You are on page 1of 11

THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 275, No. 18, Issue of May 5, pp.

13907–13917, 2000
© 2000 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A.

Identification of a Homeodomain Binding Element in the Bone


Sialoprotein Gene Promoter That Is Required for Its
Osteoblast-selective Expression*
Received for publication, June 21, 1999, and in revised form, February 14, 2000

M. Douglas Benson‡, Jeffrey L. Bargeon§, Guozhi Xiao§, Peedikayil E. Thomas§, Ahn Kim§,
Yingqi Cui§, and Renny T. Franceschi‡§¶
From the ‡Department of Biological Chemistry, School of Medicine and the §Department of Periodontics, Prevention, and
Geriatrics, School of Dentistry, University of Michigan, Ann Arbor, Michigan 48109-1078

Bone sialoprotein is a 70-kDa extracellular matrix osteoblast, and, as such, a study of its expression is important
component that is intimately associated with biominer- to our understanding of the transcriptional mechanisms that
alization, yet the cis-acting elements of the Bsp gene mediate osteoblast differentiation.
that restrict its expression to mineralizing cells remain Extensive studies of the osteocalcin gene 2, which encodes
uncharacterized. To identify such elements, we ana- another osteoblast-specific protein, have revealed that its os-
lyzed a 2472-base pair fragment of the murine promoter teoblast-selective expression is dependent on binding sites for
that directs osteoblast-selective expression of a lucifer- the Cbfa1 transcription factor in its promoter (named osteo-
ase reporter gene and found that the region between blast-specific element 2 (OSE2)) (4). Furthermore, Cbfa1,
–338 and –178 relative to the transcriptional start is which itself exhibits bone-restricted expression, has since been
crucial for its osteoblast-selective activity. We identified
shown to be required for osteoblast development in general, as
an element within this region that binds a protein com-
Cbfa1 –/– mice lack functional osteoblasts (5). This finding
plex in the nuclear extracts of osteoblastic cells and is
prompted speculation that this factor may control the tran-
required for its transcriptional activity. Introduction of
a mutation that disrupts a homeodomain binding site scription of other osteoblast-related genes by binding similar
within this sequence eliminates both its in vitro binding OSE2 sites in their promoters. However, we recently investi-
and nearly all of the osteoblastic-selective activity of the gated the contribution of two putative Cbfa1 binding sites to
2472-base pair promoter. We further found that the Dlx5 the activity of a 2.5-kb fragment of the murine Bsp promoter
homeoprotein, which is able to regulate the osteoblast- that exhibits osteoblast-selective expression. We found that
specific osteocalcin promoter, can bind this element and neither site exhibited significant enhancer activity nor contrib-
stimulate its enhancer activity when overexpressed in uted to the activity of the 2.5-kb Bsp promoter, suggesting that
COS7 cells. These data represent the first description of other cis-acting elements must be responsible for its osteoblast-
an osteoblast-specific element within the bone sialopro- selective expression (6). Although at first this result seems
tein promoter and demonstrate its regulation by a mem- surprising, it is, perhaps, less so when we consider that BSP
ber of a family of factors known to be involved in and osteocalcin are associated with different biochemical func-
skeletogenesis. tions in vivo. That is, whereas BSP is associated with mineral
formation, osteocalcin appears to play a role in bone resorption
and turnover (7, 8). Thus, it is reasonable to expect that these
Bone sialoprotein (BSP)1 is a 70-kDa extracellular matrix two genes, while both markers of the differentiated osteoblast,
component that is selectively produced by mineralizing cell may be differently regulated.
types in a pattern that correlates with the onset of mineral In addition to Cbf/runt sites, a number of other known en-
formation in vivo. This expression pattern, combined with ev- hancer sequences have been described within the Bsp pro-
idence that BSP binds collagen (1) and can nucleate hydroxy- moter, but little progress has been made toward identification
apatite formation in vitro (2), has led to the widely held theory of the elements necessary for its osteoblastic-selective expres-
that BSP plays a central role in biomineralization. In osteo- sion. Sodek and co-workers (9 –11) have characterized elements
blasts, which produce the vast majority of BSP, expression is within the rat promoter that mediate the actions of vitamin-D,
further restricted to those cells that have secreted, and are glucocorticoids, and transforming growth factor-␤, and Yang
actively mineralizing, a type I collagen matrix (3). Thus, BSP is and Gerstenfeld (12) reported that parathyroid hormone-re-
one of the primary markers of the terminally differentiated sponsive elements in the avian Bsp promoter are also tran-
scriptionally active. However, none of these elements has been
shown to confer tissue specificity. Kerr et al. (13) described a
* This work was supported by National Institutes of Health Grants
DE12211 and DE 11723, General Clinical Research Center Grant M01- binding site for Ying Yang 1, a factor implicated in the tran-
RR00042, and Michigan Multipurpose Arthritis Center Grant AR scriptional initiation of some TATA-less promoters, within in-
20557. The costs of publication of this article were defrayed in part by tron 1 of the rat gene, which displayed higher levels of en-
the payment of page charges. This article must therefore be hereby hancer activity in UMR 106-01 osteosarcoma cells than in
marked “advertisement” in accordance with 18 U.S.C. Section 1734
solely to indicate this fact.
fibroblasts. However, since this sequence is not conserved in
¶ To whom correspondence should be addressed: Dept. of Periodon- the corresponding region of either the human or mouse genes,
tics, Prevention, and Geriatrics, School of Dentistry, University of and no intronic sequence is found in the –2472/⫹41 murine
Michigan, 1011 N. University Ave., Ann Arbor, MI 48109-1078. Tel.: promoter, this element is clearly not essential for osteoblast-
734-763-7381; Fax: 734-763-5503; E-mail: rennyf@umich.edu.
1
The abbreviations used are: BSP, bone sialoprotein; bp, base pair(s);
specific expression.
kb, kilobase(s); OSE, osteoblast-specific element; PCR, polymerase Because efforts to link the tissue specificity of the Bsp pro-
chain reaction; ␤-gal, ␤-galactosidase. moter to a variety of known transcription factor binding se-

