of NN kinetics, the inhibitoi
constant, Ki, is fiequently useu to uefine piouuct inhibition,
a value that has also been iepoiteu foi seveial beta‐
glucosiuases in the ieview by Eyzaguiiie et al. (2uuS).
A ueciease in the iate of glucose foimation can also be
causeu by tiansglycosylation events. 0thei than inhibiting
the ieaction by occupying the active site, glucose can also be
consiueieu to take pait in tiansglycosylation events, thus
using the active site capacity in non‐hyuiolyzing action
which will ueciease the oveiall iate of hyuiolysis.
Tiansglycosylation has fiequently been iepoiteu foi beta‐
glucosiuases (Bhatia et al., 2uu2). In ielation to geneiating a
sugai platfoim thiough biomass hyuiolysis,
tiansglycosylation events aie unwanteu. Taigeteu
mutagenesis aiming at uisplacing essential amino acius
involveu in tiansglycosylation coulu potentially ieuuce this
unwanteu mechanism.
Stability of beta‐glucosiuases in ielation to the physical
opeiating conuitions is iequiieu foi efficient hyuiolysis.
Beta‐glucosiuases can, uepenuing on the extiemity anu time
of exposuie, be inactivateu by pB anu tempeiatuie
vaiiations. Regaiuing influence of pB, ionic gioups aie
involveu in enzyme catalysis, such as the aciu‐base catalyst
 
Review paper 
‐ 7 ‐ 
 
in the beta‐glucosiuase active site. The piotonation state of
the caiboxylic aciu iesiuue catalyst anu the caiboxylate
nucleophile is essential foi the ieaction anu a pB change
coulu impaii the catalytic mechanism (NcIntosh  et  al.,
1996). Regaiuing tempeiatuie, accoiuing to the van’t Boff
iule, ieaction iate uoubles with eveiy 1u°C inciease of
tempeiatuie, which applies to all chemical ieactions
incluuing enzyme catalyzeu ieactions. Bowevei, when
ieaching high tempeiatuies, piotein stability will be
affecteu, leauing to uenatuiation, thus iiieveisible
inacitivation, of the enzyme. Tempeiatuie anu pB optimum
foi miciobial beta‐glucosiuases have been iepoiteu in the
ieviews by Bhatia et al. (2uu2) anu Eyzaguiiie et al. (2uuS),
but foi biomass hyuiolysis piocesses that typically iun foi
the uuiation of houis oi even uays, the stability of the
enzyme at specifieu tempeiatuies is impoitant. Theimal
inactivation usually follows fiist oiuei uecay, with the iate
of uenatuiation being a valiu value foi evaluation of the
enzymes at uiffeient tempeiatuies.

Eq(2) Theimal inactivation |E]
uctì¡c
= |E]
stu¡t
c
−k
D
t


wheie |Ejactive is the iemaining active enzymes at time=t,
|Ejstait is the initial enzyme concentiation at time zeio, ‐kB is
the iate of uegiauation, anu t is the time. The enzyme
stability can be iepoiteu as the half life at uiffeient
tempeiatuies, calculateu fiom equation 2.
In piactical teims, when stuuying the kinetics of beta‐
glucosiuases, it is impoitant to specify what substiate that
is useu as substiate specificity of beta‐glucosiuases vaiies
(Riou et al., 1998; Bhatia et al., 2uu2; Eyzaguiiie et al., 2uuS;
Langston et al., 2uu6; Koiotkova et al., 2uu9) anu the choice
of substiate will influence the kinetic uata obtaineu. Seveial
uiffeient substiates with vaiying sensitivity anu ease of use
can be applieu foi the ueteimination of beta‐glucosiuase
activity. Aiyl‐glucosiuases aie often favoieu as substiates,
as a coloieu oi fluoiescent piouuct is ieleaseu upon
hyuiolysis, simplifying uetection of activity. In this categoiy
of substiates, pNPu is piobably the most common
encounteieu in the liteiatuie. In hyuiolysis of cellulose foi
making sugais foi piouuction of biopiouucts anu biofuels,
cellobiose anu cellouextiins will be the majoi substiates foi
beta‐glucosiuases. These natuial substiates shoulu
piefeiably be useu in the evaluation of beta‐glucosiuases.
Activity on the natuial substiates is calculateu by
measuiing ielease of glucose, oi alteinatively, ueciease in
substiate concentiation. The lattei iequiies high analytical
piecision anu has been uemonstiateu using ion‐exchange
chiomatogiaphy (IC) methous (Reseaich papei II, this
thesis). Betection of glucose, even in scaice amounts, can be
uone by the glucose oxiuase¡peioxiuase methou
(Beigmeyei & Beint, 1974; Nazuia  et  al., 2uu6),
hexokinase¡glucose‐6‐phosphate uehyuiogenase methou
(Kunst  et  al., 1984), high peifoimance liquiu
chiomatogiaphy (BPLC), oi IC.
Beta‐glucosidases for biomass hydrolysis 
The two laigest enzyme companies, Novozymes A¡S anu
uenencoi (a Banisco Bivision), have both paiticipateu in
laige ieseaich piogiams suppoiteu by the 0S Bepaitment
of Eneigy, aiming at impioving the peifoimance of enzymes
foi biomass hyuiolysis (Baneijee  et  al., 2u1ub). Beta‐
glucosiuaes aie wiuely piouuceu by uiffeient geneia anu
species of the fungal kinguom incluuing Ascomycetes anu
Basiuiomycetes, wheie especially the ascomycete genus
Aspergillus has been wiuely stuuieu foi beta‐glucosiuase
piouuction. Especially A.  niger has been setting the
stanuaiu in commeicial beta‐glucosiuase piouuction
(Bekkei, 1986).
Commercial beta‐glucosidases 
The piimaiy beta‐glucosiuase piepaiation by Novozymes
A¡S is Novozym 188. Seveial publications exist wheie
authois have useu this commeicial piouuct as beta‐
glucosiuase supplement to the hyuiolysis of cellulosic
mateiial. The tempeiatuie optimum foi Novozym 188 is
aiounu 6S°C (Bekkei, 1986; Chauve  et  al., 2u1u) though
with tempeiatuie stability maintaineu only below 6u°C
(Bekkei, 1986; Biavo  et  al., 2uuu; Calsavaia  et  al., 2uu1),
anu foi piolongeu incubations the stability was only uphelu
below Su°C (Kiogh  et  al., 2u1u). The pB stability iange is
between 4‐S (Chauve  et  al., 2u1u; Kiogh  et  al., 2u1u;
Reseaich papei II, this thesis), with an optimum at pB 4.S‐
4.S (Biavo  et  al., 2uuu; Biavo  et  al., 2uu1; Calsavaia  et  al.,
2uu1; Chauve  et  al., 2u1u; Reseaich papei II, this thesis).
The activity is competitively inhibiteu by glucose (Bekkei,
1986; Chauve  et  al., 2u1u), with a ueciease in activity to
Su% at a glucose concentiation appioximately S times that
of the substiate concentiation (Bekkei, 1986; Reseaich
papei II, this thesis). Eviuence of substiate inhibition oi
tiansglycosylation has been founu using pNPu, wheieas
cellobiose uiu not appeai to be inhibitoiy at the testeu
conuitions (Bekkei, 1986; Kiogh  et  al., 2u1u; Reseaich
papei II, this thesis).
The piimaiy beta‐glucosiuase piepaiation by uenencoi
is AccelleiaseBu. This enzyme is less fiequently mentioneu
in the liteiatuie, but accoiuing to the manufactuiei the
enzyme has the best opeiational stability at pB 4‐6 anu
tempeiatuies ianging Su‐SS°C, with long opeiational times
possible at the low tempeiatuies while the highei
tempeiatuies will limit the effective peiiou of opeiation.
Effect of piouuct accumulation on enzyme activity is not
mentioneu by the manufactuiei (Banisco 0S Inc, 2uu9).
Recently both enzyme companies have launcheu
cellulase piouucts with sufficient beta‐glucosiuase activity
foi efficient hyuiolysis of biomass without sepaiate
auuition of supplementaiy beta‐glucosiuase.
Cellic CTec2 is cuiiently the state‐of‐the‐ait enzyme
fiom Novozymes A¡S that accoiuing to the company has
pioven effective on a wiue vaiiety of lignocellulosic
 
Review paper 
‐ 8 ‐ 
 
substiates. Accoiuing to its application sheet, it contains a
blenu of cellulases, high level of beta‐glucosiuase, anu
hemicellulases, functioning at optimal tempeiatuie of 4S‐
Su°C anu pB S.u‐S.S. Some of the key elements, piomiseu by
the manufactuiei, aie high conveision yielus, enzyme
concentiation, stability, anu inhibitoi toleiance as well as
the enzyme being effective at high soliu concentiations anu
compatible with multiple feeustocks anu pietieatment
methous. By containing all cellulase anu beta‐glucosiuase
components foi cellulose hyuiolysis, Cellic CTec2 ieplaces
the combineu use of foimei applieu Celluclast 1.SL anu
Novozym 188 (Novozymes A¡S, 2u1u).
Accelleiase B0ET is a newly intiouuceu piouuct by
uenencoi that, accoiuing to the company, is saiu to be a
mile‐stone in making cellulosic ethanol at a commeicial
piofitable scale. Accoiuing to its application sheet the
piouuct is piouuceu with a genetically mouifieu T.  reesei
stiain. It contains all majoi activities neeueu foi biomass
hyuiolysis anu has enhanceu hemicellulase activity. Less
uosage of the piouuct is iequiieu compaieu to foimei
piouucts. Best opeiational stability is at pB 4.u‐S.S anu
tempeiatuies of 4S‐6u°C, ietaining 1uu% activity aftei 24
houis incubation at Su°C, but only appioximately 6u% at
6u°C. The enzyme complex can hyuiolyze a bioau iange of
lignocellulosic caibohyuiates of uiffeient feeustocks anu
pietieatment methous into feimentable monosacchaiiues.

Promising  beta‐glucosidases  recently  reported  in  the 
literature 
Within the last uecaue, seveial new beta‐glucosiuases with
uiffeient specificities have been iepoiteu in the liteiatuie.
We piesent some of these beta‐glucosiuases that can
potentially be impoitant in biomass uegiauation.
Special attention has been paiu to theimostability of
beta‐glucosiuases, anu beta‐glucosiuases oiiginating fiom
fungi belonging to uiffeient geneia have been pioposeu as
piomising canuiuates foi biotechnological piocesses at
elevateu tempeiatuies. Theimal stability, howevei, is moie
uifficult to compaie as uiffeient ieseaiches use uiffeient
incubation conuitions, times anu tempeiatuies. As the
commeicial enzymes piimaiily aie meant to opeiate
aiounu Su°C, only uata well above this tempeiatuie is uealt
with heie. Penicillium  citrinumis is iepoiteu to have a half
life of 12u min at S8°C (Ng et al., 2u1u), Monascus purpureus
of S1S min at 6u°C (Baioit  et  al., 2uu8), anu A. 
saccharolyticus of S6S min at 61°C (Reseaich papei Iv, this
thesis). Elevating the tempeiatuie fuithei, A. 
saccharolyticus has a half life of 61 min at 6S°C (Reseaich
papei Iv, this thesis), compaiable to Talaromyces  emersonii
foi which a half life of 62 min at 6S°C has been iepoiteu
(Nuiiay  et  al., 2uu4). We founu A.  saccharolyticus beta‐
glucosiuase to be moie theimostable than the commeicial
enzyme piepaiation Novozym 188 fiom A.  niger, as it
ietaineu moie than 9u% activity at 6u°C anu still hau
appiox. 1u % activity at 67°C aftei 2 houis of incubation,
while Novozym 188 hau 7S% activity at 6u°C, but no
activity at 67
o
C aftei 2 houis of incubation (Reseaich papei
II, this thesis). Aftei 4 houis of incubation these uiffeiences
aie much moie pionounceu as the beta‐glucosiuase of A. 
saccharolyticus still hau moie than 7u % activity while
Novozym 188 uiop to 4u % activity at 6u°C. Rojaka et  al.
(2uu6) similaily founu half‐life of A.  niger beta‐glucosiuase
to be 8 houis at SS°C anu 4 houis at 6u°C , which is similai
to oui iesults (Reseaich papei II, this thesis), wheieas
Kiogh et  al. (2u1u) inuicate a half‐life foi A.  niger beta‐
glucosiuase of 24 houis at 6u°C. This is six times longei
than measuieu by us anu Rojaka et  al.  (2uu6). Beckei et  al.
(2uuu) uemonstiates that A.  japonicus anu A.  tubingensis
beta‐glucosiuase weie iemaikably stable, maintaining 8S%
anu 9u% activity, iespectively, aftei 2u houis incubation at
6u°C.. Bowevei, Koiotkova et  al. (2uu9) founu A.  japonicus
beta‐glucosiuase to only ietain S7% of its activity aftei
incubation foi 1 houi at Su°C., contiauicting the finuings of
Bekkei et  al. (2uuu). This cleaily uemonstiates how
complex it can be to compaie iesults by uiffeient
ieseaicheis, most likely uue to uiffeient conuitions being
useu uuiing incubation anu assaying the activity. Foi a tiue
compaiison the enzymes in question shoulu be testeu in
paiallel by the same laboiatoiy. Stability foi piolongeu
peiious at high tempeiatuies was founu foi both Aspergillus 
fumigatus with a half life gieatei than 19 houis at 6S°C (Kim 
et  al., 2uu7a) anu Penicillium  brasilianum with a half life of
24 houis at 6S°C (Kiogh  et  al., 2u1u). Neanwhile, high
tempeiatuie stability has sometimes been iepoiteu using a
ielatively shoit incubation time, making it uifficult to
compaie tempeiatuie stability between uiffeient beta‐
glucosiuases. Foi example, ue Palma‐Feimanuez et  al.
(2uu2) have puiifieu two beta‐glucosiuases fiom the
theimophilic fungus Thermoacus  aurantiacus anu founu
that they ietaineu between 7S‐82% activity aftei incubation
foi 1 houi at 7u°C, anu Leite et al. (2uu8) founu that a beta‐
glucosiuase fiom the yeast‐like fungus, Aureobasidum 
pullans, hau a theimostability up to 7u°C when incubateu
foi 1 houi, anu a calculateu half life of S1 min at 8u°C.
Bigh conveision iates aie essential foi efficient
conveision of biomass. Accumulation of glucose uuiing
hyuiolysis can significantly lowei the iate of cellulose
hyuiolysis thiough inhibtion anu anothei impoitant focus
foi incieasing oveiall biomass hyuiolysis is, theiefoie, high
toleiance of beta‐glucosiuases towaius glucose
accumulation. Beckei et  al. (2uu1) have investigateu foui
beta‐glucosiuases fiom Aspergillus tubingensis of which two
hau high glucose toleiance, Ki,glu of 47u anu 6uumN,
iespectively, when using pNPu as substiate. Eailiei, the
same lab iepoiteu high glucose toleiance fiom a beta‐
glucosiuase of Aspergillus  foetidus, with a Ki of S2umN
(Beckei  et  al., 2uuu). A similai toleiance towaius glucose
was founu foi a beta‐glucosiuase fiom A. niger, Ki of S4SmN
(Yan  et  al., 1998) anu an even highei toleiance was
iepoiteu foi a beta‐glucosiuase of A.  oryzae, Ki of 9SSmN
 
Review paper 
‐ 9 ‐ 
 
 
 
 
 
 
Fig. 2. Sketch of the different 
strategies described to obtain more 
efficient beta‐glucosidases 
(uunata & valliei, 1999). Recently, the activity of beta‐
glucosiuases fiom Aspergillus  caespitosus was iepoiteu by
Sonia et al. (2uu8) to be stimulateu in the piesence of up to
SuumN glucose, having S.8 folu gieatei activity at these
glucose concentiations than in the absence of glucose;
howevei a shaip uecline in activity was founu above this
concentiation.

Screening for new beta‐glucosidases 
In oiuei to optimize the use of uiffeient biomasses, it is
impoitant to iuentify new beta‐glucosiuases with impioveu
abilities on the specific biomasses as well as with impioveu
abilities such as stability anu high conveision iates. Piouuct
inhibition, theimal inactivation, low piouuct yielus, anu
high cost of enzyme piouuction aie the main obstacles of
commeicial cellulose hyuiolysis anu theiefoie set the stage
in the seaich foi bettei alteinatives to the cuiiently
available enzyme piepaiations. The beta‐glucosiuases can
be aiiangeu in thiee gioups ielateu to localization:
intiacellulai, cell wall associateu, anu extiacellulai.
Inuustiially, piimaiily the extiacellulai beta‐glucosiuases
aie of inteiest. With moie efficient beta‐glucosiuases being
the goal, two stiategies aie in play. 0ne is to scieen foi new
beta‐glucosiuases, the othei is to impiove known beta‐
glucosiuases. The numbei of fungal species on Eaith is
estimateu to 1.S million of which as little as appioximately
S% aie known (Bawkswoith, 1991; Bawkswoith, 2uu1), a
statement that calls foi a moie uiiecteu effoit foi
uniaveling the potential of unknown species founu in
natuie. The question of wheie to look foi these unuesciibeu
fungi is uiscusseu by Bawkswoith anu Rossman (1997):
Eveiywheie, incluuing youi own backyaiu. The
iuentification anu chaiacteiization of new fungal species aie
often encounteieu in liteiatuie. Within the black Aspergilli,
to which the efficient beta‐glucosiuase piouucei A.  niger
belongs, seveial new species have been iuentifieu within
the last few yeais (Samson et al., 2uu4; ue viies et al., 2uuS;
Seiia  et  al., 2uu6; vaiga  et  al., 2uu7; Naies  et  al., 2uu8;
Noonim  et  al., 2uu8a; Noonim  et  al., 2uu8b; Peiione  et  al.,
2uu8), incluuing A.  saccharolyticus iuentifieu by oui gioup
(Reseaich papei III, this thesis).
A scieening stiategy must be planneu thoioughly
because “you get what you scieen foi”. Cheap, simple, iapiu,
anu uisciiminatoiy uetection anu selection methous aie
sought to iuentify exactly those fungi haiboiing efficient
beta‐glucosiuases, as scieening usually involves a veiy laige
numbei of samples to be piocesseu (Cheetham, 1987).
Biffeient stiategies can be chosen in the seaich foi new
beta‐glucosiuases, incluuing scieening of fungal extiacts
anu scieening using metagenomic appioaches (Fig. 2).

Fungal extract screening 
In teims of scieening fungal extiacts foi beta‐glucosiuase
activity the secieteu pioteins aie assayeu. The outcome of
such scieening stiategy builus on two key elements: the
choice of giowth conuitions anu beta‐glucosiuase assays.
The composition of a fungal extiact will to a ceitain
uegiee uepenu on the giowth meuium useu. A iich meuium
suppoiting goou giowth can be chosen to scieen geneial
expiesseu pioteins. Bowevei, in seveial cases specifically
meuia with lignocellulose as sole caibon souice have been
chosen to inuuce expiession of enzymes foi biomass
uegiauation. The scieening is theieby uiiecteu towaius
lignocellulose uegiauing fungi which woulu incluue beta‐
glucosiuases foi complete hyuiolysis to glucose that the
fungus can use in its metabolism.
Assaying foi pioteins with beta‐glucosiuase activity can
be uone using seveial uiffeient substiates, a few of which
have been mentioneu pieviously. Neasuiing beta‐
glucosiuase activity on its natuial substiate, cellobiose anu
shoit cellooligomeis, is usually teuious compaieu to
chiomogenic oi flouiogenic substiates that ieact to give
coloieu oi fluoiescent piouucts anu aie theiefoie often
piefeiieu as an easy fiist step in iuentification of the
piesence of beta‐glucosiuase activity. Zhang et  al. (2uu6)
suggest the use of chiomogenic p‐nitiophenyl‐beta‐B‐1,4‐
glucopyianosiue (yellow), anu flouiogenic beta‐naphthyl‐
beta‐B‐glucopyianosiue (blue) oi 4‐methylumbellifeiyl‐
beta‐B‐glucopyianosiue (blue) foi beta‐glucosiuase
scieening, while Peiiy et  al. (2uu7) investigateu the use of
seveial othei chiomogenic beta‐glucosiuase substiates,
that can be useu in plate assays with the vaiious coloi
piecipitates foimeu iemaining tightly localizeu to the place
of the hyuiolytic ieaction.
To oui knowleuge, bioau scieenings of fungal extiacts
foi beta‐glucosiuase activity have not fiequently been
publisheu. Steinbeig et  al. (1977) seaicheu amongst 2uu
fungal stiains foi stiains piouucing laige quantities of beta‐
glucosiuases that coulu supplement the Trichoderma  viride
cellulases foi cellulose sacchaiification. ueneially, they
founu black Aspergilli to be supeiioi in teims of beta‐
 
Review paper 
‐ 10 ‐ 
 
glucosiuase piouuction. Anothei scieening has been
publisheu by oui lab (Reseaich papei II, this thesis), using
pNPu to scieen 86 fungal extiacts fiom submeigeu
feimentation of a bioau iange of in‐house fungal stiains. We
founu a black Aspergillus stiain that we iuentifieu as a novel
species, A.  saccharolyticus (Reseaich papei III, this thesis),
which is veiy piomising in teims of beta‐glucosiuase
piouuction (Reseaich papei II, this thesis). Anothei stuuy
focuseu on iuentification of aciu‐ anu theimotoleiant
extiacellulai beta‐glucosiuase activities in Zygomycetes
fungi (Tako et al., 2u1u). They also useu pNPu foi scieening
of fungal extiacts fiom 94 stiains that hau been cultivateu
in eithei soliu state oi submeigeu feimentation, with the
finuing that especially Rhizomucor  miehei coulu be of
inuustiial inteiest. Jeya  et  al. (2u1u) have useu plates
containing 4‐methylumbellifeiyl‐beta‐B‐glucosiue as an
initial scieening foi beta‐glucosiuase piouucing fungi in soil
samples, fiom which a smallei numbei of stiains weie
selecteu baseu on obseiveu fluoiescence anu theieaftei
assayeu moie thoioughly in liquiu cultuie with pNPu with
the finuing that a P.  purpurogenum stiain was especially
efficient in piouucing beta‐glucosiuase.
Zymogiam techniques have been employeu foi the
iuentification of beta‐glucosiuases, wheie gel‐
electiophoiesis of piotein mixes is employeu foi sepaiation,
followeu by incubation with foi example 4‐
methylumbellifeiyl‐beta‐B‐glucosiue anu in situ
visualization of the ieaction in the gel facilitateu by the
fluoiescent piouuct foimation (Nuiiay  et  al., 2uu4). This
substiate is piefeiieu ovei pNPu, as pNP uiffuse moie
quickly anu will not stay in the gel at its place of piouuction.
A pioteomics stiategy using tanuem mass spectiometiy has
by Kim  et  al. (2uu7a) been coupleu with zymogiaphy to
uiscovei beta‐glucosiuases fiom A.  fumigatus, wheie the
activity spots weie cut fiom the gel, uigesteu by tiypsin, anu
analyzeu by LC¡NS¡NS.
Following an initial scieening using the simple
chiomogenic oi flouiogenic substiates, a moie uetaileu
scieening of a selecteu numbei of stiains can be peifoimeu
on cellobiose, shoit cellooligomeis, followeu by evaluation
using pietieateu lignocellulosic biomasses in combination
with known efficient cellulases.

Metagenomic screening  
0thei stiategies foi obtaining beta‐glucosiuases have
incluueu scieening of enviionmental BNA foi beta‐
glucosiuase using a metagenomics appioach (Kim  et  al.,
2uu7b; }iang et al., 2uu9; }iang et al., 2u1u). Nany miciobial
species aie uifficult to cultivate in the laboiatoiy because of
specializeu giowth iequiiements. The metagenomic
appioach of uiiectly cloning enviionmental BNA anu scieen
this uniuentifieu pool foi beta‐glucosiuase activity will
wiuen the scieening to incluue such oiganisms. The
libiaiies will seive as basis foi scieening, eithei using
hybiiuization (BNA piobes) oi PCR techniques on the basis
of sequence similaiity oi conseiveu motifs, uiiectly
scieening the libiaiy at genomic level. Such piospecting will
facilitate iuentification of novel vaiiants of uistinct piotein
families oi of known functional classes of pioteins. Anothei
appioach is to expiess the libiaiy in appiopiiate host
stiains anu theieaftei peifoim activity scieening (Loienz &
Schlepei, 2uu2). As pointeu out by Bawkswoith anu
Rossman (1997), you can seaich anywheie foi new fungi,
but seaiching foi novel beta‐glucosiuases it woulu seem
most appiopiiate to exploie lignocellulosic enviionments.
Enzyme uiscoveiy in lignocellulosic ecosystems haiboiing
ielevant enzymes can easily be too complex foi
metagenomic sequencing technologies, theiefoie BeAngelis
et  al.  (2u1u)  iecently pioposeu a stiategy of cultivating the
miciobes fiom these ecosystems unuei uefineu conuitions
to obtain feeustock‐auapteu communities with ieuuceu
uiveisity that can be scieeneu. Kim et  al. (2uu7b) weie the
fiist to iepoit the isolation of a family 1 beta‐glucosiuase
fiom a metagenome libiaiy oiiginating fiom Koiean soil
samples, using 4‐methylumbellifeiyl‐beta‐B‐cellobiosiue in
activity scieening, an enzyme of which the ciystal stiuctuie
was latei ueiiveu (Nam et al., 2uu8). }iang et al. (2uu9) have
likewise iuentifieu a novel beta‐glucosiuase fiom soil
metagenome of which the amino aciu sequence uiu not
show homology with othei beta‐glucosiuases, yet the
puiifieu iecombinant piotein efficiently hyuiolyzeu B‐
glycosyl‐beta‐1,4‐B‐glucose, anu latei the same ieseaich
gioup have thiough a similai appioach iuentifieu anothei
novel beta‐glucosiuase fiom sluuge samples fiom a biogas
ieactoi (}iang et al., 2u1u).

Improving beta‐glucosidases 
The featuies aimeu foi when impioving beta‐glucosiuases
aie the same as the goals in scieening foi novel beta‐
glucosiuases, such as impiove enzyme activity, fine‐tune
specificity, e.g. by eliminating tiansgycosylation activity anu
glucose inhibition, cieate novel specificities anu activities,
change substiate specificity, change steieo‐specificity,
anu¡oi impiove theimo stability.

Classical random mutagenesis 
Nutagenesis by 0v light oi chemical tieatment followeu by
scieening foi impioveu activity oi stability has been caiiieu
out foi uecaues. 0ne goou example of ueveloping a host
stiain with impioveu total piotein piouuction anu activity
is the woik of Nontenecouit anu Eceleigh (1979). 0sing a
combination of 0v iiiauiation anu nitiosomethyl guaniuine
tieatment iesulteu in stiain RutCSu, one of the best existing
T.  reesei cellulase mutants. The incieaseu activity obtaineu
fiom such classical mutagenesis is most often uue to
changes at the iegulatoiy level of enzyme expiession
leauing to incieaseu piouuction of the gene of inteiest oi
uecieaseu expiession of conflicting genes anu is theiefoie
 
Review paper 
‐ 11 ‐ 
 
minueu on piouuction stiain impiovements, iathei than
changes to the enzyme itself foi impioveu activity.
uamma iay iiiauiation of Cellulomonas  biazotea has
iesulteu in a mutant with incieaseu beta‐glucosiuase
piouuctivity (Rajoka et al., 1998). Analysis of puiifieu beta‐
glucosiuases of this oiganism showeu uiffeience in pKa
compaieu to the beta‐glucosiuases of the wilu type,
inuicating that the hyuiophobic micio‐enviionment in the
vicinity of the active site has been changeu. Impiovements
in both KN anu theimo stability weie founu (Rajoka  et  al.,
2uuS), thus showing that the iauiation has influenceu the
actual beta‐glucosiuase gene, not just its expiession
mechanism; howevei, no investigation of the specific
changes causeu by the iiiauiation was unueitaken.
Replacement of single amino acius thiough ianuom
mutagenesis can have gieat effects. Stability of the Bacillus 
polymyxa beta‐glucosiuase was enhanceu using
hyuioxylamine foi ianuom mutagenesis, switching the
nucleotiue base paiis fiom A to u oi fiom C to T
(LopezCamacho & Polaina, 199S). Especially two mutations,
E96K anu N416I, causeu an inciease in theimal anu pB
stability (LopezCamacho  et  al., 1996). The E96K mutation
causeu a change in the seconuaiy stiuctuie (iuentifieu by
ciystallogiaphy) most likely uue to an ion paii involving the
new Lys96, intiouucing a salt biiuge linking two uistant
segments togethei, auvancing the stability of the teitiaiy
stiuctuie (Sanz‐Apaiicio et al., 1998). Neanwhile, the effect
of the N416I is likely uue to incieaseu iesistance to
oxiuation of isoleusine, coiielating well with the finuing
that beta‐glucosiuase of theimostable miciooiganisms
geneially have a low content of methionine (LopezCamacho 
et al., 1996).

Rational design 
Noie auvanceu mutagenesis, as iational uesign, e.g. site
uiiecteu mutagenesis, is useu foi impiovements, but also
caiiieu out to unueistanu anu chaiacteiize the function of
uiffeient iegions of the beta‐glucosiuases (Antikainen &
Naitin, 2uuS). To impiove a function thiough iational
uesign, uetaileu knowleuge of the piotein stiuctuie, anu
function ielateu to stiuctuie, is iequiieu (Zhang  et  al.,
2uu6). In iational uesign, a commonly useu technique foi
changing specific amino acius is the oveilap extension
methou, wheie the mutation is intiouuceu thiough piimeis
containing a mutant couon with a mismatcheu sequence
(Reikofski & Tao, 1992). Specific amino aciu sites to be
changeu aie chosen, foi example by taking auvantage of
known SB stiuctuies. Bioinfoimatics is a pieiequisite foi
iational uesign. A gieat amount of knowleuge is available on
foi example the piotein engineeiing possibilities foi
impioving theimo stability, stabilizing the piotein thiough
incieasing the numbei of uisulfiue anu hyuiogen bonus,
incieasing the inteinal hyuiophobicity, oi substituting foi
ceitain amino acius as piotection against chemical
uestabilization (Nosoh & Sekiguchi, 199u). Bowevei,
iational uesign can in piactice be hinueieu by the
complexity of the piotein function (Tao & Coinish, 2uu2).
ueneially, site‐uiiecteu mutagenesis has in seveial cases
been useu to confiim the iuentity of the amino aciu catalysts
of beta‐glucosiuases. A combination of site‐uiiecteu anu
ianuom mutagenesis was caiiieu out on the active site
iegion of an Agrobacterium  faecalis beta‐glucosiuase,
evaluating the impoitance of uiffeient amino acius ielateu
to enzyme activity. The essential iole of ESS8 as nucleophile
in catalysis was confiimeu, BS74 was suggesteu as aciu‐
base catalyst canuiuate, anu foui othei conseiveu iesiuues
in the active site iegion weie founu to have uiffeient
uegiees of significance in teims of activity (Tiimbui  et  al.,
1992). The mechanism of tiansglycosylation coulu
piefeiably be alteieu by site‐uiiecteu mutagenesis if
specific amino acius known to be impoitant foi this function
can be iuentifieu (Seiule  et  al., 2uu6). This woulu favoi the
foimation of glucose monomeis by beta‐glucosiuase anu be
of gieat value foi the geneiation of a sugai platfoim foi
biofuels anu biopiouucts.

Directed evolution 
Biiecteu evolution seems to be the methou of choice in
teims of impioving beta‐glucosiuases. Rathei than classical
mutagenenis wheie the change coulu occui in any pait of
the genome, uiiecteu evolution taigets the specific gene of
choice, but opposeu to iational uesign you neeu no
knowleuge of enzyme stiuctuie anu specific inteiactions
between enzyme anu substiate, as ianuom changes aie
peifoimeu uelimiteu to the gene of choice, followeu by
evaluation of the mutants (Antikainen & Naitin, 2uuS).
Nutation, iecombination, anu selection set the stage foi
functional evolution in natuie. Biiecteu evolution mimics
natuial evolution by combining ieiteiative ianuom
mutagenesis anu iecombination with scieening oi selection
foi enzyme vaiiants with impioveu piopeities (Tobin et al.,
2uuu; Chiiumamilla  et  al., 2uu1; Cheiiy & Fiuantsef, 2uuS).
Reviews have been publisheu by both Kaui anu Shaima
(2uu7) anu Sen et  al (2uu6), mentioning seveial uiffeient
uiiecteu evolution stiategies anu uiscussing the auvantages
anu uisauvantage of the uiffeient techniques. In 1994
Stemmei intiouuceu the ieseaich community to gene
shuffling, which is geneially saiu to be the beginning of the
mouein eia of uiiecteu evolution. BNA shuffling iesembles
natuial sexual iecombination anu thiough shuffling
multiple ielateu BNA sequences, evolution can iauically be
acceleiateu. The tools foi peifoiming uiiecteu evolution aie
theie, howevei, the key is how to coiiectly evaluate the
peifoimance of mutants geneiateu by these iecombinant
BNA techniques (Cheiiy & Fiuantsef, 2uuS; Antikainen &
Naitin, 2uuS; Zhang et al., 2uu6).
Enhanceu theimo‐iesistance has been obtaineu thiough
eiioi pione PCR of the Paenibacillus  polymyxa beta‐
glucosiuase (uonzalez‐Blasco  et  al., 2uuu), expanuing the
iange of mutations to this gene pieviously obtaineu by
 
Review paper 
‐ 12 ‐ 
 
chemical mutagenesis mentioneu above (LopezCamacho &
Polaina, 199S; LopezCamacho  et  al., 1996). Investigation of
the same gene ianuomly mutateu by eiioi pione PCR anu
BNA shuffling‐meuiateu iecombination was publisheu.
Seveial single amino aciu substitutions geneiateu thiough
eiioi pione PCR weie founu to contiibute to incieaseu
theimal iesistance. The mutants with auvantageous
substitutions weie iecombineu by gene shuffling, with the
iesult that the clone that exhibiteu the gieatest theimal
iesistance was a tiiple mutant. Again, the impiovements aie
attiibuteu to foimation of salt biiuges anu amino acius less
pione to oxiuation (Aiiizubieta & Polaina, 2uuu). A similai
appioach of combining eiioi pione PCR anu gene shuffling
was peifoimeu on Pyrococcus  furiosus beta‐glucosiuase,
wheie the calculateu aveiage mutation fiequency was 2.S
base paiis pei gene (equals appioximately 1 oi 2 amino
aciu substitutions pei enzyme). In this case, the beta‐
glucosiuase of the oiganism is hypeitheimostable anu it
was sought to impiove low tempeiatuie hyuiolysis. The
hyuiolysis at low tempeiatuie of cellobiose was incieaseu
up to two folu anu the substiate specificity towaius pNP‐
glucopyianosiue compaieu to pNP‐galactopyianosiue was
incieaseu 7.S folu (Lebbink et al., 2uuu). Shuffling combineu
with gene tiuncation of two uiffeient family S beta‐
glucosiuases has given infoimation on the impoitance of
uiffeient iegions in ielation to enzyme activity anu foluing
(Singh & Bayashi, 199S; Bayashi  et  al., 2uu1). The
homologous C‐teiminal iegions of the beta‐glucosiuase
genes play an impoitant iole in ueteimining enzyme
chaiacteiistics incluuing pB¡tempeiatuie activity, stability,
anu specificity (Singh & Bayashi, 199S), while the N‐
teiminal catalytic uomain showeu the gieatest impoitance
in ueteimining enzyme foluing (Bayashi et al., 2uu1).
Ranuom uiift mutagenesis has been peifoimeu on
Caldicellulosiruptor  saccharolyticus beta‐glucosiuase, wheie
the scieening only focuseu on ietaineu ability to hyuiolyze
beta‐glucosiuase substiates. Whethei impioveu,
unchangeu, oi ieuuceu, the mutations weie caiiieu along
anu pooleu foi use as template in anothei iounu of
mutagenesis, allowing multiple auaptive, neutial, anu
haimful (but not inactivating) mutations to occui 
(Beigquist et al., 2uuS; Baiuiman et al., 2u1u). Baiuiman et 
al. (2u1u) peifoimeu iteiative mutagenesis pioceuuies
followeu by scieening using a high thioughput methou to
scieen foi ietaineu abilities. Fluoiescence activateu cell
soiting was combineu with in vitio compaitmentalization
that allows the substiate to iemain associateu with
inuiviuual cells expiessing the uiffeient mutants. Finally the
final libiaiy was scieeneu foi iecombinants with impioveu
activity, anu an impioveu beta‐glucosiuase was iuentifieu.

 
Production  and  implementation  related  to 
application  
Piouuction of enzymes in inuustiial scale neeus to be
economically favoiable. Commeicial uevelopment of an
enzyme fiom its natuial souice compiises uiffeient
funuamental tasks anu stiategies: Scieening foi
miciooiganism, cultuie selection, feimentation stuuies,
isolation, puiification, chaiacteiization, evaluation,
toxicology stuuy, impiovement of feimentation, iecoveiy
piocess uevelopment, piouuct foimulation, anu finally,
maiketing (Saha & Bothast, 1997). This can be veiy costly
anu time consuming anu, theiefoie, to maximize piouuct
puiity anu economy, moie than 9u% of inuustiial enzymes
aie piouuceu iecombinantly in hosts that have been
mouifieu in such a way as to ueciease unwanteu piouuct
anu inciease expiession of the intiouuceu genes (Cheiiy &
Fiuantsef, 2uuS).

Complete enzyme cocktail 
A complete enzyme cocktail can be obtaineu by co‐cultuiing
fungi that sepaiately aie known foi efficient piouuction of
single impoitant enzymes, especially fungi fiom the geneia
Trichoderma anu Aspergillus have fiequently been useu in
mixeu feimentations to obtain efficient cellulose hyuiolysis
wheie the beta‐glucosiuase contiibution is mainly fiom
Aspergillus (Buff et al., 198S; Nauamwai & Patel, 1992; Wen 
et  al., 2uuS). With the stiategy of piouucing anu selling
enzymes on a piotein mass basis, the goal is to inciease the
specific activity of the mixtuie, theieby obtaining high sugai
yielus with low enzyme loauings (Baneijee  et al., 2u1ua). It
is theiefoie valuable to have a single oiganism expiessing
all enzymes iequiieu foi making the sugais. Bowevei, most
fungal stiains uo not piouuce significant amounts of all
enzymes neeueu foi complete hyuiolysis of lignocellulosic
biomasses anu supplementation by othei enzyme extiacts
is neeueu. Such an example is the cellulase piouuct of T. 
reesei which is wiuely useu anu has foi a long peiiou set the
stage in inuustiial piouuction of enzymes foi biomass
hyuiolysis. Beta‐glucosiuase activity is founu in the piouuct
of T.  reesei, but only ioughly constitutes u.S% of the
secieteu piotein mix (Kubicek, 1992; Neiino & Cheiiy,
2uu7). This is too low amounts foi an efficient hyuiolysis of
cellulose. Enhancement of T.  reesei beta‐glucosiuase has
been achieveu thiough uisplacement of the piomotei by
homologous iecombination with xylanase anu cellulase
piomoteis obtaining a 4‐7.S folu inciease in beta‐
glucosiuase activity (Rahman  et  al., 2uu9). 0thei ways of
incieasing the beta‐glucosiuase activity of T.  reesei incluue
heteiologous expiession of beta‐glucosiuase fiom othei
fungi, e.g. Talaromyces  emersonii (Nuiiay  et  al., 2uu4),
Aspergillus  oryzae (Neiino & Cheiiy, 2uu7), oi A. 
saccharolyticus (Reseaich papei Iv, this thesis), thus
cieating a single expiession host foi the piouuction of all
 
Review paper 
‐ 13 ‐ 
 
ielevant enzymes foi conveiting biomass into monomeiic
sugais. The opposite stiategy of expiessing enuo‐
glucanases anu¡oi cellobiohyuiolases in a stiain efficient in
beta‐glucosiuase piouuction can, of couise, also be puisueu.
Application wise, completing the value chain of a
bioiefineiy concept has been consiueieu in teims of ieusing
low value stieam as fungal giowth meuium foi enzyme
piouuction anu uiiectly using this piouuct (enzymes,
fungus, anu meuium) in hyuiolysis of biomass. This on‐site
piouuction coulu apply to both co‐cultuiing as well as
cultuiing an optimizeu piouuction stiain expiessing all
ielevant enzymes. We have shown, that when cultuieu in
the filtei cake that is left aftei hyuiolysis anu feimentation
in a bioethanol piocess, both A. niger anu A. saccharolyticus
can piouuce sufficient amounts of beta.glucosiuase to
substitute Novozym 188 in hyuiolysis of pietieateu wheat
stiaw (Reseaich papei I, this thesis).

Consolidated bioprocess 
Two stiategies can be sought foi a consoliuateu piocess
wheie one oiganism is iesponsible foi both piouucing the
enzymes iequiieu foi sacchaiification as well as peifoiming
the feimentation of the sacchaiifieu sugais into fuels oi
platfoim molecules foi biopiouucts. The fiist stiategy is to
engineei an efficient enzyme piouucei, making it able to
feiment sugais into uesiieu piouucts. The seconu stiategy
is to engineei an oiganism alieauy capable of feimenting
sugais into uesiieu feimentation piouucts, making it able to
piouuce the aiiay of enzymes neeueu foi hyuiolysis of
polysacchaiiues (Xu et al., 2uu9).
In teims of bioethanol piouuction, most ieseaich on
consoliuateu biopiocessing has been caiiieu out using
Saccharomyces  cerevisiae. S.  cerevisiae is the most
fiequently useu miciooiganism foi feimenting ethanol fiom
glucose; it has uRAS status, high glucose feimentation iates,
anu high ethanol toleiance (van Zyl  et  al., 2uu7).
Auuitionally, xylose feimentation by yeast has been
acquiieu to impiove the economy of inuustiial
lignocellulosic biomass conveision by efficiently uiiecting
both main monomeiic sugais to ethanol feimentation (Chu
& Lee, 2uu7). Fungal beta‐glucosiuases have successfully
been heteiologously expiesseu in S.  cerevisiae enabling the
stiain to piouuce ethanol fiom giowth on cellobiose (van
Rooyen  et  al., 2uuS). Fuithei beta‐glucosiuase, enuo‐
glucanase, anu cellobiohyuiolase of Aspergillus  aculeatus
have successfully been expiesseu by S. cerevisiae (0oi et al.,
1994; Takaua  et  al., 1998), setting the stage foi combineu
expiession of all enzymes, making a stiain with all thiee
impoitant enzymes. Fujita et  al. (2uu4) anu Yanase et  al.
(2u1u) have iepoiteu such engineeieu S.  cerevisiae stiain
expiessing all thiee enzymes: T.  reesei enuoglucanase anu
cellobiohyuiolase, anu A.  aculeatus beta‐glucosiuase. This
stain was able to uiiectly feiment amoiphous cellulose into
ethanol. In a consoliuateu piocess, wheie yeast both
piouuces enzymes foi the hyuiolysis of the lignocellulosic
polysacchaiiues to sugai monomeis, anu feiments the
monomeiic sugais to ethanol, the issues of glucose
accumulation inhibiting enzyme hyuiolysis will be
uiminisheu. The main uiawback of a yeast consoliuateu
piocess is that a compiomise in hyuiolysis anu
feimentation must be maue in teims of piocess conuitions;
especially the tempeiatuie must be ieuuceu compaieu to
the tempeiatuies usually useu foi hyuiolysis, anu efficient
enzymes with lowei tempeiatuie optima shoulu, theiefoie,
be scieeneu foi to optimize consoliuateu biopiocessing
with yeast.
The use of fungi foi ethanol piouuction thiough
consoliuateu biopiocessing has iecently been uiscusseu by
Xu et  al. (2uu9). T.  reesei possess the pathways foi
conveision of biomass into ethanol. Bowevei, the yielu of
ethanol, iate of piouuction, anu ethanol toleiance of the
oiganism aie low. Impiovements neeueu foi a successful T. 
reesei consoliuateu biopiocess woulu, theiefoie, incluue
iuentification anu mouification of genes involveu in ethanol
toleiance, intiouuction of heteiologous genes to enhance
the ethanol pathway, anu knockout of genes iesponsible foi
inteifeiing bypiouucts (Xu  et  al., 2uu9). With iefeience to
the pievious uiscussion of the insufficiency of T. reesei beta‐
glucosiuases auuitional heteiologous expiession of bettei
beta‐glucosiuases shoulu be pait of the impiovements. In
teims of piouucing platfoim molecules foi biopiouucts,
seveial fungi natuially piouuce uiffeient oiganic aciu,
eithei as natuial piouucts oi at least as inteimeuiates in
majoi metabolic pathways; examples incluue citiic aciu,
oxalic aciu, anu gluconic aciu by A. niger, itaconic aciu by A. 
terreus, fumaiic aciu anu malic aciu by Rhizopus oryzae, anu
succinic aciu by Fusaruim spp., Aspergillus spp., anu
Penicillium  simplicissium (Nagnuson & Lasuie, 2uu4). A
consoliuateu biopiocess using fungi to make platfoim
molecules foi biopiouucts, theiefoie, seems appealing. A. 
niger is especially known in iegaius to its beta‐glucosiuase
activity but this fungus actually possess the full aiiay of
hyuiolytic enzymes foi biomass uegiauation (Pel  et  al.,
2uu7) anu coulu be a valiu canuiuate foi fuithei
impiovements towaius a consoliuateu biopiocessing
oiganism. The issue ielateu to compiomise in piocess
conuitions of hyuiolysis anu feimentation will fuithei apply
foi the use of fungal stiains as was the case foi yeast.
0veicoming this coulu potentially be uone by looking into
the use of theimophilic iathei than mesophilic fungi as the
consoliuateu biopiocess oiganism.

Conclusions 
Fungal beta‐glucosiuases aie impoitant enzymes in efficient
hyuiolysis of cellulosic biomass, as they ielieve the
inhibition of the cellobiohyuiolases anu enuoglucanases by
ieuucing cellobiose accumulation. They aie key enzymes in
the final pait foi cieating the necessaiy sugais foi
piouuction of biofuels anu platfoim molecules that can
 
Review paper 
‐ 14 ‐ 
 
seive as builuing blocks in the synthesis of chemicals anu
polymeiic mateiials. The bioiefineiy concept is a
sustainable solution that coulu ieplace touay’s oil iefineiies.
Impoitant featuies foi maintaining efficient hyuiolysis of
cellobiose anu cellouextiins by beta‐glucosiuases aie high
glucose toleiance as well as high tempeiatuie stability.
Beteiologous expiession of efficient beta‐glucosiuases
allows foi piouuction of a complete enzyme cocktail by a
suitable host. As of cuiient, in the piocess of making sugais,
enzymes aie mainly auueu as a feimentation piouuct of a
sepaiate piocess. To inciease the value chain of a
bioiefineiy concept, alteinatives shoulu be consiueieu such
as on‐site enzyme piouuction using low value stieams, oi
the use of hosts expiessing the enzyme cocktail anu
piouucing the piouucts in a consoliuateu biopiocess,
facilitating combineu biomass hyuiolysis anu feimentation.

References 
Alviia P, Tomas‐Pejo E, Ballesteios N & Negio N} (2u1u)
Pietieatment technologies foi an efficient bioethanol
piouuction piocess baseu on enzymatic hyuiolysis: A ieview
Bioiesoui Technol 101: 48S1‐4861.
Antikainen NN & Naitin SF (2uuS) Alteiing piotein specificity:
techniques anu applications Biooig Neu Chem 13: 27u1‐2716.
Aiiizubieta N} & Polaina } (2uuu) Incieaseu theimal iesistance anu
mouification of the catalytic piopeities of a beta‐glucosiuase by
ianuom mutagenesis anu in vitio iecombination } Biol Chem 
275: 2884S‐28848.
Baiioch A (2uuu) The ENZYNE uatabase in 2uuu Nucleic Acius Res 
28: Su4‐SuS.
Baiioch A (1992) Piosite ‐ a Bictionaiy of Sites anu Patteins in
Pioteins Nucleic Acius Res 20: 2u1S‐2u18.
Baneijee u, Scott‐Ciaig }S & Walton }B (2u1ua) Impioving Enzymes
foi Biomass Conveision: A Basic Reseaich Peispective
Bioeneigy Reseaich 3: 82‐92.
Baneijee S, Nuuliai S, Sen R, uiii B, Satpute B, Chakiabaiti T &
Panuey RA (2u1ub) Commeicializing lignocellulosic bioethanol:
technology bottlenecks anu possible iemeuies Biofuels
Biopiouucts & Bioiefining‐Biofpi 4: 77‐9S.
Baiiett T, Suiesh Cu, Tolley SP, Bouson E} & Bughes NA (199S) The
Ciystal‐Stiuctuie of a Cyanogenic Beta‐ulucosiuase fiom White
Clovei, a Family‐1 ulycosyl Byuiolase Stiuctuie 3: 9S1‐96u.
Beguin P & Aubeit }P (1994) The Biological Begiauation of
Cellulose FENS Niciobiol Rev 13: 2S‐S8.
Beig }N, Tymoczko }L & Stiyei L (2uu2)  Biochemistry. W.B.
Fieeman anu Company, New Yoik.
Beigmeyei B0 & Beint E (1974) Beteimination with ulucose
0xiuase anu Peioxiuase. Nethous of Enzymic Analysis
(Beigmeyei B0, eu), pp. 12uS‐1212. Acauemic Piess, New Yoik.
Beigquist PL, Reeves RA & uibbs NB (2uuS) Begeneiate
oligonucleotiue gene shuffling (B0uS) anu ianuom uiift
mutagenesis (RNBN): Two complementaiy techniques foi
enzyme evolution Biomol Eng 22: 6S‐72.
Bhatia Y, Nishia S & Bisaiia vS (2uu2) Niciobial beta‐glucosiuases:
Cloning, piopeities, anu applications Ciit Rev Biotechnol  22:
S7S‐4u7.
Biavo v, Paez NP, Aoulau N & Reyes A (2uuu) The influence of
tempeiatuie upon the hyuiolysis of cellobiose by beta‐1,4‐
glucosiuases fiom Aspergillus niger Enzyme Niciob Technol 26:
614‐62u.
Biavo v, Paez NP, Aoulau N, Reyes A & uaicia AI (2uu1) The
influence of pB upon the kinetic paiameteis of the enzymatic
hyuiolysis of cellobiose with Novozym 188 Biotechnol Piog 17:
1u4‐1u9.
Calsavaia LPv, Be Noiaes FF & Zanin uN (2uu1) Compaiison of
catalytic piopeities of fiee anu immobilizeu cellobiase Novozym
188 Appl Biochem Biotechnol 91‐3: 61S‐626.
Cantaiel BL, Coutinho PN, Rancuiel C, Beinaiu T, Lombaiu v &
Beniissat B (2uu9) The Caibohyuiate‐Active EnZymes uatabase
(CAZy): an expeit iesouice foi ulycogenomics Nucleic Acius Res 
37: B2SS‐B2S8.
Chang vS & Boltzapple NT (2uuu) Funuamental factois affecting
biomass enzymatic ieactivity Appl Biochem Biotechnol 84‐6: S‐
S7.
Chauve N, Nathis B, Buc B, Casanave B, Nonot F & Feiieiia NL
(2u1u) Compaiative kinetic analysis of two fungal beta‐
glucosiuases 3: S.
Cheetham PS} (1987) Scieening foi Novel Biocatalysts Enzyme
Niciob Technol 9: 194‐21S.
Cheiiy }R & Fiuantsef AL (2uuS) Biiecteu evolution of inuustiial
enzymes: an upuate Cuii 0pin Biotechnol 14: 4S8‐44S.
Cheiubini F (2u1u) The bioiefineiy concept: 0sing biomass insteau
of oil foi piouucing eneigy anu chemicals Eneigy Conveision
anu Nanagement 51: 1412‐1421.
Chiiumamilla RR, Nuialiuhai R, Naichant R & Nigam P (2uu1)
Impioving the quality of inuustiially impoitant enzymes by
uiiecteu evolution Nol Cell Biochem 224: 1S9‐168.
Chu BCB & Lee B (2uu7) uenetic impiovement of Saccharomyces 
cerevisiae foi xylose feimentation Biotechnol Auv 25: 42S‐441.
Chuenchoi W, Pengthaisong S, Robinson RC et al. (2uu8) Stiuctuial
insights into iice Bulu1 beta‐glucosiuase oligosacchaiiue
hyuiolysis anu tiansglycosylation } Nol Biol 377: 12uu‐121S.
Czjzek N, Cicek N, Zamboni v, Buimeistei WP, Bevan BR, Beniissat
B & Esen A (2uu1) Ciystal stiuctuie of a monocotyleuon (maize
ZNulu1) beta‐glucosiuase anu a mouel of its complex with p‐
nitiophenyl beta‐B‐thioglucosiue Biochem } 354: S7‐46.
Bale NP, Ensley BE, Kein K, Sastiy KAR & Byeis LB (198S)
Reveisible Inhibitois of Beta‐ulucosiuase Biochemistiy (N Y ) 
24: SSSu‐SSS9.
Ban S, Naiton I, Bekel N, Biavuo BA, Be SN, Witheis Su &
Shoseyov 0 (2uuu) Cloning, expiession, chaiacteiization, anu
nucleophile iuentification of family S, Aspergillus  niger beta‐
glucosiuase } Biol Chem 275: 497S‐498u.
Banisco 0S Inc (2uu9) AccelleiaseBu ‐ Accessoiy beta‐glucosiuase
foi biomass hyuiolysis.
Baioit B}, Simonetti A, Beitz PF & Bianuelli A (2uu8) Puiification
anu chaiacteiization of an extiacellulai beta‐glucosiuase fiom
Monascus  purpureus  }ouinal of Niciobiology anu Biotechnology 
18: 9SS‐941.
Bavies u & Beniissat B (199S) Stiuctuies anu Nechanisms of
ulycosyl Byuiolases Stiuctuie 3: 8SS‐8S9.
Bavies u}, Wilson KS & Beniissat B (1997) Nomenclatuie foi sugai‐
binuing subsites in glycosyl hyuiolases Biochem } 321: SS7‐SS9.
ue Palma‐Feinanuez ER, uomes E & ua Silva R (2uu2) Puiification
anu chaiacteiization of two beta‐glucosiuases fiom the
theimophilic fungus Thermoascus  aurantiacus  Folia Niciobiol
(Piaha) 47: 68S‐69u.
ue viies RP, Fiisvau }C, van ue vonueivooit P}I, Buigeis K, Kuijpeis
AFA, Samson RA & vissei } (2uuS) Aspergillus  vadensis, a new
species of the gioup of black Aspeigilli Antonie van
 
Review paper 
‐ 15 ‐ 
 
Leeuwenhoek Inteinational }ouinal of ueneial anu Noleculai
Niciobiology 87: 19S‐2uS.
BeAngelis KN, ulauuen }N, Allgaiei N  et  al.  (2u1u) Stiategies foi
Enhancing the Effectiveness of Netagenomic‐baseu Enzyme
Biscoveiy in Lignocellulolytic Niciobial Communities Bioeneigy
Reseaich 3: 146‐1S8.
Beckei CB, vissei } & Schieiei P (2uu1) Beta‐ulucosiuase
multiplicity fiom Aspergillus  tubingensis  CBS 64S.92:
puiification anu chaiacteiization of foui beta‐glucosiuases anu
theii uiffeientiation with iespect to substiate specificity,
glucose inhibition anu aciu toleiance Appl Niciobiol Biotechnol 
55: 1S7‐16S.
Beckei CB, vissei } & Schieiei P (2uuu) Beta‐glucosiuases fiom five
black Aspergillus  species: Stuuy of theii physico‐chemical anu
biocatalytic piopeities } Agiic Foou Chem 48: 4929‐49S6.
Bekkei RFB (1986) Kinetic, Inhibition, anu Stability Piopeities of a
Commeicial Beta‐B‐ulucosiuase (Cellobiase) Piepaiation fiom
Aspergillus  niger  anu its Suitability in the Byuiolysis of
Lignocellulose Biotechnol Bioeng 28: 14S8‐1442.
Buff S}B, Coopei Bu & Fullei 0N (198S) Cellulase anu Beta‐
ulucosiuase Piouuction by Nixeu Cultuie of Trichoderma  reesei
Rut CSu anu Aspergillus phoenicis Biotechnol Lett 7: 18S‐19u.
Eyzaguiiie }, Biualgo N & Leschot A (2uuS) Beta‐glucosiuases fiom
Filamentous Fungi: Piopeities, Stiuctuie, anu Applications.
Banubook of Caibohyuiate EngineeiingAnonymous , pp. 64S‐
68S. Tayloi anu Fiancis uioup, LLC.
Feinanuo S, Auhikaii S, Chanuiapal C & Nuiali N (2uu6)
Bioiefineiies: Cuiient status, challenges, anu futuie uiiection
Eneigy Fuels 20: 1727‐17S7.
Fujita Y, Ito }, 0eua N, Fukuua B & Konuo A (2uu4) Syneigistic
sacchaiification, anu uiiect feimentation to ethanol, of
amoiphous cellulose by use of an engineeieu yeast stiain
couisplaying thiee types of cellulolytic enzyme Appl Enviion
Niciobiol 70: 12u7‐1212.
uonzalez‐Blasco u, Sanz‐Apaiicio }, uonzalez B, Beimoso }A &
Polaina } (2uuu) Biiecteu evolution of beta‐glucosiuase A fiom
Paenibacillus  polymyxa to theimal iesistance } Biol Chem  275:
1S7u8‐1S712.
uunata Z & valliei N} (1999) Piouuction of a highly glucose‐
toleiant extiacellulai beta‐glucosiuase by thiee Aspergillus
stiains Biotechnol Lett 21: 219‐22S.
Bakulinen N, Paavilainen S, Koipela T & Rouvinen } (2uuu) The
ciystal stiuctuie of beta‐glucosiuase fiom Bacillus  circulans sp
alkalophilus: Ability to foim long polymeiic assemblies } Stiuct
Biol 129: 69‐79.
Baiuiman E, uibbs N, Reeves R & Beigquist P (2u1u) Biiecteu
Evolution of a Theimophilic beta‐glucosiuase foi Cellulosic
Bioethanol Piouuction Appl Biochem Biotechnol 161: Su1‐S12.
Baiiis Pv, Welnei B, NcFailanu KC  et  al.  (2u1u) Stimulation of
Lignocellulosic Biomass Byuiolysis by Pioteins of ulycosiue
Byuiolase Family 61: Stiuctuie anu Function of a Laige,
Enigmatic Family Biochemistiy (N Y ) 49: SSuS‐SS16.
Baivey A}, Bimova N, Be uoii R, vaighese }N & Finchei uB (2uuu)
Compaiative moueling of the thiee‐uimensional stiuctuies of
family S glycosiue hyuiolases Pioteins‐Stiuctuie Function anu
uenetics 41: 2S7‐269.
Bawkswoith BL (2uu1) The magnituue of fungal uiveisity: the 1.S
million species estimate ievisiteu Nycol Res 105: 1422‐14S2.
Bawkswoith BL (1991) The Fungal Bimension of Biouiveisity ‐
Nagnituue, Significance, anu Conseivation Nycol Res  95: 641‐
6SS.
Bawkswoith BL & Rossman AY (1997) Wheie aie all the
unuesciibeu fungi. Phytopathology 87: 888‐891.
Bayashi K, Ying L, Singh S, Kaneko S, Niiasawa S, Shimonishi T,
Kawata Y, Imoto T & Kitaoka N (2uu1) Impioving enzyme
chaiacteiistics by gene shuffling; application to beta‐
glucosiuase }ouinal of Noleculai Catalysis B‐Enzymatic 11: 811‐
816.
Beniissat B (1991) A Classification of ulycosyl Byuiolases Baseu on
Amino‐Aciu‐Sequence Similaiities Biochem } 280: Su9‐S16.
Beniissat B & Bavies u (1997) Stiuctuial anu sequence‐baseu
classification of glycosiue hyuiolases Cuii 0pin Stiuct Biol  7:
6S7‐644.
Beniissat B & Baiioch A (1996) 0puating the sequence‐baseu
classification of glycosyl hyuiolases Biochem } 316: 69S‐696.
Beniissat B & Baiioch A (199S) New Families in the Classification
of ulycosyl Byuiolases Baseu on Amino‐Aciu‐Sequence
Similaiities Biochem } 293: 781‐788.
Beniissat B, Biiguez B, viet C & Schulein N (198S) Syneigism of
Cellulases fiom Trichoderma  reesei in the Begiauation of
Cellulose Bio‐Technology 3: 722‐726.
}eya N, }oo A, Lee K, Tiwaii NK, Lee K, Kim S & Lee } (2u1u)
Chaiacteiization of beta‐glucosiuase fiom a stiain of Penicillium 
purpurogenum K}SSu6 Appl Niciobiol Biotechnol  86: 147S‐
1484.
}iang C, Bao Z, }in K, Li S, Che Z, Na u & Wu B (2u1u) Iuentification
of a metagenome‐ueiiveu beta‐glucosiuase fiom bioieactoi
contents }ouinal of Noleculai Catalysis B‐Enzymatic 63: 11‐16.
}iang C, Na u, Li S, Bu T, Che Z, Shen P, Yan B & Wu B (2uu9)
Chaiacteiization of a novel beta‐glucosiuase‐like activity fiom a
soil metagenome }ouinal of Niciobiology 47: S42‐S48.
Kabel NA, Bos u, Zeevalking }, voiagen Au} & Schols BA (2uu7)
Effect of pietieatment seveiity on xylan solubility anu
enzymatic bieakuown of the iemaining cellulose fiom wheat
stiaw Bioiesoui Technol 98: 2uS4‐2u42.
Kaui } & Shaima R (2uu6) Biiecteu evolution: An appioach to
engineei enzymes Ciit Rev Biotechnol 26: 16S‐199.
Kim K, Biown KN, Baiiis Pv, Langston }A & Cheiiy }R (2uu7a) A
pioteomics stiategy to uiscovei beta‐glucosiuases fiom
Aspergillus  fumigatus with two‐uimensional page in‐gel activity
assay anu tanuem mass spectiometiy }ouinal of Pioteome
Reseaich 6: 4749‐47S7.
Kim S, Lee C, Kim N, Yeo Y, Yoon S, Kang B & Koo B (2uu7b)
Scieening anu chaiacteiization of an enzyme with beta‐
glucosiuase activity fiom enviionmental BNA }ouinal of
Niciobiology anu Biotechnology 17: 9uS‐912.
Kiik TK & Faiiell RL (1987) Enzymatic Combustion ‐ the Niciobial‐
Begiauation of Lignin Annu Rev Niciobiol 41: 46S‐SuS.
Knauf N & Noniiuzzaman N (2uu4) Lignocellulosic biomass
piocessing: A peispective Int Sugai } 106: 147‐1Su.
Koiotkova 0u, Semenova Nv, Noiozova vv, Zoiov IN, Sokolova LN,
Bubnova TN, 0kunev 0N & Sinitsyn AP (2uu9) Isolation anu
piopeities of fungal beta‐glucosiuases Biochemistiy‐Noscow 
74: S69‐S77.
Koshlanu BE (19SS) Steieochemistiy anu the Nechanism of
Enzymatic Reactions Biol Rev Camb Philos Soc 28: 416‐4S6.
Kiogh KBRN, Baiiis Pv, 0lsen CL, }ohansen KS, Bojei‐Peueisen },
Boijesson } & 0lsson L (2u1u) Chaiacteiization anu kinetic
analysis of a theimostable uBS β‐glucosiuase fiom Penicillium 
brasilianum  Applieu Niciobiology & Biotechnology  86: 14S‐
1S4.
Kubicek CP (1992) The cellulase pioteins of Trichoderma  reesei:
Stiuctuie, multiplicity, moue of action anu iegulation of
 
Review paper 
‐ 16 ‐ 
 
foimation. Enzymes anu Piouucts fiom Bacteiia, Fungi, anu
Plant Cells, vol. 4SAnonymous , pp. 1‐27. Spiingei Beilin ¡
Beiuelbeig.
Kunst A, Biaegei B & Zeigenhoin } (1984) 0v‐Nethous with
Bexokinase anu ulucose‐6‐Phosphate Behyuiogenase. Nethous
of Enzymic Analysis (Beigmeyei B0, eu), pp. 16S‐172. Acauemic
Piess, New Yoik.
Langston }, Sheehy N & Xu F (2uu6) Substiate specificity of
Aspergillus  oryzae family S beta‐glucosiuase Biochimica Et
Biophysica Acta‐Pioteins anu Pioteomics 1764: 972‐978.
Lebbink }Bu, Kapei T, Bion P, van uei 0ost } & ue vos WN (2uuu)
Impioving low‐tempeiatuie catalysis in the hypeitheimostable
Pyrococcus  furiosus  beta‐glucosiuase CelB by uiiecteu evolution
Biochemistiy (N Y ) 39: S6S6‐S66S.
Leite RSR, Alves‐Piauo BF, Cabial B, Pagnocca FC, uomes E & Ba‐
Silva R (2uu8) Piouuction anu chaiacteiistics compaiison of
ciuue beta‐glucosiuases piouuceu by miciooiganisms
Thermoascus  aurantiacus  e  Aureobasidium  pullulans  in
agiicultuial wastes Enzyme Niciob Technol 43: S91‐S9S.
Li YK, Chii } & Chen FY (2uu1) Catalytic mechanism of a family S
beta‐glucosiuase anu mutagenesis stuuy on iesiuue Asp‐247
Biochem } 355: 8SS‐84u.
LopezCamacho C & Polaina } (199S) Ranuom Nutagenesis of a
Plasmiu‐Boine ulycosiuase uene anu Phenotypic Selection of
Nutants in Escherichia coli Nutat Res 301: 7S‐77.
LopezCamacho C, Salgauo }, Lequeiica }L, Nauaiio A, Ballestai E,
Fianco L & Polaina } (1996) Amino aciu substitutions enhancing
theimostability of  Bacillus  polymyxa  beta‐glucosiuase A
Biochem } 314: 8SS‐8S8.
Loienz P & Schlepei C (2uu2) Netagenome ‐ a challenging souice of
enzyme uiscoveiy }ouinal of Noleculai Catalysis B‐Enzymatic 
19: 1S‐19.
Lynu LR, Weimei P}, van Zyl WB & Pietoiius IS (2uu2) Niciobial
cellulose utilization: Funuamentals anu biotechnology
Niciobiology anu Noleculai Biology Reviews 66: Su6‐+.
Nauamwai B & Patel S (1992) Foimation of Cellulases by Co‐
cultuiing of Trichoderma  reesei anu Aspergillus  niger on
Cellulosic Waste Woilu } Niciobiol Biotechnol 8: 18S‐186.
Nagnuson }K & Lasuie LL (2uu4) 0iganic Aciu Piouuction by
Filamentous Fungi. Auvances in Fungal Biotechnology foi
Inuustiy, Agiicultuie, anu Neuicine (Lange } & Lange L, eus), pp.
Su7‐S4u. Kluwei Acauemic¡Plenum Publisheis.
Naies B, Anuieotti E, Naluonauo NE, Peuiini P, Colalongo C &
Romagnoli C (2uu8) Thiee new species of  Aspergillus fiom
Amazonian foiest soil (Ecuauoi) Cuii Niciobiol 57: 222‐229.
Naitinez AT, Speianza N, Ruiz‐Buenas F}, Feiieiia P, Camaieio S,
uuillen F, Naitinez N}, uutieiiez A & uel Rio }C (2uuS)
Biouegiauation of lignocellulosics: miciobial chemical, anu
enzymatic aspects of the fungal attack of lignin Inteinational
Niciobiology 8: 19S‐2u4.
Nazuia P, Fohleiova R, Bizobohaty B, Kiian NS & }anua L (2uu6) A
new, sensitive methou foi enzyme kinetic stuuies of scaice
glucosiues } Biochem Biophys Nethous 68: SS‐6S.
Nccaitei }B & Witheis Su (1994) Nechanisms of Enzymatic
ulycosiue Byuiolysis Cuii 0pin Stiuct Biol 4: 88S‐892.
NcIntosh LP, Banu u, }ohnson PE, }oshi NB, Koinei N, Plesniak LA,
Zisei L, Wakaichuk WW & Witheis Su (1996) The pKa of the
geneial aciu¡base caiboxyl gioup of a glycosiuase cycles uuiing
catalysis: A C‐1S‐NNR stuuy of Bacillus  circuluns xylanase
Biochemistiy (N Y ) 35: 99S8‐9966.
Neiino ST & Cheiiy } (2uu7) Piogiess anu challenges in enzyme
uevelopment foi Biomass utilization Biofuels 108: 9S‐12u.
Neyei AS, Rosgaaiu L & Soiensen BR (2uu9) The minimal enzyme
cocktail concept foi biomass piocessing } Ceieal Sci  50: SS7‐
S44.
Nontenecouit BS & Eveleigh BE (1979) Selective Scieening
Nethous foi the Isolation of Bigh Yieluing Cellulase Nutants of
Trichoderma  reesei. Byuiolysis of Cellulose: Nechanisms of
Enzymic anu Aciu Catalysis, vol. 181 (Biown RB & }uiasek L,
eus), pp. 289‐Su1. Ameiican Chemical Society.
Nosiei N, Wyman C, Bale B, Elanuei R, Lee YY, Boltzapple N &
Lauisch N (2uuS) Featuies of piomising technologies foi
pietieatment of lignocellulosic biomass Bioiesoui Technol  96:
67S‐686.
Nuiiay P, Aio N, Collins C, uiassick A, Penttila N, Saloheimo N &
Tuohy N (2uu4) Expiession in Trichoderma  reesei  anu
chaiacteiisation of a theimostable family S beta‐glucosiuase
fiom the moueiately theimophilic fungus Talaromyces 
emersonii Piotein Expi Puiif 38: 248‐2S7.
Nam KB, Kim S, Ki N0, Kim }B, Yeo Y, Lee C, }un B & Bwang KY
(2uu8) Ciystal stiuctuie of engineeieu beta‐glucosiuase fiom a
soil metagenome Pioteins‐Stiuctuie Function anu
Bioinfoimatics 73: 788‐79S.
Ng I, Li C, Chan S, Chii }, Chen PT, Tong C, Yu S & Bo TB (2u1u)
Bigh‐level piouuction of a theimoaciuophilic beta‐glucosiuase
fiom Penicillium citiinum YS4u‐S by soliu‐state feimentation
with iice bian Bioiesoui Technol 101: 1S1u‐1S17.
Nijikken Y, Tsukaua T, Igaiashi K, Samejima N, Wakagi T, Shoun B
& Fushinobu S (2uu7) Ciystal stiuctuie of intiacellulai family 1
beta‐glucosiuase BuL1A fiom the basiuiomycete Phanerochaete 
chrysosporium FEBS Lett 581: 1S14‐1S2u.
Noonim P, Nahakainchanakul W, Nielsen KF, Fiisvau }C & Samson
RA (2uu8a) Isolation, iuentification anu toxigenic potential of
ochiatoxin A‐piouucing Aspergillus species fiom coffee beans
giown in two iegions of Thailanu Int } Foou Niciobiol 128: 197‐
2u2.
Noonim P, Nahakainchanakul W, vaiga }, Fiisvau }C & Samson RA
(2uu8b) Two novel species of Aspergillus section Nigri  fiom
Thai coffee beans Int } Syst Evol Niciobiol 58: 1727‐17S4.
Nosoh Y & Sekiguchi T (199u) Piotein Engineeiing foi
Theimostability Tienus Biotechnol 8: 16‐2u.
Novozymes A¡S (2u1u) Cellic CTec2 anu BTec2 ‐ Enzymes foi
hyuiolysis of lignocellulosic mateiials.
NREL National Renewable Eneigy Laboiatoiy (2uuu) Beteimining
the cost of piouucing ethanol fiom coin staich anu
lignocellulosic feeustocks NREL/TP‐580‐28893:.
0oi T, Ninamiguchi K, Kawaguchi T, 0kaua B, Nuiao S & Aiai N
(1994) Expiession of the Cellulase (FI‐CNCase) uene of
Aspergillus  aculeatus in Saccharomyces  cerevisiae Bioscience
Biotechnology anu Biochemistiy 58: 9S4‐9S6.
Pel B}, ue Winue }B, Aichei BB  et  al.  (2uu7) uenome sequencing
anu analysis of the veisatile cell factoiy Aspergillus  niger CBS
S1S.88 Nat Biotechnol 25: 221‐2S1.
Peiez }, Nunoz‐Boiauo }, ue la Rubia T & Naitinez } (2uu2)
Biouegiauation anu biological tieatments of cellulose,
hemicellulose anu lignin: an oveiview Int Niciobiol 5: SS‐S6.
Peiione u, vaiga }, Susca A, Fiisvau }C, Stea u, Kocsube S, Toth B,
Kozakiewicz Z & Samson RA (2uu8) Aspergillus uvarum sp nov.,
an uniseiiate black Aspeigillus species isolateu fiom giapes in
Euiope Int } Syst Evol Niciobiol 58: 1uS2‐1uS9.
Peiiy }B, Noiiis KA, }ames AL, 0livei N & uoulu FK (2uu7)
Evaluation of novel chiomogenic substiates foi the uetection of
bacteiial beta‐glucosiuase } Appl Niciobiol 102: 41u‐41S.
 
Review paper 
‐ 17 ‐ 
 
Pozzo T, Pasten }L, Kailsson EN & Logan BT (2u1u) Stiuctuial anu
Functional Analyses of beta‐ulucosiuase SB fiom Thermotoga 
neapolitana: A Theimostable Thiee‐Bomain Repiesentative of
ulycosiue Byuiolase S } Nol Biol 397: 724‐7S9.
Rahman Z, Shiua Y, Fuiukawa T, Suzuki Y, 0kaua B, 0gasawaia W &
Noiikawa Y (2uu9) Application of Trichoderma  reesei Cellulase
anu Xylanase Piomoteis thiough Bomologous Recombination
foi Enhanceu Piouuction of Extiacellulai beta‐ulucosiuase I
Bioscience Biotechnology anu Biochemistiy 73: 1u8S‐1u89.
Rajoka NI, Buiiani IS & Khaliu AN (2uuS) Kinetic stuuies of the
native anu mutateu intiacellulai beta‐glucosiuases fiom
Cellulomonas biazotea Piotein Peptiue Lett 12: 28S‐288.
Rajoka NI, Bashii A, Bussain SRS & Nalik KA (1998) uamma‐iay
inuuceu mutagenesis of Cellulomonas  biazotea foi impioveu
piouuction of cellulases Folia Niciobiol (Piaha) 43: 1S‐22.
Rajoka NI, Akhtai NW, Banif A & Khaliu AN (2uu6) Piouuction anu
chaiacteiization of a highly active cellobiase fiom Aspergillus 
niger  giown in soliu state feimentation Woilu } Niciobiol
Biotechnol 22: 991‐998.
Reikofski } & Tao BY (1992) Polymeiase Chain‐Reaction (PCR)
Techniques foi Site‐Biiecteu Nutagenesis Biotechnol Auv  10:
SSS‐S47.
Riou C, Salmon }N, valliei N}, uunata Z & Baiie P (1998)
Puiification, chaiacteiization, anu substiate specificity of a
novel highly glucose‐toleiant beta‐glucosiuase fiom Aspergillus 
oryzae Appl Enviion Niciobiol 64: S6u7‐S614.
Saha BC (2uuS) Bemicellulose bioconveision } Inu Niciobiol
Biotechnol 30: 279‐291.
Saha BC & Bothast R} (1997) Enzymes in lignocellulosic biomass
conveision Fuels anu Chemicals fiom Biomass 666: 46‐S6.
Samson RA, Boubiaken }ANP, Kuijpeis AFA, Fiank }N & Fiisvau }C
(2uu4) New ochiatoxin A oi scleiotium piouucing species in
Aspergillus section Nigri Stuu Nycol 50: 4S‐61.
Sanz‐Apaiicio }, Beimoso }A, Naitinez‐Ripoll N, Lequeiica }L &
Polaina } (1998) Ciystal stiuctuie of beta‐glucosiuase A fiom
Bacillus  polymyxa: Insights into the catalytic activity in family 1
glycosyl hyuiolases } Nol Biol 275: 491‐Su2.
Sauei N, Poiio B, Nattanovich B & Bianuuaiui P (2uu8) Niciobial
piouuction of oiganic acius: expanuing the maikets Tienus
Biotechnol 26: 1uu‐1u8.
Seiule BF & Bubei RE (2uuS) Tiansglucosiuic ieactions of the
Aspergillus  niger Family S beta‐glucosiuase: Qualitative anu
quantitative analyses anu eviuence that the tiansglucosiuic iate
is inuepenuent of pB Aich Biochem Biophys 436: 2S4‐264.
Seiule BF, Allison S}, ueoige E & Bubei RE (2uu6) Tip‐49 of the
family S beta‐glucosiuase fiom Aspergillus niger is impoitant foi
its tiansglucosiuic activity: Cieation of novel beta‐glucosiuases
with low tiansglucosiuic efficiencies Aich Biochem Biophys 
455: 11u‐118.
Sen S, Basu vv & Nanual B (2uu7) Bevelopments in uiiecteu
evolution foi impioving enzyme functions Appl Biochem
Biotechnol 143: 212‐22S.
Seiia R, Cabanes F}, Peiione u, Castella u, venancio A, Nule u &
Kozakiewicz Z (2uu6) Aspergillus  ibericus: a new species of
section Nigri isolateu fiom giapes Nycologia 98: 29S‐Su6.
Shewale }u (1982) Beta‐ulucosiuase ‐ its Role in Cellulase Synthesis
anu Byuiolysis of Cellulose Int } Biochem 14: 4SS‐44S.
Singh A & Bayashi K (199S) Constiuction of Chimeiic Beta‐
ulucosiuases with Impioveu Enzymatic‐Piopeities } Biol Chem 
270: 21928‐219SS.
Sinnott NL (199u) Catalytic Nechanisms of Enzymatic ulycosyl
Tiansfei Chem Rev 90: 1171‐12u2.
Sonia Ku, Chauha BS, Bauhan AK, Saini BS & Bhat NK (2uu8)
Iuentification of glucose toleiant aciu active beta‐glucosiuases
fiom theimophilic anu theimotoleiant fungi Woilu } Niciobiol
Biotechnol 24: S99‐6u4.
Stemmei WPC (1994) Bna Shuffling by Ranuom Fiagmentation anu
Reassembly ‐ In‐vitio Recombination foi Noleculai Evolution
Pioc Natl Acau Sci 0 S A 91: 1u747‐1u7S1.
Steinbeig B, vijayakumai P & Reese ET (1977) Beta‐ulucosiuase ‐
Niciobial‐Piouuction anu Effect on Enzymatic‐Byuiolysis of
Cellulose Can } Niciobiol 23: 1S9‐147.
Sue N, Yamazaki K, Yajima S, Nomuia T, Natsukawa T, Iwamuia B
& Niyamoto T (2uu6) Noleculai anu stiuctuial chaiacteiization
of hexameiic beta‐B‐glucosiuases in wheat anu iye Plant
Physiol 141: 12S7‐1247.
Sun Y & Cheng }Y (2uu2) Byuiolysis of lignocellulosic mateiials foi
ethanol piouuction: a ieview Bioiesoui Technol 83: 1‐11.
Svensson B & Sogaaiu N (199S) Nutational Analysis of ulycosylase
Function } Biotechnol 29: 1‐S7.
Takaua u, Kawaguchi T, Sumitani } & Aiai N (1998) Expiession of
Aspergillus  aculeatus  no. F‐Su cellobiohyuiolase I (cbhI) anu
beta‐glucosiuase 1 (bgl1) genes by Saccharomyces  cerevisiae 
Bioscience Biotechnology anu Biochemistiy 62: 161S‐1618.
Tako N, Faikas E, Lung S, Kiisch }, vagvoelgyi C & Papp T (2u1u)
Iuentification of Aciu‐ anu Theimotoleiant Extiacellulai Beta‐
ulucosiuase Activities in Zygomycetes Fungi Acta Biol Bung 61:
1u1‐11u.
Tao BY & Coinish vW (2uu2) Nilestones in uiiecteu enzyme
evolution Cuii 0pin Chem Biol 6: 8S8‐864.
Tobin NB, uustafsson C & Buisman uW (2uuu) Biiecteu evolution:
the 'iational' basis foi 'iiiational' uesign Cuii 0pin Stiuct Biol 
10: 421‐427.
Tiimbui BE, Waiien RA} & Witheis Su (1992) Region‐Biiecteu
Nutagenesis of Resiuues Suiiounuing the Active‐Site
Nucleophile in Beta‐ulucosiuase fiom Agrobacterium  faecalis  }
Biol Chem 267: 1u248‐1u2S1.
0.S. Bepaitment of Eneigy (2uu4a) Top value auueu Chemicals
fiom Biomass, vol 1.
0.S. Bepaitment of Eneigy (2uu4b) Biomass Feeustock
Composition anu Piopeity Batabase :  
http:¡¡www.afuc.eneigy.gov¡biomass¡piogs¡seaich1.cgi  
van Rooyen R, Bahn‐Bageiual B, La uiange BC & van Zyl WB
(2uuS) Constiuction of cellobiose‐giowing anu feimenting
Saccharomyces cerevisiae stiains } Biotechnol 120: 284‐29S.
van Zyl WB, Lynu LR, uen Baan R & NcBiiue }E (2uu7)
Consoliuateu biopiocessing foi bioethanol piouuction using
Saccharomyces cerevisiae Biofuels 108: 2uS‐2SS.
vaiga }, Kocsube S, Toth B, Fiisvau }C, Peiione u, Susca A, Neijei N
& Samson RA (2uu7) Aspergillus  brasiliensis sp nov., a biseiiate
black Aspergillus species with woilu‐wiue uistiibution Int } Syst
Evol Niciobiol 57: 192S‐19S2.
vaighese }N, Bimova N & Finchei uB (1999) Thiee‐uimensional
stiuctuie of a bailey beta‐B‐glucan exohyuiolase, a family S
glycosyl hyuiolase Stiuctuie 7: 179‐19u.
Wang XQ, Be XY, Yang S}, An XN, Chang WR & Liang BC (2uuS)
Stiuctuial basis foi theimostability of beta‐glycosiuase fiom the
theimophilic eubacteiium Thermus  nonproteolyticus  Bu1u2 }
Bacteiiol 185: 4248‐42SS.
Wen ZY, Liao W & Chen SL (2uuS) Piouuction of cellulase¡beta‐
glucosiuase by the mixeu fungi cultuie Trichoderma  reesei anu
Aspergillus phoenicis on uaiiy manuie Piocess Biochemistiy 40:
Su87‐Su94.
 
Review paper 
‐ 18 ‐ 
 
White A & Rose BR (1997) Nechanism of catalysis by ietaining
beta‐glycosyl hyuiolases Cuii 0pin Stiuct Biol 7: 64S‐6S1.
Witheis Su (1999) 1998 Boffmann la Roche Awaiu Lectuie ‐
0nueistanuing anu exploiting glycosiuases Canauian }ouinal of
Chemistiy‐Revue Canauienne Be Chimie 77: 1‐11.
Witheis Su & Aebeisolu R (199S) Appioaches to Labeling anu
Iuentification of Active‐Site Resiuues in ulycosiuases Piotein
Science 4: S61‐S72.
Witheis Su, Rupitz K & Stieet IP (1988) 2‐Beoxy‐2‐Fluoio‐B‐
ulycosyl Fluoiiues ‐ a New Class of Specific Nechanism‐Baseu
ulycosiuase Inhibitois } Biol Chem 263: 7929‐79S2.
Witheis Su, Stieet IP, Biiu P & Bolphin BB (1987) 2‐Beoxy‐2‐
Fluoioglucosiues ‐ a Novel Class of Nechanism‐Baseu
ulucosiuase Inhibitois } Am Chem Soc 109: 7SSu‐7SS1.
Xiao ZZ, Zhang X, uiegg B} & Sauulei }N (2uu4) Effects of sugai
inhibition on cellulases anu beta‐glucosiuase uuiing enzymatic
hyuiolysis of softwoou substiates Appl Biochem Biotechnol 
113: 111S‐1126.
Xu Q, Singh A & Bimmel NE (2uu9) Peispectives anu new
uiiections foi the piouuction of bioethanol using consoliuateu
biopiocessing of lignocellulose Cuii 0pin Biotechnol  20: S64‐
S71.
Yan TR, Lin YB & Lin CL (1998) Puiification anu chaiacteiization of
an extiacellulai beta‐glucosiuase II with high hyuiolysis anu
tiansglucosylation activities fiom  Aspergillus  niger } Agiic Foou
Chem 46: 4S1‐4S7.
Yanase S, Yamaua R, Kaneko S, Noua B, Basunuma T, Tanaka T,
0gino C, Fukuua B & Konuo A (2u1u) Ethanol piouuction fiom
cellulosic mateiials using cellulase‐expiessing yeast
Biotechnology }ouinal 5: 449‐4SS.
Zhang Y‐P & Lynu LR (2uu4) Towaiu an aggiegateu unueistanuing
of enzymatic hyuiolysis of cellulose: Noncomplexeu cellulase
systems Biotechnol Bioeng 88: 797‐824.
Zhang Y‐P, Bimmel NE & Nielenz }R (2uu6) 0utlook foi cellulase
impiovement: Scieening anu selection stiategies Biotechnol
Auv 24: 4S2‐481.

Research paper I 
 
 
 
On‐site enzyme production during bioethanol production from 
biomass: screening for suitable fungal strains 
 
 
Annette Sørensen, Philip J. Teller, Peter S. Lübeck, and Birgitte K. Ahring
 
 
Intended for submission to Bioresource Technology 
 
 
 
Research paper I 
 ‐ I.1 ‐ 
 
1. Introduction 
The  need  for  purchasing  commercial  enzymes  is  an 
economical  boundary  for  feasible  second  generation 
bioethanol  production  (NREL  National  Renewable  Energy 
Laboratory,  2009).  Therefore,  the  production  of  enzymes  on‐
site  using  low  cost  substrates  or  even  process  waste  streams 
as a production substrate should be considered. 
Evaluating on the overall production cost of bioethanol the 
price  of  commercial  enzymes  is  of  outmost  importance  as  it 
typically contributes to a large part of the final bioethanol cost. 
Other  costs  related  to  second  generation  ethanol  production 
involve biomass raw material costs as well as transport of the 
biomass  to  the  ethanol  production  facility.  Operational  costs 
are  mainly  linked  to  pre‐treatment  strategies  of  the  material, 
enzymes,  microorganisms  for  the  fermentation,  distillation 
method,  other  process  options  such  as  discharge  or  reuse  of 
waste  streams,  and  distribution  of  the  product  to  the 
consumer (Knauf and Moniruzzaman, 2004) 
The  bioethanol  process  in  focus  is  based  on  the  Maxifuel 
concept,  where  the  main  process  steps  are  pretreatment, 
hydrolysis,  C6‐sugar  fermentation,  separation,  C5‐sugar 
fermentation,  and  anaerobic  digestion  (Ahring  and 
Westermann, 2007). The separation step between C6‐ and C5‐
sugar  fermentation  results  in  a  “filter  cake”  that  represents  a 
waste  stream  that  could  be  used  as  substrate  for  enzyme 
production  by  solid  state  fermentation.  The  advantages  of 
solid  state  fermentation  include  high  volumetric  productivity, 
relatively  higher  concentration  of  the  products,  less  cell  mass 
generation,  as  well  as  lower  energy  consumption  (Pandey  et 
al., 1999; Pandey, 2003).  
For  efficient  hydrolysis  of  cellulose,  a  complete  set  of 
cellulase enzymes is needed (Mansfield et al., 1999). Celluclast 
1.5L  and  Novozym  188  represent  two  commercial  enzyme 
preparations  from  Novozymes  A/S  often  used  in  combination 
for  hydrolysis  of  lignocellulosic  biomasses.  In  order  to  reduce 
the  cost  of  commercial  enzymes  for  the  hydrolysis  of  pre‐
treated  lignocellulosic  biomasses  introduction  of  enzymes 
produced  on‐site  using  a  slip  stream  from  the  bioethanol 
A B S T R A C T
Several process steps are used for production of cellulosic ethanol from biomass raw materials such as 
pre‐treatment,  enzymatic  hydrolysis,  fermentation,  and  distillation.  Use  of  streams  within  cellulosic 
ethanol  production  was  explored  for  on‐site  enzyme  production  as  part  of  a  biorefinery  concept.  In 
order  to  discover  the  most  suitable  fungal  strain  with  efficient  hydrolytic  enzymes  for  lignocellulose 
conversion,  a  screening  of  64  fungal  isolates  from  environmental  samples  was  carried  out.  These 
strains  were  examined  in  a  plate  assay  for  lignocellulolytic  activities.  Of  the  64  isolates,  25  were 
selected  for  further  enzyme  activity  studies  using  a  stream  derived  from  the  bioethanol  process.  The 
filter  cake  that  is  left  after  hydrolysis  and  fermentation  was  the  substrate  chosen  as  the  medium  for 
enzyme  production.  Five  of  the  25  isolates  were  further  selected  for  synergy  studies  with  commercial 
enzymes,  Celluclast  1.5L  and  Novozym  188.  Finally,  two  strains,  IBT25747  (Aspergillus  niger)  and  AP 
(unidentified), were found as promising candidates for on‐site enzyme production where the filter cake 
was inoculated with the  respective fungus and in combination with Celluclast 1.5L used for hydrolysis 
of pretreated biomass.  
A R T I C L E   I N F O 
Keywords: 
Onsite enzyme production 
Fungal screening,  
Beta‐glucosidase  
Cellulase  
Bioethanol 
 
 
 
 
 
 
On‐site enzyme production during bioethanol production from 
biomass: screening for suitable fungal strains 
Annette Sørensen
1
, Philip J. Teller
2
, Peter S. Lübeck
1
, and Birgitte K. Ahring
1,3,
*
 

Section for Sustainable Biotechnology, Copenhagen Institute of Technology, Aalborg University, Lautrupvang 15, DK‐2750 Ballerup, Denmark 
2
 Present address: BioGasol ApS, Lautrupvang 2A, DK‐2750 Ballerup, Denmark 
3
 Center for Bioenergy and Bioproducts, Washington State University, Richland, WA 99352, USA 
 
 
* Corresponding author: telephone +45 99402591 
E‐mail address: bka@bio.aau.dk (B.K. Ahring) 
 
Research paper I 
 ‐ I.2 ‐ 
 
process  as  part  of  the  fermentation  medium  could  be  an 
attractive alternative.  
For  this  purpose  a  screening  strategy  was  used,  using 
different  lignocellulosic,  cellulosic,  and  hemicellulosic 
substrates  to  identify  fungi  able  to  degrade  lignocelluloses, 
with  primary  focus  on  the  cellulolytic  activities.  A  predictive 
cellulase  assay or  screening is  particularly difficult to  develop 
because of the complex nature of the plant biomasses that the 
enzymes should  hydrolyze; the pre‐treated  substrates  are  not 
pure  and  possible  inhibitory  compounds  may  influence  the 
hydrolysis  (Zhang  et  al.,  2006).  In  this  study,  pre‐treated 
wheat  straw  that  had  been  processed  in  a  pilot  plant  and  the 
filter  cake  obtained  after  C6‐sugar  fermentation  were  used  to 
screen  for  and  to  test  potential  on‐site  fungal  enzyme 
producers.  Fungal  isolates  collected  for  this  work  were 
screened  for  their  cellulase  activity  and  compared  with  the 
activity  of  two  reference  strains,  Aspergillus  niger  and 
Trichoderma reesei that are commonly known as good enzyme 
producers  (Mathew  et  al.,  2008).  The  aim  was  to  identify 
fungal  strains  that  efficiently  can  utilize  the  filter  cake  stream 
of  the  second  generation  bioethanol  production  for  enzyme 
production  and  to  investigate  the  potential  of  such  on‐site 
enzyme  production  compared  to  the  use  of  commercially 
available enzymes. 
2. Materials and methods 
2.1 Biomass and biomass characterization 
Wet  oxidized  wheat  straw  (WO)  and  the  filter  cake  (FC) 
obtained  after  C6‐sugar  fermentation  of  wet  oxidized  straw 
were  kindly  provided  by  Biogasol  ApS,  Denmark.  Total  solids 
(TS),  volatile  solids  (VS),  and  ash  contents  were  determined 
according  to  the  NREL  procedures  “Determination  of  Total 
Solids in Biomass version 2005” and “Determination of Ash in 
Biomass  version  2005”,  while  structural  carbohydrates  and 
lignin  was  determined  according  to  NREL  procedure 
“Determination  of  Structural  Carbohydrates  and  lignin  in 
Biomass  version  2006”  (NREL  National  Renewable  Energy 
Laboratory, 2010). 
2.2 Media 
Potato  dextrose  agar  (PDA)  was  prepared  by  finely  dicing 
200  g  peeled  potatoes,  boiling  them  in  one  litre  of  water  for 
one  hour,  and  letting  this  mixture  pass  through  a  sieve.  1.5% 
agar, 2% dextrose, and 1 ml trace metals (TM: 1 g ZnSO47H2O, 
0.5  g  CuSO45H2O  in  100  ml  water)  per  litre  were  added, 
followed by autoclaving at 121°C for 20 minutes.  
Agar plates of filter cake (FC) (Biogasol ApS), wet oxidized 
wheat  straw  (WO)  (Biogasol  ApS),  birch  wood  xylan  (Sigma), 
avicel  (Sigma),  and  carboxymethyl  cellulose  (CMC)  (Sigma) 
were prepared as follows. The FC was washed to decrease the 
amount of free sugars by adjusting the FC to a TS (total solids) 
of 4%, autoclave at 121C for 30 minutes, followed by settling 
for  one  hour,  removing  of  top  liquid,  and  addition  of  new 
water.  The  procedure  was  repeated,  ending  up  with  a  TS  of 
approximately  4%.  2%  agar  was  added  to  the  washed  FC, 
autoclaved  at  121C  for  15  minutes,  and  pH  adjusted  to  4.8. 
The  other  agar  plates  were  prepared  by  adding  2%  w/v  of 
either  WO,  birch  wood  xylan,  avicel,  or  CMC  to  the  basic 
Czapek  (CZ)  agar  media  (3  g/l  NaNO3,  1  g/l  K2HPO4,  0.5  g/l 
KCl,  0.5  g/l  MgSO47H2O,  0.01  g/l  FeSO47H2O,  15  g/l  agar) 
(Samson et al., 2004) and adjusting the pH to 4.8.  
2.3 Fungal collection 
Fungal  isolates  were  obtained  from  various  sources. 
Samples  were  isolated  from  wooden  biomass  such  as 
decomposed  wood  in  a  local  swamp,  treated  hardwood,  and 
rye  bread.  Additionally,  fungal  strains  were  provided  from 
IBT’s Culture Collection of Fungi by selection of Professor Jens 
C.  Frisvad,  Centre  for  Microbiology,  Depertment  of  Systems 
Biology,  Technical  University  of  Denmark.  These  included  the 
following  strains:  IBT25747  (Aspergillus  niger),  IBT3016  (A. 
“massa”),  IBT3945  (Penicillium  “pseudofuniculosum”), 
IBT14668  (P.  “rapidoviride”),  IBT15094  (P.  “rapidoviride”), 
IBT16756  (A.  pseudofumigatus),  IBT18366  (P. 
“pseudoverruculosum”),  IBT26808  (P.  pulvillorum),  and 
IBT7612 (Trichiderma reesei), where A. niger and T. reesei are 
used as reference strains. 
2.4 Fungal isolation 
Initially  a  small  piece  of  e.g.  wood  was  placed  on  PDA 
plates  and  incubated  at  room  temperature.  Several  rounds  of 
culture  transfers  onto  new  PDA  plates  were  carried  out  in 
order to obtain pure single isolates.  
2.5 Screening of fungal growth on agar plates 
Five  different  substrates  were  used  for  the  initial 
screening  on  agar  plates:  Filter  cake  (FC), wet  oxidized wheat 
straw  (WO),  birch  wood  xylan,  avicel,  and  carboxymethyl 
cellulose (CMC), prepared as described above. Spores of seven 
day  old  fungal  cultures  were  transferred  to  the  centre  of  the 
different  plates  using  a  1  µl  inoculation  loop.  The  plates  were 
incubated  at  25C  for  7  days,  and  growth  was  graded  on  a 
subjective  scale  1‐5  by  visually  determining  the  colony 
diameters.  On  the  xylan  plates  an  additional  subjective  grade 
was  introduced:  0‐3z,  which  relates  to  the  clearing  zone 
observed  in  the  medium,  often  having  a  larger  diameter  than 
the growth of the fungus itself. The screening on different agar 
media was carried out in single determination. 
 
Research paper I 
 ‐ I.3 ‐ 
 
2.6 Activity studies using AZCL‐plates 
Agar  plates  with  CZ‐medium  pH  4.8  containing  0.1% 
azurine  cross‐linked  substrates:  AZCL‐HE‐Cellulose 
(HE=hydroxyethyl) and 0.1% AZCL‐arabinoxylan (Megazyme), 
were  used  for  cellulase  and  xylanase  activity  studies, 
respectively.  Inoculation  was  done  by  placing  1  µl  of  10
6
/ml 
spore  suspension  in  the  centre  of  the  plates.  The  activity  was 
indicated  by  blue  color  zones  resulting  from  hydrolysis  of  the 
substrate.  The  progress  of  the  blue  zones  was  followed  for  7 
days at room temperature and the final coloration was used to 
categorize  the  strains  on  a  subjective  scale  from  1  to  5.  The 
activity  study  on  AZCL‐plates  was  carried  out  in  double 
determination. 
2.7 Activity studies by solid state fermentation on filter cake and 
hydrolysis of wet oxidized biomass 
FC  was  autoclaved  and  freeze  dried  in  order  to  stabilize 
the  biomass.  A  mixture  of  4.15  ml  CZ  medium  and  0.85  g 
freeze  dried  FC  (TS  =  17%),  in  total  5  grams,  was  used  as 
growth  medium  in  solid  state  fermentation.  The  medium  was 
inoculated  with  a  spore  solution  of  approximately  10
6
  spores 
per  gram  DM  in  each  fermentation  and  the  beakers  were 
incubated  at  25C  in  high  humidity  for  7  days.  Growth  set‐up 
was conducted in triplicates. After incubation, 0.1 M Na‐citrate 
buffer  pH  4.8  was  added  directly  to  the  beaker  to give  a  TS  of 
3%, followed by blending with a coffee mixer for 30 seconds to 
disrupt the fungus/medium complex created by the growth of 
the  fungus.  This  homogenized  fermentation  broth  (0.85  g  DM 
FC)  was  then  added  to  wet  oxidised  straw  (containing  2.8  g 
DM  WO)  pH  4.8,  and  the  total  mixture  was  brought  to  a  final 
TS of 2% by addition of 0.1 M Na‐citrate buffer pH 4.8. The FC 
to  WO  ratio  was  approximately  1:3  on  dry  matter  basis. 
Incubation  was  done  in  50  ml  vials  at  50C  for  4  days  with 
shaking  at  160  rpm,  and  1  ml  samples  were  taken  before  and 
after  hydrolysis.  The  samples  were  centrifuged  and  the 
supernatants  were  analysed  using  HPLC  and  the  reducing 
sugar assay (see below). 
2.8 Synergistic test with commercial enzymes 
Solid  state  fermentation  was  used  for  the  purpose  of 
evaluating  synergistic  effects  of  the  fungi  and  Celluclast  1.5L 
and  Novozym  188  (Novozymes  A/S,  Denmark).  The  set‐up 
was  as  described  above,  but  with  commercial  enzyme 
preparations added after the FC with fungus and WO had been 
mixed.  One  setup  contained  the  fungus  as  the  only  source  of 
enzymatic activity; a second setup contained the fungus and 1 
FPU  (filter  paper  unit)  Celluclast  1.5L  added;  while  a  third 
contained  the  fungus,  1  FPU  Celluclast  1.5L  added,  and 
Novozym 188 (in a ratio of 4:1, respectively). 
2.9 Activity assay of fungal extracts 
Endo‐glucanase  activity  was  determined  by  the  use  of 
AZO‐CMC,  assayed  according  to  the  manufacturer’s 
description  (Megazyme)  (Wood  and  Bhat,  1988).  The  enzyme 
solution  was  assayed  in  various  dilutions  at  the  conditions 
stated by the manufacturer. A standard curve was obtained by 
activity  measurements  of  a  pure  endoglucanase  from 
Aspergillus niger (Megazymes), with an activity of 322 U/ml at 
40 C, pH 4.6, reported by the manufacturer. 
Beta‐glucosidase  activity  was  assayed  with  5  mM  p‐
nitrophenyl‐beta‐D‐glucopyranoside  (Sigma)  in  50  mM 
sodium  citrate  buffer  pH  4.8  as  substrate.  The  assay  was 
carried out as described by Flachner et al. (1999). The activity 
was  expressed  in  units  (µmoles  substrate  converted  per 
minute). 
2.10 Sugar analysis 
All samples to be analyzed by HPLC (Hewlet Packard 1100 
series)  were  run  on  a  3007.8  mm  Aminex  HPX‐87H  Column 
(BioRad)  at  60°C  with  sulfuric  acid  as  eluent  at  a  flowrate  of 
0.6 ml/min and an injection volume of 10 µl. The components 
were detected refractometrically on a RI detector.  
The  reducing  sugar  assay  was  carried  out  according  to 
Ghose  (1987)  and  Miller  (1959).  One  ml  milliQ  water  and  0.5 
ml  sample  solution  were  mixed  before  3.0  ml  dinitrosalicylic 
acid  (DNS)  was  added.  The  mixture  was  boiled  for  5  minutes; 
then  diluted  with  MilliQ  water,  followed  by 
spectrophotometrical  absorbance  measurements  at  540  nm 
(Milton Roy spectronic 301), using MilliQ water as standard. A 
standard  curve  was  obtained  with  different  concentrations  of 
glucose,  thereby  expressing  absorbance  as  glucose 
equivalents.  
3. Results and discussion 
3.1 Initial screening and biomass evaluation 
A screening program for different new fungal isolates from 
environmental  samples  was  established  in  order  to  identify 
strains  with  high  hydrolytic  activity  compared  to  wellknown 
reference  strains.  A  total  of  64  strains  were  included  in  the 
initial  screening  that  comprised  grading  of  growth  on  the 
different substrates: filter cake (FC), wet oxidized wheat straw 
(WO), xylan, avicel, and carboxymethyl cellulose (CMC) (Table 
1).  The  grading  was  based  on  colony  size  (morphology),  as  it 
was  expected  that  the  better  the  fungi  grew,  the  better  they 
utilized the  substrate.    In  general,  FC  and  WO  were  the  media 
that resulted in the best growth of the fungi tested. 25% of the 
strains  were  graded  with  3  or  above  on  FC,  while  35%  of  the 
strains  were  graded  3  or  above  on  WO,  yet  WO  was  at  the 
 
Research paper I 
 ‐ I.4 ‐ 
 
same time the substrate having the greatest number of strains 
that did not grow at all (Table 1). 
FC  of  hydrolyzed  wet  oxidized  wheat  straw  represents  a 
fraction  from  the  bioethanol  process  with  low  commercial 
value and could be of great interest to utilize as a substrate for 
enzyme production for the bioethanol process. The reuse of FC 
would  loop  back  the  un‐hydrolyzed  biomass  into  the  process 
and  thereby  make  good  value  of  this  fraction.  The  main 
components  of  the  FC  are  relatively  high  levels  of  lignin 
followed by cellulose (Table 2). The cellulose of FC is regarded 
as poorly available as it remained part of the solid product and 
thus  was  not  initially  hydrolyzed.  It  is  speculated  that  fungi 
capable  of  growing  on  FC  potentially  have  new  interesting 
enzymes  that  can  facilitate  further  hydrolysis  of  FC.  Overall, 
this favors the use of FC for on‐site enzyme production and FC 
was  therefore  included  in  the  screening.  Adding  FC  as 
fermentate  directly  in  the  hydrolysis  will  increase  the  overall 
lignin  concentration  in  the  hydrolysis;  this  could  potentially 
have  a  negative  impact  on  the  enzyme  hydrolysis  as  lignin  is 
known  to  enhance  enzyme  adsorption  (Berlin  et  al.,  2005). 
However,  FC  is  likely  to  already  be  associated  with  proteins 
from  the  previous  hydrolysis  (Jorgensen  et  al.,  2007).  This 
would reduce both the non‐productive and productive binding 
of  new  enzymes  due  to low  accessibility.  During  fermentation 
the  close  association  of  the  growing  fungus  with  the  FC  could 
result  in  proteolytic  metabolic  activities  that  to  a  certain 
extent  could  remove  some  of  the  enzymes  bound  to  the  FC. 
This  would  increase  the  accessibility  of  the  remaining 
cellulose in the FC (Berlin et al., 2006). 
WO represents another fraction in the ethanol process and 
could  be  a  potential  substrate  for  enzyme  production  as  it  is 
for  ethanol  production.  Wet  oxidized  material  has  previously 
been  reported  to  contain  compounds  inhibitory  towards 
enzyme  hydrolysis  and  fermentation  (Klinke  et  al.,  2004). 
Table 1. Grading of growth on substrates on a scale 0‐5 (0=poor growth, 5=very good growth). 
*z=zone of clearance, graded on a scale 0‐3 (0=no clearance, 3=large zone of clearance) 
 
1
.
1
 
1
.
1
.
1
 
1
.
2
 
1
.
2
.
2
 
1
.
3
 
1
.
4
 
1
.
5
.
1
 
1
.
6
 
1
.
7
 
1
.
8
.
1
 
1
.
8
.
2
 
2
.
1
 
2
.
2
 
2
.
3
 
2
.
4
 
2
.
5
 
2
.
6
 
2
.
7
 
2
.
8
 
2
.
9
 
3
.
1
 
3
.
2
 
FC  2  2  2  1  2  2  4  2  1  3  2  1  1  4  0  2  0  0  5  0  1  4 
WO  2  3  0  0  4  4  4  2  0  2  3  0  2  3  0  3  0  2  3  2  0  2 
Xylan* 

z2 

z1 

z3 

z0 

z3 

z3 

z0 

z3 

z1 

z3 

z2 

z0 

z0 

z0 

z1 

z1 

z0 

z0 

z1 

z0 

z1 

z1 
Avicel  1  1  2  0  1  1  1  2  1  5  1  3  1  1  0  1  1  1  3  1  1  1 
CMC  2  3  1  0  2  1  1  3  0  5  1  1  1  3  0  2  1  1  1  2  0  5 
   
 
3
.
3
 
4
.
1
 
4
.
2
 
5
.
1
 
7
.
1
 
7
.
2
 
7
.
3
 
9
.
1
 
9
.
2
 
9
.
3
.
1
 
9
.
3
.
2
 
9
.
4
 
9
.
4
.
1
 
9
.
5
 
1
0
.
1
 
1
0
.
2
 
1
0
.
3
 
1
0
.
4
 
1
0
.
5
 
1
1
.
1
 
1
1
.
2
 
1
1
.
3
 
FC  1  3  2  4  2  2  1  1  1  2  3  1  2  1  1  1  1  1  1  1  2  1 
WO  0  3  3  3  1  1  1  2  3  2  3  2  2  2  3  2  2  0  3  0  0  0 
Xylan* 

z1 

z0 

z0 

z0 

z0 

z1 

z0 

z1 

z2 

z2 

z0 

z2 

z3 

z2 

z0 

z0 

z0 

z2 

z0 

z0 

z0 

z3 
Avicel  0  1  1  3  2  1  3  1  1  1  1  1  1  1  1  1  1  1  1  1  1  1 
CMC  1  1  2  5  1  1  2  1  3  1  2  1  2  1  1  1  1  1  2  0  2  0 
     
 
1
1
.
4
 
1
1
.
5
 
1
3
 
1
4
 
1
5
 
H
j
1
 
H
j
3
 
A
P
 
A
1
 
A
2
 
A
3
 
I
B
T
3
0
1
6
 
I
B
T
3
9
4
5
 
I
B
T
1
4
6
6
8
 
I
B
T
1
5
0
9
4
 
I
B
T
1
6
7
5
6
 
I
B
T
1
8
3
6
6
 
I
B
T
2
6
8
0
8
 
R
e
f
.
s
t
r
a
i
n
 
I
B
T
2
5
7
4
7
 
 
R
e
f
.
s
t
r
a
i
n
 
I
B
T
7
6
1
2
 
 
 
FC  1  3  1  3  3  1  3  1  1  1  0  3  1  3  3  0  3  3  1  4     
WO  3  2  3  3  2  3  0  3  0  0  0  0  2  3  3  2  4  4  2  3     
Xylan* 

z1 

z2 

z2 

z2 

z2 

z0 

z3 

z0 

z2 

z0 

z0 

z1 

z1 

z3 

z3 

z1 

z0 

z2 

z3 

z0 
   
Avicel  2  1  1  2  1  0  3  1  2  1  0  1  1  2  2  1  1  1  1  1     
CMC  3  2  1  1  2  2  1  3  1  1  0  3  2  3  2  1  2  2  2  0     
 
 
Research paper I 
 ‐ I.5 ‐ 
 
Table 2. Biomass composition of  pre‐treated wheat straw (WO) and filter cake (FC). The cellulose, hemicelluloses, 
and lignin content are calculated using NREL procedures, where glucose and xylose amounts after acid hydrolysis 
are calculated into cellulose and hemicellulose, respectively.  
  Cellulose  
(% of DM)  Glucose 
(g/gDM)
Hemicellulose 
(% of DM)  Xylose  
(g/gDM)
Lignin  
(% of DM) 
WO 
41.0  0.3% 
  0.46    0.003 g/gDM 
16.0   0.6%
  0.18    0.007 g/gDM 
27.94  0.1% 
 
FC 
28.3  0.4% 
  0.31   0.004 g/gDM 
6.3   0.2%
  0.07    0.002 g/gDM 
46.61  0.2% 
 
 
However,  poor  growth  of  enzyme  producers  on  this  medium 
does  not  necessarily  relate  to  a  lack  of  cellulolytic  enzymes 
produced  by  the  fungus.  Amongst  those  strains  that  did  grow 
on  WO,  an  increased  number  of  strains  received  good  growth 
grades  indicating  that  the  greater  levels  of  free  sugars  in  the 
WO  media  facilitated  increased  growth  compared  to  the  FC 
where  washing  had  removed  the  free  sugars.  Free  sugars  will 
help  initiate  fungal  growth  and  perhaps  thereby  boost  the 
fungi  that  have  the  right  combination  of  enzymes  to  degrade 
the  substrate  to  continue  growth.  The  lower  lignin  content  of 
the  WO  (Table  2)  compared  to  FC  might  also  explain  the 
increased growth on WO. 
Of  the  commercial  hemicellulose  and  cellulose  substrates, 
xylan  was  the  substrate  supporting  good  growth  of  the 
greatest number of strains (grades of 3 or above), and was the 
only  substrate  that  supported  growth  of  all  strains  (Table  1). 
This  clearly  shows  that  xylanases  are  widespread  amongst 
fungi  in  general.  In  contrary,  the  strains  did  not  grow  well  on 
the  cellulose  substrates  as  less  than  10  and  20%  were  given 
grades of 3 or above on avicel and CMC, respectively (Table 1), 
thus  making  the  strains  that  did  succeed  in  utilizing  this 
carbon  source  outstanding  compared  to  the  most  strains 
tested.  
Xylan  was  included  in  the  screening  to  determine  the 
ability  of  the  fungus  to  utilize  a  hemicellulosic  carbon  source, 
as  the  enzymatic  degradation  of  xylan  to  xylose  could  add 
value  to  the  process  in  terms  of  the  pentoses  later  being 
fermented into ethanol by C5 fermenting microbes. Avicel and 
CMC  represented  the  cellulose  fraction  of  the  biomass,  each 
having  different  degree  of  crystalline  and  amorphous  regions, 
where avicel primarily requires cellobiohydrolase activity and 
CMC  requires  endoglucanase  activity  for  their  hydrolysis 
(Zhang et al. 2006).  
Of the 64 strains included in the screening, 25 were chosen 
for  further  studies  (grey  colored  in  Table  1),  with  the  grey 
colored grades representing the primary reasons for choosing 
these  particular  strains.  The  selection  was  based  on  good 
growth  grades  (≥3)  on  FC,  WO,  avicel,  and  CMC.  A.  niger 
IBT25747and  T.  reesei  IBT7612  were  included  as  reference 
strains.  
3.2 Enzyme activity studies of strains selected from screening 
Two  activity  studies  were  carried  out  to  evaluate  the 
enzyme  activity  of  the  25  strains  chosen  from  the  initial 
screening:  one  using  AZCL  medium  for  simple  measurements 
of  cellulase  and  xylanase  activity,  and  one  using  the  complex 
filter  cake  as  substrate  for  enzyme  production  followed  by  its 
use in hydrolysis of WO to determine activity on  this complex 
substrate.  AZCL  media  are  commonly  used  for  broad  enzyme 
screening  with  focus  on  endo‐activites  (Pedersen  et  al.,  2007; 
Pedersen  et  al.,  2009).  The  use  of  pretreated  biomass 
(including  wheat  straw,  wheat  bran,  rice  straw,  groundnut 
shells, corn fiber) and wastes (including paper pulp, municipal 
refuse,  stillage  of  sugar  cane  bagasse  and  spruce  wood 
hydrolysates)  to  support  fungal  growth  and  enzyme 
production  has  previously  been  reported  (Alriksson  et  al., 
2009;  Dien  et  al.,  2006;  Doppelbauer  et  al.,  1987;  Gupte  and 
Madamwar,  1997;  Thygesen  et  al.,  2003).  However,  it  has  not 
previously  been  reported  to  use  the  waste  stream  after  C6 
fermentation  and  where  C5  sugars  are  removed  with  the 
Table 3. Grading of blue color formation from growth on AZCL‐Polysaccharides plates. Blue colour zone and intensity graded on a scale 0‐5 
  1
.
1
.
1
 
1
.
5
.
1
 
1
.
6
 
1
.
8
.
1
 
2
.
1
 
2
.
3
 
2
.
8
 
3
.
2
 
4
.
1
 
5
.
1
 
9
.
2
 
9
.
3
.
2
 
1
1
.
4
 
1
1
.
5
 
1
4
 
1
5
 
H
j
3
 
A
P
 
I
B
T
3
0
1
6
 
I
B
T
1
4
6
6
8
 
I
B
T
1
5
0
9
4
 
I
B
T
1
8
3
6
6
 
I
B
T
2
6
8
0
8
 
R
e
f
.
s
t
r
a
i
n
 
I
B
T
2
5
7
4
7
 
R
e
f
.
s
t
r
a
i
n
 
I
B
T
7
6
1
2
 
AZCL‐cellulose  4  1  3  5  2  3  1  4  0  5  3  3  4  3  1  2  3  4  2  3  4  2  1  3  0 
AZCL‐arabinoxylan  4  2  3  5  3  3  2  0  2  5  3  3  4  4  2  2  3  4  4  3  4  2  4  4  4 
 
 
Research paper I 
 ‐ I.6 ‐ 
 
soluble phase. That is, to use the filter cake of the wheat straw 
bioethanol  process  for  enzyme  production  and  reuse  it 
directly  for  hydrolysis  without  separating  out  the  enzymes, 
thereby adding value to the overall process. 
The  activity  study  using  AZCL‐substrates  was  subjectively 
graded  based  on  degree  of  blue  color  zone  and  its  intensity 
(Table  3).  Comparing  these  results  with  the  initial  growth 
screening  (Table  1),  it  was  found  that  the  grades  on  CMC  and 
AZCL‐cellulose  correlate  well.    Therefore,  the  ability  to  grow 
well  on  CMC  was  indeed  an  indication  that  the  fungi  had 
enzymes  for  hydrolysis  of  CMC,  shown  by  the  dye‐release  on 
AZCL‐cellulose.  The  growth  grades  on  xylan  (Table  1)  and 
color  grades  on  AZCL‐arabinoxylan  (Table  3)  were  for  the 
most  part  comparable.  However,  the  clearing  zone  grades  on 
xylan only partially correspond with the color grades on AZCL‐
arabinoxylan.  This  might  be  due  to  that  the  color  grades  on 
AZCL‐arabinoxylan are based on both color intensity as well as 
zone  diameter,  while  it  for  the  xylan  plates  was  difficult  to 
judge clearing zone intensity.  
The  enzyme  activities  produced  by  the  fungi  growing  in 
solid  state  on  FC  were  evaluated  by  analysis  of  the  soluble 
sugars  after  hydrolysis  of  WO.  Increase  in  reducing  ends 
(measured  as  glucose  equivalents)  as  well  as  final  C6  and  C5 
sugars  present  after  hydrolysis  of  wet  oxidized  biomass  were 
compared  (Table  4).  The  increase  in  monomeric  sugar 
concentration  only  partly  correlates  with  the  measured 
increase  in reducing  ends  of the samples.  Two  good  examples 
are the strains 11.4 and IBT15094; these are in the top 5 of the 
reducing ends measurements, but do not even get in top 10 of 
the  monomeric  sugar  measurements.  A  high  score  was, 
however,  given  on  both  AZCL‐cellulose  and  –arabinoxylan, 
indicating high endo‐activity. Great endo‐activity will increase 
the  number  of  reducing  ends,  but  if  the  fungus  does  not  have 
good  beta‐glucosidase/‐xylosidase  activity,  no  great 
monomeric  concentration  will  be  detected.  To  reach  a  high 
concentration of sugar monomers, a full enzyme cocktail must 
work  together,  consisting  of  exo‐,  endo‐glucanases/xylanases, 
and  beta‐glucosidases/‐xylosidases  (Zhang  et  al.,  2006). 
Accumulation  of  cellobiose  was  detected  for  strain  1.8.1  and 
2.3  (data  not  shown),  indicating  high  cellobiohydrolase 
activity,  but  lack  of  sufficient  beta‐glucosidase  activity.  These 
different  observations  highlight  the  importance  of  multiple 
screening methods to be able to map the different activities of 
each fungus.  
Table 4. Increase in concentration of reducing ends (measured as glucose equivalents) and monomeric sugars after hydrolysis 
of wet exploded wheat straw by fungal enzymes produced on filter cake. The number in the parenthesis assigns the ranking of 
the fungus among all fungi examined. 
*Here, an accumulation of cellobiose was found. 
 
1
.
1
.
1
 
1
.
5
.
1
 
1
.
6
 
1
.
8
.
1
 
2
.
1
 
2
.
3
 
2
.
8
 
3
.
2
 
4
.
1
 
5
.
1
 
9
.
2
 
9
.
3
.
2
 
1
1
.
4
 
Reducing ends (g/l) 
1.27  0.58  1.33  0.75  1.11  0.91  1.24  0.66  1.23  1.27  1.37  1.16  1.42 
   
(8)  (7) 
 
(5) 
Glucose (g/l) 
0.41  0.68  0.18  0.52*  0.58  0.65*  0.4  0.32  0.28  0.73  0.61  0.16  0.27 
 
(4) 
 
(9)  (5)  (3)  (7) 
   
Xylose (g/l) 
1.49  0.09  0.41  0.35  1.39  0.41  1.16  0.06  1.32  1.29  1.46  0.73  1.17 
(3) 
   
(7)  (5) 
   
 
           
 
1
1
.
5
 
1
4
 
1
5
 
H
j
3
 
A
P
 
I
B
T
3
0
1
6
 
I
B
T
1
4
6
6
8
 
I
B
T
1
5
0
9
4
 
I
B
T
1
8
3
6
6
 
I
B
T
2
6
8
0
8
 
R
e
f
.
s
t
r
a
i
n
 
I
B
T
2
5
7
4
7
 
R
e
f
.
s
t
r
a
i
n
 
I
B
T
7
6
1
2
 
 
Reducing ends (g/l) 
0.91  0.76  1.49  1.25  1.68  0.53  1.32  1.48  1.38  1.24  2.23  1.29 
 
   
(3)  (2)  (9)  (4)  (6)  (1) 
   
Glucose (g/l) 
0.6  0.23  0.51  0.55  0.9  0.15  0.45  0.52  0.45  0.33  1.48  0.63 
 
(8) 
   
(2)  (1)  (6) 
 
Xylose (g/l) 
0.36  0.11  1.46  1.42  1.57  0.07  1.1  0.85  1.37  0.57  1.81  1.35 
 
   
(4)  (6)  (2)  (8)  (1)  (9) 
 
 
Research paper I 
 ‐ I.7 ‐ 
 
Of  the  25  strains,  five  were  selected  for  further  studies 
with  commercial  enzymes.  We  chose  to  continue  with  the 
strains  that  had  generally  performed  best  in  terms  of  total 
cellulose  degrading  abilities  in  multiple  of  the  assays  (ref 
strain  IBT25747,  AP,  and  5.1),  and  also  to  include  some  that 
are  thought  to  specifically  possess  high  endo‐activity 
(IBT15094) or exo‐glucanase acitivity (1.8.1).  
3.3 Synergies with commercial enzymes 
The  five  strains  were  grown  in  FC  for  enzyme  production, 
followed  by  hydrolysis  of  WO  in  combination  with  the 
commercial  enzymes  Celluclast  1.5L  and  Novozym  188.  Low 
filter  paper  unit  (FPU)  loadings  of  Celluclast  1.5L  and  a  4:1 
ratio of Novozym 188 were applied to visualize the synergistic 
effects  of  the  fungi  that  were  tested  and  the  commercial 
enzymes.  The  beta‐glucosidase  and  endo‐glucanase  activities 
were  measured  for  each  fungal  or  commercial  enzyme 
addition (Table 5). 
Of  the  two  commercial  enzyme  preparations,  the  beta‐
glycosidase  activity  of  Novozym  188  helps  increase  the 
glucose  yields  and  decrease  the  cellobiose  concentration 
created by the cellobiohydrolase activity of Celluclast 1.5L that 
can  be  self‐inhibiting  (Beguin  and  Aubert,  1994;  Bhat  and 
Bhat,  1997).  The  glucose  concentration  after  hydrolysis  with 
Celluclast 1.5L and Novozym 188, was slightly higher than the 
sum  of  glucose  and  cellobiose  after  hydrolysis  using  just 
Celluclast  1.5L  (data  not  shown).  This  could  be  explained  by 
the  higher  cellobiose  concentration  inhibiting  the 
endoglucanases  and  cellobiohydrolases  resulting  in  a  lower 
total  hydrolysis  in  the  case  of  just  using  Celluclast  1.5L 
(Mansfield et al. 1999).  
Such synergies were examined in our five selected strains, 
using  their  enzymes  produced  on  FC  to  hydrolyze  WO  alone, 
WO  in  combination  with  Celluclast1.5L,  and  WO  in 
combination with Celluclast 1.5L and Novozym 188 (Figure 1).  
Evaluations  were  primarily  based  on  the  cellobiose 
concentration  at  the  end  of  the  hydrolysis.  On  this  basis, 
synergies  were  found  with  the  strain  AP  and  IBT25747,  as 
there  was  no  accumulation  of  cellobiose  and  therefore 
sufficient  synergies  with  the  enzyme  activities  of  Celluclast 
1.5L.  With  strain  1.8.1,  5.1,  and  IBT15094,  accumulation  of 
cellobiose  was  seen  after  hydrolysis  when  hydrolysis  was 
performed with the test fungus and Celluclast 1.5L and here it 
is  obvious  that  synergetic  activities  resulting  from  growth  on 
FC  were  insufficient.  This  correlates  well  with  the  measured 
activities  (Table  5),  where  AP  and  IBT25747  showed  high 
beta‐glucosidase activity while the beta‐glucosidase activity of 
1.8.1, 5.1, and IBT15094 was low. It was further confirmed by 
the  addition  of  Novozym  188  that  in  all  cases  resulted  in  a 
drop in cellobiose concentrations.  
The  profiles  of  the  strains  AP  and  IBT25747  are  very 
similar  with  regards  to  beta‐glucosidase  activity,  while 
IBT25747  has  far  greater  endo‐glucanase  acitivity  (Table  5). 
Strain  IBT25747  gives  the  highest  glucose  yield  when 
hydrolysis  was  performed  with  only  this  fungus,  while  AP 
gives  the  second  highest  (Figure  1).  Combining  either 
IBT25747  or  AP  with  Celluclast  1.5L  for  hydrolysis  showed 
that  the  beta‐glucosidase  activity  of  IBT25747  and  AP  has 
Table 5. Units of beta‐glucosidase (BG) and endoglucanase (EG) added by each fungus or 
commercial enzyme prep to the WO hydrolysis 
   Celluclast 1.5L  Novozym 188  1.8.1  5.1  AP  IBT15094 
Ref strain 
IBT25747 
BG  0.4  1.5  low  low  7.24  low  7.85 
EG  41  low  0.99  1.05  8.09  2.92  85.37 
 
Figure 1. Synergies with commercial enzymes. Increase in glucose, cellobiose, and xylose concentrations after hydrolysis of WO.  
F= fungus; C = Celluclast 1.5L; N = Novozyme 188; error bars represent the double determinations of the hydrolysis. 
 
Research paper I 
 ‐ I.8 ‐ 
 
synergies with the cellobiohydrolase activity of Celluclast 1.5L, 
and  the  endoglucanase  activities  add  to  the  total  hydrolysis. 
Addition  of  Novozym  188  has  no  significant  effect  on  total 
hydrolysis  evaluated  by  glucose  yields,  with  the  enzyme 
concentrations  used  here,  likely  explained  by  the  fact  that the 
fungus  contributes  with  about  5  times  the  amount  of  beta‐
glucosidase  activity  compared  to  the  Novozym  188  added 
(Table 5).  
Xylose  is  readily  released  by  all  strains  (Figure  1), 
supporting  the  fact  that  xylose  is  more  accessible  due  to  the 
nature  of  the  hemicellulose  structure  (Saha,  2003).  It  is 
therefore  speculated  that  enzymes  with  relatively  high 
xylanase  activity  are  likely  to  be  “part  of  the  package”  when 
using organisms with cellulolytic activities.  
Evaluating  the  enzyme  activities  (Table  5)  together  with 
the hydrolysis results (Figure 1), it is clear that greater activity 
results  in  a  higher  degree  of  hydrolysis.  The  endoglucanase 
activity  of  IBT25747  is  approximately  10  times  higher  than 
the  endoglucanase  activity  of  AP,  while  the  beta‐glucosidase 
activity  is  approximately  the  same.  This  resulted  in  a 
difference  in  glucose  yield  amongst  the  two  strains  of  46% 
when hydrolysis was performed with only the fungus, but only 
a  difference  of  17%  when  hydrolysis  was  performed  with  the 
fungus  and  Celluclast  1.5L  combined.  The  additional  endo‐
glucanase  contribution  from  Celluclast  1.5L  is  the  most  likely 
reason for this decreased difference in yield.  
Strain  IBT25747  is  A.  niger  and  it  is,  therefore,  not 
surprising  that  its  enzymes  in  combination  with  Celluclast 
1.5L  are  good  at  hydrolyzing  WO.  However,  besides  of  this 
known  strain,  one  of  our  own  unknown  isolates,  strain  AP, 
showed  a  very  promising  profile  in  terms  of  on‐site  enzyme 
production  using  FC  as  growth  medium.  Stain  AP  was  able  to 
compete  with  the  reference  strain  and  was  sufficient  for 
hydrolysis of WO in combination with Celluclast 1.5L. Addition 
of  Novozym  188  had  no  extra  effect  on  sugar  yields  when  FC 
pregrown  with  strain  AP  was  added.  Eliminating  the  need  for 
beta‐glucosidase  addition  during  hydrolysis  will  significantly 
lower  the  cost  of  enzyme  addition  so  our  results  have 
importance for practical applications. 
4. Conclusion 
This  work  demonstrates  the  possibility  of  using  a  low 
value  stream  of  the  biofuel  production,  FC,  for  enzyme 
production,  where  the  fungus  is  grown  in  the  FC  and  the  FC 
with  the  fungus  is  used  directly  during  hydrolysis  of  WO  to 
obtain  monomeric  sugars  for  biofuel  production.  Such  on‐site 
enzyme  production  is  valuable  in  terms  of  obtaining  a 
complete  value  chain  of  the  biofuel  production.  Through  a 
broad  screening  for  on‐site  enzyme  producers  as  well  as 
testing  for  synergistic  effects,  promising  candidates  were 
selected.  From  the  use  of  reference  enzymes,  e.g.  Celluclast 
1.5L,  that  is  known  to  lack  important  enzyme  activities  for 
complete  hydrolysis,  identification  of  enzymes  that  can 
contribute  to  synergy  and  thereby  more  efficient  hydrolysis 
were found. Here, ref strain IBT25747 and own strain AP were 
found  as  promising  candidates  for  on‐site  enzyme  production 
with  FC  as  growth  and  production  medium.  It  was  showed 
that  the  FC  grown  with  these  fungi  can  substitute  Novozym 
188 in the hydrolysis of WO.. 
 
Acknowledgements 
Mette  Lübeck,  Section  for  Sustainable  Biotechnology, 
Copenhagen  Institute  of  Technology,  Aalborg  University  is 
acknowledged for revision of the manuscript 
 
References 
Ahring,  B.K.,  Westermann,  P.,  2007.  Coproduction  of  bioethanol 
with other biofuels. Biofuels. 108, 289‐302.  
Alriksson,  B.,  Rose,  S.H.,  van  Zyl,  W.H.,  Sjode,  A.,  Nilvebrant,  N., 
Jonsson,  L.J.,  2009.  Cellulase  Production  from  Spent  Lignocellulose 
Hydrolysates  by  Recombinant  Aspergillus  niger  .  Appl.  Environ. 
Microbiol. 75, 2366‐2374.  
Beguin,  P.,  Aubert,  J.P.,  1994.  The  Biological  Degradation  of 
Cellulose. FEMS Microbiol. Rev. 13, 25‐58.  
Berlin,  A.,  Gilkes,  N.,  Kurabi,  A.,  Bura,  R.,  Tu,  M.B.,  Kilburn,  D., 
Saddler,  J.,  2005.  Weak  lignin‐binding  enzymes  ‐  A  novel  approach  to 
improve  activity  of  cellulases  for  hydrolysis  of  lignocellulosics.  Appl. 
Biochem. Biotechnol. 121, 163‐170.  
Berlin,  A.,  Balakshin,  M.,  Gilkes,  N.,  Kadla,  J., Maximenko,  V.,  Kubo, 
S.,  Saddler,  J.,  2006.  Inhibition  of  cellulase,  xylanase  and  beta‐
glucosidase  activities  by  softwood  lignin  preparations.  J.  Biotechnol. 
125, 198‐209.  
Bhat,  M.K.,  Bhat,  S.,  1997.  Cellulose  degrading  enzymes  and  their 
potential industrial applications. Biotechnol. Adv. 15, 583‐620.  
Dien, B.S., Li, X.‐L., Iten, L.B., Jordan, D.B., O'Bryan, P.J., Cotta, M.A., 
2006.  Enzymatic  saccharification  of  hot‐water  pretreated  corn  fiber 
for  production  of  monosaccharides.  Enzyme  Microb.  Technol.  39, 
1137‐1144.  
Doppelbauer,  R.,  Esterbauer,  H.,  Steiner,  W.,  Lafferty,  R.M., 
Steinmuller,  H.,  1987.  The  use  of  Lignocellulosic  Wastes  for 
Production  of  Cellulase  by  Trichoderma  reesei.  Appl.  Microbiol. 
Biotechnol. 26, 485‐494.  
Flachner, B., Brumbauer, A., Reczey, K., 1999. Stabilization of beta‐
glucosidase  in  Aspergillus  phoenicis  QM  329  pellets.  Enzyme  Microb. 
Technol. 24, 362‐367.  
Ghose,  T.K.,  1987. Measurement  of  Cellulase Activities, Pure  Appl. 
Chem. 59, 257‐268 
Gupte,  A.,  Madamwar,  D.,  1997.  Solid  state  fermentation  of 
lignocellulosic waste for cellulase and beta‐glucosidase production by 
cocultivation  of  Aspergillus  ellipticus  and  Aspergillus  fumigatus  . 
Biotechnol. Prog. 13, 166‐169.  
Jorgensen,  H.,  Vibe‐Pedersen,  J.,  Larsen,  J.,  Felby,  C.,  2007. 
Liquefaction  of  lignocellulose  at  high‐solids  concentrations. 
Biotechnol. Bioeng. 96, 862‐870.  
Klinke,  H.B.,  Thomsen,  A.B.,  Ahring,  B.K..  2004.  Inhibition  of 
ethanol‐producing  yeast  and  bacteria  by  degradation  products 
 
Research paper I 
 ‐ I.9 ‐ 
 
produced  during  pre‐treatment  of  biomass.  Appl.  Microbiol. 
Biotechnol. 66, 10‐26.  
Knauf,  M.,  Moniruzzaman,  M.,  2004.  Lignocellulosic  biomass 
processing: A perspective. Int. Sugar J. 106, 147‐150.  
Mansfield,  S.D.,  Mooney,  C.,  Saddler,  J.N.,  1999.  Substrate  and 
enzyme  characteristics  that  limit  cellulose  hydrolysis.  Biotechnol. 
Prog. 15, 804‐816.  
Mathew,  G.M.,  Sukumaran,  R.K.,  Singhania,  R.R.,  Pandey,  A.,  2008. 
Progress  in  research  on  fungal  cellulases  for  lignocellulose 
degradation. J. Sci. Ind. Res. 67, 898‐907. 
Miller,  G.L.,  1959.  Use  of  Dinitrosalicylic  Acid  Reagent  for 
Determination of Reducing Sugar, Anal.Chem. 31, 426‐428  
NREL  National  Renewable  Energy  Laboratory.  2010.  Biomass 
research  ‐  Standard  Biomass  Analytical  procedures 
(http://www.nrel.gov/biomass/analytical_procedures.html).  
NREL  National  Renewable  Energy  Laboratory.  2009.  Biomass 
Research  ‐  Biochemical  Conversion  Projects 
(http://www.nrel.gov/biomass/proj_biochemical_conversion.html).  
Pandey, A., 2003. Solid‐state fermentation. Biochem. Eng. J. 13, 81‐
84.  
Pandey, A., Selvakumar, P., Soccol, C.R., Nigam, P., 1999. Solid state 
fermentation  for  the  production  of  industrial  enzymes.  Curr.  Sci.  77, 
149‐162.  
Pedersen,  M.,  Hollensted,  M.,  Lange,  L.,  Andersen,  B.,  2007. 
Screening efter biologiens katalysatorer. Dansk Kemi 88, 12‐14.  
Pedersen,  M.,  Hollensted,  M.,  Lange,  L.,  Andersen,  B.,  2009. 
Screening for cellulose and hemicellulose degrading enzymes from the 
fungal genus Ulocladium. Int. Biodeterior. Biodegrad. 63, 484‐489.  
Saha,  B.C.,  2003.  Hemicellulose  bioconversion.  J.  Ind.  Microbiol. 
Biotechnol. 30, 279‐291.  
Samson,  R.A.,  Hoekstra,  E.S.,  Frisvad,  J.C.,  2004.  Introduction  to 
Food‐  and  Airborne  Fungi.  Centralbureau  voor  Schimmelcultures, 
Utrecht, Netherlands.  
Thygesen,  A.,  Thomsen,  A.B.,  Schmidt,  A.S.,  Jorgensen,  H.,  Ahring, 
B.K.,  Olsson,  L.,  2003.  Production  of  cellulose  and  hemicellulose‐
degrading  enzymes  by  filamentous  fungi  cultivated  on  wet‐oxidised 
wheat straw. Enzyme Microb. Technol. 32, 606‐615.  
Wood,  T.M.,  Bhat,  K.M.,  1988.  Methods  for  Measuring  Cellulase 
Activities. Meth. Enzymol. 160, 87‐112.  
Zhang,  Y.‐H.P.,  Himmel,  M.E.,  Mielenz,  J.R.,  2006.  Outlook  for  cellulase 
improvement: Screening and selection strategies. Biotechnol. Adv. 24, 
452‐481. 
 
 
 
 
 
Research paper II 
 
 
Screening for beta‐glucosidase activity amongst different fungi 
capable of degrading lignocellulosic biomasses: discovery of a  
new prominent beta‐glucosidase producing Aspergillus sp. 
 
 
Annette Sørensen, Peter S. Lübeck, Mette Lübeck, Philip J. Teller, and Birgitte K. Ahring
 
 
Intended for submission to Enzyme and Microbial Technology 
 
Research paper II 
‐ II.1 ‐ 
 
1. Introduction 
Exploitation  of  lignocellulosic  biomasses  for  production  of 
biofuels,  biochemicals,  and  pharmaceuticals  comprises  a 
promising  alternative  to  the  world’s  limited  fossil  energy 
resources.  Lignocellulosic  biomasses  mainly  consist  of 
cellulose,  hemicellulose,  and lignin, with  different  distribution 
of  each  component  depending  on  the  specific  plant  species. 
Cellulose  is  of  great  interest  in  terms  of  producing  sugars  for 
biofuels  and  chemicals  as  its  hydrolysis  product,  glucose,  can 
readily be fermented into ethanol or converted into high value 
chemicals.  The  hydrolysis  of  cellulose  involves  the  synergistic 
action of cellobiohydrolases (EC 3.2.1.91), endoglucanases (EC 
3.2.1.4),  and  beta‐glucosidases  (EC  3.2.1.21)  [1].  The  first  two 
act  on  the  solid  substrate,  where  the  cellobiohydrolases  are 
capable  of  degrading  the  crystalline  parts  of  cellulose  by 
cleaving off cellobiose molecules from the ends of the cellulose 
chains.  The  endoglucanases hydrolyze  glucosidic  bonds  of  the 
more  amorphous  regions  of  the  cellulose,  decreasing  the 
degree  of  polymerization  and  creating  more  ends  for 
substrate‐enzyme  association  by  cellobiohydrolases.  Finally, 
the  beta‐glucosidases  act  in  the  liquid  phase  hydrolyzing 
mainly  cellobiose  to  glucose,  but  also  to  some  extent 
cellodextrins, sugars with a low degree of polymerization [2].  
Historically,  enzymes  from  Trichoderma  reesei  and 
Aspergillus niger are known as a good match for the hydrolysis 
of  cellulose;  T.  reesei  enzymes  mainly  contribute  with 
cellobiohydrolase  and  endoglucanase  activity  and  A.  niger 
enzymes  with  beta‐glucosidase  activity  [3].  Beta‐glucosidases 
are  of  key  importance  as  they  are  needed  to  supplement  the 
cellobiohydrolase  and  endoglucanase  activities  for  ensuring 
final  glucose  release  and  at  the  same  time  decreasing  the 
accumulation  of  cellobiose  and  shorter  cellooligmers,  which 
Screening for beta‐glucosidase activity amongst different fungi 
capable of degrading lignocellulosic biomasses: discovery of a 
new prominent beta‐glucosidase producing Aspergillus sp. 
Annette Sørensen
1,3
, Peter S. Lübeck
1
, Mette Lübeck
1
, Philip J. Teller
2
, and Birgitte K. Ahring
1,3,
*
 

Section for Sustainable Biotechnology, Copenhagen Institute of Technology, Aalborg University, Lautrupvang 15, DK‐2750 Ballerup, Denmark 
2
 Present address: BioGasol ApS, Lautrupvang 2A, DK‐2750 Ballerup, Denmark 
3
 Center for Bioenergy and Bioproducts, Washington State University, Richland, WA 99352, USA 
 
 
A B S T R A C T
Through a broad fungal screening program for beta‐glucosidase activity using wheat bran as substrate 
in  submerged  fermentation,  a  new  prominent  beta‐glucosidase  producing  strain  was  identified 
amongst  86  screened  strains.  This  uncharacterized  strain  (AP)  showed  significantly  better  beta‐
glucosidase potential than all  other fungi screened,  with  Aspergillus niger showing the second greatest 
activity. Strain AP was from its ITS1 sequence identified as an Aspergillus sp., and phylogenetic analysis 
indicated  it  was  a  new  species.  The  potential  of  a  solid  state  fermentation  extract  of  strain  AP  was 
compared  with  the  commercial  beta‐glucosidase  containing  enzyme  preparations:  Novozym  188  and 
Cellic  CTec.  The  extract  of  strain  AP  was  found  to  be  a  valid  substitute  for  Novozym  188  in  terms  of 
better  cellobiose  hydrolysis,  by  having  the  same  Michaelis  Menten  kinetics  affinity  constant,  and  by 
performing  equally  well  during  hydrolysis  with  regard  to  product  inhibition.  Furthermore,  the  extract 
from  the  strain  had  higher  specific  activity  (U/total  protein)  and  also  increased  thermostability 
compared  with  Novozym  188.  The  significant  thermostability  of  strain  AP  beta‐glucosidases  was 
further  confirmed  when  compared  with  Cellic  CTec.  The  beta‐glucosidases  of  strain  AP  were  able  to 
degrade  cellodextrins  with  an  exo‐acting  approach,  and  they  were  also  found  capable  of  hydrolyzing 
pretreated bagasse to monomeric sugars when combined with Celluclast 1.5L. 
A R T I C L E   I N F O 
Keywords: 
Beta‐glucosidase 
Screening 
Enzyme kinetics 
Aspergillus 
Novozym 188 
Cellic CTec 
 
 
 
 
 
* Corresponding author: telephone +45 99402591 
E‐mail address: bka@bio.aau.dk (B.K. Ahring) 
 
Research paper II 
‐ II.2 ‐ 
 
are known as product inhibitors for the cellobiohydrolases [1]. 
Especially  efficient  beta‐glucosidases,  that  are  not  themselves 
easily inhibited by their product, glucose, are of great interest. 
Most  commercial  cellulase  preparations  are  produced  by  T. 
reesei,  e.g.  Celluclast  1.5L  (Novozymes  A/S),  which  has  to  be 
supplemented  with  extra  beta‐glucosidase  activity  from 
another  source,  e.g.  Novozym  188  (Novozymes  A/S),  in  order 
to  improve  cellulose  hydrolysis.  Recently,  Cellic  CTec 
(Novozymes  A/S)  has  been  launched,  which  has  all  activities 
needed  for  hydrolysis  of  cellulose  in  one  single  preparation. 
The  commercially  available  beta‐glucosidases  have  relatively 
low  long‐term  temperature  stability.  Robustness, 
thermostability  and  substrate  specificity  are  very  important 
characteristics  for  enzymes  to  be  applied  in  industrial 
processes.  
The  aim  of  the  present  work  was  to  search  for  beta‐
glucosidase  producing  fungi  using  a  screening  strategy  based 
on wheat bran as substrate and to compare the enzymes from 
the best strain(s) with commercial enzyme preparations based 
on  enzyme  kinetics,  including  Michaelis‐Menten  studies, 
thermostability, pH optimum, glucose tolerance, and ability to 
hydrolyze  cellodextrins  and  pretreated  lignocellulose.  The 
hypothesis  is  that  new  and  better  beta‐glucosidase  enzyme 
producers  can  be  found  through  a  broad  screening  of 
lignocellulose  degrading  fungi.  The  fungi  selected  for  the 
screening originated  from several different  countries and was 
partly collected by ourselves for this study and partly donated 
by other researchers. 
2. Materials and methods 
2.1 Fungal samples 
This  study  comprises  fungal  samples  from  many  different  sources, 
including new isolations and fungi from our “in house” fungal collection. Table 1 
specifies the stain numbers, identity, identification method, origin, and reference 
of each sample. New fungal isolates were from soil and decaying wood samples, 
isolated  by  multiple  transfers  on  potato  broth  agar  (PDA)  plates  supplemented 
with  50  ppm  chloramphenicol  and  50  ppm  kanamycin,  incubated  at  room 
temperature.  Samples  isolated  in  this  work  were  all  identified  by  ITS 
sequencing, using the method described  below.  All  fungi  were  grown on  potato 
dextrose  agar  (PDA,  Sigma)  at  room  temperature  and  maintained  in  10  % 
glycerol at –80
 °
C. 
The following aspergilli reference strains were kindly donated by Professor 
Jens C. Frisvad, Technical University of Denmark (DTU): A. niger CBS 554.65
T
, A. 
homomorphus  CBS  101889
T
,  A.  aculeatinus  CBS  121060
T
,  A.  aculeatus  CBS 
172.66
T
, A. uvarum CBS 121591
T
, and A. japonicus CBS 114.51
T
.  
2.2 Beta‐glucosidase screening 
For beta‐glucosidase activity screening was carried out in a Falcon tube set‐
up  where  three  0.5x0.5cm  squares  were  cut  from  PDA  plates  with  7  days  old 
single fungal strains and incubated in 10 ml of media shaking (180 rpm) at room 
temperature  for  another 7  days. The media  was  composed  of  20g/l  wheat bran 
(Finax),  20g/l  corn  steep  liquor  (Sigma),  3g/l  NaNO3,  1g/l  K2HPO4,  0.5  g/l  KCl, 
0.5 g/l MgSO47H2O, 0.01 g/l FeSO47H2O. The samples were centrifuged at 10,000 
rpm  for  10  minutes  and  the  supernatants  were  subsequently  assayed  for  beta‐
glucosidase activity and protein content. 
Beta‐glucosidase  activity  was  measured  using  5  mM  p‐nitrophenyl‐beta‐D‐
glucopyranoside  (pNPG)  in  50  mM  Na‐Citrate  buffer  pH  4.8  as  substrate.  15  µl 
sample  and  150  µl  substrate  were  incubated  at  50°C  for  10  minutes  in  200  µl 
PCR tubes in a thermocycler (Biorad); 30 µl of the reaction was transferred to a 
microtiter  plate  already  containing  50  µl  1M  Na2CO3  for  termination  of  the 
reaction. Absorbance was read at 405 nm in a plate reader (Dynex Technologies 
Inc.). pNP was used to prepare a standard curve. One unit (U) of enzyme activity 
was  defined  as  the  amount  of  enzyme  needed  to  hydrolyze  1  µmol  pNPG  in  1 
minute. 
Protein  quantification  was  done  using  the  Pierce  BCA  protein  assay  kit 
microplate  procedure  according  to  manufacturer’s  instructions  (Pierce 
Biotechnology). 
2.3 Identification of fungi using sequencing of ITS1 region  
DNA extraction was carried out by the method of Dellaporta et al. [11] using 
bead  beating  (2x  20sec)  of  fungal  biomass  in  extraction  buffer  (500  mM  NaCl, 
100  mM  Tris  pH8,  50  mM  EDTA,  1m  M  DTT)  and  1x  20sec  with  SDS  added  to 
final  concentration  of  2%.  Protein  and  cell  debris  was  precipitated  with 
potassium  acetate  at  a  final  concentration  of  1.4  M.  DNA  was  precipitated  with 
equal  volumes  of  sample  and  2‐propanol,  followed  by  washing  with  70% 
ethanol, and finally resuspended in water. 
Two  fungal  primers  ITS1  (5’  TCCGTAGGTGAACCTGCGG  3’)  and  ITS2  (5’ 
GCTGCGTTCTTCATCGATGC  3’)  that  match  the  conserved  18S  and  5.8S  rRNA 
genes,  respectively,  were  used  for  the  amplification  of  the  non‐coding  IST1 
region  [12,  13].  Approx  100  ng  genomic  DNA  was  used  as  template  in  a 
polymerase  chain  reaction  with  1  U  proof  reading  WALK  polymerase  (A&A 
Biotechnology), PCR buffer (50 mM Tris pH  8, 0.23 mg/ml BSA, 0.5% Ficoll, 0.1 
mM cresol red, 2.5 mM MgCl2), 0.2 mM of dNTP, 0.4 µM of each primer ITS1 and 
ITS2.  Using  a  thermocycler  (BioRad),  an  initial  denaturation  step  (94C,  2min) 
was  followed  by  35  cycles  of  denaturation  (94C,  30  sec),  annealing  (60C,  30 
sec),  and  elongation  (72C,  1  min),  and  a  final  elongation  step  (72C,  2  min) 
following  the  last  cycle.  All  products  were  checked  by  gel  electrophoresis. 
Depending on the purity of the sample, either GelOut or CleanUp was performed 
(EZNA kits from Promega) according to the manufacturer’s instructions.  
DNA  sequencing  was  performed  by  either  MWG  Eurofins,  Germany  or 
Starseq,  Germany,  directly  sequencing  the  PCR  products  with  the  ITS1  or  ITS2 
primer. The sequence data was submitted to the GenBank NCBI nucleotide blast 
search database for fungal identification. 
2.4 Molecular phylogeny 
Phylogenetic  analysis  of  the  ITS1  region  of  the  fungus  AP  and  different 
aspergilli  was  carried  out  as  described  by  Varga  et  al.  [14]  and  Samson  et  al. 
[15]. ClustalW multiple alignment was used for sequence alignment and manual 
improvement  of  the  alignment  was  performed  using  BioEdit 
(http://www.mbio.ncsu.edu/BioEdit/bioedit.html).  The  PHYLIP  program 
package  version  3.69  [16]  was  used  for  preparation  of  phylogenetic  trees.  The 
distance matrix of the data set was calculated based on the Kimura method [17] 
using  the  program  “Dnadist”.  The  phylogenetic  tree  was  prepared  by  running 
the  program  “Neighbor”  using  the  neighbor‐joining  method  [18]  to  obtain  an 
unrooted  trees.  Talaromyces  emersonii  was  defined  as  the  outgroup  in  the 
program  “Retree”,  and  finally  the  tree  was  visualized  using  the  program 
TreeView  (win32)  [19].  Bootstrap  values  [20]  were  calculated  by  running  the 
program  “Seqboot”  to  produce  1000  bootstrapped  data  sets  from  the  original 
data set. Again, “Dnadist” with the Kimura method was used to prepare distance 
matrices  of  the  multiple  data  sets,  and  “*Neighbor”  with  the  neighbor‐joining 
method to obtain unrooted trees of the multiple data sets. Finally, the bootstrap 
values  were  obtained  from  the  consensus  tree  which  was  identified  by  the 
majority‐rule consensus method by running the program “Consense”. 
2.5 Strain AP, culture conditions, and enzyme extract preparation 
The  fungal  strain  AP  was  grown  on  potato  dextrose  agar  (Sigma)  for 
sporulation.  Spores  from  one  petri  dish  were  harvested  after  7  days  of  growth 
using  sterile  water. The  heavy  spore  suspension  was  filtered  through Miracloth 
 
Research paper II 
‐ II.3 ‐ 
 
(Andwin  Scientific).  Two  ml  of  the  spore  solution  was  inoculated  into  200  ml 
seed  medium  (2.0  g/l  wheat  bran,  5  g/l  corn  steep  powder,  0.25  g/l  yeast 
extract, 0.75 g/l peptone,  1.4 g/l (NH4)2SO4, 2.0 g/l KH2PO4, 0.4  g/l CaCl2  2H2O, 
0.3 g/l MgSO4 H2O, 5.0 mg/l FeSO4, 1.6 mg/l MnSO4 7H2O, 1.4 mg/l ZnSO4 7H2O, 
2.0 mg/l CoCl2 6H2O) in a 500 ml Erlenmeyer flask, and incubated at 30°C for 2 
days, shaking at 160 rpm. Solid state fermentation at approximately 30% TS was 
carried  out  adding  100  ml  of  the  cultivated  seed  medium  to  1  l  of  a  solid  state 
fermentation  medium  comprising  of  343  g  wheat  bran  (TS  of  87.4%),  9  g  corn 
steep powder,  557 ml Czapek liquid (3 g/l NaNO3, 1 g/l K2HPO4, 0.5 g/l KCl, 0.5 
g/l  MgSO4  7H2O,  0.01  g/l  FeSO4  7H2O)  [21].  Incubation  was  carried out in  large 
flat  boxes  (20  cm  x  20  cm  x  5  cm)  in  order  to  allow  a  large  surface  area  where 
the  fermentation  medium  had  a  height  of  approx.  2  cm.  The  samples  were 
incubated at 30°C without shaking. After 7 days incubation, liquid was extracted 
from the medium by pressing the medium by hand using gloves. The extract was 
centrifuged  at  10,000  g,  and  the  supernatant  filtered  through  Whatman  filter 
paper. 
2.6 Beta‐glucosidase activity assays 
In this work, specific activity (U/mg) is defined as units per amount of total 
protein.  Specific  beta‐glucosidase  activity  was  measured  using  two  different 
substrates:  pNPG  and  cellobiose.  The  assay  using  5  mM  pNPG  in  Na‐Citrate 
buffer  pH  4.8  was  performed  as  previously  described;  enzyme  samples  were 
assayed  at  different  concentrations  in  triple  determination  to  ensure  substrate 
saturation  in  the  assay.  The  assay  using  6  mM  cellobiose  in  50  mM  Na‐Citrate 
buffer pH 4.8 was performed as follows: 15 µl sample and 150 µl substrate was 
incubated  at  50°C  for  10  minutes  in  PCR  tubes  in  a  thermocycler;  50  µl  of  the 
reaction  was  transferred  to a  HPLC  vial  already  containing  1  ml  100  mM NaOH 
for  termination  of  the  reaction.  The  glucose  concentration  was  measured  at 
Dionex ICS3000 using gradient elution: 0‐20% eluent B (0.5 M Na‐Acetate in 100 
mM NaOH) in 13 minutes followed by 2 minutes washing with 50% eluent B and 
5  minutes  re‐equilibrating  with  100%  eluent  A  (100  mM  NaOH).  Samples  were 
assayed  at  different  concentrations  in  triple  determination  to  ensure  substrate 
saturation in the assay. 
2.7 Kinetic studies 
For  performing  Michaelis‐Menten  kinetics    beta‐glucosidase  activity  was 
measured  as  described  above,  but  using  different  substrate  concentrations 
(pNPG  0.1‐10  mM,  cellobiose  0.2‐18  mM),  and  with  an  enzyme  dilution  that 
ensured  substrate  saturation  was  reached  within  this  range.  Triple 
determinations  were  performed.  A  substrate  saturation  curve  was  prepared  by 
plotting  substrate  concentration  [S]  vs.  reaction  rate,  v.  The  Michaelis‐Menten 
constants KM and Vmax were determined from Hanes‐Wolf plots where substrate 
concentration  [S]  is  plotted  against  substrate  concentration  over  reaction  rate 
[S]/v, and the linear relationship of the data gives a slope of 1/Vmax, a y‐intercept 
of KM/Vmax, and an x‐intercept of –KM.   
2.8 Glucose tolerance 
For  testing  glucose  tolerance,  5  mM  pNPG  in  Na‐Citrate  buffer  pH  4.8  was 
used  as  substrate  with  different  glucose  amounts  added,  ranging  final  glucose 
concentrations  of  0‐280  mM.  The  remaining  activity  (glucose  tolerance)  was 
measured spectrophotometrically by release of pNP at 50°C reaction conditions, 
as  described  earlier.  Triple  determinations  were  performed.  Using  20  mM 
cellobiose  in  Na‐Citrate  buffer  pH  4.8  as  substrate  and  glucose  concentrations 
ranging  from  0‐120  mM,  15  µl  sample  and  150  µl  substrate  with  the  different 
glucose concentrations were incubated at 50°C for 10 minutes in PCR tubes in a 
thermocycler;  100  µl  of  the  reaction  was  transferred  to  a  tube  already 
containing  100  µl  200  mM  NaOH  for  termination  of  the  reaction.  The  reactions 
were further diluted 512 times and final cellobiose concentration was measured 
at  Dionex  ICS3000  using  gradient  elution:  0‐20%  eluent  B  in  13  minutes 
followed by 2 minutes washing with 50% eluent B (0.5 M Na‐Acetate in 100 mM 
NaOH) and 5 minutes re‐equilibrating with 100% eluent A (100 mM NaOH). The 
activity  was  calculated  by  the  amount  of  cellobiose  being  hydrolyzed.  Triple 
determinations were performed. 
2.9 pH and temperature profile 
For  testing  the  thermostability  of  the  enzyme  extract,  aliquots  of  the 
extracts  were  incubated  in  PCR  tubes  in  a  thermocycler  with  temperature 
gradient  option  at  12  different  temperatures  from  48.5  to  67.0°C  for  different 
time  periods  (0‐4  hours)  followed  by  assaying  the  activity  at  50°C  with  5  mM 
pNPG in Na‐Citrate buffer pH 4.8 as substrate. The rate of denaturation, kD, was 
calculated  as  the  slope  of  a  semi‐logaritmic  plot  of  remaining  activity  vs. 
incubation time. The half life was calculated as: T½ = ln(2)/kD. 
For  testing  the  pH  optimum  of  the  enzyme  extracts,  they  were  assayed  at 
50°C  with  5  mM  pNPG  in  Citrate Phosphate  buffer at  different  pH  ranging from 
2.65  to  7.25.  Endoglucanase  activity  of  Celluclast  1.5L  was  assayed  with  AZO‐
CMC  as  described  by  the  manufacturer  (Megazyme),  testing  the  same  pH  range 
2.65‐7.25 as for the pNPG assay. 
2.10 Hydrolysis of cellodextrins 
Hydrolysis  of  cellohexaose  was  carried  out  by  mixing,  in  the  ratio  1:1,  0.2 
mM  cellohexaose  in  50  mM  NaCitrate  buffer  pH  4.8  and  enzyme  diluted  in  50 
mM  NaCitrate  buffer  pH  4.8  to  a  concentration  of  3.7  µg/ml.  The  reaction  was 
incubated at 50°C and for a  period of  30  minutes,  100  µl  sample  was  placed on 
ice every 5 minutes. 100 µl 200 mM NaOH was added to terminate the reaction, 
and after another 1 fold dilution with 100 mM NaOH, the samples were analyzed 
at  Dionex  ICS3000  using  gradient  elution:  0‐30%  eluent  B  in  26  minutes 
followed by 2 minutes washing with 50% eluent B (0.5 M Na‐Acetate in 100 mM 
NaOH) and 5 minutes re‐equilibrating with 100% eluent A (100 mM NaOH). 
2.11 Hydrolysis of pretreated bagasse 
Pretreated  bagasse  was  kindly  provided  by  BioGasol  ApS,  Denmark.  The 
bagasse was pretreated using a steam explosion method with addition of oxygen 
(pers.  comm.  with  BioGasol  ApS).  Bagasse  hydrolysis  was  carried  out  in  2  ml 
Eppendorf  tubes  in  thermoshaker  heating  blocks.  The  pretreated  bagasse  was 
hydrolyzed  at  5%  dry  matter  (DM)  with  a  total  enzyme  load  of  10  mg  protein 
per  g  DM.  The  ratio  amount  of  Celluclast  1.5L  vs.  extract  from  strain  AP  or 
Novozym  188  was  varied,  ranging  0‐100%  of  one  compared  to  the  other.  The 
hydrolysis was carried out at 50°C for 24 hours, using triple determinations. The 
samples  were  centrifuged  and  supernatants  filtered  through  0.45  µm  filters 
before sugar analysis using the Ultimate 3000 HPLC (see below). 
2.12 Analytical equipment 
Dionex  ICS3000  equipped  with  an  amperometric  detector  using  a  gold 
working  electrode  and  an  Ag/AgCl  pH  reference  electrode  was  used  for 
measuring  glucose,  cellobiose,  and  cellodextrins  by  ion  exchange 
chromatography, acquiring and interpreting data with the Chromeleon software 
(Dionex).  10  µl  samples  were  run  on  a  CarboPac  PA1  column  with  100  mM 
NaOH  as eluent  A and  0.5  M Na‐Acetate  in  100 mM  NaOH  as eluent B.  Gradient 
runs  were  performed as  described  in the different assays, all at a flow  rate of  1 
ml/min.  Standards  of  glucose,  cellobiose,  ‐triose,  ‐tetraose,  ‐pentaose,  and  –
hexaose were run at concentrations 3.125 µM ‐ 0.1 mM. 
Ultimate 3000 HPLC equipped with RI‐101 detector (Shodex) was used for 
measuring  glucose  and  cellobiose  by  high  pressure  liquid  chromatography, 
acquiring  and  interpreting  data  with  the  Chromeleon  software  (Dionex).  10  µl 
samples  were  run  on  a  BIORAD  aminex  HPX‐87H  ion  exclusion  column,  heated 
to  60°C,  run  with  4  mM  H2SO4  as  eluent  at  flow  rate  0.6  ml/min.  Standards  of 
glucose and cellobiose were run at concentration 0.5‐20 g/l. 
 
   
 
Research paper II 
‐ II.4 ‐ 
 
   
1
Identification method: M=morphology, ITS=ITS and NCBI blast search, UP‐PCR= PCR finger printing 
2
Where names are found instead of reference numbers, the fungal strains have not previously been published, but identified by the person specified.  
Prof. Krystyna Tylkowska, August Cheszkowski Agricultural University of Poznan, Poland  
Thomas Sundelin, University of Copenhagen, DK 
Inge Weiergang, Maribo Seed, Nordzucker AG 
Table 1. Fungi included in the beta‐glucosidase screening 
Identity (strain number)  ID method
1
Origin  Reference
2
Alternaria radicina (R27)  M Poland  K. Tylkowska
A. radicina (R28)  M Poland  K. Tylkowska
Alternaria sp.(AS1‐2)  ITS Jamaica  This work
Amorphothea resinae (Anja)  ITS Denmark  This work
Aspergillus sp (AP)  ITS Denmark  This work
Aspergillus sp. (1259)  M Costa Rica  [4]
A. fumigates (AS3‐1)  ITS Jamaica  This work
A. fumigatus (AS11‐2)  ITS Jamaica  This work
A. fumigatus (AS11‐3)  ITS Jamaica  This work
A. fumigatus (AS12)  ITS Jamaica  This work
A. fumigatus (AS2‐1)  ITS Jamaica  This work
A. fumigatus (AS2‐3)  ITS Jamaica  This work
A. fumigatus (AS9‐7)  ITS Jamaica  This work
A. fumigatus (AS11‐4)  ITS Jamaica  This work
A. niger (Hj1)  ITS Denmark  This work 
A. niger (IBT25747)  ITS Not known  This work
A. terreus (AS4‐1)  ITS Jamaica  This work
A. terreus (AS9‐2)  ITS Jamaica  This work
Chaetomium aureum (1165)  M Costa Rica  [4]
C. globosum (11.4kont)  ITS Denmark  This work
Cladosporium sp.(1160)  M Costa Rica  [4]
Cladosporium sp.(1209)  M Costa Rica  [4]
Cladosporium sp. (1195)  M Costa Rica  [4]
Cladosporium sp. (1208)  M Costa Rica  [4]
C. cladosporioides(2.1)  ITS Denmark  This work
Clonostachys rosea (IBT9371)  M, UP‐PCR  Denmark  [5]
C. rosea (Gr3)  M, UP‐PCR  Denmark  [5]
C. rosea (Gr5)  M, UP‐PCR  Denmark  [5]
Colletotrichum acutatum (9955)  ITS Denmark  T. Sundelin
C. acutatum (F5‐3)  ITS Costa Rica  [6]
C. acutatum (F7‐1)  ITS Costa Rica  [6]
C. acutatum (Lupin1A)  ITS Not known  T. Sundelin
C. acutatum (SA2‐2)  ITS Denmark  [7]
C. gloeosporioides (2133A)  ITS Denmark  T. Sundelin
Coprinopsis cinerea (AS2‐2)  ITS Jamaica  This work
Dreshlera sp. (1178)  M Costa Rica  [4]
Fusarium sp. (3.012)  M Denmark  I. Weiergang 
Fusarium sp. (3.015)  M Denmark  I. Weiergang
F. avenaceum/trincinctum (1.8.1)  ITS Denmark  This work
F. culmorum (IBT9615)  M Norway  [8]
F. equiseti (1236)  M Costa Rica  [4]
F. graminearum (1237)  M Costa Rica  [4]
F. graminearum (NRRL31084)  M USA  [8]
 
Table 1. continued
 
 
 
Identity (strain number) ID method
1
Origin  Reference
2
F. graminearum (IBT9203) M  Costa Rica [8]
F. moniliforme (1247) M  Costa Rica [4]
F. moniliforme (1258) M  Costa Rica [4]
F. oxysporum (1244) M  Costa Rica [4]
F. oxysporum f.sp. pisi (88.001) M  Denmark I. Weiergang
F. semitectum (1232) M  Costa Rica [4]
F. semitectum (1242) M  Costa Rica [4]
Nigrospora sp. (1168) M  Costa Rica [4]
Penicillium sp. (1219) M  Costa Rica [4]
P. chrysogenum or P. commune (11.5) ITS  Denmark This work
P. chrysogenum or P. commune (2.3A) ITS  Denmark This work
P. paneum (14) ITS  Denmark This work
P. paneum (2.8) ITS  Denmark This work
P. spinolosum (1.6) ITS  Denmark This work
P. spinolosum (2.3B) ITS  Denmark This work
P. spinolosum (9.3.2) ITS  Denmark This work
P. spinolosum (9.4.2) ITS  Denmark This work
P. swiecickii or P. raistrickii (11.4) ITS  Denmark This work
Pestalotiopsis sp. (1220) M  Costa Rica [4]
Pestalotiopsis sp. (1226) M  Costa Rica [4]
Rhizoctonia solani (CS96) M, UP‐PCR  Japan  [9]
R. solani (ST‐11‐6) M, UP‐PCR  Japan  [9]
R. solani (AH‐1) M, UP‐PCR  Japan  [9]
R. solani (RH165) M  Japan  [9]
R. solani (GM10) M, UP‐PCR  Japan  [9]
Binuclear Rhizoctonia (S21) M  USA  [9]
Binuclear Rhizoctonia (SN‐1‐2) M  Japan  [9]
Rhizopus microsporum(AS1‐1A) ITS  Jamaica  This work
R. microsporum (AS1‐1B) ITS  Jamaica  This work
R. microsporum (AS2‐4) ITS  Jamaica  This work
Spaeropsidales (1190) M  Costa Rica [4]
Stenocarpella sp. (1198) M  Costa Rica [4]
Stenocarpella sp. (1214) M  Costa Rica [4]
Stenocarpella sp. (1239) M  Costa Rica [4]
Thielavia sp. (AS11‐1) ITS  Jamaica  This work
Trichoderma harzianum (5.1) ITS  Denmark This work
T. harzianum (O7) M  Costa Rica [4]
T. harzianum (IBT9385) M, UP‐PCR  Sweden  [5]
T. koningii (1211) M  Costa Rica [4]
T. koningii (CBS850.68) M, UP‐PCR  Germany [5]
T. virens (I10) ITS  Italy  [10]
T. viride (IBT8186) M, UP‐PCR  Denmark [5]
T. viridescens (7.1) ITS  Denmark This work
 
 
Research paper II 
‐ II.5 ‐ 
 
3. Results 
3.1 Beta‐glucosidase activities in broad screening 
Eighty six filamentous fungal strains, covering 19 different 
fungal  genera,  mainly  belonging  to  the  Ascomycota  phylum, 
were screened for extracellular beta‐glucosidase activity using 
pNPG  as  substrate  (Table  1).  The  screening  showed  a  great 
variety  in  activity  levels,  with  a  few  strains  showing  
remarkably better   results  (Fig. 1). All produced extracellular 
beta‐glucosidase,  though  for  about  35%  of  the  assayed  fungi 
the  activity  was  negligible  (<0.1  U/ml).    Some  genus 
tendencies  were  found,  with  Aspergillus,  a  few  Fusarium, 
Penicillium,  and  Trichoderma  showing  greatest  beta‐
glucosidase  activity  at  the  assayed  conditions.  Where  several 
strains  belonging  to  same  species  were  assayed,  the  variation 
at  species  level  was  in  most  cases  insignificant,  except  for  A. 
niger  where  a  great  variation  was  observed  within  the  two 
strains,  the  stain  Hj1  showing  approximately  two  times  the 
activity of strain F1. 
Strain  AP  (identified  as  an  Aspergillus  sp.)  and  strain  Hj1 
(identified as an A. niger) showed significantly greater activity 
than  all  other  strains  assayed  at  these  conditions,  with  strain 
AP  reaching  more  than  ten  times  greater  activity  than  the 
average of all the stains assayed. 
3.2  Identity  of  the  prominent  beta‐glucosidase  producing 
Aspergillus sp. 
Primers matching the conserved 18S and 5.8S rRNA genes 
were used for the amplification of the non‐coding ITS1 region. 
The  best  hits  obtained  in  a  GenBank  NCBI  nucleotide  blast  of 
the  ITS1  sequence  of  strain  AP  were  different black  aspergilli. 
These  best  hits,  together  with  other  selected  aspergilli  in  the 
section  Nigri  based  on  the  work  by  Samson  et  al.  [15],  were 
used  to  prepare  a  phylogenetic  tree  (Fig.  2B).  Strain  AP 
showed  to  be  phylogenetically  placed  on  its  own  branch  far 
from  the  other  aspergilli,  almost  as  far  from  them  as  the 
outgroup  Talaromyces  emersonii.  The  percentage  identity  of 
strain AP ITS1 sequence compared to selected aspergilli in the 
tree  confirm  that  strain  AP  is  significantly  different  from  the 
others  (Fig.  2A).  This,  and  the  location  of  strain  AP  on  a 
separate  branch  in  the  phylogenetic  tree,  indicated  that  the 
strain AP might belong to an unknown species.   
 
 
Fig. 1 Extracellular beta‐glucosidase activity of screened fungi grown in simple submerged fermentaion. pNPG was used as substrate in the assays, with one unit (U) 
of enzyme activity defined as the amount of enzyme needed to hydrolyze 1umol pNPG in 1 minute. 
0
1
2
3
4
5
6
A
lte
r
n
a
r
ia
 r
a
d
ic
in
a
 (R
2
7
)
A
. r
a
d
ic
in
a
 (R
2
8
)
A
lt
e
r
n
a
r
ia
 s
p
.(A
S
1
‐2
)
A
m
o
r
p
h
o
th
e
a
 r
e
s
in
a
e
 (A
n
ja
)
A
s
p
e
r
g
illu
s
 s
p
 (A
P
)
A
s
p
e
r
g
illu
s
 s
p
. (1
2
5
9
)
A
. fu
m
ig
a
te
s
 (A
S
3
‐1
)
A
. fu
m
ig
a
tu
s
 (A
S
1
1
‐2
)
A
. fu
m
ig
a
tu
s
 (A
S
1
1
‐3
)
A
. fu
m
ig
a
t
u
s
 (A
S
1
2
)
A
. fu
m
ig
a
tu
s
 (A
S
2
‐1
)
A
. fu
m
ig
a
tu
s
 (A
S
2
‐3
)
A
. fu
m
ig
a
tu
s
 (A
S
9
‐7
)
A
. fu
m
ig
a
tu
s
 (A
S
1
1
‐4
)
A
. n
ig
e
r
 (H
j1
)
A
. n
ig
e
r
 (IB
T
2
5
7
4
7
)
A
. t
e
r
r
e
u
s
 (A
S
4
‐1
)
A
. t
e
r
r
e
u
s
 (A
S
9
‐2
)
C
h
a
e
t
o
m
iu
m
 a
u
r
e
u
m
(1
1
6
5
)
C
. g
lo
b
o
s
u
m
(1
1
.4
k
o
n
t
)
C
la
d
o
s
p
o
r
iu
m
 s
p
.(1
1
6
0
)
C
la
d
o
s
p
o
r
iu
m
 s
p
. (1
1
9
5
)
C
la
d
o
s
p
o
r
iu
m
 s
p
. (1
2
0
8
)
C
la
d
o
s
p
o
r
iu
m
 s
p
.(1
2
0
9
)
C
. c
la
d
o
s
p
o
r
io
id
e
s
(2
.1
)
C
lo
n
o
s
t
a
c
h
y
s
 r
o
s
e
a
 (IB
T
9
3
7
1
)
C
. r
o
s
e
a
 (G
r
3
)
C
. r
o
s
e
a
 (G
r
5
)
C
o
lle
to
t
r
ic
h
u
m
 a
c
u
t
a
tu
m
 (9
9
5
5
)
C
. a
c
u
t
a
tu
m
 (F
5
‐3
)
C
. a
c
u
t
a
tu
m
 (F
7
‐1
)
C
. a
c
u
ta
t
u
m
 (L
u
p
in
1
A
)
C
. a
c
u
ta
t
u
m
 (S
A
2
‐2
)
C
. g
lo
e
o
s
p
o
r
io
id
e
s
 (2
1
3
3
A
)
C
o
p
r
in
o
p
s
is
 c
in
e
r
e
a
 (A
S
2
‐2
)
D
r
e
s
h
le
r
a
 s
p
. (1
1
7
8
)
F
u
s
a
r
iu
m
 s
p
. (3
.0
1
2
)
F
u
s
a
r
iu
m
 s
p
. (3
.0
1
5
)
F
. a
v
e
n
a
c
e
u
m
/
tr
in
c
in
c
t
u
m
 (1
.8
.1
)
F
. c
u
lm
o
r
u
m
 (IB
T
9
6
1
5
)
F
. e
q
u
is
e
ti (1
2
3
6
)
F
. g
r
a
m
in
e
a
r
u
m
 (1
2
3
7
)
F
. g
r
a
m
in
e
a
r
u
m
 (N
R
R
L
3
1
0
8
4
)
F
. g
r
a
m
in
e
a
r
u
m
 (IB
T
9
2
0
3
)
F
. m
o
n
ilifo
r
m
e
 (1
2
4
7
)
F
. m
o
n
ilifo
r
m
e
 (1
2
5
8
)
F
. o
x
y
s
p
o
r
u
m
 (1
2
4
4
)
F
. o
x
y
s
p
o
r
u
m
 f.s
p
. p
is
i (8
8
.0
0
1
)
F
. s
e
m
ite
c
t
u
m
 (1
2
3
2
)
F
. s
e
m
ite
c
t
u
m
 (1
2
4
2
)
N
ig
r
o
s
p
o
r
a
 s
p
. (1
1
6
8
)
P
e
n
ic
illiu
m
 s
p
. (1
2
1
9
)
P
. c
h
r
y
s
o
g
e
n
u
m
 o
r
 P
. c
o
m
m
u
n
e
 (1
1
.5
)
P
. c
h
r
y
s
o
g
e
n
u
m
 o
r
 P
. c
o
m
m
u
n
e
 (2
.3
A
)
P
.  p
a
n
e
u
m
 (1
4
)
P
. p
a
n
e
u
m
 (2
.8
)
P
. s
p
in
o
lo
s
u
m
 (1
.6
)
P
. s
p
in
o
lo
s
u
m
 (2
.3
B
)
P
. s
p
in
o
lo
s
u
m
 (9
.3
.2
)
P
. s
p
in
o
lo
s
u
m
 (9
.4
.2
)
P
. s
w
ie
c
ic
k
ii o
r
 P
. r
a
is
t
r
ic
k
ii (1
1
.4
)
P
e
s
t
a
lo
tio
p
s
is
 s
p
. (1
2
2
0
)
P
e
s
t
a
lo
tio
p
s
is
 s
p
. (1
2
2
6
)
R
h
iz
o
c
to
n
ia
 s
o
la
n
i (C
S
9
6
)
R
. s
o
la
n
i (S
T
‐1
1
‐6
)
R
. s
o
la
n
i (A
H
‐1
)
R
. s
o
la
n
i (R
H
1
6
5
)
R
. s
o
la
n
i (G
M
1
0
)
B
in
u
c
le
a
r
 R
h
iz
o
c
to
n
ia
 (S
2
1
)
B
in
u
c
le
a
r
 R
h
iz
o
c
to
n
ia
 (S
N
‐1
‐2
)
R
h
iz
o
p
u
s
 m
ic
r
o
s
p
o
r
u
m
 (A
S
1
‐ 1
A
)
R
. m
ic
r
o
s
p
o
r
u
m
 (A
S
1
‐1
B
)
R
. m
ic
r
o
s
p
o
r
u
m
 (A
S
2
‐4
)
S
p
a
e
r
o
p
s
id
a
le
s
 (1
1
9
0
)
S
te
n
o
c
a
r
p
e
lla
 s
p
. (1
1
9
8
)
S
te
n
o
c
a
r
p
e
lla
 s
p
. (1
2
1
4
)
S
te
n
o
c
a
r
p
e
lla
 s
p
. (1
2
3
9
)
T
h
ie
la
v
ia
 s
p
. (A
S
1
1
‐1
)
T
r
ic
h
o
d
e
r
m
a
 h
a
r
z
ia
n
u
m
 (5
.1
)
T
. h
a
r
z
ia
n
u
m
 (O
7
)
T
. h
a
r
z
ia
n
u
m
 (IB
T
9
3
8
5
)
T
. k
o
n
in
g
ii (1
2
1
1
)
T
. k
o
n
in
g
ii (C
B
S
8
5
0
.6
8
)
T
. v
ir
e
n
s
 (I1
0
)
T
. v
ir
id
e
 (IB
T
8
1
8
6
)
T
. v
ir
id
e
s
c
e
n
s
 (7
.1
)
U/ml
 
Research paper II 
‐ II.6 ‐ 
 
3.3 Aspergillus screening 
The  beta‐glucosidase  activity  of  the  prominent  Aspergillus 
sp.  (strain  AP)  was  compared  to  neighbor  aspergilli  in  the 
submerged  fermentation  set  up  using  wheat  bran  as  growth 
medium as described in the screening. A. niger was specifically 
included as this fungus is a known and industrially used beta‐
glucosidase  producer  [22].  A.  niger  data  is  placed  as  the 
column  furthest  from  strain  AP  as  it  is  the  most  distantly 
related  strain  in  this  Aspergillus  screening.  At  the  conditions 
tested,  AP  produces  significantly  greater  amount  of  beta‐
glucosidase  activity  (Fig.  3).  The  protein  levels  (data  not 
shown) in the assayed extracts did not vary much compared to 
the  difference  seen  in  enzyme  activity.  Relative  to  the  other 
aspergilli  tested,  strain  AP  is  therefore  more  specialized 
towards beta‐glucosidase productions at the tested conditions. 
3.4  Potential  of  strain  AP  enzyme  extract  compared  with 
commercial enzymes 
A  solid  state  fermentation  extract  of  the  strain  AP  was 
compared  to  the  commercially  available  Novozym  188, 
Celluclast  1.5L,  and  Cellic  CTec  (Novozymes  AS,  Denmark). 
Solid state fermentation was chosen to obtain as concentrated 
an extract as possible. In the previous screening, pNPG activity 
of  6.6  U/ml  (Fig.  3)  and  specific  activity  of  3.1  U/mg  total 
protein  (data  not  shown)  were  obtained  for  the  submerged 
fermentation of strain AP. With the solid state fermentation, a 
pNPG  activity  of  105  U/ml  and  a  specific  activity  of  5.7  U/mg 
total  protein  were  obtained.  The  volume  based  activity  is 
naturally  increased  as  the  water  content  of  solid  state  is 
severely  reduced  compared  to  submerged  fermentation. 
However,  there  is  no  definite  conclusion  to  whether  the 
difference in specific activity (U/mg protein) is due to the solid 
state fermentation favoring the expression of specifically beta‐
glucosidase proteins. 
As  the  enzyme  extract  of  strain  AP  is  intended  for  use  in 
combination  with  Celluclast  1.5L  for  complete  hydrolysis  of 
cellulosic  biomasses,  the  working  pH  must  match  the  pH 
profile  of  Celluclast  1.5L  cellulase  activity.  Within  pH  4.5‐6 
Celluclast  1.5L  activity  stays  above  90%  of  maximum  activity 
measured  (Fig.  4).  The  pH  span  of  strain  AP  beta‐glucosidase 
was  examined  using  pNPG  as  substrate.  Its  profile  is  very 
similar to Novozym 188, with an optimum around pH 4.2 (Fig. 
4). Within the pH range 3.8‐4.8 the activity stays above 85% of 
maximum.  pH  4.8  generally  used  in  hydrolysis  experiments 
with  Celluclast  1.5L  and  Novozym  188  is  therefore  also  valid 
for hydrolysis with AP extract beta‐glucosidases. 
Enzyme  kinetics  are  preferably  carried  out  on  pure 
enzyme  preparations,  but  were  in  this  study  used  for  the 
comparison  of  the  beta‐glucosidases  of  the  crude  enzyme 
 
 
 
Fig.  2.  Neighbor‐joining  phylogenetic  tree  (bottom)  and  homology  matrix 
(top)  of  ITS1  region  sequence  data  of  black  aspergilli,  including  strain  AP, 
using  T.  emersonii  as  out  group.  Numbers  above  the  branches  in  tree  are 
bootstrap  values.  Bar,  0.02  substitutions  per  nucleotide.  Numbers  in  matrix 
are percentage identity between the ITS1 region of the different strains. 
 