This paper is available on line at http://www.jbc.org 13907


13908 Osteoblast Specificity of the Mouse Bsp Promoter
quences have so far been unsuccessful, we took the alternate pGL3(–), which anneals to the antisense strand of the vector immedi-
approach of conducting a systematic study of the 2472-bp pro- ately 3⬘ of the pGL3Basic multiple cloning site, was used in conjunction
with BglII linker primers –253(⫹), –226(⫹), and –180(⫹) to amplify
moter to identify osteoblast-specific elements. As we report
three different length fragments by the polymerase chain reaction
here, this study has revealed that a homeodomain binding site (PCR) using Taq polymerase (Applied Biosystems, Foster City, CA).
in the proximal promoter is required for the tissue-specific These fragments were ligated into the BglII and HindIII sites of
expression of the murine Bsp gene. Furthermore, this site is pGL3Basic. Primers –279(–), A(–), and B(–) were then used with primer
positively regulated by the Dlx5 homeoprotein, which is known pGL3(⫹), a KpnI linker primer that anneals to the antisense strand of
to play an important role in skeletogenesis. the plasmid upstream of the multiple cloning site, to create PCR frag-
ments representing the upstream segments of the final constructs.
These fragments were blunted with Klenow, digested with KpnI, and
EXPERIMENTAL PROCEDURES
ligated into the KpnI and SmaI sites of the plasmids, which already
Cell Culture and Transfections—The following cell lines were used harbored the downstream PCR fragments described. The resulting Bsp
for these studies: The isolation of preosteoblastic clone 4 cells from the reporter constructs are missing 26, 30, and 50 bp of Bsp sequence for A,
parent MC3T3-E1 line (14) was described by Xiao et al. (15). UMR B, and C deletions, respectively, which is replaced with cloning site
106-01 cells (16) were a gift from Dr. Ronald Midura (Cleveland Clinic, sequence for net total deletions of 8, 13, and 33 bp. These constructs are
Cleveland, OH). C2C12 mouse myoblasts (17) were a gift from Dr. graphically depicted in Fig. 5A. The sequences of the primers used in
Daniel Goldman (University of Michigan, Ann Arbor, MI). ROS 17/2.8 their construction are given in Table I. These internal deletion con-
osteosarcoma cells (18), were provided by Dr. Laurie McCauley (Uni- structs were transfected into clone 4 and UMR 106-01 cells under the
versity of Michigan School of Dentistry). The 3T3-L1 preadipocyte (19), conditions described above in order to assess the effect on promoter
F9 teratocarcinoma (20), and S194 myeloma cell lines were purchased activity of deletion of these elements in the context of the 705 base pair
from the American Type Culture Collection (Manassas, VA). Mainte- Bsp promoter. To create the probe plasmid pBSPfp1, harboring the
nance conditions for these cell lines were previously described (6). COS7 insert used as a probe in our footprinting studies, we used linker
monkey kidney cells (21) were the gift of Dr. Fred Askari (University of primers –369(⫹) and –165(–) (see Table I) to PCR amplify a Bsp pro-
Michigan) and were maintained in Dulbecco’s modified Eagle’s medium moter fragment, which we then ligated into the BamHI and EcoRI sites
with 10% fetal bovine serum and 1% penicillin/streptomycin. C2C12 of pBluescript SK(⫹) (Stratagene, La Jolla, CA). Creation of
cells were induced to differentiate into myotubes by switching to 2% p2472mut3, containing the 2472-bp Bsp promoter with a 2-bp mutation
horse serum for 6 days. An adipose phenotype of lipid accumulation was in the C element sequence, was accomplished as follows: primers
induced in 3T3-L1 cells by growth in 30% fetal bovine serum for 6 days Cmut3SD(⫹) and (–) (Table I) were used with Stratagene’s Quick-
(19). F9 cells were induced to differentiate into endoderm by the addi- Change site-directed mutagenesis kit according to the manufacturer’s
tion of 0.1 ␮M retinoic acid and 1.0 mM dibutyryl cyclic AMP for 6 days instructions to introduce the desired mutation into p2472. An EcoRV/
(20). Clone 4 differentiation was accomplished by the addition of 50 ␮g/ml XhoI fragment containing Bsp promoter sequence from –1016 to ⫹41
ascorbic acid to the medium for 6 days to induce matrix synthesis and was then isolated from the mutagenized plasmid and ligated into the
subsequent expression of osteoblast-related genes, including osteocalcin corresponding position in the unmutagenized p2472 plasmid. This
and BSP (22). Media were changed every 2 days during treatment. strategy was used so that the resultant construct contained a much
All adherent cell lines were plated in 35-mm dishes at a density of shorter length of in vitro polymerized sequence that would have to
25 ⫻ 104 cells/cm2 and transfected with the appropriate firefly lucifer- undergo confirmatory sequencing. The sequences of all in vitro synthe-
ase reporter construct plus pRL-SV40 Renilla luciferase vector (Pro- sized constructs were confirmed by dideoxy sequencing using a Seque-
mega Corp., Madison, WI) for normalization of transfection, using Li- nase 2.0 kit (Amersham Pharmacia Biotech). The pcDNA3-Dlx5 expres-
pofectAMINE (Life Technologies, Inc.) as described previously (6). Cells sion plasmid was the generous gift of Dr. Dwight Towler (Merck, Inc.,
were switched to the appropriate differentiation media and grown for 6 West Point, PA) and contains a sequence that encodes a FLAG epitope
days, except for COS7 cells, which were additionally transfected with tag 5⬘ to codon 2 of a murine Dlx5 cDNA, resulting in the production of
100 ng of either pcDNA3-Dlx5 or pCMV5-␤-gal expression plasmid and an N-terminal “FLAG-tagged” protein (23). pCMV5-␤-gal was created
harvested 48 after transfection. S194 myeloma cells were transfected by by ligating a bacterial lacZ cDNA from pRSV␤-gal (a gift from Dr.
electroporation as described elsewhere (6). They were then transferred Daniel Wechsler, University of Michigan) into the EcoRI site of pCMV5
to growth medium for 48 h before harvesting. Luciferase expression in (Sigma).
the cell lysates was assayed using the Dual Luciferase Reporter kit Northern Analysis—Total RNA from cells subjected to differentia-
(Promega) and a Monolight 2010 luminometer (PharMingen, San Di- tion treatments as described above was isolated by the method of
ego, CA). All transfection experiments were performed in triplicate at Chomczynski and Sacchi (24). 10 ␮g aliquots were fractionated on 1%
least three times. Values shown are the means ⫾ standard deviations of agarose-formaldehyde gels and blotted to nylon membranes as de-
triplicate samples from representative experiments. scribed previously (25). The mouse BSP cDNA insert used as probe was
To produce Dlx5-containing or control COS7 nuclear extracts for gel isolated from a plasmid obtained from Dr. Marion Young (NIDCR,
shift experiments, cells were plated at the same density as above, but in National Institutes of Health) (26). The Dlx5 cDNA was obtained from
150-mm dishes, and transfected with either pcDNA3-Dlx5, or pCMV5- Dr. Steven Harris (University of Texas Health Center at San Antonio,
␤-gal plasmid (see below). The cells were harvested after 48 h, and San Antonio, TX). Both were labeled with [␣-32P]dCTP using a random
nuclear extracts were prepared as described below. primer kit (Roche Molecular Biochemicals), and incubated with the
DNA Constructs—Construction of pmBSP2472 was described previ- membranes in a Bellco Autoblot hybridization oven as described previ-
ously (6). This vector, renamed p2472, contains the region of the murine ously (27). The washed membranes were then exposed to Kodak X-omat
Bsp gene from –2472 to ⫹41 ligated upstream of a firefly luciferase AR film at –70 °C.
reporter gene in pGL3Basic (Promega). The 5⬘-deletion constructs p705, DNase I Footprinting Assays—Nuclear extracts were prepared after
p338, p178, and p49 were created by ExoIII digestion of p2472 linear- the method of Dignam et al. (28) from cells grown under differentiation
ized with KpnI and MluI using the Erase-a-Base kit (Promega) accord- conditions. Additionally, nuclei from ascorbic acid-treated clone 4 cells
ing to the manufacturer’s instructions. The p49BSP luciferase reporter were isolated from the collagenous matrix by treatment with 2 mg/ml
vector was constructed by ligating a double-stranded, synthetic oligo- collagenase A (Sigma) and 0.25% trypsin (Life Technologies, Inc.) for 1 h
nucleotide containing the sequence of the basal murine Bsp promoter followed by exhaustive rinsing in cold phosphate-buffered saline before
from – 49 to ⫹41 into the BglII and HindIII sites of pGL3Basic. The continuing with the extraction of nuclear proteins. Footprinting assays
p34OG2 vector containing a fragment of the osteocalcin gene 2 pro- were performed as follows: 5 ␮g of probe plasmid was digested with
moter from –34 to ⫹1 was created in a similar fashion, as described either BamHI (to label the positive strand) or EcoRI (to label the
previously (6). This fragment has previously been shown to direct high negative strand). The cut linearized plasmid was then treated with calf
levels of matrix-induced transcription in MC3T3-E1 cells when posi- intestinal alkaline phosphatase, labeled with [␥-32P]ATP using T4
tioned downstream of a bone-specific enhancer. Double-stranded oligo- polynucleotide kinase, and digested with either EcoRI or BamHI. The