 
Fig.  3.  Beta‐glucosidase  activity  of  extracts  from  selected  aspergilli  grown  in 
simple  submerged  fermentation  (*=type  strain).  One  unit  (U)  of  enzyme 
activity is defined as the amount of enzyme needed to hydrolyze 1umol pNPG 
in 1 minute. 
0
1
2
3
4
5
6
7
A
.
n
i
g
e
r
 
C
B
S
 
5
5
4
.
6
5
*
A
.
h
o
m
o
m
o
r
p
h
u
s
 
C
B
S
 
1
0
1
8
8
9
*
A
.
a
c
u
l
e
a
t
i
n
u
s
 
C
B
S
 
1
2
1
0
6
0
*
A
.
a
c
u
l
e
a
t
u
s
 
C
B
S
 
1
7
2
.
6
6
*
A
.
u
v
a
r
u
m
 
C
B
S
 
1
2
1
5
9
1
*
A
,
j
a
p
o
n
i
c
u
s
 
C
B
S
 
1
1
4
.
5
1
*
S
t
r
a
i
n
 
A
P
U
/
m
l
 
Research paper II 
‐ II.7 ‐ 
 
extract  of  strain  AP  and  the  commercially  available  enzyme 
preparations  Novozym  188  and  Cellic  CTec.  Any  parameter 
expressed  per  amount  of  protein  was  always  total  protein 
content  in  the  extract  or  commercial  enzyme  preparation, 
with  no  specific  knowledge  of  how  large  a  fraction  that  was 
beta‐glucosidase proteins.   
Kinetic  analysis  was  performed  on  both  pNPG  and 
cellobiose,  measuring  the  specific  activity  at  different 
substrate  concentrations.  By  plotting  reaction  rate  vs. 
substrate  concentration,  it  was  found  that  for  all  three 
samples,  strain  AP,  Novozym  188,  and  Cellic  CTec,  the 
hydrolysis of pNPG only followed MM kinetics at low substrate 
concentrations,  while  evidence  of  substrate  inhibition  or 
transglycosylation  was  found  at  higher  concentrations,  seen 
by  a  decrease  in  reaction  rate  with  increased  substrate 
concentration (data no shown). With regards to cellobiose, no 
substrate  inhibition  was  observed  within  the  substrate 
concentrations  tested.  The  MM  kinetics  parameters,  Vmax  and 
KM,  were  therefore  only  determined  for  cellobiose.  The 
enzyme  extract  from  strain  AP  and  the  commercial 
preparation  Novozym  188  had  similar  affinity  for  cellobiose 
and values being slightly better than Cellic CTec (Table 2), the 
lower  the  KM  values  the  better  the  affinity.  The  maximum 
activity,  Vmax,  was,  however,  highest  for  Cellic  CTec,  but  with 
strain AP being significantly better than Novozym 188.  
Product  inhibition  was  found  to  be  substrate  dependent, 
especially for strain AP beta‐glucosidases (Fig. 5). Using pNPG 
as  substrate,  the  beta‐glucosidase  activity  of  strain  AP 
remained  greater  than  80%  at  product  concentrations  12 
times higher than the substrate concentration. Cellic CTec was 
slightly  lower  (approx  75%),  while  the  activity  of  Novozym 
188  at  this  product‐substrate ratio  had  dropped  to  just  below 
40%. The activities of strain AP, Cellic CTec, and Novozym 188 
was  calculated  to  reach  half  the  maximum  activity  at 
concentrations  180,  115,  and  60  mM  glucose  (equal  to  36x, 
23x,  and  12x  the  substrate  concentration),  respectively.  With 
regards  to  cellobiose,  an  activity  drop  to  around  80%  was 
found  for  both  strain  AP  and  Novozym  188  when  the  product 
and  substrate  occured  in  equal  concentrations.  Overall,  the 
profile  of  substrate  inhibition  was  identical  for  strain  AP  and 
Novozym  188  when  using  cellobiose  as  substrate,  while  with 
pNPG,  strain  AP  beta‐glucosidases  performed  much  better  at 
high  glucose  concentrations  than  Novozym  188.  This  glucose 
inhibition  study  demonstrated  the  importance  of  testing  the 
true substrate, cellobiose, and not just relying on pNPG data.  
          
Fig.  4.  pH  profile.  Beta‐glucosidase  activity  of  Strain  AP  and  Novoym  188  at 
different  pH  measured  on  pNPG.  Endoglucanase  activity  of  Celluclast  1.5L  at 
different pH measured on AZO‐CMC. 
0%
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
110%
2 3 4 5 6 7 8
A
c
t
i
v
i
t
y
 
a
s
 
%
 
o
f
 
m
a
x
pH
Stain AP
Novozym 188
Celluclast 1.5L
 
Table 2 Kinetic properties of strain AP, Novozym 188, and 
Cellic CTec with cellobiose as substrate for MM kinetics study. 
  Vmax (U/mg)  KM (mM) 
Strain AP  11.3 1.09 
Novozym 188  7.5  1.06 
Cellic CTec  22.9 1.69 
 
 
 
 
Fig.  5.  Product  inhibition;  remaining  beta‐glucosidase  activity  at  different 
inhibitor  (glucose)  concentrations  relative  to  activity  measured  without 
inhibitor.  A:  pNPG  as  substrate,  activity  measured  by  release  of  pNP.  B: 
cellobiose  as  substrate,  activity  measured  by  decrease  in  cellobiose 
concentration. 
 
0%
20%
40%
60%
80%
100%
0 20 40 60 80 100 120 140
R
e
m
a
i
n
i
n
g
 
a
c
t
i
v
i
t
y
Glucose concentration (mM)
(A) 5mM pNPG substrate
Strain AP
Novozym 188
Cellic
0%
20%
40%
60%
80%
100%
0 20 40 60 80
R
e
m
a
i
n
i
n
g
 
a
c
t
i
v
i
t
y
Glucose concentration (mM)
(B) 20 mM cellobiose substrate
Strain AP
Novozym 188
 
Research paper II 
‐ II.8 ‐ 
 
The  thermostability  of  the  enzymes  was  examined  at 
temperatures  ranging  from  48.5  to  67.0°C  using  pNPG  as 
substrate. At temperatures up to 58°C there was no significant 
difference  between  strain  AP  and  Novozym  188  in  terms  of 
stability;  both  were  fairly  stable  throughout  the  four  hours  of 
incubation  (data  not  shown).  Meanwhile,  the  beta‐
glucosidases  of  Cellic  CTec  were  much  more  sensitive  to 
temperature increases. At temperatures ≥60°C, strain AP beta‐
glucosidases were clearly more stable than Novozym 188, and 
Cellic  CTec  was  showing  a  lack  of  performance  as  it  was 
severely inactivated even within the first half hour (Fig. 6A‐C). 
At  60.7°C,  65%  of  the  activity  remained  for  strain  AP  beta‐
glucosidases  after  4  hours  of  incubation,  while  only  33% 
activity  remained  for  Novozym  188.  The  inactivation  roughly 
followed  first  order  kinetics,  with  the  rate  constants  of 
denaturation,  kD,  defined  by  the  slopes  of  the  lines  in  a  semi‐
logaritmic  plot  of  the  remaining  activity  vs.  time  for  the 
different temperatures, and the half‐life was calculated as T½ = 
ln(2)/kD.  The  calculated  half‐life  of  strain  AP  at  60.7°C  was 
440  min  vs.  180  min  for  Novozym  188.  To  reach  a  half‐life  of 
180 min for Cellic CTec, the temperature should be lowered to 
around  the  tested  55.8°C, while for  strain  AP  the  temperature 
should  be  raised  to  around  the  tested  62.9°C  (Fig.  6A‐C).    The 
calculated  half‐lives  at  different  temperatures  were  plotted  in 
a semi‐logarithmic plot vs. temperature (Fig. 6D). The data for 
each enzyme preparation form a straight line, and the thermal 
activity  number,  the  temperature  that  gave  a  half‐life  of  1 
hour,  was  66.8°C,  63.4°C,  and  58.9°C  for  strain  AP,  Novozym 
188, and Cellic CTec, respectively. 
Cellodextrins  were  used  to  make  a  hydrolytic  time  course 
study  of  strain  AP  extract,  Novozym  188,  Celluclast  1.5L,  and 
Cellic  CTec  (Fig.  7).  Strain  AP  enzyme  extract  showed  clear 
exo‐activity,  with  a  cellopentaose  and  glucose  concentration 
increase  as  the  cellohexaose  concentration  decreased.  Less 
rapidly,  the  cellotetraose  and  cellotriose  concentrations 
increased  too.  Evidence  of  endo‐activity  or  cellobiohydrolase 
activity  was  found,  as  the  cellobiose  concentration  went  up 
relatively  fast  compared  to  the  cellotetraose  and  cellotriose. 
On  the  contrary,  Novozym  188  only  showd  beta‐glucosidase 
exo‐activity,  with  the  only  significant  change  over  time  being 
glucose  and  cellopentaose  increase  as  cellohexaose  decrease. 
The  results  suggested  that  the  beta‐glucosidases  act  by 
capturing  the  substrate,  cleave  the  glycosidic  bond,  and 
release  the  products.  They  do  not  continuously  cleave  one 
bond  after  another  upon  capturing  the  substrate.  Celluclast 
1.5L  mainly  possess  cellobiohydrolase  and  endoglucanase 
activity,  seen  by  the  immediate  increase  in  cellobiose  and 
cellotriose,  and  lacking  sufficient  beta‐glucosidase  activity  as 
the  glucose  concentration  did  not  increase,  but  the  cellobiose 
concentration increases continually. As the only sample, Cellic 
CTec  showed  continuously  increase  in  both  cellobiose  and 
glucose,  indicating  a  combination  of  cellobiohydrolase  and 
beta‐glucosidase  activity.  Endoglucanase  activity  was  most 
likely present too, identified by the formation of cellotriose. 
Pretreated  bagasse  was  hydrolyzed  by  strain  AP  beta‐
glucosidases  combined  with  Celluclast  1.5L  to  investigate  its 
capabilities  on  a  lignocellulosic  substrate.  This  was  compared 
with  hydrolysis  data  of  Novozym  188  and  Celluclast  1.5L. 
Strain  AP  beta‐glucosidases  and  Novozym  188  beta‐
glucosidases  are  compared  on  total  protein  amount  basis.    A 
dosage‐response  plot  of  hydrolysis  of  5%  DM  pretreated 
bagasse showed a leveling off in glucose yields at total enzyme 
dosages  greater  than  10mg/gDM  (data  not  shown).  This  total 
enzyme  dosage  was  used  for  optimal  enzyme  ratio 
     
Fig.  6.  (A),  (B),  and  (C):  Time  course  of  thermal  inactivation  of  the  beta‐glucosidases  of  (A)  strain  AP,  (B)  Novozym  188,  and  (C)  Cellic  CTec.  Thermostability  is 
evaluated based on the remaining activity after 0‐4 hours of incubation at different temperatures relative to the activity without incubation. (D) Semi‐logarithmic plot 
of calculated half life at different temperatures.  The x‐axis intercept indicates the thermal activity number, temperature at which the half life is one hour.
0%
20%
40%
60%
80%
100%
0 1 2 3 4
%
 
a
c
t
i
v
i
t
y
 
r
e
m
a
i
n
i
n
g
Incubation time (h)
(A) Strain AP
58.2°C
60.7°C
62.9°C
64.8°C
66.3°C
67.0°C
0%
20%
40%
60%
80%
100%
0 1 2 3 4
%
 
a
c
t
i
v
i
t
y
 
r
e
m
a
i
n
i
n
g
Incubation time (h)
(B) Novozym 188
58.2°C
60.7°C
62.9°C
64.8°C
66.3°C
67.0°C
0%
20%
40%
60%
80%
100%
0 1 2 3 4
%
 
a
c
t
i
v
i
t
y
 
r
e
m
a
i
n
i
n
g
Incubation time (h)
(C) Cellic CTec
53.4°C
55.8°C
58.2°C
60.7°C
62.9°C
‐3
‐2
‐1
0
1
2
3
4
52 56 60 64 68
l
n
(
T
½
)
Temperature (°C)
(D)
Strain AP
Novozym 188
Cellic CTec
 
Research paper II 
‐ II.9 ‐ 
 
determination;  the  ratio  of  Celluclast  1.5L  and  Strain  AP 
extract  or  Novozym  188.  The  greatest  yields  were  found  with 
approximately  20%  Novozym  188  (80%  Celluclast  1.5L)  and 
15% strain AP extract (85% Celluclast 1.5L) (Fig. 8). Generally, 
the  glucose  yields  were  higher  when  using  strain  AP  extract 
compared  with  Novozym  188,  illustrating  the  possibility  of 
substituting  the  commercial  enzyme  preparation  with  an 
extract  from  our  newly  isolated  Aspergillus  strain  AP.  These 
results  for  bagasse  hydrolysis  correlated  well  with  the  fact 
that  the  beta‐glucosidases  of  strain  AP  extract  had  a  higher 
reaction  rate  on  cellobiose  (Vmax,  Table  2)  compared  to 
Novozym 188. 
 
4. Discussion 
Traditionally,  two  commonly  used  enzyme  preparations 
that  supplement  each  other  in  the  hydrolysis  of  cellulosic 
biomasses  are  Novozym  188  and  Celluclast  1.5L  (Novozymes 
A/S),  contributing  with  beta‐glucosidase  activity,  and 
endoglucanase  and  cellobiohydrolase  activity,  respectively 
[23].    Recently,  an  enzyme  preparation  containing  all  three 
components  has  been  released  into  the  market,  Cellic  CTec 
(Novozymes  AS,  Denmark).  Costs  related  to  enzymatic 
hydrolysis  make  this  step  a  bottle  neck  in  the  process  of 
creating  a  sugar  plat  form  for  biofuels,  chemicals,  and 
pharmaceuticals;  therefore  there  is  a  need  for  more  efficient 
enzymes,  both  in  terms  of  reaction  rates  and  stability  [23]. 
Beta‐glucosidases  are  widely  distributed  in  nature,  with 
especially  fungi  known  to  be  industrial  producers  of  these 
enzymes  for  cellulose  hydrolysis.  In  this  study,  we  present  a 
prominent  fungal  beta‐glucosidase  producer  naturally 
producing  an  enzyme  cocktail  with  better  beta‐glucosidases 
compared  to  the  commercial  preparation  Novozym  188  and 
markedly  better  thermostabily  than  the  commercial  beta‐
glucosidase  containing  preparations,  Novozym  188  and  Cellic 
CTec. 
The present  work included  a  broad  screening  of 87  fungal 
strains collected from soil and decaying wood samples as well 
as  was  from  an  in  house  collection  of  fungi  kindly  donated  by 
various  scientists.  To  our  knowledge,  there  are  not  many 
examples on screening of  fungal strains belonging to different 
species  for  beta‐glucosidase  activity.  Sternberg  et  al.  [3] 
screened  200  fungal  strains,  thus  found  beta‐glucosidase  that 
 
Fig. 7. Hydrolysis af cellohexaose by Strain AP extract, Novozym 188, Celluclast 1.5L, and Cellic CTec, showing a clear difference in the mode of action. G1=glucose, 
G2=cellobiose, G3=cellotriose, G4=cellotetraose, G5=cellopentaose, G6=cellohexaose. 
0
5
10
15
20
25
0 10 20 30
C
o
n
c
 
(
u
M
)
Time (min)
Strain AP
G1
G2
G3
G4
G5
G6
0
5
10
15
20
25
0 10 20 30
C
o
n
c
 
(
u
M
)
Time (min)
Novozym 188
0
5
10
15
20
25
30
35
40
0 10 20 30
C
o
n
c
 
(
u
M
)
Time (min)
Celluclast 1.5L
0
5
10
15
20
25
30
35
40
45
50
55
60
65
70
75
0 10 20 30
C
o
n
c
 
(
u
M
)
Time (min)
Cellic CTec
 
Fig.  8.  Hydrolysis  of  bagasse  using  different  enzyme  ratios  of  Strain  AP  or 
Novozym 188 relative to Celluclast 1.5L. 
 
Research paper II 
‐ II.10 ‐ 
 
could  supplement  the  Trichoderma  viride  cellulases  for 
cellulose  saccharification.  Generally,  in  accordance  with  or 
results,  black  Aspergilli  were  found  to  be  superior  in  terms  of 
beta‐glucosidase  production  [3].  Later,  a  study  focusing  on 
identification  of  acid‐  and  thermotolerant  extracellular  beta‐
glucosidase  activities  in  zygomycetes  fungi  was  carried  out 
where  Rhizomucor  miehei  performed  best  [24].  Screening  for 
general  cellulase  activities  have  included  beta‐glucosidase 
activities  in  a  few  cases  [25‐28],  and  other  strategies  for 
obtaining  beta‐glucosidases  have  been  employed  such  as 
screening  environmental  DNA  for  beta‐glucosidase  activity 
rather  than  collecting  microbial  samples  [29],  and  a 
proteomics  strategy  to  discover  beta‐glucosidases  from 
Aspergillus  fumigatus  has  been  reported  [30].  In  this  work, 
wheat  bran  was  used  as  substrate  in  a  submerged 
fermentation,  as  it  is  generally  known  as  a  good  substrate  for 
cellulase  and  beta‐glucosidase  production  [31,  32],  being  rich 
in  carbohydrates  and  protein  [33],  and  submerged 
fermentation  allows  for  easy  assaying  of  the  extracellular 
enzymes  of  the  fungi.  The  supernatants  were  tested  for  beta‐
glucosidase  activity  using  pNPG  at  50C  pH  4.8;  which  are 
optimal  conditions  for  Celluclast  1.5L,  thus  aiming  at  finding 
enzyme activities supplementing this enzyme preparation. 
It  was  found  that  especially  strains  from  the  genera 
Aspergillus,  Fusarium,  Penicillium,  and  Trichoderma  had  the 
highest  beta‐glucosidase  activity,  with  strains  of  Aspergillus 
being  the  best.  These  fungal  genera  have  also  been  found  in 
other  screening  programs  for  discovery  of  cellulolytic 
enzymes [26, 34]. Aspergilli in general have a high capacity for 
producing  and  secreting  extracellular  enzymes  [35,  36], 
especially  A.  niger,  with  all  classes  of  enzymes  essential  for 
cellulose  degradation  having  been  found  [36].  Within  the  A. 
fumigati  strains,  the  expression  levels  of  beta‐glucosidase  at 
the  tested  conditions  were  very  consistent,  while  great  strain 
variation was found in A. niger (Fig. 1). This variation was not 
surprising as it correlates well with publications on citric acid, 
antioxidant,  and  urease  production  in  A.  niger,  which  is  also 
very strain dependent [37‐39].  
Several  studies  have  been  published  on  the  kinetics  of 
Novozym  188  and  A.  niger  beta‐glucosidases,  and  it  is 
apparent that substrate affinity, KM, does vary amongst strains 
within  this  species  [31,  40‐42].  However,  most  common 
amongst  the  A.  niger  beta‐glucosidases  is  that  they  have 
greater  affinity  for  pNPG  than  for  cellobiose.  Jäger  et  al.  [31] 
report  similar  findings  for  other  Aspergillus  strain  beta‐
glucosidases.  We  have,  however,  chosen  to  only  calculate  MM 
kinetics  parameters  related  to  hydrolysis  of  cellobiose  as 
hydrolysis  data  of  pNPG  did  not  fit  the  MM  equation.  pNPG 
might  actually  be  a  poor  substitute  in  terms  of  assaying  for 
beta‐glucosidase  activity,  which  was  also  concluded  by  e.g. 
Khan et al. [43], and especially in this study it was additionally 
evident  in  relation  to  product  inhibition.  To  compare 
activities,  it  is  always  desired  to  perform  measurements  at 
substrate saturation; however, with pNPG the saturation point 
could  not  be  determined  as  substrate  inhibition  was  the 
dominating  factor  at  high  substrate  concentrations  which 
correlates  with  studies  carried  out  by  Dekker  [22]  and 
Eyzaguirre  et  al.  [41].  As  transglycosylation  activity  has  been 
reported in several cases for different beta‐glucosidases [44] it 
was speculated if the proposed substrate inhibition was rather 
a  transglycosylation  reaction  at  high  product  concentrations.  
However,  the  option  of  the  enzyme  carrying  out 
transglycosylation  by  coupling  the  glucose  product  to  a  new 
pNPG  at  high  pNPG  concentrations  was  not  investigated, 
which  could  potentially  mimic  substrate  inhibition  in  data 
evaluation.  The  effect  of  pNPG  substrate  inhibition  or 
transglycosylation  reaction  on  the  measured  reaction  rates  in 
the  beta‐glucosidase  screening  strategy  was  a  factor  that  was 
not taken into account.  
Product  inhibition  is  a  common  phenomenon  with  beta‐
glucosidases; glucose being the main inhibitor, which can have 
a  significant  influence  on  process  reaction  in  industrial 
applications  [23].  The  importance  of  testing  such  inhibitory 
effects  on  the  true  substrate,  cellobiose,  rather  than  the 
substitute,  pNPG,  was  demonstrated  in  this  study.  The  beta‐
glucosidases  of  strain  AP  compared  to  Novozym  188  only 
showed low inhibition by glucose using pNPG as substrate, but 
when  using  cellobiose,  the  inhibition  patterns  of  the  two 
enzyme preparations were similar, with the activities reaching 
only  50%  when  twice  the  concentration  of  glucose  is  present 
compared  to  cellobiose  concentration  (Fig.  5).  pNPG  is  an 
easy‐to‐use substrate,  but  can be misguiding in  terms of beta‐
glucosidase  performance  in  true  cellulosic  hydrolysis 
conditions. 
The  extract  of  strain  AP  showed  greater  specific  beta‐
glucosidase  activity  than  Novozym  188,  while  that  of  Cellic 
CTec  was  found  to  be  even  greater  (Table  2).  The  enzyme 
preparations  were  evaluated  on  basis  of  total  extracellular 
proteins,  which,  however,  also  comprise  proteins  originating 
from  the  growth  medium.  It  is  therefore  unknown  how  much 
of  the  measured  protein  is  actually  fungal  proteins. 
Furthermore  aspergilli  strains  are  known  to  possess  several 
beta‐glucosidases  that  can  have  different  relative  activities 
and specificities, e.g. three beta‐glucosidases from A. aculeatus 
have  been  assayed  with  the  findings  that  one  has  very  weak 
and  the  two  other  very  high  activities  towards  cellobiose 
relative  to  pNPG  [45].  The  beta‐glucosidase  activity  of  the 
screened extract is therefore very likely the combined activity 
of  several  beta‐glucosidases  of  the  strain  AP.  Without  further 
optimization,  the  specific  activity  of  the  solid  state 
fermentation  extract  of  strain  AP  was  able  to  compete  with 
Novozym  188  in  hydrolysis  of  cellobiose,  and  in  the  case  of 
 
Research paper II 
‐ II.11 ‐ 
 
cellohexaose the rate by which the cellohexaose concentration 
decreased  and  the  glucose  and  cellopentaose  increased  was 
greater for strain AP than Novozym 188. Increasing the degree 
of  complexity  and  potential  amount  of  inhibitors,  etc,  bagasse 
is  one  of  many  cellulose  containing  biomasses  of  interest  for 
bioethanol  purposes.  Bagasse  is  a  lignocellulosic  waste 
product  from  the  sugar  cane  industry  produced  in  great 
quantities in countries such as Brazil and other tropical places 
[46]. Its utilization for fuel production is value contributing to 
the  current  processes  [47].  Hydrolysis  of  bagasse  was  here 
used  to  show  that  our  enzyme  extract  from  strain  AP 
supplemented  with  Celluclast  (Fig.  8)  did  work  on  actual 
lignocellulosic  material  and  was  competitive  with  Novozym 
188.  
Thermostability  and  temperature  optima  presented  in 
different  publications  are  difficult  to  compare  as  the 
incubation  time,  reaction  time,  and  temperatures  tested  vary. 
Generally,  the  dependence  of  temperature  resembles  a  bell‐
shaped  curve,  with  a  maximum  where  the  enzyme  is  actually 
not at its optimum as the maximum indicates the beginning of 
the  irreversible  denaturation  process  [48].  This  method  of 
directly  assaying  at  different  temperatures  to  determine  the 
temperature  profile  is  of  no  real  use  in  terms  of  industrial 
hydrolysis  as  hydrolysis  reactions  are  usually  run  for  several 
hours  and  time  dependent  enzyme  degradation  will  play  a 
role.  By  pre‐incubating  the  enzymes  at  distinct  temperatures 
and  assaying  after  different  time  intervals  at  normal  assay 
temperatures,  the  beta‐glucosidases  of  strain  AP  were  found 
to have excellent  temperature stability compared to Novozym 
188  and  Cellic  CTec  (Fig.  6A‐C).  Novozym  188  has  previously 
been reported to only maintain stability at temperatures at or 
below  50°C  [41].  Cellic  CTec was found  to  be  very unstable  at 
elevated  temperatures  observed  by  the  poor  performance 
when  assaying  for activity  after  incubation  above  50°C, which 
relates  to  the  manufactures  instructions  of  best  performance 
at  temperatures  40‐50°C  [49].  The  time  course  of  the 
inactivation  of  all  enzymes  approximately  followed  a  first 
order  reaction  from  which  the  denaturation  rates  and  half‐
lives  at  the  different  temperatures  were  calculated,  and  the 
thermal  activity  number  confirmed  the  dominating  status  of 
strain  AP  beta‐glucosidases  in  terms  of  thermostability  (Fig. 
6D). 
To  conclude,  a  new  yet  unidentified  species  has  been 
identified:  strain  AP,  belonging  to  the  Aspergillus  nigri  group. 
This  stain  had  significantly  greater  beta‐glucosidase  potential 
than  all  other  fungi  screened  and  was  shown  to  be  a  valid 
substitute  for  Novozym  188,  even  performed  better  than 
Novozym  188  in  some  aspects,  and  definitely  out‐competed 
Cellic CTec in terms of thermostability.   
 
Acknowledgements 
The  authors  acknowledge  the  financial  support  from 
Danish  Council  for  Strategic  Research,  project  “Biofuels  from 
Important  Foreign  Biomasses” that  was  the  foundation  of  this 
work.  The  authors  wish  to  thank  Professor  J.C.  Frisvad, 
Technical  University  of  Denmark  as  well  as  the  scientist 
mentioned in Table 1 for all fungal strain donations. Professor 
Henrik  Christensen,  University  of  Copenhagen  is  thanked  for 
his assistance in relation to phylogeny.   
 
References 
[1] Beguin P, Aubert JP. The Biological Degradation of Cellulose. FEMS Microbiol 
Rev 1994;1:25‐58.  
[2]  Zhang  Y‐P,  Himmel  ME,  Mielenz  JR.  Outlook  for  cellulase  improvement: 
Screening and selection strategies. Biotechnol Adv 2006;5:452‐81.  
[3]  Sternberg  D,  Vijayakumar  P,  Reese  ET.  Beta‐Glucosidase  ‐  Microbial‐
Production and Effect on Enzymatic‐Hydrolysis of Cellulose. Can J Microbiol 
1977;2:139‐47.  
[4]  Danielsen  S.  Ph.D.  thesis:  Characterization  of  Fusarium  moniliforme  from 
maize from Costa Rica and approaches to biocontrol 1997.  
[5] Bulat SA, Lubeck M, Mironenko N, Jensen DF, Lubeck PS. UP‐PCR analysis and 
ITS1  ribotyping  of  strains  of  Trichoderma  and  Gliocladium  .  Mycol  Res 
1998:933‐43.  
[6] Schiller M, Lubeck M, Sundelin T, Fernando Campos Melendez L, Danielsen S, 
Funck  Jensen  D  et  al.  Two  subpopulations  of  Colletotrichum  acutatum  are 
responsible  for  anthracnose  in  strawberry  and  leatherleaf  fern  in  Costa 
Rica. Eur J Plant Pathol 2006;2:107‐18.  
[7]  Sundelin  T,  Schiller  M,  Lubeck  M,  Jensen  DF,  Paaske  K.  First  report  of 
anthracnose  fruit  rot  caused  by  Colletotrichum  acutatum  on  strawberry  in 
Denmark. Plant Dis 2005;4:432‐.  
[8]  Tobiasen  C,  Aahman  J,  Ravnholt  KS,  Bjerrum  MJ,  Grell  MN,  Giese  H. 
Nonribosomal peptide synthetase (NPS) genes in Fusarium graminearum, F. 
culmorum  and  F.  pseudograminearium  and  identification  of  NPS2  as  the 
producer of ferricrocin. Curr Genet 2007;1:43‐58.  
[9]  Lubeck  M,  Poulsen  H.  UP‐PCR  cross  blot  hybridization  as  a  tool  for 
identification  of  anastomosis  groups  in  the  Rhizoctonia  solani  complex. 
FEMS Microbiol Lett 2001;1:83‐9.  
[10]  Sarrocco  S,  Mikkelsen  L,  Vergara  M,  Jensen  DF,  Lubeck  M,  Vannacci  G. 
Histopathological  studies  of  sclerotia  of  phytopathogenic  fungi  parasitized 
by  a  GFP  transformed  Trichoderma  virens  antagonistic  strain.  Mycol  Res 
2006:179‐87.  
[11]  Dellaporta  SL,  Wood  J,  Hicks  JB.  A  plant  DNA  minipreparation:  Version  II. 
Plant Molecular Biology Reporter 1983;4:19‐21.  
[12] White TJ, Bruns T, Lee S, Taylor JW. Amplification and direct sequencing of 
fungal  ribosomal  RNA  genes  for  phylogenetics.  In:  Innis  MA,  Gelfand  DH, 
Sninsky  JJ,  White  TJ,  editors.  PCR  Protocols:  A  Guide  to  Methods  and 
Applications, New York: Academic Press Inc; 1990, p. 315‐322.  
[13]  Kumar  R,  Singh  S,  Singh  OV.  Bioconversion  of  lignocellulosic  biomass: 
biochemical  and  molecular  perspectives.  J  Ind  Microbiol  Biotechnol 
2008;5:377‐91.  
[14]  Varga  J,  Kocsube  S,  Toth  B,  Frisvad  JC,  Perrone  G,  Susca  A  et  al.  Aspergillus 
brasiliensis  sp  nov.,  a  biseriate  black  Aspergillus  species  with  world‐wide 
distribution. Int J Syst Evol Microbiol 2007:1925‐32.  
[15]  Samson  RA,  Noonim  P,  Meijer  M,  Houbraken  J,  Frisvad  JC,  Varga  J. 
Diagnostic tools to identify black aspergilli. Stud Mycol 2007:129‐45.  
[16] Felsenstein J. PHYLIP (Phylogeny Inference Package) version 3.69 2004.  
[17] Kimura M. The neutral theory of molecular evolution. New York: Cambridge 
University Press; 1983.  
[18]  Saitou  N,  Nei  M.  The  Neighbor‐Joining  Method  ‐  a  New  Method  for 
Reconstructing Phylogenetic Trees. Mol Biol Evol 1987;4:406‐25.  
 
Research paper II 
‐ II.12 ‐ 
 
[19]  Page  RDM.  TREEVIEW:  An  application  to  display  phylogenetic  trees  on 
personal  computers.  Computer  Applications  in  the  Biosciences  1996:357‐
358.  
[20]  Felsenstein  J.  Confidence‐Limits  on  Phylogenies  ‐  an  Approach  using  the 
Bootstrap. Evolution 1985;4:783‐91.  
[21]  Samson  RA,  Hoekstra  ES,  Frisvad  JC.  Introduction  to  Food‐  and  Airborne 
Fungi.  7th  ed.  Centralbureau  voor  Schimmelcultures,  Utrecht,  Netherlands: 
American Society Microbiology; 2004.  
[22]  Dekker  RFH.  Kinetic,  Inhibition,  and  Stability  Properties  of  a  Commercial 
Beta‐D‐Glucosidase  (Cellobiase)  Preparation  from  Aspergillus  niger  and  its 
Suitability  in  the  Hydrolysis  of  Lignocellulose.  Biotechnol  Bioeng 
1986;9:1438‐42.  
[23]  Berlin  A,  Gilkes  N,  Kilburn  D,  Bura  R,  Markov  A,  Skomarovsky  A  et  al. 
Evaluation  of  novel  fungal  cellulase  preparations  for  ability  to  hydrolyze 
softwood  substrates  ‐  evidence  for  the  role  of  accessory  enzymes.  Enzyme 
Microb Technol 2005;2:175‐84.  
[24]  Tako  M,  Farkas  E,  Lung  S,  Krisch  J,  Vagvoelgyi  C,  Papp  T.  Identification  of 
Acid‐  and  Thermotolerant  Extracellular  Beta‐Glucosidase  Activities  in 
Zygomycetes Fungi. Acta Biol Hung 2010;1:101‐10.  
[25]  Djarwanto,  Tachibana  S.  Screening  for  Fungi  Capable  of  Degrading 
Lignocellulose from Plantation Forests 2009;9:669‐675.  
[26]  Jahangeer  S,  Khan  N,  Jahangeer  S,  Sohail  M,  Shahzad  S,  Ahmad  A  et  al. 
Screening and characterization of fungal cellulases isolated from the native 
environmental source. Pak J Bot 2005;3:739‐48.  
[27]  Krogh  KBR,  Morkeberg  A,  Jorgensen  H,  Frisvad  JC,  Olsson  L.  Screening 
genus  Penicillium  for  producers  of  cellulolytic  and  xylanolytic  enzymes. 
Appl Biochem Biotechnol 2004:389‐401.  
[28] Pedersen M, Hollensted M, Lange L, Andersen B. Screening for cellulose and 
hemicellulose  degrading  enzymes  from  the  fungal  genus  Ulocladium  .  Int 
Biodeterior Biodegrad 2009;4:484‐9.  
[29]  Kim  S,  Lee  C,  Kim  M,  Yeo  Y,  Yoon  S,  Kang  H  et  al.  Screening  and 
characterization  of  an  enzyme  with  beta‐glucosidase  activity  from 
environmental  DNA.  Journal  of  Microbiology  and  Biotechnology 
2007;6:905‐12.  
[30] Kim K, Brown KM, Harris PV, Langston JA, Cherry JR. A proteomics strategy 
to  discover  beta‐glucosidases  from  Aspergillus  fumigatus  with  two‐
dimensional  page  in‐gel  activity  assay  and  tandem  mass  spectrometry. 
Journal of Proteome Research 2007;12:4749‐57.  
[31]  Jager  S,  Brumbauer  A,  Feher  E,  Reczey  K,  Kiss  L.  Production  and 
characterization  of  beta‐glucosidases  from  different  Aspergillus  strains. 
World J Microbiol Biotechnol 2001;5:455‐61.  
[32]  Leite  RSR,  Alves‐Prado  HF,  Cabral  H,  Pagnocca  FC,  Gomes  E,  Da‐Silva  R. 
Production  and  characteristics  comparison  of  crude  beta‐glucosidases 
produced  by  microorganisms  Thermoascus  aurantiacus  e  Aureobasidium 
pullulans in agricultural wastes. Enzyme Microb Technol 2008;6:391‐5.  
[33]  Kent  NL,  Evers  AD.  Nutrition.  In:  Anonymous  Technology  of  cereals: 
Woodhead Publishing; 1994, p. 276‐301.  
[34]  Sohail  M,  Naseeb  S,  Sherwani  SK,  Sultana  S,  Aftab  S,  Shahzad  S  et  al. 
Distribution  of  Hydrolytic  Enzymes  among  Native  Fungi:  Aspergillus  the 
Pre‐Dominant Genus of Hydrolase Producer. Pak J Bot 2009;5:2567‐82.  
[35] Ward OP, Qin WM, Dhanjoon J, Ye J, Singh A. Physiology and biotechnology 
of Aspergillus . Advances in Applied Microbiology, Vol 58 2006:1‐75.  
[36]  de  Vries  RP,  Visser  J.  Aspergillus  enzymes  involved  in  degradation  of  plant 
cell  wall  polysaccharides.  Microbiology  and  Molecular  Biology  Reviews 
2001;4:497,+.  
[37]  Ali  S.  Studies  of  the  Submerged  Fermentation  of  Citric  Acid  by  Aspergillus 
niger in Stirred Fermentor 2004.  
[38]  Kawai  Y,  Otaka  M,  Kakio  M,  Oeda  Y,  Inoue  N,  Shinano  H.  Screening  of 
Antioxidant‐Producing  Fungi  in  Aspergillus  niger  Group  for  Liquid‐  and 
Solid‐State Fermentation. Bull Fac FIsh Hokkaido Univ 1994;1:26‐31.  
[39]  Ghasemi  MF,  Bakhtiari  MR,  Fallahpour  M,  Noohi  A,  Nasrin  M,  Amidi  Z. 
Screening  of  Urease  Production  by  Aspergillus  niger  Strains.  Iran  Biomed 
2004;1:47‐50.  
[40]  Eyzaguirre  J,  Hidalgo  M,  Leschot  A.  Beta‐glucosidases  from  Filamentous 
Fungi: Properties, Structure, and Applications. In: Anonymous Handbook of 
Carbohydrate  Engineering:  Taylor  and  Francis  Group,  LLC;  2005,  p.  645‐
685.  
[41] Krogh KBRM, Harris PV, Olsen CL, Johansen KS, Hojer‐Pedersen J, Borjesson 
J  et  al.  Characterization  and  kinetic  analysis  of  a  thermostable  GH3  β‐
glucosidase  from  Penicillium  brasilianum  .  Applied  Microbiology  & 
Biotechnology 2010;1:143‐54.  
[42] Seidle  HF,  Marten I, Shoseyov O, Huber RE.  Physical and kinetic properties 
of  the  family  3  beta‐glucosidase  from  Aspergillus  niger  which  is  important 
for cellulose breakdown. Protein Journal 2004;1:11‐23.  
[43]  Khan  AW,  Meek  E,  Henschel  JR.  Beta‐D‐Glucosidase  ‐  Multiplicity  of 
Activities and Significance to Enzymic Saccharification of Cellulose. Enzyme 
Microb Technol 1985;9:465‐7.  
[44]  Bhatia  Y,  Mishra  S,  Bisaria  VS.  Microbial  beta‐glucosidases:  Cloning, 
properties, and applications. Crit Rev Biotechnol 2002;4:375‐407.  
[45]  Sakamoto  R,  Arai  M,  Murao  S.  Enzymic  Properties  of  3  Beta‐Glucosidases 
from Aspergillus aculeatus No‐F‐50. Agric Biol Chem 1985;5:1283‐90.  
[46]  Soccol  CR,  de  Souza  Vandenberghe  LP,  Pedroni  Medeiros  AB,  Karp  SG, 
Buckeridge  M,  Ramos  LP  et  al.  Bioethanol  from  lignocelluloses:  Status  and 
perspectives in Brazil. Bioresour Technol 2010;13:4820‐5.  
[47]  Leite  RCD,  Leal  MRLV,  Cortez  LAB,  Griffin  WM,  Scandiffio  MIG.  Can  Brazil 
replace  5%  of  the  2025  gasoline  world  demand  with  ethanol?.  Energy 
2009;5:655‐61.  
[48] Bisswanger H.  Temperature  Dependence. In: Anonymous Enzyme Kinetics, 
Principles  and  Methods,  Weinheim:  WILEY‐VCH  Verlag  GmbH  &  Co.  KGaA; 
2008, p. 154‐158.  
[49]  Novozymes  A/S.  Cellic  CTec2  and  HTec2  ‐  Enzymes  for  hydrolysis  of 
lignocellulosic materials 2010.  
 
 
Research paper III 
 
 
Aspergillus saccharolyticus sp. nov., a new black Aspergillus 
species isolated from treated oak wood in Denmark 
 
 
Annette Sørensen, Peter S. Lübeck, Mette Lübeck, Kristian F. Nielsen,  
Birgitte K. Ahring, Philip J. Teller, and Jens C. Frisvad 
 
Intended for submission to International Journal of Systematic and Evolutionary Microbiology 
 
 
 
 
 
Research paper III 
‐ III.1 ‐ 
 
 
INTRODUCTION 
The  black  aspergilli  (Aspergillus  section  Nigri)  (Gams  et 
al., 1985) are important industrial working horses as they 
are frequently used in the biotech industry for production 
of  hydrolytic  enzymes  and  organic  acids  (Pel  et  al.,  2007, 
Goldberg et al., 2006, Pariza & Foster, 1983). 
Black aspergilli are some of the most common fungi being 
responsible for postharvest decay of fruit (Pitt & Hocking, 
2009).  Of  these  A.  carbonarius  is  especially  problematic 
due  to  its  high  production  of  the  carcinogenic  ochratoxin 
A,  which  is  an  important  mycotoxin  in  wine  and  raisins 
(Abarca et al., 2003).  Recently, also A. niger was shown to 
contaminate  wine  with  the  carcinogenic  mycotoxin 
fumonisin B2 (Mogensen et al., 2010). In addition to these 
toxins,  the  black  aspergilli  are  well  known  for  their 
prolific production of many secondary metabolites. In the 
biseriate  species  a  diverse  array  of  polyketides  and 
several alkaloids are known, while the uniseriate species, 
A.  aculeatinus,  A.  aculeatus,  A.  japonicus,  and  A.  uvarum 
predominantly  produce  alkaloids  and  few  polyketides 
(Nielsen et al., 2009). 
Aspergillus section Nigri is one of the more taxonomically 
difficult  groups,  but  the  uniseriate  subgroup  differ 
significantly  in  morphology  and  physiology  from  the 
biseriate subgroup (Samson & Varga, 2009, Samson et al., 
2007,  Perrone  et  al.,  2008,  Noonim  et  al.,  2008).  The 
species  concept  of  black  aspergilli  has  been  discussed  by 
several  researches  within  the  Aspergillus  research 
community, and it is generally agreed that it is important 
to delimit a species in the genus by combining molecular, 
morphological,  and  physiological  characteristics  using  a 
polyphasic  approach  (Samson  &  Varga,  2009,  Samson  et 
al., 2007).  
During  a  broad  screening  of  different  fungal  strains 
collected  in  Denmark  for  prominent  beta‐glucosidase 
producing  fungi  (Research  paper  II,  this  thesis),  we 
discovered  a  uniseriate  Aspergillus,  morphologically 
 
A novel species, Aspergillus saccharolyticus sp. nov., is described within the black Aspergillus 
section Nigri species. This species was isolated in Denmark from treated hardwood. Its 
taxonomic status was determined using a polyphasic taxonomic approach with phenotypic 
(morphology and extrolite profiles) and molecular (beta‐tubulin, internal transcribed spacer 
and calmodulin gene sequences, and universally‐primed PCR fingerprinting) characteristics. 
These features clearly distinguished this species from other black aspergilli. A. saccharolyticus 
is a uniseriate black Aspergillus with a similar morphology to A. japonicus and A. aculeatus, 
but with a totally different extrolite profile as compared to any known Aspergillus. The type 
strain is CBS 127449
T
 (= IBT 28509
T
).  
 
 
Aspergillus saccharolyticus sp. nov., a new black
Aspergillus species isolated from treated oak wood in
Denmark
Annette Sørensen
1
, Peter S. Lübeck
1
, Mette Lübeck
1
, Kristian F.
Nielsen
2
, Birgitte K. Ahring
1,3
, Philip J. Teller
4
, and Jens C. Frisvad
2
1
Section for Sustainable Biotechnology, Copenhagen Institute of Technology, Aalborg 
University, Lautrupvang 15, DK‐2750 Ballerup, Denmark 
2
Center for Microbial Biotechnology, Department of Systems Biology, Building 224, Technical 
University of Denmark, DK‐2800 Kgs. Lyngby, Denmark 
3
Center for Biotechnology and Bioenergy, Washington State University, Richland, WA 99352, 
USA  
4
Current address: Biogasol ApS, Denmark, Lautrupvang 2A, 2750 Ballerup, Denmark 
 
 
 
 
 
 
 
 
Correspondance 
Peter. S. Lübeck 
psl@bio.aau.dk 
 
Abbreviations:  ITS,  internal  transcribed  spacer  region;  UP‐PCR, 
universally primed PCR. 
The  GenBank  accession  numbers  for  the  beta‐tubulin,  ITS,  and 
calmodulin  gene  sequenced  of  strains  examined  are  shown  on 
the phylogenetic trees. 
The Mycobank (http://www.mycobank.org) accession number for 
A. saccharolyticus sp. nov. is MB 158695 
 
 
 
 
Research paper III 
‐ III.2 ‐ 
 
similar to A. japonicus. However, both molecular data and 
extrolite  profile  showed  that  this  fungus  differed 
significantly  from  known  aspergilli  from  section  Nigri.  In 
this  paper  we  describe  the  relationship  of  this  strain  to 
other black aspergilli using the polyphasic approach with 
studies  of  ITS,  calmodulin,  and  beta‐tubulin  sequence 
phylogeny,  UP‐PCR  finger  printing,  macro‐  and  micro‐
morphology,  temperature  tolerance,  and  extrolite 
production. 
METHODS 
A  strain  of  a  novel  species,  Aspergillus  saccharolyticus,  was 
isolated  indoor  from  treated  oak  wood  in  Denmark.  The  isolate 
was  maintained  on  potato  dextrose  agar  at  room  temperature. 
All reference strains and accession numbers used for comparison 
are listed in Supplemetary Table 1.  
Molecular  analysis.  Fungal  biomass  for  DNA  extraction  was 
obtained by scraping the surface of a PDA plate with a seven day 
old colony. DNA extraction was carried out as described by (Yu & 
Mohn,  1999),  using  bead  beating  for  cell  disruption.  The  two 
fungal  primers  Bt2a  (5’  GGTAACCAAATCGGTGCTGCTTTC)  and 
Bt2b  (5’  ACCCTCAGTGTAGTGACCCTTGGC)  were  used  to  amplify 
a  fragment  of  the  beta‐tubulin  gene  (Glass  &  Donaldson,  1995), 
while  the  primers  Cmd5  (5’  CCGAGTACAAGGAGGCCTTC)  and 
Cmd6  (5’  CCGATAGAGGTCATAACGTGG)  were  used  to  amplify  a 
segment  of  the  calmodulin  gene  (Hong  et  al.,  2006),  and  the 
primers  ITS1  (5’  TCCGTAGGTGAACCTGCGG)  and  ITS4    (5’ 
TCCTCCGCTTATTGATATG)  were  used  to  amplify  the  ribosomal 
rDNA spacers, ITS1 and ITS2 (White et al., 1990). 
Phylogenetic  analysis  of  the  beta‐tubulin,  calmodulin,  and 
internal  transcribed  spacer  region  of  rRNA  (ITS1  and  ITS2) 
sequences  of  the  novel  isolate  was  carried  out  as  described  by 
Varga  et  al.  (2007),  using  the  beta‐tubulin,  calmodulin,  and  ITS 
region  sequences  of  the  aspergilli  presented  in  the  article  by 
Samson  et  al.  (2007).  ClustalW  multiple  alignment  was  used  for 
sequence  alignment  and  manual  improvement  of  the  alignment 
was  performed  using  BioEdit 
(http://www.mbio.ncsu.edu/BioEdit/bioedit.html).  The  PHYLIP 
program  package  version  3.69  was  used  for  preparation  of 
phylogenetic  trees  (Felsenstein,  2004).  The  distance  matrix  of 
the  data  set  was  calculated  based  on  the  Kimura  method 
(Kimura,  1983)  using  the  program  “Dnadist”.  The  phylogenetic 
tree was prepared by running the  program “Neighbor” using the 
neighbor‐joining method (Saitou & Nei, 1987) to obtain unrooted 
trees.  A.  flavus  was  defined  as  the  outgroup  in  the  program 
“Retree”,  and  finally  the  tree  was  visualized  using  the  program 
TreeView  (win32)  (Page,  1996).  Bootstrap  values  (Felsenstein, 
1985)  were  calculated  by  running  the  program  “Seqboot”  to 
produce  1000  bootstrapped  data  sets  from  the  original  data  set. 
Again,  “Dnadist”  with  the  Kimura  method  was  used  to  prepare 
distance  matrices  of  the  multiple  data  sets,  and  “Neighbor”  with 
the  neighbor‐joining  method  to  obtain  unrooted  trees  of  the 
multiple  data  sets.  Finally,  the  bootstrap  values  were  obtained 
from  the  consensus  tree  which  was  identified  by  the  majority‐
rule consensus method by running the program “Consense”.  
UP‐PCR  fingerprinting  was  carried  out  using  two  different  UP 
primers,  L45  (5'  GTAAAACGACGGCCAGT)  and  L15/AS19  (5' 
GAGGGTGGCGGCTAG) (Lubeck et al., 1999) for DNA amplification 
in  separate  reactions.  The  amplification  was  performed  as 
described  in  Lübeck  et  al.  (1999)  except  that  the  reactions  were 
carried  out  in  a  25  µl  volume  containing  50  mM  Tris  pH  8,  0.23 
mg/ml BSA, 0.5 % Ficoll, 2.5 mM MgCl2, 0.2 mM of dNTP, 0.4 µM 
of primer and 1 U RUN polymerase (A&A Biotechnology).  
Morphological  analysis.  For  microscopic  analysis,  microscopic 
mounts  were  made  in  lactophenol  from  colonies  grown  on  MEA 
(malt extract autolysate) and OA (oat meal agar). 
For investigation of morphological characteristics, a dense spore 
suspension  of  A.  saccharolyticus  was  three‐point  inoculated  on 
the following media: CREA (creatine sucrose), CYA (Czapek yeast 
autolysate),  CY20S  (CYA  with  20%  sucrose),  CY40S  (CYA  with 
40%  sucrose),  CYAS  (CYA  with  50g/l  NaCl),  MEA  (malt  extract 
autolysate),  OA  (oat  meal  agar)  and  YES  (yeast  extract  sucrose) 
agar  (Samson  et  al.,  2004a),  and  incubated  7  days  in  the  dark  at 
25°C. For temperature tolerance analysis, three‐point inoculating 
was  performed  on  CYA  and  incubated  7  days  in  the  dark  at 
different temperatures: room temp, 30°C, 33°C, 36°C, and 40°C.  
Extrolite analysis. Three 6 mm diameter plugs were taken from 
each strain grown as three‐point inoculations in the dark at 25 °C 
for  7  and  14  days  on  YES,  CYA20,  CYA40,  PDA,  CYA    media 
(Nielsen  et  al.,  2009,  Samson  et  al.,  2004a).  The  plugs  were 
transferred  to  a  2  ml  vial  and  1.4  ml  of  ethyl  acetate  containing 
1%  formic  acid  was  added.  The  plugs  were  placed  in  an  ultra‐
sonication bath for 60 min. The ethyl acetate was transferred to a 
new  vial  in  which  the  organic  phase  was  evaporated  to  dryness 
by  applying  nitrogen  airflow  at  30  °C.  The  residues  were  re‐
dissolved  by  ultrasonication  for  10  min  in  150  μl  ACN/H2O  (1:1, 
v/v) mixture.  
HPLC‐UV/VIS‐high  resolution  mass  spectrometry  (LC‐HRMS) 
analysis  was  performed  with  an  Agilent  1100  system 
(Waldbronn, Germany) equipped with a diode array detector and 
coupled  to  a  Micromass  LCT  (Micromass,  Manchester,  U.K.) 
equipped with an electrospray (ESI) (Nielsen et al., 2009, Nielsen 
&  Smedsgaard,  2003).  Separations  of  2  µl  samples  was 
performed  on  a  50  ×  2  mm  inner  diameter,  3  μm  Luna  C18  II 
column  (Phenomenex,  Torrance,  CA)  using  a  linear  water‐ACN 
gradient at a flow of 0.300 ml/min with 15‐100% ACN in 20 min 
followed  by  a  plateau  at  100  %  ACN  for  3  min  (Nielsen  et  al., 
2009). Both solvents contained 20 mM formic acid. Samples were 
analyzed both in ESI

 and ESI
+
 mode. 
For  compound  identification,  each  peak  was  matched  against  an 
internal  reference  standard  database  (~800  compounds) 
(Nielsen  et  al.,  2009,  Nielsen  &  Smedsgaard,  2003).  Other  peaks 
were  tentatively  identified  by  matching  data  from  previous 
studies in our lab and searching the accurate mass in the ~13500 
fungal metabolites reported in Antibase 2010 (Laatsch, 2010).  
RESULTS AND DISCUSSION 
In  a  screening  program,  fungal  strains  were  obtained 
from  different  environmental  habitats,  Danish  as  well  as 
international,  and  tested  for  beta‐glucosidase  activity 
(Research  paper  II,  this  thesis).  Some  of  the  strains  were 
found indoor in Denmark on treated oak wood, and one of 
 
 
 
 
Research paper III 
‐ III.3 ‐ 
 
these  strains  showed  an  extraordinary  good  beta‐
glucosidase  activity.  In  this  work,  a  thorough 
characterization  was  carried  out  in  order  to  identify  the 
strain.  
Morphological data showed that the strain was related to 
A. japonicus or A. aculeatus, but extrolite profiles and DNA 
sequencing  data  showed  that  the  strain  clearly  was 
different  from  all  known  species.  The  genetic  relatedness 
of  this  novel  species,  A.  saccharolyticus,  to  other  black 
aspergilli was investigated by comparing sequence data of 
parts  of  the  beta‐tubulin  and  calmodulin  genes  as  well  as 
the ITS region, using A. flavus  as the out group. The black 
aspergilli chosen for comparison are the same as the ones 
presented  by  Samson  et  al.  (2007).  Phylogetic  trees  were 
prepared  for  A.  saccharolyticus  based  on  these  sequence 
data  and  data  obtained  in  this  work,  with  especially  the 
ITS  and  calmodulin  sequence  trees  showing  similar 
topology (Fig 1 and Supplementary Fig S1 and S2). Based 
on  the  phylogenetic  analysis  of  the  ITS  and  calmodulin 
gene  sequence  data,  A.  saccharolyticus  was  with  high 
bootstrap  values  found  to  belong  to  the  clade  with  A. 
homomorphus, A. aculeatinus, A. uvarum, A. japonicus, and 
both  A.  aculeatus  strains,  while  for  the  beta‐tubulin  gene 
sequence  data  A.  saccharolyticus  clustered  with  A. 
homomorphus,  A.  aculeatinus,  A.  uvarum,  and  A.  aculeatus 
CBS  114.80.  The  separate  grouping  in  the  beta‐tubulin 
tree  of  A.  japonicus  and  A.  aculeatus  CBS  172.66
T
  has 
consistently been shown in other publications (Noonim et 
al.,  2008,  Samson  et  al.,  2007,  Varga  et  al.,  2007,  de  Vries 
et  al.,  2005,  Samson  et  al.,  2004b).  For  all  three  loci,  A. 
saccharolyticus  is  placed  on  its  own  branch  far  from  the 
other  species  in  the  clade  supported  by  the  majority‐rule 
consensus  analysis  for  all  three  loci  and  high  bootstrap 
values  for  the  beta‐tubulin  and  calmodulin  loci,  but  low 
bootstrap  value  (51%)  for  the  ITS  locus.  Sequence 
alignment revealed that amongst the species from section 
Aculeati  that  are  in  clade  with  A.  saccharolyticus, 
interspecific  sequence  divergences  are  ≤0.7%,  7.1%,  and 
5.7%  for  the  ITS,  calmodulin,  and  beta‐tubulin  regions, 
respectively.  Meanwhile,  the  interspecific  sequence 
divergences  in  the  ITS,  calmodulin,  and  beta‐tubulin 
region between A. saccharolyticus and the other species in 
the  clade  are  on  average  12.9±0.6%,  20±0.5%,  and 
15.4±1.2%,  respectively.  The  variation  in  sequence  data 
observed between A. saccharolyticus and A. homomorphus 
is the same as the variation between A. homomorphus and 
the  smaller  clade(s)  of  A.  aculeatinus,  A.  uvarum,  A. 
japonicus,  and  both  A.  aculeatus  strains.  Searching  the 
NCBI  database  does  not  give  any  closer  genetic  match. 
Based  on  this,  there  is  a  clear  genetic  foundation  for 
proposing the new species, A. saccharolyticus. 
Furthermore,  this  strain  could  readily  be  distinguished 
from  other  black  aspergilli  by  Universally  Primed‐PCR 
analysis  using  each  of  the  two  UP  primers,  L45  and 
L15/AS19  (Supplementary  Fig  S3).  UP‐PCR  is  a  PCR 
fingerprinting  method  that  has  demonstrated  its 
applicability  in  different  aspects  of  mycology.  These 
applications  constitute  analysis  of  genome  structures, 
identification  of  species,  analysis  of  population  and 
species diversity, revealing of genetic relatedness at infra‐ 
and  inter‐species  level,  and  identification  of  UP‐PCR 
markers  at  different  taxonomic  levels  (strain,  group 
and/or  species)  (Lübeck  &  Lübeck,  2005).  Each  of  the 
analyzed  aspergilli,  A.  saccharolyticus,  A.  aculeatinus,  A. 
ellipticus,  A.  homomorphus,  A.  niger,  A.  uvarum,  A. 
aculeatus  and  A.  japonicus,  produced  a  unique  banding 
profile,  and  did  not  share  any  bands  (Supplementary  Fig 
S3).  This  is  an  indication  of  clearly  separated  species,  as 
strains  within  a  species  should  at  least  have  some 
similarities  in  their  banding  profiles  (Lübeck  &  Lübeck, 
2005).  
The  extrolite  profiles  further  showed  that  A. 
saccharolyticus  produced  the  largest  chemical  diversity 
on  YES  agar  (25°C),  whereas  CYA  (25  and  30°C),  and 
CYAS,  CY20S,  CY20,  CY40S,  and  PDA  (all  at  25°C)  yielded 
fewer  peaks.  The  results  further  showed  that  it  is 
Fig.  1.  Neighbor‐joining  phylogenetic  tree  based  on  partial 
calmodulin  gene  sequence  data  for  Aspergillus  section  Nigri. 
Numbers  above  the  branches  are  bootstrap  values.  Only  values 
above 70% are indicated. Bar, 0.02 substitutions per nucleotide. 
 
 
 
 
Research paper III 
‐ III.4 ‐ 
 
probably  a  new  species  since  it  does  not  share  any 
metabolites with other species in the Nigri section where 
e.g.  the  naphto‐γ‐pyrones  are  consistently  produced 
(Nielsen et al., 2009) and only two compounds, ACU‐1 and 
ACU‐2,  with  series  Aculeati  (Table  1  and  Supplementary 
Fig  S4)  whereas  the  well‐known  compounds  from  the 
series:  neooxaline,  secalonic  acids,  cycloclavine  and 
aculeasins  were  not  detected (Parenicova  et al.,  2001).  In 
addition, none of the 12 detected peaks matched with the 
approx. 13500 fungal extrolites in Antibase2010 (Laatsch, 
2010)  indicating  that  the  species  has  not  been 
investigated by natural products chemists.  
Morphologically, A. saccharolyticus is most closely related 
to  A.  japonicus  (Fig  2),  but  with  larger  conidia  of  5‐6  µm 
and  vesicle  size  in  the  high  margin  of  A.  japonicus.  Based 
on  physiological  features,  differences  between  A. 
saccharolyticus  and  other  uniseriate  species  in  the  Nigri 
section were found. Growth on CREA resembled that of A. 
aculeatinus,  as  moderate  growth  and  medium  acid 
Table 1. Physiological features and extrolite production
1
 by the strains of uniseriate species in Aspergillus section Nigri. 
Species  Growth on 
CYAS  
(diam, mm) 
Growth at 
37°C on CYA 
(diam, mm) 
Extrolites
 
A saccharolyticus sp. nov.  
(CBS 127449
T

 
 
11‐14 
 
7‐14  12 compounds not described in the literature* including ACU‐1** and ACU‐2** 
A aculeatinus  
(CBS 121060
T
, CBS 
121875, IBT 29275) 
 
37‐54 18‐52  Aculeasins, neoxaline, secalonic acid D & F 
A aculeatus  
(CBS 172.66
T

 
0‐4  15‐26  Secalonic acid D & F, ACU‐1** and ACU‐2**
A japonicus  
(CBS 114.51
T
, IBT 29329,  
IBT 26338, ITEM 4497) 
 
0  8‐25  Cycloclavine, festuclavine
A uvarum 
 (CBS 121591
T
, ITEM 4834; 
ITEM 4856; ITEM 5024) 
 
54‐73 11‐14  Asterric acid, dihydrogeodin, erdin, geodin, secalonic acid D & F 
1
Extrolite production described in (Parenicova et al., 2001) and (Noonim et al., 2008), updated here. 
* No matches found among the 13 500 fungal metabolites listed in Anitbase2010.  
** ACU‐1 and ACU‐2 unidentified compounds with UV max 242 nm (100%) and 346 (88%) with mono isotopic masses of 315.1799 and 218.1268 
Da respectively.  
Fig. 2. A. saccharolyticus sp. nov. CBS 127449
T
. A) conidia, B‐C) conidial heads, D‐H) Three‐point inoculation on CREA, CYA, CYA 37°C, MEA, and 
CYAS, respectively, incubated 7 days  
 
 
 
 
Research paper III 
‐ III.5 ‐ 
 
production  was  observed,  while  growth  on  CYA  mostly 
resembled  that  of  A.  aculeatus,  however,  the  reverse  side 
of A. saccharolyticus is olive‐green/brownish with sulcate 
structure,  while  that  of  A.  aculeatus  is  curry‐
yellowish/brown  (Fig  2  compared  with  Samson  et  al. 
(2007)).  MEA  was  a  medium  where  colony  size  was 
clearly  different,  with  A.  saccharolyticus  being  smaller 
than  the  other  uniseriate  aspergilli.  A.  saccharolyticus 
grew  better  on  CYAS  than  A.  aculeatus  and  A.  japonicus, 
but growth was limited compared to A. aculeatinus and A. 
uvarum.  Growth  diameter  of  A.  saccharolyticus  on  CYA  at 
37°C was approximately the same as for A. uvarum, while 
A.  aculeatus  and  A.  japonicus  were  less  inhibited,  and  A. 
aculeatinus  even  less  inhibited  measuring  the  largest 
diameter  of  all  uniseriate  at  this  elevated  temperature 
(Table 1). 
With  regards  to  temperature  tolerance,  growth  was 
examined  on  CYA  at  30°C,  33°C,  36°C,  and  40°C.  The 
maximum  temperature  A.  saccharolyticus  was  able  to 
grow  at  was  36°C,  but  growth  at  this  temperature  was 
restricted  compared  to  the  lower  temperatures,  which  is 
generally  the  case  for  the  other  uniseriate  aspergilli  as 
well  (Samson  et  al.,  2007).  A.  saccharolyticus  showed  a 
distinct change in morphology on CYA from 30°C to 33°C, 
but maintained good growth at both temperatures (Fig 3). 
The  same  tendency  has  been  observed  for  A.  aculeatinus 
grown  on  MEA,  while  A.  japonicus,  and  A.  aculeatus 
showed  no  change  in  morphology  at  these  temperatures, 
while growth of A. uvarum was inhibited at 33°C (Samson 
et al., 2007). 
Our  conclusion,  that  we  have  identified  a  novel  species  is 
based  on  a  polyphasic  approach  combining  phylogenetic 
analysis  of  three  genes  and  UP‐PCR  data  for 
characterizing  the  genotype,  and  morphological, 
physiological,  and  chemotaxonomical  characteristics  for 
phenotype  analysis.  Because  the  strain  was  unique  in  its 
genetic  phylogeny,  UP‐PCR  profile,  extrolite  profile, 
morphological,  and  physiological  characteristics,  we 
propose  it  as  a  novel  species,  Aspergillus  saccharolyticus. 
The  novel  species  is  an  efficient  producer  of  beta‐
glucosidases (Research paper II, this thesis) and the name 
refers  to  its  great  ability  to  hydrolyze  cellobiose  and 
cellodextrins. 
Latin  diagnosis  of  Aspergillus  saccharolyticus 
Sørensen, Lübeck et Frisvad sp. nov. 
Coloniae post 7 dies 58‐62 mm diam in agaro CYA, in CYA, 
37 °C: 7‐14 mm;  in MEA 35‐37, in YES 75‐80 mm, in agaro 
farina  avenacea  confecto  39‐42  mm,  in  CREA  30‐34  mm. 
Coloniae primum albae, deinde obscure brunneae vel atrae, 
reversum  cremeum  vel  dilute  brunneum.  Conidiorum 
capitula  primum  globosa,  stipes  200‐850  x  5‐7  μm, 
crassitunicatus,  levis,  vesiculae  25‐40  μm  diam,  fere 
globosae;  capitula  uniseriata;  phialides  lageniformes, 
collulis brevis, 5.5‐7 μm; conidia globosa vel subglobosa, 5‐
6.2 μm, echinulata. Sclerotia haud visa. 
Typus  CBS  127449
T
  (=  IBT  28509
T
),  isolatus  e  lignore 
Quercetorum in Gentofte, Dania. 
Description  of  Aspergillus  saccharolyticus  Sørensen, 
Lübeck et  Frisvad sp. nov.  
Aspergillus  saccharolyticus  (sac.ca’ro.ly’ti.cus.  N.L.  masc. 
adj.  saccharolyticus,  being  able  to  degrade  cellobiose  and 
cellodextins). 
Colony  diameter  at  7  days:  CYA  at  25°C:  58‐62  mm,  at 
37°C: 7‐14 mm; CYAS: 11‐14 mm; YES: 75‐80 mm; OA: 39‐
42 mm; CY20S: 42‐54 mm; CY40S: 43‐54 mm; MEA: 35‐37 
mm; CREA 30‐34 mm, poor growth, good acid production, 
colony  first  white  then  dark  brown  to  black  (Fig  2). 
Exudates  absent,  reverse  cream‐coloured  to  light  greyish 
olive  brown  on  CYA  and  light  brown  on  YES.  Conidial 
heads  globose;  stipes  200‐850  x  5‐7  μm,  walls  thick, 
smooth;  vesicles  25‐40  μm  diam,  globose;  uniseriate, 
phialides  flask  shaped  with  a  short  broad  collulum,  5.5‐7 
μm;  conidia  mostly  globose,  but  some  are  subglobose,  5‐
6.2  μm,  distinctly  echinulate,  with  long  sharp  discrete 
spines,  the  spines  being  0.6‐0.8  μm  long.  Sclerotia  have 
not been observed.  
The type strain CBS 127449
T
 (= IBT 28509
T
) was isolated 
from  under  a  toilet  seat  made  of  treated  oak  wood, 
Gentofte, Denmark  
Fig. 3. A. saccharolyticus sp. nov. CBS 127449
T
 three point inoculation on CYA, incubation at different temperatures, growth observation day 7. 
RT  30C  33C 36C 40C 
   
 
 
 
 
 
Research paper III 
‐ III.6 ‐ 
 
ACKNOWLEDGEMENTS 
The research investigating the strain was in  part supported by  a 
grant  from  Danish  Council  for  Strategic  Research,  project 
“Biofuels from Important Foreign Biomasses”. 
REFERENCES  
Abarca,  M.  L.,  Accensi,  F.,  Bragulat,  M.  R.,  Castella,  G.  & 
Cabanes, F. J. (2003). Aspergillus carbonarius as the main source 
of  ochratoxin  A  contamination  in  dried  vine  fruits  from  the 
Spanish market. J Food Prot 66, 504‐506.  
de  Vries,  R.  P.,  Frisvad,  J.  C.,  van  de  Vondervoort,  P.  J.  I., 
Burgers,  K.,  Kuijpers,  A.  F.  A.,  Samson,  R.  A.  &  Visser,  J. 
(2005). Aspergillus vadensis, a new species of the  group of black 
Aspergilli.  Antonie  Van  Leeuwenhoek  International  Journal  of 
General and Molecular Microbiology 87, 195‐203.  
Felsenstein,  J.  (2004).  PHYLIP  (Phylogeny  Inference  Package) 
version 3.69. Distributed by the author.,  
Felsenstein,  J.  (1985).  Confidence‐Limits  on  Phylogenies  ‐  an 
Approach using the Bootstrap. Evolution 39, 783‐791.  
Gams, W., Christensen, M., Onions, A. H. S., Pitt, J. I. & Samson, 
R.  A.  (1985).  Infrageneric  taxa  of  Aspergillus.  In  Advances  in 
Penicillium and Aspergillus Systematics, pp. 55‐61. Edited by R. A. 
Samson & J. I. Pitt. New York: Plenum Press.  
Glass,  N.  L.  &  Donaldson,  G.  C.  (1995).  Development  of  Primer 
Sets  Designed  for  use  with  the  PCR  to  Amplify  Conserved  Genes 
from Filamentous Ascomycetes. Appl Environ Microbiol 61, 1323‐
1330.  
Goldberg, I., Rokem, J. S. & Pines, O. (2006). Organic acids: old 
metabolites,  new  themes.  Journal  of  Chemical  Technology  and 
Biotechnology 81, 1601‐1611.  
Hong, S. B., Cho, H. S., Shin, H. D., Frisvad, J. C. & Samson, R. A. 
(2006). Novel Neosartorya species isolated from soil in Korea. Int 
J Syst Evol Microbiol 56, 477‐486.  
Kimura,  M.  (1983).  The  neutral  theory  of  molecular  evolution. 
New York: Cambridge University Press.  
Laatsch,  H.  (2010).  AntiBase  2010:  The  Natural  Compound 
IdentifierWiley‐VCH.  
Lubeck, M., Alekhina, I. A., Lubeck, P. S., Jensen, D. F. & Bulat, 
S.  A.  (1999).  Delineation  of  Trichoderma  harzianum  into  two 
different  genotypic  groups  by  a  highly  robust  fingerprinting 
method, UP‐PCR, and UP‐PCR product cross‐hybridization. Mycol 
Res 103, 289‐298.  
Lübeck, M. & Lübeck, P. S. (2005). Universally Primed PCR (UP‐
PCR)  and  its  applications  in  Mycology.  In  The  Biodiversity  of 
Fungi.  Their  Role  In  Human  Life,  pp.  409‐438.  Edited  by  S.  K. 
Deshmukh & M. K. Rai. New Hampshire, USA: Science Publishers, 
Inc.  
Mogensen,  J.  M.,  Larsen,  T.  O.  &  Nielsen,  K.  F.  (2010). 
Widespread Occurrence of the Mycotoxin Fumonisin B‐2 in Wine. 
J Agric Food Chem 58, 4853‐4857.  
Nielsen,  K.  F.  &  Smedsgaard,  J.  (2003).  Fungal  metabolite 
screening:  database  of  474  mycotoxins  and  fungal  metabolites 
for  dereplication  by  standardised  liquid  chromatography‐UV‐
mass  spectrometry  methodology.  Journal  of  Chromatography  a 
1002, 111‐136.  
Nielsen,  K.  F.,  Mogensen,  J.  M.,  Johansen,  M.,  Larsen,  T.  O.  & 
Frisvad,  J.  C.  (2009).  Review  of  secondary  metabolites  and 
mycotoxins  from  the  Aspergillus  niger  group.  Analytical  and 
Bioanalytical Chemistry 395, 1225‐1242.  
Noonim,  P.,  Mahakarnchanakul,  W.,  Varga,  J.,  Frisvad,  J.  C.  & 
Samson,  R.  A.  (2008).  Two  novel  species  of  Aspergillus  section 
Nigri  from  Thai  coffee  beans.  Int  J  Syst  Evol  Microbiol  58,  1727‐
1734.  
Page,  R.  D.  M.  (1996).  TREEVIEW:  An  application  to  display 
phylogenetic trees on personal computers. Computer Applications 
in the Biosciences 12, 357‐358.  
Parenicova, L., Skouboe, P., Frisvad, J., Samson, R. A., Rossen, 
L.,  ten  Hoor‐Suykerbuyk,  M.  &  Visser,  J.  (2001).  Combined 
molecular  and  biochemical  approach  identifies  Aspergillus 
japonicus  and  Aspergillus  aculeatus  as  two  species.  Appl  Environ 
Microbiol 67, 521‐527.  
Pariza, M. W. & Foster, E. M. (1983). Determining the Safety of 
Enzymes used in Food‐Processing. J Food Prot 46, 453‐468.  
Pel, H. J., de Winde, J. H., Archer, D. B.& other authors (2007). 
Genome  sequencing  and  analysis  of  the  versatile  cell  factory 
Aspergillus niger CBS 513.88. Nat Biotechnol 25, 221‐231.  
Perrone, G., Varga, J., Susca, A., Frisvad, J. C., Stea, G., Kocsube, 
S., Toth, B., Kozakiewicz, Z. & Samson, R. A. (2008). Aspergillus 
uvarum  sp  nov.,  an  uniseriate  black  Aspergillus  species  isolated 
from grapes in Europe. Int J Syst Evol Microbiol 58, 1032‐1039.  
Pitt, J. I. & Hocking, A. D. (2009). Fungi and Food Spoilage, Third 
edition edn. Dordrecht: Springer.  
Saitou,  N.  &  Nei,  M.  (1987).  The  Neighbor‐Joining  Method  ‐  a 
New Method for Reconstructing Phylogenetic Trees. Mol Biol Evol 
4, 406‐425.  
Samson,  R.  A.,  Hoekstra,  E.  S.  &  Frisvad,  J.  C.  (2004a). 
Introduction to Food‐ and Airborne Fungi, 7th edn. Centralbureau 
voor  Schimmelcultures,  Utrecht,  Netherlands:  American  Society 
Microbiology.  
Samson, R. A., Houbraken, J. A. M. P., Kuijpers, A. F. A., Frank, 
J.  M.  &  Frisvad,  J.  C.  (2004b).  New  ochratoxin  A  or  sclerotium 
producing species in Aspergillus section Nigri . Stud Mycol 50, 45‐
61.  
Samson,  R.  A.,  Noonim,  P.,  Meijer,  M.,  Houbraken,  J.,  Frisvad, 
J.  C.  &  Varga,  J.  (2007).  Diagnostic  tools  to  identify  black 
aspergilli. Stud Mycol 59, 129‐145.  
Samson,  R.  A.  &  Varga,  J.  (2009).  What  is  a  species  in 
Aspergillus? Medical Mycology 47, S13‐S20.  
Samson,  R.  A.,  Varga,  J.,  Witiak,  S.  M.  &  Geiser,  D.  M.  (2007). 
The  species  concept  in  Aspergillus:  recommendations  of  an 
international panel. Stud Mycol 59, 71‐73.  
Varga,  J.,  Kocsube,  S.,  Toth,  B.,  Frisvad,  J.  C.,  Perrone,  G., 
Susca,  A.,  Meijer,  M.  &  Samson,  R.  A.  (2007).  Aspergillus 
brasiliensis  sp  nov.,  a  biseriate  black  Aspergillus  species  with 
world‐wide distribution. Int J Syst Evol Microbiol 57, 1925‐1932.  
White,  T.  J.,  Bruns,  T.,  Lee,  S.  &  Taylor,  J.  W.  (1990). 
Amplification  and  direct  sequencing  of  fungal  ribosomal  RNA 
genes for phylogenetics. In PCR Protocols: A Guide to Methods and 
Applications, pp. 315‐322. Edited by M. A. Innis, D. H. Gelfand, J. J. 
Sninsky & T. J. White. New York: Academic Press Inc.  
Yu,  Z.  T.  &  Mohn,  W.  W.  (1999).  Killing  two  birds  with  one 
stone:  simultaneous  extraction  of  DNA  and  RNA  from  activated 
sludge biomass. Can J Microbiol 45, 269‐272.  
 
 
 
 
Research paper III 
‐ III.7 ‐ 
 
 
Supplementary Table 1. GenBank accession numbers of sequence data used to prepare the phylogenetic trees 
ITS  Beta‐tubulin  Calmodulin 
A. niger CBS 554.65
T
AJ223852  AY585536  AJ964872 
A. tubingensis CBS 134.48
T
AJ223853  AY820007  AJ964876 
A. japonicus CBS 114.51
T
AJ279985  AY585542  AJ964875 
A. aculeatus CBS 172.66
T
AJ279988  AY585540  AJ964877 
A. foetidus CBS 565.65  AJ280009  AY585533  FN594547 
A. brasiliensis CBS 101740
T
AJ280010  AY820006  AM295175 
A. heteromorphous CBS 117.55

AJ280013  AY585529  AM421461 
A. ellipticus CBS 707.79
T
AJ280014  AY585530  AM117809 
A. vadensis CBS 113363
T
AY585549  AY585531  EU163269 
A. ibericus CBS 121593
T
AY656625  AM419748  AJ971805 
A. costaricaensis CBS 115574
T
DQ900602  AY820014  EU163268 
A. piperis CBS 112811
T
DQ900603  AY820013  EU163267 
A. lacticoffeatus CBS 101883
T
DQ900604  AY819998  EU163270 
A. carbonarius CBS 111.26
T
DQ900605  AY585532  AJ964873 
A. sclerotioniger CBS 115572
T
DQ900606  AY819996  EU163271 
A. homomorphus CBS 101889
T
EF166063  AY820015  AM887865 
A. aculeatinus CBS 121060
T
EU159211  EU159220  EU159241 
A. sclerotiicarbonarius CBS 121057
T
EU159216  EU159229  EU159235 
A. uvarum CBS 121591
T
AM745757  AM745751  AM745755 
A. aculeatus CBS 114.80  AJ280005  AY585539  AM419750 
A. saccharolyticus CBS 127449
T
  HM853552  HM853553  HM853554 
A. flavus CBS 100927
T
AF027863  AY819992  AY974341 
 
 
 
 
 
 
Research paper III 
‐ III.8 ‐ 
 
 
 
Supplementary Fig. S1. Neighbor‐joining phylogenetic tree based on ITS sequence data for Aspergillus section Nigri. Numbers above the branches 
are bootstrap values. Only values above 70% are indicated. Bar, 0.02 substitutions per nucleotide.   
 
 
 
 
Research paper III 
‐ III.9 ‐ 
 
 
 
 
Supplementary Fig. S2. Neighbor‐joining phylogenetic tree based on partial beta‐tubulin gene sequence data for Aspergillus section Nigri. Numbers 
above the branches are bootstrap values. Only values above 70% are indicated. Bar, 0.02 substitutions per nucleotide. 
 
 
 
 
 
Research paper III 
‐ III.10 ‐ 
 
 
 
 
Supplementary  Fig.  S3.  Universally  Primed‐PCR  analysis  using  each  of  the  two  UP  primers,  L45  and  L15/AS19.  Loaded  in  lanes:  1&2)  A. 
saccharolyticus sp. nov. CBS 127449
T
, 3) A. aculeatinus CBS 121060
T
, 4) A. ellipticus CBS 707.79
T
, 5) A. homomorphus CBS 101889
T
, 6) A. niger CBS 
554.65
T
, 7) A. uvarum CBS 121591
T
, 8) A., auleatus CBS 172.66
T
, 9) A. japonicus CBS 114.51
T
 
 
 
 
 
Research paper III 
‐ III.11 ‐ 
 
 
Supplementary Fig. S4. Extrolite profile from YES agar (14 days 25°C) of A. saccharolyticus sp. nov. CBS 127449
T
. Above is the ESI
+
 trace (m/z 100‐
900) and below the UV trace (200‐700 nm,  0.05  min ahead of ESI
+
). Mono isotopic masses (Mm) of  major  peaks are inserted.  The UV spectrum  of 
two related compounds, ACU‐1 and ACU‐2, with identical UV spectra is also inserted.  
Time (min)
2.50 5.00 7.50 10.00 12.50 15.00
A
U
0.0
2.0
4.0
6.0
2.50 5.00 7.50 10.00 12.50 15.00
%
0
9.0×10
4 8.06
7.03
4.74
4.43
0.55
6.62
9.16
10.07
12.16
11.02
6.98
6.56
4.38
0.52
8.04
9.41
nm
200 225 250 275 300 325 350 375 400 425 450
A
U
0.0
0.05
0.10
242
346
ACU‐1
M
m
315.1799 Da
M
m
616.2797 Da
M
m
317.1950 Da
M
m
312.2287 Da
ACU‐2  M
m
218.1268 Da
M
m
296.2320 Da
M
m
294.2166 Da
M
m
236.1363 Da
 
 
 
Research paper IV 
 
 
Cloning, expression, and characterization of a novel highly 
efficient beta‐glucosidase from Aspergillus saccharolyticus 
 
 
Annette Sørensen, Birgitte K. Ahring, Mette Lübeck, Wimal Ubhayasekera,  
Kenneth S. Bruno, David E. Culley, and Peter S. Lübeck 
 
Intended for submission to Applied and Environmental Microbiology 
 
 
Research paper IV 
‐ IV.1 ‐ 
 
Cellulose is the most abundant renewable biomass available
on earth. Three main players are involved in the hydrolysis of
cellulose: cellobiohydrolases (EC 3.2.1.74), endo-glucanases
(EC 3.2.1.4), and beta-glucosidases (EC 3.2.1.21). Hydrolysis
of cellulose is completed through their synergistic actions.
Cellobiohydrolases processively hydrolyze cellulose from the
ends releasing cellobiose, while endo-glucanases hydrolyze the
amorphous regions thereby creating more ends for the
cellobiohydrolases. Finally, beta-glucosidases hydrolyze the
short cellodextrins and cellobiose to glucose (3, 55), hereby
lowering the concentration of cellobiose and cellodextrins that
are inhibitors of cellobiohydrolases and endo-glucanases (3, 7,
12, 15, 16) .
Beta-glucosidases are of great industrial interest in relation
to efficient hydrolysis of lignocellulosic biomass into glucose.
Aspergilli are known to be good beta-glucosidase producers
(56), and Aspergillus niger which has GRAS status is used
industrially (46). It has been known for a long time that the
combination of A. niger beta-glucosidases and Trichoderma
reesei cellulases perform well in hydrolysis of cellulose, with
increased rates of glucose production compared to the use of
any one of the components alone (51).
Several beta-glucosidases have been purified and/or cloned,
from aspergilli and other filamentous fungi (13, 22, 25, 33, 35).
A number of these beta-glucosidases have been expressed in
heterologous hosts, including T. reesei, which has been used
extensively for industrial enzyme production. Characterization
of different purified beta-glucosidases is part of the search for
new and more efficient enzymes for the biotech industry,
where especially enzymes with high specificity towards
cellobiose and enzymes that function at high temperatures are
Cloning, expression, and characterization of a novel highly 
efficient beta‐glucosidase from Aspergillus saccharolyticus 
Annette Sørensen
1,2
, Birgitte K. Ahring
1,2
, Mette Lübeck
1
, Wimal Ubhayasekera
3,4
,  
Kenneth S. Bruno
5
, David E. Culley
5
, and Peter S. Lübeck
1* 
Section for Sustainable Biotechnology, Copenhagen Institute of Technology, Aalborg University, Lautrupvang 15, DK‐
2750 Ballerup, Denmark
1
, Center for Biotechnology and Bioenergy, Washington State University, Richland, WA 99354, 
USA
2
, MAX‐lab, Lund University, Box 118, S‐221 00 Lund, Sweden
3
,  Institute of Medicinal Chemistry, University of 
Copenhagen, Universitetsparken 2, DK‐2100 København Ø, Denmark
4
, Pacific Northwest National Laboratory, PO box 
999, Richland, WA 99532, USA


A novel beta-glucosidase, BGL1, was identified in the solid state enzyme extract from the new species
Aspergillus saccharolyticus. Ion exchange chromatography was used to fractionate the extract, yielding
fractions with high beta-glucosidase activity and only one visible band on SDS-page gel. LC-MS/MS
analysis of this band gave peptide matches of aspergilli beta-glucosidases. The beta-glucosidase gene,
bgl1, of Aspergillus saccharolyticus was cloned by PCR using degenerate primers followed by genome
walking, obtaining a 2919 bp genomic sequence coding for the BGL1 polypeptide. The genomic
sequence includes 6 introns and 7 exons resulting in a 860 aa polypeptide, BGL1, which has 91% and
82% identity with BGL1 from Aspergillus aculeatus and BGL1 from Aspergillus niger, respectively. The
bgl1 gene was heterologously expressed in Trichoderma reesei QM6a, purified, and characterized by
enzyme kinetics studies. The enzyme was able to hydrolyze cellobiose, pNPG, and cellodextrins. V
max

and K
M
for cellobiose were determined to be 45 U/mg and 1.9 mM, respectively. Using pNPG as
substrate, the enzyme was inhibited by glucose with a 50% reduction in activity at glucose
concentrations 30 times greater than the pNPG concentration. The pH optimum was 4.2, the enzyme
was stable at 50°C and at 60°C it had a halflife of approximately 6 hours. Generally the kinetics
observed for the pure BGL1 enzyme resembled those of raw extract of A. saccharolyticus previously
reported by our lab. BGL1 was identified as belonging to GH family 3. Through homology modeling, a
3D structure was proposed, finding retaining enzyme characteristics and, interestingly, a more open
catalytic pocket compared to other beta-glucosidases.