nucleotides containing wild type and mutant A, B, and C elements from released insert was then purified from a 5% acrylamide gel, and its
the Bsp promoter (see Table I) were synthesized by the University of activity was quantitated with a scintillation counter. 15,000 cpm of
Michigan Core Facilities. They were then self-ligated and inserted into these probes and 0, 25, 50, or 75 ␮g of nuclear extract were incubated
the BglII site of both p49BSP and p34OG2 in order to compare the for 20 min at room temperature in a 100-␮l reaction volume containing
enhancer activities of the Bsp sites with those of the minimal promoters 25 mM Tris-HCl, pH 8.0, 50 mM KCl, 6.25 mM MgCl2, 0.5 mM EDTA, 0.5
alone. A, B, or C element sequences were deleted from the 705-base pair mM dithiothreitol, and 10% glycerol, with 5 ␮g of poly(dI䡠dC). An equal
promoter to create p705⌬A, p705⌬B, and p705⌬C as follows: primer volume of a 2.5 mM CaCl2, 5 mM MgCl2 solution was added, and the
Osteoblast Specificity of the Mouse Bsp Promoter 13909
reactions were digested with 1.2 units of RNase free DNase I (Promega) are comparable to those in clone 4 cells (Fig. 2). Thus, the
for 60 s at room temperature. Digestion was stopped by the addition of 2472-bp murine Bsp promoter is expressed at high levels only
180 ␮l of stop solution (200 mM NaCl, 30 mM EDTA, 1% SDS, and 100
in cells that produce BSP and in a pattern that mirrors that of
␮g/ml yeast tRNA), followed by extraction with phenol/chloroform/
isoamyl alcohol (25:24:1) equilibrated with TEB (10 mM Tris, pH 8.0, 1 the endogenous message.
mM EDTA, and 15 mM ␤-mercaptoethanol). The samples were precipi- Isolation of a Region Necessary for Osteoblast Selectivity by
tated with 1 ml of ethanol, rinsed twice with 70% ethanol, dried, and 5⬘-Deletion Analysis—We created a series of 5⬘-deletions of the
resuspended in 5 ␮l of loading buffer (95% formamide, 20 mM EDTA, 2472-bp promoter construct in order to isolate regions of the
0.05% bromphenol blue, 0.05% xylene cyanol). After heating for 5 min at fragment responsible for its osteoblast selective expression.
95 °C, the samples were then electrophoresed on a sequencing gel of 8%
acrylamide (19:1 with bis-acrylamide) in 1⫻ TBE at 60 W. The gels
These deletions were transfected into osteoblastic cell lines
were dried and exposed to Kodak BioMax film at ⫺70 °C. In order to (MC3T3-E1 and UMR 106-01) and nonbone cells (C2C12 myo-
determine positions of the protected nucleotides in these assays, the blasts, 3T3-L1 preadipocytes, F9 teratocarcinoma, and S194
samples were run alongside aliquots of the same probes subjected to lymphocytes) and grown under conditions that induced differ-
chemical sequencing reactions after the method of Maxam and Gilbert entiation appropriate for each cell type (osteoblast, muscle,
(29).
adipose, endoderm, and B lymphocyte, respectively; see under
Gel Mobility Shift Assays—Gel shift probe was made by labeling 1.5
pmol of double-stranded C oligonucleotide (shown in Table I) with “Experimental Procedures”). The object of these treatments
[␥-32P]ATP and T4 kinase; filling in with Klenow, cold G, A, and T was to approximate a panel of different tissue types in cell
nucleotides, and [␣-32P]dCTP; and purifying the labeled oligo on a 5% culture so as to examine the tissue selectivity of the transfected
acrylamide gel. Gel mobility shift assays were performed by incubation Bsp promoter constructs. The results of these transfections,
at 4 °C for 30 min of 5 ␮g of nuclear extract with approximately 5 fmol shown in Fig. 2, revealed three major features. (i) Deletion of
of probe in a 15-␮l reaction containing 2 ␮l of poly(dI䡠dC) in the same
the promoter sequence from –2472 to –178 caused no change in
binding buffer that was used in the footprinting assays described above.
For experiments including antibody, samples were then incubated for activity in the nonbone cell lines, whereas further deletion to
an additional 30 min with either 4 ␮g of anti-FLAG M2 monoclonal – 49 resulted in a drastic loss of activity in all cell lines. This
antibody (Stratagene) or IgG as control (Life Technologies) and, in some likely means that the region from – 49 to –178 contains se-
cases, 100 ng of FLAG peptide (Sigma). The shifted complexes were quences required for basal, non-tissue-specific transcription.
then electrophoresed on 5% acrylamide gels in 1⫻ TGE (50 mM Tris- (ii) Deletion from –2472 to –338 reduced promoter activity in
HCl, pH 8.5, 380 mM glycine, 2 mM EDTA, 0.2 mM ␤-mercaptoethanol)
for 120 min at 170 V in a 4 °C cold room. Gels were dried and exposed
clone 4 cells by approximately 60% but caused only a slight
to BioMax film. drop in UMR 106-01 cells. This segment may contain regula-
tory sequences that are required for high level transcription in
RESULTS the MC3T3-E1 cell line but not in the tumor-derived UMR line.
Osteoblast-selective Expression of the 2.5-kb Bsp Promot- (iii) Deletion of sequences from –338 to –178 resulted in a loss
er—In order to identify tissue-specific elements in the BSP of over half of the remaining activity in both clone 4 and UMR
promoter, we employed a construct containing bases –2472 to lines. This represents the most severe drop in activity to that
⫹41 of the murine gene driving expression of a luciferase point and brings the activity in these cells down to that seen in
reporter gene. Our decision to focus on this region was based on the nonosteoblastic cell lines, indicating that the region from
previous work which demonstrated that this construct was able –338 to –178 most likely contains elements crucial to the bone-
to direct 5–10-fold higher levels of expression in osteoblastic selective expression of the promoter. Interestingly, we noted
cells than in nonbone cell lines (6), indicating that this frag- the presence of a sequence similar to the OSE1 site, described
ment of the promoter likely contains sequence elements neces- by Ducy and Karsenty (4) and Schinke and Karsenty (32) as
sary to direct tissue-specific BSP expression. This finding is in important to the tissue-specific expression of osteocalcin, at
agreement with data reported by Chen et al. (30), which –566 (TTACATCA). However, because deletion of the region
showed mineralized tissue-restricted expression of a similar containing this sequence resulted in only a relatively small
region of the rat BSP promoter in transgenic mice. As a prelude decrease in activity in clone 4 cells and none in UMR cells, and
to a detailed analysis of the sequence elements responsible for because this deletion did not abolish tissue specificity, it was
this selective expression, a more thorough characterization of not considered further.
the expression of this reporter construct was performed in DNase I footprint analysis was employed to determine which
various osteoblastic cell lines to determine whether its regula- bases in the –338 to –178 region contacted protein complexes in
tion pattern parallels that of the endogenous BSP message. the nuclear extracts of osteoblastic cells. Preincubation of a
The murine MC3T3-E1 preosteoblastic cell line produces probe containing promoter sequence from –390 to –165 with
high levels of bone-related proteins, including BSP, in response increasing amounts of UMR nuclear extract resulted in the
to induction of collagen matrix synthesis by ascorbic acid (31). protection of three regions (Fig. 3A) on both the sense strand
For our studies, we employed a subclone, clone 4, which gives (lanes 2– 4) and the corresponding antisense strand (lanes
higher levels of bone marker transcription than the more het- 6 – 8). The same pattern was seen when nuclear extracts from
erogeneous parent cell line (15). Upon transfection with the ascorbic acid-treated clone 4 cells were used (not shown). To-
p2472 construct, and treatment with ascorbic acid over a 7-day gether, these three regions, named A, B, and C, were found
time course, clone 4 cells showed a significant induction in between –278 and –187 and are represented graphically in Fig.
reporter activity— up to 40-fold over that in nontreated cells by 3B. When compared with their corresponding sequences in the
day 7—that paralleled the increase in endogenous BSP mes- rat and human Bsp promoters (Fig. 3C), the A, B, and C
sage (Fig. 1, A and B). By way of comparison, ROS 17/2.8 elements show a high degree of sequence conservation, consist-
osteosarcoma cells, which express high levels of osteocalcin but ent with a potentially crucial role in regulating transcription.
not of BSP (Fig. 1C), exhibited only 20% of the luciferase Both the A and B regions are AT rich and do not contain any
activity seen in clone 4 cells when transfected with the p2472 recognizable transcription factor binding sites. The C element,
construct, comparable to those seen in C2C12 myoblasts and however, contains a consensus binding site for engrailed-1 (33,
3T3-L1 preadipocytes, two mesenchymal cell lines that do not 34), marking it as a potential binding site for a wide range of
express BSP (Fig. 1D). However, UMR 106-01 osteosarcoma homeodomain-containing factors.
cells, which constitutively express high levels of BSP (16), To determine whether these three elements were able to
showed levels of expression of the transfected construct that function as transcriptional enhancers, we synthesized A, B,
13910 Osteoblast Specificity of the Mouse Bsp Promoter