*Corresponding  author.  Mailing  address:  Section  for  Sustainable 
Biotechnology,  Copenhagen  Institute  of  Technology,  Aalborg 
University, Lautrupvang 15, 2750 Ballerup, Denmark. Phone: +45 
99402590. Email: psl@bio.aau.dk 
 
Research paper IV 
‐ IV.2 ‐ 
 
of interest. In addition to being indispensable for an efficient
cellulase system, beta-glucosidases themselves are also of great
interest as versatile industrial biocatalysts for their ability to
activate glucosidic bonds (transglycosylation activity)
facilitating synthesis of stereo/region-specific glycosides or
oligosaccharides. These may be useful as functional materials,
nutraceuticals or pharmaceuticals because of their biosignaling,
recognition, or antibiotic properties (48). Fungal beta-
glucosidases are classified into glycosyl hydrolase (GH) family
1 and 3. The GH3 enzymes, which are most abundant in the
fungal genomes

(11), are less well characterized than their GH1
homologues and only a few crystal structures have been solved,
one from barley (53), and preliminary structures from the
hyperthermophilic bacterium Thermotoga neapolitana

(40) and
the yeast Kluyveromyces marxianus

(59), and at present there is
no structure available from filamentous fungi

(11).
In a recent study, Aspergillus saccharolyticus was found to
produce beta-glucosidases with more efficient hydrolytic
activity compared to commercial beta-glucosidase containing
preparations, especially with regard to thermostability
(Research article II, this thesis). The aim of this work was to
identify, isolate, and characterize the most prominent beta-
glucosidase from A. saccharolyticus. We report the molecular
cloning of the novel beta-glucosidase gene, bgl1, and a model
prediction of its structure. The novel beta-glucosidase was
expressed in T. reesei for purification and the enzyme was then
characterized by Michaelis-Menten kinetic studies,
thermostability, pH optimum, glucose tolerance, and ability to
hydrolyze cellodextrins.
MATERIALS AND METHODS
Fungal strain and enzyme extract preparation. A. saccharolyticus CBS
127449
T
was initially isolated from treated hard wood (Research article III, this
thesis) and routinely maintained on potato dextrose agar. A solid state
fermentation enzyme extract of A. saccharolyticus was prepared as described in
research article II, this thesis.
Fractionation by ion exchange chromatography. The enzyme extract of A.
saccharolyticus was fractionated by ion exchange chromatography using an
ÄKTApurifier system with UNICORN software. HiTrap Q XL 1 ml anion
column (GE Healthcare) was run at a flow rate of 1 ml/min, 5 CV of buffer A
(Tris buffer pH 8) was used to equilibrate the column, 5 CV sample (approx 0.5
mg protein/ml) was loaded onto the column, followed by a 2 CV wash with
buffer A. Gradient elution was carried out over 30 CV with buffer B (Tris buffer
pH 8, 1M NaCl) reaching 70% of the total volume. The column was finally
washed with 5 CV buffer B and reequilibrated for the next run with buffer A.
Aliquots of 1ml were collected and assayed for beta-glucosidase activity as well
as quantified in terms of protein content, as described below.
Assays for beta-glucosidase activity and protein quantification. Beta-
glucosidase activity was assayed using using 5mM p-nitrophenyl-beta-D-
glucopyranoside (pNPG) (Sigma) in 50mM Na-Citrate buffer pH 4.8 as described
in research article II, this thesis.
Protein quantification was done using the Pierce BCA protein assay kit
microplate procedure according to manufacturer’s instructions (Pierce
Biotechnology), using bovine serum albumin as standard.
Electrophoresis. Sample preparation and electrophoresis was performed
using ClearPAGE precast gels and accessories (C.B.S. Scientific Company, Inc).
Samples were prepared by mixing 65 vol% protein, 25% 4xLDS sample buffer
(40% glycerol, 4% Ficoll-400, 0.8M Triethano amine pH 7.6, 6N HCl, 4%
Lithium dodecyl sulphate, 2mM EDTA di-sodium, 0.025% Brilliant blue G250,
0.025% Phenol red), and 10% 10x reducing agent (20mM DTT) and heating for
10 min at 70°C. 25 µl of each sample were loaded on a ClearPAGE 4-12% SDS-
gel, using ClearPAGE two-color SDS marker for band size approximation. The
gel was stained with ClearPAGE Instant Blue stain by placing the gel in a small
container, adding the Instant Blue stain till the gel was covered, followed by
shaking the gel gently for 10-30 minutes till desired band intensity was achieved.
No destaining was performed, but the gels were washed a few times in ultrapure
water, with gently shaking.
Mass Spectrometry and Protein Identification. Bands of interest were
excised from the gel, and in-gel digestion was performed as described by Kinter
and Sherman, 2000 (29). The trypsin digestion, and sample analysis was carried
out by The Laboratory for Biotechnology and Bioanalysis 2 (LBB2), Washington
State University, Pullman, Washington, USA, where analysis was performed by
LC-MS/MS using LC Packings Ultimate Nano high-performance liquid
chromatography system (with LC Packings monolithic column PS-DVB) and
Esquire HCT electrospray ion trap (Bruker Daltonics, Billerica, MA) as described
in their former publication (37). The Mascot search engine
(www.matrixscience.com) was used to search the peptide finger prints against
predicted peptides in the NCBI database with the significance threshold p<0.05.
Isolation and cloning of beta-glucosidase gene. Based on the Aspergillus
aculeatus peptide match found in the LC-MS/MS analysis, the corresponding full
length beta-glucosidase protein (GenBank: BAA10968) was submitted to a NCBI
blast search in the protein entries of GenBank
(http://blast.ncbi.nlm.nih.gov/Blast.cgi) to identify similar beta-glucosidases. An
alignment of these sequences was made with BioEdit
(http://www.mbio.ncsu.edu/BioEdit/bioedit.html) to identify conserved regions.
Degenerate primers were designed using the CODEHOP strategy (44): forward
primer: 5’CACGAAATGTACCTCtggcccttygc and reverse primer
5’CCTTGATCACGTTGTCGccrttcykcca. Genomic DNA of A. saccharolyticus
was isolated as described in research article II, this thesis. The primers were used
in polymerase chain reaction (PCR) with genomic DNA and RUN polymerase
(A&A Biotechnology), obtaining a fragment of approximately 950 bp. The band
was excised from the gel and sequenced using the sequencing service at MWG,
Germany, and was by NCBI blast found to be related to other aspergilli beta-
glucosidase fragments. From several rounds of genome walking (18), the
flanking regions were characterized, thereby obtaining the full genomic sequence
of the gene. The start and stop codon was predicted by NCBI blast comparison
and the GenScan Web server (http://genes.mit.edu/GENSCAN.html).
RNA was prepared from 4 day old fungal spores and mycelium grown on
plates containing 20 g/l wheat bran, 20 g/l corn steep liquor, 3 g/l NaNO3, 1 g/l
K2HPO4, 0.5 g/l KCl, 0.5 g/l MgSO47H2O, 0.01 g/l FeSO47H2O, 15g/l agar. The
cells were disrupted by bead beating (2x 20sec) in Fenozol supplied with the
Total RNA kit (A&A Biotechnology) and RNA purified following the kit
protocol. cDNA was prepared from total RNA using First strand cDNA synthesis
kit and random hexamer primers (Fermentas),
A cassette comprising Magnaporthe grisea ribosomal promoter RP27, the
beta-glucosidase genomic DNA gene, six histidine residues, and Neurospora
crassa beta-tubulin terminator was constructed using PCR cloning techniques and
was cloned into the PciI site of pAN7-1. The plasmid pAN7-1 containing the E.
coli hygB resistance gene was donated by Peter Punt (University of Leiden, The
Netherlands) (41). The promoter and terminator were from plasmid pSM565 (10)
and the beta-glucosidase gene was from A. saccharolyticus genomic DNA. PCR
was performed using proofreading WALK polymerase (A&A Biotechnology),
while restriction enzymes (fast digest PciI), alkaline phosphatase (fastAP), and
ligase (T4 DNA ligase) were from Fermentas. The construct pAS3-gBGL1 was
transformed into E. coli Top 10 competent cells (prepared using CaCl2 (45)) and
plated on LB plates (10 g/l bacto tryptone, 5 g/l yeast extract, 10 g/l NaCl, 15 g/l
agar, pH 7.5) with ampicillin selection (100ppm). Correct transformants were
checked for by colony PCR using several different promoter, beta-glucosidase,
and terminator specific primers. An overnight culture with a correct transformant
was prepared and the constructed cloning vector purified the following day
(E.Z.N.A. Plasmid Midi Kit, Omega Biotech). The final cloning vector, pAS3-
gBGL1, is sketched in Fig. 1.
Transformation and identification of active recombinant beta-
glucosidase in T. reesei. Protoplast preparation of T. reesei QM6a was carried
out similarly to the procedure described by Pentillä et al., 1987 (39). 100 ml
complete medium (10 g/l glucose, 2 g/l peptone, 1 g/l yeast extract, 1 g/l
casamino acids, 6 g/l NaNO3, 0.52 g/l KCl, 0.52 g/l MgSO47H2O, 1.52 g/l
KH2PO4, 22mg/l ZnSO47H2O, 11mg/l H3BO3, 5mg/l MnCl24H2O, 5mg/l
FeSO47H2O, 1.7mg/l CoCl26H2O, 1.6mg/l CuSO45H2O, 1.5mg/l
Na2MoO42H2O, and 50mg/l Na2EDTA) in a 500 ml baffled flask was inoculated
with fresh T. reesei conidia reaching a concentration of 10
6
spores per ml and
incubated for 16-22 hours at 30°C, 120rpm. The mycelium was collected on
double folded Miracloth (Andwin scientific) and washed with sterile water. The
mycelium was suspended in 20 ml protoplasting solution (1.2 M MgSO4, 50 mM
NaPO4 pH 5.8) with 60mg VinoTaste Pro (Novozymes A/S) enzyme per ml,
 
Research paper IV 
‐ IV.3 ‐ 
 
incubated for 2-4 hours at 30°C, 65 rpm, then filtered through double folded
Miracloth, and washed with a few ml protoplasting solution. The protoplasts were
overlaid with ST buffer (0.6 M sorbitol, 0.1M Tris-HCL pH 7.0) (approx. 20%
the volume of protoplasting solution) and centrifuged at 1000g for 10 min.
Protoplasts were collected from the interphase and washed twice with STC buffer
(1.0 M sorbitol, 10mM CaCl2 2H2O, 10mM Tris-HCl pH 7.5), finally
resuspending in STC buffer at a concentration of approximately 5x10
7
for
immediate use in transformation.
For transformation, 200 µl protoplasts, 10 µl plasmid DNA (>1µg), and 50 µl
PEG1 (25% PEG 6000 in STC buffer) were mixed gently and incubated on ice
for 20 min. 2 ml PEG2 (25% PEG 6000, 50mM CaCl2, 10mM Tris-HCl pH7.5)
was added and incubated 5 min at room temperature, followed by addition of 4
ml STC buffer. Aliquots of 1 ml were plates in recovery agar (1 g/l MgSO47H2O,
10 g/l KH2PO4, 6 g/l (NH4)2SO4, 3 g/l NaCitrate 2H2O, 10 g/l glucose, 182 g/l
sorbitol (final 1M), 5 mg/l FeSO47H2O, 1.6 mg/l MnSO4H2O, 1.4 mg/l
ZnSO4H2O, 2 mg/l CaCl22H2O, 15 g/l agar) with 100ppm hygromycin as
selection, and incubated at 28°C over night. The following day, a top layer of the
above described agar, again with 100ppm hygromycin, but without sorbitol, was
added, and the plates were incubated for another 2-4 days before colonies that
had surfaced were picked and carried through multiple retransfers and streaking
on selective medium to obtain pure colonies.
Identification of positive transformants was done by a simple pNPG activity
screen, where three 0.5x0.5cm agar plugs of the transformants were added to 10
ml growth medium (20 g/l wheat bran, 20 g/l corn steep liquor, 3g/l NaNO3, 1g/l
K2HPO4, 0.5 g/l KCl, 0.5 g/l MgSO47H2O, 0.01 g/l FeSO47H2O) in 50 ml Falcon
tubes and incubated at 30°C, 180rpm for five days. The supernatant was
collected, centrifuged at 10,000 rpm for 10 min and assayed for beta-glucosidase
activity using the pNPG assay described earlier. At these conditions, the wild
type QM6a showed no significant activity, so positive transformants were
identified by the presence of beta-glucosidase activity.
Purification of expressed beta-glucosidases. Using the HisSpin Trap kit
(GE Healthcare), following the protocol supplied with the kit, the optimal
imidazole concentration for purification of the histidine tagged beta-glucosidases
was found to be 0 mM imidazole.
The transformant having shown the greatest beta-glucosidase activity was
cultured in 150 ml growth medium (specified above) in a 500 ml baffled flask,
incubated at 30°C, 160 rpm for 6 days. The supernatant was centrifuged at 10,000
rpm for 10 min, filtered through a 0.22 µm filter (Millipore) and pH adjusted to
7.4.
The his-tagged beta-glucosidases were purified on the ÄKTApurifier system
with UNICORN software, using a HisTrap HP 5 ml anion column (GE
Healthcare), run at a flow rate of 5 ml/min. The column was equilibrated with 5
CV of binding buffer (20mM sodium phosphate, 0.5M NaCl, pH 7.4), 100 ml
sample was loaded onto the column, followed by washing with binding buffer till
the absorbance reached the baseline. The his-tagged beta-glucosidases were
eluted with 3 CV elution buffer (20mM sodium phosphate, 0.5M NaCl, 500mM
imidazole, pH 7.4) and the peak (1 CV) collected by monitoring the absorbance.
Assays for characterization of purified beta-glucosidases. Michaelis
Menten kinetics, glucose tolerance, termostability, pH optimum, and cellodextrin
hydrolysis were carried out as described in research article II, this thesis.
Sequence comparisons and homology modeling. Sequences similar to
BGL1 were located by BLAST (1) in the protein entries of GenBank (5) and
aligned using hidden Markov models (26) and CLUSTAL W (52). Similar beta-
glucosidase catalytic domain structures were obtained from the Protein Data
Bank (PDB; (6)), then superimposed and compared with the program O (24).
Multiple sequence alignments were used to generate the best pair-wise alignment
of the A. saccharolyticus beta-glucosidase with that of the T. neapolitana beta-
glucosidase 3B. This pair-wise alignment was the basis of creating a homology
model, with PDB entry 2X40 (40) as the template in the program SOD (30). The
model was adjusted in O, using rotamers that would improve packing in the
interior of the protein. The model is available upon request from the authors. The
figure was prepared using O, MOLSCRIPT (32) and Molray (19).
RESULTS
Identification of beta-glucosidase in A. saccharolyticus
extract
The enzyme extract of A. saccharolyticus produced by solid
state fermentation on wheat bran, was fractionated by ion
exchange chromatography, investigating the beta-glucosidase
activity and protein content of each fraction (Fig. 2). Protein
content could be measured in all fractions. Approximately 25%
of the proteins did not bind to the column, but passed through
prior to the start of the gradient elution. No beta-glucosidase
activity was found in this initial flow-through. The fractions
displaying the greatest beta-glucosidase activity were the
fractions #15-17 (Fig. 2). These fractions with eluted beta-
glucosidase were calculated to have a NaCl concentration of
approximately 0.14-0.23M. From SDS-page, one dominating
band of approximately 130 kDa was discovered in these
fractions (Fig. 2). The intensity of this band in the different
fractions followed the measured beta-glucosidase activity. The
proteins in this band were found to be highly expressed relative
to other proteins in the raw A. saccharolyticus extract (Fig. 3).
The band of fraction 16 was excised from the gel, trypsin
digested, analyzed by LC-MS/MS, and searched against the
NCBI database for peptide matches using the Mascot program.
The sample was identified as a beta-glucosidase, having
peptides identical to several aspergilli species, including A.
aculeatus (Swiss-Prot: P48825), A. terreus (NCBI ref seq
XP_001212225), A. niger (GenBank CAB75696), and A.
fumigatus (NCBI ref seq XP_750327). The best match was the
beta-glucosidase of A. aculeatus, with five peptide matches.
Besides of beta-glucosidase peptides, also peptide matches of
beta-galactosidase from different Aspergillus species were
found suggesting that the analyzed band contained more than
one protein. Only the results for the beta-glucosidase peptides
were used for degenerate primer design to obtain the
homologous beta-glucosidase of A. saccharolyticus.
Characterization of beta-glucosidase gene, bgl1, and
predicted protein, BGL1
By the use of degenerate primers and genome walking, the
genomic coding sequence of bgl1 of 2919 base pairs (incl stop
coden) was obtained (GenBank HM853555). The sequence
comprises seven exons, intercepted by six introns located at 58-
 
FIG.  1.  Sketch  of  the  cloning  vector,  pAS3‐gBGL1:  pAN7‐1  modified  with  a 
cassette  of  RP27  promoter,  beta‐glucosidase  gene  bgl1,  his‐tail,  and  beta‐
tubulin terminator inserted at the PciI restriction site. 
pAS3-gBGL1 sketch
10439bp
Ampicillin resistance gene
Beta-glucosidase gene
His tag
M13 (20) fw primer
M13 rev primer
gpdA promoter
RP27 promoter
ampR promoter
lac promoter
pBR322 origin of replication
TrpC terminator
Beta-tubulin terminator
Hygromycin resistance gene
lacZ
PciI(6402)
PciI(10082)
 
Research paper IV 
‐ IV.4 ‐ 
 
119, 263-313, 359-414, 468-523, 1716-1776, 2636-2685 bp,
which all followed the GT-AG rule at the intron/exon
junctions. The gene encodes a 860 amino acid polypeptide,
BGL1, predicted by NetAspGene 1.0 (54) and confirmed by
mRNA isolation and sequencing of the derived cDNA. A
signal peptide with a cleavage site between amino acid 19 and
20 was predicted by SignalP server (4, 36). A TATA-like
sequence at position -138 bp, a CCAAT box at position –695
bp, and several CreI sites at positions -145, -619, -1186, -1294,
and -1313 were identified upstream of the start codon. Analysis
of the predicted cDNA gene sequence revealed 85% identity
with bgl1 from A. aculeatus (GenBank D64088.1) (27) and
75% identity with bgl1 A. niger (NCBI ref seq
XM_001398779) (38).
The pI of BGL1 was calculated to 4.96 and the molecular
mass was calculated to 91 kDa using the ExPASy Proteomics
server (17). This prediction does not relate to the size of the
band in fraction 16 (Fig. 3), but from the NetNGlyc 1.0 server
(9) BGL1 has 12 asparagines that are potential N-linked
glycosylation sites. The molecular weight of 130 kDa observed
by SDSpage therefore probably reflects extensive
glycosylation.
The previous MS/MS data of the band in faction 16 was by
use of Mascot searched against possible trypsin fragments and
expected MS/MS patterns of the BGL1 sequence. The
observed MS/MS data matched the expected data, thus
confirming that the cloned bgl1 gene codes for the protein
present in fraction 16.
Analysis of the amino acid sequence of BGL1 resulted in
91% identity with beta-glucosidase BGL1 from A. aculeatus
(GenBank BAA10968) (27) and 82% identity with beta-
glucosidase BGL1 from A. niger (NCBI ref seq
XP_001398816) (38). Alignment of the amino acid sequence
of BGL1 from A. saccharolyticus with several aspergilli
glycosyl hydrolase (GH) family 3 beta-glucosidases revealed a
high degree of homology in highly conserved regions including
the catalytic sites (Fig. 4), and PROSITE scan (49) confirmed
the presence of a GH family 3 active site in BGL1, predicting
the signature sequence to be between amino acids 248-264
(LLKSELGFQGFVMSDWGA) in the mature protein. The
putative nucleophile, Asp261, of the mature BGL1 of A.
FIG. 2. Beta‐glucosidase activity and protein content of the different fractions from ion exchange. Fractions 2‐6 are flow through from the load, fractions 7‐8 are 
wash prior to gradient elution, fractions 9‐38 are gradient elution, and fractions 39‐45 are final column stripping. Top right corner: SDS‐page 4‐12% of fractions 
14‐23 with high beta‐glucosidase activity. 
 
0,000
0,020
0,040
0,060
0,080
0,100
0,120
0,140
0,160
0,0
0,5
1,0
1,5
2,0
2,5
3,0
1 2 3 4 5 6 7 8 9
1
0
1
1
1
2
1
3
1
4
1
5
1
6
1
7
1
8
1
9
2
0
2
1
2
2
2
3
2
4
2
5
2
6
2
7
2
8
2
9
3
0
3
1
3
2
3
3
3
4
3
5
3
6
3
7
3
8
3
9
4
0
4
1
4
2
4
3
4
4
R
e
a
c
t
i
o
n
 
r
a
t
e
 
(
µ
m
o
l
/
m
i
n
)
/
m
l
P
r
o
t
e
i
n
 
m
o
u
n
t
 
(
m
g
/
m
l
)
Fraction#
Beta‐glucosidase activity
 
FIG.  3.  SDS‐page  12‐20%,  lane  1)  A. 
saccharolyticus  raw  extract,  lane  2)  fraction 
#16  from  the  ion  exchange  fractionation,  lane 
3) His‐tag purified BGL1 
 
 
FIG.  4.  Alignment  of  proposed  active  site  region  (boxed)  of  different  aspergilli  GH3  beta‐
glucosidases, the GenBank accession number is given in parenthesis. 
 
Research paper IV 
‐ IV.5 ‐ 
 
saccharolyticus is located in this region (20).
Homology modeling studies show that A. saccharolyticus
beta-glucosidase, BGL1, catalytic module possesses a fold
similar to that of beta-glucosidase 3B from T. neapolitana with
5 deletions and 8 insertions compared to it (Fig. 5). Although
the sequence identity is relatively low (35%) it is obvious that
the residues important for substrate binding and catalysis are
conserved (Fig. 5A).
These results imply that BGL1 is a novel beta-glucosidase
belonging to GH family 3.
Heterologous expression of bgl1 by T. reesei
The bgl1 gene was heterologously expressed in T. reesei
from the constitutive RP27 ribosomal promoter. Positive
transformants were selected by simple pNPG assay, where the
negative control, wild type QM6a, showed no beta-glucosidase
activity at the culture and assay conditions used. The
transformant identified from the screening to have the highest
beta-glucosidase activity was confirmed by PCR to have the
expression cassette incorporated into its genomic DNA. Using
a Ni-sepharose column, the his-tagged proteins were purified
from an extract of the transformant. An SDS-page gel of the
eluent showed two bands (Fig. 3), one correlating in size with
the band found in fractions 15-17 in the initial fractionation of
the A. saccharolyticus extract (approximately 130 kDa) and
another that was smaller (approximately 90 kDa) correlating
with the predicted size of the protein. 3.8 mg purified protein
was obtained from 100 ml filtered culture extract, which
corresponded to about 2.7% of the total amount of protein in
the culture extract.
Characterization of the purified BGL1
The purified BGL1 was characterized by its activity on
pNPG and cellobiose.
A substrate saturation plot of BGL1 revealed inhibition of
the enzyme reaction, when pNPG in high concentrations was
used as substrate. This was observed by a decrease in reaction
rate with increasing substrate concentration rather than a
leveling off toward a maximum velocity (Fig. 6A).
Meanwhile, a MM kinetics relationship was found for
cellobiose, where the reaction rate tends towards the maximum
velocity (Fig. 6A). A Hanes plot of the cellobiose data gave a
good distribution of the data points for preparation of a straight
trendline from which V
max
and K
M
were determined to be 45
U/mg and 1.9 mM, respectively. Glucose inhibition was
investigated with pNPG as substrate, showing a reduction in
activity to 50% at a product concentration 30 times greater than
the substrate concentration (Fig. 6B).
BGL1 was incubated at different temperatures for different
time periods to investigate the thermostability and half-life of
the enzyme. At regularly used hydrolysis temperature of 50°C,
the enzyme was stable throughout the incubation period (data
not shown). The enzyme is fairly stable at temperatures up to
58°C at 4 hour incubation (Fig. 7A), and with temperatures
around 60°C the calculated half-life is approximately 6 hours
(Fig. 7A). From 62 °C and up to 65 °C there is a gradual
decrease in the half-life to less than 2.5 hours. The calculated
half-lives at different temperatures were plotted in a semi-
logarithmic plot vs. temperature (Fig. 7B). The data forms a
straight line, and the thermal activity number of BGL1, the
temperature that gives a half-life of 1 hour, was 65.3°C. The
pH span of BGL1 was examined at 50°C using pNPG as
substrate. Its profile gives the typical bell-shape curve with an
optimum around pH 4.2, and within the pH range 3.8-4.8 the
 
 
FIG  5.  Homology  model  of  the  catalytic  module  of  beta‐glucosidase,  BGL1, 
from  Aspergillus  saccharolyticus.  A.  Ribbon  cartoon  representation  of  the 
catalytic  module  showing  the  important  residues  for  catalysis  (in  royal‐
blue) and substrate/product binding (in spring‐green). Glucose (in gray) is 
modeled  into  the  catalytic  site.  The  part  of  the  loop  marked  ‘Y’  is  not 
modeled. B. Stereo diagram illustrating the comparison of beta‐glucosidase 
homology  model  of  A.  saccharolyticus  (in  steel‐blue)  with  the  template 
structure  from  T.  neapolitana  (PDB  entry  2X41)  (in  orange‐red).  The 
catalytic nucleophile (D261) and the acid/base (E490) are shown in gold. 
 
Research paper IV 
‐ IV.6 ‐ 
 
activity stayed above 90% of maximum. At alkaline conditions,
activity was below 10%, showing that acidic pH values are
better suited for enzyme activity (Fig. 7C).
The ability of BGL1 to hydrolyze short chains of glucose
units was studied with cellohexaose, -pentaose, -tetraose, and -
triose, where only data for cellohexaose hydrolysis is shown
here (Fig. 8). Initially, as the level of cellohexaose decreases,
the concentration of primarily cellopentaose and glucose
increase. Later, as the concentration of cellopentaose has
increased, an increase in cellotetraose is observed, indicating
that the enzyme hydrolyzes the different cellodextrins
depending on the concentration in which they occur. Similar
results were obtained using cellopentaose, -tetraose, and –triose
as initial substrates. These observations of the different
cellodextrins increasing in concentration over time related to
their length suggests that the enzyme hydrolyzes the different
cellodextrins through exohydrolase action, removing one
glucose unit at the time releasing glucose and the one unit
shorter product before it associates with another substrate,
rather than processively cleaving off glucose units.
 
FIG. 6. A) Substrate saturation plot where enzyme activity is related to substrate concentration with the two substrates, pNPG and cellobiose. B) Relative beta‐
glucosidase activity at different inhibitor concentrations with a substrate concentration of 5mM pNPG. 
FIG. 7. A) Thermostability of BGL1 incubated at different temperatures for different time period followed by assaying at 50°C, pH 4.8, 10 min reactions. T½= half‐
life, calculated for temperatures above 60°C. B) Semi‐logarithmic plot of calculated half life at different temperatures.  The x‐axis intercept indicates the thermal 
activity number, temperature at which the half life is one hour. C) pH profile of BGL1 assayed at 50°C, varying pH, 10 min reactions. 
 
 
FIG. 8. Snap shot at different time points of the hydrolysis of cellohexaose 
for analysis of the degradation pattern. G1= glucose, G2= cellobiose, G3= 
cellotriose, G4= cellotetraose, G5= cellopentaose, G6= cellohexaose. 
0
5
10
15
20
25
0 5 10 15 20 25 30
C
o
n
c
 
(
u
M
)
Time (min)
G1
G2
G3
G4
G5
G6
 
Research paper IV 
‐ IV.7 ‐ 
 

DISCUSSION
We have cloned a beta-glucosidase, BGL1, from the novel
species A. saccharolyticus (Research article III, this thesis) and
expressed it in T. reesei in order to purify the enzyme for a
specific characterization.
Initially, we used ionexchange fractionation of the raw
enzyme extract of A. saccharolyticus followed by LC-MS/MS
analysis of the dominating protein band in the fractions with
high beta-glucosidase activity. This was applied for the
identification of active beta-glucosidases from A.
saccharolyticus. Aspergilli are known to possess several beta-
glucosidases in their genomes, e.g. A. niger has 11 GH3 beta-
glucosidases predicted (38) of which 6 were identified as
extracellular proteins by the SignalP 1.0 server (4, 36). With
this approach we intended to identify the key beta-glucosidase
player amongst the potential several expressed beta-
glucosidases of A. saccharolyticus.
Ion exchange separates molecules on the basis of
differences in their net surface charge. The net surface charge
of proteins will change gradually as pH of the environment
changes (2). The isoelectric point (pI) of the 6 predicted A.
niger secreted beta-glucosidases (38) were, using ExPASY
proteomics server (17), calculated to around pH 5. Assuming
the pI of the secreted A. saccharolyticus beta-glucosidases are
in the same range, an anion column was chosen for ion
exchange using Tris buffer pH 8, as proteins will bind to an
anion exchanger at pH above its isoelectric point (2). The beta-
glucosidases of A. saccharolyticus did bind to the column at
these conditions, with no activity found in the initial flow
through fractions, and analysis of the later deducted amino acid
sequence of BGL1 was calculated to have a pI of 4.96,
correlating well with the above.
Proteomics is useful for the identification of secreted
proteins and have been used for the identification of beta-
glucosidases of A. fumigatus (28). MS/MS peptide analysis
followed by molecular techniques were here employed for the
identification and cloning of beta-glucosidases from A.
saccharolyticus,. From LC-MS/MS analysis, peptides of a
beta-glucosidase and a beta-galactosidase were identified in the
protein band that was dominating in the protein fractions with
high beta-glucosidase activity, indicating that it had not been a
pure band, but rather had it contained both a beta-glucosidase
and a beta-galactosidase of A. saccharolyticus. Only the
identification of the beta-glucosidase was further pursued.
By genome walking, the beta-glucosidase was successfully
cloned, and the size of its cDNA corresponded well with the
beta-glucosidases of A. aculeatus (GenBank: BAA10968) and
A. niger (GenBank: XP_001398816) to which it is most closely
related. However, the predicted polypeptide size of the cloned
beta-glucosidase was only 91 kDa compared to the
approximately 130 kDa band seen in the SDS-page gel.
Glycosylation of beta-glucosidases is common (13, 14, 23, 33,
35) and it was therefore assumed that the SDS-page gel size
estimation of the protein was mislead by glycosylation that
makes the protein run slower in the gel, which has also been
seen with beta-glucosidases from Talaromyces emersonii
expressed in T. reesei (35). Several potential N-glycosylation
sites were identified for BGL1, supporting this assumption.
Based on interest in obtaining knowledge of regulation of bgl1
expression in A. saccharolyticus, putative binding sites for the
cellulose regulatory protein, CREI, were searched for upstream
of the bgl1 gene. Five putative CreI sites were found within the
1350 pb sequence upstream of the gene obtained by genome
walking. CREI is known to be involved in carbon catabolite
repression of many fungal cellulase genes.
BGL1 was based on its amino acid sequence characterized
as belonging to the GH family 3, matching the active site
signature (11, 20). Several GH3 beta-glucosidases have been
cloned and characterized, but few studies have been published
on heterologous expression by T. reesei, while several have
been expressed by E. coli, and some by Yeast (8). One example
of expression by T. reesei is the beta-glucosidase, cel3a cDNA,
of T. emersonii where the chb1 promoter and terminator of T.
reesei were used (35). Another example is the T. reesei
production strain by Novozymes A/S expressing A. oryzae
beta-glucosidase for improved cellulose conversion (34). We
here present heterologous expression of bgl1 from A,
saccharolyticus by T. reesei QM6a using the constitutive M.
grisea ribosomal promoter RP27 and the N. crassa beta-tubulin
terminator to control expression of the gDNA clone of bgl1,
thereby successfully combining host, promoter, gene, and
terminator from different eukaryotes. The host strain was
transformed with the non-linearized plasmid for random
insertion, giving recombinant protein yields of 3.8mg/100ml
from 6 days cultivation of the best transformant. This is
significantly greater than the expression levels reached with T.
emersonii beta-glucosidase (35), but still low compared to the
secretion capacity of T. reesei (34).
Interestingly, it appeared that T. reesei secreted the
heterologously expressed BGL1 in two different forms
represented by the two bands on the SDS-page gel of the
histidine-tag purified proteins. It is speculated that these two
different bands represent different degrees of glycolysation, the
large band being glycosylated to the same extent as found in
the A. saccharolyticus secreted BGL1, and the smaller band
correlating with the predicted molecular mass thus not being
glycosylated. Postsecretional modification of glycosylated
proteins expressed by T. reesei is medium dependent, with the
effect on extracellular hydrolases being most dominating in
enriched medium (50), possibly explaining the different forms
of the recombinant BGL1 beta-glucosidases.
BGL1 is classified as a broad specificity beta-glucosidase as
it can hydrolyze both aryl-beta-glycosides, cellobiose, and
cellooligo-saccharides (8). Comparing the properties of A.
saccharolyticus BGL1 to other Aspergillus beta-glucosidases,
the observed inhibition at high pNPG substrate concentrations
has also been reported for A. niger (33, 47, 58), A. aculeatus
and A. japonicus (14). Whether the inhibition of A.
saccharolyticus BGL1 is due to regular substrate inhibition
 
Research paper IV 
‐ IV.8 ‐ 
 
kinetics with an additional pNPG binding to the substrate-
enzyme complex hindering release of product, or if
transglycosylation occurs with pNPG playing the role of the
nucleophile competing with a water molecule in breaking the
enzyme-product complex, is not known. BGL1 had a K
M
value
of cellobiose comparable with other reported values for
Aspergillus beta-glucosidases, with K
M
values of 2-3 mM for
A. phoenicis, A. niger, and A. carbonarius beta-glucosidases
(22), 1 mM for A. japonicus (31), and a general literature
search by Jäger et al., 2001, showing K
M
varying from 1.5-5.6
mM for A. niger (22). Meanwhile, the specific activity, V
max
, of
A. saccharolyticus BGL1 was significantly higher than values
reported for other purified Aspergillus beta-glucosidases, with
cellobiose as substrate in hydrolysis (Table 1) (22, 42, 57).
Hydrolysis of cellodextrins was facilitated by BGL1, as has
also been found with A. niger beta-glucosidase, that similarly
in exo-fashion removes one glucose unit at the time from the
end of cellodextrins, so that products released are subsequently
used as substrates to be shortened by another glucose (47).
Acidic pH being best suited for beta-glucosidase activity
was also found for beta-glucosidases from A. oryzae, A.
phoenicis, A. carbonarius, A. aculeatus, A. foetidus, A.
japonicus, A. niger, and A. tubingensis with optima ranging pH
4-5, and close to no activity at alkaline conditions (14, 22, 31,
43). Thermal stability, however, is more difficult to compare as
different researches use different incubation conditions, times
and temperatures. We found A. saccharolyticus BGL1 to be
more thermostable compared with Novozym 188 from A.
niger, as it retained more than 90% activity at 60°C and still
had approx. 10 % activity at 67°C after 2 hours of incubation,
while Novozym 188 had 75% activity at 60°C but no activity at
67
o
C after 2 hours of incubation (Research article II, this
thesis). After 4 hours of incubation these differences is much
more pronounced as our BGL1 still had more than 70 %
activity while Novozym 188 drop to 40 % activity at 60°C.
Jäger et al., 2001, studied beta-glucosidases from A. phoenicis,
A. niger, A. carbonarius, finding them all to be stable at 2
hours incubation at 50°C, while activities of 87%, 64%, and
53%, respectively, remained after 2 hours incubation at 60°C,
and total inactivation was observed after 2 hours at 70°C (22).
Compared to this, A. saccharolyticus BGL1 showed
approximately the same stability as A. phoenicis expect for the
total inactivation at 70°C. Rojaka et al., 2006, similarly find
half-life of A. niger beta-glucosidase to be 8 hours at 55°C and
4 hours at 60°C (42), which is similar to our results (Research
article II, this thesis), whereas Krogh et al., 2010, indicate a
half-life for A. niger BGL of 24 hours at 60°C. This is six times
longer than measured by us and Rojaka et al., 2006. Decker et
al., 2000, demonstrates that an A. japonicus and A. tubingensis
beta-glucosidase were remarkably stable, maintaining 85% and
90% activity, respectively, after 20 hours incubation at 60°C
(14). However, Korotkova et al., 2009, found A. japonicus
beta-glucosidase to only retain 57% of its activity after
incubation for 1 hour at 50°C (31), contradicting the findings
of Dekker et al., 2000.
The crude extract of A. saccharolyticus, from which BGL1
was identified, has previously been characterized by its beta-
glucosidase activity and evaluated against two commercial
enzyme preparations (Research article II, this thesis).
Comparing the enzyme kinetics, temperature and pH profiles,
glucose tolerance, and cellodextrin hydrolysis, a striking
similarity was found for the crude extract and the purified
BGL1. Substrate inhibition (or transglycosylation activity) with
pNPG was found in both cases, while none was observed for
cellobiose within the tested concentrations. There was therefore
no foundation for the calculation of V
max
and K
M
for pNPG as
no tendency of the activity approaching a maximum was seen
rather the activity decreased with higher substrate
concentrations. Therefore V
max
and K
M
were only calculated
for cellobiose where the data correlated well with MM kinetics
and a straight Hanes plot could be obtained for determination
of the kinetic parameters. Calculated K
M
values for cellobiose
were similar, 1.9 mM for the purified BGL1 vs. 1.09 mM for
the crude extract, while the V
max
value expectedly increased for
the purified BGL1 compared to the crude extract. The pure
enzyme was inhibited by glucose to the same extent as the
crude extract, the pH and temperature profiles were very
similar, and the mode of hydrolysis of cellodextrins was
consistent. This all together indicate that BGL1 is the main
contributor to the beta-glucosidase activity observed in the
crude extract of A. saccharolyticus.
The crystal structure of a beta-glucosidase from barley has
recently been used as template to construct a homology model
of a beta-glucosidase from Penicillium purpurogenum where
superimposition of the modeled structure on the true structure
from barley showed similar orientation and location of the
conserved catalytic residues (23). We chose to use the recently
resolved crystal structure of a T. neopolitana beta-glucosidase
to construct a homology model of the A. saccharolyticus BGL1
and found that the conserved catalytically important residues
show that the enzyme possesses beta-glucosidase activity (Fig.
5A). The deletion of loop X (Fig. 5B), having Ser370 described
to have weak H-bonds with glucose in -1 subsite in T.
neapolitana structure, makes the catalytic pocket wider where
this may be important for substrate accessibility as well as to
remove the product fast from the enzyme. The insertions and
deletions lining the catalytic pocket (Fig. 5B) may play a major
role in the dynamics of the enzyme. The motif KHFV, Lys163,
His164, Phe165, Val166, in the T. neapolitana structure is
considered to be important for substrate recognition (40).
However, this motif in the A. saccharolyticus enzyme is
slightly different, KHYI, Lys170, His171, Tyr172 and Ile173.
Table 1. Comparison of Vmax values reported in the literature for hydrolysis of 
cellobiose by purified beta‐glucosidases, either heterologously expressed or 
directly purified from extract of origin. 
Organism ID  Vmax 
(U/mg) 
Assay conditions 
(°C, pH) 
Reference
A. saccharolyticus CBS 127449  49  50, 4.8  This work
A. niger NIAB280 36.5  50, 5.0  (42)
A. niger CCRC31494 5.27  40, 4.0  (58)
A. niger BKMF‐1305 38.8  50, 4.0  (22)
A. carbonarius KLU‐93 15.4  50, 4.0  (22)
A. phoenicis QM329 27.3  50, 4.0  (22)
 
 
Research paper IV 
‐ IV.9 ‐ 
 
The homology modeling revealed that the catalytic pocket of A.
saccharolyticus beta-glucosidase is open compared to those of
barley (PDB entry 1LQ2) (21), Pseudoalteromonas sp. BB1
(PDB entry 3F94) and T. neapolitana (40) indicating possible
high activity. The distance between the putative nucleophile
(D261) and the acid/base (E490) is approximately 5.8Å
displaying the general characteristic of a retaining enzyme.
In conclusion, we have successfully identified and
expressed a novel highly efficient beta-glucosidase from the
newly discovered species A. saccharolyticus. The enzyme has a
great potential for use in industrial bioconversion processes due
to its high degree of thermostability compared to the
commercial beta-glucosidase from A. niger (Novozym 188) as
well as a high specific activity.
ACKNOWLEDGEMENTS
We thank Professor Dr. Peter Punt (University of Leiden, The
Netherlands) for providing the pAN7-1 vector. The authors highly
appreciate the advice and guidance on Trichoderma expression by
Shuang Deng,. Gerhard Munske (Washington State University, USA)
is thanked for his help on analyzing LC-MS/MS data.
Financial support from Danish Council for Strategic Research and
DANSCATT is acknowledged.
REFERENCES
1. Altschul, S. F., T. L. Madden, A. A. Schaffer, J. H. Zhang, Z. Zhang, W.
Miller, and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new
generation of protein database search programs. Nucleic Acids Res. 25:3389-
3402.
2. Amersham Biosciences. 2004. Ion Exchange Chromatography and
Chromatofocusing - Principles and Methods. Amersham Biosciences Limited,
Uppsala, Sweden.
3. Beguin, P., and J. P. Aubert. 1994. The Biological Degradation of Cellulose.
FEMS Microbiol. Rev. 13:25-58.
4. Bendtsen, J. D., H. Nielsen, G. von Heijne, and S. Brunak. 2004. Improved
prediction of signal peptides: SignalP 3.0. J. Mol. Biol. 340:783-795.
5. Benson, D. A., I. Karsch-Mizrachi, D. J. Lipman, J. Ostell, and D. L. Wheeler.
2004. GenBank: update. Nucleic Acids Res. 32:D23-D26.
6. Berman, H. M., J. Westbrook, Z. Feng, G. Gilliland, T. N. Bhat, H. Weissig, I.
N. Shindyalov, and P. E. Bourne. 2000. The Protein Data Bank. Nucleic Acids
Res. 28:235-242.
7. Bhat, M. K., and S. Bhat. 1997. Cellulose degrading enzymes and their potential
industrial applications. Biotechnol. Adv. 15:583-620.
8. Bhatia, Y., S. Mishra, and V. S. Bisaria. 2002. Microbial beta-glucosidases:
Cloning, properties, and applications. Crit. Rev. Biotechnol. 22:375-407.
9. Blom, N., T. Sicheritz-Ponten, R. Gupta, S. Gammeltoft, and S. Brunak. 2004.
Prediction of post-translational glycosylation and phosphorylation of proteins
from the amino acid sequence. Proteomics. 4:1633-1649.
10. Bourett, T. M., J. A. Sweigard, K. J. Czymmek, A. Carroll, and R. J.
Howard. 2002. Reef coral fluorescent proteins for visualizing fungal pathogens.
Fungal Genetics and Biology. 37:211-220.
11. Cantarel, B. L., P. M. Coutinho, C. Rancurel, T. Bernard, V. Lombard, and
B. Henrissat. 2009. The Carbohydrate-Active EnZymes database (CAZy): an
expert resource for Glycogenomics. Nucleic Acids Res. 37:D233-D238.
12. Coughlan, M. P. 1992. Enzymatic-Hydrolysis of Cellulose - an Overview.
Bioresour. Technol. 39:107-115.
13. Dan, S., I. Marton, M. Dekel, B. A. Bravdo, S. M. He, S. G. Withers, and O.
Shoseyov. 2000. Cloning, expression, characterization, and nucleophile
identification of family 3, Aspergillus niger beta-glucosidase. J. Biol. Chem.
275:4973-4980.
14. Decker, C. H., J. Visser, and P. Schreier. 2000. Beta-glucosidases from five
black Aspergillus species: Study of their physico-chemical and biocatalytic
properties. J. Agric. Food Chem. 48:4929-4936.
15. Duff, S. J. B., D. G. Cooper, and O. M. Fuller. 1987. Effect of Media
Composition and Growth-Conditions on Production of Cellulase and Beta-
Glucosidase by a Mixed Fungal Fermentation. Enzyme Microb. Technol. 9:47-
52.
16. Duff, S. J. B., and W. D. Murray. 1996. Bioconversion of forest products
industry waste cellulosics to fuel ethanol: A review. Bioresour. Technol. 55:1-33.
17. Gasteiger, E., C. Hoogland, A. Gattiker, S. Duvaud, M. R. Wilkins, R. D.
Appel, and A. Bairoch. 2005. Protein Identification and Analysis Tools on the
ExPASY Server, p. 571-607. In J. M. Walker (ed.), The Proteomics Protocols
Handbook. Humana Press Inc., Totowa, NJ.
18. Guo, H., and J. Xiong. 2006. A specific and versatile genome walking
technique. Gene. 381:18-23.
19. Harris, M., and T. A. Jones. 2001. Molray - a web interface between O and the
POV-Ray ray tracer. Acta Crystallographica Section D-Biological
Crystallography. 57:1201-1203.
20. Henrissat, B. 1991. A Classification of Glycosyl Hydrolases Based on Amino-
Acid-Sequence Similarities. Biochem. J. 280:309-316.
21. Hrmova, M., R. De Gori, B. J. Smith, A. Vasella, J. N. Varghese, and G. B.
Fincher. 2004. Three-dimensional structure of the barley beta-D-glucan
glucohydrolase in complex with a transition state mimic. J. Biol. Chem.
279:4970-4980.
22. Jager, S., A. Brumbauer, E. Feher, K. Reczey, and L. Kiss. 2001. Production
and characterization of beta-glucosidases from different Aspergillus strains.
World J. Microbiol. Biotechnol. 17:455-461.
23. Jeya, M., A. Joo, K. Lee, M. K. Tiwari, K. Lee, S. Kim, and J. Lee. 2010.
Characterization of beta-glucosidase from a strain of Penicillium purpurogenum
KJS506. Appl. Microbiol. Biotechnol. 86:1473-1484.
24. Jones, T. A., J. Y. Zou, S. W. Cowan, and M. Kjeldgaard. 1991. Improved
Methods for Building Protein Models in Electron-Density Maps and the Location
of Errors in these Models. Acta Crystallographica Section a. 47:110-119.
25. Joo, A., M. Jeya, K. Lee, W. Sim, J. Kim, I. Kim, Y. Kim, D. Oh, P.
Gunasekaran, and J. Lee. 2009. Purification and characterization of a beta-1,4-
glucosidase from a newly isolated strain of Fomitopsis pinicola . Appl.
Microbiol. Biotechnol. 83:285-294.
26. Karplus, K., S. Katzman, G. Shackleford, M. Koeva, J. Draper, B. Barnes,
M. Soriano, and R. Hughey. 2005. SAM-T04: What is new in protein-structure
prediction for CASP6. Proteins-Structure Function and Bioinformatics. 61:135-
142.
27. Kawaguchi, T., T. Enoki, S. Tsurumaki, J. Sumitani, M. Ueda, T. Ooi, and
M. Arai. 1996. Cloning and sequencing of the cDNA encoding beta-glucosidase
1 from Aspergillus aculeatus. Gene. 173:287-288.
28. Kim, K., K. M. Brown, P. V. Harris, J. A. Langston, and J. R. Cherry. 2007.
A proteomics strategy to discover beta-glucosidases from Aspergillus fumigatus
with two-dimensional page in-gel activity assay and tandem mass spectrometry.
Journal of Proteome Research. 6:4749-4757
29. Kinter, M., and N. E. Sherman. 2000. The Preparation of Protein Digests for
Mass Spectrometric Sequencing Experiments, p. 147-165. In Anonymous Protein
Sequencing and Identification Using Tandem Mass Spectrometry. John Wiley &
Sons, Inc., New York.
30. Kleywegt, G. J., J. Y. Zou, M. Kjeldgaard, and T. A. Jones. 2001. Around O,
p. 353-356, 366-367. In M. G. Rossmann and E. Arnold (eds.), International
Tables for Crystallography, Volume F: Crystallography of biological
macromolecules. Kluwer Academic Publishers, Dordrecht, The Netherlands.
31. Korotkova, O. G., M. V. Semenova, V. V. Morozova, I. N. Zorov, L. M.
Sokolova, T. M. Bubnova, O. N. Okunev, and A. P. Sinitsyn. 2009. Isolation
and properties of fungal beta-glucosidases. Biochemistry-Moscow. 74:569-577.
32. Kraulis, P. J. 1991. Molscript - a Program to Produce both Detailed and
Schematic Plots of Protein Structures. Journal of Applied Crystallography.
24:946-950.
33. Krogh, K. B. R. M., P. V. Harris, C. L. Olsen, K. S. Johansen, J. Hojer-
Pedersen, J. Borjesson, and L. Olsson. 2010. Characterization and kinetic
analysis of a thermostable GH3 β-glucosidase from Penicillium brasilianum .
Applied Microbiology & Biotechnology. 86:143-154.
34. Merino, S. T., and J. Cherry. 2007. Progress and challenges in enzyme
development for Biomass utilization. Biofuels. 108:95-120.
35. Murray, P., N. Aro, C. Collins, A. Grassick, M. Penttila, M. Saloheimo, and
M. Tuohy. 2004. Expression in Trichoderma reesei and characterisation of a
thermostable family 3 beta-glucosidase from the moderately thermophilic fungus
Talaromyces emersonii . Protein Expr. Purif. 38:248-257.
 
Research paper IV 
‐ IV.10 ‐ 
 
36. Nielsen, H., J. Engelbrecht, S. Brunak, and G. vonHeijne. 1997. Identification
of prokaryotic and eukaryotic signal peptides and prediction of their cleavage
sites. Protein Eng. 10:1-6.
37. Noh, S. M., K. A. Brayton, W. C. Brown, J. Norimine, G. R. Munske, C. M.
Davitt, and G. H. Palmer. 2008. Composition of the surface proteome of
Anaplasma marginale and its role in protective immunity induced by outer
membrane immunization. Infect. Immun. 76:2219-2226.
38. Pel, H. J., J. H. de Winde, D. B. Archer, P. S. Dyer, G. Hofmann, P. J.
Schaap, G. Turner, R. P. de Vries, R. Albang, K. Albermann, M. R.
Andersen, J. D. Bendtsen, J. A. E. Benen, M. van den Berg, S. Breestraat, M.
X. Caddick, R. Contreras, M. Cornell, P. M. Coutinho, E. G. J. Danchin, A.
J. M. Debets, P. Dekker, P. W. M. van Dijck, A. van Dijk, L. Dijkhuizen, A.
J. M. Driessen, C. d'Enfert, S. Geysens, C. Goosen, G. S. P. Groot, P. W. J.
de Groot, T. Guillemette, B. Henrissat, M. Herweijer, J. P. T. W. van den
Hombergh, C. A. M. J. J. van den Hondel, R. T. J. M. van der Heijden, R.
M. van der Kaaij, F. M. Klis, H. J. Kools, C. P. Kubicek, P. A. van Kuyk, J.
Lauber, X. Lu, M. J. E. C. van der Maarel, R. Meulenberg, H. Menke, M. A.
Mortimer, J. Nielsen, S. G. Oliver, M. Olsthoorn, K. Pal, N. N. M. E. van
Peij, A. F. J. Ram, U. Rinas, J. A. Roubos, C. M. J. Sagt, M. Schmoll, J. Sun,
D. Ussery, J. Varga, W. Vervecken, P. J. J. v. de Vondervoort, H. Wedler, H.
A. B. Wosten, A. Zeng, A. J. J. van Ooyen, J. Visser, and H. Stam. 2007.
Genome sequencing and analysis of the versatile cell factory Aspergillus niger
CBS 513.88. Nat. Biotechnol. 25:221-231
39. Penttila, M., H. Nevalainen, M. Ratto, E. Salminen, and J. Knowles. 1987. A
Versatile Transformation System for the Cellulolytic Filamentous Fungus
Trichoderma reesei . Gene. 61:155-164.
40. Pozzo, T., J. L. Pasten, E. N. Karlsson, and D. T. Logan. 2010. Structural and
Functional Analyses of beta-Glucosidase 3B from Thermotoga neapolitana: A
Thermostable Three-Domain Representative of Glycoside Hydrolase 3. J. Mol.
Biol. 397:724-739.
41. Punt, P. J., R. P. Oliver, M. A. Dingemanse, P. H. Pouwels, and C. A. van den
Hondel. 1987. Transformation of Aspergillus based on the hygromycin B
resistance marker from Escherichia coli . Gene. 56:117-124.
42. Rajoka, M. I., M. W. Akhtar, A. Hanif, and A. M. Khalid. 2006. Production
and characterization of a highly active cellobiase from Aspergillus niger grown in
solid state fermentation. World J. Microbiol. Biotechnol. 22:991-998.
43. Riou, C., J. M. Salmon, M. J. Vallier, Z. Gunata, and P. Barre. 1998.
Purification, characterization, and substrate specificity of a novel highly glucose-
tolerant beta-glucosidase from Aspergillus oryzae . Appl. Environ. Microbiol.
64:3607-3614.
44. Rose, T. M., J. G. Henikoff, and S. Henikoff. 2003. CODEHOP (COnsensus-
DEgenerate hybrid oligonucleotide primer) PCR primer design. Nucleic Acids
Res. 31:3763-3766.
45. Sambrook, J., and D. W. Russel. 2001. Molecular Cloning - A laboratory
manual. Cold Spring Harbor Laboratory Press, New York.
46. Schuster, E., N. Dunn-Coleman, J. C. Frisvad, and P. W. M. van Dijck. 2002.
On the safety of Aspergillus niger - a review. Appl. Microbiol. Biotechnol.
59:426-435.
47. Seidle, H. F., I. Marten, O. Shoseyov, and R. E. Huber. 2004. Physical and
kinetic properties of the family 3 beta-glucosidase from Aspergillus niger which
is important for cellulose breakdown. Protein Journal. 23:11-23.
48. Shaikh, F. A., and S. G. Withers. 2008. Teaching old enzymes new tricks:
engineering and evolution of glycosidases and glycosyl transferases for improved
glycoside synthesis. Biochemistry and Cell Biology-Biochimie Et Biologie
Cellulaire. 86:169-177.
49. Sigrist, C. J. A., L. Cerutti, E. de Castro, P. S. Langendijk-Genevaux, V.
Bulliard, A. Bairoch, and N. Hulo. 2010. PROSITE, a protein domain database
for functional characterization and annotation. Nucleic Acids Res. 38:D161-
D166.
50. Stals, I., K. Sandra, S. Geysens, R. Contreras, J. Van Beeumen, and M.
Claeyssens. 2004. Factors influencing glycosylation of Trichoderma reesei
cellulases. I: Postsecretorial changes of the O- and N-glycosylation pattern of
Cel7A. Glycobiology. 14:713-724.
51. Sternberg, D., P. Vijayakumar, and E. T. Reese. 1977. Beta-Glucosidase -
Microbial-Production and Effect on Enzymatic-Hydrolysis of Cellulose. Can. J.
Microbiol. 23:139-147.
52. Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. Clustal-W -
Improving the Sensitivity of Progressive Multiple Sequence Alignment through
Sequence Weighting, Position-Specific Gap Penalties and Weight Matrix Choice.
Nucleic Acids Res. 22:4673-4680.
53. Varghese, J. N., M. Hrmova, and G. B. Fincher. 1999. Three-dimensional
structure of a barley beta-D-glucan exohydrolase, a family 3 glycosyl hydrolase.
Structure. 7:179-190.
54. Wang, K., D. W. Ussery, and S. Brunak. 2009. Analysis and prediction of gene
splice sites in four Aspergillus genomes. Fungal Genetics and Biology. 46:S14-
S18.
55. Wood, T. M., and V. Garcia-Campayo. 1990. Enzymology of cellulose
degradation. Biodegradation. 1:147-161.
56. Woodward, J., and A. Wiseman. 1982. Fungal and Other Beta-D-Glucosidases
- their Properties and Applications. Enzyme Microb. Technol. 4:73-79.
57. Yan, T. R., and C. L. Lin. 1997. Purification and characterization of a glucose-
tolerant beta-glucosidase from Aspergillus niger CCRC 31494. Bioscience
Biotechnology and Biochemistry. 61:965-970.
58. Yan, T. R., Y. H. Lin, and C. L. Lin. 1998. Purification and characterization of
an extracellular beta-glucosidase II with high hydrolysis and transglucosylation
activities from Aspergillus niger. J. Agric. Food Chem. 46:431-437.
59. Yoshida, E., M. Hidaka, S. Fushinobu, T. Koyanagi, H. Minami, H. Tamaki,
M. Kitaoka, T. Katayama, and H. Kumagai. 2009. Purification, crystallization
and preliminary X-ray analysis of beta-glucosidase from Kluyveromyces
marxianus NBRC1777. Acta Crystallographica Section F-Structural Biology and
Crystallization Communications. 65:1190-1192.

 
 
 
 
Patent 
 
 
PA 2010 7034 
Beta‐glucosidases and nucleic acids encoding same 
 
 
Annette Sørensen, Birgitte K. Ahring, Philip J. Teller, and Peter S. Lübeck  
 
Filed July 30, 2010 
 
 
 
 
 
PA 2010 7034 – Beta‐glucosidases and nucleic acids encoding same 
 
‐ v ‐ 
 
SUMMARY OF THE INVENTION 
The  present  invention  relates  to  the  identification  of  a  novel  and  improved  beta‐glucosidase  producing 
strain of the fungus Aspergillus, namely Aspergillus saccharolyticus, which is efficient in the degradation of 
lignocellulosic  biomasses  into  glucose  for  production  of  biofuels,  biochemicals  and  pharmaceuticals. 
Several enzymes of the newly identified strain are efficient in degradation of lignocellulosic biomasses. In 
particular one enzyme has been identified and characterised as having improved beta‐glucosidase activity. 
The  identified  beta‐glucosidase  has  improved  thermal  stability,  while  maintaining  its  activity  at  a  high 
level for a prolonged period of time compared to other fungal beta‐glucosidases. This makes it a superior 
choice for degradation of lignocellulosic material.  
In one aspect, the present invention relates to An isolated polypeptide comprising  
a. an amino acids consisting of the SEQ NO:1,  
b. a  biologically  active  sequence  variant  of  SEQ  NO:1,  wherein  the  variant  has  at  least  92% 
sequence identity to said SEQ NO:1, or 
c. a  biologically  active  fragment  of  at  least  30  consecutive  amino  acids  of  any  of  a)  through  b), 
wherein said fragment is a fragment of SEQ ID NO:1. 
In  a  preferred  embodiment  the  polypeptide  is  purified  from  Aspergillus  saccharolyticus,  such  as  deposit 
no.: CBS 127449. The polypeptide is capable of degrading or converting lignocellulosic material that may 
be obtained from various sources. In a preferred embodiment the polypeptide of the present invention is 
capable of hydrolyzing a beta 1‐4 glucose‐glucose linkage. 
A  second  aspect  of  the  invention  relates  to  an  isolated  polynucleotide  comprising  a  nucleic  acid  or  its 
complementary sequence being selected from the group consisting of 
a. a polynucleotide sequence encoding a polypeptide consisting of an amino acid sequence SEQ ID 
NO:1,  
b. a  biologicaly  active  sequence  variant  of  the  amino  acid  sequence,  wherein  the  variant  has  at 
least 92% sequence identity to said SEQ ID NO 1, and 
c. a  biologically  active  fragment  of  at  least  30  contigous  consecutive  amino  acids  of  any  of  a) 
through b), wherein said fragment is a fragment of SEQ ID NO 1 or 
d. SEQ ID NO.: 3 or 4 or 
e. a polynucleotide comprising a nucleic acid sequence having at least 70% identity to SEQ ID NO: 
3 or 4 or  
f. a polynucleotide hybridising to SEQ ID NO.: 3 or 4 and 
g. a polynucleotide complementary to any of a) to f). 
The  polynucleotide  may  be  used  for  cloning  purposes  and  for  production  of  the  polypeptide  of  the 
invention.  Thus,  in  a  third aspect, the  present  invention  also relates to a  recombinant  nucleic  acid  vector 
comprising a polynucleotide of the invention.  
It  is  appreciated  that  the  polynucleotide  and/or  the  recombinant  nucleic  acid  vector  of  the  present 
invention  may  be  introduced  into  host  cells.  Accordingly,  the  invention  in  a  fourth  aspect  pertains  to  a 
recombinant host cell comprising a polynucleotide of the present invention and/or a nucleic acid vector of 
the invention. 
PA 2010 7034 – Beta‐glucosidases and nucleic acids encoding same 
 
‐ vi ‐ 
 
A  fifth  aspect  of  the  invention  relates  to  an  isolated  microorganism  comprising  a  polypeptide  of  the 
invention,  a  polynucleotide  of  the  invention  and/or  a  recombinant  nucleic  acid  vector  of  the  invention. 
The  isolated  microorganism  is  in  one  preferred  embodiment  the  newly  discovered  strain  Aspergillus 
saccharolyticcus of the invention or progeny thereof. 
A  sixth  aspect  relates  to  a  method  of  producing  a  polypeptide  as  disclosed  in  the  present  invention 
comprising 
a. cultivating a microorganism, where said microorganism produces said polypeptide, 
b. recovering the polypeptide from said microorganism. 
The  microorganism  may  thus  comprise  a  polynucleotide  of  the  invention  and/or  a  recombinant  nucleic 
acid vector of the invention. The microorganism may be any microorganism suitable for the purpose. In a 
preferred  embodiment,  wherein  microorganism  is  Aspergillus,  and  particularly  Aspergillus 
saccharolyticcus or progeny thereof. 
According to the invention the polypeptide, recombinant host cell and/or microorganism may be used in a 
composition.  Thus,  a  seventh  aspect  related  to  a  composition  comprising  at  least  one  polypeptide  of  the 
invention,  at  least  one  recombinant  host  cell  of  the  invention  and/or  at  least  one  microorganism  of  the 
invention.  
It  is  further  appreciated  that  the  polypeptide,  recombinant  nucleic  acid  vector,  recombinant  host  cell, 
microorganism  and/  or  composition  of  the  present  invention  may  be  combined  with  other  components. 
Thus,  a  further  aspect  pertains  to  a  kit‐of  parts  comprising  at  least  one  polypeptide  of  the  invention,  at 
least  one  recombinant  nucleic  acid  vector  of  the  invention,  at  least  one  recombinant  host  cell  of  the 
invention,  at  least  one  isolated  microorganism  of  the  invention  and/or  at  least  one  composition  of  the 
invention, and at least one additional component. An additional component is typically enzymes that aid in 
the degradation or conversion of biomass for example cellulases, endogluconase, cellobiohydrolase, beta‐
glucosidase, hemicellulase, esterase, laccase, protease and/or peroxidise.  
The  invention  in  yet  a  further  aspect  relates  to  a  method  for  degrading  or  converting  a  lignocellulosic 
material, said method comprising a) incubating said lignocellulosic material with at least one polypeptide 
of  the  invention,  at  least  one  microorganism  of  the  invention,  at  least  one  recombinant  host  of  the 
invention, at least one composition of the invention and/or at least one kit‐of parts of the invention and b) 
recovering the degraded lignocellolosic material. 
In a final aspect the invention pertains to a method for a method for fermenting a cellulosic material, said 
method comprising  
a.  treating  the  cellulosic  material  with  at  least  one  polypeptide  of  the  invention,  at  least  one 
recombinant  host  cell  of  the  invention,  at  least  one  microorganism  of  the  invention,  at  least 
one composition of the invention, at least one kit‐of parts of the invention, and 
b.  incubating the treated cellulosic material with one or more fermenting microorganisms. 
c.   obtaining at least one fermentation product . 
 
   
PA 2010 7034 – Beta‐glucosidases and nucleic acids encoding same 
 
‐ vii ‐ 
 
CLAIMS 
1. An isolated polypeptide comprising 
a. an amino acids consisting of the SEQ NO:1,  
b. a  biologically  active  sequence  variant  of  SEQ  NO:1,  wherein  the  variant  has  at  least  92% 
sequence identity to said SEQ NO:1, or 
c. a  biologically  active  fragment  of  at  least  30  consecutive  amino  acids  of  any  of  a)  through  b), 
wherein said fragment is a fragment of SEQ ID NO:1. 
2. The polypeptide according to any of the preceding claims, wherein said polypeptide is purified from 
Aspergillus saccharolyticus, such as deposit no.: CBS 127449 
3. The  polypeptide  according  to  any  of  the  preceding  claims,  wherein  said  isolated  polypeptide  is 
capable of degrading or converting lignocellulosic material. 
4. The  polypeptide  according  to  any  of  the  preceding  claims,  wherein  said  lignocellulosic  material  is 
obtained from agricultural residues such as straw, maize stems, corn fibers and husk, forestry waste 
such as sawdust and/or wood‐chips, and/or from energy crops such as willow, yellow poplar and/or 
switch grass. 
5. The  polypeptide  according  to  any  of  the  preceding  claims,  wherein  said  polypeptide  is  capable  of 
hydrolyzing a β1‐4 glucose‐glucose linkage. 
6. An  isolated  polynucleotide  comprising  a  nucleic  acid  or  its  complementary  sequence  being  selected 
from the group consisting of 
a. a polynucleotide sequence encoding a polypeptide consisting of an amino acid sequence SEQ ID 
NO:1,  
b. a  biologicaly  active  sequence  variant  of  the  amino  acid  sequence,  wherein  the  variant  has  at 
least 92% sequence identity to said SEQ ID NO 1, and 
c. a  biologically  active  fragment  of  at  least  30  consecutive  amino  acids  of  any  of  a)  through  b), 
wherein said fragment is a fragment of SEQ ID NO 1 or 
d. SEQ ID NO.: 3 or 4 or 
e. a polynucleotide comprising a nucleic acid sequence having at least 70% identity to SEQ ID NO: 
3 or 4 or  
f. a polynucleotide hybridising to SEQ ID NO.: 3 or 4 and 
g. a polynucleotide complementary to any of a) to f). 
7. The  polynucleotide  according  to  claim  6,  wherein  said  polynucleotide  is  selected  from  the  group 
consisting of 
a. a polynucleotide encoding an amino acid sequence consisting of SEQ ID NO.: 1 or 
b. a  biologically  active  sequence  variant  of  the  amino  acid  sequence,  wherein  the  variant  has  at 
least 92% sequence identity to said SEQ ID NO.: 1 and 
c. a  biologically  active  fragment  of  at  least  30  consecutive  amino  acid  of  any  of  a)  trough  b), 
wherein said fragment is a fragment of SEQ ID NO.: 1. 
PA 2010 7034 – Beta‐glucosidases and nucleic acids encoding same 
 
‐ viii ‐ 
 
8. A recombinant nucleic acid vector comprising a polynucleotide sequence as defined on any of claims 
6 to 7 
9. A  recombinant  host  cell  comprising  a  polynucleotide  as  defined  in  any  of  claims  6  to  7  and/or  a 
recombinant nucleic acid vector as defined in claim 8 
10. An isolated microorganism comprising a polypeptide as defined in any of claims 1‐5, a polynucleotide 
as defined in any of claims 6 to 7 and/or a recombinant nucleic acid vector as defined in claim 8 
11. The microorganism according to claim 10, wherein said microorganism is Aspergillus. 
12. The microorganism according to any of claims 10 to 11, wherein said microorganism is deposited in 
CBS under accession no.: CBS 127449, or progeny thereof. 
13. A method of producing a polypeptide as defined in any of claims 1 to 5 comprising 
a. cultivating a microorganism, where said microorganism produces said polypeptide, 
b. recovering the polypeptide from said microorganism. 
14. The  method  according  to  claim  13,  wherein  said  microorganism  comprises  a  polynucleotide  as 
defined in any of claims 6 to 8 and/or a recombinant nucleic acid vector as defined in claim 8 
15. The method according to any of claims 13 to 14, wherein microorganism is Aspergillus. 
16. The  method  according  to  any  of  claims  13  to  15,  wherein  said  microorganism  is  deposited  in  CBS 
under accession no.: CBS 127449, or progeny thereof. 
17. A  composition  comprising  at  least  one  polypeptide  as  defined  in  any  of  claims  1  to  5,  at  least  one 
recombinant  host  cell  as  defined  in  claim  9  and/or  at  least  one  microorganism  as  defined  in  any  of 
claims 10 to 12 
18. A  kit‐of  parts  comprising  at  least  one  polypeptide  as  defined  in  any  of  claims  1  to  5,  at  least  one 
recombinant nucleic acid vector as defined in claim 8, at least one recombinant host cell as defined in 
claim 9, at least one isolated microorganism as defined in any of claims 10 to 12 and/or at least one 
composition as defined in claim 17, and at least one additional component.  
19. The kit‐of parts according to claim 18, wherein said additional component is selected from the group 
consisting  of  cellulases,  endogluconase,  cellobiohydrolase,  beta‐glucosidase,  hemicellulase,  esterase, 
laccase, protease and peroxidise 
20. A  method  for  degrading  or  converting  a  lignocellulosic  material,  said  method  comprising  a) 
incubating said lignocellulosic material with at least one polypeptide as defined in any of claims 1 to 
5, at least one microorganism as defined in any one of claims 10 to 12, at least one recombinant host 
cell  as  defined  in  claim  9,    at  least  one  composition  as  defined  in  claim  17  and/or  at  least  one  kit‐of 
parts as defined in any of claims 18 to 19 and b) recovering the degraded lignocellolosic material. 
21. The  method  according  to  claim  20,  wherein  said  lignocellulosic  material  is  obtained  from  straw, 
maize stems, forestry waste, sawdust and/or wood‐chips. 
22. The method according to any of claims 20 to 21, said method comprising treating said lignocellulosic 
material with at least one additional component. 
23. The method according to any of claims 20 to 22, wherein said at least one additional component for 
treating  said  lignocellulosic  material  is  selected  from  the  group  consisting  of  cellulase, 
endogluconase,  cellobiohydrolase,  beta‐glucosidase,  hemicellulase,  esterase,  laccase,  protease  and 
peroxidise. 
PA 2010 7034 – Beta‐glucosidases and nucleic acids encoding same 
 
‐ ix ‐ 
 
24. The  method  according  to  any  of  claims  20  to  23,  wherein  said  lignocellulosic  material  is  at  least 
partly converted or degraded to monosaccharide glucose units. 
25. The method according to any of claims 20 to 24, wherein at least 50% of said lignocellulosic material 
is degraded or converted to monosaccharide glucose units. 
26. A method for a method for fermenting a cellulosic material, said method comprising 
a.  treating the cellulosic material with at least one polypeptide as defined in any of claims 1 to 5, at 
least  one  recombinant  host  cell  as  defined  in  claim  9,  at  least  one  microorganism  as  defined  in 
any of claims 10 to 12, at least one composition as defined in claim 17, at least one kit‐of parts as 
defined in any of claims 18 to 19, and 
b.  incubating the treated cellulosic material with one or more fermenting microorganisms. 
c.   obtaining at least one fermentation product . 
27. The  method  of  claim  26  wherein  said  at  least  one  fermentation  product  is  at  least  one  alcohol, 
inorganic acid, organic acid, hydrocarbon, ketone, amino acid, and/or gas 
 
 
 
 
 
 
 
 
 
Concluding remarks 
 
 
Annette Sørensen 
 
 
 
 
 
 
 
CONCLUDING REMARKS 
The  work  presented  in  the  four  research  papers  shows  a  successful  screening  event  leading  to  the 
discovery  of  a  new  efficient  beta‐glucosidase  from  a  novel  fungal  species.  As  stated  by  Hawsworth  and 
Rossman (1997), you can look everywhere, including your own backyard, when searching for undescribed 
fungi.  This,  indeed,  is  true,  as  the  novel  fungus  A.  saccharolyticus  was  found  in  the  bathroom  of  my  own 
home.  The  extract  from  this  fungus  could  in  biomass  hydrolysis  compete  with  beta‐glucosidases  from 
commercial  enzyme  preparations,  Novozym  188  and  Cellic  CTec,  and  was  superior  especially  in  terms of 
thermostability.  The  key  beta‐glucosidase,  BGL1,  in  the  extract  of  A.  saccharolyticus  was  identified  and 
heterologously expressed for purification. The novelty of A. saccharolyticus and its beta‐glucosidase, BGL1, 
as  well  as  the  surprising  elevated  thermostability  of  the  enzyme  was  the  foundation  for  the  patent  PA 
2010  70347.  We  see  the  potential  of  BGL1  as  a  key  enzyme  in  a  biorefinery  concept.  This  can  be  in  an 
onsite enzyme production strategy, where BGL1 is expressed by A. saccharolyticus that has been modified 
for improved endoglucanase and cellobiohydrolase expression or co‐cultured with an efficient producer of 
these  enzymes.  The  other  option  could  be  to  heterologously  express  BGL1  in  an  organism  of  choice  for 
production of a complete enzyme cocktail or even be part of a consolidated bioprocess.  
One  of  the  most  important  features  concerning  BGL,  that  would  be  relevant  to  investigate  further,  is 
prolonged thermostability. Hydrolysis of biomass is usually carried out for a duration of several hours or 
even  days.  It  is  therefore  important  to  test  the  stability  of  the  enzyme  at  different  conditions  for  longer 
periods  of  time.  Kinetically,  it  would  be  of  great  value  to  perform  more  studies  with  cellobiose  as 
substrate,  especially  assays  related  to  product  inhibition,  where  for  example  prolonged  duration  of 
hydrolysis can be used to evaluate performance related to glucose accumulation. Other inhibition studies 
to  test  the  influence  of  different  compounds  typically  present  in  pretreated  biomass  should  as  well  be 
performed.  Another  aspect  of  kinetics  that  would  be  of  interest  related  to  the  use  of  BGL  for  making  a 
sugar  platform,  is  to  investigate  the  degree  of  transglycosylation  activity  the  enzyme  possesses.  We  are 
further more very interested in expressing the bgl gene in E. coli to compare the non‐glycosylated protein 
with the glycosylated one to test how glycosylation affects the function and stability of the enzyme. From 
the  non‐glycosylated  protein,  a  crystal  of  the  protein  can  be  made  and  the  three  dimensional  structure 
thereby  determined.  This  could  give  valuable  information  as  to  what  amino  acid  residues  that  could 
potentially  be  targeted  in  engineering  for  enzyme  improvement.  Finally,  we  have  in  preliminary  studies 
identified additional beta‐glucosidase genes in the genome of A. saccharolyticus. It could be interesting to 
clone,  express,  and  purify  these  to  explore  and  compare  their  potential  as  well  as  study  the  expression 
pattern of the  genes  when A.  saccharolyticus  is  grown in  different  conditions,  including  media containing 
different carbon sources ranging from simple saccharides such as cellobiose to complete sources such as 
lignocellulosic  biomass.  This  will  enhance  the  basic  understanding  of  the  function  of  the  different  beta‐
glucosidases biomass degradation and utilization. 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

A NEW HIGHLY EFFICIENT BETAGLUCOSIDASE FROM THE NOVEL SPECIES, ASPERGILLUS SACCHAROLYTICUS ANNETTE SØRENSEN

Section for Sustainable Biotechnology Aalborg University, Copenhagen Ph.D. Dissertation, 2010

Printed in Denmark by UNIPRINT, Aalborg University, November 2010 ISBN 978-87-90033-73-6 Cover: Ribbon cartoon representation of the homology model of the catalytic module of beta-glucosidase BGL1 from Aspergillus saccharolyticus. The figure was provided by Dr. Wimal Ubhayasekera

 consisting of a review paper and four research papers. I would likewise like to express my great appreciation to the contribution of Mette Lübeck.  and  guidance  throughout  the  whole  period  –  thank  you  for  your  shoulder to cry at. and especially your loving heart that cares deeply.  encouragement.  study.  and  joyful  atmosphere  my  colleagues  at  Section  for  Sustainable  Biotechnology.D.  Nielsen. and David E.D. study and  their interest in my work.  Aalborg  University.  study  has  resulted in a patent application.  Sciences. Jens C. Kristian F. The individual manuscripts are printed in a layout form consistent with the journal  for  which  the  individual  manuscripts  are  intended. Teller. I value your support. Kenneth S.D  study.D.  a  lot  of  my  research  has  been  carried  out  at  the  Bioproducts. Bruno. Lübeck for support. Culley.  but  also  as  initial  inspiration  and  introduction  into  the  field  of  sustainable  and  fungal  biotechnology. Frisvad.  provide  every  day  –  especially  during  this  last  phase  of  thesis writing.  and  Engineering  Laboratory  in  collaboration  with  Washington  State  University  and  the  Pacific  Northwest  National Laboratory. ending with brief  concluding remarks.  who has acted as supervisor though she was not officially so.  The  work  carried  out  during  this  Ph. Furthermore I would like to thank all other  co‐authors for their contributions to the papers in this thesis: Philip J.  During  this  Ph. your happy face to smile with. love and thanks to both of you! Most of all I would like to thank Philip Teller  for  strong  support. Denmark            THESIS STRUCTURE  Please  notice  that  the  thesis  has  been  organized  as  a  short  summary  in  the  beginning  followed  by  a  collection of journal manuscripts. of which the summary and claims are included in the thesis. Arhing and Peter S. It was a great experience and I highly appreciate the help and guidance I was given  by my co‐scientists at both WSU and PNNL. thesis –  you are a great inspiration.D.ACKNOWLEDGEMENTS  I would like to thank my supervisors Birgitte K. not only during  my  Ph.   Finally I would like to thank my family and friends for their enormous support during my Ph.            Annette Sørensen   August 2010. Wimal Ubhayasekera.  encouraging.   I  am  grateful  for  the  enthusiastic.     . I doubt many parents have read and understood their daughter’s Ph.

  .

  nov.1‐III.10 v‐vi vii‐ix x   .9 II.1‐IV.    Research paper III  Aspergillus  saccharolyticus  sp.    Research paper IV  Cloning.11 IV.THESIS CONTENT      Summary (English)  Summary (Danish)    Review paper  Fungal beta‐glucosidases and their applications for production  of biofuels and bioproducts    Research paper I  On‐site  enzymeproduction  during  bioethanol  production  from  biomass: screening for suitable fungal strains    Research paper II  Screening for beta‐glucosidase activity amongst different fungi  capable  of  degrading  lignocellulosic  biomasses:  discovery  of  a  new prominent beta‐glucosidase producing Aspergillus sp..  a  new  black  Aspergillusspecies isolated from treated oak wood in Denmark.  and  characterization  of  a  novel  highly  efficient beta‐glucosidase from Aspergillus saccharolyticus    Patent  Summary of the invention Claims    Concluding remarks          i‐ii iii‐iv 1‐18 I.1‐II.  expression.12 III.1‐I.

  including  A.  allowing  for  increased  hydrolysis  of  cellulose  by  cellobiohydrolases  and  endoglucanases. Cellic CTec (Novozymes A/S) and AcceleraseDUET (Genencor A/S). by hydrolyzing the biomass to monomeric sugars.   Main  components  of  lignocellulosic  biomass.    Superior  enzymes  can  be  obtained  either  by  discovery  of  new  enzymes  through  different  screening  strategies or by improvement of known enzymes mainly by different molecular methods.5L (mainly cellobiohydrolase and endoglucanase activity) (Novozymes A/S) have been used in  combination  for  hydrolysis  of  pretreated  biomass.  niger. In the wake of this. the commercial enzyme preparations Novozym 188 (mainly beta‐glucosidase activity) and  Celluclast 1. the extract of  strain  AP  showed  higher  specific  activity  (U/total  protein)  as  well  as  increased  thermostability. finding Aspergillus niger as  well as an unidentified strain AP as promising candidates for the utilization of the filter cake for growth  and  enzyme  production. The pretreatment mainly opens up the cell wall structure and partly hydrolyzes hemicellulose.1. and the two preparations  performed equally well in cellobiose hydrolysis with regard to product inhibition.   A  screening  for  beta‐glucosidase  activity  was  conducted. substitute the use of Novozym 188 in hydrolysis of pretreated biomass. mainly fungi isolated from different woody habitats.  and  recently  complete  enzyme  cocktails  have  been  launched.  By  hydrolysis  of  cellobiose.  The  strain  AP  showed  significantly  greater  potential  in  beta‐glucosidase  activity  than  all  other  fungi  screened.21) play an essential  role  in  efficient  hydrolysis  of  cellulose.  combined  with  Celluclast 1.       ‐ i ‐    .  The  major  factors  influencing this are product inhibition and temperature stability.  which  could  act  as  platform  molecules  serving  as  building  blocks  in  the  synthesis  of  chemicals  and  polymeric  materials. However.  The  Michaelis  Menten  kinetics  affinity  constants of strain AP extract and Novozym 188 were approximately the same.   Initially.  the  biomass  is  pretreated.   Traditionally.  and  lignin.  using  wheat  bran  as  substrate  in  simple  submerged  fermentation.  In  terms  of  cellobiose  hydrolysis.5L.  so that cellulose is the main target for enzyme hydrolysis.  corresponding  to  the  previous  result  where  filter  cake  inoculated  with  the  fungus  was  directly  used  in  hydrolysis  of  pretreated  biomass.  when  combined  with  Celluclast  1.  Prior  to  enzymatic  hydrolysis  for  generating  sugar  monomers.  able  to  contribute  to  the  generation  of  a  sugar  platform  from pretreated bagasse.  This  is  a  sustainable  solution that is expected to replace today’s oil refineries.  and  was.  biomass  polymers  of  cellulose  and  hemicellulose  are  converted  into  sugars.  The  extract  of  strain  AP  facilitated  hydrolysis  of  cellodextrins  with  an  exo‐acting  approach.  SUMMARY  In  a  biorefinery  concept.  focus was placed on beta‐glucosidases.  which  can  be  used  for  production  of  biofuels  and  biochemicals. The enzyme preparations by  Novozymes A/S are used as benchmarks in the following research. Different fungi  were applied in this screening. A low value stream of  a cellulosic ethanol production was explored as enzyme production medium.  the  extract  of  strain  AP  was  found  to  be  a  valid  substitute  for  Novozym  188.  Efficient  hydrolysis  requires  high  conversion  rates  throughout  the  hydrolysis.  hemicellulose. Beta‐glucosidases (EC 3.5L. we employed a screening strategy using different lignocellulosic materials for discovery of new  enzymes to be used in an onsite enzyme production concept during bioethanol production.  The  significant  thermostability  of  strain  AP  beta‐glucosidases  was  further  confirmed  when  compared  with  Cellic  CTec.  testing  selected  strains  from  the  previous  screening  as  well  as  new  isolated  strains  and  strains  from  our  in‐house  strain  collection.  beta‐glucosidases  relieve  inhibiting  conditions.2.  primarily  consisting  of  plant  cell  walls.  The  beta‐ glucosidase  activity  of  a  solid  state  fermentation  extract  of  strain  AP  was  compared  with  Novozym  188  and  Cellic  CTec.  The  filter  cake  inoculated  with  the  respective  fungi  could.  are  cellulose.

 the beta‐glucosidase gene. studying enzyme kinetics. saccharolyticus was cloned.  a  more  open  catalytic  pocket  compared  to  other  beta‐ glucosidases. saccharolyticus was identified as belonging to  GH family 3. the  extrolite production of strain AP differed significantly from other known aspergilli in section Nigri. mentioned above.  However. niger.  interestingly. Futhermore.  in  detailed  phenotypic  analysis.  saccharolyticus were undertaken. A striking similarity was found when comparing the data of purified BGL1 to the  data previously reported of the crude extract. bgl1.  Codons  coding  for  histidine  residues were included in the 3’end of the gene to assist purification.  combining  promoter. A cloning vector for heterologous expression of bgl1 in Trichoderma reesei was constructed.  and  terminator  of  different  eukaryotic  origin. finding retaining  enzyme  characteristics  and.  and  the  peaks  detected  did  not  match  the  approximately  13500  fungal  extrolites  in  the  natural  product  chemist’s  database. was fractionated by ion  exchange chromatography. Using the peptide matches for  design of degenerate primers.  and  partial  calmodulin  gene  placed  strain  AP  on  a  separate  branch  in  phylogenetic  trees  prepared  with  other  black  aspergilli. indicating that we have successfully cloned and expressed  the  protein  mainly  contributing  to  the  beta‐glucosidase  activity  observed  in  the  crude  extract. and  cellodextrin hydrolysis.  Antibase2010.  aculeatus and BGL1 from A. respectively.  Morphologically. A three dimentsional structure was proposed through homology modeling.  both in terms of growth characteristics on different media as well as temperature tolerance.  isolation. obtaining fractions pure enough that a specific SDS‐page gel protein band of  high beta‐glucosidase activity could be excised and analyzed by LC‐MS/MS. temperature and pH profiles.  gene. The 2919  bp genomic sequence encodes a 680 aa polypeptide which has 91% and 82% identity with BGL1 from A.  saccharolyticus.  The extract from this fungus.   Identification.  partial  beta‐tubuline  gene.  strain  AP  distinguished  itself  from  the  other  uniseriate  aspergilli.  Strain AP was from a polyphasic taxonomic approach identified as a yet undescribed uniseriate Aspergillus  species  belonging  to  section  Nigri.  referring to  its ability to hydrolyze cellobiose and  cellodextrins.  japonicus.  and  it  was  deposited  in  the strain collection of Centraalbureau voor Schimmelcultures (CBS 127449T). BGL1 of A.  and  universally  primed  PCR  furthermore readily distinguished strain AP data from other black aspergilli. of A. saccharolyticus.  Genotypic  analysis  of  the  ITS  region.        ‐ ii ‐    .  at  first  glance  strain  AP  resembles  A.  and  characterization  of  the  most  prominent  beta‐glucosidase  from  A. glucose tolerance. as several  well‐known  compounds  from  this  series  were  not  present.  thus  the  most prominent beta‐glucosidase of A. The purified BGL1 was assayed for  beta‐glucosidase activity. We named the novel species A.

2.  hvor  filterkage  inokuleret  med  svampen  direkte  blev  brugt  i  hydrolyse  af  forbehandlet biomasse.  Indledningsvist  benyttede  vi  en  screeningsstrategi.  Lignocelluloseholdig  biomasse  består  primært  af  plantecellevægge.  Beta‐glucosidaser (EC 3.5L erstatte brugen af Novozym 188 i hydrolyse af forbehandlet biomasse.  Traditionelt set har de kommercielle enzymprodukter Novozym 188 (primært beta‐glucosidase‐aktivitet)  og Celluclast 1. Dette er en bæredygtig løsning.5L (primært cellobiohydrolase‐ og endoglucanase‐aktivitet) (Novozymes A/S) været brugt  i kombination til at hydrolysere forbehandlet biomasse.  Filterkagen  inokuleret  med  de  respektive  svampe  kunne  i  kombination  med  Celluclast 1. Michaelis‐Menten kinetik affinitetskonstanten for ekstraktet fra strammen AP og  for Novozym 188 var cirka ens. der ellers ville begrænse cellobiohydrolase‐ og  endoglucanase‐aktiviten.  niger. Forskellige svampe blev testet i denne screening.   Bedre  enzymer  kan  fremskaffes  enten  ved  opdagelse  af  nye  enzymer  gennem  forskellige  screeningsstrategier  eller  ved  forbedring  af  kendte  enzymer  primært  ved  forskellige  molekylære  teknikker.  For  at  danne  en  sukkerplatform  fra  biomasse.  Hovedkomponenterne  er  cellulose.  Et  restprodukt. Som følge af dette  blev fokus rettet på beta‐glucosidaser. som kan erstatte nutidens olieraffinaderier.  fra  cellulose  ethanolproduktion  af  lav  kommerciel  værdi  blev  undersøgt  som  enzymproduktionsmedie.  Stammen  AP  viste  betydeligt  større  beta‐ glucosidase‐aktivitetspotentiale  end  alle  andre  testede  stammer. og for nyligt er nye komplette enzymblandinger  blevet lanceret: Cellic CTec (NovozymesA/S) og AcceleraseDUET (Genencor A/S).  Effektiv  hydrolyse  kræver  høj  omsætningsrate under hele hydrolysen. hvilket stemmer over ens med  de  tidligere  resultater. Enzymprodukterne fra  Novozymes A/S vil løbende blive brugt som sammenligningsgrundlag i den her præsenterede forskning.  at  stammen AP kan erstatte Novozym 188 inden for hydrolyse af cellobiose.  Den  signifikante  termostabilitet  af  beta‐glucosidaser  fra  stammen  AP  blev  yderligere  bekræftet  ved  sammenligning  med  Cellic  CTec.1.  hemicellulose  og  lignin.  Vi  fandt.  Beta‐glucosidase‐aktiviteten  af  et  fermenteringsekstrakt  af  stammen  AP  er  sammenlignet  med  Novozym  188  og  Cellic  CTec. og med hensyn til produktinhibering var effekten af øget glucosemængde  omtrent den samme. er produktinhibering  og temperaturstabilitet. Faktorer.  forbehandles  biomassen  og  hydrolyseres  derefter.  inkluderende  A.  Forbehandlingen  åbner  primært  cellevægstrukturen  op  og  hydrolyserer  delvist  hemicellulosen.  DANSK SAMMENFATNING  Værdien af lignocelluloseholdig biomasse bliver i et bioraffinaderikoncept maksimeret ved frembringelse  af en sukkerplatform fra biomassens kulhydrater.  og  muliggør  derved  øget  hydrolyse  af  cellulose. Denne sukkerplatform kan anvendes til produktion af  biobrændstoffer  og  biomolekyler. der særligt kan influere på dette. nyligt isolerede stammer samt isolater fra vores  egen  stammesamling  blev  testet. Isolater fra den tidligere screening. Ved at hydrolysere  cellobiose fjerner beta‐glucosidase de inhiberende forhold.  Ekstraktet  fra  stammen  AP  kunne  via  exo‐   ‐ iii ‐    .  filterkage.  Screening  for  beta‐glucosidase‐aktivitet  blev  udført  ved  brug  af  hvedeklid  som  substrat  i  simpel  væskefermentering. Ekstraktet fra stammen AP viste dog højere specifik aktivitet (U/total protein) såvel  som  øget  termostabilitet. hvoraf de fleste var isoleret fra  naturens  biomasseholdige  habitater.21) spiller en vigtig rolle i effektiv hydrolyse af cellulose.  Aspergillus  niger  så  vel  som  en  uidentificerbar stamme AP viste sig at være lovende kandidater for anvendelsen af filterkagen til vækst‐  og  enzymproduktion.  således  at  cellulose  er  primær  genstand  for  den  efterfølgende  enzymatiske  hydrolyse.  hvor  forskellige  lignocelluloseholdige  komponenter  blev  anvendt  til  at  lede  efter  nye  enzymer  til  brug  i  et  on‐site  enzymproduktionskoncept  indenfor  biobrændstofproduktion.  som  kan  være  byggesten  i  syntesen  af  kemikalier  og  polymere  materialer.

  aktivitet  hydrolysere  cellodextriner  og  kunne  sammen  med  Celluclast  1.  hvor  enzymkinetik.  bgl1.      ‐ iv ‐    . som primært kontribuerer til den beta‐glucosidase‐aktivitet.  blev  inkluderet  i  3’enden af genet for at lette oprensning af genet.  hvilket  refererer  til  dens  evne  til  at  hydrolysere cellobiose og cellodextriner.  da  adskillige  kendte  stoffer  inden  for  denne  sektion  ikke  kunne  detekteres. En påfaldende ensartethed blev fundet ved sammenligning af data for det oprensede BGL1  og de data.  gen  og  terminator  af  forskellig  eukaryotisk  oprindelse  var  kombineret.  og  de  toppe. der har hhv.  BGL1  fra  A. beskrevet og analyseret ovenfor. Universal‐primed PCR adskilte yderligere data for stammen AP fra  andre  sorte  aspergilli.  og  det  partielle  calmodulin  gen  placerede  stammen  AP  på  en  separat  gren  i  de  fylogenetiske  træer. isolering og karakterisering af den fremstående beta‐glucosidase fra A.5L  hydrolysere  forbehandlet  bagasse til sukkermonomerer og derved danne en sukkerplatform fra biomasse.  som  koder  for  aminosyren  histidin.  som  var  udarbejdet med andre sorte aspergilli. Dette indikerer.  glukosetolerance  samt  hydrolyse  af  cellodextrin  blev studeret.   Identificering.  Vi  navngav  den  nye  art  A. at vi med succes  har klonet og ekspresseret det protein.  En  kloningsvektor  blev  konstrueret  til  benyttelse  indenfor  heterolog  ekspression  af  bgl1  i  Trichoderma  reesei. Ydermere adskilte stammen AP sig  signifikant  fra  andre  kendte  aspergilli  i  sektion  Nigri  ved  dens  sekundære  metabolitproduktion. Stammen blev deponeret i stammesamling Centraalbureau voor  Schimmelcultures (CBS 127449T).  hvor  promoter. Det oprensede BGL1 blev undersøgt for beta‐glucosidase  aktivitet. Ved at benytte peptid‐matchene  til  design  af  degenererede  primere  blev  beta‐glucosidase  genet.  der  findes  i  databasen  for  naturprodukt  kemikere. 91% and 82% identitet med BGL1 fra A.  Antibase2010.  at  en  mere  åben  katalytisk  lomme  blev  sandsynliggjort  for  BGL1  relativt  til  andre  beta‐glucosidaser.  niger.  både  i  forhold  til  vækstkarakteristika på forskellige medier samt temperaturtolerance. blev ved ionkromatografi fraktioneret. saccharolyticus blev  iværksat. aculeatus og  BGL1  fra  A. hvor ”retaining” enzymkarakteristika  blev  bestemt. der  var observeret i råekstraktet fra A.  En  tredimensionel struktur blev foreslået ud fra homologimodellering.  temperatur‐  og  pH‐profil.  matchede  ikke  de  omtrent  13500  metabolitter  fra  svampe.  som  var  til  stede.  japonicus.  Genotypisk  analyse  af  ITS  regionen.  saccharolyticus  blev  identificeret  til  at  tilhøre  GH  familie  3.  klonet.  hvorved  rene  nok  fraktioner  blev  opnået. Ekstraktet fra svampen. saccharolyticus.  saccharolyticus.   Stammen AP blev taksonomisk identificeret som en hidtil ubeskrevet uniseriat Aspergillus art tilhørende  sektion  Nigri.  Den  2919  bp  genomiske  sekvens koder for et 680 aa polypeptid.  men  ud  fra  detaljeret  fænotypisk  analyse  adskilte  stammen  AP  sig  fra  de  andre  uniseriate  aspergilli. der tidligere blev rapporteret for råekstraktet fra svampen.  Morfologisk  ligner  stammen  AP  ved  første  øjekast  A.  Codons.  det  partielle  beta‐tubulin  gen.  således  at  et  specifikt  proteinbånd  med  høj  beta‐glucosidase‐ aktivitet kunne skæres ud fra SDS‐page gel og analyseres ved LC‐MS/MS.  Det  er  bemærkelsesværdigt.