FIG. 2. 5ⴕ-Deletion analysis of the Bsp promoter. ExoIII deletion


of the p2472 construct yielded the set of 5⬘-deletions of the murine Bsp
promoter shown. These deletion constructs were transfected into clone
4, UMR 106-01, C2C12, 3T3-L1, F9, and S194 cells and grown under
differentiation conditions. Firefly luciferase activities were assayed and
normalized to Renilla luciferase and are shown as a percentage of the
activity of the full-length construct in clone 4 cells.

and C double-stranded oligonucleotides containing the se-


quences shown in Fig. 3C (see also Table I) and subcloned
multimers of them, in both orientations, into a firefly luciferase
reporter plasmid upstream of a minimal – 49/⫹41 Bsp promoter
fragment. When transfected into both the clone 4 and UMR cell
lines, only the C element construct exhibited elevated reporter
activity relative to the minimal promoter alone (Fig. 4A, com-
pare rows 1, 4, and 7), with levels approximately 3-fold higher
in clone 4 cells and 2-fold higher in UMR. The same pattern
was observed when the three elements were placed into a
similar vector containing a 34-bp minimal promoter from the
murine osteocalcin gene 2, which has been shown to be en-
hanced by multimers of the bone-specific OSE2 element (4, 6).
In this case, however, the C element displayed a 2–3-fold stim-
ulation in both osteoblastic cell lines when placed in the for-
ward orientation (Fig. 4B, row 4) and a 10 –13-fold stimulation
when in the reverse orientation (row 7). This apparent orien-
tation dependence may result from the presence of one more
copy of the C element in the reverse construct (five) than in the
forward construct (four). To assess the transcriptional contri-
butions of these elements in the context of the native promoter,
we then created three reporter constructs from which either
the A, B, or C element had been deleted from the –705-bp Bsp
promoter and compared their activities to that of the wild type
–705-bp construct when transfected into both clone 4 and UMR
cell lines. The construction of these internal deletion mutants
(named p705⌬A, ⌬B, and ⌬C) is diagrammed in Fig. 5A. The
705-bp promoter was chosen as the template for these deletions
because it contains enough promoter sequence to exhibit osteo-
blast specificity but is short enough to make confirmatory se-
quencing of the resultant PCR-produced fragments feasible. As
is shown in Fig. 5B, deletion of the A element did not effect
promoter activity in clone 4 cells, and although deletion of the
B element reduced promoter activity by approximately 35% in
UMR cells, it did not affect activity in clone 4 cells. Because the
B element also failed to show enhancer activity when placed in
front of a minimal promoter (Fig. 4), it was not considered
FIG. 1. Osteoblast-selective activity of the 2472-bp Bsp pro-
moter. A, time course of Bsp promoter induction. MC3T3-E1 clone 4
cells were transfected with p2472 and grown for up to 6 days with (A) or was conducted on RNA from MC3T3-E1 clone 4, ROS17/2.8, C2C12, and
without (C) ascorbic acid. Cells were harvested at the times indicated 3T3-L1 cells grown for 6 days under differentiating conditions. D, cell
and assayed for firefly and Renilla luciferase activities. B, induction of line specificity of Bsp promoter activity. Clone 4, ROS17/2.8, C2C12,
endogenous BSP mRNA in MC3T3-E1 cells. Total RNA from clone 4 and 3T3-L1 cells were transfected with p2472 and grown for 6 days
cells, grown with or without ascorbic acid and harvested at the times under the same conditions as in D. Firefly luciferase activities were
shown, was subjected to Northern blot analysis with a labeled BSP normalized to Renilla luciferase activities and are shown as a percent-
cDNA. C, cell line specificity of BSP mRNA expression. Northern analysis age of the clone 4 ascorbate-treated sample.
Osteoblast Specificity of the Mouse Bsp Promoter 13911

FIG. 3. DNase I footprint analysis of


the –338 to –178 promoter region. A, a
construct containing the murine Bsp pro-
moter from –338 to –178 was linearized
with EcoRI (to label the (⫹) strand) or
BamHI (for the (–) strand), end-labeled
with 32P, and incubated with the indi-
cated amount of UMR nuclear extract be-
fore digestion with DNase I. Digested
products were run on a sequencing gel
and compared with digested probe with-
out extract. The three regions that were
protected on both strands are named A, B,
and C and are indicated by brackets. The
base pair numbering of the ends of each
protected region is also shown. Asterisks
mark bands that were intensified due to
the creation of DNase I hypersensitivity
caused by the adjacent bound proteins. B,
shown is the region of the Bsp promoter
from –290 to –181 with the bases pro-
tected from DNase I digestion in A
marked by brackets (only the (⫹) strand
sequence is shown for simplicity). Brack-
ets above the base sequence denote the
protected bases on the (⫹) strand in A,
whereas those below the sequence denote
the corresponding protected bases on the
(–) strand. C, sequence conservation of A,
B, and C sequences. Brackets mark the
sequences of the A, B, and C oligonucleo-
tides that contain the protected bases in-
dicated in B. The base pair numbers in
the promoter sequence corresponding to
the ends of each oligonucleotide are
shown above the brackets. Shown below
each are the homologous regions of the rat
and human Bsp promoters for sequence
comparison. A consensus binding site for
the engrailed-1 homeodomain protein was
found in region C and is boxed.

further. In contrast to the A and B deletions, however, deletion UMR and clone 4 cells with radiolabeled double-stranded C
of the C element from the 705-bp promoter caused a major loss oligonucleotide as probe yielded a complex array of bands (Fig.
of transcriptional activity in both cell types. And, in fact, this 6, lane 2). All but one of these species (bands 1–5) could be
deletion accounted for the entire 60% drop in activity seen upon competed for, to varying degrees, by the addition of 50 –100-fold
removal of the entire region from –338 to –178 in these cell molar excess of unlabeled C oligonucleotide (Fig. 6, lanes 3 and
lines (compare Figs. 2 and 5B). The results from these deletion 4) but not by the addition of a heterologous oligonucleotide
transfections are in agreement with the data from the multim- containing the proximal OSE2 site from the Og2 promoter (4)
erized oligonucleotide experiments described above, and, taken (data not shown), indicating that this element is able to specif-
together, these two complementary studies indicate that the C ically bind a protein complex in the nuclear extracts of these
element is likely the only one of the three that is important for osteoblastic cells. We synthesized a series of mutated C oligo-
promoter activity in osteoblastic cells. Thus, we chose to focus nucleotides to determine which bases in the C element were
our further investigations on this sequence element. essential for protein binding. These contained the same se-
Identification of a Homeodomain Binding Site in the C Ele- quence as the wild type C oligonucleotide shown in Table I,
ment that is Necessary for Osteoblast-selective Bsp Promoter with the exception of a 2-base pair change in each. The identity
Activity—Gel mobility shift assays of nuclear extracts from of the mutated bases in each, and their effects on the binding of
13912 Osteoblast Specificity of the Mouse Bsp Promoter
TABLE I
Oligonucleotides used in this study
Oligo name Sequence

A GATCCTTTGCTATTTATTTTATTTGAA
GAAAACGATAAATAAAATAAACTTCTAG
B GATCCAGTATATTATTATATATATTCA
GTCATATAATAATATATATAAGTCTAG
Ca GATCCTCCTCACCCTTCAATTAAATCCCACAA
GAGGAGTGGGAAGTTAATTTAGGGTGTTCTAG
⫺369(⫹) TATGAATTCACTTTAGACCCCATGCAGTG
⫺253(⫹) TATGGATCCGCAGTATATTATTATATATATTCAGAACTC
⫺226(⫹) TATGGATCCCTCTAACTACCATCTTCTCC
⫺180(⫹) TATGGATCCCAAGCCTCTTGGCAGAAGG
⫺279(⫺) GATCGACTTAAGCATTTAAGCTTTC
⫺165(⫺) TATGGATCCCAAGAGGCTTGCATTGTGG
pGL3(⫹) TATGGTACCTGCCAGAACATTTCTCTATCG
pGL3(⫺) ATGCCAAGCTTACTTAGATCG
Cmut3SDb CCATCTTCTCCTCACCCTTCCCTTAAATCCCACAATGCAAG
GGTAGAAGAGGAGTGGGAAGGGAATTTAGGGTGTTACGTTC
a
The sequences of the C mutant oligonucleotides used in this study are the same as those of the wild type shown here except for the two base
pair changes shown in Fig. 6A.
b
The two base pairs that differ from the wild type BSP sequence are shown in boldface.

FIG. 4. Enhancer activity of A, B,


and C elements. A, A, B, and C double-
stranded oligonucleotides were ligated
into multimers and inserted immediately
upstream of a 49-bp minimal Bsp pro-
moter driving luciferase expression in the
p49BSP vector. Constructs containing
oligonucleotides oriented in either the for-
ward (F) or reverse (R) direction were
transfected into clone 4 and UMR cells.
Cells were harvested after 6 days and as-
sayed for luciferase activity (clone 4 cells
were treated with ascorbic acid). Values
shown are fold induction of each construct
over that of the insertless p49BSP vector
(row 1). Each arrow represents one copy
of a double-stranded oligonucleotide. The
open box represents the Bsp promoter
from – 49 to ⫹41. B, multimers of A, B,
and C oligonucleotides were also ligated
into the p34OG2 vector, which is the same
as the p49BSP vector described above, ex-
cept that the osteocalcin gene 2 promoter
from –34 to ⫹1 is substituted for the – 49/
⫹41 Bsp fragment. The resulting con-
structs were transfected into clone 4 and
UMR cells as in A.

the C probe when used as competitors in gel shift assays, are ognizable transcription factor binding site in the C sequence.
shown in Fig. 6. We chose a series of mutations that spanned Addition of a 50 –100-fold molar excess of unlabeled mutant 1
the consensus homeodomain site because this is the only rec- or mutant 6 oligonucleotides (Fig. 6, lanes 5, 6, 15, and 16)
Osteoblast Specificity of the Mouse Bsp Promoter 13913

FIG. 5. Effect of A, B, or C internal


deletions on the activity of the p705
construct. A, different combinations of
primers (represented as arrows) were
used with p705 as a template to create
PCR fragments containing sequences ei-
ther upstream or downstream of the de-
sired deletion, as described under “Exper-
imental Procedures.” These fragments
were ligated into pGL3Basic to create the
p705⌬A, p705⌬B, and p705⌬C constructs
represented here. The hatched bar repre-
sents Bsp promoter sequence. The open
bar is pGL3 sequence. Dashed lines indi-
cate the sequences that are deleted from
the final constructs. The end points of the
deleted promoter sequences are shown
relative to the start of transcription above
each construct. B, the deletion constructs
shown in A, as well as the complete p705,
were transfected into clone 4 and UMR
cells. Their activities are shown as per-
centages of p705 activity in each cell line.