      .

 Ahring    Intended for submission to FEMS microbiology reviews  . Peter S.Review paper      Fungal beta‐glucosidases and their applications for production  of biofuels and bioproducts      Annette Sørensen. Lübeck. and Birgitte K. Mette Lübeck.

.

  which can be used for production of biofuels and biochemicals.  Oil  is  currently  the  primary  source  of  energy  for  the  transportation  sector  and  for  production of chemicals and plastics. A biorefinery concept  could  replace  the  oil  refineries. Aalborg University.  Tel.. and Birgitte K.  Sugar  platform  biorefineries  focus  on production of a platform of simple sugars extracted from  biomass. Ahring1. either made from a separate fungal fermentation or as part of a  consolidated bioprocess.  maximizing  the  value  derived  from  biomass  by  producing  fuels  and  platform  molecules  that  can  be  used  as  building  blocks  in  the  synthesis of chemicals and polymeric materials (Cherubini.  the  awareness  in  the  public  has  again  increased  towards  alternatives  for  fossil  fuels. 2000).    Especially  organic  acids  are  key  building  block  chemicals  that  can  be  produced  by  microbial processes (Sauer et al. Ahring. enzyme discovery.  With  the  biorefinery  application  in  mind. Mette Lübeck1.  ethanol).2. Copenhagen  Institute of Technology.  These  sugars  can  biologically  be  fermented  into  fuels  (e.     Introduction  The  ever‐increasing  energy  consumption.1.  This  review  focuses  on  beta‐glucosidases  applied  for  biomass  hydrolysis. 2008).  as  well  as  a  growing  environmental  concern  have  laid  the  foundation  for  a  shift  towards  sustainable  biofuels  and  bioproducts  from  renewable  sources.  2004). email: bka@bio.  2010). Lübeck1. The  major  factors  influencing  this  are  product  inhibition  and  temperature  stability.  as  lignocellulosic  biomass  is  an  abundant  and  inexpensive  renewable  energy  resource  (Knauf  &  Moniruzzaman.  By  hydrolysis  of  cellobiose.  Today.  building  block  chemicals  (e.  an  application  where  all  commercial  enzymes  are  of  fungal  origin. Biorefineries are expected to replace our day’s oil refineries. Washington State University.  Lautrupvang 15.dk                    Keywords  Beta‐glucosidases.2.   The  search  for  renewable  energy  in  the  form  of  bioethanol  from  plant  biomasses  emerged  in  the  1970s  in  response to the oil crisis (NREL National Renewable Energy  Laboratory.   2 Correspondence: Birgitte K.  polymers  of  cellulose  and  hemicellulose  in  the  biomass  materials  are  converted  into  sugars.  Efficient  hydrolysis requires high conversion rates throughout the hydrolysis process. Peter S.  allowing  for  increased  hydrolysis  of  cellulose  by  cellobiohydrolases  and  endoglucanases. which could act as  platform  molecules  serving  as  building  blocks  in  the  synthesis  of  chemicals  and  polymeric materials. Denmark.  Better  beta‐glucosidases  can  be  obtained  either  by  discovery  of  new  beta‐ glucosidases through different screening strategies or by improvement of known  beta‐glucosidases  for  instance  by  protein  engineering. Richland. as well as other high value products.   Review paper  ‐ 1 ‐    . improvement. Ballerup. Denmark.  Similarly. Copenhagen Institute of Technology. WA. Aalborg University.  attention  has  been  drawn  towards  production  of  platform  molecules  for  new  bioproducts  by  microbial  fermentation  from  glucose  or  other  simple  carbohydrates. 2750 Ballerup.: +45 99402591.aau.  different  organic  acids)  as  specified  by  US  Department  of  Energy  Report (2004a).g.  beta‐glucosidases  should  be  included  as  part  of  a  complete  enzyme cocktail.  characterization. biofuels & bioproducts.  One  of  the  goals  of  the  biorefinery  is  the  combined  production  of  high‐value  low‐volume  products  together  with  low‐value  high‐volume  products  such  as  fuels  (Fernando  et  al.  Center for Biotechnology and  Bioenergy.  the  depletion  of  fossil  resources.21)  play  an  essential  role  in  efficient  hydrolysis  of  cellulosic  biomasses. and  application  Abstract  Beta‐glucosidases  (EC  3.  beta‐glucosidases  relieve  inhibiting  conditions.g.  2006).  REVIEW ARTICLE  Fungal  beta‐glucosidases  and  their  applications  for  production  of  biofuels and bioproducts  Annette Sørensen1. USA.  with  the  recent  oil  disaster  in  the  Mexican  gulf. Especially second generation bioethanol  production  has  increased  in  interest  during  this  decade  with  focus  on  the  use  of  lignocellulosic  wastes  for  fuel  production.. Section  for Sustainable Biotechnology.2  1 Section for Sustainable Biotechnology.  In  a  biorefinery  concept.  biomass hydrolysis.

  mono‐.  making  beta‐glucosidases  important  in  terms  of  avoiding  decreased  hydrolysis  rates  of  cellulose  over  time  due  to  cellobiose  accumulation.  About  80%  of  the  xylan backbone is highly substituted with monomeric side‐ chains  of  arabinose  linked  to  O‐2  and/or  O‐3  of  the  xylose  units of the backbone (Saha.  2002.21).  Proteins  have  been  discovered  that  by  themselves lack measurable hydrolytic activity.  rapidly  decreasing  the  degree  of  polymerization  and  creating more free ends for attack by the cellobiohydrolases  (Lynd et al.  the  enzymes  mentioned  below  are  required  for  the  breakdown  of  cellulose.  Pretreatment  aims  at  increasing  the  accessibility  of  the  polymers  for  the  enzyme  hydrolysis..  with  cellulose  most  often  being  the  most  abundant  component.  oils  and  ash  make  up  the  remaining  fraction  of  the  biomass.  glucuronic  acid  or  its  4‐O‐methyl  ether.  making  them  key  enzymes  for  efficient  hydrolysis  of  cellulose..    Several  different  pretreatment  strategies have been suggested over the last years. Zhang et al.  2009). with CBHIs acting on the reducing ends  and  CBHIIs  acting  on  the  non‐reducing  ends.  acetic  acid.  The major constituent of plant biomass is lignocellulose.1.  with  commonly  used  methods  including  (but  not  excluding  others)  alkali‐.2.S.. The general consensus  is  that  cellobiohydrolases  (CBHs)  hydrolyze  the  cellulose  polymer from the ends.  Cellulose  polymers are through sequential and cooperative actions of  these enzymes degraded to glucose. Lynd et al.  or  organosolvent  pretreatement.  and  p‐coumaric  acid.  is  a  homogenous  linear  polymer  of  beta‐D‐ glucosyl  units  linked  by  1.  Cellobiohydrolases  and  endoglucanases  are  often  inhibited  by  cellobiose.  The  degree  of  heterogeneity. and wet‐oxidation. 2004b). respectively.  The  cellulose  chains  are  assembled  in  larger  rigid  units  held  together  by  both  intrachain  and  interchain hydrogen bonds and weak van der Wall’s forces. which have a backbone  of D‐xylose linked by 1.  or  non‐methoxylated. ranging  from  extreme  temperatures.4‐beta‐ glucanases)  (EC  3.  but  are  interspersed  with  amorphous regions of more disordered structure (Beguin &  Aubert.  ferulic  acid.  hexoses. Xylan.  is  composed  of  aromatic  phenyl‐propanoid  compounds  that  are  either  di‐.  2005.  typically  constituting  30‐50%  according  to  the  Biomass  Feedstock  Composition  database  (U.  the  distribution of the different sugars.  The  general  concept  of  polysaccharide  hydrolysis  has  been  agreed  on  for  several  years..  and  acid/base  conditions  to  the  milder  biological  approaches..  2007). 2004. 1994.  Such  synergism  of  cellobiohydrolases  and  endoglucanases  was  already  studied  decades  ago  in  Trichoderma  reesei  (Henrissat et al.. Proteins.  will  vary to a great extent depending on the plant material and  the  pretreatment  applied.  Such  variation  in  biomass  characteristics  will  influence  the  composition  requirements  for  an  optimal  enzyme  cocktail  for  the  breakdown  of  lignocellulosic  biomasses  (Meyer  et  al.  degree  of  polymerization.  and  beta‐glucosidases  (EC  3. releasing cellobiose as product in a  processive fashion..  and  sugar  acids.  Lignocellulose  consists  mainly  of  polysaccharides  such  as  cellulose and hemicelluloses that together with the phenolic  lignin polymer form a complex and rigid structure.000. Zhang & Lynd.  Endo‐ glucanases (EGs) randomly hydrolyze the internal 1.  2006. hemicellulose.  2004).  Through  parallel  orientation.  in  general terms.000‐15.  polymer  of  pentoses. Besides of xylose. 2002.  2000.  Mosier  et  al.1.  with  regard  to  cellulose  accessibility. 1985).  attention  has been paid to accessory enzymes that are coregulated or  coexpressed  by  microbes  during  growth  on  cellulosic  substrates.2.  pretreatment is crucial as a first step for breaking this rigid  structure  followed  by  enzymatic  hydrolysis. 2006).  forming  a  three‐dimensional  network  that  is  highly  resistant  towards  biological  and  chemical degradation (Martinez et al.  More  recently.   The  third  main  component.  Alvira  et  al. and lignin. Xiao  et  al.  pressures.  1982.  The  characteristics  of  the  lignocellulosic  substrate  for  enzyme  hydrolysis. 2010).4‐beta‐glucanases  (EC  3.  However.91).. is  a  heterogeneous.  the  sugar  yields  from  hydrolysis of the biomass will evidently depend on type and  severity  of  the  pretreatment  (Chang  &  Holtzapple.  lignin.  and  other  potential  interfering  compounds.  endo‐1. Department of Energy..1.  steam‐.2.  acid‐. yet are able  to  significantly  enhance  the  activity  of  cellulases  on  pretreated biomass.  The  three  main  categories  of  players  in  cellulose  hydrolysis  are  cellobiohydrolases  (or  exo‐1. hemicellulose may contain  arabinose.  In  order  to  produce  a  sugar  platform  from  plant  biomass. 2003).  highly  branched. Finally. 2002.  glucose (Shewale.  hemicellulose  content..  The complex structure of the cellulose fibrils embedded  in  the  amorphous  matrix  of  lignin  and  hemicellulose  protects the plant against attack from microorganisms and  enzymatic degradation as well as other naturally occurring  environmental  stress  such  as  weather  conditions  through  covalent  cross‐links  that  strengthen  the  plant  cell  wall.. 2002)  The second most abundant component.4‐beta‐D‐glucosidic  bonds  with  the degree of polymerization of native cellulose being in the  range  of  7.     Review paper  ‐ 2 ‐    .  Kabel  et  al.4‐beta‐ linkages  in  primarily  the  amorphous  regions  of  cellulose. as well as the extent of  branching is plant dependent.  lignin  content.  2010). beta‐glucosidases hydrolyze  the  cellobiose  and  in  some  cases  the  cellooligosaccharides  to  glucose.4‐beta bonds.  the  chains  form  a  highly  ordered  crystalline  domain. Berg et al. Some of these proteins have since been  referred to as GH61 proteins (Harris et al. is the most abundant  hemicellulose.4).  Therefore.  Several  reviews  on  different  pretreatment  methods  and  factors  influencing the following enzymatic hydrolysis exist (Sun &  Cheng.  hemicellulose.  and  maintaining  high  hydrolysis  rates  will  therefore  ultimately  depend  on  the  beta‐glucosidases.. 2005).  wax.  Cellulose.  Zhang  et  al..  The  biomass  composition  depends  on  the  plant/crop  type. ammonia fiber‐ or CO2 explosion.  On  the  other  hand  beta‐glucosidases  are  often  themselves  inhibited by their product.

  production.  therefore. fossil‐based fuels. 2005).   It  appears  from  the  above  mentioned  enzyme  systems  that  efficient  enzymatic  degradation  of  lignocellulose  requires  cooperative  and  synergistic  interactions  of  enzymes  responsible  for  cleaving  different  linkages  in  different  polymers  and  within  the  same  polymer.  discovery.  2000). 1987). The sequence identity of  a  family  could  be  as  low  as  10%  but  with  conserved  sequence  motifs  spanning  the  active  site  being  recognized.  location  and  transport  of  the  biomass to the production facility.  the  price  of enzymes typically contributes to a large part of the total  cost  (Merino  &  Cherry.  or  broad  specificity  beta‐glucosidases  (Shewale.  alpha‐L‐ arabinosides. aryl‐ beta‐ glucosidases (high specificity towards substrates such as p‐ nitrophenyl‐beta‐D‐glucopyranoside  (pNPG)).4‐beta‐xylanases  and  beta‐ xylosidases  are  key  players  hydrolyzing  internal  1.1.  Henrissat  (1991)  proposed  a  classification  system  based  on  sequence  and  structural  features  that  could  complement  the  IUB  system  for  better  description  of  the  glycoside  hydrolases.  Eyzaguirre  et  al.  Meanwhile  accessory  enzymes  such  as  alpha‐L‐arabinofuranosidase.  Based  on  substrate  specificity.  with  the  “X”  representing  the  substrate  specificity.  GH  families  were  defined  when  at  least  two  sequences  showed  significant amino acid similarity or no significant similarity  could be found with other families. As beta‐glucosidases are  key  in  terms  of  final  cellulose  hydrolysis  for  obtaining  sugars.  As  most  of  the  currently  used  pretreatment  methods  remove  lignin  from  the  sugar  polymers  and  in  many  cases  also  hydrolyze  most  of  the  hemicellulose.  2007).1. 2005).2.  and  efficient  hydrolytic  enzymes  (Knauf  &  Moniruzzaman.  Due  to  the  heterogeneous  structure  of  hemicellulose.  respectively.  such  as  the  1.  In  the  case  of  beta‐glucosidases.  the  main  target  for enzyme treatment is cellulose.  Glycoside  hydrolase  enzymes  have  been  assigned  the  number  EC  3.  structure.  and  action  of  beta‐ glucosidases  Classification  Beta‐glucosidases  are  classified  as  glycoside  hydrolases  in  the IUB Enzyme Nomenclature (1984) based on the type of  reaction  they  catalyze.  1993.  we  have  chosen  to  focus  this  review  on  fungal  beta‐ glucosidases. 2003).  beta‐D‐xylosides.  therefore.  Through  sequence  alignment  of  the  known  glycoside  hydrolases.  Evaluating  on  the  overall  production cost.  alpha‐ glucuronisidase  acetylxylan  esterase.  integration  of  enzymatic  saccharafication and fermentation in a single organism in a  consolidated bioprocess is discussed.2..  The  primary  challenge  in  making  a  sugar  platform  for  bioproducts  and  biofuels  is  to  get  a  cost‐competitive  product.  and  commercial  beta‐glucosidases  originate  from  fungi.  as  more  sequence  data  of  different  organisms  become  available  the  total  number  of  families  is  likely  to  increase  (Henrissat.   A  classification  based  on  substrate  specificity  cannot  sufficiently  accommodate  enzymes  that  act  on  several  substrates.  most  likely  share  the  same  Review paper  ‐ 3 ‐    .  This  defines  hydrolysis  of  terminal.   This  paper  will  present  the  characterization.  a  process  referred  to  as  enzymatic  combustion  (Kirk & Farrell. The strength of this system especially lies  in  the  investigation  of  the  active  site  of  the  enzymes.  2004).  ferulic  acid  esterase.  and  use  of  fungal  beta‐glucosidases  for  production of sugars for biofuel and bioproduct production.  or  beta‐D‐fucosides  (Bairoch. Peroxidases and laccases are the two  major families involved in ligninolysis.  which  denotes  their  ability  to  hydrolyze  O‐glycosyl  linkages.  non‐reducing  beta‐D‐glucosyl  residues  with  release  of  beta‐D‐glucose.4‐beta‐ linkages  and  xylobiose.  which  is  often  necessary  before  the  backbone itself can be hydrolyzed (Saha. generating aromatic  radicals  by  oxidizing  the  lignin  polymer..  The  foundation  for  both  biofuels  and  bioproducts  is  a  sugar  platform  of  monomeric  sugars  such  as  glucose  and  xylose  which  are  converted  to  the  desired  products  (Cherubini.  1982.  It  focuses  on  some  of  the  features  that  are  important  to  consider  for  industrial  application  within  production  of  biofuels  and  bioproducts  as  well  as  describes  different  methods to discover new beta‐glucosidases and methods to  improve  beta‐glucosidases.  Members  of  the  same  GH  family. 2002.  beta‐ glucosidases  have  traditionally  been  divided  into  cellobiases (high specificity towards cellobiose).  the  full  number  is  EC  3. Martinez et al.  Henrissat  &  Bairoch.  Naturally.  an  issue  that  is  particularly  relevant  for  glycoside  hydrolases  that  frequently  display  broad  overlapping  specificities.21`. 1996) and at present (July 2010) there  are 118 families.  Efficient  enzymes  for  lignocellulose  degradation  are.  These  aromatic  radicals  then  evolve  in  different  non‐enzymatic  reactions  contributing to the breakdown of the lignin structure (Perez  et al.  Lignin  depolymerization  is  catalyzed  by  unspecific  oxidative enzymes that liberate unstable compounds which  subsequently  take  part  in  many  different  oxidative  reactions.  2010).  Besides  discussing  the  application  of  beta‐glucosidases  for  generation  of  monomeric  sugars.  endo‐1.  A  wide  specificity  for  beta‐D‐ glucosides  is  found  and  there  are  examples  of  some  beta‐ glucosidases  hydrolyzing  beta‐D‐galactosides.  with  significant similarity of sequences being a strong indication  of  similarity  in  the  fold  of  the  structure. The costs related  to  creating  a  sugar  platform  from  lignocellulosic  biomass  involve  biomass  abundance. pre‐treatment strategies.X.. relative to e.4‐ beta‐linkage  of  cellobiose.  a  combination  of  main  enzymes  acting  on  the  backbone  as  well  as  different  accessory  enzymes  acting  on  the  side‐ chains  must  contribute  to  its  hydrolysis.  For  hydrolysis  of  the  xylan  backbone.  1991.g.  and p‐coumaric acid esterase remove substituents from the  xylan  backbone.  Henrissat & Bairoch.  of  high  demand.     Sequence.

  1992.  binding  and  catalytic  mechanism  and  rate. e.  at  present  there  are  no  crystal  structures  available from filamentous fungi (Cantarel et al. implying evolutionary divergence..  and  some  fungal  beta‐ glucosidases..  all  yeast. Wimal Ubhayasekera).  where  they  found  that  the  distance  between  the  conserved  catalytic  residues  is  similar  to  that  of  the  enzyme  from  barley.  fold  and  the  active  site  residues  as  illustrated  above.  Trifolium  repens  (clover)  (Barrett  et  al.  Thermus  nonproteolyticus  (eubacterium)  (Wang  et  al.  (2010)  have  modeled  the  enzyme  from  Penicillium  purpugenum.  also  show  significantly  beta‐galactosidase  activity  (Cantarel et al.   Box 1.  besides  of  beta‐glucosidase  activity.  Meanwhile.org/)  has  since  1998  been  a  database  specifically  dedicated  to  list  the  information  on  Carbohydrate‐Active  enZYmes. 1997)..   Homology  modeling  has  been  the  method  of  choice  for  obtaining  the  structural  information  from  fungal  beta‐ glucosidases  due  to  unavailability  of  the  structures.  The  EC  and  GH  systems  complement  each other and are at the same time interlinked in the way  that many of the sequence based families are polyspecific in  terms  of  containing  enzymes  with  different  substrate  specificities.  Henrissat  &  Davies  (1997)  proposed  convergent  evolution  to  explain  the  distribution  of  beta‐glucosidases  in  different  GH  families.  however  fungal  beta‐glucosidases  are  represented  only  in  families 1 and 3.  Bacillus  circulans (Hakulinen et al. the active site consensus patterns are defined  as written in Box 1..  2010). and (iii) tunnel. deep pocket like a narrow tunnel  with  a  dead  end.  plant..  2008).com. 2000.  they  have  adapted  towards  the  same  kind  of  environment.  1999). are less well characterized with only a few crystal  structures  having  been  solved:  beta‐glucoasidase  from  Hordeum  vulgare  (barley)  (Varghese  et  al.  which  are  abundant  in  the  fungal  genomes.cazy.  2003).    Triticum  aestivum  (wheat)  and  Secale  cereale  (rye)  (Sue  et  al. Generally.  The  catalytic  pocket of GH1s is a tight..  2009).  Bairoch. and  Oryza  sativa  (rice)  (Chuenchor  et  al..  with  the  depth  and  shape  of  the  pocket  or  crater  reflecting  the  number of subsites that contribute to substrate binding and  the length of the leaving group (Davies et al.  folding  characteristics  and  analysis  of  their  primary  structure  can  assign  potential  conserved  active‐site  residues.g.  in  other  words.  Phanerochaete  chrysosporium (white rot fungus) (Nijikken et al.  Jeya  et  al.  open  pocket.  e. Beta‐glucosidases and non‐ processive  exo‐acting  enzymes  have  the  pocket  or  crater  topology  that  is  well  suited  for  recognition  of  a  saccharide  non‐reducing  extremity  (Davies  &  Henrissat.  2006).  while  family  3  includes  some  bacterial.  GH3s  have  a  shallow.   The  CAZY  database  (http://www.. The structure of GH1s will most likely place greater  constraints  on  the  substrate  conformation  compared  to  GH3s (Harvey et al.  respectively.   Several  GH1  beta‐glucosidase  crystal  structures  have  been  determined  from  different  organisms. concluding a comparable function. where the glutamate (E) and aspartate  (D)  are  the  active  site  residues  (underlined).  2000).  These  regions  are  used  as  a  signature  pattern  in  the  GH  classification  of  the  enzymes  (Bairoch.  Bacillus  polymyxa  (eubacterium)  (Sanz‐Aparicio  et  al.  The  GH3  enzymes..  2001).  1998).  polysaccharide  lyases  (PLs). family 1 enzymes mainly include  bacterial.  1995). 1997).  Sweden. sequence  identity.   For  GH1  and  GH3  which  contain  fungal  beta‐ glucosidases.  These  structural  differences  alter  the  functional  properties  of  the  enzymes  such  as  substrate  specificity.     Structure  The  topology  of  the  active  sites  of  all  glycoside  hydrolases  falls into only three general classes. pers.g.  Evolution  and  environmental  factors  effect  on  these  differences  in  structure. (i) pocket or crater.  The  database  comprises  glycoside  hydrolases  (GHs).. 3.  archaeal. 30.  which  will  be  discussed  in  greater  detail  in  the  following  paragraph.  containing  genomic.. while at the  same time enzymes with similar specificities are sometimes  found  in  different  families.  1995). Zea mays (maize) (Czjzek  et  al.  Kluyveromyces  marxianus  (a  yeast).  Structurally GH1s and GH3s differ greatly.  and  Thermotoga  neapolitana  (a  hyperthermophilic  bacterium)  (Pozzo  et  al.  structural  and  biochemical  information. 2009).  it  was  obvious  that  the  residues  important  for  substrate  binding  and  catalysis  were  conserved  (Research  paper  IV.  beta‐glucosidases are found in families 1.  We  have  modeled  the  beta‐glucosidase  from  the  newly  identified  A. 2000). (ii)  cleft or groove.  Most  family  1  enzymes.  this  thesis).. Active site signatures  GH1 active site signature  [LIVMFSTC] – [LIVFYS] – [LIV] – [LIVMST] – E – N – G – [LIVMFAR] – [CSAGN]    GH3 active site signature  [LIVM](2) – [KR] – X – [EQKRD] – X(4) – G – [LIVMFTC] – [LIVT] – [LIVMF] – [ST] – D – X(2) – [SGADNIT]  Review paper  ‐ 4 ‐    . Searching the CAZY database.  glycosyl  transferases  (GTs). 2009).  However..  and  several  fungal  beta‐glucosidases  (Cantarel  et  al.  implying  convergent  evolution  (Henrissat & Davies.  and  carbohydrate esterases (CEs). and 116.. 2007).  animal.  saccharolyticus  in  collaboration  with  MAX‐lab.  Even  though  the  sequence  identity  was  relatively  low. 9.  which  have  helped understanding their mechanism and broad substrate  specificity..  Similarly.

    (2001)  on  a  GH3  beta‐glucosidase.4‐ dinitrophenolate or fluoride will speed up the glycosylation  step and allow for the “capture” of the inhibitor at the active  site. which by abstraction  of  a  proton  has  been  activated  by  the  deprotonated  acid/base  catalyst  (Koshland.  One  example  is  site‐directed  mutagenesis  studies  where a proposed nucleophile catalyst is replaced by other  amino  acids  that  will  not  change  the  conformation  of  the  active site.  HPLC  separation.  In  this  case. 1). and tandem mass spectrometric analysis.  2000). neapolitana is a good example to show this  process. White & Rose.  2010).  The  inhibitor  interacts  with  the  enzyme.  2000). K163.  1987. which  allowed  for  identification  of  the  peptide  to  which  the  inhibitor  had  bound..  respectively  (Bairoch.  but  also  the  residues  important  for  substrate  binding  can  be  identified  from  the  structure  of  the  enzyme. This will decrease the rate of  both the glycosylation and deglycosylation... This can give insight  to  the  necessity  and  function  of  that  particular  replaced  amino  acid.  and  E491)  from  the  the  barley  beta‐glucan  exohydrolases  have  been  reported  to  involve  in  hydrogen  bonding with the substrate.  1992.  where  the positive charge.  1987.  generating  a  covalent  intermediate.   No  tagging  method  of  the  acid/base  catalyst  has  been  described.   Most  retaining  beta‐glucosidases  have  transglycosidic          Fig.  rather  has  the  role  of  proposed  catalysts  been  verified  by  mutagenesis  and  kinetic  analysis  (Svensson  &  Sogaard. Incorporation of  a  good  leaving  group  to  the  substrate  such  as  2.  1994. Y210.  seven  amino  acids  (D58.  and  S307  (Pozzo  et  al.  Generally.  1995).  1953.  Catalytic mechanism  Hydrolysis  of  beta‐1.  The  carboxylic  acid  nucleophile  attacks  the  anomeric  carbon. Reprintet from  McCarter & Withers (1994).  1990).  Withers  et  al.  Not  only  catalytic  residues. R174. H207.  obtaining  a  time‐dependent  inactivation  via  accumulation  of  the  relative  stable  2‐deoxy‐2‐ fluoroglycosyl‐enzyme  intermediate  (Withers  et  al.  The  GH3  glycosidase of T. 2010).  the  nucleophile  Asp‐242  and  acid/base  Glu‐458  were  recognized  first  by  sequence  alignment  evaluation. With substrate located at the active site.  niger  beta‐glucosidase  was  the  only  possible  nucleophile  candidate present in the specified peptide. developed at C1 in the transition state. 1. Catalytic mechanism of  beta‐glucosidases. 1997).  Bairoch.  Similarly.  Identification  of  the  active  site  nucleophile  in  beta‐ glucosidases has been achieved through the formation of a  stabilized  glycosyl‐enzyme  intermediate  using  glycosidase  inhibitors  such  as  2‐fluoro‐glycosides  to  trap  the  covalent  intermediate  (Withers  et  al. and compare it with a non‐ inhibited  enzyme  through  peptic  digestion. seven amino acids (D95.  will  be  significantly  destabilized  due  to  presence  of  the  fluorine  substituent  at  C2  as  fluorine  is  much  more  electronegative than hydroxyl.  1993). providing evidence that Asp‐247 plays an  important  role  in  the  enzymatic  reaction  catalyzed  by  that  particular beta‐glucosidase and most likely functions as the  nucleophile..  Structural  studies  of  beta‐glucosidases  give  concrete  evidence  on  active  site  residues. and C6 and amino  acid  residues  W243.  Asp‐261  of  the  A.  and  creating  an  oxocarbenium‐ion‐like  transition  state  with  a  build‐up  of  positive  charge  on  the  anomeric  carbon.  for  the  GH3  beta‐ glucosidase  from  T.  the  Asp‐261  was  identified  as  the  catalytic  nucleophile  by the  use  of  2‐deoxy‐2‐fluoroglucosyl  (Dan  et  al.4‐oxygen  of  the  scissile  bond. but cannot act as a catalyst.  Withers  &  Aebersold.  In  the  Aspergillus  niger  beta‐ glucosidase..  1995).  M207.  R130.  1988.  This  was  done  by  Li  et  al.  which  are  possible  to  confirm  by  site‐directed  mutagenesis.  Review paper  ‐ 5 ‐    .  For  example.  several  site‐directed  mutagenesis  studies  have  been  carried  out  on  glycoside  hydrolases  in  terms  of  understand  in  their  mechanism  better.  Withers  &  Aebersold. D285.  breaking  the  bond.  The side‐chain of either a glutamate or an aspartate acts  as  the  catalytic  nucleophile  in  GH1  and  GH3  beta‐ glucosidases.  This  intermediate  is  hydrolyzed  by  nucleophile  attack  of  a  water molecule from the bulk solvent. K206. R158.  where  the  acid/base  catalyst  donates  a  proton  to  the  linking  beta‐1.4‐glycosidic  bonds  by  beta‐ glucosidases  is  carried  out  by  an  overall  retaining  double‐ displacement  mechanism  (Sinnott. and E548) in the active site  have been pointed out to be involved in hydrogen bonding  with  the  glucopyranoside  residue. C5.  Mccarter  &  Withers. the  departure  of  the  aglycone  is  initially  facilitated  by  general  acid  catalysis.  Dan  et  al.  (2000)  used  this  method to label the nucleophile.  Y253.  then  compared  with  three  dimensional  structure  and  confirmed by site‐directed mutagenesis (Pozzo et al.  neapolitana.  Two  catalytic  carboxylic  acid  residues  at  the  active  site  separated  by  approximately 5Å facilitate the reaction with one carboxylic  acid  acting  as  a  nucleophile  and  the  other  as  an  acid/base  catalyst (Fig. H164..  where  van  der  Walls  interactions occur between atoms C4.

 Eyzaguirre et al.    What is a good beta‐glucosidase?  In  relation  to  industrial  biomass  conversion.  Transglycosylation  has  frequently  been  reported  for  beta‐ glucosidases (Bhatia et al.  the  velocity  of  the  reaction.  including  (but  not  exclusive)  other simple sugars.  niger  beta‐glucosidase.      Stability  of  beta‐glucosidases  in  relation  to  the  physical  operating  conditions  is  required  for  efficient  hydrolysis.  that  in  situations  where  substrate  concentration  is  much  greater  than  KM.  the  optimal  enzyme has high Vmax and low KM.  niger  beta‐glucosidase  has  been  shown  to  be  important  for  binding  acceptors  and  thus  transglycosidic  activity.  a  value  that  has  also  been  reported  for  several  beta‐ glucosidases in the review by Eyzaguirre et al.  an  acceptor  such  as  sugar  or  alcohol  binds. and substitution of Trp‐262 cause the reaction to  be  mainly  transglycosidic  (Seidle  &  Huber. The value of KM should not be discredited in such  situation.  The  substrate  concentration  for  the  beta‐ glucosidases  will  depend  on  the  balance  of  the  cellobiohydrolase.  Trp‐262  has  been  found  to  be  a  key  residue  in  terms  of  maintaining  hydrolytic  rather  than  transglycosidic  activity. the effect is  naturally  increased  during  the  course  of  the  reaction  as  more and more glucose is formed.  Vmax  will  be  the  better  description  in  terms  of  enzyme  evaluation. In case of product inhibition. and for beta‐glucosidases  the end‐product is generally not removed during hydrolysis  so  the  actual  reaction  rate  will  differ  more  and  more  from  Vmax.  activity.. 2002). depending on the extremity and time  of  exposure. such as the acid‐base catalyst  Review paper  ‐ 6 ‐    .  In  relation  to  beta‐glucosidase  activity  in  hydrolysis  of  biomass  for  generating  sugars    the  inhibition  type  mostly  discussed  and  often  encountered  is  caused  by  the  end‐product.  Vmax  is  the  maximum reaction rate. High conversion rates are essential.  thus  using  the  active  site  capacity  in  non‐hydrolyzing  action  which  will  decrease  the  overall  rate  of  hydrolysis.  the  hydrolysis of cellobiose by the beta‐glucosidases should not  just  be  evaluated  at  saturated  conditions  in  an  isolated  fashion.  and  beta‐glucosidase  enzyme  mixture. the rate observed when the enzyme  is  saturated  with  substrate.  Other  than  inhibiting  the reaction by occupying the active site. 2005) . In relation to generating a  sugar  platform  through  biomass  hydrolysis..  The  accumulation  of  glucose  has  often  been  reported  to  decrease  reaction  rates  of  beta‐glucosidases  as  hydrolysis  proceeds.  ionic  groups  are  involved in enzyme catalysis. is frequently used to define product inhibition.  compounds  other  than  glucose  are  potentially  present  that  can  influence  the  activity  of  beta‐glucosidases.. Previous  reviews  on  beta‐glucosidases  have  summarized  published  values  of  kinetic  properties  of  different  microbial  beta‐ glucosidases (Bhatia et al. So on  that  note.  The  beta‐glucosidases  might  efficiently  hydrolyze the cellobiose product as they are formed by the  cellobiohydrolases..  endo‐glucanase.  whereby  substrate  saturation  is  never  reached. Such reaction takes place after the glycosidic bond  has  been  cleaved  and  the  aglycone  released. which is  equivalent  to  micromoles  hydrolyzed  per  minute  of  the  reaction under a given set of conditions. The kinetic constants  can  be  determined  by  different  rearrangements  of  the  MM  equation  giving  linear  equation.  In  terms  of  evaluating  beta‐glucosidase  performance  based  on  the  kinetic  parameters.  the  inhibitor  constant.  In  terms  of  MM  kinetics. or by non‐linear  regression aided by different computer programs. and stability. v..  Vmax  and  KM. amines.  Trp‐49  of  A. in the  active site.  concentration.  2005).  In  relation  to  the  application  of  beta‐ glucosidases  for  complete  cellulose  hydrolysis.  Instead  of  a  nucleophilic  attack  by  a  water  molecule  from  bulk  solvent  to  proceed  the  hydrolysis  of  the  glycosyl‐enzyme  intermediate.  KM  is  the  Michaelis  constant. From the MM equation it  can  be  derived.  where  the  constants  are  derived from axis intercepts or line slope.  A  decrease  in  the  rate  of  glucose  formation  can  also  be  caused  by  transglycosylation  events. Ki.  glucose.  In  A.    1  MM kinetics     = +     where  v  is  the  initial  rate  of  product  formation. (2005).  On  the  contrary. Kinetic parameters  reported  for  beta‐glucosidases  used  for  comparison  and  general  evaluation  typically  relates  to  Michaelis  Menten  kinetics.   Enzyme activity is standardly measured in units.  and [S] is the substrate concentration.  substitution  of  this  residue  produced  an  enzyme  with  high  ratio  of  hydrolytic  to  transglycosidic activity (Seidle et al.  Trp‐262  is  located adjacent to the nucelophile catalyst. Asp‐261.  inhibitors.  However.  and  tendency  to  react  of  the  acceptor  (Withers.  Beta‐glucosidases can.  1999).  Targeted  mutagenesis  aiming  at  displacing  essential  amino  acids  involved in transglycosylation could potentially reduce this  unwanted mechanism.  be  inactivated  by  pH  and  temperature  variations. 2006). 1985).  but issues such as product inhibition and thermal instability  can  be  a  restriction  for  maintaining  high  conversion  rates  throughout the hydrolysis. will equal Vmax with no dependence on KM.  The  acceptor  competes  with  water  and  the  extent  of  transglycosidic  reaction  depends  on  the  affinity. 2002.  a  good  beta‐ glucosidase  facilitates  efficient  hydrolysis  at  specified  operating  conditions. sugar derivatives.  Key  points  to  consider  when  evaluating  a  beta‐glucosidase  are  conversion  rate.  The activity of beta‐glucosidases is influenced by several  factors  including  inhibitors  and  stability  at  process  conditions.  including  beta‐glucosidases  of  different  origin.  Regarding  influence  of  pH.  transglycosylation  events  are  unwanted. glucose can also be  considered  to  take  part  in  transglycosylation  events. and phenols  (Dale et al.

  Several  publications  exist  where  authors  have  used  this  commercial  product  as  beta‐ glucosidase  supplement  to  the  hydrolysis  of  cellulosic  material.  The  temperature  optimum  for  Novozym  188  is  around  65°C  (Dekker.  Chauve  et  al.  Krogh  et  al.  Beta‐ glucosidaes  are  widely  produced  by  different  genera  and  species  of  the  fungal  kingdom  including  Ascomycetes  and  Basidiomycetes.  Effect  of  product  accumulation  on  enzyme  activity  is  not  mentioned by the manufacturer (Danisco US Inc.. of the enzyme. aiming at improving the performance of enzymes  for  biomass  hydrolysis  (Banerjee  et  al.  2001.  2010. 1986).  2010)..   Commercial beta‐glucosidases  The  primary  beta‐glucosidase  preparation  by  Novozymes  A/S  is  Novozym  188.  but  for  biomass  hydrolysis  processes  that  typically  run  for  the  duration  of  hours  or  even  days.  Research  paper II.  cellobiose and cellodextrins will be the major substrates for  beta‐glucosidases.  These  natural  substrates  should  preferably  be  used  in  the  evaluation  of  beta‐glucosidases. ‐kD is  the  rate  of  degradation.   In  practical  terms. calculated from equation 2.  1996).  hexokinase/glucose‐6‐phosphate  dehydrogenase  method  (Kunst  et  al. 1998.  it  is  important  to  specify  what  substrate  that  is  used  as  substrate  specificity  of  beta‐glucosidases  varies  (Riou et al..  whereas  cellobiose  did  not  appear  to  be  inhibitory  at  the  tested  conditions  (Dekker.  the  stability  of  the  enzyme  at  specified  temperatures  is  important.  [E]start is the initial enzyme concentration at time zero.  However..  and for prolonged incubations the stability was only upheld  below  50°C  (Krogh  et  al.  2010)..    The  pH  stability  range  is  between  4‐5    (Chauve  et  al.  Research  paper  II.  1984).  Krogh  et  al.   The  primary  beta‐glucosidase  preparation  by  Genencor  is AccelleraseBG. In  hydrolysis  of  cellulose  for  making  sugars  for  production  of  bioproducts  and  biofuels. Temperature and pH optimum  for  microbial  beta‐glucosidases  have  been  reported  in  the  reviews by Bhatia et al.  Research paper II.  in the beta‐glucosidase active site. This enzyme is less frequently mentioned  in  the  literature. 2009).  2000.  where  especially  the  ascomycete  genus  Aspergillus  has  been  widely  studied  for  beta‐glucosidase  production. In this category  of  substrates.  Regarding  temperature..  Novozymes  A/S  and  Genencor  (a  Danisco  Division). with the rate  of  denaturation  being  a  valid  value  for  evaluation  of  the  enzymes at different temperatures.  Calsavara  et  al.  Bravo  et  al.  Evidence  of  substrate  inhibition  or  transglycosylation  has  been  found  using  pNPG.  Cellic  CTec2  is  currently  the  state‐of‐the‐art  enzyme  from  Novozymes  A/S  that  according  to  the  company  has  proven  effective  on  a  wide  variety  of  lignocellulosic  Review paper  ‐ 7 ‐    . Several  different substrates with varying sensitivity and ease of use  can  be  applied  for  the  determination  of  beta‐glucosidase  activity.  2010. (2005).  Aryl‐glucosidases  are  often  favored  as  substrates..  2010.  when  studying  the  kinetics  of  beta‐ glucosidases.  and  t  is  the  time.  which  applies  to  all  chemical  reactions  including  enzyme  catalyzed  reactions. Korotkova et al.  2000.  2001).  Chauve  et  al. 2002. 2006.  2010b).  leading  to  denaturation.  or  alternatively.  pNPG  is  probably  the  most  common  encountered  in  the  literature.  protein  stability  will  be  affected.  with  a  decrease  in  activity  to  50% at a glucose concentration approximately 3 times that  of  the  substrate  concentration  (Dekker.3‐ 4.  2001. Detection of glucose. with an optimum at pH 4.. 2005.  according  to  the  van’t  Hoff  rule.  1986.  Research  paper  II.    − =   2  Thermal inactivation         where  [E]active  is  the  remaining  active  enzymes  at  time=t.  The  activity  is  competitively  inhibited  by  glucose  (Dekker.  Especially  A.  Thermal  inactivation usually follows first order decay. this thesis).. this thesis)..  high  performance  liquid  chromatography (HPLC).  this  thesis). Bhatia et al..  Activity  on  the  natural  substrates  is  calculated  by  measuring  release  of  glucose. The protonation state of  the  carboxylic  acid  residue  catalyst  and  the  carboxylate  nucleophile  is  essential  for  the  reaction  and  a  pH  change  could  impair  the  catalytic  mechanism  (McIntosh  et  al. even in scarce amounts.  2010)  though  with  temperature  stability  maintained  only  below  60°C  (Dekker.      Beta‐glucosidases for biomass hydrolysis  The  two  largest  enzyme  companies.  this  thesis).  thus  irreversible  inacitivation.  have  both  participated  in   large  research  programs  supported  by  the  US  Department  of Energy.. (2002) and Eyzaguirre et al.. 2009) and the choice  of substrate will influence the kinetic data obtained.  but  according  to  the  manufacturer  the  enzyme  has  the  best  operational  stability  at  pH  4‐6  and  temperatures ranging 30‐55°C.  1986..  2010.  Chauve  et  al.  1986.. with long operational times  possible  at  the  low  temperatures  while  the  higher  temperatures  will  limit  the  effective  period  of  operation.  1986. The latter requires high analytical  precision  and  has  been  demonstrated  using  ion‐exchange  chromatography  (IC)  methods  (Research  paper  II..  niger  has  been  setting  the  standard  in  commercial  beta‐glucosidase  production  (Dekker.  when  reaching  high  temperatures..  Langston et al. can be  done  by  the  glucose  oxidase/peroxidase  method  (Bergmeyer  &  Bernt..  as  a  colored  or  fluorescent  product  is  released  upon  hydrolysis.  Recently  both  enzyme  companies  have  launched  cellulase  products  with  sufficient  beta‐glucosidase  activity  for  efficient  hydrolysis  of  biomass  without  separate  addition of supplementary beta‐glucosidase.  Bravo  et  al. simplifying detection of activity.5  (Bravo  et  al.  The  enzyme  stability  can  be  reported  as  the  half  life  at  different  temperatures.  1974.  Calsavara  et  al..  Mazura  et  al. Eyzaguirre et al...  decrease  in  substrate concentration.  1986.  this  thesis).  reaction  rate  doubles  with  every  10°C  increase  of  temperature.  2006). or IC.

  high  temperature stability has sometimes been reported using a  relatively  short  incubation  time.  10  %  activity  at  67°C  after  2  hours  of  incubation.  Earlier.. several new beta‐glucosidases with  different  specificities  have  been  reported  in  the  literature.  However. 2007a) and Penicillium brasilianum with a half life of  24  hours  at  65°C  (Krogh  et  al. promised by  the  manufacturer.  saccharolyticus  beta‐ glucosidase  to  be  more  thermostable  than  the  commercial  enzyme  preparation  Novozym  188  from  A.  2004).  (2000)  demonstrates  that  A. comparable to Talaromyces emersonii  for  which  a  half  life  of  62  min  at  65°C  has  been  reported  (Murray  et  al.  (2006) similarly found half‐life of A.  Cellic  CTec2  replaces  the  combined  use  of  former  applied  Celluclast  1. however.  it  contains  a  blend  of  cellulases..  By  containing  all  cellulase  and  beta‐glucosidase  components  for  cellulose  hydrolysis.  de  Palma‐Fermandez  et  al. after 20 hours incubation at  60°C. therefore.  and  inhibitor  tolerance  as  well  as  the enzyme being effective at high solid concentrations and  compatible  with  multiple  feedstocks  and  pretreatment  methods.  Rojaka  et  al.  2010). and a calculated half life of 51 min at 80°C.  Less  dosage  of  the  product  is  required  compared  to  former  products.  enzyme  concentration.. 2010).  saccharolyticus  has  a  half  life  of  61  min  at  65°C  (Research  paper IV.  (2001)  have  investigated  four  beta‐glucosidases from Aspergillus tubingensis of which two  had  high  glucose  tolerance.  High  conversion  rates  are  essential  for  efficient  conversion  of  biomass.  oryzae.  Ki  of  953mM  Review paper  ‐ 8 ‐    .  Accumulation  of  glucose  during  hydrolysis  can  significantly  lower  the  rate  of  cellulose  hydrolysis  through  inhibtion  and  another  important  focus  for increasing overall biomass hydrolysis is.  Korotkova  et al.glu  of  470  and  600mM.  This  clearly  demonstrates  how  complex  it  can  be  to  compare  results  by  different  researchers.0‐5.0‐5.  Meanwhile.  the  same  lab  reported  high  glucose  tolerance  from  a  beta‐ glucosidase  of  Aspergillus  foetidus. Ki of 543mM  (Yan  et  al.  making  it  difficult  to  compare  temperature  stability  between  different  beta‐ glucosidases. only data well above this temperature is dealt  with  here.  We  found  A.  It  contains  all  major  activities  needed  for  biomass  hydrolysis  and  has  enhanced  hemicellulase  activity. this thesis).  and  A.  saccharolyticus  still  had  more  than  70  %  activity  while  Novozym  188  drop  to  40  %  activity  at  60°C.  most  likely  due  to  different  conditions  being  used during incubation and assaying the activity.  had  a  thermostability  up  to  70°C  when  incubated  for 1 hour.  but  only  approximately  60%  at  60°C..  This  is  six  times  longer  than measured by us and Rojaka et al.  stability.  reesei  strain..  (2010)  indicate  a  half‐life  for  A. this  thesis).     Promising  beta‐glucosidases  recently  reported  in  the  literature  Within the last decade.  retaining  100%  activity  after  24  hours  incubation  at  50°C.  is  said  to  be  a  mile‐stone  in  making  cellulosic  ethanol  at  a  commercial  profitable  scale.  tubingensis  beta‐glucosidase were remarkably stable. this thesis)..  niger. respectively.  Stability  for  prolonged  periods at high temperatures was found for both Aspergillus  fumigatus with a half life greater than 19 hours at 65°C (Kim  et al. niger beta‐glucosidase  to be 8 hours at 55°C and 4 hours at 60°C .  but  no  activity at 67oC after 2 hours of incubation (Research paper  II.. is more  difficult  to  compare  as  different  researches  use  different  incubation  conditions.  2008).  A  similar  tolerance  towards  glucose  was found for a beta‐glucosidase from A.  (2002)  have  purified  two  beta‐glucosidases  from  the  thermophilic  fungus  Thermoacus  aurantiacus  and  found  that they retained between 75‐82% activity after incubation  for 1 hour at 70°C.  Aureobasidum  pullans. (2006).  japonicus  beta‐glucosidase  to  only  retain  57%  of  its  activity  after  incubation for 1 hour at 50°C.  2000). The enzyme complex can hydrolyze a broad range of  lignocellulosic  carbohydrates  of  different  feedstocks  and  pretreatment methods into fermentable monosaccharides. Decker et al.  We  present  some  of  these  beta‐glucosidases  that  can  potentially be important in biomass degradation.  japonicus  and  A.  Elevating  the  temperature  further. For a true  comparison  the  enzymes  in  question  should  be  tested  in  parallel  by  the  same  laboratory.  when  using  pNPG  as  substrate.  times  and  temperatures.  As  the  commercial  enzymes  primarily  are  meant  to  operate  around 50°C.  as  it  retained  more  than  90%  activity  at  60°C  and  still  had  approx.  (2000).  (2009)  found  A.  whereas  Krogh  et  al.. (2008) found that a beta‐ glucosidase  from  the  yeast‐like  fungus.  A.  and  hemicellulases.  Best  operational  stability  is  at  pH  4.  According  to  its  application  sheet  the  product  is  produced  with  a  genetically  modified  T.  1998)  and  an  even  higher  tolerance  was  reported  for  a  beta‐glucosidase  of  A. maintaining 85%  and 90% activity.  For  example. high  tolerance  of  beta‐glucosidases  towards  glucose  accumulation.  respectively.   Special  attention  has  been  paid  to  thermostability  of  beta‐glucosidases. 2010).  this  thesis). After 4 hours of incubation these differences  are  much  more  pronounced  as  the  beta‐glucosidase  of  A.5  and  temperatures  of  45‐60°C. which is similar  to  our  results  (Research  paper  II.  saccharolyticus of 365 min at 61°C (Research paper IV. niger.  substrates.  and  beta‐glucosidases  originating  from  fungi  belonging  to  different  genera  have  been  proposed  as  promising  candidates  for  biotechnological  processes  at  elevated temperatures. Thermal stability.  according  to  the  company.  are  high  conversion  yields. and Leite et al.  According  to  its  application  sheet.  Ki..  functioning  at  optimal  temperature  of  45‐ 50°C and pH 5.  high  level  of  beta‐glucosidase.  while  Novozym  188  had  75%  activity  at  60°C.  with  a  Ki  of  520mM  (Decker  et  al.5. contradicting the findings of  Dekker  et  al. Some of the key elements.  niger  beta‐ glucosidase  of  24  hours  at  60°C.  Decker  et  al. Monascus purpureus  of  315  min  at  60°C  (Daroit  et  al.5L  and  Novozym 188 (Novozymes A/S.  Penicillium  citrinumis  is  reported  to  have  a  half  life of 120 min at 58°C (Ng et al.    Accellerase  DUET  is  a  newly  introduced  product  by  Genencor  that.

 A rich medium  supporting  good  growth  can  be  chosen  to  screen  general  expressed  proteins.  Serra  et  al.  in  several  cases  specifically  media  with  lignocellulose  as  sole  carbon  source  have  been  chosen  to  induce  expression  of  enzymes  for  biomass  degradation.  saccharolyticus  identified  by  our  group  (Research paper III.  and  discriminatory  detection  and  selection  methods  are  sought  to  identify  exactly  those  fungi  harboring  efficient  Review paper  ‐ 9 ‐    .  several  new  species  have  been  identified  within  the last few years (Samson et al. With more efficient beta‐glucosidases being  the goal. 2005..  including  A.  However.  Mares  et  al. 2...  Sternberg  et  al.  Measuring  beta‐ glucosidase activity on its natural substrate.  Zhang  et  al.  Recently.4‐ glucopyranoside  (yellow). as screening usually involves a very large  number  of  samples  to  be  processed  (Cheetham. Cheap.  the  other  is  to  improve  known  beta‐ glucosidases.   that  can  be  used  in  plate  assays  with  the  various  color  precipitates formed remaining tightly localized to the place  of the hydrolytic reaction.  1987).  2006.8  fold  greater  activity  at  these  glucose  concentrations  than  in  the  absence  of  glucose.  and  extracellular. 2004.  2001).  2008. two strategies are in play.  Generally.  Hawksworth.  The  identification and characterization of new fungal species are  often encountered in literature.  is  usually  tedious  compared  to  chromogenic  or  flourogenic  substrates  that  react  to  give  colored  or  fluorescent  products  and  are  therefore  often  preferred  as  an  easy  first  step  in  identification  of  the  presence  of  beta‐glucosidase  activity. rapid. cellobiose and  short  cellooligomers.  Perrone  et  al.  broad  screenings  of  fungal  extracts  for  beta‐glucosidase  activity  have  not  frequently  been  published. Sketch of the different  strategies described to obtain more  efficient beta‐glucosidases    (Gunata  &  Vallier.  they  found  black  Aspergilli  to  be  superior  in  terms  of  beta‐ Screening for new beta‐glucosidases  In  order  to  optimize  the  use  of  different  biomasses.  to  which  the  efficient  beta‐glucosidase  producer  A.  Noonim  et  al.  and  flourogenic    beta‐naphthyl‐ beta‐D‐glucopyranoside  (blue)  or  4‐methylumbelliferyl‐ beta‐D‐glucopyranoside  (blue)  for  beta‐glucosidase  screening.          Fig.   The  composition  of  a  fungal  extract  will  to  a  certain  degree depend on the growth medium used.  The  outcome  of  such  screening  strategy  builds  on  two  key  elements:  the  choice of growth conditions and beta‐glucosidase assays.  (2006)  suggest  the  use  of  chromogenic  p‐nitrophenyl‐beta‐D‐1.. (2008)  to be stimulated in the presence of up to  300mM  glucose.  cell  wall  associated. The question of where to look for these undescribed  fungi  is  discussed  by  Hawksworth  and  Rossman  (1997):  Everywhere.  including  your  own  backyard.  2008).  niger  belongs.  1991.  it  is  important to identify new beta‐glucosidases with improved  abilities on the specific biomasses as well as with improved  abilities such as stability and high conversion rates.  thermal  inactivation.   Assaying  for  proteins  with  beta‐glucosidase  activity  can  be  done  using  several  different  substrates.  the  activity  of  beta‐ glucosidases  from  Aspergillus  caespitosus  was  reported  by  Sonia et al.  Varga  et  al.  (1977)  searched  amongst  200  fungal strains for strains producing large quantities of beta‐ glucosidases that could supplement the  Trichoderma  viride  cellulases  for  cellulose  saccharification.  2007. Within the black Aspergilli.  and  high  cost  of  enzyme  production  are  the  main  obstacles  of  commercial cellulose hydrolysis and therefore set the stage  in  the  search  for  better  alternatives  to  the  currently  available  enzyme  preparations.  however  a  sharp  decline  in  activity  was  found  above  this  concentration. simple..     Fungal extract screening  In  terms  of  screening  fungal  extracts  for  beta‐glucosidase  activity  the  secreted  proteins  are  assayed. 2). this thesis)..  primarily  the  extracellular  beta‐glucosidases  are of interest.    beta‐glucosidases.5 million of which as little as approximately  5%  are  known  (Hawksworth.  a  statement  that  calls  for  a  more  directed  effort  for  unraveling  the  potential  of  unknown  species  found  in  nature.  The  number  of  fungal  species  on  Earth  is  estimated to 1.   To  our  knowledge.  having  3.  1999).  low  product  yields. while Perry et al.  2008b. de Vries et al.  a  few  of  which  have  been  mentioned  previously.  A  screening  strategy  must  be  planned  thoroughly  because “you get what you screen for”.  including  screening  of  fungal  extracts  and screening using metagenomic approaches (Fig..  Industrially.  Noonim  et  al. One is to screen for new  beta‐glucosidases.  The  beta‐glucosidases  can  be  arranged  in  three  groups  related  to  localization:  intracellular.  Different  strategies  can  be  chosen  in  the  search  for  new  beta‐glucosidases. Product  inhibition.  The  screening  is  thereby  directed  towards  lignocellulose  degrading  fungi  which  would  include  beta‐ glucosidases  for  complete  hydrolysis  to  glucose  that  the  fungus can use in its metabolism..  2008a. (2007) investigated the use of  several  other  chromogenic  beta‐glucosidase  substrates.

 Another  approach  is  to  express  the  library  in  appropriate  host  strains and thereafter perform activity screening (Lorenz &  Schleper.  Another  screening  has  been  published  by  our  lab  (Research  paper  II.  using  pNPG  to  screen  86  fungal  extracts  from  submerged  fermentation of a broad range of in‐house fungal strains. Kim et al. digested by trypsin. 2010). Such prospecting will  facilitate  identification  of  novel  variants  of  distinct  protein  families or of known functional classes of proteins.  a  more  detailed  screening of a selected number of strains can be performed  on  cellobiose.  you  can  search  anywhere  for  new  fungi.4‐D‐glucose. this thesis).  Enzyme  discovery  in  lignocellulosic  ecosystems  harboring  relevant  enzymes  can  easily  be  too  complex  for  metagenomic sequencing technologies.  and/or improve thermo stability.  (2007a)  been  coupled  with  zymography  to  discover  beta‐glucosidases  from  A. Jiang et al. 2010).  2002).  The  increased  activity  obtained  from  such  classical  mutagenesis  is  most  often  due  to  changes  at  the  regulatory  level  of  enzyme  expression  leading  to  increased  production  of  the  gene  of  interest  or  decreased  expression  of  conflicting  genes  and  is  therefore  Metagenomic screening   Other  strategies  for  obtaining  beta‐glucosidases  have  included  screening  of  environmental  DNA  for  beta‐ glucosidase  using  a  metagenomics  approach  (Kim  et  al.  One  good  example  of  developing  a  host  strain  with  improved  total  protein  production  and  activity  is  the  work  of  Montenecourt  and  Eceleigh  (1979).  Following  an  initial  screening  using  the  simple  chromogenic  or  flourogenic  substrates. one of the best existing  T.  where  gel‐ electrophoresis of protein mixes is employed for separation.  change  stereo‐specificity.  As  pointed  out  by  Hawksworth  and  Rossman  (1997).  with  the  finding  that  especially  Rhizomucor  miehei  could  be  of  industrial  interest..g.  create  novel  specificities  and  activities. by eliminating transgycosylation activity and  glucose  inhibition.  The  libraries  will  serve  as  basis  for  screening. 2010).  fine‐tune  specificity.  followed  by  evaluation  using  pretreated  lignocellulosic  biomasses  in  combination  with known efficient cellulases.  The  metagenomic  approach of directly cloning environmental DNA and screen  this  unidentified  pool  for  beta‐glucosidase  activity  will  widen  the  screening  to  include  such  organisms. 2009. 2008).  This  substrate  is  preferred  over  pNPG. and  analyzed by LC/MS/MS.  as  pNP  diffuse  more  quickly and will not stay in the gel at its place of production.  short  cellooligomers.  this  thesis). They also used pNPG for screening  of  fungal  extracts  from  94  strains  that  had  been  cultivated  in  either  solid  state  or  submerged  fermentation.  Another  study  focused  on  identification  of  acid‐  and  thermotolerant  extracellular  beta‐glucosidase  activities  in  Zygomycetes  fungi (Tako et al.    Improving beta‐glucosidases  The  features  aimed  for  when  improving  beta‐glucosidases  are  the  same  as  the  goals  in  screening  for  novel  beta‐ glucosidases...  but  searching  for  novel  beta‐glucosidases  it  would  seem  most  appropriate  to  explore  lignocellulosic  environments. therefore DeAngelis  et al.  A.  from  which  a  smaller  number  of  strains  were  selected  based  on  observed  fluorescence  and  thereafter  assayed  more  thoroughly  in  liquid  culture  with  pNPG  with  the  finding  that  a  P. We  found a black Aspergillus strain that we identified as a novel  species.     Classical random mutagenesis  Mutagenesis by UV light or chemical treatment followed by  screening for improved activity or stability has been carried  out  for  decades.  such  as  improve  enzyme  activity. (2010) recently proposed a strategy of cultivating the  microbes  from  these  ecosystems  under  defined  conditions  to  obtain  feedstock‐adapted  communities  with  reduced  diversity that can be screened.  2004). an enzyme of which the crystal structure  was later derived (Nam et al.  and  later  the  same  research  group  have  through  a  similar  approach  identified  another  novel  beta‐glucosidase  from  sludge  samples  from  a  biogas  reactor (Jiang et al.. Jiang et al.  yet  the  purified  recombinant  protein  efficiently  hydrolyzed  D‐ glycosyl‐beta‐1.  (2010)  have  used  plates  containing  4‐methylumbelliferyl‐beta‐D‐glucoside  as  an  initial screening for beta‐glucosidase producing fungi in soil  samples.. (2007b) were the  first  to  report  the  isolation  of  a  family  1  beta‐glucosidase  from  a  metagenome  library  originating  from  Korean  soil  samples.  Using  a  combination of UV irradiation and nitrosomethyl guanidine  treatment resulted in strain RutC30.  this  thesis).  using  4‐methylumbelliferyl‐beta‐D‐cellobioside  in  activity screening.  reesei  cellulase  mutants.  saccharolyticus  (Research  paper  III.  purpurogenum  strain  was  especially  efficient in producing beta‐glucosidase.  either  using  hybridization (DNA probes) or PCR techniques on the basis  Review paper  ‐ 10 ‐    . Jiang et al..    of  sequence  similarity  or  conserved  motifs.  fumigatus.  change  substrate  specificity.  Jeya  et  al.  followed  by  incubation  with  for  example  4‐ methylumbelliferyl‐beta‐D‐glucoside  and  in  situ  visualization  of  the  reaction  in  the  gel  facilitated  by  the  fluorescent  product  formation  (Murray  et  al.  which  is  very  promising  in  terms  of  beta‐glucosidase  production  (Research  paper  II.  where  the  activity spots were cut from the gel.  directly  screening the library at genomic level..   Zymogram  techniques  have  been  employed  for  the  identification  of  beta‐glucosidases.  glucosidase  production.  2007b.  A proteomics strategy using tandem mass spectrometry has  by  Kim  et  al. (2009) have  likewise  identified  a  novel  beta‐glucosidase  from  soil  metagenome  of  which  the  amino  acid  sequence  did  not  show  homology  with  other  beta‐glucosidases. e. Many microbial  species are difficult to cultivate in the laboratory because of  specialized  growth  requirements.

  followed  by  evaluation  of  the  mutants  (Antikainen  &  Martin.. Rather than classical  mutagenenis  where  the  change  could  occur  in  any  part  of  the  genome.  1996). 1998).     Replacement  of  single  amino  acids  through  random  mutagenesis can have great effects.  Bioinformatics  is  a  prerequisite  for  rational design.  2005).  no  investigation  of  the  specific  changes caused by the irradiation was undertaken. 2002).  2000.  and  selection  set  the  stage  for  functional  evolution  in  nature.  but  also  carried  out  to  understand  and  characterize  the  function  of  different  regions  of  the  beta‐glucosidases  (Antikainen  &  Martin.  Directed  evolution  mimics  natural  evolution  by  combining  reiterative  random  mutagenesis and recombination with screening or selection  for enzyme variants with improved properties (Tobin et al. Stability of the Bacillus  polymyxa  beta‐glucosidase  was  enhanced  using  hydroxylamine  for  random  mutagenesis. 1993). DNA shuffling resembles  natural  sexual  recombination  and  through  shuffling  multiple related DNA sequences.  Reviews  have  been  published  by  both  Kaur  and  Sharma  (2007)  and  Sen  et  al  (2006).. Analysis of purified beta‐ glucosidases  of  this  organism  showed  difference  in  pKa  compared  to  the  beta‐glucosidases  of  the  wild  type. A great amount of knowledge is available on  for  example  the  protein  engineering  possibilities  for  improving  thermo  stability..  advancing  the  stability  of  the  tertiary  structure (Sanz‐Aparicio et al.  rather  than  changes to the enzyme itself for improved activity. Cherry & Fidantsef. Meanwhile.  2005).  2003...  introducing  a  salt  bridge  linking  two  distant  segments  together.  a  commonly  used  technique  for  changing  specific  amino  acids  is  the  overlap  extension  method.   Generally.  detailed  knowledge  of  the  protein  structure.   Gamma  ray  irradiation  of  Cellulomonas  biazotea  has  resulted  in  a  mutant  with  increased  beta‐glucosidase  productivity (Rajoka et al.  not  just  its  expression  mechanism. and four other conserved residues  in  the  active  site  region  were  found  to  have  different  degrees  of  significance  in  terms  of  activity  (Trimbur  et  al. which is generally said to be the beginning of the  modern era of directed evolution.  The  E96K  mutation  caused  a  change  in  the  secondary  structure  (identified  by  crystallography) most likely due to an ion pair involving the  new  Lys96.  expanding  the  range  of  mutations  to  this  gene  previously  obtained  by  Rational design  More  advanced  mutagenesis.  increasing  the  internal  hydrophobicity.  stabilizing  the  protein  through  increasing  the  number  of  disulfide  and  hydrogen  bonds.  Antikainen  &  Martin.  minded  on  production  strain  improvements.  D374  was  suggested  as  acid‐ base catalyst candidate. 2003).  Mutation. This would favor the  formation of glucose monomers by beta‐glucosidase and be  of  great  value  for  the  generation  of  a  sugar  platform  for  biofuels and bioproducts. The tools for performing directed evolution are  there. evolution can radically be  accelerated.  however. 2005..  thus  showing  that  the  radiation  has  influenced  the  actual  beta‐glucosidase  gene.  To  improve  a  function  through  rational  design.  is  required  (Zhang  et  al.  2005)..       Directed evolution  Directed  evolution  seems  to  be  the  method  of  choice  in  terms of improving beta‐glucosidases.  2006).  site  directed  mutagenesis.  indicating  that  the  hydrophobic  micro‐environment  in  the  vicinity of the active site has  been changed. 1998). Zhang et al.  mentioning  several  different  directed evolution strategies and discussing the advantages  and  disadvantage  of  the  different  techniques.  1990).  Improvements  in  both  KM  and  thermo  stability  were  found  (Rajoka  et  al.  The  mechanism  of  transglycosylation  could  preferably  be  altered  by  site‐directed  mutagenesis  if  specific amino acids known to be important for this function  can be identified (Seidle et al.  caused  an  increase  in  thermal  and  pH  stability  (LopezCamacho  et  al. Especially two mutations. The essential role of E358 as nucleophile  in  catalysis  was  confirmed.  However. the effect  of  the  M416I  is  likely  due  to  increased  resistance  to  oxidation  of  isoleusine.  2000).  correlating  well  with  the  finding  that  beta‐glucosidase  of  thermostable  microorganisms  generally have a low content of methionine (LopezCamacho  et al.  Review paper  ‐ 11 ‐    .g. 2006).  recombination.. 2006).  directed  evolution  targets  the  specific  gene  of  choice.  e.  Specific  amino  acid  sites  to  be  changed  are  chosen.    rational  design  can  in  practice  be  hindered  by  the  complexity of the protein function (Tao & Cornish. site‐directed mutagenesis has in several cases  been used to confirm the identity of the amino acid catalysts  of  beta‐glucosidases.  Enhanced thermo‐resistance has been obtained through  error  prone  PCR  of  the  Paenibacillus  polymyxa  beta‐ glucosidase  (Gonzalez‐Blasco  et  al.  as  rational  design.. 1996).  In  1994  Stemmer  introduced  the  research  community  to  gene  shuffling..  or  substituting  for  certain  amino  acids  as  protection  against  chemical  destabilization  (Nosoh  &  Sekiguchi.  evaluating  the  importance  of  different  amino  acids  related  to enzyme activity.  1992).  for  example  by  taking  advantage  of  known  3D  structures.  however..  but  opposed  to  rational  design  you  need  no  knowledge  of  enzyme  structure  and  specific  interactions  between  enzyme  and  substrate.  as  random  changes  are  performed  delimited  to  the  gene  of  choice.  and  function  related  to  structure.  1992). where the mutation is introduced through primers  containing  a  mutant  codon  with  a  mismatched  sequence  (Reikofski  &  Tao.  is  used  for  improvements. 2001.. Chirumamilla et al.  A  combination  of  site‐directed  and  random  mutagenesis  was  carried  out  on  the  active  site  region  of  an  Agrobacterium  faecalis  beta‐glucosidase.  switching  the  nucleotide  base  pairs  from  A  to  G  or  from  C  to  T  (LopezCamacho & Polaina.  E96K  and  M416I.  In  rational  design.  the  key  is  how  to  correctly  evaluate  the  performance  of  mutants  generated  by  these  recombinant  DNA  techniques  (Cherry  &  Fidantsef.

..  Such  an  example  is  the  cellulase  product  of  T.  With  the  strategy  of  producing  and  selling  enzymes on a protein mass basis. 1985.  Other  ways  of  increasing  the  beta‐glucosidase  activity  of  T. Investigation of  the  same  gene  randomly  mutated  by  error  prone  PCR  and  DNA  shuffling‐mediated  recombination  was  published.  recovery  process  development.  purification.  but  only  roughly  constitutes  0.  2001).    Complete enzyme cocktail  A complete enzyme cocktail can be obtained by co‐culturing  fungi  that  separately  are  known  for  efficient  production  of  single important enzymes.  reesei which is widely used and has for a long period set the  stage  in  industrial  production  of  enzymes  for  biomass  hydrolysis. Shuffling combined  with  gene  truncation  of  two  different  family  3  beta‐ glucosidases  has  given  information  on  the  importance  of  different  regions  in  relation to enzyme  activity  and  folding  (Singh  &  Hayashi. and an improved beta‐glucosidase was identified. A similar  approach of combining error prone PCR and gene shuffling  was  performed  on  Pyrococcus  furiosus  beta‐glucosidase.  the  beta‐ glucosidase  of  the  organism  is  hyperthermostable  and  it  was  sought  to  improve  low  temperature  hydrolysis.  to  maximize  product  purity and economy.  culture  selection.  Fluorescence  activated  cell  sorting  was  combined  with  in  vitro  compartmentalization  that  allows  the  substrate  to  remain  associated  with  individual cells expressing the different mutants.  fermentation  studies.  the  mutations  were  carried  along  and  pooled  for  use  as  template  in  another  round  of  mutagenesis.  or  A. 2005.  1997).  The  homologous  C‐terminal  regions  of  the  beta‐glucosidase  genes  play  an  important  role  in  determining  enzyme  characteristics including pH/temperature activity. the improvements are  attributed to formation of salt bridges and amino acids less  prone to oxidation (Arrizubieta & Polaina.  marketing  (Saha  &  Bothast.  2007).  The  mutants  with  advantageous  substitutions  were  recombined  by  gene  shuffling.  The  hydrolysis  at  low  temperature  of  cellobiose  was  increased  up  to  two  fold  and  the  substrate  specificity  towards  pNP‐ glucopyranoside  compared  to  pNP‐galactopyranoside  was  increased 7. Madamwar & Patel.  e. thereby obtaining high sugar  yields with low enzyme loadings (Banerjee et al.  Talaromyces  emersonii  (Murray  et  al.  unchanged.  2005).3  base  pairs  per  gene  (equals  approximately  1  or  2  amino  acid  substitutions  per  enzyme). 2010a).  or  reduced. especially fungi from the genera  Trichoderma  and  Aspergillus  have  frequently  been  used  in  mixed fermentations to obtain efficient cellulose hydrolysis  where  the  beta‐glucosidase  contribution  is  mainly  from  Aspergillus (Duff et al.  2007).  Enhancement  of  T.   Random  drift  mutagenesis  has  been  performed  on  Caldicellulosiruptor saccharolyticus beta‐glucosidase..  characterization.  reesei  include  heterologous  expression  of  beta‐glucosidase  from  other  fungi..  Merino  &  Cherry.  and  finally..  isolation. more than 90% of industrial enzymes  are  produced  recombinantly  in  hosts  that  have  been  modified  in  such  a  way  as  to  decrease  unwanted  product  and increase expression of the introduced genes (Cherry &  Fidantsef. This is too low amounts for an efficient hydrolysis of  cellulose.5 fold (Lebbink et al. where  the screening only focused on retained ability to hydrolyze  beta‐glucosidase  substrates. Hardiman et  al.    Production  and  implementation  related  to  application   Production  of  enzymes  in  industrial  scale  needs  to  be  economically  favorable.  Whether  improved.  thus  creating  a  single  expression  host  for  the  production  of  all    Review paper  ‐ 12 ‐    .  reesei  beta‐glucosidase  has  been  achieved  through  displacement  of  the  promoter  by  homologous  recombination  with  xylanase  and  cellulase  promoters  obtaining  a  4‐7.  chemical  mutagenesis  mentioned  above  (LopezCamacho  &  Polaina..  saccharolyticus  (Research  paper  IV.  1995..  (2010)  performed  iterative  mutagenesis  procedures  followed  by  screening  using  a  high  throughput  method  to  screen  for  retained  abilities.g.  toxicology  study.  evaluation.  Aspergillus  oryzae  (Merino  &  Cherry. 1996)..  product  formulation.  with  the  result  that  the  clone  that  exhibited  the  greatest  thermal  resistance was a triple mutant. Wen  et  al.  this  thesis).5%  of  the  secreted  protein  mix  (Kubicek. stability.  2009)..  1992.  therefore.  and  harmful  (but  not  inactivating)  mutations  to  occur  (Bergquist et al. 2003). the goal is to increase the  specific activity of the mixture. Finally the  final library was screened for recombinants with improved  activity.. 2000). However.  This  can  be  very  costly  and  time  consuming  and.  improvement  of  fermentation.  allowing  multiple  adaptive. 1993. Again.  2004). most  fungal  strains  do  not  produce  significant  amounts  of  all  enzymes  needed  for  complete  hydrolysis  of  lignocellulosic  biomasses  and  supplementation  by  other  enzyme  extracts  is  needed. 2010).  In  this  case. LopezCamacho et al.  1995).  where  the  calculated  average  mutation  frequency  was  2. Beta‐glucosidase activity is found in the product  of  T.  and  specificity  (Singh  &  Hayashi.  Commercial  development  of  an  enzyme  from  its  natural  source  comprises  different  fundamental  tasks  and  strategies:  Screening  for  microorganism.  Hayashi  et  al.  neutral. 1992.5  fold  increase  in  beta‐ glucosidase  activity  (Rahman  et  al. It  is  therefore  valuable  to  have  a  single  organism  expressing  all enzymes required for making the sugars.  Several  single  amino  acid  substitutions  generated  through  error  prone  PCR  were  found  to  contribute  to  increased  thermal  resistance.  while  the  N‐ terminal  catalytic  domain  showed  the  greatest  importance  in determining enzyme folding (Hayashi et al. 2000).. 2001).  reesei. Hardiman et al.

 

relevant  enzymes  for  converting  biomass  into  monomeric  sugars.  The  opposite  strategy  of  expressing  endo‐ glucanases and/or cellobiohydrolases in a strain efficient in  beta‐glucosidase production can, of course, also be pursued.   Application  wise,  completing  the  value  chain  of  a  biorefinery concept has been considered in terms of reusing  low  value  stream  as  fungal  growth  medium  for  enzyme  production  and  directly  using  this  product  (enzymes,  fungus, and medium) in hydrolysis of biomass. This on‐site  production  could  apply  to  both  co‐culturing  as  well  as  culturing  an  optimized  production  strain  expressing  all  relevant  enzymes.  We  have  shown,  that  when  cultured  in  the filter cake that is left after hydrolysis and fermentation  in a bioethanol process, both A. niger and A. saccharolyticus  can  produce  sufficient  amounts  of  beta.glucosidase  to  substitute  Novozym  188  in  hydrolysis  of  pretreated  wheat  straw (Research paper I, this thesis).    Consolidated bioprocess  Two  strategies  can  be  sought  for  a  consolidated  process  where  one  organism  is  responsible  for  both  producing  the  enzymes required for saccharification as well as performing  the  fermentation  of  the  saccharified  sugars  into  fuels  or  platform molecules for bioproducts. The first strategy is to  engineer  an  efficient  enzyme  producer,  making  it  able  to  ferment  sugars  into  desired  products.  The  second  strategy  is  to  engineer  an  organism  already  capable  of  fermenting  sugars into desired fermentation products, making it able to  produce  the  array  of  enzymes  needed  for  hydrolysis  of  polysaccharides (Xu et al., 2009).    In  terms  of  bioethanol  production,  most  research  on  consolidated  bioprocessing  has  been  carried  out  using  Saccharomyces  cerevisiae.  S.  cerevisiae  is  the  most  frequently used microorganism for fermenting ethanol from  glucose; it has GRAS status, high glucose fermentation rates,  and  high  ethanol  tolerance  (van  Zyl  et  al.,  2007).  Additionally,  xylose  fermentation  by  yeast  has  been  acquired  to  improve  the  economy  of  industrial  lignocellulosic  biomass  conversion  by  efficiently  directing  both main monomeric sugars to ethanol fermentation (Chu  &  Lee,  2007).  Fungal  beta‐glucosidases  have  successfully  been heterologously expressed in S. cerevisiae enabling the  strain  to  produce  ethanol  from  growth  on  cellobiose  (van  Rooyen  et  al.,  2005).  Further  beta‐glucosidase,  endo‐ glucanase,  and  cellobiohydrolase  of  Aspergillus  aculeatus  have successfully been expressed by S. cerevisiae (Ooi et al.,  1994;  Takada  et  al.,  1998),  setting  the  stage  for  combined  expression  of  all  enzymes,  making  a  strain  with  all  three  important  enzymes.  Fujita  et  al.  (2004)  and  Yanase  et  al.  (2010)  have  reported  such  engineered  S.  cerevisiae  strain  expressing  all  three  enzymes:  T.  reesei  endoglucanase  and  cellobiohydrolase,  and  A.  aculeatus  beta‐glucosidase.  This  stain was able to directly ferment amorphous cellulose into  ethanol.  In  a  consolidated  process,  where  yeast  both  produces  enzymes  for  the  hydrolysis  of  the  lignocellulosic 

polysaccharides  to  sugar  monomers,  and  ferments  the  monomeric  sugars  to  ethanol,  the  issues  of  glucose  accumulation  inhibiting  enzyme  hydrolysis  will  be  diminished.  The  main  drawback  of  a  yeast  consolidated  process  is  that  a  compromise  in  hydrolysis  and  fermentation must be made in terms of process conditions;  especially  the  temperature  must  be  reduced  compared  to  the  temperatures  usually  used  for  hydrolysis,  and  efficient  enzymes with lower temperature optima should, therefore,  be  screened  for  to  optimize  consolidated  bioprocessing  with yeast.   The  use  of  fungi  for  ethanol  production  through  consolidated  bioprocessing  has  recently  been  discussed  by  Xu  et  al.  (2009).  T.  reesei  possess  the  pathways  for  conversion  of  biomass  into  ethanol.  However,  the  yield  of  ethanol,  rate  of  production,  and  ethanol  tolerance  of  the  organism are low. Improvements needed for a successful T.  reesei  consolidated  bioprocess  would,  therefore,  include  identification and modification of genes involved in ethanol  tolerance,  introduction  of  heterologous  genes  to  enhance  the ethanol pathway, and knockout of genes responsible for  interfering  byproducts  (Xu  et  al.,  2009).  With  reference  to  the previous discussion of the insufficiency of T. reesei beta‐ glucosidases  additional  heterologous  expression  of  better  beta‐glucosidases  should  be  part  of  the  improvements.  In  terms  of  producing  platform  molecules  for  bioproducts,  several  fungi  naturally  produce  different  organic  acid,  either  as  natural  products  or  at  least  as  intermediates  in  major  metabolic  pathways;  examples  include  citric  acid,  oxalic acid, and gluconic acid by A. niger, itaconic acid by A.  terreus, fumaric acid and malic acid by Rhizopus oryzae, and  succinic  acid  by  Fusaruim  spp.,  Aspergillus  spp.,  and  Penicillium  simplicissium  (Magnuson  &  Lasure,  2004).  A  consolidated  bioprocess  using  fungi  to  make  platform  molecules  for  bioproducts,  therefore,  seems  appealing.  A.  niger is especially known in regards to its beta‐glucosidase  activity  but  this  fungus  actually  possess  the  full  array  of  hydrolytic  enzymes  for  biomass  degradation  (Pel  et  al.,  2007)  and  could  be  a  valid  candidate  for  further  improvements  towards  a    consolidated  bioprocessing  organism.  The  issue  related  to  compromise  in  process  conditions of hydrolysis and fermentation will further apply  for  the  use  of  fungal  strains  as  was  the  case  for  yeast.  Overcoming  this  could  potentially  be  done  by  looking  into  the use of thermophilic rather than mesophilic fungi as the  consolidated bioprocess organism.    

Conclusions 
Fungal beta‐glucosidases are important enzymes in efficient  hydrolysis  of  cellulosic  biomass,  as  they  relieve  the  inhibition of the cellobiohydrolases and endoglucanases by  reducing cellobiose accumulation. They are key enzymes in  the  final  part  for  creating  the  necessary  sugars  for  production  of  biofuels  and  platform  molecules  that  can 

Review paper  ‐ 13 ‐ 

 

 

serve  as  building  blocks  in  the  synthesis  of  chemicals  and  polymeric  materials.  The  biorefinery  concept  is  a  sustainable solution that could replace today’s oil refineries.   Important  features  for  maintaining  efficient  hydrolysis  of  cellobiose  and  cellodextrins  by  beta‐glucosidases  are  high  glucose  tolerance  as  well  as  high  temperature  stability.  Heterologous  expression  of  efficient  beta‐glucosidases  allows  for  production  of  a  complete  enzyme  cocktail  by  a  suitable host. As of current, in the process of making sugars,  enzymes  are  mainly  added  as  a  fermentation  product  of  a  separate  process.  To  increase  the  value  chain  of  a  biorefinery concept, alternatives should be considered such  as  on‐site  enzyme  production  using  low  value  streams,  or  the  use  of  hosts  expressing  the  enzyme  cocktail  and  producing  the  products  in  a  consolidated  bioprocess,  facilitating combined biomass hydrolysis and fermentation.    