showed that these mutants were able to compete for protein site-directed mutagenesis using primers Cmut3SD(⫹) and (–)
binding nearly as well as the wild type C probe. Mutants 2–5, (see Table I), into the full-length 2472-bp promoter construct.
however, were unable to compete with the wild type sequence. Results from the transfection of this mutated construct into
Taken together, these assays show that disruption of the ho- bone and nonbone cell lines are shown in Fig. 7B. The relative
meodomain binding sequence, TCAATTAA, abolishes the abil- normalized activities of the wild type 2472-bp construct in
ity of the C element to bind protein complexes in the nuclei of these lines were the same as those shown in Fig. 2. However, in
osteoblastic cells. Fig. 7B, we have set the activity of the full-length construct at
To test whether this sequence requirement for in vitro bind- 100% in each cell line and expressed the activities of the site
ing also applied to the enhancer activity of the C element, the mutant and deleted constructs as a percentage of that in order
ability of the mutant oligonucleotide 3 (Cmut3) to stimulate to clearly illustrate the drop caused by the 2-bp change. Al-
transcription of the – 49/⫹41 Bsp minimal promoter was com- though the mutation had no effect on the activity of the pro-
pared with that of the wild type C element described above. As moter in nonosteoblastic cells, it abolished 60% of the promoter
expected, a construct containing three copies of the wild type activity in the osteoblastic clone 4 and UMR cells, causing a
sequence gave up to 3-fold higher activity in osteoblastic cells drop nearly equivalent to the deletion of the entire sequence
than the minimal promoter alone (Fig. 7A, row 2), but the between –2472 and –178. Thus, the disruption of the homeodo-
mutant construct, which differed from the wild type by only 2 main binding site resulted in the ablation of almost all of the
bp, showed no such stimulation. To assess the contribution of osteoblast selective activity of the 2472-bp Bsp promoter.
the homeodomain binding site to the osteoblast specificity of Dlx5 Regulation of the C Element Homeodomain Site—We
the Bsp promoter, we introduced the same 2 bp mutation, by further characterized the activity of this element by examining
13914 Osteoblast Specificity of the Mouse Bsp Promoter
oligonucleotide (lanes 10 –12). Thus, this complex is dependent
on the intact homeodomain site for binding. The lower species
was competed by both wild type and mutant C oligos and was
also found in control nuclear extracts made from COS7 cells
transfected with a ␤-galactosidase expression vector (Fig. 8C,
lanes 2– 4). Therefore, it does not represent homeodomain site-
specific binding. To confirm that the specifically shifted species
observed was the result of Dlx5 binding, we repeated the gel
shift assay with a monoclonal antibody (M2) recognizing a
FLAG epitope tag built into the overexpressed Dlx5. This an-
tibody blocked the appearance of the specific species while
having no effect on the lower, nonspecific band (Fig. 8C, lane
13). Furthermore, this blocking action was counteracted by the
addition of FLAG peptide to compete for antibody binding,
indicating that the protein complex observed contains Dlx5
(Fig. 8C, lane 14). Addition of M2 antibody had no effect in
binding reactions with ␤-gal control extract (Fig. 8C, lane 5).
Together, these experiments show that the Dlx5 gene is ex-
pressed in our osteoblastic cell lines, and that the Dlx5 homeo-
protein is able to bind the Bsp C element and stimulate its
transcriptional activity.
DISCUSSION
Of the known bone extracellular matrix constituents, bone
sialoprotein is, perhaps, the most intimately associated with
the primary function of the differentiated osteoblast, namely
the mineralization of a collagenous matrix, yet little is known
about the cis-acting elements that restrict its expression to the
FIG. 6. Interaction of the C element with osteoblast nuclear mineralizing osteoblast. We previously reported the isolation of
proteins requires an intact homeodomain binding motif. A series a 2472-bp fragment of the murine Bsp promoter that is able to
of six double-stranded mutant C oligonucleotides was synthesized to
span the entire homeodomain binding motif. Each oligonucleotide con- direct osteoblastic-selective expression of a luciferase cDNA
tains a 2-bp mutation (as denoted by the brackets) in, or adjacent to, the under growth conditions which are known to support osteoblast
homeodomain consensus binding sequence. Although the corresponding differentiation in cell culture (6). Here we describe the results
mutations were made in the (–) strand, only the (⫹) strand is shown. of a systematic study to identify sequences within this frag-
The sequences of all mutants are identical to that of the wild type C
oligonucleotide shown in Table I except for these 2-bp changes. Gel
ment that may direct this tissue-specific expression.
mobility shift assays were conducted with either UMR or clone 4 nu- We found that the –2472/⫹41 base pair Bsp promoter, in
clear extract as described under “Experimental Procedures.” Lane 1 addition to its preferential expression in osteoblastic versus
contains no extract. Lane 2 contains extract but no cold competitor. The nonosteoblastic cell lines, was induced by collagen matrix pro-
remaining lanes contain binding reactions (with extract) incubated
duction in parallel with the endogenous BSP message. This
with a 50- or 100-fold molar excess (increasing amounts indicated by the
triangles) of unlabeled wild type (w.t.) C oligo or the mutant C oligo up-regulation in response to matrix interaction is indicative of
indicated. The six shifted species observed are numbered 1– 6 in order genes whose expression is associated with osteoblast differen-
from lowest to highest mobility. tiation and provides further evidence that the 2472-bp pro-
moter contains the requisite information to appropriately reg-
its ability to be directly regulated by the Dlx5 homeoprotein, a ulate Bsp transcription during the differentiation process (37).
member of the Dlx family of Drosophila distalless homologues. Deletion of sequence from –2472 to –705 caused a marked drop
We chose this factor as the most likely known candidate for the in promoter activity in clone 4 cells, but not in UMR 106-01
C element-binding protein because it has been shown to be cells, which constitutively produce BSP. One possible explana-
expressed on bone and to be able to regulate the osteoblast- tion for this observation is that this region contains sequences
specific osteocalcin promoter (23, 35). Additionally, homozy- that are necessary for the normal matrix-stimulated induction
gous knockout of the Dlx5 gene produces mice with severe of BSP but that are inactive in osteosarcoma cells which are
skeletal deformities, implying a crucial role in skeletogenesis free from the matrix requirement. It will be interesting to
(36). As represented in Fig. 8A, Dlx5 mRNA is expressed only identify the cis-acting elements in this region of the Bsp pro-
in those cell lines that also produce BSP, thus qualifying it as moter that are responsible for the differences in reporter ex-
a possible regulator of Bsp transcription. Furthermore, overex- pression between these two osteoblastic cell lines. Character-
pression of Dlx5 in COS7 cells (a highly transfectable, Dlx5- ization of such elements may yield additional information on
and BSP-null background) stimulated the activity of the C the matrix-induced signaling pathways that are active in
element-driven minimal Bsp promoter construct 6-fold over osteoblasts.
cells transfected with a ␤-galactosidase control vector, but only This present study, however, focuses on the isolation of se-
if the homeodomain site was left intact (Fig. 8B, compare C w.t. quences that are important for promoter activity in osteoblastic
and Cmut3 constructs). versus nonbone cells, as these are likely to be the elements that
Finally, gel shift assays performed with nuclear extract pre- confer bone specificity. We identified one such element, a con-
pared from COS cells overexpressing Dlx5 demonstrated the sensus homeodomain binding site, between –199 and –192
sequence-specific binding of Dlx5 to the C element. These ex- (TCAATTAA). Disruption of this sequence caused a 60% drop
periments produced two major shifted species (Fig. 8C, lane 6), in transcriptional activity only in the osteoblastic cells and
the upper one of which (asterisk) was competed by the addition accounted for almost all of the difference in activity between
of a 50-, 100-, or 200-fold excess of unlabeled wild type C the bone and nonbone cell lines used in this study. To our
oligonucleotide (lanes 7–9) but not by the addition of Cmut3 knowledge, this is the first description of an osteoblast-specific
Osteoblast Specificity of the Mouse Bsp Promoter 13915