References 
Alvira  P,  Tomas‐Pejo  E,  Ballesteros  M  &  Negro  MJ  (2010)  Pretreatment  technologies  for  an  efficient  bioethanol  production  process  based  on  enzymatic  hydrolysis:  A  review  Bioresour Technol 101: 4851‐4861.   Antikainen  NM  &  Martin  SF  (2005)  Altering  protein  specificity:  techniques and applications Bioorg Med Chem 13: 2701‐2716.   Arrizubieta MJ & Polaina J (2000) Increased thermal resistance and  modification of the catalytic properties of a beta‐glucosidase by  random  mutagenesis  and  in  vitro  recombination  J  Biol  Chem  275: 28843‐28848.   Bairoch A (2000) The ENZYME database in 2000 Nucleic Acids Res  28: 304‐305.   Bairoch  A  (1992)  Prosite  ‐  a  Dictionary  of  Sites  and  Patterns  in  Proteins Nucleic Acids Res 20: 2013‐2018.   Banerjee G, Scott‐Craig JS & Walton JD (2010a) Improving Enzymes  for  Biomass  Conversion:  A  Basic  Research  Perspective  Bioenergy Research 3: 82‐92.   Banerjee  S,  Mudliar  S,  Sen  R,  Giri  B,  Satpute  D,  Chakrabarti  T  &  Pandey RA (2010b) Commercializing lignocellulosic bioethanol:  technology  bottlenecks  and  possible  remedies  Biofuels  Bioproducts & Biorefining‐Biofpr 4: 77‐93.   Barrett T, Suresh CG, Tolley SP, Dodson EJ & Hughes MA (1995) The  Crystal‐Structure of a Cyanogenic Beta‐Glucosidase from White  Clover, a Family‐1 Glycosyl Hydrolase Structure 3: 951‐960.   Beguin  P  &  Aubert  JP  (1994)  The  Biological  Degradation  of  Cellulose FEMS Microbiol Rev 13: 25‐58.   Berg  JM,  Tymoczko  JL  &  Stryer  L  (2002)  Biochemistry.  W.H.  Freeman and Company, New York.   Bergmeyer  HU  &  Bernt  E  (1974)  Determination  with  Glucose  Oxidase  and  Peroxidase.  Methods  of  Enzymic  Analysis  (Bergmeyer HU, ed), pp. 1205‐1212. Academic Press, New York.   Bergquist  PL,  Reeves  RA  &  Gibbs  MD  (2005)  Degenerate  oligonucleotide  gene  shuffling  (DOGS)  and  random  drift  mutagenesis  (RNDM):  Two  complementary  techniques  for  enzyme evolution Biomol Eng 22: 63‐72.   Bhatia Y, Mishra S & Bisaria VS (2002) Microbial beta‐glucosidases:  Cloning,  properties,  and  applications  Crit  Rev  Biotechnol  22:  375‐407.   Bravo  V,  Paez  MP,  Aoulad  M  &  Reyes  A  (2000)  The  influence  of  temperature  upon  the  hydrolysis  of  cellobiose  by  beta‐1,4‐

glucosidases from Aspergillus niger Enzyme Microb Technol 26:  614‐620.   Bravo  V,  Paez  MP,  Aoulad  M,  Reyes  A  &  Garcia  AI  (2001)  The  influence  of  pH  upon  the  kinetic  parameters  of  the  enzymatic  hydrolysis of cellobiose with Novozym 188 Biotechnol Prog 17:  104‐109.   Calsavara  LPV,  De  Moraes  FF  &  Zanin  GM  (2001)  Comparison  of  catalytic properties of free and immobilized cellobiase Novozym  188 Appl Biochem Biotechnol 91‐3: 615‐626.   Cantarel  BL,  Coutinho  PM,  Rancurel  C,  Bernard  T,  Lombard  V  &  Henrissat B (2009) The Carbohydrate‐Active EnZymes database  (CAZy): an expert resource for Glycogenomics Nucleic Acids Res  37: D233‐D238.   Chang  VS  &  Holtzapple  MT  (2000)  Fundamental  factors  affecting  biomass enzymatic reactivity Appl Biochem Biotechnol 84‐6: 5‐ 37.   Chauve  M,  Mathis  H,  Huc  D,  Casanave  D,  Monot  F  &  Ferreira  NL  (2010)  Comparative  kinetic  analysis  of  two  fungal  beta‐ glucosidases 3: 3.   Cheetham  PSJ  (1987)  Screening  for  Novel  Biocatalysts  Enzyme  Microb Technol 9: 194‐213.   Cherry  JR  &  Fidantsef  AL  (2003)  Directed  evolution  of  industrial  enzymes: an update Curr Opin Biotechnol 14: 438‐443.   Cherubini F (2010) The biorefinery concept: Using biomass instead  of  oil  for  producing  energy  and  chemicals  Energy  Conversion  and Management 51: 1412‐1421.   Chirumamilla  RR,  Muralidhar  R,  Marchant  R  &  Nigam  P  (2001)  Improving  the  quality  of  industrially  important  enzymes  by  directed evolution Mol Cell Biochem 224: 159‐168.   Chu  BCH  &  Lee  H  (2007)  Genetic  improvement  of  Saccharomyces  cerevisiae for xylose fermentation Biotechnol Adv 25: 425‐441.   Chuenchor W, Pengthaisong S, Robinson RC et al. (2008) Structural  insights  into  rice  BGlu1  beta‐glucosidase  oligosaccharide  hydrolysis and transglycosylation J Mol Biol 377: 1200‐1215.   Czjzek M, Cicek M, Zamboni V, Burmeister WP, Bevan DR, Henrissat  B & Esen A (2001) Crystal structure of a monocotyledon (maize  ZMGlu1)  beta‐glucosidase  and  a  model  of  its  complex  with  p‐ nitrophenyl beta‐D‐thioglucoside Biochem J 354: 37‐46.   Dale  MP,  Ensley  HE,  Kern  K,  Sastry  KAR  &  Byers  LD  (1985)  Reversible  Inhibitors  of  Beta‐Glucosidase  Biochemistry  (N  Y  )  24: 3530‐3539.   Dan  S,  Marton  I,  Dekel  M,  Bravdo  BA,  He  SM,  Withers  SG  &  Shoseyov  O  (2000)  Cloning,  expression,  characterization,  and  nucleophile  identification  of  family  3,  Aspergillus  niger  beta‐ glucosidase J Biol Chem 275: 4973‐4980.   Danisco US Inc (2009) AccelleraseBG ‐ Accessory  beta‐glucosidase  for biomass hydrolysis.   Daroit  DJ,  Simonetti  A,  Hertz  PF  &  Brandelli  A  (2008)  Purification  and  characterization  of  an  extracellular  beta‐glucosidase  from  Monascus purpureus Journal of Microbiology and Biotechnology  18: 933‐941.   Davies  G  &  Henrissat  B  (1995)  Structures  and  Mechanisms  of  Glycosyl Hydrolases Structure 3: 853‐859.   Davies GJ, Wilson KS & Henrissat B (1997) Nomenclature for sugar‐ binding subsites in glycosyl hydrolases Biochem J 321: 557‐559.   de Palma‐Fernandez ER, Gomes E & da Silva R (2002) Purification  and  characterization  of  two  beta‐glucosidases  from  the  thermophilic  fungus  Thermoascus  aurantiacus  Folia  Microbiol  (Praha) 47: 685‐690.   de Vries RP, Frisvad JC, van de Vondervoort PJI, Burgers K, Kuijpers  AFA,  Samson  RA  &  Visser  J  (2005)  Aspergillus  vadensis,  a  new  species  of  the  group  of  black  Aspergilli  Antonie  Van 

Review paper  ‐ 14 ‐ 

 

 

Leeuwenhoek  International  Journal  of  General  and  Molecular  Microbiology 87: 195‐203.   DeAngelis  KM,  Gladden  JM,  Allgaier  M  et  al.  (2010)  Strategies  for  Enhancing  the  Effectiveness  of  Metagenomic‐based  Enzyme  Discovery in Lignocellulolytic Microbial Communities Bioenergy  Research 3: 146‐158.   Decker  CH,  Visser  J  &  Schreier  P  (2001)  Beta‐Glucosidase  multiplicity  from  Aspergillus  tubingensis  CBS  643.92:  purification  and  characterization  of  four  beta‐glucosidases  and  their  differentiation  with  respect  to  substrate  specificity,  glucose inhibition and acid tolerance Appl Microbiol Biotechnol  55: 157‐163.   Decker CH, Visser J & Schreier P (2000) Beta‐glucosidases from five  black  Aspergillus  species:  Study  of  their  physico‐chemical  and  biocatalytic properties J Agric Food Chem 48: 4929‐4936.   Dekker RFH (1986) Kinetic, Inhibition, and Stability Properties of a  Commercial  Beta‐D‐Glucosidase  (Cellobiase)  Preparation  from  Aspergillus  niger  and  its  Suitability  in  the  Hydrolysis  of  Lignocellulose Biotechnol Bioeng 28: 1438‐1442.   Duff  SJB,  Cooper  DG  &  Fuller  OM  (1985)  Cellulase  and  Beta‐ Glucosidase Production by Mixed Culture of Trichoderma reesei  Rut C30 and Aspergillus phoenicis Biotechnol Lett 7: 185‐190.   Eyzaguirre J, Hidalgo M & Leschot A (2005) Beta‐glucosidases from  Filamentous  Fungi:  Properties,  Structure,  and  Applications.  Handbook  of  Carbohydrate  EngineeringAnonymous  ,  pp.  645‐ 685. Taylor and Francis Group, LLC.   Fernando  S,  Adhikari  S,  Chandrapal  C  &  Murali  N  (2006)  Biorefineries:  Current  status,  challenges,  and  future  direction  Energy Fuels 20: 1727‐1737.   Fujita  Y,  Ito  J,  Ueda  M,  Fukuda  H  &  Kondo  A  (2004)  Synergistic  saccharification,  and  direct  fermentation  to  ethanol,  of  amorphous  cellulose  by  use  of  an  engineered  yeast  strain  codisplaying  three  types  of  cellulolytic  enzyme  Appl  Environ  Microbiol 70: 1207‐1212.   Gonzalez‐Blasco  G,  Sanz‐Aparicio  J,  Gonzalez  B,  Hermoso  JA  &  Polaina  J  (2000)  Directed  evolution  of  beta‐glucosidase  A  from  Paenibacillus  polymyxa  to  thermal  resistance  J  Biol  Chem  275:  13708‐13712.   Gunata  Z  &  Vallier  MJ  (1999)  Production  of  a  highly  glucose‐ tolerant  extracellular  beta‐glucosidase  by  three  Aspergillus  strains Biotechnol Lett 21: 219‐223.   Hakulinen  N,  Paavilainen  S,  Korpela  T  &  Rouvinen  J  (2000)  The  crystal  structure  of  beta‐glucosidase  from  Bacillus  circulans  sp  alkalophilus: Ability to form long polymeric assemblies J Struct  Biol 129: 69‐79.   Hardiman  E,  Gibbs  M,  Reeves  R  &  Bergquist  P  (2010)  Directed  Evolution  of  a  Thermophilic  beta‐glucosidase  for  Cellulosic  Bioethanol Production Appl Biochem Biotechnol 161: 301‐312.   Harris  PV,  Welner  D,  McFarland  KC  et  al.  (2010)  Stimulation  of  Lignocellulosic  Biomass  Hydrolysis  by  Proteins  of  Glycoside  Hydrolase  Family  61:  Structure  and  Function  of  a  Large,  Enigmatic Family Biochemistry (N Y ) 49: 3305‐3316.   Harvey AJ, Hrmova M, De Gori R, Varghese JN & Fincher GB (2000)  Comparative  modeling  of  the  three‐dimensional  structures  of  family  3  glycoside  hydrolases  Proteins‐Structure  Function  and  Genetics 41: 257‐269.   Hawksworth DL (2001) The magnitude of fungal diversity: the 1.5  million species estimate revisited Mycol Res 105: 1422‐1432.   Hawksworth  DL  (1991)  The  Fungal  Dimension  of  Biodiversity  ‐  Magnitude,  Significance,  and  Conservation  Mycol  Res  95:  641‐ 655.  

Hawksworth  DL  &  Rossman  AY  (1997)  Where  are  all  the  undescribed fungi? Phytopathology 87: 888‐891.   Hayashi  K,  Ying  L,  Singh  S,  Kaneko  S,  Nirasawa  S,  Shimonishi  T,  Kawata  Y,  Imoto  T  &  Kitaoka  M  (2001)  Improving  enzyme  characteristics  by  gene  shuffling;  application  to  beta‐ glucosidase Journal of Molecular Catalysis B‐Enzymatic 11: 811‐ 816.   Henrissat B (1991) A Classification of Glycosyl Hydrolases Based on  Amino‐Acid‐Sequence Similarities Biochem J 280: 309‐316.   Henrissat  B  &  Davies  G  (1997)  Structural  and  sequence‐based  classification  of  glycoside  hydrolases  Curr  Opin  Struct  Biol  7:  637‐644.   Henrissat  B  &  Bairoch  A  (1996)  Updating  the  sequence‐based  classification of glycosyl hydrolases Biochem J 316: 695‐696.   Henrissat B & Bairoch A (1993) New Families in the Classification  of  Glycosyl  Hydrolases  Based  on  Amino‐Acid‐Sequence  Similarities Biochem J 293: 781‐788.   Henrissat  B,  Driguez  H,  Viet  C  &  Schulein  M  (1985)  Synergism  of  Cellulases  from  Trichoderma  reesei  in  the  Degradation  of  Cellulose Bio‐Technology 3: 722‐726.   Jeya  M,  Joo  A,  Lee  K,  Tiwari  MK,  Lee  K,  Kim  S  &  Lee  J  (2010)  Characterization of beta‐glucosidase from a strain of Penicillium  purpurogenum  KJS506  Appl  Microbiol  Biotechnol  86:  1473‐ 1484.   Jiang C, Hao Z, Jin K, Li S, Che Z, Ma G & Wu B (2010) Identification  of  a  metagenome‐derived  beta‐glucosidase  from  bioreactor  contents Journal of Molecular Catalysis B‐Enzymatic 63: 11‐16.   Jiang  C,  Ma  G,  Li  S,  Hu  T,  Che  Z,  Shen  P,  Yan  B  &  Wu  B  (2009)  Characterization of a novel beta‐glucosidase‐like activity from a  soil metagenome Journal of Microbiology 47: 542‐548.   Kabel  MA,  Bos  G,  Zeevalking  J,  Voragen  AGJ  &  Schols  HA  (2007)  Effect  of  pretreatment  severity  on  xylan  solubility  and  enzymatic  breakdown  of  the  remaining  cellulose  from  wheat  straw Bioresour Technol 98: 2034‐2042.   Kaur  J  &  Sharma  R  (2006)  Directed  evolution:  An  approach  to  engineer enzymes Crit Rev Biotechnol 26: 165‐199.   Kim  K,  Brown  KM,  Harris  PV,  Langston  JA  &  Cherry  JR  (2007a)  A  proteomics  strategy  to  discover  beta‐glucosidases  from  Aspergillus fumigatus with two‐dimensional page in‐gel activity  assay  and  tandem  mass  spectrometry  Journal  of  Proteome  Research 6: 4749‐4757.   Kim  S,  Lee  C,  Kim  M,  Yeo  Y,  Yoon  S,  Kang  H  &  Koo  B  (2007b)  Screening  and  characterization  of  an  enzyme  with  beta‐ glucosidase  activity  from  environmental  DNA  Journal  of  Microbiology and Biotechnology 17: 905‐912.   Kirk TK & Farrell RL (1987) Enzymatic Combustion ‐ the Microbial‐ Degradation of Lignin Annu Rev Microbiol 41: 465‐505.   Knauf  M  &  Moniruzzaman  M  (2004)  Lignocellulosic  biomass  processing: A perspective Int Sugar J 106: 147‐150.   Korotkova OG, Semenova MV, Morozova VV, Zorov IN, Sokolova LM,  Bubnova  TM,  Okunev  ON  &  Sinitsyn  AP  (2009)  Isolation  and  properties  of  fungal  beta‐glucosidases  Biochemistry‐Moscow  74: 569‐577.   Koshland  DE  (1953)  Stereochemistry  and  the  Mechanism  of  Enzymatic Reactions Biol Rev Camb Philos Soc 28: 416‐436.   Krogh  KBRM,  Harris  PV,  Olsen  CL,  Johansen  KS,  Hojer‐Pedersen  J,  Borjesson  J  &  Olsson  L  (2010)  Characterization  and  kinetic  analysis  of  a  thermostable  GH3  β‐glucosidase  from  Penicillium  brasilianum  Applied  Microbiology  &  Biotechnology  86:  143‐ 154.   Kubicek  CP  (1992)  The  cellulase  proteins  of  Trichoderma  reesei:  Structure,  multiplicity,  mode  of  action  and  regulation  of 

Review paper  ‐ 15 ‐ 

 

   LopezCamacho  C  &  Polaina  J  (1993)  Random  Mutagenesis  of  a  Plasmid‐Borne  Glycosidase  Gene  and  Phenotypic  Selection  of  Mutants in Escherichia coli Mutat Res 301: 73‐77.  Gutierrez  A  &  del  Rio  JC  (2005)  Biodegradation  of  lignocellulosics:  microbial  chemical.  Colalongo  C  &  Romagnoli  C  (2008)  Three  new  species  of  Aspergillus  from  Amazonian forest soil (Ecuador) Curr Microbiol 57: 222‐229.  Kim  S. New York. Hand G.  Vol. Wakagi T.  Pedrini  P.   Meyer AS.   Merino  ST  &  Cherry  J  (2007)  Progress  and  challenges  in  enzyme  development for Biomass utilization Biofuels 108: 95‐120. pp. Varga J.  Lee  C.  Hydrolysis  of  Cellulose:  Mechanisms  of  Enzymic  and  Acid  Catalysis. Fohlerova R. Academic  Press.   Murray  P.  sensitive  method  for  enzyme  kinetic  studies  of  scarce  glucosides J Biochem Biophys Methods 68: 55‐63.  and  Plant  Cells.  Martinez  MJ.  Ziser  L.  pp. Frisvad JC & Samson RA  (2008b)  Two  novel  species  of  Aspergillus  section  Nigri  from  Thai coffee beans Int J Syst Evol Microbiol 58: 1727‐1734.  Kim  JH.  Draeger  B  &  Zeigenhorn  J  (1984)  UV‐Methods  with  Hexokinase  and  Glucose‐6‐Phosphate  Dehydrogenase.  Chir  J  &  Chen  FY  (2001)  Catalytic  mechanism  of  a  family  3  beta‐glucosidase  and  mutagenesis  study  on  residue  Asp‐247  Biochem J 355: 835‐840.  Kocsube  S.   Lebbink JHG.  Vol.   Ooi  T. Mahakarnchanakul W. and Medicine (Lange J & Lange L.  formation.   Ng  I.  Cabral  H.  eds). pp. Kiran NS & Janda L (2006) A  new. van der Oost J & de Vos WM (2000)  Improving low‐temperature catalysis in the hyperthermostable  Pyrococcus furiosus beta‐glucosidase CelB by directed evolution  Biochemistry (N Y ) 39: 3656‐3665.   Langston  J.   Perez  J.   Mosier  N.  Ruiz‐Duenas  FJ.   Perry  JD.  Holtzapple  M  &  Ladisch  M  (2005)  Features  of  promising  technologies  for  pretreatment  of  lignocellulosic  biomass  Bioresour  Technol  96:  673‐686.  Andreotti  E.  Fungi.  181  (Brown  RD  &  Jurasek  L.  Penttila  M.  de  la  Rubia  T  &  Martinez  J  (2002)  Biodegradation  and  biological  treatments  of  cellulose.  Grassick  A.  Yu  S  &  Ho  TD  (2010)  High‐level  production  of  a  thermoacidophilic  beta‐glucosidase  from  Penicillium  citrinum  YS40‐5  by  solid‐state  fermentation  with rice bran Bioresour Technol 101: 1310‐1317.  Wakarchuk  WW  &  Withers  SG  (1996)  The  pKa  of  the  general acid/base carboxyl group of a glycosidase cycles during  catalysis:  A  C‐13‐NMR  study  of  Bacillus  circuluns  xylanase  Biochemistry (N Y ) 35: 9958‐9966.  an  uniseriate  black  Aspergillus  species  isolated  from  grapes  in  Europe Int J Syst Evol Microbiol 58: 1032‐1039.  James  AL.  45Anonymous  .  Gomes  E  &  Da‐ Silva  R  (2008)  Production  and  characteristics  comparison  of  crude  beta‐glucosidases  produced  by  microorganisms  Thermoascus  aurantiacus  e  Aureobasidium  pullulans  in  agricultural wastes Enzyme Microb Technol 43: 391‐395.  Elander  R. Joshi MD.  Ferreira  P.   Leite  RSR.   Lorenz P & Schleper C (2002) Metagenome ‐ a challenging source of  enzyme  discovery  Journal  of  Molecular  Catalysis  B‐Enzymatic  19: 13‐19.  Saloheimo  M  &  Tuohy  M  (2004)  Expression  in  Trichoderma  reesei  and  characterisation  of  a  thermostable  family  3  beta‐glucosidase  from  the  moderately  thermophilic  fungus  Talaromyces  emersonii Protein Expr Purif 38: 248‐257.  Alves‐Prado  HF.  Varga  J.  1‐27.  and  enzymatic  aspects  of  the  fungal  attack  of  lignin  International  Microbiology 8: 195‐204. Rosgaard L & Sorensen HR (2009) The minimal enzyme  cocktail  concept  for  biomass  processing  J  Cereal  Sci  50:  337‐ 344. Kluwer Academic/Plenum Publishers.  Ballestar  E. Johnson PE. 289‐301.  Kozakiewicz Z & Samson RA (2008) Aspergillus uvarum sp nov. Kaper T. Samejima M. 163‐172.   Nijikken Y.  identification  and  toxigenic  potential  of  ochratoxin  A‐producing  Aspergillus  species  from  coffee  beans  grown in two regions of Thailand Int J Food Microbiol 128: 197‐ 202.  Yeo  Y.  Pagnocca  FC.  Springer  Berlin  /  Heidelberg.  Lee  YY.   Li  YK..  Sheehy  N  &  Xu  F  (2006)  Substrate  specificity  of  Aspergillus  oryzae  family  3  beta‐glucosidase  Biochimica  Et  Biophysica Acta‐Proteins and Proteomics 1764: 972‐978.  Advances  in  Fungal  Biotechnology  for  Industry.  Frisvad  JC. Mahakarnchanakul W.  Archer  DB  et  al.  Maldonado  ME.  Murao  S  &  Arai  M  (1994)  Expression  of  the  Cellulase  (FI‐CMCase)  Gene  of  Aspergillus  aculeatus  in  Saccharomyces  cerevisiae  Bioscience  Biotechnology and Biochemistry 58: 954‐956.   McIntosh LP. Shoun H  & Fushinobu S (2007) Crystal structure of intracellular family 1  beta‐glucosidase BGL1A from the basidiomycete Phanerochaete  chrysosporium FEBS Lett 581: 1514‐1520.  Camarero  S.  Lequerica  JL.  Aro  N.  Methods  of Enzymic Analysis (Bergmeyer HU.  Li  C. Tsukada T.  Wyman  C.   Perrone  G.  Collins  C.  Speranza  M.   Lynd  LR.   NREL  National  Renewable  Energy  Laboratory  (2000)  Determining  the  cost  of  producing  ethanol  from  corn  starch  and  lignocellulosic feedstocks NREL/TP‐580‐28893:.   Mares  D.  Tong  C.   Review paper  ‐ 16 ‐    .   Noonim P. Igarashi K.  hemicellulose and lignin: an overview Int Microbiol 5: 53‐56.  Chan  S. Agriculture. ed).  Weimer  PJ.  Jun  H  &  Hwang  KY  (2008) Crystal structure of engineered beta‐glucosidase from a  soil  metagenome  Proteins‐Structure  Function  and  Bioinformatics 73: 788‐793.  Minamiguchi  K.  Oliver  M  &  Gould  FK  (2007)  Evaluation of novel chromogenic substrates for the detection of  bacterial beta‐glucosidase J Appl Microbiol 102: 410‐415.  307‐340.  Franco L & Polaina J (1996) Amino acid substitutions enhancing  thermostability  of  Bacillus  polymyxa  beta‐glucosidase  A  Biochem J 314: 833‐838.  Stea  G.  Dale  B.  Kawaguchi  T. Frisvad JC & Samson  RA  (2008a)  Isolation.  Susca  A.  Munoz‐Dorado  J.   Montenecourt  BS  &  Eveleigh  DE  (1979)  Selective  Screening  Methods for  the Isolation of High  Yielding Cellulase Mutants of  Trichoderma  reesei.88 Nat Biotechnol 25: 221‐231.  Chen  PT.   Mccarter  JD  &  Withers  SG  (1994)  Mechanisms  of  Enzymatic  Glycoside Hydrolysis Curr Opin Struct Biol 4: 885‐892.   Magnuson  JK  &  Lasure  LL  (2004)  Organic  Acid  Production  by  Filamentous  Fungi.  Morris  KA.  de  Winde  JH. Korner M. American Chemical Society.   Mazura P.  Enzymes  and  Products  from  Bacteria.   Nam  KH.  Guillen  F.  Ki  MO. Bron P.   Kunst  A.   LopezCamacho  C.  Toth  B. pp.   Noonim P.  Chir  J. Plesniak LA.   Pel  HJ. Nielsen KF.  van  Zyl  WH  &  Pretorius  IS  (2002)  Microbial  cellulose  utilization:  Fundamentals  and  biotechnology  Microbiology and Molecular Biology Reviews 66: 506‐+.  Madarro  A.   Novozymes  A/S  (2010)  Cellic  CTec2  and  HTec2  ‐  Enzymes  for  hydrolysis of lignocellulosic materials.   Nosoh  Y  &  Sekiguchi  T  (1990)  Protein  Engineering  for  Thermostability Trends Biotechnol 8: 16‐20. eds).  (2007)  Genome  sequencing  and  analysis  of  the  versatile  cell  factory  Aspergillus  niger  CBS  513.  Salgado  J.   Martinez  AT. Brzobohaty B.   Madamwar  D  &  Patel  S  (1992)  Formation  of  Cellulases  by  Co‐ culturing  of  Trichoderma  reesei  and  Aspergillus  niger  on  Cellulosic Waste World J Microbiol Biotechnol 8: 183‐186.  Okada  H.

   Sternberg D. vol 1.energy.  Liao  W  &  Chen  SL  (2005)  Production  of  cellulase/beta‐ glucosidase  by  the  mixed  fungi  culture  Trichoderma  reesei  and  Aspergillus phoenicis on dairy manure Process Biochemistry 40:  3087‐3094.   Rajoka MI.  Lynd  LR.  George  E  &  Huber  RE  (2006)  Trp‐49  of  the  family 3 beta‐glucosidase from Aspergillus niger is important for  its  transglucosidic  activity:  Creation  of  novel  beta‐glucosidases  with  low  transglucosidic  efficiencies  Arch  Biochem  Biophys  455: 110‐118. Okada H.   van  Zyl  WH.   Sue M. Iwamura H  & Miyamoto T (2006) Molecular and structural characterization  of  hexameric  beta‐D‐glucosidases  in  wheat  and  rye  Plant  Physiol 141: 1237‐1247.  Cabanes  FJ.   Saha  BC  (2003)  Hemicellulose  bioconversion  J  Ind  Microbiol  Biotechnol 30: 279‐291. Kocsube S.  Hahn‐Hagerdal  B.  Salmon  JM.   Shewale JG (1982) Beta‐Glucosidase ‐ its Role in Cellulase Synthesis  and Hydrolysis of Cellulose Int J Biochem 14: 435‐443.   Svensson B & Sogaard M (1993) Mutational Analysis of Glycosylase  Function J Biotechnol 29: 1‐37. Nomura T. a biseriate  black Aspergillus species with world‐wide distribution Int J Syst  Evol Microbiol 57: 1925‐1932.   Review paper  ‐ 17 ‐    .  Department  of  Energy  (2004a)  Top  value  added  Chemicals  from Biomass..  Hermoso  JA.   Takada G. Frisvad JC.  Dasu  VV  &  Mandal  B  (2007)  Developments  in  directed  evolution  for  improving  enzyme  functions  Appl  Biochem  Biotechnol 143: 212‐223.   Reikofski  J  &  Tao  BY  (1992)  Polymerase  Chain‐Reaction  (PCR)  Techniques  for  Site‐Directed  Mutagenesis  Biotechnol  Adv  10:  535‐547. Sumitani  J & Arai M (1998) Expression of  Aspergillus  aculeatus  no. Yajima S.   Saha  BC  &  Bothast  RJ  (1997)  Enzymes  in  lignocellulosic  biomass  conversion Fuels and Chemicals from Biomass 666: 46‐56.   Tako  M. Karlsson EN & Logan DT (2010) Structural and  Functional  Analyses  of  beta‐Glucosidase  3B  from  Thermotoga  neapolitana:  A  Thermostable  Three‐Domain  Representative  of  Glycoside Hydrolase 3 J Mol Biol 397: 724‐739. Pasten JL.  Chadha  BS.   Sun Y & Cheng JY (2002) Hydrolysis of lignocellulosic materials for  ethanol production: a review Bioresour Technol 83: 1‐11.  and  substrate  specificity  of  a  novel  highly  glucose‐tolerant  beta‐glucosidase  from  Aspergillus  oryzae Appl Environ Microbiol 64: 3607‐3614.  An  XM. Meijer M  & Samson RA (2007) Aspergillus brasiliensis sp nov.   Serra  R. Mattanovich D & Branduardi P (2008) Microbial  production  of  organic  acids:  expanding  the  markets  Trends  Biotechnol 26: 100‐108.  Castella  G.   Tao  HY  &  Cornish  VW  (2002)  Milestones  in  directed  enzyme  evolution Curr Opin Chem Biol 6: 858‐864.gov/biomass/progs/search1. Susca A.  Durrani  IS  &  Khalid  AM  (2005)  Kinetic  studies  of  the  native  and  mutated  intracellular  beta‐glucosidases  from  Cellulomonas biazotea Protein Peptide Lett 12: 283‐288.   Samson RA.   Riou  C.  Hussain  SRS  &  Malik  KA  (1998)  Gamma‐ray  induced  mutagenesis  of  Cellulomonas  biazotea  for  improved  production of cellulases Folia Microbiol (Praha) 43: 15‐22.   Rajoka  MI.  Warren  RAJ  &  Withers  SG  (1992)  Region‐Directed  Mutagenesis  of  Residues  Surrounding  the  Active‐Site  Nucleophile  in  Beta‐Glucosidase  from  Agrobacterium  faecalis  J  Biol Chem 267: 10248‐10251.  Farkas  E. Perrone G.   Trimbur  DE.  den  Haan  R  &  McBride  JE  (2007)  Consolidated  bioprocessing  for  bioethanol  production  using  Saccharomyces cerevisiae Biofuels 108: 205‐235. Suzuki Y.afdc.cgi   van  Rooyen  R.  Perrone  G. Matsukawa T.   Varghese  JN.   Wang  XQ. Vijayakumar P & Reese ET (1977) Beta‐Glucosidase ‐  Microbial‐Production  and  Effect  on  Enzymatic‐Hydrolysis  of  Cellulose Can J Microbiol 23: 139‐147. Frank JM & Frisvad JC  (2004)  New  ochratoxin  A  or  sclerotium  producing  species  in  Aspergillus section Nigri Stud Mycol 50: 45‐61.  Saini  HS  &  Bhat  MK  (2008)  Identification  of  glucose  tolerant  acid  active  beta‐glucosidases  from  thermophilic  and  thermotolerant  fungi  World  J  Microbiol  Biotechnol 24: 599‐604.  Chang  WR  &  Liang  DC  (2003)  Structural basis for thermostability of beta‐glycosidase from the  thermophilic  eubacterium  Thermus  nonproteolyticus  HG102  J  Bacteriol 185: 4248‐4255. Kuijpers AFA.S.S.  Department  of  Energy  (2004b)  Biomass  Feedstock  Composition and Property Database :   http://www.  Pozzo T.   Sonia  KG.  Yang  SJ. Toth B.   Wen  ZY.   Seidle  HF.   Rahman Z.  Venancio  A.  Mule  G  &  Kozakiewicz  Z  (2006)  Aspergillus  ibericus:  a  new  species  of  section Nigri isolated from grapes Mycologia 98: 295‐306.   Seidle  HF  &  Huber  RE  (2005)  Transglucosidic  reactions  of  the  Aspergillus  niger  Family  3  beta‐glucosidase:  Qualitative  and  quantitative analyses and evidence that the transglucosidic rate  is independent of pH Arch Biochem Biophys 436: 254‐264.  Vallier  MJ.  He  XY.   Stemmer WPC (1994) Dna Shuffling by Random Fragmentation and  Reassembly  ‐  In‐Vitro  Recombination  for  Molecular  Evolution  Proc Natl Acad Sci U S A 91: 10747‐10751.  La  Grange  DC  &  van  Zyl  WH  (2005)  Construction  of  cellobiose‐growing  and  fermenting  Saccharomyces cerevisiae strains J Biotechnol 120: 284‐295.   Varga J. Hanif A & Khalid AM (2006) Production and  characterization  of  a  highly  active  cellobiase  from  Aspergillus  niger  grown  in  solid  state  fermentation  World  J  Microbiol  Biotechnol 22: 991‐998.  Badhan  AK.   Tobin MB.  a  family  3  glycosyl hydrolase Structure 7: 179‐190.   Sanz‐Aparicio  J.  Bashir  A.  Lequerica  JL  &  Polaina  J  (1998)  Crystal  structure  of  beta‐glucosidase  A  from  Bacillus polymyxa: Insights into the catalytic activity in family 1  glycosyl hydrolases J Mol Biol 275: 491‐502. Ogasawara W &  Morikawa Y (2009) Application of Trichoderma reesei Cellulase  and  Xylanase  Promoters  through  Homologous  Recombination  for  Enhanced  Production  of  Extracellular  beta‐Glucosidase  I  Bioscience Biotechnology and Biochemistry 73: 1083‐1089.   Sen  S. Shida Y.   Rajoka  MI. Akhtar MW.   U. Furukawa T.  Gunata  Z  &  Barre  P  (1998)  Purification. Gustafsson C & Huisman GW (2000) Directed evolution:  the  'rational'  basis  for  'irrational'  design  Curr  Opin  Struct  Biol  10: 421‐427.  Lung  S. Houbraken JAMP.   Sinnott  ML  (1990)  Catalytic  Mechanisms  of  Enzymatic  Glycosyl  Transfer Chem Rev 90: 1171‐1202.   Sauer M.  Vagvoelgyi  C  &  Papp  T  (2010)  Identification  of  Acid‐  and  Thermotolerant  Extracellular  Beta‐ Glucosidase Activities in Zygomycetes Fungi Acta Biol Hung 61:  101‐110. Porro D.   U.  F‐50  cellobiohydrolase  I  (cbhI)  and  beta‐glucosidase  1  (bgl1)  genes  by  Saccharomyces  cerevisiae  Bioscience Biotechnology and Biochemistry 62: 1615‐1618.  Allison  SJ. Yamazaki K.  Hrmova  M  &  Fincher  GB  (1999)  Three‐dimensional  structure  of  a  barley  beta‐D‐glucan  exohydrolase. Kawaguchi T.  characterization.  Krisch  J.   Singh  A  &  Hayashi  K  (1995)  Construction  of  Chimeric  Beta‐ Glucosidases  with  Improved  Enzymatic‐Properties  J  Biol  Chem  270: 21928‐21933.  Martinez‐Ripoll  M.

  Street  IP.  Gregg  DJ  &  Saddler  JN  (2004)  Effects  of  sugar  inhibition  on  cellulases  and  beta‐glucosidase  during  enzymatic  hydrolysis  of  softwood  substrates  Appl  Biochem  Biotechnol  113: 1115‐1126.   Xiao  ZZ.   Yanase  S.   Withers  SG  (1999)  1998  Hoffmann  la  Roche  Award  Lecture  ‐  Understanding  and  exploiting  glycosidases  Canadian  Journal  of  Chemistry‐Revue Canadienne De Chimie 77: 1‐11.   Yan TR.  Kaneko  S.   Withers  SG. Fukuda H & Kondo A (2010) Ethanol production from  cellulosic  materials  using  cellulase‐expressing  yeast  Biotechnology Journal 5: 449‐455.   Withers  SG.  Rupitz  K  &  Street  IP  (1988)  2‐Deoxy‐2‐Fluoro‐D‐ Glycosyl  Fluorides  ‐  a  New  Class  of  Specific  Mechanism‐Based  Glycosidase Inhibitors J Biol Chem 263: 7929‐7932.  Zhang  X. Lin YH & Lin CL (1998) Purification and characterization of  an  extracellular  beta‐glucosidase  II  with  high  hydrolysis  and  transglucosylation activities from Aspergillus niger J Agric Food  Chem 46: 431‐437.  Yamada  R.  Himmel  ME  &  Mielenz  JR  (2006)  Outlook  for  cellulase  improvement:  Screening  and  selection  strategies  Biotechnol  Adv 24: 452‐481.     Review paper  ‐ 18 ‐    .  Ogino C.  White  A  &  Rose  DR  (1997)  Mechanism  of  catalysis  by  retaining  beta‐glycosyl hydrolases Curr Opin Struct Biol 7: 645‐651.  Hasunuma  T.   Withers  SG  &  Aebersold  R  (1995)  Approaches  to  Labeling  and  Identification  of  Active‐Site  Residues  in  Glycosidases  Protein  Science 4: 361‐372.  Singh  A  &  Himmel  ME  (2009)  Perspectives  and  new  directions  for  the  production  of  bioethanol  using  consolidated  bioprocessing  of  lignocellulose  Curr  Opin  Biotechnol  20:  364‐ 371.   Zhang  Y‐P.  Tanaka  T.  Bird  P  &  Dolphin  DH  (1987)  2‐Deoxy‐2‐ Fluoroglucosides  ‐  a  Novel  Class  of  Mechanism‐Based  Glucosidase Inhibitors J Am Chem Soc 109: 7530‐7531.   Zhang Y‐P & Lynd LR (2004) Toward an aggregated understanding  of  enzymatic  hydrolysis  of  cellulose:  Noncomplexed  cellulase  systems Biotechnol Bioeng 88: 797‐824.   Xu  Q.  Noda  H.

 Ahring    Intended for submission to Bioresource Technology  . Philip J.Research paper I        On‐site enzyme production during bioethanol production from  biomass: screening for suitable fungal strains      Annette Sørensen. Lübeck. Teller. Peter S. and Birgitte K.

    .

 The separation step between C6‐ and C5‐ sugar  fermentation  results  in  a  “filter  cake”  that  represents  a  waste  stream  that  could  be  used  as  substrate  for  enzyme  production  by  solid  state  fermentation.  These  strains  were  examined  in  a  plate  assay  for  lignocellulolytic  activities. less cell mass  generation.  the  production  of  enzymes  on‐ site  using  low  cost  substrates  or  even  process  waste  streams  as a production substrate should be considered. Peter S.  and  distillation.  as  well  as  lower  energy  consumption  (Pandey  et  al. Ahring)  consumer (Knauf and Moniruzzaman.  C5‐sugar  fermentation.5L used for hydrolysis  of pretreated biomass.K.*  1  2 3 Section for Sustainable Biotechnology.  Other  costs  related  to  second  generation  ethanol  production  involve biomass raw material costs as well as transport of the  biomass  to  the  ethanol  production  facility. Lautrupvang 15. 1999).  Finally. Five of the 25 isolates were further selected for synergy studies with commercial  enzymes. 2007). 2003).  enzymes.   Beta‐glucosidase   Cellulase   Bioethanol  A B S T R A C T Several process steps are used for production of cellulosic ethanol from biomass raw materials such as  pre‐treatment..  Operational  costs  are  mainly  linked  to  pre‐treatment  strategies  of  the  material.  and  distribution  of  the  product  to  the  * Corresponding author: telephone +45 99402591  E‐mail address: bka@bio.  Of  the  64  isolates. DK‐2750 Ballerup.5L  and  Novozym  188.3. USA      A R T I C L E   I N F O  Keywords:  Onsite enzyme production  Fungal screening.5L  and  Novozym  188  represent  two  commercial  enzyme  preparations from Novozymes A/S often used in combination  for hydrolysis of lignocellulosic biomasses. DK‐2750 Ballerup.  other  process  options  such  as  discharge  or  reuse  of  waste  streams.  Use  of  streams  within  cellulosic  ethanol  production  was  explored  for  on‐site  enzyme  production  as  part  of  a  biorefinery  concept. In order to reduce  the  cost  of  commercial  enzymes  for  the  hydrolysis  of  pre‐ treated  lignocellulosic  biomasses  introduction  of  enzymes  produced  on‐site  using  a  slip  stream  from  the  bioethanol  Research paper I   ‐ I. Washington State University.1 ‐    .  fermentation. Lautrupvang 2A..  hydrolysis. WA 99352. and Birgitte K.aau. Pandey. Lübeck1.  IBT25747  (Aspergillus  niger)  and  AP  (unidentified). Denmark   Present address: BioGasol ApS.  a  screening  of  64  fungal  isolates  from  environmental  samples  was  carried  out.  Evaluating on the overall production cost of bioethanol the  price  of  commercial  enzymes  is  of  outmost  importance  as  it  typically contributes to a large part of the final bioethanol cost. Teller2. Denmark   Center for Bioenergy and Bioproducts. Aalborg University.  Celluclast  1. Copenhagen Institute of Technology.  microorganisms  for  the  fermentation. 2004)  The  bioethanol  process  in  focus  is  based  on  the  Maxifuel  concept. Introduction  The  need  for  purchasing  commercial  enzymes  is  an  economical  boundary  for  feasible  second  generation  bioethanol  production  (NREL  National  Renewable  Energy  Laboratory.  two  strains. were found as promising candidates for on‐site enzyme production where the filter cake  was inoculated with the respective fungus and in combination with Celluclast 1.   For  efficient  hydrolysis  of  cellulose.  The  advantages  of  solid state fermentation include high volumetric productivity.  C6‐sugar  fermentation.  25  were  selected  for  further  enzyme  activity  studies  using  a  stream  derived  from  the  bioethanol  process. Richland.  a  complete  set  of  cellulase enzymes is needed (Mansfield et al.  enzymatic  hydrolysis.  relatively higher concentration of the products.  Therefore.  On‐site enzyme production during bioethanol production from  biomass: screening for suitable fungal strains  Annette Sørensen1. 1999.  In  order  to  discover  the  most  suitable  fungal  strain  with  efficient  hydrolytic  enzymes  for  lignocellulose  conversion.  and  anaerobic  digestion  (Ahring  and  Westermann. Philip J. Celluclast  1.  where  the  main  process  steps  are  pretreatment.               1.  2009). Ahring1.  separation.dk (B.  The  filter  cake  that  is  left  after  hydrolysis  and  fermentation  was  the  substrate  chosen  as  the  medium  for  enzyme production.  distillation  method.

  wood  was  placed  on  PDA  plates  and  incubated at room  temperature..  “rapidoviride”).  birch  wood  xylan. 1.  2.  2008).  and  carboxymethyl  cellulose (CMC). wet oxidized wheat  straw  (WO).  0. The FC was washed to decrease the  amount of free sugars by adjusting the FC to a TS (total solids)  of 4%.  IBT15094  (P.  Samples  were  isolated  from  wooden  biomass  such  as  decomposed  wood  in  a  local  swamp.  which  relates  to  the  clearing  zone  observed in  the  medium. niger and T.5  g/l  MgSO47H2O.  Centre  for  Microbiology.  The  aim  was  to  identify  fungal strains that efficiently can utilize the filter cake stream  of  the  second  generation  bioethanol  production  for  enzyme  production  and  to  investigate  the  potential  of  such  on‐site  enzyme  production  compared  to  the  use  of  commercially  available enzymes. where A. wet oxidized  wheat  straw (WO) (Biogasol  ApS).  and  ash  contents  were  determined  according  to  the  NREL  procedures  “Determination  of  Total  Solids in Biomass version 2005” and “Determination of Ash in  Biomass  version  2005”.  Additionally.  and  pH  adjusted  to  4. reesei are  used as reference strains.  and  growth  was  graded  on  a  subjective  scale  1‐5  by  visually  determining  the  colony  diameters. the pre‐treated substrates are not  pure  and  possible  inhibitory  compounds  may  influence  the  hydrolysis  (Zhang  et  al.  Research paper I   ‐ I.  Several  rounds  of  culture  transfers  onto  new  PDA  plates  were  carried  out  in  order to obtain pure single isolates. followed by settling  for  one  hour.  2%  agar  was  added  to  the  washed  FC.5%  agar.  and  carboxymethyl  cellulose  (CMC)  (Sigma)  were prepared as follows.  IBT3945  (Penicillium  “pseudofuniculosum”).  removing  of  top  liquid.  cellulosic.  The  procedure  was  repeated.   Agar plates of filter cake (FC) (Biogasol ApS).  followed by autoclaving at 121°C for 20 minutes.  A  predictive  cellulase assay or screening is particularly difficult to develop  because of the complex nature of the plant biomasses that the  enzymes should hydrolyze.1 Biomass and biomass characterization  Wet  oxidized  wheat  straw  (WO)  and  the  filter  cake  (FC)  obtained  after  C6‐sugar  fermentation  of  wet  oxidized  straw  were  kindly provided  by Biogasol  ApS.  and  addition  of  new  water.  0. Technical University of Denmark.g.  with  primary  focus  on  the  cellulolytic  activities.  and  IBT7612 (Trichiderma reesei).  “massa”). The screening on different agar  media was carried out in single determination.  “rapidoviride”).  IBT14668  (P.  fungal  strains  were  provided  from  IBT’s Culture Collection of Fungi by selection of Professor Jens  C.  birch  wood  xylan.  often having  a  larger  diameter  than  the growth of the fungus itself. 2010).   2.   2.  In  this  study.  or  CMC  to  the  basic  Czapek  (CZ)  agar  media  (3  g/l  NaNO3.8.  2.  using  different  lignocellulosic.  Aspergillus  niger  and  Trichoderma reesei that are commonly known as good enzyme  producers  (Mathew  et  al.  2006). The plates were  incubated  at  25C  for  7  days.  Depertment  of  Systems  Biology.4 Fungal isolation  Initially  a  small  piece  of  e.  volatile  solids  (VS).2 ‐    . autoclave at 121C for 30 minutes.  avicel  (Sigma).2 Media  Potato dextrose agar (PDA) was prepared by finely dicing  200  g  peeled  potatoes.  avicel.5 Screening of fungal growth on agar plates  Five  different  substrates  were  used  for  the  initial  screening on agar plates: Filter cake (FC). prepared as described above.5  g/l  KCl.  0.   For  this  purpose  a  screening  strategy  was  used. 2% dextrose.  Fungal  isolates  collected  for  this  work  were  screened  for  their  cellulase  activity  and  compared  with  the  activity  of  two  reference  strains. and letting this mixture pass through a sieve.  “pseudoverruculosum”).  1  g/l  K2HPO4.  IBT3016  (A.  boiling  them  in  one  litre  of  water  for  one hour.01  g/l  FeSO47H2O.  and  hemicellulosic  substrates  to  identify  fungi  able  to  degrade  lignocelluloses.  avicel.  process  as  part  of  the  fermentation  medium  could  be  an  attractive alternative.  and  rye  bread. Total  solids  (TS).  2.  pre‐treated  wheat straw that had been processed in a  pilot  plant and the  filter cake obtained after C6‐sugar fermentation were used to  screen  for  and  to  test  potential  on‐site  fungal  enzyme  producers.  IBT18366  (P. Materials and methods  2.  birch wood xylan (Sigma).  pseudofumigatus).  while  structural  carbohydrates  and  lignin  was  determined  according  to  NREL  procedure  “Determination  of  Structural  Carbohydrates  and  lignin  in  Biomass  version  2006”  (NREL  National  Renewable  Energy  Laboratory.  ending  up  with  a  TS  of  approximately  4%..  IBT16756  (A.  IBT26808  (P.5  g  CuSO45H2O  in  100  ml  water)  per  litre  were  added.  autoclaved  at  121C  for  15  minutes.3 Fungal collection  Fungal  isolates  were  obtained  from  various  sources.  The  other  agar  plates  were  prepared  by  adding  2%  w/v  of  either  WO. These included the  following  strains:  IBT25747  (Aspergillus  niger).  Denmark.. and 1 ml trace metals (TM: 1 g ZnSO47H2O.8.  treated  hardwood.  Frisvad.  0.  pulvillorum). 2004) and adjusting the pH to 4. Spores of seven  day  old  fungal  cultures  were  transferred  to  the  centre  of  the  different plates using a 1 µl inoculation loop.  On  the  xylan  plates  an  additional  subjective  grade  was  introduced:  0‐3z.  15  g/l  agar)  (Samson et al.

8  as  substrate.  thereby  expressing  absorbance  as  glucose  equivalents.  A  mixture  of  4.7 Activity studies by solid state fermentation on filter cake and  hydrolysis of wet oxidized biomass  FC  was  autoclaved  and  freeze  dried  in  order  to  stabilize  the  biomass.5L  and  Novozym  188  (Novozymes  A/S.  The  grading  was  based  on  colony  size  (morphology). while 35% of the  strains  were  graded  3  or  above  on  WO.  1  FPU  Celluclast  1.8  containing  0.3 ‐    .  The  samples  were  centrifuged  and  the  supernatants  were  analysed  using  HPLC  and  the  reducing  sugar assay (see below).6 ml/min and an injection volume of 10 µl. a second setup contained the fungus and 1  FPU  (filter  paper  unit)  Celluclast  1.8 Synergistic test with commercial enzymes  Solid  state  fermentation  was  used  for  the  purpose  of  evaluating  synergistic  effects  of  the  fungi  and  Celluclast  1.5L  added. as  it  was  expected  that  the  better  the  fungi  grew. respectively).  the  better  they  utilized the substrate. with an activity of 322 U/ml at  40 C.8  g  DM  WO) pH  4.85  g  freeze  dried  FC  (TS  =  17%). A  standard curve was obtained with different concentrations of  glucose. One ml milliQ water and 0.8.0  ml  dinitrosalicylic  acid (DNS) was added.  2.  in  total  5  grams.   3. Results and discussion  3.  The  activity  study  on  AZCL‐plates  was  carried  out  in  double  determination. avicel. reported by the manufacturer. The activity  was  expressed  in  units  (µmoles  substrate  converted  per  minute).1%  azurine  cross‐linked  substrates:  AZCL‐HE‐Cellulose  (HE=hydroxyethyl) and 0.  were  used  for  cellulase  and  xylanase  activity  studies.  then  diluted  with  MilliQ  water. and carboxymethyl cellulose (CMC) (Table  1).  Incubation  was  done  in  50  ml  vials  at  50C  for  4  days  with  shaking at 160 rpm.  assayed  according  to  the  manufacturer’s  description (Megazyme) (Wood and Bhat. Growth set‐up  was conducted in triplicates.1 Initial screening and biomass evaluation  A screening program for different new fungal isolates from  environmental  samples  was  established  in  order  to  identify  strains  with  high  hydrolytic  activity  compared  to  wellknown  reference  strains. 25% of the  strains were graded with 3 or above on FC.  The  assay  was  carried out as described by Flachner et al.  Denmark).9 Activity assay of fungal extracts  Endo‐glucanase  activity  was  determined  by  the  use  of  AZO‐CMC.  The  progress  of  the  blue  zones  was  followed  for  7  days at room temperature and the final coloration was used to  categorize  the  strains  on  a  subjective  scale  from  1  to  5.  yet  WO  was  at  the  Research paper I   ‐ I.10 Sugar analysis  All samples to be analyzed by HPLC (Hewlet Packard 1100  series)  were  run  on  a  3007.  2. and 1 ml samples were taken before and  after  hydrolysis.8  mm  Aminex  HPX‐87H  Column  (BioRad)  at  60°C  with  sulfuric  acid  as  eluent  at  a  flowrate  of  0.15  ml  CZ  medium  and  0.  2. The activity was  indicated by blue color zones resulting from hydrolysis of the  substrate. After incubation. wet oxidized wheat straw  (WO).  Beta‐glucosidase  activity  was  assayed  with  5  mM  p‐ nitrophenyl‐beta‐D‐glucopyranoside  (Sigma)  in  50  mM  sodium  citrate  buffer  pH  4. using MilliQ water as standard. followed by blending with a coffee mixer for 30 seconds to  disrupt the fungus/medium complex created by the growth of  the fungus. The medium was  inoculated with a spore solution  of approximately 106 spores  per  gram  DM  in  each  fermentation  and  the  beakers  were  incubated at 25C in high humidity for 7 days. pH 4. The enzyme  solution  was  assayed  in  various  dilutions  at  the  conditions  stated by the manufacturer.6. The FC  to  WO  ratio  was  approximately  1:3  on  dry  matter  basis.  and  the  total  mixture  was brought  to  a  final  TS of 2% by addition of 0.  was  used  as  growth medium in solid state fermentation.85 g DM  FC)  was  then  added  to  wet  oxidised  straw  (containing  2.1 M Na‐citrate buffer pH 4. A standard curve was obtained by  activity  measurements  of  a  pure  endoglucanase  from  Aspergillus niger (Megazymes).   The  reducing  sugar  assay  was  carried  out  according  to  Ghose (1987) and Miller (1959).  Inoculation  was  done  by  placing  1  µl  of  106/ml  spore suspension in  the centre of the plates.  while  a  third  contained  the  fungus.5  ml  sample  solution  were  mixed  before  3.1% AZCL‐arabinoxylan (Megazyme).8 was added directly to the beaker to give a TS of  3%.  but  with  commercial  enzyme  preparations added after the FC with fungus and WO had been  mixed.5L  added. FC and WO were the media  that resulted in the best growth of the fungi tested.  One  setup  contained  the  fungus  as  the  only  source  of  enzymatic activity. (1999).  A  total  of  64  strains  were  included  in  the  initial  screening  that  comprised  grading  of  growth  on  the  different substrates: filter cake (FC). This homogenized fermentation broth (0.6 Activity studies using AZCL‐plates  Agar  plates  with  CZ‐medium  pH  4.  2.  2. The components  were detected refractometrically on a RI detector.  The  set‐up  was  as  described  above. xylan.8.1 M Na‐citrate  buffer pH 4.  respectively.  followed  by  spectrophotometrical  absorbance  measurements  at  540  nm  (Milton Roy spectronic 301). The mixture was boiled for 5 minutes. 1988). 0.  In general.  and  Novozym 188 (in a ratio of 4:1.

5    1. graded on a scale 0‐3 (0=no clearance.  However.2.4  1.1  10.  2005).1  1  0  4  z1  1  0    9.4  2.4  10.1  4.4  4.3  1  0  2  z3  1  0                FC  WO  Xylan*  Avicel  CMC  2  2  3  z2  1  2  2  3  5  z1  1  3  2  0  5  z3  2  1  1  0  1  z0  0  0  2  4  5  z3  1  2  2  4  5  z3  1  1  4  4  2  z0  1  1  2  2  4  z3  2  3  1  0  1  z1  1  0  3  2  5  z3  5  5  2  3  3  z2  1  1  1  0  2  z0  3  1  1  2  3  z0  1  1  4  3  5  z0  1  3  0  0  2  z1  0  0  2  3  2  z1  1  2  0  0  2  z0  1  1  0  2  2  z0  1  1  5  3  4  z1  3  1  0  2  2  z0  1  2  FC  WO  Xylan*  Avicel  CMC  1  0  2  z1  0  1  3  3  1  z0  1  1  2  3  1  z0  1  2  4  3  4  z0  3  5  2  1  3  z0  2  1  2  1  2  z1  1  1  1  1  3  z0  3  2  1  2  2  z1  1  1  1  3  2  z2  1  3  2  2  2  z2  1  1  3  3  1  z0  1  2  1  2  2  z2  1  1  2  2  2  z3  1  2  1  2  2  z2  1  1  1  3  1  z0  1  1  1  2  1  z0  1  1  1  2  1  z0  1  1  1  0  2  z2  1  1  1  3  1  z0  1  2    Ref.1  9.  WO represents another fraction in the ethanol process and  could  be  a  potential  substrate  for  enzyme  production  as  it  is  for  ethanol  production.1  3.2  9.8..1  3.5  Hj1  Hj3  AP  A1  A2  A3  14  13  15    .5  11.  Table 1.strain  IBT7612  4  3  2  z0  1  0  IBT14668  IBT15094  IBT16756  IBT18366  3  4  1  z0  1  2  FC  WO  Xylan*  Avicel  CMC    1  3  3  z1  2  3  3  2  3  z2  1  2  1  3  2  z2  1  1  3  3  2  z2  2  1  3  2  2  z2  1  2  1  3  1  z0  0  2  3  0  3  z3  3  1  1  3  1  z0  1  3  1  0  2  z2  2  1  1  0  1  z0  1  1  0  0  1  z0  0  0  3  0  3  z1  1  3  1  2  1  z1  1  2  3  3  3  z3  2  3  3  3  3  z3  2  2  0  2  3  z1  1  1  3  z2  1  2  Research paper I   ‐ I.5.5  2.  FC  is  likely  to  already  be  associated  with  proteins  from  the  previous  hydrolysis  (Jorgensen  et  al.3.  same time the substrate having the greatest number of strains  that did not grow at all (Table 1).3  1. Grading of growth on substrates on a scale 0‐5 (0=poor growth.6  2.  The  main  components  of  the  FC  are  relatively  high  levels  of  lignin  followed by cellulose (Table 2)..8  2.1  1.2  1.  2004). The cellulose of FC is regarded  as poorly available as it remained part of the solid product and  thus  was  not  initially  hydrolyzed. 2006).  this favors the use of FC for on‐site enzyme production and FC  was  therefore  included  in  the  screening.  Overall.  2007).  This  would  increase  the  accessibility  of  the  remaining  cellulose in the FC (Berlin et al. The reuse of FC  would  loop  back  the  un‐hydrolyzed  biomass  into  the  process  and  thereby  make  good  value  of  this  fraction.1  7.1  11.1  10.3  9. During fermentation  the close association of the growing fungus with the FC could  result  in  proteolytic  metabolic  activities  that  to  a  certain  extent  could  remove  some  of  the  enzymes  bound  to  the  FC.2  9.2  1.  this  could  potentially  have  a  negative  impact  on  the  enzyme  hydrolysis  as  lignin  is  known  to  enhance  enzyme  adsorption  (Berlin  et  al.8.1  7.1  1.3  10.4  11.2  5.7  2.3.2  4  2  4  z1  1  5    11.4..  Adding  FC  as  fermentate directly in  the hydrolysis will increase the  overall  lignin  concentration  in  the  hydrolysis.2  10.2  1.  FC  of  hydrolyzed  wet  oxidized  wheat  straw  represents  a  fraction  from  the  bioethanol  process  with  low  commercial  value and could be of great interest to utilize as a substrate for  enzyme production for the bioethanol process.4 ‐    IBT26808  3  4  IBT3016  IBT3945  11.  This  would reduce both the non‐productive and productive binding  of new enzymes due to low accessibility.  *z=zone of clearance. 5=very good growth).2  7.7  2.  Wet  oxidized  material  has  previously  been  reported  to  contain  compounds  inhibitory  towards  enzyme  hydrolysis  and  fermentation  (Klinke  et  al.strain  IBT25747   1  2  4  z3  1  2  1  0  1  z0  1  0    Ref..2  2  0  1  z0  1  2                9.1  1.6  1.3  9.2  2.1.3  2.1  2. 3=large zone of clearance)  1.9  3.  It  is  speculated  that  fungi  capable  of  growing  on  FC  potentially  have  new  interesting  enzymes  that  can  facilitate  further  hydrolysis  of  FC.

 respectively.  thus  making  the  strains  that  did  succeed  in  utilizing  this  carbon  source  outstanding  compared  to  the  most  strains  tested.5.0  0.3%    28. 2007. it has not  previously  been  reported  to  use  the  waste  stream  after  C6  fermentation  and  where  C5  sugars  are  removed  with  the  Table 3.1  1.  AZCL  media  are  commonly  used  for  broad  enzyme  screening with focus on endo‐activites (Pedersen et al.46    0. hemicelluloses.  each  having different degree of crystalline and amorphous regions. 2003).  with  the  grey  colored grades representing the primary reasons for choosing  these  particular  strains.007 g/gDM  0.strain  IBT7612  0  4  IBT3016  2  4  1. 1997.  where avicel primarily requires cellobiohydrolase activity and  CMC  requires  endoglucanase  activity  for  their  hydrolysis  (Zhang et al.  and lignin content are calculated using NREL procedures.  1987.1  5.2%    WO  FC    However.8  3. Grading of blue color formation from growth on AZCL‐Polysaccharides plates. Thygesen et al. The lower lignin content of  the  WO  (Table  2)  compared  to  FC  might  also  explain  the  increased growth on WO.3  0.3   0.  WO.1  1. and was the  only  substrate  that  supported  growth  of  all  strains  (Table  1).0   0.     Cellulose   (% of DM)  41.  Gupte  and  Madamwar.   3. corn fiber) and wastes (including paper pulp. Blue colour zone and intensity graded on a scale 0‐5  IBT15094  IBT18366  IBT26808  IBT14668  Ref..  xylan  was  the  substrate  supporting  good  growth  of  the  greatest number of strains (grades of 3 or above).  avicel.  Doppelbauer  et  al.  The  selection  was  based  on  good  growth  grades  (≥3)  on  FC.18    0.1.2%   Xylose   (g/gDM)  0. Avicel and  CMC  represented  the  cellulose  fraction  of  the  biomass. Biomass composition of  pre‐treated wheat straw (WO) and filter cake (FC). respectively (Table 1).6  2.  This  clearly  shows  that  xylanases  are  widespread  amongst  fungi in general.  2009).  and  one  using  the  complex  filter cake as substrate for enzyme production followed by its  use in hydrolysis of WO to determine activity on this complex  substrate. municipal  refuse..002 g/gDM  Lignin   (% of DM)  27. Amongst those strains that did grow  on WO.6%   6.  poor  growth  of  enzyme  producers  on  this  medium  does  not  necessarily  relate  to  a  lack  of  cellulolytic  enzymes  produced by the fungus.2 Enzyme activity studies of strains selected from screening  Two  activity  studies  were  carried  out  to  evaluate  the  enzyme  activity  of  the  25  strains  chosen  from  the  initial  screening: one  using  AZCL  medium for  simple  measurements  of  cellulase  and  xylanase  activity.  groundnut  shells.2  11. where glucose and xylose amounts after acid hydrolysis  are calculated into cellulose and hemicellulose.94  0.8.5  Hj3  3  3  1.  The  use  of  pretreated  biomass  (including  wheat  straw. the strains did not grow well on  the  cellulose  substrates  as  less  than  10  and  20%  were  given  grades of 3 or above on avicel and CMC.   Xylan  was  included  in  the  screening  to  determine  the  ability of the fungus to utilize a hemicellulosic carbon source.   Of the 64 strains included in the screening.  rice  straw.2  4.  niger  IBT25747and  T. 25 were chosen  for  further  studies  (grey  colored  in  Table  1).5 ‐    .  Dien  et  al.31   0..  2006.strain  IBT25747  3  4  Ref.61  0.1  9.  A.4%    Glucose  (g/gDM)  0.3  2. The cellulose. 2006).1%    46.  Of the commercial hemicellulose  and  cellulose  substrates..  Table 2. Free sugars will  help  initiate  fungal  growth  and  perhaps  thereby  boost  the  fungi  that  have  the  right  combination  of  enzymes  to  degrade  the substrate to continue growth.2    AZCL‐cellulose  AZCL‐arabinoxylan    4  4  1  2  3  3  5  5  2  3  3  3  1  2  4  0  0  2  5  5  3  3  3  3  4  4  3  4  1  2  2  2  AP  4  4  14  15  3  3  4  4  2  2  1  4  Research paper I   ‐ I.003 g/gDM  0.  reesei  IBT7612  were  included  as  reference  strains.  wheat  bran.4  11.  as  the  enzymatic  degradation  of  xylan  to  xylose  could  add  value  to  the  process  in  terms  of  the  pentoses  later  being  fermented into ethanol by C5 fermenting microbes. In contrary..  Pedersen  et  al. an increased number of strains received good growth  grades  indicating  that  the  greater  levels  of  free  sugars  in  the  WO  media  facilitated  increased  growth  compared  to  the  FC  where washing had removed the free sugars..07    0.  2009.  stillage  of  sugar  cane  bagasse  and  spruce  wood  hydrolysates)  to  support  fungal  growth  and  enzyme  production  has  previously  been  reported  (Alriksson  et  al.004 g/gDM  Hemicellulose  (% of DM)  16.1  9. However.3.  and  CMC.1  2.

37  (8)  1. Two good examples  are the strains 11.75  1.1  2.  given  on  both  AZCL‐cellulose  and  –arabinoxylan.2  1.61  (7)  1.41  Glucose (g/l)    1. endo‐glucanases/xylanases.16  0.66  1.1.48  (1)  0.32  (9)  1.24  0.29    0.25  1.3.  but  lack  of  sufficient  beta‐glucosidase  activity.32  1.23  (1)  1.15  0.1  5.39  (7)  0.07  1.52  1.6 ‐    .1  1.  while  it  for  the  xylan  plates  was  difficult  to  judge clearing zone intensity.29  9.46  (5)    IBT14668  IBT15094  IBT18366  IBT26808  1.91  Reducing ends (g/l)    0.42  (6)  1.35  (9)  11. a full enzyme cocktail must  work together.  and  beta‐glucosidases/‐xylosidases  (Zhang  et  al.1  0.3  (data  not  shown).57  Ref.   Table 4. it was found that the grades on CMC and  AZCL‐cellulose  correlate  well.  The  increase  in  monomeric  sugar  concentration  only  partly  correlates  with  the  measured  increase in reducing ends of the samples. Increase in concentration of reducing ends (measured as glucose equivalents) and monomeric sugars after hydrolysis  of wet exploded wheat straw by fungal enzymes produced on filter cake.  The activity study using AZCL‐substrates was subjectively  graded  based  on  degree  of  blue  color  zone  and  its  intensity  (Table  3).strain  IBT7612  1.  However.  1.16    0.37  (7)  0.  the  ability  to  grow  well  on  CMC  was  indeed  an  indication  that  the  fungi  had  enzymes  for  hydrolysis  of  CMC.3  2.8  3.52*  0.  *Here. these are in the top 5 of the  reducing ends measurements.36  Xylose (g/l)    0.58    0.  Accumulation  of  cellobiose  was  detected  for  strain  1.33  (8)  0.46  (4)  1.45  1.  To  reach  a  high  concentration of sugar monomers.18    0.73  (3)  1.    Therefore.53  1.28  0.11    1.33  0.  thereby adding value to the overall process.41  0.8.45  0.2  4.49  (3)  0.2  1.27    1.4 and IBT15094.11  0.42  (5)  0. but do not even get in top 10 of  the  monomeric  sugar  measurements.1  and  2.   The  enzyme  activities  produced  by  the  fungi  growing  in  solid  state  on  FC  were  evaluated  by  analysis  of  the  soluble  sugars  after  hydrolysis  of  WO.09      14  1.38  (6)  0.51    1.  indicating  high  cellobiohydrolase  activity.strain  IBT25747  2.1  1.48  (4)  0.  These  different  observations  highlight  the  importance  of  multiple  screening methods to be able to map the different activities of  each fungus.49  Xylose (g/l)  (3)      11.8.32  0.06  1.68  (4)  0.27  Reducing ends (g/l)    0.81  (1)  IBT3016  Hj3  AP    1.4  0.1  1.55  0.24  0.  however.  shown  by  the  dye‐release  on  AZCL‐cellulose.57  (2)  Research paper I   ‐ I. The number in the parenthesis assigns the ranking of  the fungus among all fungi examined. but if the fungus does not have  good  beta‐glucosidase/‐xylosidase  activity.  soluble phase. an accumulation of cellobiose was found. consisting of exo‐.  Comparing  these  results  with  the  initial  growth  screening (Table 1).65*  (5)  0.6  2..16    0.41      15  0.5  0.  indicating high endo‐activity.17                    1.73      Ref.  the  clearing  zone  grades  on  xylan only partially correspond with the color grades on AZCL‐ arabinoxylan.5.76    0.  A  high  score  was. Great endo‐activity will increase  the number of reducing ends.58  (9)  0.9  (2)  0.23    0.  Increase  in  reducing  ends  (measured  as  glucose  equivalents)  as  well  as  final  C6  and  C5  sugars present after hydrolysis of wet oxidized biomass were  compared  (Table  4).23    0. to use the filter cake of the wheat straw  bioethanol  process  for  enzyme  production  and  reuse  it  directly  for  hydrolysis  without  separating  out  the  enzymes.6  Glucose (g/l)  (8)  0.4  1.  2006).85  1.68  (2)  0.27  0.  no  great  monomeric  concentration  will  be  detected.  This  might  be  due  to  that  the  color  grades  on  AZCL‐arabinoxylan are based on both color intensity as well as  zone  diameter. That is.63  (6)  1.35  1.91  1.  The  growth  grades  on  xylan  (Table  1)  and  color  grades  on  AZCL‐arabinoxylan  (Table  3)  were  for  the  most  part  comparable.1  9.

 It was further confirmed by  the  addition  of  Novozym  188  that  in  all  cases  resulted  in  a  drop in cellobiose concentrations.1.  where  AP  and  IBT25747  showed  high  beta‐glucosidase activity while the beta‐glucosidase activity of  1.3 Synergies with commercial enzymes  The five strains were grown in FC for enzyme production.1).  1994.   Evaluations  were  primarily  based  on  the  cellobiose  concentration  at  the  end  of  the  hydrolysis.1  low  0.09  IBT15094  low  2.24  8.8.1.  the  beta‐ glycosidase  activity  of  Novozym  188  helps  increase  the  glucose  yields  and  decrease  the  cellobiose  concentration  created by the cellobiohydrolase activity of Celluclast 1.37  Figure 1.  and  5.05  AP  7.  The  beta‐glucosidase  and  endo‐glucanase  activities  were  measured  for  each  fungal  or  commercial  enzyme  addition (Table 5).5L.  using  their  enzymes  produced  on  FC  to  hydrolyze  WO  alone.85  85.  WO  in  combination  with  Celluclast1. error bars represent the double determinations of the hydrolysis.  Low  filter  paper  unit  (FPU)  loadings  of  Celluclast  1. and IBT15094 was low.  This  correlates  well  with  the  measured  activities  (Table  5).  while  IBT25747  has  far  greater  endo‐glucanase  acitivity  (Table  5).8.   Such synergies were examined in our five selected strains.1.5L  for  hydrolysis  showed  that  the  beta‐glucosidase  activity  of  IBT25747  and  AP  has  Table 5.5L  and  Novozym  188.  and  WO  in  combination with Celluclast 1.5L. N = Novozyme 188.4  41  Novozym 188  1.  1997).5L and here it  is  obvious that  synergetic activities resulting from growth  on  FC  were  insufficient.  synergies  were  found  with  the  strain  AP  and  IBT25747.  AP.  Of  the  25  strains. Increase in glucose.  5. Units of beta‐glucosidase (BG) and endoglucanase (EG) added by each fungus or  commercial enzyme prep to the WO hydrolysis     BG  EG    Celluclast 1.  The  glucose  concentration  after  hydrolysis  with  Celluclast 1.   F= fungus.1  low  1.  five  were  selected  for  further  studies  with  commercial  enzymes.  and  IBT15094.   3.5L and Novozym 188. Synergies with commercial enzymes.  and  also  to  include  some  that  are  thought  to  specifically  possess  high  endo‐activity  (IBT15094) or exo‐glucanase acitivity (1.  accumulation  of  cellobiose  was  seen  after  hydrolysis  when  hydrolysis  was  performed with the test fungus and Celluclast 1.1.  followed  by  hydrolysis  of  WO  in  combination  with  the  commercial  enzymes  Celluclast  1.  Bhat  and  Bhat.5L and Novozym 188 (Figure 1).  This  could  be  explained  by  the  higher  cellobiose  concentration  inhibiting  the  endoglucanases  and  cellobiohydrolases  resulting  in  a  lower  total  hydrolysis  in  the  case  of  just  using  Celluclast  1.7 ‐    .5  low  1. 5.8.5L  0. 1999).92  Ref strain  IBT25747  7.5L  (data  not  shown).5L  (Mansfield et al.  Of  the  two  commercial  enzyme  preparations. and xylose concentrations after hydrolysis of WO. was slightly higher than the  sum  of  glucose  and  cellobiose  after  hydrolysis  using  just  Celluclast  1. cellobiose.5L  and  a  4:1  ratio of Novozym 188 were applied to visualize the synergistic  effects  of  the  fungi  that  were  tested  and  the  commercial  enzymes.  as  there  was  no  accumulation  of  cellobiose  and  therefore  sufficient  synergies  with  the  enzyme  activities  of  Celluclast  1.99  5.  Strain  IBT25747  gives  the  highest  glucose  yield  when  hydrolysis  was  performed  with  only  this  fungus.  With  strain  1.  Research paper I   ‐ I. C = Celluclast 1.1).5L.   The  profiles  of  the  strains  AP  and  IBT25747  are  very  similar  with  regards  to  beta‐glucosidase  activity.  while  AP  gives  the  second  highest  (Figure  1).  On  this  basis.8.5L that  can  be  self‐inhibiting  (Beguin  and  Aubert.  Combining  either  IBT25747  or  AP  with  Celluclast  1.  We  chose  to  continue  with  the  strains  that  had  generally  performed  best  in  terms  of  total  cellulose  degrading  abilities  in  multiple  of  the  assays  (ref  strain  IBT25747.

 Jordan. Eliminating the need for  beta‐glucosidase  addition  during  hydrolysis  will  significantly  lower  the  cost  of  enzyme  addition  so  our  results  have  importance for practical applications.  Esterbauer.K..  Addition  of  Novozym  188  has  no  significant  effect  on  total  hydrolysis  evaluated  by  glucose  yields..  Lafferty. Kubo.S.  1997. 862‐870.  B. likely explained by the fact that the  fungus  contributes  with  about  5  times  the  amount  of  beta‐ glucosidase  activity  compared  to  the  Novozym  188  added  (Table 5).  The  Biological  Degradation  of  Cellulose.B.  Kilburn.  Larsen. 163‐170. 583‐620.  Steiner.    Acknowledgements  Mette  Lübeck. 15.H.  2006..B.  C.. Brumbauer.  This  resulted  in  a  difference  in  glucose  yield  amongst  the  two  strains  of  46%  when hydrolysis was performed with only the fungus. 485‐494. P.  W. 96.  Microbiol. 75.  Kurabi. Such on‐site  enzyme  production  is  valuable  in  terms  of  obtaining  a  complete  value  chain  of  the  biofuel  production.5L. Prog.  FC.  J.   Bhat.  N. Biotechnol...  that  is  known  to  lack  important  enzyme  activities  for  complete  hydrolysis. Biotechnol..  125. 257‐268  Gupte.  H.  Rose. M. Biofuels.  Aubert.  Saddler.. T..   Berlin.  Tu.5L..   Dien. Addition  of Novozym 188  had no extra  effect  on sugar  yields when FC  pregrown with strain AP was added.  Ahring.  2007.K.   Beguin. it is clear that greater activity  results  in  a  higher  degree  of  hydrolysis.  W.  Solid  state  fermentation  of  lignocellulosic waste for cellulase and beta‐glucosidase production by  cocultivation  of  Aspergillus  ellipticus  and  Aspergillus  fumigatus  .  H....  Technol.  xylanase  and  beta‐ glucosidase  activities  by  softwood  lignin  preparations.  Microbiol..  A.5L  is the most likely  reason for this decreased difference in yield.  The  endoglucanase  activity  of  IBT25747  is  approximately  10  times  higher  than  the  endoglucanase  activity  of  AP.  Vibe‐Pedersen.  M. 289‐302.B.  Inhibition  of  cellulase.   Strain  IBT25747  is  A.  Cellulase  Production  from  Spent  Lignocellulose  Hydrolysates  by  Recombinant  Aspergillus  niger  . A.   Berlin. K..  39.  one  of  our  own  unknown  isolates.  2004. 166‐169.  L.  Aalborg  University  is  acknowledged for revision of the manuscript    References  Ahring.  supporting  the  fact  that  xylose  is  more  accessible  due  to  the  nature  of  the  hemicellulose  structure  (Saha.8 ‐    .  showed  a  very  promising  profile  in  terms  of  on‐site  enzyme  production using FC as growth medium.  Inhibition  of  ethanol‐producing  yeast  and  bacteria  by  degradation  products  Research paper I   ‐ I.  Madamwar.K. B.  not  surprising  that  its  enzymes  in  combination  with  Celluclast  1.J.  R.  H. Conclusion  This  work  demonstrates  the  possibility  of  using  a  low  value  stream  of  the  biofuel  production.  A.  Enzyme  Microb..  The  additional  endo‐ glucanase contribution  from  Celluclast  1.  1987.  besides  of  this  known  strain..  with  the  enzyme  concentrations used here.  4.  D. 13.  S.  Copenhagen  Institute  of  Technology.  B. 108.   Alriksson. V.. Here.  Technol. 1999. N...  Biotechnol...  while  the  beta‐glucosidase  activity  is  approximately  the  same. 13. Li. L.   Flachner.B. J.  promising  candidates  were  selected. O'Bryan.  M.  1994..  van  Zyl..  Sjode.  Thomsen.B. Measurement of Cellulase Activities. Pure Appl...  Saddler....  Through  a  broad  screening  for  on‐site  enzyme  producers  as  well  as  testing  for  synergistic  effects.  A.  Cellulose  degrading  enzymes  and  their  potential industrial applications..5L  combined.  Gilkes.   Doppelbauer.  Enzyme  Microb.J.  P.  for  enzyme  production. 24. Reczey. Rev. Kadla. A.  therefore.  2003).  N.‐L.   Xylose  is  readily  released  by  all  strains  (Figure  1).P..  1997. 1987..g..  2007.   Evaluating  the  enzyme  activities  (Table  5)  together  with  the hydrolysis results (Figure 1). ref strain IBT25747 and own strain AP were  found as promising candidates for on‐site enzyme production  with  FC  as  growth  and  production  medium.  Appl. Gilkes..  A. D. 2005.  J.  Nilvebrant.  Section  for  Sustainable  Biotechnology.... 59.  synergies with the cellobiohydrolase activity of Celluclast 1... Stabilization of beta‐ glucosidase  in  Aspergillus  phoenicis  QM  329  pellets. 2366‐2374.  It  was  showed  that  the  FC  grown  with  these  fungi  can  substitute  Novozym  188 in the hydrolysis of WO.  J. 362‐367.  D. Balakshin.  B.  J.  J..  e. FEMS Microbiol.  H. Bioeng. B. Cotta..  Appl.   Klinke.   Ghose.  Chem..  Celluclast  1.   Jorgensen.  Jonsson. 198‐209.  and  the  endoglucanase  activities  add  to  the  total  hydrolysis. J.  R.  identification  of  enzymes  that  can  contribute  to  synergy  and  thereby  more  efficient  hydrolysis  were found.  Appl.  Felby.M.  The  use  of  Lignocellulosic  Wastes  for  Production  of  Cellulase  by  Trichoderma  reesei..  where  the  fungus  is  grown  in  the  FC  and  the  FC  with  the  fungus  is  used  directly  during  hydrolysis  of  WO  to  obtain monomeric sugars for biofuel production. Maximenko.. Weak lignin‐binding enzymes ‐ A novel approach to  improve  activity  of  cellulases  for  hydrolysis  of  lignocellulosics..  A. Stain AP was able to  compete  with  the  reference  strain  and  was  sufficient  for  hydrolysis of WO in combination with Celluclast 1.  strain  AP.A.5L  are  good  at  hydrolyzing  WO.  Coproduction  of  bioethanol  with other biofuels.  However.  S. but only  a difference of 17% when hydrolysis was performed with the  fungus  and  Celluclast  1.. X..  Biotechnol.  Steinmuller..5L..  Biotechnol.  2006.  2009..  P.  S.  Liquefaction  of  lignocellulose  at  high‐solids  concentrations. 121.  niger  and  it  is.  Bhat.  Westermann. 26.H.  Enzymatic  saccharification  of  hot‐water  pretreated  corn  fiber  for  production  of  monosaccharides. M.  Environ.  Biochem.  R.  Bura.  Biotechnol. 25‐58.K.  1137‐1144. Iten.  It  is  therefore  speculated  that  enzymes  with  relatively  high  xylanase  activity  are  likely  to  be  “part  of  the  package”  when  using organisms with cellulolytic activities. Adv.  From  the  use  of  reference  enzymes..

  Ind..   Pedersen. J.  Utrecht.  A.  Methods  for  Measuring  Cellulase  Activities.html).  M.  Introduction  to  Food‐  and  Airborne  Fungi. J.  Curr.   Mathew. Biochem.  2004. 2006. Solid‐state fermentation..M. R.  Screening for cellulose and hemicellulose degrading enzymes from the  fungal genus Ulocladium.  G...  L.  G. Biodeterior. 15. 147‐150.gov/biomass/proj_biochemical_conversion..M..K..  Hollensted.R..gov/biomass/analytical_procedures..  2009.  Use  of  Dinitrosalicylic  Acid  Reagent  for  Determination of Reducing Sugar... Selvakumar. 160..  Appl. P. Nigam. Adv.K.  Biotechnol. 32.  M.. Biodegrad.   NREL  National  Renewable  Energy  Laboratory.   Zhang.  B. Technol.  Bhat. 898‐907. 30.A..  R.  2007. 279‐291.  2003.  2004. C. Enzymol.  H.D.  2008.  Sukumaran.  Prog.  Progress  in  research  on  fungal  cellulases  for  lignocellulose  degradation.   Saha.  Biotechnol.  A.nrel.  E. 10‐26. 31. 1999.  Saddler.  Moniruzzaman. 12‐14. 484‐489. Ind.  Andersen.  Screening efter biologiens katalysatorer.  452‐481. P.9 ‐    .  A.   Pandey.R.Chem. Sci.  M.  Production  of  cellulose  and  hemicellulose‐ degrading  enzymes  by  filamentous  fungi  cultivated  on  wet‐oxidised  wheat straw.  Centralbureau  voor  Schimmelcultures. 81‐ 84..  Microbiol.. Mielenz.  Biomass  Research  ‐  Biochemical  Conversion  Projects  (http://www.   Pedersen..html).  Miller..L.   Knauf.  2010.. 66.  Outlook for cellulase  improvement: Screening and selection strategies.  C.  T..  produced  during  pre‐treatment  of  biomass.  B.   Pandey.  M..  Pandey.. Int..   Samson.  B. 606‐615. 67..      Research paper I   ‐ I.  L. 13.  M.  Jorgensen..  Hemicellulose  bioconversion.  Olsson..B.  K. A. Dansk Kemi 88.  Andersen.nrel.C.  1959.  S..  J.  149‐162.  1988.  Schmidt..E. 24. Biotechnol.   Wood. Anal. Soccol.  M.  Thomsen. 426‐428   NREL  National  Renewable  Energy  Laboratory.S.   Thygesen. Netherlands.  1999. Y. A..P.C.  77..  J. Meth. J.  Lignocellulosic  biomass  processing: A perspective. Himmel.  2003..  M.  R.. Solid state  fermentation  for  the  production  of  industrial  enzymes. Enzyme Microb. 87‐112.M.  Mooney.  Hoekstra. Res.  Substrate  and  enzyme  characteristics  that  limit  cellulose  hydrolysis. 106.  2009..N. 2003.  Sci.S..   Mansfield.  A.  Microbiol... Eng.  Ahring. 804‐816.  L.‐H.  Lange. Singhania.R...  Biomass  research  ‐  Standard  Biomass  Analytical  procedures  (http://www.  B.  J. Int.  Biotechnol.  Lange.  Hollensted.  Frisvad. 63. Sugar J.

      .

 Mette Lübeck.      Annette Sørensen. Philip J. Teller.Research paper II      Screening for beta‐glucosidase activity amongst different fungi  capable of degrading lignocellulosic biomasses: discovery of a   new prominent beta‐glucosidase producing Aspergillus sp. Lübeck. and Birgitte K. Ahring    Intended for submission to Enzyme and Microbial Technology  . Peter S.

 

Screening for beta‐glucosidase activity amongst different fungi  capable of degrading lignocellulosic biomasses: discovery of a  new prominent beta‐glucosidase producing Aspergillus sp. 
Annette Sørensen1,3, Peter S. Lübeck1, Mette Lübeck1, Philip J. Teller2, and Birgitte K. Ahring1,3,* 
Section for Sustainable Biotechnology, Copenhagen Institute of Technology, Aalborg University, Lautrupvang 15, DK‐2750 Ballerup, Denmark   Present address: BioGasol ApS, Lautrupvang 2A, DK‐2750 Ballerup, Denmark  3 Center for Bioenergy and Bioproducts, Washington State University, Richland, WA 99352, USA 
1  2

 

 
A R T I C L E   I N F O 
Keywords:  Beta‐glucosidase  Screening  Enzyme kinetics  Aspergillus  Novozym 188  Cellic CTec 

A B S T R A C T
Through a broad fungal screening program for beta‐glucosidase activity using wheat bran as substrate  in  submerged  fermentation,  a  new  prominent  beta‐glucosidase  producing  strain  was  identified  amongst  86  screened  strains.  This  uncharacterized  strain  (AP)  showed  significantly  better  beta‐ glucosidase potential than all other fungi screened, with Aspergillus niger showing the second greatest  activity. Strain AP was from its ITS1 sequence identified as an Aspergillus sp., and phylogenetic analysis  indicated  it  was  a  new  species.  The  potential  of  a  solid  state  fermentation  extract  of  strain  AP  was  compared  with  the  commercial  beta‐glucosidase  containing  enzyme  preparations:  Novozym  188  and  Cellic  CTec.  The  extract  of  strain  AP  was  found  to  be  a  valid  substitute  for  Novozym  188  in  terms  of  better  cellobiose  hydrolysis,  by  having  the  same  Michaelis  Menten  kinetics  affinity  constant,  and  by  performing equally well during hydrolysis with regard to product inhibition. Furthermore, the extract  from  the  strain  had  higher  specific  activity  (U/total  protein)  and  also  increased  thermostability  compared  with  Novozym  188.  The  significant  thermostability  of  strain  AP  beta‐glucosidases  was  further  confirmed  when  compared  with  Cellic  CTec.  The  beta‐glucosidases  of  strain  AP  were  able  to  degrade  cellodextrins  with  an  exo‐acting  approach,  and  they  were  also  found  capable  of  hydrolyzing  pretreated bagasse to monomeric sugars when combined with Celluclast 1.5L. 

 
       

1. Introduction  Exploitation of lignocellulosic biomasses for production of  biofuels,  biochemicals,  and  pharmaceuticals  comprises  a  promising  alternative  to  the  world’s  limited  fossil  energy  resources.  Lignocellulosic  biomasses  mainly  consist  of  cellulose, hemicellulose, and lignin, with different distribution  of  each  component  depending  on  the  specific  plant  species.  Cellulose  is of  great interest in terms  of  producing  sugars  for  biofuels  and  chemicals  as  its  hydrolysis  product,  glucose,  can  readily be fermented into ethanol or converted into high value  chemicals. The hydrolysis of cellulose involves the synergistic  action of cellobiohydrolases (EC 3.2.1.91), endoglucanases (EC  3.2.1.4), and beta‐glucosidases (EC 3.2.1.21) [1]. The first two  act  on  the  solid  substrate,  where  the  cellobiohydrolases  are 
* Corresponding author: telephone +45 99402591  E‐mail address: bka@bio.aau.dk (B.K. Ahring) 

capable  of  degrading  the  crystalline  parts  of  cellulose  by  cleaving off cellobiose molecules from the ends of the cellulose  chains. The endoglucanases hydrolyze glucosidic bonds of the  more  amorphous  regions  of  the  cellulose,  decreasing  the  degree  of  polymerization  and  creating  more  ends  for  substrate‐enzyme  association  by  cellobiohydrolases.  Finally,  the  beta‐glucosidases  act  in  the  liquid  phase  hydrolyzing  mainly  cellobiose  to  glucose,  but  also  to  some  extent  cellodextrins, sugars with a low degree of polymerization [2].   Historically,  enzymes  from  Trichoderma  reesei  and  Aspergillus niger are known as a good match for the hydrolysis  of  cellulose;  T.  reesei  enzymes  mainly  contribute  with  cellobiohydrolase  and  endoglucanase  activity  and  A.  niger  enzymes  with  beta‐glucosidase  activity  [3].  Beta‐glucosidases  are  of  key  importance  as  they  are  needed  to  supplement  the  cellobiohydrolase  and  endoglucanase  activities  for  ensuring  final  glucose  release  and  at  the  same  time  decreasing  the  accumulation  of  cellobiose  and  shorter  cellooligmers,  which 

Research paper II  ‐ II.1 ‐   

 

are known as product inhibitors for the cellobiohydrolases [1].  Especially efficient beta‐glucosidases, that are not themselves  easily inhibited by their product, glucose, are of great interest.  Most  commercial  cellulase  preparations  are  produced  by  T.  reesei,  e.g.  Celluclast  1.5L  (Novozymes  A/S),  which  has  to  be  supplemented  with  extra  beta‐glucosidase  activity  from  another source, e.g. Novozym 188 (Novozymes A/S), in order  to  improve  cellulose  hydrolysis.  Recently,  Cellic  CTec  (Novozymes  A/S)  has  been  launched,  which  has  all  activities  needed  for  hydrolysis  of  cellulose  in  one  single  preparation.  The  commercially  available  beta‐glucosidases  have  relatively  low  long‐term  temperature  stability.  Robustness,  thermostability  and  substrate  specificity  are  very  important  characteristics  for  enzymes  to  be  applied  in  industrial  processes.   The  aim  of  the  present  work  was  to  search  for  beta‐ glucosidase  producing  fungi  using  a  screening  strategy  based  on wheat bran as substrate and to compare the enzymes from  the best strain(s) with commercial enzyme preparations based  on  enzyme  kinetics,  including  Michaelis‐Menten  studies,  thermostability, pH optimum, glucose tolerance, and ability to  hydrolyze  cellodextrins  and  pretreated  lignocellulose.  The  hypothesis  is  that  new  and  better  beta‐glucosidase  enzyme  producers  can  be  found  through  a  broad  screening  of  lignocellulose  degrading  fungi.  The  fungi  selected  for  the  screening originated from several different countries and was  partly collected by ourselves for this study and partly donated  by other researchers. 
2. Materials and methods  2.1 Fungal samples 

Beta‐glucosidase activity was measured using 5 mM p‐nitrophenyl‐beta‐D‐ glucopyranoside  (pNPG)  in 50 mM Na‐Citrate  buffer  pH 4.8 as  substrate.  15 µl  sample  and  150  µl  substrate  were  incubated  at  50°C  for  10  minutes  in  200  µl  PCR tubes in a thermocycler (Biorad); 30 µl of the reaction was transferred to a  microtiter  plate  already  containing  50  µl  1M  Na2CO3  for  termination  of  the  reaction. Absorbance was read at 405 nm in a plate reader (Dynex Technologies  Inc.). pNP was used to prepare a standard curve. One unit (U) of enzyme activity  was  defined  as  the  amount  of  enzyme  needed  to  hydrolyze  1  µmol  pNPG  in  1  minute.  Protein  quantification  was  done  using  the  Pierce  BCA  protein  assay  kit  microplate  procedure  according  to  manufacturer’s  instructions  (Pierce  Biotechnology).  2.3 Identification of fungi using sequencing of ITS1 region   DNA extraction was carried out by the method of Dellaporta et al. [11] using  bead  beating  (2x  20sec)  of  fungal  biomass  in  extraction  buffer  (500  mM  NaCl,  100  mM  Tris  pH8,  50 mM  EDTA,  1m  M  DTT)  and  1x  20sec  with  SDS  added  to  final  concentration  of  2%.  Protein  and  cell  debris  was  precipitated  with  potassium acetate at a final concentration of 1.4 M. DNA was precipitated with  equal  volumes  of  sample  and  2‐propanol,  followed  by  washing  with  70%  ethanol, and finally resuspended in water.  Two  fungal  primers  ITS1  (5’  TCCGTAGGTGAACCTGCGG  3’)  and  ITS2  (5’  GCTGCGTTCTTCATCGATGC  3’)  that  match  the  conserved  18S  and  5.8S  rRNA  genes,  respectively,  were  used  for  the  amplification  of  the  non‐coding  IST1  region  [12,  13].  Approx  100  ng  genomic  DNA  was  used  as  template  in  a  polymerase  chain  reaction  with  1  U  proof  reading  WALK  polymerase  (A&A  Biotechnology), PCR buffer (50 mM Tris pH 8, 0.23 mg/ml BSA, 0.5% Ficoll, 0.1  mM cresol red, 2.5 mM MgCl2), 0.2 mM of dNTP, 0.4 µM of each primer ITS1 and  ITS2.  Using  a  thermocycler  (BioRad),  an  initial  denaturation  step  (94C,  2min)  was  followed  by  35  cycles  of  denaturation  (94C,  30  sec),  annealing  (60C,  30  sec),  and  elongation  (72C,  1  min),  and  a  final  elongation  step  (72C,  2  min)  following  the  last  cycle.  All  products  were  checked  by  gel  electrophoresis.  Depending on the purity of the sample, either GelOut or CleanUp was performed  (EZNA kits from Promega) according to the manufacturer’s instructions.   DNA  sequencing  was  performed  by  either  MWG  Eurofins,  Germany  or  Starseq,  Germany,  directly  sequencing  the  PCR products  with  the ITS1 or  ITS2  primer. The sequence data was submitted to the GenBank NCBI nucleotide blast  search database for fungal identification.  2.4 Molecular phylogeny 

This  study  comprises  fungal  samples  from  many  different  sources,  including new isolations and fungi from our “in house” fungal collection. Table 1  specifies the stain numbers, identity, identification method, origin, and reference  of each sample. New fungal isolates were from soil and decaying wood samples,  isolated by multiple transfers on potato broth agar (PDA) plates supplemented  with  50  ppm  chloramphenicol  and  50  ppm  kanamycin,  incubated  at  room  temperature.  Samples  isolated  in  this  work  were  all  identified  by  ITS  sequencing, using the method described below. All fungi were grown on potato  dextrose  agar  (PDA,  Sigma)  at  room  temperature  and  maintained  in  10  %  glycerol at –80 °C.  The following aspergilli reference strains were kindly donated by Professor  Jens C. Frisvad, Technical University of Denmark (DTU): A. niger CBS 554.65T, A.  homomorphus  CBS  101889T,  A.  aculeatinus  CBS  121060T,  A.  aculeatus  CBS  172.66T, A. uvarum CBS 121591T, and A. japonicus CBS 114.51T.   2.2 Beta‐glucosidase screening  For beta‐glucosidase activity screening was carried out in a Falcon tube set‐ up  where  three  0.5x0.5cm  squares  were  cut  from  PDA  plates  with  7  days  old  single fungal strains and incubated in 10 ml of media shaking (180 rpm) at room  temperature for another 7 days. The media was composed of 20g/l wheat bran  (Finax),  20g/l  corn steep  liquor  (Sigma),  3g/l  NaNO3,  1g/l K2HPO4,  0.5  g/l KCl,  0.5 g/l MgSO47H2O, 0.01 g/l FeSO47H2O. The samples were centrifuged at 10,000  rpm for 10 minutes and the supernatants were subsequently assayed for beta‐ glucosidase activity and protein content. 