FIG. 7. Comparison of enhancer ac-


tivities of wild type and mutant C el-
ement sequences. A, a trimer of the
Cmut3 double-stranded oligonucleotide
was inserted into the p49BSP vector in
the forward orientation (row 2), and its
transcriptional activity in clone 4 and
UMR cells was compared with that of the
construct containing the wild type C ele-
ment (row 3). Values shown are fold in-
duction of each construct over that of the
insertless p49BSP vector (row 1). B, the
2-bp mutation corresponding to that in
the Cmut3 oligonucleotide was intro-
duced into p2472 by site-directed mu-
tagenesis using primers Cmut3SD(⫹) and
(–) (see Table I). The resulting p2472mut3
construct was transfected into clone 4,
UMR, C2C12, 3T3-L1, and F9 cells, and
its transcriptional activity was compared
with that of the wild type p2472, as well
as the p178 (which lacks A, B, and C
elements) and p49 (minimal promoter)
deletion constructs. Normalized lucifer-
ase activities are shown as a percentage
of the wild type p2472 (p2472 w.t.) con-
struct activity, with the p2472 w.t. activ-
ity set at 100% in each cell line in order to
emphasize the percentage of drop attrib-
uted to the mutation in each cell type.
Normalized luciferase activities of the
wild type promoter in osteoblastic and
nonosteoblastic cell lines were similar to
results shown in Fig. 2.

transcriptional element within the bone sialoprotein gene pression in MC3T3-E1 cells of a 199-base pair promoter frag-
promoter. ment containing this site. More recently, Newberry et al. (23)
There is a large body of genetic evidence implicating home- reported that overexpression of Dlx5 was able to reverse this
odomain proteins in the development of mineralized tissues, inhibition through heterodimerization with Msx2, further sup-
particularly with respect to members of the Dlx and Msx fam- porting the theory that these two families of homeoproteins are
ilies, which are known to be expressed in tissues that give rise capable of influencing the transcription of an osteoblast-spe-
to skeletal structures, and mutations in which result in the cific gene. Our finding that Dlx5 can bind the Bsp C element
display of severe skeletal phenotypes. For example, mice con- and stimulate its activity is not only consistent with this the-
taining mutations in Msx1 show craniofacial abnormalities ory, but extends it in that it represents the first example of
that include cleft palate and absence of specific teeth (38), while direct activation of an osteoblastic-specific cis-acting element
mice expressing a mutated Msx2 transgene exhibit the symp- by a Dlx factor.
toms of craniosynostosis, a disease characterized by premature Two other studies which also describe positive regulation
closure of the cranial sutures (39). Furthermore, both Dlx1 and through an osteoblast-selective homeodomain binding element
Dlx2 knockout mice display abnormal formation of the skull in vivo were performed by two independent groups on the
bones derived from the first and second branchial arches (40, murine and rat ␣1(I) collagen gene promoters. Taken together,
41), while mice deficient in both factors show additional defects these studies found that a homeodomain binding site (TTA-
in dentition (42). In addition, in a recent study by Acampora et ATTA), which is conserved in the human, rat, and murine
al. (36), Dlx5 –/– mice were shown to have the most severe promoters, was required for osteoblastic-selective activity in
phenotype of all the known Dlx knockouts, displaying not only transgenic mice and that this site bound in vitro to a complex
cranial and mandibular malformations, but defects in long found only in osteoblastic cells. Furthermore, both in vitro
bone development as well. binding and transcriptional activity were lost if the homeodo-
At the molecular level, Towler and colleagues (43) reported main consensus sequence was mutated (44, 45).
that Msx2 is able to bind in vitro to a homeodomain binding site Our discovery of an osteoblastic-specific homeodomain bind-
between – 84 and –92 in the rat osteocalcin promoter (ACTA- ing site in the Bsp promoter that is similar to the one shown to
ATTGG) and that forced overexpression of Msx2 inhibited ex- direct expression of ␣1(I) collagen may provide new insight into
13916 Osteoblast Specificity of the Mouse Bsp Promoter

FIG. 8. Transcriptional activation


and in vitro binding of the C element
by Dlx5. A, correlation of Dlx5 and BSP
expression. RNA was isolated from
MC3T3-E1 clone 4, UMR 106-01, C2C12,
F9, and COS7 cells grown for 6 days un-
der differentiating conditions as described
under “Experimental Procedures” (except
COS cells, which were grown for 48 h) and
assayed for Dlx5 and BSP expression by
Northern analysis. Hybridization with a
probe for 18 S rRNA was performed to con-
firm equal loading of all lanes. B, the vec-
tors shown in Fig. 7A, containing either the
C wild type (C wt) or Cmut3 sequences
upstream of the 49 Bsp minimal promoter,
were each transfected into COS7 cells with
either the pcDNA3Dlx5 or pCMV5-␤-gal
expression vector and assayed for lucifer-
ase reporter activity after 48 h. Values
shown are fold stimulation of Renilla nor-
malized firefly luciferase activities of
Dlx5 transfected samples over those of
␤-galactosidase-transfected samples for
each construct. C, binding of Dlx5 to the C
element. 5 ␮g per binding reaction of nu-
clear extract from COS7 cells transfected
with either pCMV5-␤-gal expression plas-
mid (lanes 2–5) or pcDNA3-Dlx5 plasmid
(lanes 6 –16) was subjected to gel mobility
shift analysis with the wild type C oligo-
nucleotide. Lane 1 contains no extract.
50-, 100-, and 200-fold molar excesses of
wild type C oligo (lanes 7–9) or Cmut3
oligo (lanes 10 –12) were used as unla-
beled competitors. A 200-fold excess of ei-
ther wild type or mutant C oligo was used
in lanes 3 and 4, respectively. The species
that represents homeodomain site-spe-
cific binding to the probe in lanes 6 –16 is
marked with an asterisk. A faster migrat-
ing band that is not homeodomain site-
specific appears in both ␤-gal and Dlx5
reactions and is competed by both wild
type and mutant sequences. M2 mono-
clonal anti-FLAG epitope antibody (lane
13), but not control IgG (lane 15), added to
the binding reaction blocked formation of
the specific species. Addition of an ap-
proximately 100-fold molar excess of
FLAG peptide reversed this blockage
(lanes 14 and 16). Antibody addition to a
␤-gal control extract binding reaction
(lane 5) had no effect.

the mechanism of osteoblast gene expression. If it is true, as is transcription factors. Given the new data reported here, it is
widely held, that BSP plays a crucial role in the nucleation of possible that one such factor may be a homeodomain protein
mineral formation in the collagenous matrix of bone, then it is complex that binds to both collagen and Bsp promoters, ena-
plausible to speculate that the col1␣(I) and Bsp promoters are bling their transcription in osteoblasts, and thus coordinating
coordinately regulated by a shared set of osteoblast-specific both the deposition and mineralization of the collagenous ma-
Osteoblast Specificity of the Mouse Bsp Promoter 13917
trix. Such a complex, in conjunction with other factors such as 15. Xiao, G., Cui, Y., Ducy, P., Karsenty, G., and Franceschi, R. T. (1997) Mol.
Endocrinol. 11, 1103–1113
Cbfa1, might function as a central determinant of osteoblast 16. Midura, R. J., McQuillan, D. J., Benham, K. J., Fisher, L. W., and Hascall,
differentiation. Our data, combined with the recent description V. C. (1990) J. Biol. Chem. 265, 5285–5291
17. Yaffe, D., and Saxel, O. (1977) Nature 270, 725–727
of the Dlx5 knockout mice mentioned above, strongly support a 18. Majeska, R. J., Rodan, S. B., and Rodan, G. A. (1980) Endocrinology 107,
role for Dlx5 as one such determinant. However, in considering 1494 –1503
this scenario, it is important to recognize that the results we 19. Green, H., and Meuth, M. (1974) Cell 3, 127–133
20. Strickland, S., and Mahdavi, V. (1978) Cell 15, 393– 403
present here, as well as the aforementioned osteocalcin pro- 21. Gluzman, Y. (1981) Cell 23, 175–182
moter studies, merely demonstrate that Dlx5, or a related 22. Franceschi, R. T., Iyer, B. S., Parikh, U. K., and Pineron, G. J. (1992) J. Bone
homeoprotein, may regulate osteoblast-specific transcription in Miner. Res. 7, S218
23. Newberry, E. P., Latifi, T., and Towler, D. A. (1998) Biochemistry 37,
vivo; they do not positively identify Dlx5, or any other known 16360 –16368
factor, as such a regulator. Furthermore, the apparently im- 24. Chomczynski, P., and Sacchi, N. (1987) Analytical Biochemistry 162, 156 –159
25. Thomas, P. S. (1980) Proc. Natl. Acad. Sci. U. S. A. 77, 5201–5205
precise DNA binding specificities of homeoproteins in vitro 26. Young, M. F., Ibaraki, K., Kerr, J. M., Lyu, M. S., and Kozak, C. A. (1994)
prohibits their identification merely by examination of the se- Mamm. Genome 5, 108 –111
quences to which they bind in individual promoters. Our ongo- 27. Franceschi, R. T., Iyer, B. S., and Cui, Y. (1994) J. Bone Miner. Res. 9, 843– 854
28. Dignam, J. D., Martin, P. L., Shastry, S., and Roeder, R. G. (1983) Methods
ing studies are aimed at identifying the factor that binds the Enzymol. 101, 582–598
newly characterized osteoblast-specific element in the Bsp pro- 29. Maxam, A. M., and Gilbert, W. (1977) Proc. Natl. Acad. Sci. U. S. A. 74,
560 –564
moter and at elucidating its role in the expression of the osteo- 30. Chen, J., Thomas, H. F., Jin, H., Jiang, H., and Sodek, J. (1996) J. Bone Miner.
blast phenotype. Res. 11, 654 – 664
31. Franceschi, R. T., and Iyer, B. S. (1992) J. Bone Miner. Res. 7, 235–246
REFERENCES 32. Schinke, T., and Karsenty, G. (1999) J. Biol. Chem. 274, 30182–30189
1. Fujisawa, R., Nodasaka, Y., and Kuboki, Y. (1995) Calcif. Tissue Int. 56, 33. Ohkuma, Y., Horikoshi, M., Roeder, R. G., and Desplan, C. (1990) Proc. Natl.
140 –144 Acad. Sci. U. S. A. 87, 2289 –2293
2. Goldberg, H. A., Warner, K. J., Stillman, M. J., and Hunter, G. K. (1996) 34. Catron, K. M., Iler, N., and Abate, C. (1993) Mol. Cell. Biol. 13, 2354 –2365
Connect Tissue Res. 35, 385–392 35. Ryoo, H. M., Hoffmann, H. M., Beumer, T., Frenkel, B., Towler, D. A., Stein,
3. Chen, J., Shapiro, H. S., and Sodek, J. (1992) J. Bone Miner. Res. 7, 987–997 G. S., Stein, J. L., van Wijnen, A. J., and Lian, J. B. (1997) Mol. Endocrinol.
4. Ducy, P., and Karsenty, G. (1995) Mol. Cell. Biol. 15, 1858 –1869 11, 1681–1694
5. Komori, T., Yagi, H., Nomura, S., Yamaguchi, A., Sasaki, K., Deguchi, K., 36. Acampora, D., Merlo, G. R., Paleari, L., Zerega, B., Postiglione, M. P., Mantero,
Shimizu, Y., Bronson, R. T., Gao, Y. H., Inada, M., Sato, M., Okamoto, R., S., Bober, E., Barbieri, O., Simeone, A., and Levi, G. (1999) Development
Kitamura, Y., Yoshiki, S., and Kishimoto, T. (1997) Cell 89, 755–764 126, 3795–3809
6. Benson, M. D., Aubin, J. E., Xiao, G., Thomas, P. E., and Franceschi, R. T. 37. Franceschi, R. T. (1999) Crit. Rev. Oral Biol. Med. 10, 40 –57
(1999) J. Bone Miner. Res. 14, 396 – 405 38. Satokata, I., and Maas, R. (1994) Nat. Genet. 6, 348 –356
7. Ducy, P., Desbois, C., Boyce, B., Pinero, G., Story, B., Dunstan, C., Smith, E., 39. Liu, Y. H., Kundu, R., Wu, L., Luo, W., Ignelzi, M. A., Jr., Snead, M. L., and
Bonadio, J., Goldstein, S., Gundberg, C., Bradley, A., and Karsenty, G. Maxson, R. E., Jr. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 6137– 6141
(1996) Nature 382, 448 – 452 40. Qiu, M., Bulfone, A., Martinez, S., Meneses, J. J., Shimamura, K., Pedersen,
8. Defranco, D. J., Lian, J. B., and Glowacki, J. (1992) Endocrinology 131, R. A., and Rubenstein, J. L. (1995) Genes Dev. 9, 2523–2538
114 –121 41. Qiu, M., Bulfone, A., Ghattas, I., Meneses, J. J., Christensen, L., Sharpe, P. T.,
9. Kim, R. H., Li, J. J., Ogata, Y., Yamauchi, M., Freedman, L. P., and Sodek, J. Presley, R., Pedersen, R. A., and Rubenstein, J. L. (1997) Dev. Biol. 185,
(1996) Biochem. J. 318, 219 –226 165–184
10. Ogata, Y., Niisato, N., Furuyama, S., Cheifetz, S., Kim, R. H., Sugiya, H., and 42. Thomas, B. L., Tucker, A. S., Qui, M., Ferguson, C. A., Hardcastle, Z.,
Sodek, J. (1997) J. Cell. Biochem. 65, 501–512 Rubenstein, J. L., and Sharpe, P. T. (1997) Development 124, 4811– 4818
11. Ogata, Y., Yamauchi, M., Kim, R. H., Li, J. J., Freedman, L. P., and Sodek, J. 43. Towler, D. A., Rutledge, S. J., and Rodan, G. A. (1994) Mol. Endocrinol 8,
(1995) Eur J Biochem 230, 183–192 1484 –1493
12. Yang, R., and Gerstenfeld, L. C. (1996) J. Biol. Chem. 271, 29839 –29846 44. Bedalov, A., Salvatori, R., Dodig, M., Kronenberg, M. S., Kapural, B.,
13. Kerr, J. M., Hiscock, D. R., Grzesik, W., Robey, P. G., and Young, M. F. (1997) Bogdanovic, Z., Kream, B. E., Woody, C. O., Clark, S. H., Mack, K., Rowe,
Calcif. Tissue Int. 60, 276 –282 D. W., and Lichtler, A. C. (1995) J. Bone Miner. Res. 10, 1443–1451
14. Sudo, H., Kodama, H.-A., Amagai, Y., Yamamoto, S., and Kasai, S. (1983) 45. Rossert, J. A., Chen, S. S., Eberspaecher, H., Smith, C. N., and de Crombrugghe,
J. Cell Biol. 96, 191–198 B. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 1027–1031