Phylogenetic  analysis  of  the  ITS1  region  of  the  fungus  AP  and  different  aspergilli  was  carried  out  as  described  by  Varga  et  al.  [14]  and  Samson  et  al.  [15]. ClustalW multiple alignment was used for sequence alignment and manual  improvement  of  the  alignment  was  performed  using  BioEdit  (http://www.mbio.ncsu.edu/BioEdit/bioedit.html).  The  PHYLIP  program  package  version  3.69  [16]  was  used  for  preparation  of  phylogenetic  trees.  The  distance matrix of the data set was calculated based on the Kimura method [17]  using  the  program  “Dnadist”.  The  phylogenetic  tree  was  prepared  by  running  the  program  “Neighbor”  using  the  neighbor‐joining  method  [18]  to  obtain  an  unrooted  trees.  Talaromyces  emersonii  was  defined  as  the  outgroup  in  the  program  “Retree”,  and  finally  the  tree  was  visualized  using  the  program  TreeView  (win32)  [19].  Bootstrap  values  [20]  were  calculated  by  running  the  program  “Seqboot”  to  produce  1000  bootstrapped  data  sets  from  the  original  data set. Again, “Dnadist” with the Kimura method was used to prepare distance  matrices  of  the  multiple  data  sets,  and  “*Neighbor”  with  the  neighbor‐joining  method to obtain unrooted trees of the multiple data sets. Finally, the bootstrap  values  were  obtained  from  the  consensus  tree  which  was  identified  by  the  majority‐rule consensus method by running the program “Consense”.  2.5 Strain AP, culture conditions, and enzyme extract preparation  The  fungal  strain  AP  was  grown  on  potato  dextrose  agar  (Sigma)  for  sporulation. Spores from one  petri  dish  were harvested after 7  days of  growth  using sterile water. The heavy spore suspension was filtered through Miracloth 

Research paper II  ‐ II.2 ‐   

 The rate of denaturation.  2.65  to  7.  and  the  supernatant  filtered  through  Whatman  filter  paper.7 Kinetic studies  For  performing  Michaelis‐Menten  kinetics    beta‐glucosidase  activity  was  measured  as  described  above.25  g/l  yeast  extract.9 pH and temperature profile  For  testing  the  thermostability  of  the  enzyme  extract.5L  vs. using triple determinations.  2.0 mg/l CoCl2 6H2O) in a 500 ml Erlenmeyer flask.  aliquots  of  the  extracts  were  incubated  in  PCR  tubes  in  a  thermocycler  with  temperature  gradient  option  at  12  different  temperatures  from  48.3 ‐    .  The  remaining  activity  (glucose  tolerance)  was  measured spectrophotometrically by release of pNP at 50°C reaction conditions. was  calculated  as  the  slope  of  a  semi‐logaritmic  plot  of  remaining  activity  vs.  Two  ml  of  the  spore  solution  was  inoculated  into  200  ml  seed  medium  (2. 100 µl sample was placed on  ice every 5 minutes. kD.  Triple  determinations were performed.  2.0°C  for  different  time  periods  (0‐4  hours)  followed  by  assaying  the  activity  at  50°C  with  5  mM  pNPG in Na‐Citrate buffer pH 4. After 7 days incubation.8  to  a  concentration  of  3.  15  µl  sample  and  150  µl  substrate  with  the  different  glucose concentrations were incubated at 50°C for 10 minutes in PCR tubes in a  thermocycler.  and after another 1 fold dilution with 100 mM NaOH.4%). the samples were analyzed  at  Dionex  ICS3000  using  gradient  elution:  0‐30%  eluent  B  in  26  minutes  followed by 2 minutes washing with 50% eluent B (0.  acquiring  and  interpreting  data  with  the  Chromeleon  software  (Dionex). The  activity  was  calculated  by  the  amount  of  cellobiose  being  hydrolyzed.  (Andwin  Scientific).  1.  10  µl  samples  were  run  on  a  CarboPac  PA1  column  with  100  mM  NaOH as eluent A and 0. 0.  Specific  beta‐glucosidase  activity  was  measured  using  two  different  substrates:  pNPG  and  cellobiose.  The  pretreated  bagasse  was  hydrolyzed  at  5%  dry  matter  (DM)  with  a  total  enzyme  load  of  10  mg  protein  per  g  DM.0 mg/l FeSO4.11 Hydrolysis of pretreated bagasse  Pretreated  bagasse  was  kindly  provided  by  BioGasol  ApS. Incubation was carried out in large  flat boxes (20 cm x 20 cm x 5 cm) in order to allow a large surface area where  the  fermentation  medium  had  a  height  of  approx.  For  testing  the  pH  optimum  of  the  enzyme  extracts.  cellobiose. shaking at 160 rpm. 557 ml Czapek liquid (3 g/l NaNO3.5L  was  assayed  with  AZO‐ CMC as described by the manufacturer (Megazyme).  2.7  µg/ml. The extract was  centrifuged  at  10.  0.  ‐pentaose.8  as  substrate  and  glucose  concentrations  ranging  from  0‐120  mM.1 mM.000  g.4 g/l (NH4)2SO4.  2.  enzyme  samples  were  assayed at  different concentrations  in triple  determination  to ensure  substrate  saturation  in  the  assay.  2. Samples were  assayed at  different concentrations  in triple  determination  to ensure  substrate  saturation in the assay.3 g/l MgSO4 H2O.12 Analytical equipment  Dionex  ICS3000  equipped  with  an  amperometric  detector  using  a  gold  working  electrode  and  an  Ag/AgCl  pH  reference  electrode  was  used  for  measuring  glucose. 1.5  g/l MgSO4 7H2O.  10  µl  samples were run on a BIORAD aminex HPX‐87H ion exclusion column.8 Glucose tolerance  For testing glucose tolerance.  The  hydrolysis was carried out at 50°C for 24 hours.5 M Na‐Acetate in 100 mM  NaOH) and 5 minutes re‐equilibrating with 100% eluent A (100 mM NaOH). The reactions  were further diluted 512 times and final cellobiose concentration was measured  at  Dionex  ICS3000  using  gradient  elution:  0‐20%  eluent  B  in  13  minutes  followed by 2 minutes washing with 50% eluent B (0.4 g/l CaCl2 2H2O.  ‐triose.2  mM  cellohexaose  in  50  mM  NaCitrate  buffer  pH  4.  The  glucose  concentration  was  measured  at  Dionex ICS3000 using gradient elution: 0‐20% eluent B (0.5‐20 g/l. 1.75 g/l peptone.2‐18  mM).  extract  from  strain  AP  or  Novozym  188  was  varied.8 was performed as follows: 15 µl sample and 150 µl substrate was  incubated  at  50°C  for  10  minutes  in  PCR  tubes  in  a  thermocycler. and incubated at 30°C for 2  days.  100  µl  of  the  reaction  was  transferred  to  a  tube  already  containing 100 µl 200 mM NaOH for termination of the reaction.  but  using  different  substrate  concentrations  (pNPG  0.  v. 0. 9 g corn  steep powder.  ranging  final  glucose  concentrations  of  0‐280  mM. The  samples  were  centrifuged  and  supernatants  filtered  through  0. 2.  0.8  and  enzyme  diluted  in  50  mM  NaCitrate  buffer  pH  4.  ranging  0‐100%  of  one  compared  to  the  other.  and  with  an  enzyme  dilution  that  ensured  substrate  saturation  was  reached  within  this  range.  and  cellodextrins  by  ion  exchange  chromatography.  The  bagasse was pretreated using a steam explosion method with addition of oxygen  (pers.0 g/l KH2PO4. 0. A substrate saturation curve was prepared by  plotting  substrate  concentration  [S]  vs.  cellobiose. testing the same pH range  2.  5  g/l  corn  steep  powder.10 Hydrolysis of cellodextrins  Hydrolysis of  cellohexaose  was  carried  out  by mixing.  Using  20  mM  cellobiose  in  Na‐Citrate  buffer  pH  4.  reaction  rate.  and  – hexaose were run at concentrations 3.  Endoglucanase  activity  of  Celluclast  1.5 g/l KCl.  50  µl  of  the  reaction was transferred to a HPLC vial already containing 1 ml 100 mM NaOH  for  termination  of  the  reaction.  as  described  earlier.125 µM ‐ 0.4 mg/l ZnSO4 7H2O. and an x‐intercept of –KM.  2.6 Beta‐glucosidase activity assays  In this work. all at a flow rate of 1  ml/min.  The  samples  were  incubated at 30°C without shaking.6 mg/l MnSO4 7H2O. 5.65‐7.8  was  performed  as  previously  described.45  µm  filters  before sugar analysis using the Ultimate 3000 HPLC (see below).    2.  incubation time. The half life was calculated as: T½ = ln(2)/kD.  Ultimate 3000 HPLC equipped with RI‐101 detector (Shodex) was used for  measuring  glucose  and  cellobiose  by  high  pressure  liquid  chromatography.  2  cm.  0. heated  to  60°C.5 M Na‐Acetate in 100  mM NaOH) in 13 minutes followed by 2 minutes washing with 50% eluent B and  5 minutes re‐equilibrating with 100% eluent A (100 mM NaOH).1‐10  mM. a y‐intercept  of KM/Vmax.  run  with  4  mM  H2SO4  as  eluent  at  flow  rate  0.  ‐tetraose. 5 mM pNPG in Na‐Citrate buffer pH 4.  comm. and the linear relationship of the data gives a slope of 1/Vmax.  they  were  assayed  at  50°C with 5 mM pNPG in Citrate Phosphate buffer at different pH ranging from  2. acquiring and interpreting data with the Chromeleon software  (Dionex).  The  reaction  was  incubated at 50°C and for a period of 30 minutes.  The  assay  using  6  mM  cellobiose  in  50  mM  Na‐Citrate  buffer pH 4.5 M Na‐Acetate in 100 mM NaOH as eluent B.  Triple  determinations were performed. 0. Solid state fermentation at approximately 30% TS was  carried out adding 100 ml of the cultivated seed medium to 1 l of a solid state  fermentation medium comprising of 343 g wheat bran (TS of 87.25.  Standards  of  glucose and cellobiose were run at concentration 0.25 as for the pNPG assay.5 M Na‐Acetate in 100 mM  NaOH) and 5 minutes re‐equilibrating with 100% eluent A (100 mM NaOH). liquid was extracted  from the medium by pressing the medium by hand using gloves.8 was  used  as  substrate  with  different  glucose  amounts  added.  in  the  ratio  1:1.5  to  67.  The  assay  using  5  mM  pNPG  in  Na‐Citrate  buffer  pH  4. 1 g/l K2HPO4.  The  ratio  amount  of  Celluclast  1.  Triple  determinations  were  performed.  cellobiose  0.8 as substrate. 100 µl 200 mM NaOH was added to terminate the reaction.  with  BioGasol  ApS).        Research paper II  ‐ II.  Denmark.6  ml/min. Gradient  runs were performed as described in the different assays.0  g/l  wheat  bran. specific activity (U/mg) is defined as units per amount of total  protein.  Bagasse  hydrolysis  was  carried  out  in  2  ml  Eppendorf  tubes  in  thermoshaker  heating  blocks. 0.  Standards  of  glucose.01 g/l FeSO4 7H2O) [21].  The  Michaelis‐Menten  constants KM and Vmax were determined from Hanes‐Wolf plots where substrate  concentration  [S]  is  plotted  against  substrate  concentration  over  reaction  rate  [S]/v.

 UP‐PCR  M. (1239) Thielavia sp. UP‐PCR  ITS  M. koningii (1211) T. Weiergang This work [8] Denmark This work Costa Rica [4] Sweden  [5] Costa Rica [4] Germany [5] Italy  [10] Costa Rica  [4] Costa Rica  [4] USA  [8] Denmark [5] Denmark This work   1 2   Identification method: M=morphology. UP‐PCR  Denmark  M.012)  Fusarium sp. fumigates (AS3‐1)  A. equiseti (1236)  F. solani (RH165) R. graminearum (1237)  F. (1220) Pestalotiopsis sp. fumigatus (AS2‐1)  A. harzianum (O7) T. fumigatus (AS11‐4)  A. cladosporioides(2. pisi (88. graminearum (IBT9203) F. spinolosum (1. Sundelin M. solani (AH‐1) R. fumigatus (AS11‐2)  A. acutatum (F7‐1)  C. DK  Inge Weiergang. moniliforme (1258) F.6) P. Maribo Seed. oxysporum f.(1160)  Cladosporium sp. University of Copenhagen. swiecickii or P. paneum (14) P. (AS11‐1) Trichoderma harzianum (5. Tylkowska K. Fungi included in the beta‐glucosidase screening  Identity (strain number)  Alternaria radicina (R27)  A. ITS=ITS and NCBI blast search. spinolosum (2. microsporum (AS2‐4) Spaeropsidales (1190) Stenocarpella sp.3A) P. continued Identity (strain number) F. UP‐PCR  M  M. acutatum (F5‐3)  C. (1198) Stenocarpella sp.4. Tylkowska This work This work This work Table 1. August Cheszkowski Agricultural University of Poznan. Krystyna Tylkowska.1)       ID method1  Origin  M  M  M  M  M  M  M  M  M  ITS  ITS  ITS  ITS  ITS  ITS  ITS  ITS  ITS  M  M  M.(1209)  Cladosporium sp.8) P.8. semitectum (1232) F. but identified by the person specified. viridescens (7. globosum (11.2) P.001) F. (1178)  Fusarium sp. acutatum (SA2‐2)  C. acutatum (Lupin1A)  C.015)  F.4kont)  Cladosporium sp. microsporum (AS1‐1B) R.4 ‐    . solani (ST‐11‐6) R. UP‐PCR  Denmark  ITS ITS ITS ITS ITS ITS ITS M M M ITS M M M M Denmark  Costa Rica  [6] Costa Rica  [6] Not known  T. UP‐PCR  ITS  Reference2      Poland  Poland  Jamaica  Denmark  Denmark  Costa Rica [8] Costa Rica [4] Costa Rica [4] Costa Rica [4] Denmark I. spinolosum (9. avenaceum/trincinctum (1. UP‐PCR= PCR finger printing  Where names are found instead of reference numbers. fumigatus (AS11‐3)  A.3B) P. graminearum (NRRL31084)  ID method1  Origin  M M ITS ITS ITS M ITS ITS ITS ITS ITS ITS ITS ITS ITS ITS ITS ITS M ITS M M M M ITS Reference2  K. moniliforme (1247) F.  Table 1. niger (Hj1)  A. UP‐PCR  M.3. Weiergang Costa Rica [4] Costa Rica [4] Costa Rica [4] Costa Rica [4] Denmark This work Denmark This work Denmark This work Denmark This work Denmark This work Denmark This work Denmark This work Denmark This work Denmark This work Costa Rica [4] Costa Rica [4] Japan  Japan  Japan  Japan  Japan  USA  Japan  Jamaica  Jamaica  Jamaica  [9] [9] [9] [9] [9] [9] [9] This work This work This work Costa Rica  [4] Jamaica  Jamaica  Jamaica  Jamaica  Jamaica  Jamaica  Jamaica  Jamaica  Denmark  This work This work This work This work This work This work This work This work This work  Not known  This work Jamaica  Jamaica  This work This work Costa Rica  [4] Denmark  This work Costa Rica  [4] Costa Rica  [4] Costa Rica  [4] Costa Rica  [4] Denmark  This work [5] [5] [5] T. culmorum (IBT9615)  F.2) P. paneum (2. terreus (AS9‐2)  Chaetomium aureum (1165)  C. virens (I10) T.4) Pestalotiopsis sp. UP‐PCR  M  M. (1214) Stenocarpella sp. (1259)  A.(AS1‐2)  Amorphothea resinae (Anja)  Aspergillus sp (AP)  Aspergillus sp. UP‐PCR  M  M  ITS  ITS  ITS  M  M  M  M  ITS  ITS  M  M. (1208)  C. chrysogenum or P. (3.1)  F. (1168) Penicillium sp. gloeosporioides (2133A)  Coprinopsis cinerea (AS2‐2)  Dreshlera sp. solani (GM10) Binuclear Rhizoctonia (S21) Binuclear Rhizoctonia (SN‐1‐2) Rhizopus microsporum (AS1‐1A) R.   Prof. niger (IBT25747)  A. commune (2.1)  Clonostachys rosea (IBT9371)  C. oxysporum (1244) F. chrysogenum or P. Weiergang  I. raistrickii (11. spinolosum (9. terreus (AS4‐1)  A. viride (IBT8186) T. UP‐PCR  Denmark  M. koningii (CBS850. fumigatus (AS9‐7)  A. Poland   Thomas Sundelin. semitectum (1242) Nigrospora sp. fumigatus (AS2‐3)  A. (1195)  Cladosporium sp. fumigatus (AS12)  A. Sundelin Denmark  Denmark  Jamaica  [7] T. commune (11. Sundelin This work Costa Rica [4] Costa Rica [4] Costa Rica [4] Costa Rica [4] Jamaica  This work Costa Rica  [4] Denmark  Denmark  Denmark  Norway  I. (1226) Rhizoctonia solani (CS96) R. Nordzucker AG  Research paper II  ‐ II. radicina (R28)  Alternaria sp. (1219) P. harzianum (IBT9385) T. the fungal strains have not previously been published.68) T. rosea (Gr3)  C. (3. rosea (Gr5)  Colletotrichum acutatum (9955)  C.1) T.sp.5) P.

 (1259) A.1  U/ml).5) P.2) P. rosea (Gr5) Colletotrichum acutatum (9955) C.  with  a  few  strains  showing   remarkably better  results  (Fig. spinolosum (9. paneum (2. harzianum (IBT9385) T. chrysogenum or P. semitectum (1232) F. acutatum (SA2‐2) C.8) P.  the  stain  Hj1  showing  approximately  two  times  the  activity of strain F1. solani (GM10) Binuclear Rhizoctonia (S21) Binuclear Rhizoctonia (SN‐1‐2) Rhizopus microsporum (AS1‐1A) R. fumigatus (AS11‐3) A. rosea (Gr3) C.  mainly  belonging  to  the  Ascomycota  phylum.68) T. oxysporum (1244) F.8.015) F. with one unit (U)  of enzyme activity defined as the amount of enzyme needed to hydrolyze 1umol pNPG in 1 minute. fumigatus (AS2‐1) A.  The  percentage  identity  of  strain AP ITS1 sequence compared to selected aspergilli in the  tree  confirm  that  strain  AP  is  significantly  different  from  the  others  (Fig. microsporum (AS2‐4) Spaeropsidales (1190) Stenocarpella sp. Results  3.3.  2B). fumigatus (AS12) A.  though  for  about  35%  of  the  assayed  fungi  the  activity  was  negligible  (<0. (1198) Stenocarpella sp. graminearum (NRRL31084) F.5 ‐    . avenaceum/trincinctum (1. chrysogenum or P.3A) P. covering 19 different  fungal  genera. culmorum (IBT9615) F.1) Clonostachys rosea (IBT9371) C.1) F.(1209) C. (1239) Thielavia sp.  3. acutatum (F5‐3) C.  almost  as  far  from  them  as  the  outgroup  Talaromyces  emersonii. spinolosum (9. spinolosum (1.sp. viride (IBT8186) T.  indicated  that  the  strain AP might belong to an unknown species.  a  few  Fusarium.  2A).    Some  genus  tendencies  were  found. paneum (14) P.  Where  several  strains belonging to same species were assayed. fumigatus (AS11‐4) A.(1160) Cladosporium sp.  and  the  location  of  strain  AP  on  a  separate  branch  in  the  phylogenetic  tree. with  strain    U/ml 6 AP  reaching  more  than  ten  times  greater  activity  than  the  average of all the stains assayed. (1208) Cladosporium sp.4. terreus (AS4‐1) A.)  and  strain  Hj1  (identified as an A. (1226) Rhizoctonia solani (CS96) R.  and  Trichoderma  showing  greatest  beta‐ glucosidase  activity  at  the  assayed  conditions. 1). spinolosum (2. semitectum (1242) Nigrospora sp.012) Fusarium sp.4kont) Cladosporium sp.2) P.  Strain  AP  showed  to  be  phylogenetically  placed  on  its  own  branch  far  from  the  other  aspergilli.1)   Fig. cladosporioides(2. solani (ST‐11‐6) R.  [15].  Research paper II  ‐ II. commune (2. koningii (1211) T. raistrickii (11. solani (AH‐1) R. oxysporum f. terreus (AS9‐2) Chaetomium aureum(1165) C. (1220) Pestalotiopsis sp. graminearum (IBT9203) F.001) F. the variation  at  species  level  was  in  most  cases  insignificant. globosum(11. microsporum (AS1‐1B) R.  together  with  other  selected  aspergilli  in  the  section  Nigri  based  on  the  work  by  Samson  et  al. solani (RH165) R. fumigates (AS3‐1) A. (1168) Penicillium sp.  These  best  hits. (AS11‐1) Trichoderma harzianum (5.  3. fumigatus (AS11‐2) A. virens (I10) T.  with  Aspergillus. radicina (R28) Alternaria sp. acutatum (Lupin1A) C.(AS1‐2) Amorphothea resinae (Anja) Aspergillus sp (AP) Aspergillus sp. equiseti (1236) F.  Penicillium.    5 4 3 2 1 0 Alternaria radicina (R27) A.3B) P. (3. commune (11.  except  for  A. 1 Extracellular beta‐glucosidase activity of screened fungi grown in simple submerged fermentaion. (1178) Fusarium sp. fumigatus (AS2‐3) A.  were  used  to  prepare  a  phylogenetic  tree  (Fig. fumigatus (AS9‐7) A. niger) showed significantly greater activity  than  all  other  strains  assayed at  these  conditions. swiecickii or P. (1195) Cladosporium sp. niger (IBT25747) A.2  Identity  of  the  prominent  beta‐glucosidase  producing  Aspergillus sp. moniliforme (1247) F. (3.8S rRNA genes  were used for the amplification of the non‐coding ITS1 region. graminearum (1237) F. (1219) P.6) P. koningii (CBS850. moniliforme (1258) F. pNPG was used as substrate in the assays. pisi (88.  The  best  hits  obtained in  a GenBank  NCBI  nucleotide  blast  of  the ITS1 sequence of strain AP were different black aspergilli. All produced extracellular  beta‐glucosidase. gloeosporioides (2133A) Coprinopsis cinerea (AS2‐2) Dreshlera sp. niger (Hj1) A.  were screened for extracellular beta‐glucosidase activity using  pNPG  as  substrate  (Table  1). harzianum (O7) T. (1214) Stenocarpella sp.  Strain  AP  (identified  as  an  Aspergillus  sp.1) T.  niger  where  a  great  variation  was  observed  within  the  two  strains.  Primers matching the conserved 18S and 5. acutatum (F7‐1) C.  This.4) Pestalotiopsis sp. viridescens (7.1 Beta‐glucosidase activities in broad screening  Eighty six filamentous fungal strains.  The  screening  showed  a  great  variety  in  activity  levels.

uvarum  CBS 121591* Strain AP   Fig. Beta‐glucosidase activity of extracts from selected aspergilli grown in  simple  submerged  fermentation  (*=type  strain).  Numbers  above  the  branches  in  tree  are  bootstrap  values.  The  pH span  of  strain AP  beta‐glucosidase  was  examined  using  pNPG  as  substrate.  Celluclast  1. pNPG activity  of  6.  0.8‐4.51* A.5L  for  complete  hydrolysis  of  cellulosic  biomasses.  3)  and  specific  activity  of  3.  including  strain  AP.  Relative  to  the  other  aspergilli  tested. with an optimum around pH 4.02  substitutions  per  nucleotide.niger  CBS 554.  Solid state fermentation was chosen to obtain as concentrated  an extract as possible.65* A.  A.aculeatinus  CBS 121060* A. 3.66* A.  3.  As  the  enzyme  extract  of  strain  AP  is  intended  for  use  in  combination  with  Celluclast  1.  Within  pH  4.  However. niger was specifically  included as this fungus is a known and industrially used beta‐ glucosidase  producer  [22].3 Aspergillus screening  The beta‐glucosidase activity of the prominent Aspergillus  sp.  4).2 (Fig.  using  T.  2.  U/ml Research paper II  ‐ II.  but  were  in  this  study  used  for  the  comparison  of  the  beta‐glucosidases  of  the  crude  enzyme        Fig.  One  unit  (U)  of  enzyme  activity is defined as the amount of enzyme needed to hydrolyze 1umol pNPG  in 1 minute. Within the pH range 3.8 the activity stays above 85% of  maximum.    7 6 5 4 3 2 1 0 A.5‐6  Celluclast  1. A.6 ‐    .  3).7 U/mg  total  protein  were  obtained.8  generally  used  in  hydrolysis  experiments  with  Celluclast  1.  Its  profile  is  very  similar to Novozym 188.5L  cellulase  activity.  there  is  no  definite  conclusion  to  whether  the  difference in specific activity (U/mg protein) is due to the solid  state fermentation favoring the expression of specifically beta‐ glucosidase proteins.  At  the  conditions  tested.  and  Cellic  CTec  (Novozymes  AS.  Numbers  in  matrix  are percentage identity between the ITS1 region of the different strains.  emersonii  as  out  group.homomorphus  CBS 101889* A.5L  and  Novozym  188  is  therefore  also  valid  for hydrolysis with AP extract beta‐glucosidases.  3. With the solid state fermentation.japonicus  CBS 114.  pH  4.5L.6  U/ml  (Fig.4  Potential  of  strain  AP  enzyme  extract  compared  with  commercial enzymes  A  solid  state  fermentation  extract  of  the  strain  AP  was  compared  to  the  commercially  available  Novozym  188.  niger  data  is  placed  as  the  column  furthest  from  strain  AP  as  it  is  the  most  distantly  related  strain  in  this  Aspergillus  screening.5L  activity stays  above  90%  of  maximum  activity  measured  (Fig.  4).  AP  produces  significantly  greater  amount  of  beta‐ glucosidase  activity  (Fig.  Neighbor‐joining  phylogenetic  tree  (bottom)  and  homology  matrix  (top)  of  ITS1  region  sequence  data  of  black  aspergilli. a  pNPG activity of 105 U/ml and a specific activity of 5.  Bar.aculeatus  CBS 172.  strain  AP  is  therefore  more  specialized  towards beta‐glucosidase productions at the tested conditions. In the previous screening.  The  volume  based  activity  is  naturally  increased  as  the  water  content  of  solid  state  is  severely  reduced  compared  to  submerged  fermentation.  (strain  AP)  was  compared  to  neighbor  aspergilli  in  the  submerged  fermentation  set  up  using  wheat  bran  as  growth  medium as described in the screening.  The  protein  levels  (data  not  shown) in the assayed extracts did not vary much compared to  the  difference  seen  in  enzyme  activity.  the  working  pH  must  match  the  pH  profile  of  Celluclast  1.  Enzyme  kinetics  are  preferably  carried  out  on  pure  enzyme  preparations.  Denmark).1  U/mg  total  protein  (data  not  shown)  were  obtained  for  the  submerged  fermentation of strain AP.

5  22. With regards to cellobiose.  pH  profile.  while  with  pNPG.  The  maximum  activity.  measuring  the  specific  activity  at  different  substrate  concentrations.  4.  respectively.   Activity as % of max (A) 5mM pNPG substrate 100% Remaining activity 80% 60% 40% 20% 0% 0 20 40 60 80 Strain AP Novozym 188 Cellic 100 120 140   Glucose concentration (mM) (B) 20 mM cellobiose substrate 100% Remaining activity 80% 60% 40% 20% 0% 0 20 40 60 Glucose concentration (mM) 80 Strain AP Novozym 188       Fig.  however.  With  regards  to  cellobiose.  Beta‐glucosidase  activity  of  Strain  AP  and  Novoym  188  at  different  pH  measured  on  pNPG.69  Product  inhibition  was  found  to  be  substrate  dependent.  was.  while  evidence  of  substrate  inhibition  or  transglycosylation  was  found  at  higher  concentrations.  remaining  beta‐glucosidase  activity  at  different  inhibitor  (glucose)  concentrations  relative  to  activity  measured  without  inhibitor. Novozym 188.  B:  cellobiose  as  substrate.  Product  inhibition.  but  with  strain AP being significantly better than Novozym 188.  the  beta‐glucosidase  activity  of  strain  AP  remained  greater  than  80%  at  product  concentrations  12  times higher than the substrate concentration.  Any  parameter  expressed  per  amount  of  protein  was  always  total  protein  content  in  the  extract  or  commercial  enzyme  preparation. The activities of strain AP. no  substrate  inhibition  was  observed  within  the  substrate  concentrations  tested.  A:  pNPG  as  substrate.  seen  by  a  decrease  in  reaction  rate  with  increased  substrate  concentration (data no shown).  Endoglucanase  activity  of  Celluclast  1.  activity  measured  by  release  of  pNP.    Vmax (U/mg)  KM (mM)  Strain AP  Novozym 188  Cellic CTec  11.  highest  for  Cellic  CTec.  were  therefore  only  determined  for  cellobiose.  5.  substrate  concentration.  the  profile  of  substrate  inhibition  was  identical  for  strain  AP  and  Novozym  188  when  using  cellobiose  as  substrate.  110% 100% 90% 80% 70% 60% 50% 40% 30% 20% 10% 0% 2 3 4 5 pH 6 Stain AP Novozym 188 Celluclast 1.  Overall. Using pNPG  as  substrate.  especially for strain AP beta‐glucosidases (Fig.    Research paper II  ‐ II.  Vmax.  an  activity  drop  to  around  80%  was  found for both strain AP and Novozym 188 when the product  and  substrate  occured  in  equal  concentrations.  The  enzyme  extract  from  strain  AP  and  the  commercial  preparation  Novozym  188  had  similar  affinity  for  cellobiose  and values being slightly better than Cellic CTec (Table 2).  while  the  activity  of  Novozym  188 at this product‐substrate ratio had dropped to just below  40%.  strain  AP  beta‐glucosidases  performed  much  better  at  high  glucose  concentrations  than  Novozym  188.  strain  AP. and  Cellic CTec with cellobiose as substrate for MM kinetics study. 5).9 1. cellobiose.  and  12x  the  substrate  concentration).5L  at  different pH measured on AZO‐CMC.  the  hydrolysis of pNPG only followed MM kinetics at low substrate  concentrations. and Novozym 188  was  calculated  to  reach  half  the  maximum  activity  at  concentrations  180.  activity  measured  by  decrease  in  cellobiose  concentration.3 7.    Kinetic  analysis  was  performed  on  both  pNPG  and  cellobiose.  Novozym  188.5L 7 8            Fig. and not just relying on pNPG data.  By  plotting  reaction  rate  vs.09  1.  and  Cellic  CTec.  This  glucose  inhibition  study  demonstrated  the  importance  of  testing  the  true substrate.06  1.  and  60  mM  glucose  (equal  to  36x.7 ‐    .  23x. Cellic CTec was  slightly  lower  (approx  75%).  with  no  specific  knowledge  of  how  large  a  fraction  that  was  beta‐glucosidase proteins.  extract  of  strain  AP  and  the  commercially  available  enzyme  preparations  Novozym  188  and  Cellic  CTec. Cellic CTec.  Vmax  and  KM. the  lower  the  KM  values  the  better  the  affinity.  it  was  found  that  for  all  three  samples.  The  MM  kinetics  parameters.  115.     Table 2 Kinetic properties of strain AP.

  indicating  a  combination  of  cellobiohydrolase  and  beta‐glucosidase  activity.  Strain  AP  beta‐glucosidases  and  Novozym  188  beta‐ glucosidases  are  compared  on  total  protein  amount  basis. 180 min for Novozym 188.9°C (D) 4 3 2 ln(T½) 1 0 56 60 Strain AP Novozym 188 Cellic CTec ‐1 52 ‐2 0 1 2 3 4 Incubation time (h) ‐3 64 68 1 2 3 4 Incubation time (h) 0   1 2 3 4 Incubation time (h)   Temperature (°C)   Fig. Cellic  CTec  showed  continuously  increase  in  both  cellobiose  and  glucose.  Celluclast  1.  Celluclast  1.3°C 67.0°C (C) Cellic CTec 100% % activity remaining 80% 60% 40% 20% 0% 53.9°C 64. defined  by  the slopes  of  the  lines in  a semi‐ logaritmic  plot  of  the  remaining  activity  vs.5  to  67.7°C. 6A‐C).  The  inactivation  roughly  followed  first  order  kinetics.  and  (C)  Cellic  CTec.  At  60.  The  calculated  half‐life  of  strain  AP  at  60.  They  do  not  continuously  cleave  one  bond  after  another  upon  capturing  the  substrate.3°C 67.5L.  time  for  the  different temperatures.2°C 60.  6.8 ‐    .9°C  for  strain  AP.  Evidence  of  endo‐activity  or  cellobiohydrolase  activity  was  found.  The  results  suggested  that  the  beta‐glucosidases  act  by  capturing  the  substrate.  Cellodextrins were used to make a hydrolytic time course  study  of  strain  AP  extract.9°C (Fig.  Novozym  188.  65%  of  the  activity  remained  for  strain  AP  beta‐ glucosidases  after  4  hours  of  incubation. The  thermostability  of  the  enzymes  was  examined  at  temperatures  ranging  from  48.9°C 64.  Endoglucanase  activity  was  most  likely present too.  Thermostability  is  evaluated based on the remaining activity after 0‐4 hours of incubation at different temperatures relative to the activity without incubation.  with  a  cellopentaose  and  glucose  concentration  increase  as  the  cellohexaose  concentration  decreased. As the only sample. To reach a half‐life of  180 min for Cellic CTec.5L  mainly  possess  cellobiohydrolase  and  endoglucanase  activity.  and  (C):  Time  course  of  thermal  inactivation  of  the  beta‐glucosidases  of  (A)  strain  AP.  and  lacking  sufficient  beta‐glucosidase  activity  as  the glucose concentration did  not increase. strain AP beta‐ glucosidases were clearly more stable than Novozym 188.5L.  On  the  contrary. (D) Semi‐logarithmic plot  of calculated half life at different temperatures.4°C. and Cellic CTec. This total  enzyme  dosage  was  used  for  optimal  enzyme  ratio  Research paper II  ‐ II.  kD.2°C 60.2°C 60.  was  66.  as  the  cellobiose  concentration  went  up  relatively  fast  compared  to  the  cellotetraose  and  cellotriose.  (B).4°C 55.  and  58. and the half‐life was calculated as T½ =  ln(2)/kD.  Meanwhile. At temperatures ≥60°C.  the  temperature  that  gave  a  half‐life  of  1  hour. This was compared  with  hydrolysis  data  of  Novozym  188  and  Celluclast  1.  seen  by  the  immediate  increase  in  cellobiose  and  cellotriose. and  Cellic  CTec  was  showing  a  lack  of  performance  as  it  was  severely inactivated even within the first half hour (Fig.  Novozym  188  only  showd  beta‐glucosidase  exo‐activity.  Pretreated  bagasse  was  hydrolyzed  by  strain  AP  beta‐ glucosidases  combined  with  Celluclast  1.  and  Cellic  CTec  (Fig. The data for  each enzyme preparation form a straight line.    A  dosage‐response  plot  of  hydrolysis  of  5%  DM  pretreated  bagasse showed a leveling off in glucose yields at total enzyme  dosages greater than 10mg/gDM (data not shown).  with  the  only  significant  change  over  time  being  glucose  and  cellopentaose  increase  as  cellohexaose  decrease. identified by the formation of cellotriose.0°C (B) Novozym 188 100% % activity remaining 80% 60% 40% 20% 0% 58.8°C 58. At temperatures up to 58°C there was no significant  difference  between  strain  AP  and  Novozym  188  in  terms  of  stability.  Strain  AP  enzyme  extract  showed  clear  exo‐activity. temperature at which the half life is one hour.  the  cellotetraose  and  cellotriose  concentrations  increased  too.7°C 62. and the thermal  activity  number.  and  release  the  products.7°C 62.  Novozym  188.8°C 66. both were fairly stable throughout the four hours of  incubation  (data  not  shown). but the cellobiose  concentration increases continually.8°C.8°C 66.  (B)  Novozym  188.  7).  Less  rapidly.  The x‐axis intercept indicates the thermal activity number.  with  the  rate  constants  of  denaturation.  (A). the temperature should be lowered to  around the tested 55. 6D).  cleave  the  glycosidic  bond.7°C  was  440 min vs.5L  to  investigate  its  capabilities on a lignocellulosic substrate. 6A‐C).  the  beta‐ glucosidases  of  Cellic  CTec  were  much  more  sensitive  to  temperature increases.  while  only  33%  activity  remained  for  Novozym  188.7°C 62. respectively.  63.0°C  using  pNPG  as  substrate. while for strain AP the temperature  should be raised to around the tested 62.  (A) Strain AP 100% % activity remaining 80% 60% 40% 20% 0% 0 58.  The  calculated half‐lives at different temperatures were plotted in  a semi‐logarithmic plot vs.8°C. temperature (Fig.

  there  are  not  many  examples on screening of fungal strains belonging to different  species  for  beta‐glucosidase  activity.  Research paper II  ‐ II.  Table  2)  compared  to  Novozym 188. thus found beta‐glucosidase that    Fig.5L 75 70 65 60 55 50 45 40 35 30 25 20 15 10 5 0 Cellic CTec 20 30 Conc (uM) 15 25 20 15 10 Conc (uM) Conc (uM) 10 10 5 5 5 0 0 10 20 Time (min) 30 0 0 10 20 Time (min) 30 0 0 10 20 Time (min) 30 Conc (uM) 15 0 10 20 Time (min) 30   Fig.  The present work included a broad screening of 87 fungal  strains collected from soil and decaying wood samples as well  as was from an in house collection of fungi kindly donated by  various  scientists.  with  especially  fungi  known  to  be  industrial  producers  of  these  enzymes  for  cellulose  hydrolysis. showing a clear difference in the mode of action.  To  our  knowledge.    Recently.  illustrating  the  possibility  of  substituting  the  commercial  enzyme  preparation  with  an  extract  from  our  newly  isolated  Aspergillus  strain  AP. The greatest yields were found with  approximately  20%  Novozym  188  (80%  Celluclast  1.5L  and  Strain  AP  extract or Novozym 188.  In  this  study. 7.  and  pharmaceuticals.  the  ratio  of  Celluclast  1. Novozym 188.    4.  an  enzyme  preparation  containing  all  three  components  has  been  released  into  the  market.  Costs  related  to  enzymatic  hydrolysis  make  this  step  a  bottle  neck  in  the  process  of  creating  a  sugar  plat  form  for  biofuels. Discussion  Traditionally. G4=cellotetraose.  determination.  Hydrolysis  of  bagasse  using  different  enzyme  ratios  of  Strain  AP  or  Novozym 188 relative to Celluclast 1. G3=cellotriose.  Beta‐glucosidases  are  widely  distributed  in  nature.5L) (Fig.  8.5L  (Novozymes  A/S).  we  present  a  prominent  fungal  beta‐glucosidase  producer  naturally  producing  an  enzyme  cocktail  with  better  beta‐glucosidases  compared  to  the  commercial  preparation  Novozym  188  and  markedly  better  thermostabily  than  the  commercial  beta‐ glucosidase  containing preparations. Generally.  respectively  [23]. G5=cellopentaose.  G2=cellobiose.  contributing  with  beta‐glucosidase  activity.  Sternberg  et  al. G6=cellohexaose. and Cellic CTec.  chemicals.  the  glucose  yields  were  higher  when  using  strain  AP  extract  compared  with  Novozym  188.5L.  Cellic  CTec  (Novozymes  AS.5L.5L)  and  15% strain AP extract (85% Celluclast 1.  Denmark).  therefore  there  is  a  need  for  more  efficient  enzymes.  both  in  terms  of  reaction  rates  and  stability  [23]. 8). G1=glucose. Celluclast 1.  two  commonly  used  enzyme  preparations  that  supplement  each  other  in  the  hydrolysis  of  cellulosic  biomasses  are  Novozym  188  and  Celluclast  1.  and  endoglucanase  and  cellobiohydrolase  activity. Hydrolysis af cellohexaose by Strain AP extract. Novozym 188 and  Cellic  CTec.  25 Strain AP 20 G1 G2 G3 G4 G5 G6 25 Novozym 188 40 35 Celluclast 1.9 ‐    .  These  results  for  bagasse  hydrolysis  correlated  well  with  the  fact  that  the  beta‐glucosidases  of  strain  AP  extract  had  a  higher  reaction  rate  on  cellobiose  (Vmax.  [3]  screened 200 fungal strains.

 and especially in this study it was additionally  evident  in  relation  to  product  inhibition. 32].g. KM. 1).  especially  A.  Fusarium.  which  was  also  concluded  by  e.  The  beta‐ glucosidases  of  strain  AP  compared  to  Novozym  188  only  showed low inhibition by glucose using pNPG as substrate. black Aspergilli were found to be superior in terms of  beta‐glucosidase  production  [3].8.  the  expression  levels  of  beta‐glucosidase  at  the tested conditions were very consistent.  To  compare  activities.  wheat  bran  was  used  as  substrate  in  a  submerged  fermentation. The supernatants  were tested for  beta‐ glucosidase  activity  using  pNPG  at  50C  pH  4.   Product  inhibition  is  a  common  phenomenon  with  beta‐ glucosidases. with pNPG the saturation point  could  not  be  determined  as  substrate  inhibition  was  the  dominating  factor  at  high  substrate  concentrations  which  correlates  with  studies  carried  out  by  Dekker  [22]  and  Eyzaguirre  et  al.  niger.  The  enzyme  preparations  were  evaluated  on  basis  of  total  extracellular  proteins.  5).  Screening  for  general  cellulase  activities  have  included  beta‐glucosidase  activities  in  a  few  cases  [25‐28].  however.  36].  and  other  strategies  for  obtaining  beta‐glucosidases  have  been  employed  such  as  screening  environmental  DNA  for  beta‐glucosidase  activity  rather  than  collecting  microbial  samples  [29].  niger  beta‐glucosidases  is  that  they  have  greater  affinity  for  pNPG  than  for  cellobiose.  with  all  classes  of  enzymes  essential  for  cellulose  degradation  having  been  found  [36].  The  beta‐glucosidase  activity  of  the  screened extract is therefore very likely the combined activity  of  several  beta‐glucosidases of  the  strain  AP.  [31]  report  similar  findings  for  other  Aspergillus  strain  beta‐ glucosidases.  which.  was  demonstrated  in  this  study.  while  that  of  Cellic  CTec  was  found  to  be  even  greater  (Table  2). Aspergilli in general have a high capacity for  producing  and  secreting  extracellular  enzymes  [35.  Khan et al.  Later. does vary amongst strains  within  this  species  [31.  pNPG  might  actually  be  a  poor  substitute  in  terms  of  assaying  for  beta‐glucosidase  activity.  niger  beta‐glucosidases.  most  common  amongst  the  A. niger (Fig.  fumigati  strains.  cellobiose.  [41]. chosen to only calculate MM  kinetics  parameters  related  to  hydrolysis  of  cellobiose  as  hydrolysis  data  of  pNPG  did  not  fit  the  MM  equation.  Within  the  A.  40‐42].  Penicillium.  which  could  potentially  mimic  substrate  inhibition  in  data  evaluation. three beta‐glucosidases from A.  Furthermore  aspergilli  strains  are  known  to  possess  several  beta‐glucosidases  that  can  have  different  relative  activities  and specificities. but  when  using  cellobiose.  Jäger  et  al.  the  option  of  the  enzyme  carrying  out  transglycosylation  by  coupling  the  glucose  product  to  a  new  pNPG  at  high  pNPG  concentrations  was  not  investigated.  The  extract  of  strain  AP  showed  greater  specific  beta‐ glucosidase  activity  than  Novozym  188.g. aculeatus  have  been  assayed  with  the  findings  that  one  has  very  weak  and  the  two  other  very  high  activities  towards  cellobiose  relative  to  pNPG  [45].  Without further  optimization.  rather  than  the  substitute.  antioxidant.  the  specific  activity  of  the  solid  state  fermentation  extract  of  strain  AP  was  able  to  compete  with  Novozym  188  in  hydrolysis  of  cellobiose.  could  supplement  the  Trichoderma  viride  cellulases  for  cellulose  saccharification.  In  this  work.  and  Trichoderma  had  the  highest  beta‐glucosidase  activity.  and  it  is  apparent that substrate affinity.  it  is  always  desired  to  perform  measurements  at  substrate saturation.  As  transglycosylation  activity  has  been  reported in several cases for different beta‐glucosidases [44] it  was speculated if the proposed substrate inhibition was rather  a  transglycosylation  reaction  at  high  product  concentrations. however. 34].5L. as it is generally known as a good substrate for  cellulase and beta‐glucosidase production [31.  with  strains  of  Aspergillus  being  the  best.  thus  aiming  at  finding  enzyme activities supplementing this enzyme preparation.  It  was  found  that  especially  strains  from  the  genera  Aspergillus. [43].  pNPG.  pNPG  is  an  easy‐to‐use substrate.  a  study  focusing  on  identification  of  acid‐  and  thermotolerant  extracellular  beta‐ glucosidase  activities  in  zygomycetes  fungi  was  carried  out  where  Rhizomucor  miehei  performed  best  [24].   Several  studies  have  been  published  on  the  kinetics  of  Novozym  188  and  A. but can be misguiding in terms of beta‐ glucosidase  performance  in  true  cellulosic  hydrolysis  conditions. This variation was not  surprising as it correlates well with publications on citric acid. We have.  These  fungal  genera  have  also  been  found  in  other  screening  programs  for  discovery  of  cellulolytic  enzymes [26.  The  importance  of  testing  such  inhibitory  effects  on  the  true  substrate.  The  effect  of  pNPG  substrate  inhibition  or  transglycosylation reaction on the measured reaction rates in  the beta‐glucosidase screening strategy was a factor that was  not taken into account. being rich  in  carbohydrates  and  protein  [33].   However. glucose being the main inhibitor.10 ‐    . e.  Generally. while great strain  variation was found in A. however.  However.  which  is  also  very strain dependent [37‐39].  and  submerged  fermentation  allows  for  easy  assaying  of  the  extracellular  enzymes of  the fungi.  and  a  proteomics  strategy  to  discover  beta‐glucosidases  from  Aspergillus  fumigatus  has  been  reported  [30].  which  are  optimal  conditions  for  Celluclast  1.  and  in  the  case  of  Research paper II  ‐ II. which can have  a  significant  influence  on  process  reaction  in  industrial  applications  [23].  in  accordance  with  or  results. It is therefore unknown how much  of  the  measured  protein  is  actually  fungal  proteins.  and  urease  production  in  A.  the  inhibition  patterns  of  the  two  enzyme preparations were similar. with the activities reaching  only 50% when twice the concentration  of glucose is present  compared  to  cellobiose  concentration  (Fig.  also  comprise  proteins  originating  from the growth medium.  niger.

  Bioconversion  of  lignocellulosic  biomass:  biochemical  and  molecular  perspectives.   [18]  Saitou  N. Taylor JW.  cellohexaose the rate by which the cellohexaose concentration  decreased  and  the  glucose  and  cellopentaose  increased  was  greater for strain AP than Novozym 188. Lubeck PS.  Aahman  J.  Hydrolysis  of  bagasse  was  here  used  to  show  that  our  enzyme  extract  from  strain  AP  supplemented  with  Celluclast  (Fig.  and  definitely  out‐competed  Cellic CTec in terms of thermostability. Professor  Henrik  Christensen.  University  of  Copenhagen  is  thanked  for  his assistance in relation to phylogeny.  Lubeck  M. 6A‐C).  Jensen  DF.  even  performed  better  than  Novozym  188  in  some  aspects. 315‐322. Its utilization for fuel production is value contributing to  the  current  processes  [47].  Frisvad  JC.  a  new  yet  unidentified  species  has  been  identified:  strain  AP..  PCR  Protocols:  A  Guide  to  Methods  and  Applications. p.1:43‐58.   [17] Kimura M.  This stain had significantly greater beta‐glucosidase potential  than  all  other  fungi  screened  and  was  shown  to  be  a  valid  substitute  for  Novozym  188.  Paaske  K.      References  [1] Beguin P. Plant Dis 2005. New York: Academic Press Inc.      Acknowledgements  The  authors  acknowledge  the  financial  support  from  Danish  Council  for  Strategic  Research.  Diagnostic tools to identify black aspergilli.  Schiller  M. New York: Cambridge  University Press. Increasing the degree  of complexity and potential amount of inhibitors.  Jensen  DF.  with  a maximum where  the  enzyme  is  actually  not at its optimum as the maximum indicates the beginning of  the  irreversible  denaturation  process  [48].  and  the  thermal  activity  number  confirmed  the  dominating  status  of  strain  AP  beta‐glucosidases  in  terms  of  thermostability  (Fig. 1990.  Two  subpopulations  of  Colletotrichum  acutatum  are  responsible  for  anthracnose  in  strawberry  and  leatherleaf  fern  in  Costa  Rica. Cellic CTec was found to be very unstable at  elevated  temperatures  observed  by  the  poor  performance  when assaying for activity after incubation above 50°C. Susca A et al.4:406‐25.  Ravnholt  KS.  J  Ind  Microbiol  Biotechnol  2008. Biotechnol Adv 2006. Lubeck M. Eur J Plant Pathol 2006.  The  authors  wish  to  thank  Professor  J.  and  temperatures tested vary.  Hicks  JB. Toth B.   Research paper II  ‐ II.5:377‐91.  Ph.  culmorum  and  F.   [16] Felsenstein J.  Noonim  P. Lubeck M. Int J Syst Evol Microbiol 2007:1925‐32.   [6] Schiller M. Can J Microbiol  1977. Perrone G.  thesis:  Characterization  of  Fusarium  moniliforme  from  maize from Costa Rica and approaches to biocontrol 1997. etc.   [9]  Lubeck  M.   [8]  Tobiasen  C.   [15]  Samson  RA. PHYLIP (Phylogeny Inference Package) version 3.  Nonribosomal peptide synthetase (NPS) genes in Fusarium graminearum.  The  time  course  of  the  inactivation  of  all  enzymes  approximately  followed  a  first  order  reaction  from  which  the  denaturation  rates  and  half‐ lives  at  the  different  temperatures  were  calculated. The Biological Degradation of Cellulose.  a  biseriate  black  Aspergillus  species  with  world‐wide  distribution.  Generally.2:107‐18.   [11]  Dellaporta SL.  Meijer  M.C. The neutral theory of molecular evolution.  Sninsky  JJ.  Vannacci  G.  Technical  University  of  Denmark  as  well  as  the  scientist  mentioned in Table 1 for all fungal strain donations.  Himmel  ME.  Bjerrum  MJ.  the  beta‐glucosidases  of  strain  AP  were  found  to have excellent temperature stability compared to Novozym  188 and  Cellic  CTec (Fig. which  relates  to  the  manufactures  instructions  of  best  performance  at  temperatures  40‐50°C  [49].  Poulsen  H.  White  TJ. bagasse  is  one  of  many  cellulose  containing  biomasses  of  interest  for  bioethanol  purposes. Bruns T.4:19‐21.  Plant Molecular Biology Reporter 1983. Curr Genet 2007. Lee S.   [14] Varga J.   [12] White TJ.   [13]  Kumar  R. Amplification and direct sequencing of  fungal  ribosomal  RNA  genes  for  phylogenetics.  Beta‐Glucosidase  ‐  Microbial‐ Production and Effect on Enzymatic‐Hydrolysis of Cellulose.5:452‐81. Kocsube S.  Giese  H.D.  Mycol  Res  1998:933‐43.  Frisvad.2:139‐47.  Lubeck  M.  Mikkelsen  L. Frisvad JC.   [4]  Danielsen  S. 1983. Mironenko N.  Bagasse  is  a  lignocellulosic  waste  product  from  the  sugar  cane  industry  produced  in  great  quantities in countries such as Brazil and other tropical places  [46].  8)  did  work  on  actual  lignocellulosic  material  and  was  competitive  with  Novozym  188.  Singh  S.1:25‐58.  Reese  ET.  Varga  J. Danielsen S.  Houbraken  J.  Nei  M.  Mielenz  JR. F. UP‐PCR analysis and  ITS1  ribotyping  of  strains  of  Trichoderma  and  Gliocladium  .  A  plant  DNA  minipreparation:  Version  II.  In:  Innis  MA.  This  method  of  directly  assaying  at  different  temperatures  to  determine  the  temperature  profile  is  of  no  real  use  in  terms  of  industrial  hydrolysis  as  hydrolysis  reactions  are  usually  run  for  several  hours  and  time  dependent  enzyme  degradation  will  play  a  role.  6D). Jensen DF.   [7]  Sundelin  T.  To  conclude.  Histopathological  studies of  sclerotia of  phytopathogenic  fungi  parasitized  by  a  GFP  transformed  Trichoderma  virens  antagonistic  strain.  By  pre‐incubating  the  enzymes  at  distinct  temperatures  and  assaying  after  different  time  intervals  at  normal  assay  temperatures.  Outlook  for  cellulase  improvement:  Screening and selection strategies.  Gelfand  DH. Novozym  188 has previously  been reported to only maintain stability at temperatures at or  below 50°C [41].  FEMS Microbiol Lett 2001.  Wood  J.  Funck  Jensen  D  et  al.1:83‐9.69 2004. FEMS Microbiol  Rev 1994.  First  report  of  anthracnose fruit rot caused by Colletotrichum acutatum on strawberry in  Denmark.  pseudograminearium  and  identification  of  NPS2  as  the  producer of ferricrocin.  the  dependence  of  temperature  resembles  a  bell‐ shaped  curve.  Grell  MN.11 ‐    .  Vergara  M. Fernando Campos Melendez L. Sundelin T.  editors. Aspergillus  brasiliensis  sp  nov.  project  “Biofuels  from  Important Foreign Biomasses” that was the foundation of this  work.   [10]  Sarrocco  S.  Vijayakumar  P. reaction  time. Stud Mycol 2007:129‐45.  UP‐PCR  cross  blot  hybridization  as  a  tool  for  identification  of  anastomosis  groups  in  the  Rhizoctonia  solani  complex.   Thermostability  and  temperature  optima  presented  in  different  publications  are  difficult  to  compare  as  the  incubation  time.   [5] Bulat SA.  Singh  OV.4:432‐.   [2]  Zhang  Y‐P. Aubert JP.   [3]  Sternberg  D. Mol Biol Evol 1987.  belonging  to  the  Aspergillus  nigri  group.  Mycol  Res  2006:179‐87.  The  Neighbor‐Joining  Method  ‐  a  New  Method  for  Reconstructing Phylogenetic Trees.

  Evers  AD. Borjesson  J  et  al.2:175‐84.  Oeda  Y. Visser J.  Leal  MRLV. Vol 58 2006:1‐75.  Hidalgo  M.  Buckeridge M.4:375‐407. Qin WM.  Microbial  beta‐glucosidases:  Cloning.   [34]  Sohail  M.   [23]  Berlin  A.  Meek  E.5:2567‐82.  Studies of  the Submerged  Fermentation of Citric  Acid  by  Aspergillus  niger in Stirred Fermentor 2004.  Scandiffio  MIG.  Screening  and  characterization  of  an  enzyme  with  beta‐glucosidase  activity  from  environmental  DNA. Centralbureau voor Schimmelcultures.  LLC.  Amidi  Z. Utrecht.  In:  Anonymous  Technology  of  cereals:  Woodhead Publishing.  Screening  of  Antioxidant‐Producing  Fungi  in  Aspergillus  niger  Group  for  Liquid‐  and  Solid‐State Fermentation.   [46]  Soccol  CR.  Can  Brazil  replace  5%  of  the  2025  gasoline  world  demand  with  ethanol?.  Microbiology  and  Molecular  Biology  Reviews  2001.  p.   [24]  Tako  M.6:391‐5.   [47]  Leite  RCD. Bioethanol from lignocelluloses: Status and  perspectives in Brazil.  Inhibition. 276‐301. Harris PV.+. Evolution 1985.  Papp  T.  2005. p.  Markov  A.5:1283‐90.  Yoon  S.   [41] Krogh KBRM.  [19]  Page  RDM.  Krisch  J.  Iran  Biomed  2004. Shoseyov O.  Computer  Applications  in  the  Biosciences  1996:357‐ 358.  Tachibana  S.   [31]  Jager  S. Enzyme  Microb Technol 2005.   [42] Seidle HF.  Lung  S.  Lee  C.  Shinano  H.  Bisaria  VS.  Bura  R. Olsen CL.  Aftab  S. Lange L.  Kiss  L.  Pedroni  Medeiros  AB.1:11‐23. Cherry JR. Physical and kinetic properties  of  the family  3  beta‐glucosidase from Aspergillus  niger  which  is  important  for cellulose breakdown.  Screening and characterization of fungal cellulases isolated from the native  environmental source.4:783‐91.  and  Stability  Properties  of  a  Commercial  Beta‐D‐Glucosidase (Cellobiase) Preparation from  Aspergillus  niger  and its  Suitability  in  the  Hydrolysis  of  Lignocellulose.  Ahmad  A  et  al.  Vagvoelgyi  C. Harris PV.  Murao  S.  Int  Biodeterior Biodegrad 2009.  Nutrition.1:26‐31. Johansen KS.  Cellic  CTec2  and  HTec2  ‐  Enzymes  for  hydrolysis  of  lignocellulosic materials 2010. Ye J.   [45]  Sakamoto  R.   [48] Bisswanger H.   [26]  Jahangeer  S.  Enzymic  Properties  of  3  Beta‐Glucosidases  from Aspergillus aculeatus No‐F‐50. In: Anonymous Handbook of  Carbohydrate  Engineering:  Taylor  and  Francis  Group.  Sherwani  SK.   [30] Kim K.  Gilkes  N.9:465‐7. Agric Biol Chem 1985.   [33]  Kent  NL.  Griffin  WM.  Production  and  characterization  of  beta‐glucosidases  from  different  Aspergillus  strains.  Characterization  and  kinetic  analysis  of  a  thermostable  GH3  β‐ glucosidase  from  Penicillium  brasilianum  .1:143‐54.   [22]  Dekker  RFH. Advances in Applied Microbiology.5:455‐61. and applications.  Leschot  A.  Brumbauer  A.  Arai  M.  645‐ 685.13:4820‐5.  World J Microbiol Biotechnol 2001.  Otaka  M.  Mishra  S. Weinheim: WILEY‐VCH Verlag GmbH & Co. Dhanjoon J.  de  Souza  Vandenberghe  LP.  Gomes  E.5:655‐61. In: Anonymous Enzyme Kinetics.  Kakio  M.  Hoekstra  ES.  Journal of Proteome Research 2007.   [35] Ward OP.  Kilburn  D.  Fallahpour  M.  Farkas  E. Hojer‐Pedersen J.  Da‐Silva  R.  Alves‐Prado  HF.  Skomarovsky  A  et  al. Huber RE.   [28] Pedersen M.  Khan  N. Screening for cellulose and  hemicellulose  degrading  enzymes  from  the  fungal  genus  Ulocladium  . A proteomics strategy  to  discover  beta‐glucosidases  from  Aspergillus  fumigatus  with  two‐ dimensional  page  in‐gel  activity  assay  and  tandem  mass  spectrometry.9:669‐675. Crit Rev Biotechnol 2002.   [37]  Ali  S.   [39]  Ghasemi  MF.6:905‐12.  Feher  E.  Shahzad  S  et  al.  Cortez  LAB.  Shahzad  S.   [20]  Felsenstein  J.  Screening  for  Fungi  Capable  of  Degrading  Lignocellulose from Plantation Forests 2009. Netherlands:  American Society Microbiology. Singh A. 2004.  Identification  of  Acid‐  and  Thermotolerant  Extracellular  Beta‐Glucosidase  Activities  in  Zygomycetes Fungi. 1994.  Journal  of  Microbiology  and  Biotechnology  2007.4:497.  Biotechnol  Bioeng  1986.   [38]  Kawai  Y.  Applied  Microbiology  &  Biotechnology 2010.  Screening  genus  Penicillium  for  producers  of  cellulolytic  and  xylanolytic  enzymes.  Pagnocca  FC.  Kinetic. Pak J Bot 2005.  Naseeb  S.  Principles and Methods. Hollensted M. Structure.   [44]  Bhatia  Y.  Olsson  L. Pak J Bot 2009.   [40]  Eyzaguirre  J.  Bakhtiari  MR.  Confidence‐Limits  on  Phylogenies  ‐  an  Approach  using  the  Bootstrap.  Jorgensen  H.  Reczey  K. Langston JA.  Evaluation  of  novel  fungal  cellulase  preparations  for  ability  to  hydrolyze  softwood substrates ‐ evidence for the role of accessory enzymes.3:739‐48.12 ‐    .  Sohail  M.   [21]  Samson  RA.  Yeo  Y. Acta Biol Hung 2010.  Production  and  characteristics  comparison  of  crude  beta‐glucosidases  produced  by  microorganisms  Thermoascus  aurantiacus  e  Aureobasidium  pullulans in agricultural wastes. Aspergillus enzymes involved in degradation of plant  cell  wall  polysaccharides.  Distribution  of  Hydrolytic  Enzymes  among  Native  Fungi:  Aspergillus  the  Pre‐Dominant Genus of Hydrolase Producer.12:4749‐57. Enzyme  Microb Technol 1985.  Beta‐D‐Glucosidase  ‐  Multiplicity  of  Activities and Significance to Enzymic Saccharification of Cellulose.  2008.  Kang  H  et  al.  Beta‐glucosidases  from  Filamentous  Fungi: Properties.  Frisvad  JC.   [29]  Kim  S.  Noohi  A. Brown KM.  Henschel  JR. 154‐158.   [27]  Krogh  KBR.1:101‐10.   [43]  Khan  AW.  Morkeberg  A. Physiology and biotechnology  of Aspergillus .  TREEVIEW:  An  application  to  display  phylogenetic  trees  on  personal  computers.   [32]  Leite  RSR.  Introduction  to  Food‐  and  Airborne  Fungi. p.  Nasrin  M. and Applications. Protein Journal 2004.1:47‐50.  Screening  of  Urease  Production  by  Aspergillus  niger  Strains.   [36] de Vries RP.  Cabral  H.  Sultana  S.   [25]  Djarwanto. Bioresour Technol 2010.  properties.  Kim  M.   [49]  Novozymes  A/S.9:1438‐42. Bull Fac FIsh Hokkaido Univ 1994. Enzyme Microb Technol 2008.  Frisvad  JC.  Appl Biochem Biotechnol 2004:389‐401. Temperature Dependence.  Energy  2009.  Karp  SG. Andersen B. 7th ed.  Jahangeer  S. KGaA. Ramos LP et al.       Research paper II  ‐ II.4:484‐9.  Inoue  N. Marten I.

 Frisvad    Intended for submission to International Journal of Systematic and Evolutionary Microbiology    . Lübeck. and Jens C. Nielsen. Mette Lübeck.Research paper III      Aspergillus saccharolyticus sp. nov. a new black Aspergillus  species isolated from treated oak wood in Denmark      Annette Sørensen. Kristian F.. Philip J. Peter S.   Birgitte K. Teller. Ahring.

.

 is MB 158695    Research paper III  ‐ III.  which  is  an  important  mycotoxin  in  wine  and  raisins  (Abarca et al.3. Birgitte K..  USA   Current address: Biogasol ApS. nov. also A. saccharolyticus sp. Mette Lübeck1.  A.. aculeatus.  japonicus. Kristian F. a new black Aspergillus species isolated from treated oak wood in Denmark Annette Sørensen1.1 ‐    .   During  a  broad  screening  of  different  fungal  strains  collected  in  Denmark  for  prominent  beta‐glucosidase  producing  fungi  (Research  paper  II. Ahring1. Richland. Philip J. Copenhagen Institute of Technology. DK‐2800 Kgs.  Samson  et  al.. Lübeck  psl@bio. and it is generally agreed that it is important  to delimit a species in the genus by combining molecular. The type  T T strain is CBS 127449  (= IBT 28509 )..  2008).  morphologically  INTRODUCTION  The  black  aspergilli  (Aspergillus  section  Nigri)  (Gams  et  al.  aculeatinus.  ITS. Denmark  Center for Biotechnology and Bioenergy.         toxins. In addition to these  Abbreviations:  ITS..org) accession number for  A. S. is described within the black Aspergillus  section Nigri species. niger was shown to  contaminate  wine  with  the  carcinogenic  mycotoxin  fumonisin B2 (Mogensen et al. Lübeck1. internal transcribed spacer  and calmodulin gene sequences.dk  Aspergillus saccharolyticus sp. Building 224. A.  this  thesis). japonicus and A.  and  A.  Recently. nov. Aspergillus saccharolyticus sp.  The  species concept of black aspergilli has been discussed by  several  researches  within  the  Aspergillus  research  community. This species was isolated in Denmark from treated hardwood.  Noonim  et  al.. Denmark  2   3 4   A novel species. In the  biseriate  species  a  diverse  array  of  polyketides  and  several alkaloids are known. 2006.  uvarum  predominantly  produce  alkaloids  and  few  polyketides  (Nielsen et al..  internal  transcribed  spacer  region.  aculeatus..  A. Its  taxonomic status was determined using a polyphasic taxonomic approach with phenotypic  (morphology and extrolite profiles) and molecular (beta‐tubulin.  Goldberg et al. 2007).  Aspergillus section Nigri is one of the more taxonomically  difficult  groups. 2003).. 2009.. Teller4.  These features clearly distinguished this species from other black aspergilli. Department of Systems Biology..  Of  these  A. Washington State University.  and  calmodulin  gene  sequenced  of  strains  examined  are  shown  on  the phylogenetic trees.  carbonarius  is  especially  problematic  due to its high production of the carcinogenic ochratoxin  A.  and  physiological  characteristics  using  a  polyphasic  approach  (Samson  &  Varga. 2010). while the uniseriate species. WA 99352.  2008. DK‐2750 Ballerup. Denmark. 2009).  morphological. Lautrupvang 15.  The Mycobank (http://www. and universally‐primed PCR fingerprinting) characteristics.  we  discovered  a  uniseriate  Aspergillus. Lyngby.  The  GenBank  accession  numbers  for  the  beta‐tubulin.  the  black  aspergilli  are  well  known  for  their  prolific production of many secondary metabolites.  but with a totally different extrolite profile as compared to any known Aspergillus. 2007. Aalborg  University.  but  the  uniseriate  subgroup  differ  significantly  in  morphology  and  physiology  from  the  biseriate subgroup (Samson & Varga. and Jens C.                      Correspondance  Peter..  2009. Samson et al.  A. Technical  University of Denmark. Nielsen2. 2750 Ballerup.  universally primed PCR. nov.aau.  2007.  2009).mycobank. Denmark  Center for Microbial Biotechnology. 1985) are important industrial working horses as they  are frequently used in the biotech industry for production  of hydrolytic enzymes and organic acids (Pel et al. Peter S. Pariza & Foster.  Perrone  et  al.  Black aspergilli are some of the most common fungi being  responsible for postharvest decay of fruit (Pitt & Hocking. 1983).  UP‐PCR. saccharolyticus  is a uniseriate black Aspergillus with a similar morphology to A. Lautrupvang 2A. Frisvad2 1 Section for Sustainable Biotechnology.

.  Again.  Fungal  biomass  for  DNA  extraction  was  obtained by scraping the surface of a PDA plate with a seven day  old colony. japonicus.  Bootstrap  values  (Felsenstein.  and  beta‐tubulin  sequence  phylogeny.  (2007).  PDA.  was  isolated  indoor  from  treated  oak  wood  in  Denmark.K. and one of    Research paper III  ‐ III. DNA extraction was carried out as described by (Yu &  Mohn.  All reference strains and accession numbers used for comparison  are listed in Supplemetary Table 1.  For investigation of morphological characteristics. 33°C.mbio. For temperature tolerance analysis..  The  phylogenetic  tree was prepared by running the program “Neighbor” using the  neighbor‐joining method (Saitou & Nei.  the  bootstrap  values  were  obtained  from  the  consensus  tree  which  was  identified  by  the  majority‐ rule consensus method by running the program “Consense”.   UP‐PCR  fingerprinting  was  carried  out  using  two  different  UP  primers.html).ncsu. 2009.  microscopic  mounts were made in lactophenol from colonies grown on MEA  (malt extract autolysate) and OA (oat meal agar)..  CYAS  (CYA  with  50g/l  NaCl). Three 6 mm diameter plugs were taken from  each strain grown as three‐point inoculations in the dark at 25 °C  for  7  and  14  days  on  YES.  Samson  et  al. and incubated 7 days in the dark at  25°C.  using  the  beta‐tubulin.  2003). Nielsen  &  Smedsgaard.2 mM of dNTP. and 40°C.5 mM MgCl2.  calmodulin.  2009..  The  plugs  were  transferred  to  a  2  ml  vial  and  1.  The  isolate  was  maintained  on  potato  dextrose  agar  at  room  temperature.  and  finally  the  tree  was  visualized  using  the  program  TreeView  (win32)  (Page.  CY40S  (CYA  with  40%  sucrose).  using  bead  beating  for  cell  disruption.  1999). 1987) to obtain unrooted  trees.. However.  1995).69  was  used  for  preparation  of  phylogenetic  trees  (Felsenstein.4 µM  of primer and 1 U RUN polymerase (A&A Biotechnology). 0. and “Neighbor” with  the  neighbor‐joining  method  to  obtain  unrooted  trees  of  the  multiple  data  sets.  1996).  Aspergillus  saccharolyticus.  (2007).  Separations  of  2  µl  samples  was  performed  on  a  50  ×  2  mm  inner  diameter.   Morphological  analysis.  and  ITS  region  sequences  of  the  aspergilli  presented  in  the  article  by  Samson  et  al.  1985)  were  calculated  by  running  the  program  “Seqboot”  to  produce 1000 bootstrapped data sets from the original data set.  Finally.  0.  calmodulin. 0.  “Dnadist”  with  the  Kimura  method  was  used  to  prepare  distance matrices of the multiple data sets. 1999) for DNA amplification  in  separate  reactions.  The  plugs  were  placed  in  an  ultra‐ sonication bath for 60 min. 0.  flavus  was  defined  as  the  outgroup  in  the  program  “Retree”.  ClustalW  multiple  alignment  was  used  for  sequence  alignment  and  manual  improvement  of  the  alignment  was  performed  using  BioEdit  (http://www. Both solvents contained 20 mM formic acid.  GAGGGTGGCGGCTAG) (Lubeck et al.  2004).  fungal  strains  were  obtained  from  different  environmental  habitats.5 % Ficoll.edu/BioEdit/bioedit.      similar to A. 2009.)  equipped with an electrospray (ESI) (Nielsen et al.  (1999)  except  that  the  reactions  were  carried  out  in  a  25  µl  volume  containing  50  mM  Tris  pH  8. both molecular data and  extrolite  profile  showed  that  this  fungus  differed  significantly from known aspergilli from section Nigri.  For  microscopic  analysis.  2006).  The  two  fungal  primers  Bt2a  (5’  GGTAACCAAATCGGTGCTGCTTTC)  and  Bt2b (5’ ACCCTCAGTGTAGTGACCCTTGGC) were used to amplify  a  fragment  of  the  beta‐tubulin  gene  (Glass  &  Donaldson.   METHODS  A  strain  of  a  novel  species.23  mg/ml BSA.  and  the  primers  ITS1  (5’  TCCGTAGGTGAACCTGCGG)  and  ITS4    (5’  TCCTCCGCTTATTGATATG)  were  used  to  amplify  the  ribosomal  rDNA spacers.  and  tested  for  beta‐glucosidase  activity  (Research paper II. 1990).  3  μm  Luna  C18  II  column  (Phenomenex.. 2004a).  2009).  v/v) mixture.  temperature  tolerance..  1983)  using  the  program  “Dnadist”. The ethyl acetate was transferred to a  new  vial  in  which  the  organic  phase  was  evaporated  to  dryness  by  applying  nitrogen  airflow  at  30  °C.  UP‐PCR  finger  printing.  Manchester. Germany) equipped with a diode array detector and  coupled  to  a  Micromass  LCT  (Micromass.  2004a).  CYA40.  saccharolyticus  was  three‐point  inoculated  on  the following media: CREA (creatine sucrose).   Extrolite analysis.   HPLC‐UV/VIS‐high  resolution  mass  spectrometry  (LC‐HRMS)  analysis  was  performed  with  an  Agilent  1100  system  (Waldbronn. 2003). Nielsen  & Smedsgaard.300 ml/min with 15‐100% ACN in 20 min  followed  by  a  plateau  at  100  %  ACN  for  3  min  (Nielsen  et  al. CYA (Czapek yeast  autolysate)..  CA)  using  a  linear  water‐ACN  gradient at a flow of 0.  CYA20. Some of the strains were  found indoor in Denmark on treated oak wood.  L45  (5'  GTAAAACGACGGCCAGT)  and  L15/AS19  (5'  RESULTS AND DISCUSSION  In  a  screening  program.  MEA  (malt  extract  autolysate).  In  this  paper  we  describe  the  relationship  of  this  strain  to  other black aspergilli using the polyphasic approach with  studies  of  ITS.2 ‐    . 2. 36°C.  A. 30°C.  Other peaks  were  tentatively  identified  by  matching  data  from  previous  studies in our lab and searching the accurate mass in the ~13500  fungal metabolites reported in Antibase 2010 (Laatsch.  OA  (oat  meal  agar)  and  YES  (yeast  extract  sucrose)  agar (Samson et al. ITS1 and ITS2 (White et al.  Phylogenetic  analysis  of  the  beta‐tubulin.  Danish  as  well  as  international.  CYA    media  (Nielsen  et  al. a dense spore  suspension  of  A.  The  residues  were  re‐ dissolved by ultrasonication for 10 min in 150 μl ACN/H2O (1:1.  The  PHYLIP  program  package  version  3.4  ml  of  ethyl  acetate  containing  1%  formic  acid  was  added.  U.   Molecular  analysis.  For compound identification.  The  amplification  was  performed  as  described  in  Lübeck  et  al. this thesis).  calmodulin. three‐point inoculating  was  performed  on  CYA  and  incubated  7  days  in  the  dark  at  different temperatures: room temp. Samples were  analyzed both in ESI‐ and ESI+ mode.  and  internal  transcribed  spacer  region  of  rRNA  (ITS1  and  ITS2)  sequences  of  the  novel  isolate  was  carried  out  as  described  by  Varga  et  al.  The  distance  matrix  of  the  data  set  was  calculated  based  on  the  Kimura  method  (Kimura.  Torrance.  macro‐  and  micro‐ morphology.  CY20S  (CYA  with  20%  sucrose).  and  extrolite  production. each peak was matched against an  internal  reference  standard  database  (~800  compounds)  (Nielsen et al.. 2010).  while  the  primers  Cmd5  (5’  CCGAGTACAAGGAGGCCTTC)  and  Cmd6  (5’  CCGATAGAGGTCATAACGTGG)  were  used  to  amplify  a  segment  of  the  calmodulin  gene  (Hong  et  al.

  identification  of  species.80.  2005.  aculeatus  CBS  172.7%  for  the  ITS.  Meanwhile. de Vries  et  al.  A.  and  beta‐tubulin  regions.  This  is  an  indication  of  clearly  separated  species.  2005).9±0.  interspecific  sequence  divergences  are  ≤0.  as  strains  within  a  species  should  at  least  have  some  similarities  in  their  banding  profiles  (Lübeck  &  Lübeck. japonicus or A.  A.. 0.  and  did  not  share  any bands  (Supplementary  Fig  S3).2%.  homomorphus.  japonicus. CY20.  homomorphus.  A.  japonicus..  the  interspecific  sequence  divergences  in  the  ITS.  Furthermore.5%. (2007). and A.  there  is  a  clear  genetic  foundation  for  proposing the new species. uvarum.  saccharolyticus  clustered  with  A.  Based  on  this.  calmodulin.  this  strain  could  readily  be  distinguished  from  other  black  aspergilli  by  Universally  Primed‐PCR  analysis  using  each  of  the  two  UP  primers.  7. 2007.  a  thorough  characterization  was  carried  out  in  order  to  identify  the  strain.  and  identification  of  UP‐PCR  markers  at  different  taxonomic  levels  (strain.7%. A.  A.  A.1%.  and  15.  uvarum.      these  strains  showed  an  extraordinary  good  beta‐ glucosidase  activity.  A.  1.  A.   Fig.  A.  saccharolyticus  was  with  high  bootstrap  values  found  to  belong  to  the  clade  with  A. but extrolite profiles and DNA  sequencing  data  showed  that  the  strain  clearly  was  different from all known species.  produced  a  unique  banding  profile.  and  CYAS. aculeatinus.  respectively. revealing of genetic relatedness at infra‐  and  inter‐species  level. Samson et al.  ellipticus.  and  5.  A.  to  other  black  aspergilli was investigated by comparing sequence data of  parts of the beta‐tubulin and calmodulin genes as well as  the ITS region. japonicus. using A. uvarum. saccharolyticus and A..02 substitutions per nucleotide. Bar. 2007. Varga et al.  Neighbor‐joining  phylogenetic  tree  based  on  partial  calmodulin  gene  sequence  data  for  Aspergillus  section  Nigri.   Morphological data showed that the strain was related to  A.  The  separate  grouping  in  the  beta‐tubulin  tree  of  A.  A.  Sequence  alignment revealed that amongst the species from section  Aculeati  that  are  in  clade  with  A.  For  all  three  loci. homomorphus  is the same as the variation between A. CY20S.  aculeatus  strains. A.  Each  of  the  analyzed  aspergilli.  Numbers  above  the  branches  are  bootstrap  values. A.  L45  and  L15/AS19  (Supplementary  Fig  S3).  while  for  the  beta‐tubulin  gene  sequence  data  A.  and  beta‐tubulin  region between A. aculeatus.  UP‐PCR  is  a  PCR  fingerprinting  method  that  has  demonstrated  its  applicability  in  different  aspects  of  mycology.  saccharolyticus  is  placed  on  its  own  branch  far  from  the  other species in the clade supported by the majority‐rule  consensus  analysis  for  all  three  loci  and  high  bootstrap  values  for  the  beta‐tubulin  and  calmodulin  loci.  saccharolyticus  based  on  these  sequence  data  and  data  obtained  in  this  work. flavus as the out group.  and  both  A.  homomorphus.  aculeatinus.  uvarum.  calmodulin.  Samson  et  al.  Only  values  above 70% are indicated. saccharolyticus and the other species in  the  clade  are  on  average  12.. 2008. CY40S. aculeatus  CBS  114.  but  low  bootstrap  value  (51%)  for  the  ITS  locus.  A.  japonicus  and  A.  The  results  further  showed  that  it  is    Research paper III  ‐ III. A.  2005). The genetic relatedness  of  this  novel  species.4±1.  These  applications  constitute  analysis  of  genome  structures.  respectively.  with  especially  the  ITS  and  calmodulin  sequence  trees  showing  similar  topology (Fig 1 and Supplementary Fig S1 and S2).  In  this  work.6%.  analysis  of  population  and  species diversity. A.  Searching  the  NCBI  database  does  not  give  any  closer  genetic  match.  2004b).  niger. Based  on  the  phylogenetic  analysis  of  the  ITS  and  calmodulin  gene  sequence  data.  aculeatus  and  A. A.  The  extrolite  profiles  further  showed  that  A.  aculeatinus. The black  aspergilli chosen for comparison are the same as the ones  presented by Samson et al.  A.  group  and/or  species)  (Lübeck  &  Lübeck.  20±0..  saccharolyticus.  saccharolyticus.  saccharolyticus  produced  the  largest  chemical  diversity  on  YES  agar  (25°C). homomorphus and  the  smaller  clade(s)  of  A.  whereas  CYA  (25  and  30°C). and  both  A.66T  has  consistently been shown in other publications (Noonim et  al.  saccharolyticus. and PDA (all at 25°C) yielded  fewer  peaks. Phylogetic trees were  prepared  for  A.  The  variation  in  sequence  data  observed between A. aculeatinus. saccharolyticus.3 ‐    .  aculeatus  strains.

 D‐H) Three‐point inoculation on CREA.   1 probably  a  new  species  since  it  does  not  share  any  metabolites with other species in the Nigri section where  e. 2008).  but  with  larger  conidia  of  5‐6  µm  and vesicle size in the high margin of A. incubated 7 days   T   Research paper III  ‐ III. B‐C) conidial heads.. 2001) and (Noonim et al. neoxaline. respectively. MEA.g.   IBT 26338.4 ‐    . nov. saccharolyticus is most closely related  to  A.  cycloclavine  and  aculeasins were not detected (Parenicova et al. nov. secalonic acid D & F  A uvarum   (CBS 121591T. Growth on CREA resembled that of A.   T)  (CBS 127449   A aculeatinus   37‐54 18‐52  Aculeasins. CBS  121875. dihydrogeodin. and  CYAS. mm)        11‐14  7‐14  12 compounds not described in the literature* including ACU‐1** and ACU‐2**  A saccharolyticus sp. A. ITEM 5024)    1Extrolite production described in (Parenicova et al. In  addition. Based  on  physiological  features. saccharolyticus sp. updated here. ITEM 4497)    54‐73 11‐14  Asterric acid..  japonicus  (Fig  2). 13500 fungal extrolites in Antibase2010 (Laatsch.1799 and 218. CBS 127449 . ACU‐1 and  ACU‐2. geodin. 2.  the  naphto‐γ‐pyrones  are  consistently  produced  (Nielsen et al. mm)  (diam. none of the 12 detected peaks matched with the  approx. CYA 37°C.   Morphologically.  2010)  indicating  that  the  species  has  not  been  investigated by natural products chemists. japonicus.1268  Da respectively.51T.  with  series  Aculeati  (Table  1  and  Supplementary  Fig  S4)  whereas  the  well‐known  compounds  from  the  series:  neooxaline. A. ITEM 4834. A) conidia.  * No matches found among the 13 500 fungal metabolites listed in Anitbase2010. IBT 29329.  secalonic  acids.  as  moderate  growth  and  medium  acid  Fig. erdin. Physiological features and extrolite production  by the strains of uniseriate species in Aspergillus section Nigri. 2001). CYA.  ITEM 4856.  differences  between  A.  Species  Growth on  Growth at  Extrolites CYAS   37°C on CYA  (diam.  aculeatinus..66T)    A japonicus   0  8‐25  Cycloclavine. IBT 29275)    A aculeatus   0‐4  15‐26  Secalonic acid D & F. festuclavine (CBS 114.. secalonic acid D & F   (CBS 121060T. 2009) and only two compounds.   ** ACU‐1 and ACU‐2 unidentified compounds with UV max 242 nm (100%) and 346 (88%) with mono isotopic masses of 315.  saccharolyticus  and  other  uniseriate  species  in  the  Nigri  section were found. ACU‐1** and ACU‐2** (CBS 172.      Table 1.

 this thesis) and the name  refers  to  its  great  ability  to  hydrolyze  cellobiose  and  cellodextrins. OA: 39‐ 42 mm.  phialides flask shaped with a short broad collulum.  saccharolyticus  grew  better  on  CYAS  than  A.  and  physiological  characteristics. CREA 30‐34 mm. echinulata.  and  40°C.   The type strain CBS 127449T (= IBT 28509T) was isolated  from  under  a  toilet  seat  made  of  treated  oak  wood.  The  same  tendency  has  been  observed  for  A..  distinctly  echinulate. YES: 75‐80 mm. MEA: 35‐37  mm.  aculeatus  and  A. growth observation day 7.  levis.  walls  thick. saccharolyticus is olive‐green/brownish with sulcate  structure.  and  A.  and  chemotaxonomical  characteristics  for  phenotype  analysis.  Exudates absent.  conidia  mostly  globose.  stipes  200‐850  x  5‐7  μm.  Sclerotia  have  not been observed.  aculeatus  is  curry‐ yellowish/brown  (Fig  2  compared  with  Samson  et  al.cus. while  A. Growth diameter of A.2  μm.  2007).  Aspergillus  saccharolyticus. nov.  in MEA 35‐37.  we  propose  it  as  a  novel  species.  production  was  observed.  Conidial  heads  globose.  reversum  cremeum  vel  dilute  brunneum.  while  growth  on  CYA  mostly  resembled that of A.2 μm.  with  long  sharp  discrete  spines. CYAS: 11‐14 mm.  33°C. in YES 75‐80 mm. uvarum was inhibited at 33°C (Samson  et al.  the  spines  being  0.   Aspergillus  saccharolyticus  (sac.  but maintained good growth at both temperatures (Fig 3). uvarum.  Typus  CBS  127449T  (=  IBT  28509T).  uvarum. Dania.5‐7 μm. saccharolyticus sp.  isolatus  e  lignore  Quercetorum in Gentofte.  Latin  diagnosis  of  Aspergillus  Sørensen.  but  some  are  subglobose.  With  regards  to  temperature  tolerance.  saccharolyticus  showed  a  distinct change in morphology on CYA from 30°C to 33°C. saccharolyticus on CYA at  37°C was approximately the same as for A. in CYA.  37 °C: 7‐14 mm.  while  A. 2007).  physiological. Lübeck et Frisvad sp.  (2007)).  aculeatus  and  A. 5.  masc. 5‐ 6.  UP‐PCR  profile. deinde obscure brunneae vel atrae. conidia globosa vel subglobosa.6‐0.  at  37°C: 7‐14 mm.  japonicus.  saccharolyticus  Coloniae post 7 dies 58‐62 mm diam in agaro CYA.5‐7  μm.  A. aculeatinus and A.  MEA  was  a  medium  where  colony  size  was  clearly  different.L. 3.ca’ro.  extrolite  profile.8  μm  long.      RT  30C  33C 36C 40C      T   Fig. Denmark     Research paper III  ‐ III.  Our conclusion. nov.  fere  globosae.  globose.  Because  the  strain  was  unique  in  its  genetic  phylogeny. 5.ly’ti.  The  novel  species  is  an  efficient  producer  of  beta‐ glucosidases (Research paper II.  Coloniae primum albae.  morphological. aculeatus.  Lübeck et  Frisvad sp.  Conidiorum  capitula  primum  globosa.  5‐ 6.  Colony  diameter  at  7  days:  CYA  at  25°C:  58‐62  mm.  36°C.  saccharolyticus  being  smaller  than  the  other  uniseriate  aspergilli. nov.  japonicus  were  less  inhibited.  uniseriate. CBS 127449  three point inoculation on CYA.  but growth was limited compared to A.  stipes  200‐850  x  5‐7  μm.  crassitunicatus.  collulis brevis.  with  A.  japonicus.  The  maximum  temperature  A.  vesiculae  25‐40  μm  diam.  and  morphological.  vesicles  25‐40  μm  diam..  aculeatinus  even  less  inhibited  measuring  the  largest  diameter  of  all  uniseriate  at  this  elevated  temperature  (Table 1). CY40S: 43‐54 mm.  aculeatinus  grown  on  MEA.  while  that  of  A.  A. poor growth. good acid production.  saccharolyticus.  saccharolyticus  was  able  to  grow  at  was  36°C.  growth  was  examined  on  CYA  at  30°C. the reverse side  of A.  colony  first  white  then  dark  brown  to  black  (Fig  2). that we have identified a novel species is  based  on  a  polyphasic  approach  combining  phylogenetic  analysis  of  three  genes  and  UP‐PCR  data  for  characterizing  the  genotype. which is  generally  the  case  for  the  other  uniseriate  aspergilli  as  well  (Samson  et  al. A.  Gentofte.  while growth of A.  capitula  uniseriata. CY20S: 42‐54 mm.  and  A.  Description  of  Aspergillus  saccharolyticus  Sørensen.5 ‐    .  aculeatus  showed no change in morphology at these temperatures.  adj.  smooth.  N. in agaro  farina  avenacea  confecto  39‐42  mm. reverse cream‐coloured to light greyish  olive  brown  on  CYA  and  light  brown  on  YES.  phialides  lageniformes.  in  CREA  30‐34  mm. Sclerotia haud visa. being able to degrade cellobiose and  cellodextins). incubation at different temperatures. however.  but  growth  at  this  temperature  was  restricted compared to the lower temperatures.

 S..   Gams.  an  uniseriate  black  Aspergillus  species  isolated  from grapes in Europe.  Larsen. A.  Perrone.  T.  J. Stud Mycol 59. C. C.  T. White. Susca. A. 1323‐ 1330.  J.  J. B. P.  M.  (1996). Universally Primed PCR (UP‐ PCR)  and  its  applications  in  Mycology. K. 477‐486.  (2007)..  (2007)..& other authors (2007). A.  New York: Cambridge University Press. M.. 45‐ 61.   de  Vries.  M. & Donaldson.  a  biseriate  black  Aspergillus  species  with  world‐wide distribution. J.  The  neutral  theory  of  molecular  evolution. (2009).  (1983).  Delineation  of  Trichoderma  harzianum  into  two  different  genotypic  groups  by  a  highly  robust  fingerprinting  method. & Hocking.  J.  T.  (1999). M. S.  Kocsube.  (2008). 1925‐1932. Lubeck...  &  Visser.88.  J..  J.  J.  J. 55‐61.  J.  Burgers. Kuijpers.  Varga. 315‐322. S.   Samson...   Yu. 111‐136.. L.   Samson. Houbraken.. Gelfand.   Samson. 1601‐1611. Edited by R.   Kimura. R..  A. & Samson. UP‐PCR.  Edited  by  S.  R.  (1987).. S13‐S20. J.   Noonim. G..  M.  I. H. P.  What  is  a  species  in  Aspergillus? Medical Mycology 47. Aspergillus carbonarius as the main source  of  ochratoxin  A  contamination  in  dried  vine  fruits  from  the  Spanish market. 129‐145.  M..  Z.  T. & Bulat.  J. In PCR Protocols: A Guide to Methods and  Applications. Edited by M.  Johansen. 221‐231. Archer. & Foster. Mol Biol Evol  4. J.. D. 406‐425.  S. J.  project  “Biofuels from Important Foreign Biomasses”.  J.69.  C.   Mogensen. Frisvad. Jensen.  (1990).  P. 1032‐1039. C.  O. Frisvad.  Susca. Toth.  Killing  two  birds  with  one  stone:  simultaneous  extraction  of  DNA  and  RNA  from  activated  sludge biomass.  Castella.  R.  W.  F. (1983).. 453‐468.  (2010).  409‐438.   Pitt.  C.  W. Noonim.  A.   REFERENCES   Abarca. Mahakarnchanakul. H.  R.. 357‐358.  M.  H..  (2010). 504‐506. Innis.  (2004).  R. Dordrecht: Springer.  Netherlands:  American  Society  Microbiology. Skouboe.  new  themes. J.  J. D.  New  ochratoxin  A  or  sclerotium  producing species in Aspergillus section Nigri . L.  &  Smedsgaard.  B.  (2009).  (2009). Frisvad.   Varga. pp. Evolution 39.  Kuijpers.. Organic acids: old  metabolites.. Novel Neosartorya species isolated from soil in Korea. A.  Accensi. H..  (2001)..  1727‐ 1734.  A. (2005). M.  &  Samson.. D. and UP‐PCR product cross‐hybridization.  Frisvad.  M.  Diagnostic  tools  to  identify  black  aspergilli.  &  Visser.  (1985).  S.  R.  C. H. O.  Genome  sequencing  and  analysis  of  the  versatile  cell  factory  Aspergillus niger CBS 513. 269‐272.  AntiBase  2010:  The  Natural  Compound  IdentifierWiley‐VCH.  &  Frisvad. S. Frank. Z.  &  Varga.  J.  In  Advances  in  Penicillium and Aspergillus Systematics.   Parenicova.. New York: Academic Press Inc. Rai. H. A.   Pel.. (1995)...   Hong. 521‐527. I.  S. A.  &  Cabanes.  M.  M. Kozakiewicz. Stud Mycol 50.  A.  W. E.  Witiak.  A. D. Determining the Safety of  Enzymes used in Food‐Processing..  Deshmukh & M.  Confidence‐Limits  on  Phylogenies  ‐  an  Approach using the Bootstrap.  C. A.  &  Samson. J Food Prot 46.  J. W.  ten  Hoor‐Suykerbuyk.  R.  W. Onions.  J. & Lübeck. C.  A..  D. J. Alekhina. J. (2003).  Toth.   Laatsch. 195‐203..  A.  Analytical  and  Bioanalytical Chemistry 395... A.. J. Pitt.  R. & Pines. (2006). S.  Journal  of  Chemical  Technology  and  Biotechnology 81.  E. New York: Plenum Press.  (1999).  &  Taylor. 71‐73. A. R..  A.  Bruns. Varga. Distributed by the author.  R.  M.  Fungal  metabolite  screening:  database  of  474  mycotoxins  and  fungal  metabolites  for  dereplication  by  standardised  liquid  chromatography‐UV‐ mass  spectrometry  methodology.  F. Aspergillus  uvarum  sp  nov. Shin.  PHYLIP  (Phylogeny  Inference  Package)  version 3.  Bragulat.  D.  O. I.  K.   Pariza.  Sninsky & T. J.  Int  J  Syst  Evol  Microbiol  58. & Samson.  Journal  of  Chromatography  a  1002.  L. F. & Samson..  In  The  Biodiversity  of  Fungi. Cho.  S. B. R...  Aspergillus  brasiliensis  sp  nov. G..   Felsenstein..  Introduction to Food‐ and Airborne Fungi.  R.   Glass..  K. Rokem.  Combined  molecular  and  biochemical  approach  identifies  Aspergillus  japonicus  and  Aspergillus  aculeatus  as  two  species. W. F. New Hampshire.  J.   Nielsen.   Samson. D. P.  R.  (2004b). Samson. M.  S. R...  Infrageneric  taxa  of  Aspergillus.  Larsen.  Samson & J.  F. Fungi and Food Spoilage.. (2008). M. 783‐791.   Felsenstein. Can J Microbiol 45. 7th edn. 1225‐1242.  M. P.  J. J Food Prot 66.  G.  K..  &  Varga.  Antonie  Van  Leeuwenhoek  International  Journal  of  General and Molecular Microbiology 87.  F.   Perrone.  K..  &  Frisvad. P.. Int  J Syst Evol Microbiol 56..  Frisvad. J. Int J Syst Evol Microbiol 58.  S.. J. Kocsube.  Two  novel  species  of  Aspergillus  section  Nigri  from  Thai  coffee  beans.  J. A.   White.  M.  P.  G. J. Third  edition edn.  L. 289‐298..  Inc...  T. Pitt. A. Rossen.. Appl Environ Microbiol 61. Aspergillus vadensis. Christensen.  &  Nielsen.  The  species  concept  in  Aspergillus:  recommendations  of  an  international panel.  (1985).  TREEVIEW:  An  application  to  display  phylogenetic trees on personal computers.  &  Frisvad.   Lubeck. H. I. J. Mycol  Res 103.  Amplification  and  direct  sequencing  of  fungal  ribosomal  RNA  genes for phylogenetics.  pp. USA: Science Publishers.  Utrecht. Nat Biotechnol 25.  The  Neighbor‐Joining  Method  ‐  a  New Method for Reconstructing Phylogenetic Trees. Stud Mycol 59.  J.  Mogensen. Int J Syst Evol Microbiol 57.. J.   Goldberg.  K.  J.  Review  of  secondary  metabolites  and  mycotoxins  from  the  Aspergillus  niger  group.  Frisvad. P. de Winde.   Nielsen.  J Agric Food Chem 58.  M. A. M. Meijer. S. Varga.  (2006). A.  &  Geiser.  C.  A..  F.   Lübeck.  (2007).  (2005). R. Stea.  M. 4853‐4857. a new species of the group of black  Aspergilli.  Samson. Development of Primer  Sets Designed for use with the PCR to Amplify Conserved Genes  from Filamentous Ascomycetes.  J. Houbraken.   Samson.. B..  Appl  Environ  Microbiol 67.  N.  &  Nei.. J.  A.  &  Mohn. Computer Applications  in the Biosciences 12.  Widespread Occurrence of the Mycotoxin Fumonisin B‐2 in Wine.  (2004a). pp. J.  van  de  Vondervoort. G.  A. A.     Research paper III  ‐ III.  Lee.  Hoekstra.  Meijer. N. F.  (2003).  C.      ACKNOWLEDGEMENTS  The research investigating the strain was in part supported by a  grant  from  Danish  Council  for  Strategic  Research. Centralbureau  voor  Schimmelcultures. I.  Their  Role  In  Human  Life.   Saitou. M..  Page. I.  J. Frisvad..6 ‐    .

26T  A. niger CBS 554.65T  A.65  A. uvarum CBS 121591T  A. japonicus CBS 114. piperis CBS 112811T  A. saccharolyticus CBS 127449T  A. GenBank accession numbers of sequence data used to prepare the phylogenetic trees  ITS  A.7 ‐    . aculeatus CBS 114. brasiliensis CBS 101740T  A. heteromorphous CBS 117. homomorphus CBS 101889T  A. ibericus CBS 121593T  A. flavus CBS 100927T      AJ223852  AJ223853  AJ279985  AJ279988  AJ280009  AJ280010  AJ280013  AJ280014  AY585549  AY656625  DQ900602  DQ900603  DQ900604  DQ900605  DQ900606  EF166063  EU159211  EU159216  AM745757  AJ280005  HM853552  AF027863  Beta‐tubulin  AY585536  AY820007  AY585542  AY585540  AY585533  AY820006  AY585529  AY585530  AY585531  AM419748  AY820014  AY820013  AY819998  AY585532  AY819996  AY820015  EU159220  EU159229  AM745751  AY585539  HM853553  AY819992  Calmodulin  AJ964872  AJ964876  AJ964875  AJ964877  FN594547  AM295175  AM421461  AM117809  EU163269  AJ971805  EU163268  EU163267  EU163270  AJ964873  EU163271  AM887865  EU159241  EU159235  AM745755  AM419750  HM853554  AY974341    Research paper III  ‐ III.55T  A. sclerotioniger CBS 115572T  A. carbonarius CBS 111. sclerotiicarbonarius CBS 121057T  A. tubingensis CBS 134. costaricaensis CBS 115574T  A. aculeatinus CBS 121060T  A.51T  A. foetidus CBS 565.        Supplementary Table 1.80  A. vadensis CBS 113363T  A.79T  A. aculeatus CBS 172. lacticoffeatus CBS 101883T  A.66T  A. ellipticus CBS 707.48T  A.

 Only values above 70% are indicated. Numbers above the branches  are bootstrap values.02 substitutions per nucleotide.          Supplementary Fig. S1. 0. Neighbor‐joining phylogenetic tree based on ITS sequence data for Aspergillus section Nigri. Bar.      Research paper III  ‐ III.8 ‐    .

 Neighbor‐joining phylogenetic tree based on partial beta‐tubulin gene sequence data for Aspergillus section Nigri. Bar. 0.02 substitutions per nucleotide. Numbers  above the branches are bootstrap values.            Supplementary Fig.      Research paper III  ‐ III. Only values above 70% are indicated. S2.9 ‐    .

65 . 5) A. auleatus CBS 172. japonicus CBS 114. CBS 127449 ..  L45  and  L15/AS19. 7) A. 8) A. homomorphus CBS 101889 .  Loaded  in  lanes:  1&2)  A. niger CBS  T T T T 554. ellipticus CBS 707.  S3.66 .  Universally  Primed‐PCR  analysis  using  each  of  the  two  UP  primers.            Supplementary  Fig.79 .  T  T T T saccharolyticus sp. 6) A. 4) A. nov.51     Research paper III  ‐ III. uvarum CBS 121591 .10 ‐    . aculeatinus CBS 121060 . 9) A. 3) A.

98 10.1363 Da Mm296.50 5.2166 Da % 12.      Mm616.0 200 6.50 6.62 11. Above is the ESI  trace (m/z 100‐ + 900) and below the UV trace (200‐700 nm.2287 Da 9. S4.55 4. CBS 127449 .43 0.00 7. Mono isotopic masses (Mm) of major peaks are inserted.0 2.02 0 2. Extrolite profile from YES agar (14 days 25°C) of A.50 15.05 0.50 T 15.06 Mm312.56 ACU‐1 Mm315.00 7.2797 Da 9.     Research paper III  ‐ III. with identical UV spectra is also inserted.74 7.0 6.1950 Da 4.00 242 12.00 346 ACU‐2  Mm218.2320 Da Mm294.16 6.50 5.1268 Da AU 4.38 0.52 AU 0.16 10.07 Mm236.0 4.0 0.03 8.10 225 250 275 300 9.1799 Da 8. 0. nov.00   + Supplementary Fig.04 0.05 min ahead of ESI ).11 ‐    . saccharolyticus sp.00 Time (min) 12.0×104 Mm317.41 325 350 nm 375 400 425 450 2. The UV spectrum of  two related compounds.50 10. ACU‐1 and ACU‐2.

      .

 Lübeck    Intended for submission to Applied and Environmental Microbiology    . and Peter S.Research paper IV      Cloning. Ahring. Mette Lübeck. David E.   Kenneth S. Culley. Wimal Ubhayasekera. expression. Bruno. Birgitte K. and characterization of a novel highly  efficient beta‐glucosidase from Aspergillus saccharolyticus      Annette Sørensen.

.

beta-glucosidases hydrolyze the short cellodextrins and cellobiose to glucose (3. BGL1. WA 99532.  USA2. Lund University. Richland. pNPG. MAX‐lab. The enzyme was able to hydrolyze cellobiose. and beta-glucosidases (EC 3.1. from aspergilli and other filamentous fungi (13. hereby lowering the concentration of cellobiose and cellodextrins that are inhibitors of cellobiohydrolases and endo-glucanases (3. respectively. purified. S‐221 00 Lund.4. BGL1 was identified as belonging to GH family 3.aau.  Aalborg  University. finding retaining enzyme characteristics and. 15. respectively. Richland.  Copenhagen  Institute  of  Technology. yielding fractions with high beta-glucosidase activity and only one visible band on SDS-page gel.2.  Mailing  address:  Section  for  Sustainable  Biotechnology. 12. Lübeck1*  Section for Sustainable Biotechnology. Center for Biotechnology and Bioenergy. obtaining a 2919 bp genomic sequence coding for the BGL1 polypeptide.9 mM. Lautrupvang 15. Phone: +45  99402590.   Kenneth S. Bruno5. The bgl1 gene was heterologously expressed in Trichoderma reesei QM6a. Cellulose is the most abundant renewable biomass available on earth. DK‐2100 København Ø. *Corresponding  author. was identified in the solid state enzyme extract from the new species Aspergillus saccharolyticus. The beta-glucosidase gene. Aalborg University. University of  Copenhagen. PO box  999.2. Mette Lübeck1. including T.  Cloning. Cellobiohydrolases processively hydrolyze cellulose from the ends releasing cellobiose. Characterization of different purified beta-glucosidases is part of the search for new and more efficient enzymes for the biotech industry.2. reesei. and Aspergillus niger which has GRAS status is used industrially (46). the enzyme was inhibited by glucose with a 50% reduction in activity at glucose concentrations 30 times greater than the pNPG concentration. Wimal Ubhayasekera3. saccharolyticus previously reported by our lab. LC-MS/MS analysis of this band gave peptide matches of aspergilli beta-glucosidases.4). Through homology modeling. 35). Pacific Northwest National Laboratory. while endo-glucanases hydrolyze the amorphous regions thereby creating more ends for the cellobiohydrolases.1. and characterized by enzyme kinetics studies. Hydrolysis of cellulose is completed through their synergistic actions. Email: psl@bio. 22. of Aspergillus saccharolyticus was cloned by PCR using degenerate primers followed by genome walking. expression. and Peter S.74). the enzyme was stable at 50°C and at 60°C it had a halflife of approximately 6 hours. niger beta-glucosidases and Trichoderma reesei cellulases perform well in hydrolysis of cellulose. interestingly.dk  Beta-glucosidases are of great industrial interest in relation to efficient hydrolysis of lignocellulosic biomass into glucose. USA5  A novel beta-glucosidase. Ahring1. Several beta-glucosidases have been purified and/or cloned. which has been used extensively for industrial enzyme production. a 3D structure was proposed. It has been known for a long time that the combination of A. DK‐ 2750 Ballerup. Finally. A number of these beta-glucosidases have been expressed in heterologous hosts. Lautrupvang 15. Aspergilli are known to be good beta-glucosidase producers (56). Box 118. Denmark. 55). 7. and cellodextrins. Generally the kinetics observed for the pure BGL1 enzyme resembled those of raw extract of A. and characterization of a novel highly  efficient beta‐glucosidase from Aspergillus saccharolyticus  Annette Sørensen1.21). BGL1. Washington State University. 16) .1.2.2. bgl1.1 ‐    . David E. Copenhagen Institute of Technology. Culley5.2. WA 99354.  Institute of Medicinal Chemistry. Birgitte K. a more open catalytic pocket compared to other beta-glucosidases. Vmax and KM for cellobiose were determined to be 45 U/mg and 1. Ion exchange chromatography was used to fractionate the extract. which has 91% and 82% identity with BGL1 from Aspergillus aculeatus and BGL1 from Aspergillus niger. 33. The pH optimum was 4. The genomic sequence includes 6 introns and 7 exons resulting in a 860 aa polypeptide. Denmark1. Three main players are involved in the hydrolysis of cellulose: cellobiohydrolases (EC 3. with increased rates of glucose production compared to the use of any one of the components alone (51). 25. where especially enzymes with high specificity towards cellobiose and enzymes that function at high temperatures are Research paper IV  ‐ IV. Sweden3. endo-glucanases (EC 3. Universitetsparken 2. Using pNPG as substrate. 2750 Ballerup. Denmark4.

and characterize the most prominent betaglucosidase from A. thermostability..6. Germany. 11mg/l H3BO3. beta-glucosidase. 4% Lithium dodecyl sulphate. pAS3gBGL1. Genomic DNA of A. Isolation and cloning of beta-glucosidase gene. 5mg/l FeSO47H2O. which are most abundant in the fungal genomes (11). The start and stop codon was predicted by NCBI blast comparison and the GenScan Web server (http://genes.7mg/l CoCl26H2O. An alignment of these sequences was made with BioEdit (http://www.nih. 120rpm.025% Brilliant blue G250. 5 CV sample (approx 0.05.matrixscience. alkaline phosphatase (fastAP). 15g/l agar. and ability to hydrolyze cellodextrins. and preliminary structures from the hyperthermophilic bacterium Thermotoga neapolitana (40) and the yeast Kluyveromyces marxianus (59). A cassette comprising Magnaporthe grisea ribosomal promoter RP27. 2mM EDTA di-sodium. nutraceuticals or pharmaceuticals because of their biosignaling. RNA was prepared from 4 day old fungal spores and mycelium grown on plates containing 20 g/l wheat bran. Inc). 0. and 50mg/l Na2EDTA) in a 500 ml baffled flask was inoculated with fresh T.ncsu. The gel was stained with ClearPAGE Instant Blue stain by placing the gel in a small container.N. A.8M Triethano amine pH 7. adding the Instant Blue stain till the gel was covered. and sample analysis was carried out by The Laboratory for Biotechnology and Bioanalysis 2 (LBB2).gov/Blast. 1M NaCl) reaching 70% of the total volume. as described below. 0. The mycelium was collected on double folded Miracloth (Andwin scientific) and washed with sterile water. Based on the Aspergillus aculeatus peptide match found in the LC-MS/MS analysis. The mycelium was suspended in 20 ml protoplasting solution (1. saccharolyticus was isolated as described in research article II. bgl1. 3 g/l NaNO3. and terminator specific primers. The GH3 enzymes. this thesis. Mass Spectrometry and Protein Identification. Gradient elution was carried out over 30 CV with buffer B (Tris buffer pH 8. The primers were used in polymerase chain reaction (PCR) with genomic DNA and RUN polymerase (A&A Biotechnology).nlm. The plasmid pAN7-1 containing the E. the corresponding full length beta-glucosidase protein (GenBank: BAA10968) was submitted to a NCBI blast search in the protein entries of GenBank (http://blast. 2 g/l peptone. The trypsin digestion. 1.B. saccharolyticus. 0. Fungal betaglucosidases are classified into glycosyl hydrolase (GH) family 1 and 3. and 10% 10x reducing agent (20mM DTT) and heating for 10 min at 70°C.8 as described in research article II. The aim of this work was to identify. pH 7. In a recent study. The column was finally washed with 5 CV buffer B and reequilibrated for the next run with buffer A. 0. We report the molecular cloning of the novel beta-glucosidase gene. Pullman.025% Phenol red). Plasmid Midi Kit. The final cloning vector. and Neurospora crassa beta-tubulin terminator was constructed using PCR cloning techniques and was cloned into the PciI site of pAN7-1.mit. Washington State University. MATERIALS AND METHODS Fungal strain and enzyme extract preparation. PCR was performed using proofreading WALK polymerase (A&A Biotechnology). 10 g/l NaCl. 6 g/l NaNO3. thereby obtaining the full genomic sequence of the gene. one from barley (53). are less well characterized than their GH1 homologues and only a few crystal structures have been solved. Protein quantification was done using the Pierce BCA protein assay kit microplate procedure according to manufacturer’s instructions (Pierce Biotechnology). this thesis. saccharolyticus was fractionated by ion exchange chromatography using an ÄKTApurifier system with UNICORN software. using ClearPAGE two-color SDS marker for band size approximation. 25% 4xLDS sample buffer (40% glycerol.2 M MgSO4. the beta-glucosidase genomic DNA gene. 15 g/l agar. Assays for beta-glucosidase activity and protein quantification. 4% Ficoll-400. obtaining a fragment of approximately 950 bp.  of interest. Billerica. 50 mM NaPO4 pH 5. isolate. Transformation and identification of active recombinant betaglucosidase in T. 1.01 g/l FeSO47H2O. The promoter and terminator were from plasmid pSM565 (10) and the beta-glucosidase gene was from A. Aspergillus saccharolyticus was found to produce beta-glucosidases with more efficient hydrolytic activity compared to commercial beta-glucosidase containing preparations. while restriction enzymes (fast digest PciI). saccharolyticus CBS 127449T was initially isolated from treated hard wood (Research article III. 1. recognition.cgi) to identify similar beta-glucosidases. MA) as described in their former publication (37). USA. A solid state fermentation enzyme extract of A. 1. 1 g/l casamino acids. this thesis) and routinely maintained on potato dextrose agar.S. From several rounds of genome walking (18). beta-glucosidases themselves are also of great interest as versatile industrial biocatalysts for their ability to activate glucosidic bonds (transglycosylation activity) facilitating synthesis of stereo/region-specific glycosides or oligosaccharides. The band was excised from the gel and sequenced using the sequencing service at MWG.edu/GENSCAN. with gently shaking. followed by shaking the gel gently for 10-30 minutes till desired band intensity was achieved. and in-gel digestion was performed as described by Kinter and Sherman. reesei. 1 g/l yeast extract. 2000 (29).A. Scientific Company. 6N HCl. These may be useful as functional materials. is sketched in Fig. 0. No destaining was performed. The Mascot search engine (www. but the gels were washed a few times in ultrapure water.Z. pH optimum. The cells were disrupted by bead beating (2x 20sec) in Fenozol supplied with the Total RNA kit (A&A Biotechnology) and RNA purified following the kit protocol. 5 g/l yeast extract. Omega Biotech). HiTrap Q XL 1 ml anion column (GE Healthcare) was run at a flow rate of 1 ml/min.5 mg protein/ml) was loaded onto the column.html) to identify conserved regions. Research paper IV  ‐ IV. 1 g/l K2HPO4. 0.52 g/l KCl.2 ‐    . saccharolyticus was prepared as described in research article II. 0.html). coli hygB resistance gene was donated by Peter Punt (University of Leiden. The enzyme extract of A. and at present there is no structure available from filamentous fungi (11). 5 CV of buffer A (Tris buffer pH 8) was used to equilibrate the column. 1.5) with ampicillin selection (100ppm). and a model prediction of its structure. The Netherlands) (41). 22mg/l ZnSO47H2O. Betaglucosidase activity was assayed using using 5mM p-nitrophenyl-beta-Dglucopyranoside (pNPG) (Sigma) in 50mM Na-Citrate buffer pH 4.5mg/l Na2MoO42H2O. glucose tolerance. or antibiotic properties (48). The novel beta-glucosidase was expressed in T. and ligase (T4 DNA ligase) were from Fermentas.mbio. An overnight culture with a correct transformant was prepared and the constructed cloning vector purified the following day (E. cDNA was prepared from total RNA using First strand cDNA synthesis kit and random hexamer primers (Fermentas). six histidine residues. reesei conidia reaching a concentration of 106 spores per ml and incubated for 16-22 hours at 30°C. Sample preparation and electrophoresis was performed using ClearPAGE precast gels and accessories (C. Degenerate primers were designed using the CODEHOP strategy (44): forward primer: 5’CACGAAATGTACCTCtggcccttygc and reverse primer 5’CCTTGATCACGTTGTCGccrttcykcca. Washington.52 g/l MgSO47H2O.6mg/l CuSO45H2O. reesei for purification and the enzyme was then characterized by Michaelis-Menten kinetic studies. Samples were prepared by mixing 65 vol% protein. 1987 (39). 100 ml complete medium (10 g/l glucose. 25 µl of each sample were loaded on a ClearPAGE 4-12% SDSgel. Aliquots of 1ml were collected and assayed for beta-glucosidase activity as well as quantified in terms of protein content. coli Top 10 competent cells (prepared using CaCl2 (45)) and plated on LB plates (10 g/l bacto tryptone.8) with 60mg VinoTaste Pro (Novozymes A/S) enzyme per ml. Bands of interest were excised from the gel.com) was used to search the peptide finger prints against predicted peptides in the NCBI database with the significance threshold p<0. this thesis. Protoplast preparation of T. reesei QM6a was carried out similarly to the procedure described by Pentillä et al.5 g/l KCl. where analysis was performed by LC-MS/MS using LC Packings Ultimate Nano high-performance liquid chromatography system (with LC Packings monolithic column PS-DVB) and Esquire HCT electrospray ion trap (Bruker Daltonics. 5mg/l MnCl24H2O. In addition to being indispensable for an efficient cellulase system. this thesis). 20 g/l corn steep liquor.edu/BioEdit/bioedit. Correct transformants were checked for by colony PCR using several different promoter.52 g/l KH2PO4.ncbi. followed by a 2 CV wash with buffer A. The construct pAS3-gBGL1 was transformed into E. and was by NCBI blast found to be related to other aspergilli betaglucosidase fragments. 0. Electrophoresis. using bovine serum albumin as standard. saccharolyticus genomic DNA. especially with regard to thermostability (Research article II.5 g/l MgSO47H2O. Fractionation by ion exchange chromatography. the flanking regions were characterized.

The intensity of this band in the different fractions followed the measured beta-glucosidase activity. The protoplasts were overlaid with ST buffer (0. niger (GenBank CAB75696). 3 g/l NaCitrate 2H2O. this thesis. 180rpm for five days. 6 g/l (NH4)2SO4. From SDS-page.000 rpm for 10 min and assayed for beta-glucosidase activity using the pNPG assay described earlier. saccharolyticus beta-glucosidase with that of the T. incubated at 30°C. 160 rpm for 6 days. 65 rpm. with PDB entry 2X40 (40) as the template in the program SOD (30). Purification of expressed beta-glucosidases. so positive transformants were identified by the presence of beta-glucosidase activity. The model is available upon request from the authors.5 g/l MgSO47H2O. 0. The best match was the beta-glucosidase of A.4) and the peak (1 CV) collected by monitoring the absorbance.5M NaCl. with five peptide matches.  1. but without sorbitol. The his-tagged beta-glucosidases were eluted with 3 CV elution buffer (20mM sodium phosphate.  lac promoter M13 rev primer PciI (10082) Beta-tubulin terminator His tag gpdA promoter Beta-glucosidase gene pAS3-gBGL1 sketch 10439 bp Hygromycin resistance gene RP27 promoter PciI (6402) TrpC terminator M13 (20) fw primer lacZ ampR promoter Ampicillin resistance gene Assays for characterization of purified beta-glucosidases. 3g/l NaNO3. 1g/l K2HPO4. (6)). 10 g/l KH2PO4. using a HisTrap HP 5 ml anion column (GE Healthcare). 182 g/l sorbitol (final 1M). 2 mg/l CaCl22H2O. centrifuged at 10. one dominating band of approximately 130 kDa was discovered in these fractions (Fig. glucose tolerance. 2). The model was adjusted in O.0 M sorbitol. Using the HisSpin Trap kit (GE Healthcare).  pAS3‐gBGL1:  pAN7‐1  modified  with  a  cassette  of  RP27  promoter. The proteins in this band were found to be highly expressed relative to other proteins in the raw A. No beta-glucosidase activity was found in this initial flow-through. Protein content could be measured in all fractions. and cellodextrin hydrolysis were carried out as described in research article II. filtered through a 0. run at a flow rate of 5 ml/min. saccharolyticus. 10mM CaCl2 2H2O. 2). the wild type QM6a showed no significant activity. saccharolyticus extract (Fig. 500mM imidazole. Multiple sequence alignments were used to generate the best pair-wise alignment of the A. 200 µl protoplasts. and 50 µl PEG1 (25% PEG 6000 in STC buffer) were mixed gently and incubated on ice for 20 min. Protoplasts were collected from the interphase and washed twice with STC buffer (1.6 M sorbitol.4). 5 mg/l FeSO47H2O. This pair-wise alignment was the basis of creating a homology model. finally resuspending in STC buffer at a concentration of approximately 5x107 for immediate use in transformation. saccharolyticus extract The enzyme extract of A.5 g/l KCl. 100 ml sample was loaded onto the column. and washed with a few ml protoplasting solution. At these conditions. 0. using rotamers that would improve packing in the interior of the protein. 1. analyzed by LC-MS/MS. The transformant having shown the greatest beta-glucosidase activity was cultured in 150 ml growth medium (specified above) in a 500 ml baffled flask. including A.01 g/l FeSO47H2O) in 50 ml Falcon tubes and incubated at 30°C. pH 7. The supernatant was centrifuged at 10. pH 7. was added. 20% the volume of protoplasting solution) and centrifuged at 1000g for 10 min. fumigatus (NCBI ref seq XP_750327). bgl1. aculeatus (Swiss-Prot: P48825). then filtered through double folded Miracloth. where three 0. the optimal imidazole concentration for purification of the histidine tagged beta-glucosidases was found to be 0 mM imidazole. The sample was identified as a beta-glucosidase. 0.5cm agar plugs of the transformants were added to 10 ml growth medium (20 g/l wheat bran. intercepted by six introns located at 58- FIG.4 mg/l ZnSO4H2O. Similar betaglucosidase catalytic domain structures were obtained from the Protein Data Bank (PDB. 20 g/l corn steep liquor. but passed through prior to the start of the gradient elution. Michaelis Menten kinetics. A. 50mM CaCl2. Aliquots of 1 ml were plates in recovery agar (1 g/l MgSO47H2O. saccharolyticus produced by solid state fermentation on wheat bran.000 rpm for 10 min.14-0. 2 ml PEG2 (25% PEG 6000. 10mM Tris-HCl pH7. trypsin digested. then superimposed and compared with the program O (24). Only the results for the beta-glucosidase peptides were used for degenerate primer design to obtain the homologous beta-glucosidase of A. These fractions with eluted betaglucosidase were calculated to have a NaCl concentration of approximately 0. pBR322 origin of replication   RESULTS Identification of beta-glucosidase in A. 0. 10 µl plasmid DNA (>1µg).  beta‐glucosidase  gene  bgl1. Besides of beta-glucosidase peptides. termostability. 3). aculeatus.5M NaCl. followed by addition of 4 ml STC buffer.5x0. following the protocol supplied with the kit. 0. followed by washing with binding buffer till the absorbance reached the baseline.23M.6 mg/l MnSO4H2O.5).0) (approx. 2). investigating the beta-glucosidase activity and protein content of each fraction (Fig. and searched against the NCBI database for peptide matches using the Mascot program. Sequence comparisons and homology modeling. 15 g/l agar) with 100ppm hygromycin as selection. and A.  and  beta‐ tubulin terminator inserted at the PciI restriction site. 10mM Tris-HCl pH 7. terreus (NCBI ref seq XP_001212225). The supernatant was collected. pH optimum. 1.  his‐tail. BGL1 By the use of degenerate primers and genome walking. The fractions displaying the greatest beta-glucosidase activity were the fractions #15-17 (Fig. The figure was prepared using O. For transformation. and the plates were incubated for another 2-4 days before colonies that had surfaced were picked and carried through multiple retransfers and streaking on selective medium to obtain pure colonies. Research paper IV  ‐ IV. Characterization of beta-glucosidase gene.4. A.1M Tris-HCL pH 7. also peptide matches of beta-galactosidase from different Aspergillus species were found suggesting that the analyzed band contained more than one protein. Approximately 25% of the proteins did not bind to the column. a top layer of the above described agar. neapolitana betaglucosidase 3B. again with 100ppm hygromycin.22 µm filter (Millipore) and pH adjusted to 7. The band of fraction 16 was excised from the gel. The sequence comprises seven exons.3 ‐    . The his-tagged beta-glucosidases were purified on the ÄKTApurifier system with UNICORN software. and predicted protein. the genomic coding sequence of bgl1 of 2919 base pairs (incl stop coden) was obtained (GenBank HM853555). The following day. and incubated at 28°C over night.5) was added and incubated 5 min at room temperature. MOLSCRIPT (32) and Molray (19). The column was equilibrated with 5 CV of binding buffer (20mM sodium phosphate. 0.  Sketch  of  the  cloning  vector.  incubated for 2-4 hours at 30°C. Sequences similar to BGL1 were located by BLAST (1) in the protein entries of GenBank (5) and aligned using hidden Markov models (26) and CLUSTAL W (52). Identification of positive transformants was done by a simple pNPG activity screen. 10 g/l glucose. was fractionated by ion exchange chromatography. having peptides identical to several aspergilli species.

aculeatus (GenBank BAA10968) (27) and 82% identity with betaglucosidase BGL1 from A. The molecular weight of 130 kDa observed by SDSpage therefore probably reflects extensive glycosylation. but from the NetNGlyc 1. The observed MS/MS data matched the expected data. -1294.0 0. which all followed the GT-AG rule at the intron/exon junctions. of the mature BGL1 of A. A signal peptide with a cleavage site between amino acid 19 and 20 was predicted by SignalP server (4.  Alignment  of  proposed  active  site  region  (boxed)  of  different  aspergilli  GH3  beta‐ glucosidases.5 1. and several CreI sites at positions -145.020 0. -1186. predicting the signature sequence to be between amino acids 248-264 (LLKSELGFQGFVMSDWGA) in the mature protein. thus confirming that the cloned bgl1 gene codes for the protein present in fraction 16. 263-313.  lane  1)  A. The putative nucleophile. Alignment of the amino acid sequence of BGL1 from A.5 1.140 0.  lane  3) His‐tag purified BGL1    FIG. Beta‐glucosidase activity and protein content of the different fractions from ion exchange. 468-523.0 Fraction# FIG. 2636-2685 bp. Asp261. Fractions 2‐6 are flow through from the load.0 0.96 and the molecular mass was calculated to 91 kDa using the ExPASy Proteomics server (17).  lane  2)  fraction  #16  from  the  ion  exchange  fractionation.  Beta‐glucosidase activity 3. This prediction does not relate to the size of the band in fraction 16 (Fig.    119. 2. 359-414. saccharolyticus with several aspergilli glycosyl hydrolase (GH) family 3 beta-glucosidases revealed a high degree of homology in highly conserved regions including the catalytic sites (Fig. 3). Analysis of the amino acid sequence of BGL1 resulted in 91% identity with beta-glucosidase BGL1 from A. The pI of BGL1 was calculated to 4.0 (54) and confirmed by mRNA isolation and sequencing of the derived cDNA. the GenBank accession number is given in parenthesis. and -1313 were identified upstream of the start codon. and PROSITE scan (49) confirmed the presence of a GH family 3 active site in BGL1.080 0. predicted by NetAspGene 1. The gene encodes a 860 amino acid polypeptide. A TATA-like sequence at position -138 bp. a CCAAT box at position –695 bp. niger (NCBI ref seq XM_001398779) (38).1) (27) and 75% identity with bgl1 A.0 server (9) BGL1 has 12 asparagines that are potential N-linked glycosylation sites.   FIG.160 0.060 0. fractions 7‐8 are  wash prior to gradient elution. 4).  3.  SDS‐page  12‐20%. 36).5 0. -619. and fractions 39‐45 are final column stripping. aculeatus (GenBank D64088. 1716-1776.120 2.100 0. niger (NCBI ref seq XP_001398816) (38).4 ‐    .0 0.  4. fractions 9‐38 are gradient elution. BGL1.  saccharolyticus  raw  extract.    Research paper IV  ‐ IV. Analysis of the predicted cDNA gene sequence revealed 85% identity with bgl1 from A. The previous MS/MS data of the band in faction 16 was by use of Mascot searched against possible trypsin fragments and expected MS/MS patterns of the BGL1 sequence.000 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 Reaction rate (µmol/min)/ml Protein mount (mg/ml) 2.040 0. Top right corner: SDS‐page 4‐12% of fractions  14‐23 with high beta‐glucosidase activity.

  Ribbon  cartoon  representation  of  the  catalytic  module  showing  the  important  residues  for  catalysis  (in  royal‐ blue) and substrate/product binding (in spring‐green).8 mg purified protein was obtained from 100 ml filtered culture extract. saccharolyticus beta-glucosidase. A Hanes plot of the cellobiose data gave a good distribution of the data points for preparation of a straight trendline from which Vmax and KM were determined to be 45 U/mg and 1. The calculated half-lives at different temperatures were plotted in a semilogarithmic plot vs. BGL1.    Research paper IV  ‐ IV. Meanwhile. 6A). 7A). Using a Ni-sepharose column. the enzyme was stable throughout the incubation period (data not shown). BGL1 was incubated at different temperatures for different time periods to investigate the thermostability and half-life of the enzyme. when pNPG in high concentrations was used as substrate.7% of the total amount of protein in the culture extract. An SDS-page gel of the eluent showed two bands (Fig. 6B).  saccharolyticus  (in  steel‐blue)  with  the  template  structure  from  T.  neapolitana  (PDB  entry  2X41)  (in  orange‐red). the his-tagged proteins were purified from an extract of the transformant. This was observed by a decrease in reaction rate with increasing substrate concentration rather than a leveling off toward a maximum velocity (Fig. The pH span of BGL1 was examined at 50°C using pNPG as substrate. and with temperatures around 60°C the calculated half-life is approximately 6 hours (Fig. showing a reduction in activity to 50% at a product concentration 30 times greater than the substrate concentration (Fig. The enzyme is fairly stable at temperatures up to 58°C at 4 hour incubation (Fig.9 mM. was 65. the temperature that gives a half-life of 1 hour. and within the pH range 3. reesei from the constitutive RP27 ribosomal promoter. 7A). Stereo diagram illustrating the comparison of beta‐glucosidase  homology  model  of  A. At regularly used hydrolysis temperature of 50°C. respectively. one correlating in size with the band found in fractions 15-17 in the initial fractionation of the A. showed no beta-glucosidase activity at the culture and assay conditions used.  The  catalytic nucleophile (D261) and the acid/base (E490) are shown in gold. Glucose (in gray) is  modeled  into  the  catalytic  site.  The  part  of  the  loop  marked  ‘Y’  is  not  modeled. temperature (Fig. 6A). catalytic module possesses a fold similar to that of beta-glucosidase 3B from T. where the reaction rate tends towards the maximum velocity (Fig. Heterologous expression of bgl1 by T. reesei The bgl1 gene was heterologously expressed in T. 5). a MM kinetics relationship was found for cellobiose.  A. which corresponded to about 2.  saccharolyticus is located in this region (20).8 the   FIG 5. neapolitana with 5 deletions and 8 insertions compared to it (Fig. The data forms a straight line.8-4. saccharolyticus extract (approximately 130 kDa) and another that was smaller (approximately 90 kDa) correlating with the predicted size of the protein. 5A). Positive transformants were selected by simple pNPG assay. Homology model of the catalytic module of beta‐glucosidase.2.3°C. wild type QM6a. From 62 °C and up to 65 °C there is a gradual decrease in the half-life to less than 2. where the negative control.5 ‐    . Glucose inhibition was investigated with pNPG as substrate. These results imply that BGL1 is a novel beta-glucosidase belonging to GH family 3. BGL1. 3.5 hours. A substrate saturation plot of BGL1 revealed inhibition of the enzyme reaction. B.  from  Aspergillus  saccharolyticus. The transformant identified from the screening to have the highest beta-glucosidase activity was confirmed by PCR to have the expression cassette incorporated into its genomic DNA. Although the sequence identity is relatively low (35%) it is obvious that the residues important for substrate binding and catalysis are conserved (Fig. and the thermal activity number of BGL1. Its profile gives the typical bell-shape curve with an optimum around pH 4. Homology modeling studies show that A. Characterization of the purified BGL1 The purified BGL1 was characterized by its activity on pNPG and cellobiose. 7B). 3).

 10 min reactions. These observations of the different cellodextrins increasing in concentration over time related to their length suggests that the enzyme hydrolyzes the different cellodextrins through exohydrolase action. removing one glucose unit at the time releasing glucose and the one unit shorter product before it associates with another substrate. Later. -pentaose.    25 activity stayed above 90% of maximum. G5= cellopentaose. pNPG and cellobiose. temperature at which the half life is one hour. calculated for temperatures above 60°C. activity was below 10%. -tetraose. C) pH profile of BGL1 assayed at 50°C.6 ‐    . At alkaline conditions. G3=  cellotriose. an increase in cellotetraose is observed. A) Thermostability of BGL1 incubated at different temperatures for different time period followed by assaying at 50°C. where only data for cellohexaose hydrolysis is shown here (Fig. T½= half‐ life.8.  The x‐axis intercept indicates the thermal  activity number.  Research paper IV  ‐ IV. as the level of cellohexaose decreases.  FIG. the concentration of primarily cellopentaose and glucose increase. varying pH. Initially. as the concentration of cellopentaose has increased. 8. The ability of BGL1 to hydrolyze short chains of glucose units was studied with cellohexaose. B) Semi‐logarithmic plot of calculated half life at different temperatures. 6. indicating that the enzyme hydrolyzes the different cellodextrins depending on the concentration in which they occur. A) Substrate saturation plot where enzyme activity is related to substrate concentration with the two substrates. 8). showing that acidic pH values are better suited for enzyme activity (Fig.    FIG. B) Relative beta‐ glucosidase activity at different inhibitor concentrations with a substrate concentration of 5mM pNPG. 20 G1 G2 G3 G4 G5 G6 15 Conc (uM) 10 5 0 0 5 10 15 20 Time (min) 25 30   FIG. 10 min reactions. G4= cellotetraose. 7C). -tetraose. G2= cellobiose. G6= cellohexaose. Similar results were obtained using cellopentaose. pH 4. Snap shot at different time points of the hydrolysis of cellohexaose  for analysis of the degradation pattern. and –triose as initial substrates. and triose. G1= glucose. 7. rather than processively cleaving off glucose units.

Initially. MS/MS peptide analysis followed by molecular techniques were here employed for the identification and cloning of beta-glucosidases from A. reesei in order to purify the enzyme for a specific characterization. but still low compared to the secretion capacity of T. saccharolyticus followed by LC-MS/MS analysis of the dominating protein band in the fractions with high beta-glucosidase activity. Assuming the pI of the secreted A. 36).g. The host strain was transformed with the non-linearized plasmid for random insertion. japonicus (14). reesei secreted the heterologously expressed BGL1 in two different forms represented by the two bands on the SDS-page gel of the histidine-tag purified proteins. This was applied for the identification of active beta-glucosidases from A. peptides of a beta-glucosidase and a beta-galactosidase were identified in the protein band that was dominating in the protein fractions with high beta-glucosidase activity. Interestingly. an anion column was chosen for ion exchange using Tris buffer pH 8. 58). gene. A. crassa beta-tubulin terminator to control expression of the gDNA clone of bgl1. the large band being glycosylated to the same extent as found in the A. and terminator from different eukaryotes. Ion exchange separates molecules on the basis of differences in their net surface charge. promoter. The betaglucosidases of A. matching the active site signature (11. CREI. reesei (35). niger (GenBank: XP_001398816) to which it is most closely related. saccharolyticus beta-glucosidases are in the same range. The net surface charge of proteins will change gradually as pH of the environment changes (2). we used ionexchange fractionation of the raw enzyme extract of A.0 server (4. saccharolyticus BGL1 is due to regular substrate inhibition Research paper IV  ‐ IV. BGL1. niger (33. oryzae beta-glucosidase for improved cellulose conversion (34). Aspergilli are known to possess several betaglucosidases in their genomes. and the smaller band correlating with the predicted molecular mass thus not being glycosylated. thereby successfully combining host. supporting this assumption. reesei QM6a using the constitutive M.7 ‐    . saccharolyticus BGL1 to other Aspergillus beta-glucosidases. the beta-glucosidase was successfully cloned. indicating that it had not been a pure band. aculeatus (GenBank: BAA10968) and A. as proteins will bind to an anion exchanger at pH above its isoelectric point (2). This is significantly greater than the expression levels reached with T. while several have been expressed by E. aculeatus and A. We here present heterologous expression of bgl1 from A.8mg/100ml from 6 days cultivation of the best transformant. 20). emersonii beta-glucosidase (35). giving recombinant protein yields of 3. it appeared that T. cel3a cDNA. Postsecretional modification of glycosylated proteins expressed by T. By genome walking. the predicted polypeptide size of the cloned beta-glucosidase was only 91 kDa compared to the approximately 130 kDa band seen in the SDS-page gel. BGL1 is classified as a broad specificity beta-glucosidase as it can hydrolyze both aryl-beta-glycosides. reesei (34). With this approach we intended to identify the key beta-glucosidase player amongst the potential several expressed betaglucosidases of A. BGL1 was based on its amino acid sequence characterized as belonging to the GH family 3. from the novel species A. and the size of its cDNA corresponded well with the beta-glucosidases of A. reesei is medium dependent. saccharolyticus did bind to the column at these conditions. which has also been seen with beta-glucosidases from Talaromyces emersonii expressed in T. reesei were used (35). of T. saccharolyticus. A. Only the identification of the beta-glucosidase was further pursued. Comparing the properties of A. calculated to around pH 5. but rather had it contained both a beta-glucosidase and a beta-galactosidase of A. and cellooligo-saccharides (8). reesei. saccharolyticus. Whether the inhibition of A. CREI is known to be involved in carbon catabolite repression of many fungal cellulase genes. with the effect on extracellular hydrolases being most dominating in enriched medium (50). niger has 11 GH3 betaglucosidases predicted (38) of which 6 were identified as extracellular proteins by the SignalP 1. coli. Five putative CreI sites were found within the 1350 pb sequence upstream of the gene obtained by genome walking. 47. saccharolyticus (Research article III. 33. this thesis) and expressed it in T. putative binding sites for the cellulose regulatory protein. using ExPASY proteomics server (17). saccharolyticus. Several GH3 beta-glucosidases have been cloned and characterized. correlating well with the above. fumigatus (28). saccharolyticus by T. One example of expression by T. From LC-MS/MS analysis.96. Several potential N-glycosylation sites were identified for BGL1. cellobiose. The isoelectric point (pI) of the 6 predicted A.  DISCUSSION We have cloned a beta-glucosidase. and analysis of the later deducted amino acid sequence of BGL1 was calculated to have a pI of 4. It is speculated that these two different bands represent different degrees of glycolysation. reesei is the beta-glucosidase. Based on interest in obtaining knowledge of regulation of bgl1 expression in A. 14. the observed inhibition at high pNPG substrate concentrations has also been reported for A. e. saccharolyticus. emersonii where the chb1 promoter and terminator of T. were searched for upstream of the bgl1 gene. possibly explaining the different forms of the recombinant BGL1 beta-glucosidases.. grisea ribosomal promoter RP27 and the N. reesei production strain by Novozymes A/S expressing A. and some by Yeast (8). Glycosylation of beta-glucosidases is common (13. with no activity found in the initial flow through fractions. 23. saccharolyticus secreted BGL1. Another example is the T. 35) and it was therefore assumed that the SDS-page gel size estimation of the protein was mislead by glycosylation that makes the protein run slower in the gel. However. saccharolyticus. but few studies have been published on heterologous expression by T. Proteomics is useful for the identification of secreted proteins and have been used for the identification of betaglucosidases of A. niger secreted beta-glucosidases (38) were.

with cellobiose as substrate in hydrolysis (Table 1) (22. 2006. Therefore Vmax and KM were only calculated for cellobiose where the data correlated well with MM kinetics and a straight Hanes plot could be obtained for determination of the kinetic parameters.0  (58) A. or if transglycosylation occurs with pNPG playing the role of the nucleophile competing with a water molecule in breaking the enzyme-product complex.8 ‐    . 2000. A. Hydrolysis of cellodextrins was facilitated by BGL1.. saccharolyticus BGL1 to be more thermostable compared with Novozym 188 from A. saccharolyticus BGL1 was significantly higher than values reported for other purified Aspergillus beta-glucosidases. and A.27  40. 4. 64%. A. Lys170. Comparison of Vmax values reported in the literature for hydrolysis of  cellobiose by purified beta‐glucosidases. After 4 hours of incubation these differences is much more pronounced as our BGL1 still had more than 70 % activity while Novozym 188 drop to 40 % activity at 60°C. after 20 hours incubation at 60°C (14). neopolitana beta-glucosidase to construct a homology model of the A. Jäger et al. The insertions and deletions lining the catalytic pocket (Fig. pH)    A. The deletion of loop X (Fig. tubingensis beta-glucosidase were remarkably stable.09 mM for the crude extract. A. neapolitana structure is considered to be important for substrate recognition (40). saccharolyticus. a striking similarity was found for the crude extract and the purified BGL1. japonicus (31). studied beta-glucosidases from A.0  (22)   A. 5. Acidic pH being best suited for beta-glucosidase activity was also found for beta-glucosidases from A. Lys163. Compared to this. of A..0  (22)   kinetics with an additional pNPG binding to the substrateenzyme complex hindering release of product. glucose tolerance. this thesis). The pure enzyme was inhibited by glucose to the same extent as the crude extract. However. 2001. However. 5A). phoenicis. from which BGL1 was identified. with KM values of 2-3 mM for A. Substrate inhibition (or transglycosylation activity) with pNPG was found in both cases. and total inactivation was observed after 2 hours at 70°C (22). this motif in the A.4  50. contradicting the findings of Dekker et al. tubingensis with optima ranging pH 4-5. oryzae. phoenicis. in the T. 10 % activity at 67°C after 2 hours of incubation.0  (22) A. this thesis). His171. Comparing the enzyme kinetics. japonicus. carbonarius. 43). as it retained more than 90% activity at 60°C and still had approx. niger. The crystal structure of a beta-glucosidase from barley has recently been used as template to construct a homology model of a beta-glucosidase from Penicillium purpurogenum where superimposition of the modeled structure on the true structure from barley showed similar orientation and location of the conserved catalytic residues (23). A.5  50. has previously been characterized by its betaglucosidase activity and evaluated against two commercial enzyme preparations (Research article II. which is similar to our results (Research article II. 4. saccharolyticus CBS 127449  49  50. niger. This is six times longer than measured by us and Rojaka et al. BGL1 had a KM value of cellobiose comparable with other reported values for Aspergillus beta-glucosidases.0  (42) A. 4. 5B) may play a major role in the dynamics of the enzyme. Tyr172 and Ile173. 2010. niger BGL of 24 hours at 60°C.. is more difficult to compare as different researches use different incubation conditions. A. japonicus and A. carbonarius. 2001. Meanwhile. There was therefore no foundation for the calculation of Vmax and KM for pNPG as no tendency of the activity approaching a maximum was seen rather the activity decreased with higher substrate concentrations. niger beta-glucosidase. saccharolyticus. whereas Krogh et al. is not known. having Ser370 described to have weak H-bonds with glucose in -1 subsite in T. 22. Decker et al. demonstrates that an A. respectively. 1. His164. saccharolyticus BGL1 showed approximately the same stability as A. Research paper IV  ‐ IV. indicate a half-life for A. Calculated KM values for cellobiose were similar. A. neapolitana structure. 2000. this thesis).  Table 1. and A. Val166. We found A. while activities of 87%. A. This all together indicate that BGL1 is the main contributor to the beta-glucosidase activity observed in the crude extract of A. showing KM varying from 1. niger NIAB280  36. niger. that similarly in exo-fashion removes one glucose unit at the time from the end of cellodextrins. carbonarius KLU‐93 15. similarly find half-life of A. and the mode of hydrolysis of cellodextrins was consistent. temperature and pH profiles. The motif KHFV. The crude extract of A. Korotkova et al. times and temperatures. Phe165. phoenicis expect for the total inactivation at 70°C. saccharolyticus enzyme is slightly different.. niger beta-glucosidase to be 8 hours at 55°C and 4 hours at 60°C (42). the pH and temperature profiles were very similar. 4.5-5.. Thermal stability.8  This work A. 31. aculeatus. Vmax. as has also been found with A. We chose to use the recently resolved crystal structure of a T. niger BKMF‐1305  38. and close to no activity at alkaline conditions (14. 1 mM for A.8  50. found A. 42.  Assay conditions  Reference Organism ID  Vmax  (U/mg)  (°C. phoenicis QM329  27. Rojaka et al. remained after 2 hours incubation at 60°C. 5B). and 53%. while Novozym 188 had 75% activity at 60°C but no activity at 67oC after 2 hours of incubation (Research article II. niger. respectively. finding them all to be stable at 2 hours incubation at 50°C.6 mM for A. A. and a general literature search by Jäger et al. saccharolyticus BGL1 and found that the conserved catalytically important residues show that the enzyme possesses beta-glucosidase activity (Fig. A. and cellodextrin hydrolysis.3  50. 2009. maintaining 85% and 90% activity. KHYI. while none was observed for cellobiose within the tested concentrations. 57). makes the catalytic pocket wider where this may be important for substrate accessibility as well as to remove the product fast from the enzyme. so that products released are subsequently used as substrates to be shortened by another glucose (47). carbonarius beta-glucosidases (22). japonicus beta-glucosidase to only retain 57% of its activity after incubation for 1 hour at 50°C (31). either heterologously expressed or  directly purified from extract of origin.. foetidus..9 mM for the purified BGL1 vs. while the Vmax value expectedly increased for the purified BGL1 compared to the crude extract. 4. niger (22). A. 1. 2006. phoenicis.. niger CCRC31494  5. however. the specific activity.

Microbiol. Bravdo. 12. N. Kraulis. Y. Kim. SAM-T04: What is new in protein-structure prediction for CASP6. Enzymatic-Hydrolysis of Cellulose . and O. NJ. Kjeldgaard. Chem. and J. M. Schaffer. T. D. Prediction of post-translational glycosylation and phosphorylation of proteins from the amino acid sequence. 37:D233-D238. Three-dimensional structure of the barley beta-D-glucan glucohydrolase in complex with a transition state mimic. P. and M. Duff. Decker. Microbiol. and L. 83:285-294. Peter Punt (University of Leiden. H. W. E. S. 34. 32. Z. Weissig. P. S. Jones. Gilliland. M.. N. Bernard. REFERENCES 1.. R.8Å displaying the general characteristic of a retaining enzyme. A. J. Fincher. 340:783-795. Biol. J. Morozova. M.4glucosidase from a newly isolated strain of Fomitopsis pinicola . Reczey. T. Jones. Zou. USA) is thanked for his help on analyzing LC-MS/MS data. I. Dordrecht. J.. N. L. J. T. niger (Novozym 188) as well as a high specific activity. Penttila. S. saccharolyticus. Lee. Marton. and J. I.. T. GenBank: update. C. C. 2000. Harris. P. Berman. Soriano. Purif. M. Bioconversion of forest products industry waste cellulosics to fuel ethanol: A review. B. A. M. J. J. Biotechnol. V. 366-367. P. von Heijne. we have successfully identified and expressed a novel highly efficient beta-glucosidase from the newly discovered species A. neapolitana (40) indicating possible high activity. Technol. Enzyme Microb. Cantarel. Z. Sweigard. 55:1-33. The enzyme has a great potential for use in industrial bioconversion processes due to its high degree of thermostability compared to the commercial beta-glucosidase from A.. G. The Biological Degradation of Cellulose.. Xiong. 32:D23-D26. E. S. Expression in Trichoderma reesei and characterisation of a thermostable family 3 beta-glucosidase from the moderately thermophilic fungus Talaromyces emersonii . Gammeltoft. 2004. 26. and T. B. P. Gattiker. J. V. A. Hughey. In J. B. 173:287-288. 27. Rossmann and E. Volume F: Crystallography of biological macromolecules. Nucleic Acids Res. A. and A. 571-607. S. 2006. 2004. T. D. and D. and V. 2002. K. World J. K. and J. Oh. p. Feng. T.. Merino. and J. M. Gene. M. Joo. J.. 19. The authors highly appreciate the advice and guidance on Trichoderma expression by Shuang Deng. 1991. 1997. Y. and T. 2010. O. Barnes. 1996. 6. Lombard.a web interface between O and the POV-Ray ray tracer. Bhat. P.. Kim. Aspergillus niger beta-glucosidase. 21. K. Sumitani. 17:455-461. 2004. 39:107-115. D. 20. and G. Brumbauer. J. 2001. D. M. J. 381:18-23. J. G. P. B. Lee. 24. A Classification of Glycosyl Hydrolases Based on AminoAcid-Sequence Similarities. and J. Gunasekaran. Microbiol. Cherry. T.0. 1997. B. Carroll. Visser. 28:235-242. 147-165. Dekel. Langston. Withers. Biol. P. Lipman. Henrissat. Collins. Ueda.. Semenova. Ion Exchange Chromatography and Chromatofocusing . V. J. 33. M. J. Fuller. Research paper IV  ‐ IV.. M. Gene. H. Katzman. 2000. Ostell. ACKNOWLEDGEMENTS We thank Professor Dr. 3. J. S. V.. J. Walker (ed. 353-356. Kleywegt. M. 2004. 74:569-577. A. Financial support from Danish Council for Strategic Research and DANSCATT is acknowledged. Brunak. J. A.). C. Kim. Bendtsen. Agric. Cloning. Coutinho. A.. M. M. 1991. 22. 10.9 ‐    . Bourett. Karplus. 2002. characterization. J. G. Beta-glucosidases from five black Aspergillus species: Study of their physico-chemical and biocatalytic properties. Appl. Production and characterization of beta-glucosidases from different Aspergillus strains. and R. G. S. Nielsen. Biofuels. G. Blom. J. 2004. Inc. K. J. M. 18. Coughlan. Characterization and kinetic analysis of a thermostable GH3 β-glucosidase from Penicillium brasilianum . Gupta. C. Varghese. Improved Methods for Building Protein Models in Electron-Density Maps and the Location of Errors in these Models. In Anonymous Protein Sequencing and Identification Using Tandem Mass Spectrometry. 2009. D. 28. 30. and B. R. E. Hoogland. The Preparation of Protein Digests for Mass Spectrometric Sequencing Experiments. Duff. Sherman. Enoki. and S. 31. 2004. A proteomics strategy to discover beta-glucosidases from Aspergillus fumigatus with two-dimensional page in-gel activity assay and tandem mass spectrometry. Protein Identification and Analysis Tools on the ExPASY Server. Improved prediction of signal peptides: SignalP 3. 47:110-119. Shoseyov. Food Chem. R. Saloheimo. S. 2000. Y. Olsen. Adv. Feher. Benson. Kim.. Nucleic Acids Res. Molray . 9.an Overview. 2001. Joo. Lee. Brunak. S. V.. Lee. Nucleic Acids Res.. In conclusion. p. 2007. 2. Aro. 61:135142. Sweden. Humana Press Inc. H. Jeya. Jager. and J. 13:25-58. A specific and versatile genome walking technique. 1992. Tiwari. and applications. 2005. J. New York. H. M. Journal of Proteome Research. M. Borjesson. Wheeler. and nucleophile identification of family 3. In M. and P. Kinter. 15. Molscript . Sinitsyn. W. Sicheritz-Ponten. N. Miller. Smith. D. K. J. B. and W. Zhang. Murray. M. 2009. and N. Gasteiger. 108:95-120.. A. 2000. 11. Aubert. I.. J. 86:1473-1484. Beguin. 57:1201-1203. Shackleford. H.. Uppsala. BB1 (PDB entry 3F94) and T. expression. 15:583-620. Brown. Rev. T. Zorov. 1987. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. A. Proteins-Structure Function and Bioinformatics. Dan. T. Howard. S. B. 280:309-316. J. Amersham Biosciences Limited. M. Bhat. The Carbohydrate-Active EnZymes database (CAZy): an expert resource for Glycogenomics.. Kawaguchi. Kluwer Academic Publishers. Shindyalov. The distance between the putative nucleophile (D261) and the acid/base (E490) is approximately 5. Biotechnol. Mol. and R. 2001.. Amersham Biosciences. O. S. Murray. and A. Acta Crystallographica Section a. 14. John Wiley & Sons. Johansen. 275:4973-4980. and M. The Netherlands) for providing the pAN7-1 vector.. Progress and challenges in enzyme development for Biomass utilization.. 25:33893402. Around O. M. Tuohy. Cooper. 4:1633-1649. 9:4752. HojerPedersen. Bioresour. F. M. Draper. J. G. 6:4749-4757 29. Biotechnol. B. Crit. Rev. M. properties. 2007. 25. Pseudoalteromonas sp. M. 35.. R. Guo. Cherry.. Microbial beta-glucosidases: Cloning. Jones. Rancurel. P. and P. 2010. 1991. The Proteomics Protocols Handbook. and D. J.. He. Bhat. Purification and characterization of a beta-1. Koeva. T. 23. and S. Harris. Reef coral fluorescent proteins for visualizing fungal pathogens. Sokolova. Czymmek. J. Okunev. T. Cowan. M. Harris. De Gori. Lipman. The Netherlands. Lee. Zhang. J. FEMS Microbiol. S. S. Kjeldgaard. 279:4970-4980. Technol. saccharolyticus beta-glucosidase is open compared to those of barley (PDB entry 1LQ2) (21). Arnold (eds. Bisaria. Cellulose degrading enzymes and their potential industrial applications. A. K. B. and S. Bourne. L.a Program to Produce both Detailed and Schematic Plots of Protein Structures. M. C. Isolation and properties of fungal beta-glucosidases. Grassick. Karsch-Mizrachi.. A. Olsson. A. Ooi. Zou. M. A. K. Biochem. 22:375-407.. W.. Y. Effect of Media Composition and Growth-Conditions on Production of Cellulase and BetaGlucosidase by a Mixed Fungal Fermentation. Krogh. Appl. Bairoch. S.Principles and Methods. and L. Bubnova. J. Gerhard Munske (Washington State University. K. The Protein Data Bank. Tsurumaki. K. Biotechnol. R. Kim. P. and M. A. 17. I. Acta Crystallographica Section D-Biological Crystallography. Technol. Westbrook. Totowa. 8. H.. J. L. Bhatia. A. S. R. 48:4929-4936. International Tables for Crystallography.. M. V. Fungal Genetics and Biology. 24:946-950. E. 37:211-220. K. A. 13. M. 2005. Appel. 16.. Vasella. Characterization of beta-glucosidase from a strain of Penicillium purpurogenum KJS506. Duvaud. and O. Biol. p. S. Biotechnol. Jeya. 86:143-154. K. 2009. 1996. 4. Altschul. 7. N.. Schreier. G. S. Madden. Kiss.  The homology modeling revealed that the catalytic pocket of A. Biochemistry-Moscow. Proteomics. 38:248-257. L. Cloning and sequencing of the cDNA encoding beta-glucosidase 1 from Aspergillus aculeatus.. Sim. Arai. Journal of Applied Crystallography. Wilkins. Nucleic Acids Res. L. Protein Expr. Bioresour. Korotkova. Henrissat. K. 1994. G. N. Applied Microbiology & Biotechnology. Mishra. N. Hrmova. Chem. I. 5.). D.

Langendijk-Genevaux. and A. Groot. 1:147-161. World J. Lu. H. Kubicek. P. Herweijer. Russel. J. C. U. S. Vervecken. Danchin. Henikoff. M.. J. Gunata. T. 2010. Gene. J. W. and E. R. 46. Wiseman. T. M.  36.. Claeyssens. Bairoch.. Microbiol. J. Ratto. 43. Yan. New York. J. T. Pasten. Albermann. D.. M. Munske. Ram. Albang.. Stals. van den Hondel. and S. F. I. J. N. J. Mol. Stam. Garcia-Campayo. N. 45. C. 2009. Acta Crystallographica Section F-Structural Biology and Crystallization Communications. van den Hombergh. 61:965-970. J. Sambrook. S. J. T. 53. C.. Woodward. Research paper IV  ‐ IV. 2006. 1990. A. Contreras. Katayama. Dyer. and J. and T. Genome sequencing and analysis of the versatile cell factory Aspergillus niger CBS 513. A. J. Archer. and V. L. M. 61:155-164.10 ‐    . and P. 2004. Structure. CODEHOP (COnsensusDEgenerate hybrid oligonucleotide primer) PCR primer design. 65:1190-1192. and R. Kools. Wang.. A. S. J. C. R. and C.. J. and S. 1977. Olsthoorn. 1994. Microbiol. R. J. Frisvad. C. Microbiol. P. 38. 2007. A. Pal. Van Beeumen. W. Dijkhuizen. J. W. L. and substrate specificity of a novel highly glucosetolerant beta-glucosidase from Aspergillus oryzae . J. D. 51. Nielsen. Biotechnol. C. Breestraat. Purification. 64:3607-3614.. Environ. de Groot. Transformation of Aspergillus based on the hygromycin B resistance marker from Escherichia coli . Lin. Analysis and prediction of gene splice sites in four Aspergillus genomes. 2009. van der Maarel. Production and characterization of a highly active cellobiase from Aspergillus niger grown in solid state fermentation. van Ooyen. B. M. Infect. T. Mortimer. P. Fungal Genetics and Biology. 1998. L. and C. 397:724-739. 2010. H. M. 1987. Huber. 57. Pozzo. D. Sternberg. P. D. 1997. Koyanagi. B. Cerutti. Sandra. Biotechnol. Protein Eng. and A. Higgins.. 52. Bendtsen. de Winde. 2003. T.A laboratory manual. characterization. Technol. Meulenberg. M. J. F. P. 38:D161D166. Thompson. Oliver. E. N. 42. G. Physical and kinetic properties of the family 3 beta-glucosidase from Aspergillus niger which is important for cellulose breakdown. E. T.. Shaikh.. Protein Journal. P. C. G. K. 86:169-177.and N-glycosylation pattern of Cel7A. J. M. 46:431-437. A. H. M. Barre. L. R. Brown. Engelbrecht. H. On the safety of Aspergillus niger . 10:1-6. J. Vallier. 25:221-231 39. A. 46:S14S18. X. Punt. van Peij. Davitt. M. 56. 23:11-23. P. and N.. Rose. Three-dimensional structure of a barley beta-D-glucan exohydrolase. 22:991-998. A. M. J. 2008. Lin. Henikoff. M. Biotechnol. Brayton. and P. G. Hofmann. A. Cornell. H. Z. 56:117-124. Marten. Palmer. A. a protein domain database for functional characterization and annotation. Dekker. J. and D. Pouwels. 14:713-724. A. J. 1982. J. M. R. S. 59. van den Berg. Rajoka. Appl. M. C.a review. A. D. B. 47. J. W. Sun. J. Purification and characterization of a glucosetolerant beta-glucosidase from Aspergillus niger CCRC 31494.their Properties and Applications. J. S. Biodegradation. Withers. van Dijck. E. F. Nielsen.. J. Lin. M. M. S. H. 23:139-147. Kumagai. Hrmova. P. Klis. Seidle. P. Logan. J. Glycobiology. J. Varghese. a family 3 glycosyl hydrolase. and D. F. and S. Biol. Oliver. A Versatile Transformation System for the Cellulolytic Filamentous Fungus Trichoderma reesei . R. R. J. A. H. Schuster. M. Food Chem. E. Visser. M.. J. Kitaoka. J. G. R. Roubos... Biochemistry and Cell Biology-Biochimie Et Biologie Cellulaire. Immun. Composition of the surface proteome of Anaplasma marginale and its role in protective immunity induced by outer membrane immunization. P. v. T. K. E.. 2002. R. 59:426-435. 7:179-190. PROSITE.. Microbiol. and H. Varga. Shoseyov. Bioscience Biotechnology and Biochemistry. D. J. vonHeijne. 2008. 1999. and G. d'Enfert. X. J. M. Ussery. T. E. N. W. C. Brunak. Structural and Functional Analyses of beta-Glucosidase 3B from Thermotoga neapolitana: A Thermostable Three-Domain Representative of Glycoside Hydrolase 3. G. Geysens. W. Teaching old enzymes new tricks: engineering and evolution of glycosidases and glycosyl transferases for improved glycoside synthesis. Guillemette. J. and G. Tamaki. M. 41. V. Enzyme Microb. J. Nucleic Acids Res. Menke. W. A. A. M. H. van den Hondel. S. Geysens. Wedler. M. van Kuyk. 55. S. H. J. Enzymology of cellulose degradation. H. M. A. Nucleic Acids Res. O. W. Akhtar. E. W. M. van der Kaaij. J. M. C. Turner. Sagt. Noh. Pel.. 76:2219-2226. Factors influencing glycosylation of Trichoderma reesei cellulases. K. 2001. P. T. Salmon. Brunak. M. H. Knowles. M. Henrissat. J. Benen. de Vondervoort. Ussery. J. 50.. K. P. 58. Penttila. Agric. I: Postsecretorial changes of the O. M. Fincher. E. van der Heijden. 1998. Cold Spring Harbor Laboratory Press. H. de Vries. R. Vijayakumar. Caddick. and H. I. L. Riou. van Dijk. and G. J. Appl.88. J.. C. T. 4:73-79. Purification. A. N. S. Schmoll. 1987. H. P. Yan. P. Zeng. crystallization and preliminary X-ray analysis of beta-glucosidase from Kluyveromyces marxianus NBRC1777. Hanif. Dunn-Coleman. G. Hulo. Nat. de Castro. and C. E. 2004. K. 22:4673-4680. G. Driessen. Minami. G. Can. Reese. Salminen. T. Karlsson. R. Coutinho. Fungal and Other Beta-D-Glucosidases . A. Hidaka. Debets. Beta-Glucosidase Microbial-Production and Effect on Enzymatic-Hydrolysis of Cellulose. 48. B. Purification and characterization of an extracellular beta-glucosidase II with high hydrolysis and transglucosylation activities from Aspergillus niger. Molecular Cloning . P. H. Khalid. M. J. J. 40. D. Clustal-W Improving the Sensitivity of Progressive Multiple Sequence Alignment through Sequence Weighting. S. I. Goosen. Gibson.. M. 1997. M. Schaap.. E. Rinas. G. J. Norimine. 54. van Dijck. A. Nevalainen. R. Lauber. Y. Gene. 49. Andersen. Contreras. Wood. Yoshida. P. P. 44. Dingemanse. A. M. 31:3763-3766. Wosten. Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. M. M. and M. J. 37. Bulliard. Fushinobu. Position-Specific Gap Penalties and Weight Matrix Choice. Nucleic Acids Res. Sigrist. M.

 Birgitte K. Teller. Lübeck     Filed July 30. Ahring. and Peter S. 2010          . Philip J.  Patent      PA 2010 7034  Beta‐glucosidases and nucleic acids encoding same      Annette Sørensen.

        .

: 3 or 4 or  a polynucleotide comprising a nucleic acid sequence having at least 70% identity to SEQ ID NO:  3 or 4 or   a polynucleotide hybridising to SEQ ID NO.  A  second  aspect  of  the  invention  relates  to  an  isolated  polynucleotide  comprising  a  nucleic  acid  or  its  complementary sequence being selected from the group consisting of  a. or  a  biologically  active  fragment  of  at  least  30  consecutive  amino  acids  of  any  of  a)  through  b). In  particular one enzyme has been identified and characterised as having improved beta‐glucosidase activity.  In  a  preferred  embodiment  the  polypeptide  is  purified  from  Aspergillus  saccharolyticus.: CBS 127449.  Several enzymes of the newly identified strain are efficient in degradation of lignocellulosic biomasses.  wherein  the  variant  has  at  least  92%  sequence identity to said SEQ NO:1.   a  biologically  active  sequence  variant  of  SEQ  NO:1. The polypeptide is capable of degrading or converting lignocellulosic material that may  be obtained from various sources.   In one aspect.  wherein  the  variant  has  at  least 92% sequence identity to said SEQ ID NO 1. In a preferred embodiment the polypeptide of the present invention is  capable of hydrolyzing a beta 1‐4 glucose‐glucose linkage. Thus.PA 2010 7034 – Beta‐glucosidases and nucleic acids encoding same  SUMMARY OF THE INVENTION  The  present  invention  relates  to  the  identification  of  a  novel  and  improved  beta‐glucosidase  producing  strain of the fungus Aspergillus. d.  the  invention  in  a  fourth  aspect  pertains  to  a  recombinant host cell comprising a polynucleotide of the present invention and/or a nucleic acid vector of  the invention. This makes it a superior  choice for degradation of lignocellulosic material. wherein said fragment is a fragment of SEQ ID NO 1 or  SEQ ID NO. c.  The  polynucleotide  may  be  used  for  cloning  purposes  and  for  production  of  the  polypeptide  of  the  invention. the present invention relates to An isolated polypeptide comprising   a.    ‐ v ‐    . and  a  biologically  active  fragment  of  at  least  30  contigous  consecutive  amino  acids  of  any  of  a)  through b). f. which is efficient in the degradation of  lignocellulosic  biomasses  into  glucose  for  production  of  biofuels.  wherein said fragment is a fragment of SEQ ID NO:1.  The  identified  beta‐glucosidase  has  improved  thermal  stability. b. g.  biochemicals  and  pharmaceuticals. c. e. in a third aspect.   a  biologicaly  active  sequence  variant  of  the  amino  acid  sequence.   It  is  appreciated  that  the  polynucleotide  and/or  the  recombinant  nucleic  acid  vector  of  the  present  invention  may  be  introduced  into  host  cells.: 3 or 4 and  a polynucleotide complementary to any of a) to f). the present invention also relates to a recombinant nucleic acid vector  comprising a polynucleotide of the invention. a polynucleotide sequence encoding a polypeptide consisting of an amino acid sequence SEQ ID  NO:1.  such  as  deposit  no. an amino acids consisting of the SEQ NO:1.  Accordingly. b. namely Aspergillus saccharolyticus.  while  maintaining  its  activity  at  a  high  level for a prolonged period of time compared to other fungal beta‐glucosidases.

  at  least  one  isolated  microorganism  of  the  invention  and/or  at  least  one  composition  of  the  invention. Thus.  The  isolated  microorganism  is  in  one  preferred  embodiment  the  newly  discovered  strain  Aspergillus  saccharolyticcus of the invention or progeny thereof.  at  least  one  recombinant  host  of  the  invention.  at  least  one  recombinant  nucleic  acid  vector  of  the  invention.  treating  the  cellulosic  material  with  at  least  one  polypeptide  of  the  invention.  recovering the polypeptide from said microorganism. An additional component is typically enzymes that aid in  the degradation or conversion of biomass for example cellulases.  and  particularly  Aspergillus  saccharolyticcus or progeny thereof. hemicellulase.  wherein  microorganism  is  Aspergillus. at least one kit‐of parts of the invention.PA 2010 7034 – Beta‐glucosidases and nucleic acids encoding same  A  fifth  aspect  of  the  invention  relates  to  an  isolated  microorganism  comprising  a  polypeptide  of  the  invention.           ‐ vi ‐    .   The  invention  in  yet  a  further  aspect  relates  to  a  method  for  degrading  or  converting  a  lignocellulosic  material. endogluconase.  at  least  one  recombinant  host  cell  of  the  invention.  According to the invention the polypeptide. cellobiohydrolase. at least one composition of the invention and/or at least one kit‐of parts of the invention and b)  recovering the degraded lignocellolosic material.  at  least  one  microorganism  of  the  invention.   It  is  further  appreciated  that  the  polypeptide.  recombinant  nucleic  acid  vector. and  incubating the treated cellulosic material with one or more fermenting microorganisms. recombinant host cell and/or microorganism may be used in a  composition.  at  least  one composition of the invention.  a  polynucleotide  of  the  invention  and/or  a  recombinant  nucleic  acid  vector  of  the  invention. beta‐ glucosidase.  a  further  aspect  pertains  to  a  kit‐of  parts  comprising  at  least  one  polypeptide  of  the  invention.  recombinant  host  cell.  at  least  one  microorganism  of  the  invention. In a  preferred  embodiment.  b. protease and/or peroxidise.  microorganism and/ or composition of the present invention may be combined with other components.  obtaining at least one fermentation product .  Thus.  at  least  one  recombinant  host  cell  of  the  invention  and/or  at  least  one  microorganism  of  the  invention.  The  microorganism  may  thus  comprise  a  polynucleotide  of  the  invention  and/or  a  recombinant  nucleic  acid vector of the invention. The microorganism may be any microorganism suitable for the purpose.  In a final aspect the invention pertains to a method for a method for fermenting a cellulosic material. esterase.  c. said  method comprising   a. where said microorganism produces said polypeptide.  A  sixth  aspect  relates  to  a  method  of  producing  a  polypeptide  as  disclosed  in  the  present  invention  comprising  a. said method comprising a) incubating said lignocellulosic material with at least one polypeptide  of  the  invention. b. a seventh aspect related to a composition comprising at least one polypeptide of the  invention. cultivating a microorganism.  at  least  one  recombinant  host  cell  of  the  invention. laccase. and at least one additional component.

e. b. yellow poplar and/or  switch grass.: 3 or 4 or  a polynucleotide comprising a nucleic acid sequence having at least 70% identity to SEQ ID NO:  3 or 4 or   a polynucleotide hybridising to SEQ ID NO.  The  polypeptide  according  to  any  of  the  preceding  claims. and  a  biologically  active  fragment  of  at  least  30  consecutive  amino  acids  of  any  of  a)  through  b). wherein said polypeptide is purified from  Aspergillus saccharolyticus. g. f. such as deposit no.  wherein said fragment is a fragment of SEQ ID NO 1 or  SEQ ID NO. 7.  wherein said fragment is a fragment of SEQ ID NO:1. maize stems. forestry waste  such as sawdust and/or wood‐chips.  wherein  said  lignocellulosic  material  is  obtained from agricultural residues such as straw. The polypeptide according to any of the preceding claims.  wherein said fragment is a fragment of SEQ ID NO. b.  An isolated polynucleotide comprising a nucleic acid or its complementary sequence being selected  from the group consisting of  a. c.   a  biologically  active  sequence  variant  of  SEQ  NO:1.PA 2010 7034 – Beta‐glucosidases and nucleic acids encoding same  CLAIMS  1.  wherein  the  variant  has  at  least  92%  sequence identity to said SEQ NO:1.  wherein  the  variant  has  at  least 92% sequence identity to said SEQ ID NO.  wherein  said  polypeptide  is  capable  of  hydrolyzing a β1‐4 glucose‐glucose linkage.: CBS 127449  The  polypeptide  according  to  any  of  the  preceding  claims. 4.  3. an amino acids consisting of the SEQ NO:1. and/or from energy crops such as willow.: 1. b. d.: 3 or 4 and  a polynucleotide complementary to any of a) to f).: 1 or  a  biologically  active  sequence  variant  of  the  amino  acid  sequence. c.   a  biologicaly  active  sequence  variant  of  the  amino  acid  sequence.  The  polypeptide  according  to  any  of  the  preceding  claims.  wherein  said  polynucleotide  is  selected  from  the  group  consisting of  a.  wherein  said  isolated  polypeptide  is  capable of degrading or converting lignocellulosic material.    ‐ vii ‐    . An isolated polypeptide comprising  a. corn fibers and husk. a polynucleotide sequence encoding a polypeptide consisting of an amino acid sequence SEQ ID  NO:1.  2.: 1 and  a  biologically  active  fragment  of  at  least  30  consecutive  amino  acid  of  any  of  a)  trough  b). or  a  biologically  active  fragment  of  at  least  30  consecutive  amino  acids  of  any  of  a)  through  b). The  polynucleotide  according  to  claim  6. 6. 5. c. a polynucleotide encoding an amino acid sequence consisting of SEQ ID NO.  wherein  the  variant  has  at  least 92% sequence identity to said SEQ ID NO 1.

A  composition  comprising  at  least  one  polypeptide  as  defined  in  any  of  claims  1  to  5. endogluconase.  protease  and  peroxidise. sawdust and/or wood‐chips.  12.    ‐ viii ‐    .  16.  wherein  said  microorganism  is  deposited  in  CBS  under accession no.PA 2010 7034 – Beta‐glucosidases and nucleic acids encoding same  8. wherein said microorganism is deposited in  CBS under accession no. hemicellulase. protease and peroxidise  20.  laccase.  maize stems. at least one isolated microorganism as defined in any of claims 10 to 12 and/or at least one  composition as defined in claim 17.  21. or progeny thereof.  beta‐glucosidase. A  kit‐of  parts  comprising  at  least  one  polypeptide  as  defined  in  any  of  claims  1  to  5.  wherein  said  microorganism  comprises  a  polynucleotide  as  defined in any of claims 6 to 8 and/or a recombinant nucleic acid vector as defined in claim 8  15. where said microorganism produces said polypeptide.  13. A  method  for  degrading  or  converting  a  lignocellulosic  material. An isolated microorganism comprising a polypeptide as defined in any of claims 1‐5. The microorganism according to claim 10.  at  least  one  recombinant host cell as defined in claim 9 and/or at least one microorganism as defined in any of  claims 10 to 12  18. 9.  said  method  comprising  a)  incubating said lignocellulosic material with at least one polypeptide as defined in any of claims 1 to  5. wherein said additional component is selected from the group  consisting of cellulases.  b. cultivating a microorganism.: CBS 127449.: CBS 127449. a polynucleotide  as defined in any of claims 6 to 7 and/or a recombinant nucleic acid vector as defined in claim 8  11.  17. or progeny thereof. wherein microorganism is Aspergillus. The  method  according  to  any  of  claims  13  to  15.  laccase. and at least one additional component.  wherein  said  lignocellulosic  material  is  obtained  from  straw. said method comprising treating said lignocellulosic  material with at least one additional component. The  method  according  to  claim  13. The microorganism according to any of claims 10 to 11. A recombinant nucleic acid vector comprising a polynucleotide sequence as defined on any of claims  6 to 7  A  recombinant  host  cell  comprising  a  polynucleotide  as  defined  in  any  of  claims  6  to  7  and/or  a  recombinant nucleic acid vector as defined in claim 8  10.  cellobiohydrolase. The method according to any of claims 20 to 22. at least one recombinant host  cell as defined in claim 9. beta‐glucosidase.  14.  at  least  one  recombinant nucleic acid vector as defined in claim 8. The method according to any of claims 13 to 14. at least one microorganism as defined in any one of claims 10 to 12. esterase.   19. wherein said microorganism is Aspergillus. The  method  according  to  claim  20.  endogluconase. recovering the polypeptide from said microorganism.  at least one composition as defined in claim 17 and/or at least one kit‐of  parts as defined in any of claims 18 to 19 and b) recovering the degraded lignocellolosic material. The method according to any of claims 20 to 21. at least one recombinant host cell as defined in  claim 9. cellobiohydrolase. The kit‐of parts according to claim 18.  22.  23.  hemicellulase. A method of producing a polypeptide as defined in any of claims 1 to 5 comprising  a.  esterase. forestry waste. wherein said at least one additional component for  treating  said  lignocellulosic  material  is  selected  from  the  group  consisting  of  cellulase.

  treating the cellulosic material with at least one polypeptide as defined in any of claims 1 to 5. organic acid. at least one microorganism as defined in  any of claims 10 to 12. at least one composition as defined in claim 17.  27. at  least one recombinant host cell as defined in claim 9.  wherein  said  lignocellulosic  material  is  at  least  partly converted or degraded to monosaccharide glucose units. at least one kit‐of parts as  defined in any of claims 18 to 19.  inorganic acid. hydrocarbon.  25. and/or gas        ‐ ix ‐    . A method for a method for fermenting a cellulosic material.  26. and  incubating the treated cellulosic material with one or more fermenting microorganisms. ketone.   obtaining at least one fermentation product . wherein at least 50% of said lignocellulosic material  is degraded or converted to monosaccharide glucose units. The method according to any of claims 20 to 24. The  method  of  claim  26  wherein  said  at  least  one  fermentation  product  is  at  least  one  alcohol. amino acid. The  method  according  to  any  of  claims  20  to  23. said method comprising  a.  b.  c.PA 2010 7034 – Beta‐glucosidases and nucleic acids encoding same  24.

    .

        Concluding remarks      Annette Sørensen        .

    .

 BGL1.  express. saccharolyticus was found in the bathroom of my own  home.  that  would  be  relevant  to  investigate  further.  This  can  be  in  an  onsite enzyme production strategy.  Kinetically. saccharolyticus. and was superior especially in terms of  thermostability.  CONCLUDING REMARKS  The  work  presented  in  the  four  research  papers  shows  a  successful  screening  event  leading  to  the  discovery  of  a  new  efficient  beta‐glucosidase  from  a  novel  fungal  species.  It  is  therefore  important to test  the  stability  of  the  enzyme  at different  conditions for  longer  periods  of  time. It could be interesting to  clone.  Finally. The novelty of A. you can look everywhere.  We  see  the  potential  of  BGL1  as  a  key  enzyme  in  a  biorefinery  concept. is true.  where  for  example  prolonged  duration  of  hydrolysis can be used to evaluate performance related to glucose accumulation. saccharolyticus and its beta‐glucosidase. This.  it  would  be  of  great  value  to  perform  more  studies  with  cellobiose  as  substrate.  We  are  further more very interested in expressing the bgl gene in E. Novozym 188 and Cellic CTec.  The  key  beta‐glucosidase. as the novel fungus A. saccharolyticus that has been modified  for improved endoglucanase and cellobiohydrolase expression or co‐cultured with an efficient producer of  these  enzymes.  As  stated  by  Hawsworth  and  Rossman (1997).   One  of  the  most  important  features  concerning  BGL.  is  prolonged thermostability.  a  crystal  of  the  protein  can  be  made  and  the  three  dimensional  structure  thereby  determined. including media containing  different carbon sources ranging from simple saccharides such as cellobiose to complete sources such as  lignocellulosic  biomass.  The  extract  from  this  fungus  could  in  biomass  hydrolysis  compete  with  beta‐glucosidases  from  commercial enzyme preparations. coli to compare the non‐glycosylated protein  with the glycosylated one to test how glycosylation affects the function and stability of the enzyme.  Another  aspect  of  kinetics  that  would  be  of  interest  related  to  the  use  of  BGL  for  making  a  sugar  platform. including your own backyard. we have  in preliminary studies  identified additional beta‐glucosidase genes in the genome of A. From  the  non‐glycosylated  protein.  saccharolyticus  was  identified  and  heterologously expressed for purification.  as  well  as  the  surprising  elevated  thermostability  of  the  enzyme  was  the  foundation  for  the  patent  PA  2010  70347. saccharolyticus is grown in different conditions. Hydrolysis of biomass is usually carried out for a duration of several hours or  even  days.                    .  This  will  enhance  the  basic  understanding  of  the  function  of  the  different  beta‐ glucosidases biomass degradation and utilization. when searching for undescribed  fungi.  in  the  extract  of  A.  BGL1.  especially  assays  related  to  product  inhibition. Other inhibition studies  to  test  the  influence  of  different  compounds  typically  present  in  pretreated  biomass  should  as  well  be  performed.  and  purify  these  to  explore  and  compare  their  potential  as  well  as  study  the  expression  pattern of the genes when A.  is  to  investigate  the  degree  of  transglycosylation  activity  the  enzyme  possesses.  The  other  option  could  be  to  heterologously  express  BGL1  in  an  organism  of  choice  for  production of a complete enzyme cocktail or even be part of a consolidated bioprocess.  This  could  give  valuable  information  as  to  what  amino  acid  residues  that  could  potentially be targeted in engineering for enzyme improvement. where BGL1 is expressed by A. indeed.

              .

Sign up to vote on this title
UsefulNot useful

Master Your Semester with Scribd & The New York Times

Special offer: Get 4 months of Scribd and The New York Times for just $1.87 per week!

Master Your Semester with a Special Offer from Scribd & The New York Times