MICHAEL CRICHTON

ŐSLÉNYPARK

MÆCENAS

A fordítás az alábbi kiadás alapján készült: Jurassic Park. A Novel by Michael Crichton Alfred A. Knopf, New York, 1990 © 1990 by Michael Crichton

Fordította BORIS JÁNOS A fedélen HELÉNYI TIBOR festménye Fedéltipográfia: GÁLÓCSI ÁGNES

ISBN 963 7425 91 8 Maecenas Könyvkiadó, Budapest Felelős kiadó: a Maecenas Kiadó igazgatója Szerkesztette: B. Háry Lenke Tipográfia és műszaki szerkesztés: Szakálos Mihály

Hungarian edition © by Maecenas Könyvkiadó, 1993 Hungarian translation © by Boris János, 1992

A. M.-nek és T.-nek

A hüllők visszataszítóak, mert testük hideg, színük halvány, a bőrük mocskos, csontvázuk porcos, hangjuk kellemetlen, lakóhelyük undorító, mérgük pedig iszonyú; mindezen okokból Alkotójuk nem vesztegette rá erejét, hogy túl sokat teremtsen belőlük. LINNÉ, 1797 Új életformákat nem lehet „felidézni”. ERWIN CHARGAFF, 1972

BEVEZETÉS
„Az InGen-ügy” A huszadik század vége felé hihetetlen méretű tudományos aranyláz kezdődött: eszeveszett versenyfutás indult a génsebészet kommercializálásáért. Ez az iparág oly gyorsan fejlődik – és oly kevés szó esik róla „civil” körökben –, hogy jószerivel senki sem tudja, mi folyik itt, micsoda méretekben, és milyen következményekkel kell számolnunk. A biotechnológia az emberiség történelmének eddigi legnagyobb forradalmával kecsegtet. Az évtized végére le fogja körözni az atomenergiát és a számítástechnikát, annyival nagyobb hatása lesz hétköznapi életünkre. Egy szakember így véli: „a biotechnológia az emberi élet minden oldalát át fogja formálni: orvosi ellátásunkat, étkezésünket, egészségünket, szórakozásainkat, magát a testünket. Semmi sem lesz többé olyan, mint volt. A szó legszorosabb értelmében más lesz az egész bolygó arca.” A biotechnológiai forradalom azonban három fontos szempontból különbözik a múlt tudományos átalakulásaitól. Először is igen széles körben folyik. Amerikát egyetlen tudományos intézmény, Los Alamos munkája vezette be az atomkorba. A számítógépkorszakba már egy tucat cég erőfeszítései révén jutott el. Biotechnológiai kutatásokkal viszont csak Amerikában több mint kétezer laboratórium foglalkozik. Ötszáz cég költ évi ötmilliárd dollárt ennek a technológiának a kimunkálására. Másodszor: e kutatások jó része felelőtlen, sőt egyenesen frivol. Halványabb színű pisztrángokat akarnak létrehozni, hogy jobban látszódjanak a vízben, szögletes fatörzseket, amelyeket könnyebb feldolgozni, vagy éppen injekcióba beadható parfümöt, hogy mindig kedvenc illatunkat árasszuk. Lehet, hogy ez mulatságosnak tűnik, de sajnos a legkevésbé sem az. Sőt, az új technológiával kapcsolatos aggodalmakat éppen hogy fokozza az a tény, hogy olyan iparágakban is alkalmazhatják, amelyek ki vannak téve a divat legszélsőségesebb változásainak. Harmadszor: ez a munka ellenőrizetlen. Senki sem felügyel rá. Nem vonatkoznak rá országos törvények. Nem foglalkoznak vele az állami politika szintjén. Nem is könnyű egyértelmű politikai álláspontot kialakítani vele kapcsolatban, mivel a biotechnológia termékeinek skálája a gyógyszerektől a mezőgazdaságon át a mesterséges hóig mindent magában foglal. Ami azonban a legijesztőbb: maguk a tudósok sem hoztak eddig létre semmiféle független ellenőrző csoportot. Feltűnő, hogy szinte minden kutató, aki géntechnikával foglalkozik, egyidejűleg a kereskedelmi célú biotechnológiában is érdekelt. Mindenki benne van a buliban. A molekuláris biológia elüzletiesedése erkölcsi szempontból a tudománytörténet eddigi legmegdöbbentőbb fordulata, ráadásul elképesztő gyorsasággal ment végbe. Négyszáz évig, Galilei óta, a tudomány mindig egyet jelentett a természet titkainak nyílt, szabad vizsgálatával. A tudósok soha nem vettek tudomást az országhatárokról. Úgy érezték, felette állnak a politika kérészéletű szempontjainak, sőt még a háborúknak is. Újra meg újra fellázadtak a kutatás bármiféle titkossága ellen, s még találmányaik szabadalmaztatása sem volt az ínyükre, mivel úgy vélték, munkájuknak az egész emberiség javát kell szolgálnia. És így is volt évszázadokon át: a tudósok felfedezéseiben volt valami sajátos önzetlenség. Amikor 1953-ban Angliában két fiatal kutató, James Watson és Francis Crick megfejtette a DNS-molekula szerkezetét, munkájukat úgy ünnepelték, mint az emberi szellem diadalát, azét az évszázados vágyét, hogy tudományos magyarázat szülessék a világegyetem egyik legnagyobb kérdésére. Mindenki meg volt győződve róla, hogy ezt a felfedezést is önzetlenül az emberiség javára fogják fordítani. De nem így történt. Harminc év sem telt bele, és Watson és Crick szinte minden tudós kollégája egy egészen másfajta törekvés részese lett. A molekuláris genetika kutatása hatalmas, multimilliárd dolláros üzleti vállalkozássá vált, amelynek eredete nem 1953-ra, hanem 1976-ra nyúlik vissza, egészen pontosan 1976 áprilisára. Ekkor került sor arra a ma már híresnek mondható találkozásra, amikor Robert Swanson, a nagyvállalkozó ajánlatot tett Herbert Boyernek, a kaliforniai egyetem biokémikusának. Megegyeztek, hogy kereskedelmi céget alapítanak a Boyer által kidolgozott génsebészeti technika kiaknázására. Új cégük, a Genentech szinte pillanatok alatt a géntechnikai vállalkozások legnagyobbika és a legsikeresebbje lett. Egyszerre csak úgy tűnt, mindenki meg akar gazdagodni. Szinte hetente jelentették be újabb és újabb cégek alapítását, s a kutatók seregestül jelentkeztek az új genetikai eljárások kiaknázására. 1986-ra már legalább 362 tudós – közülük 64 a Nemzeti Akadémia tagja – ült a biotechnológiai cégek elnökségeiben. Ennél is jóval többen voltak tőkéstársi vagy tanácsadói pozíciókban. Nem lehet eléggé hangsúlyozni ennek a magatartásváltozásnak a jelentőségét. A múltban a „tiszta” tudósok arisztokratikus módon lenézték az üzletet. A pénzhajhászást olyasvalaminek tekintették, amely szellemileg érdektelen, csak boltosoknak való. Ipari kutatásokat folytatni – még ha a nagy tekintélyű Bell cégről vagy az IBM-

hogy „bepiszkolja” őket az ipar. Az InGen kutatásait végül is titokban végezték. mely szerint semmit sem hoznak nyilvánosságra. Ennek azonban vége. így a kör zárva maradt. a Hamaguri és a Densaka. mint a Palo Alto-i International Genetic Technologies. s ha bármiféle technológiai vita adódott. és közülük is csak maroknyian maradtak életben. A bírósági iratok közül csak keveset hoztak nyilvánosságra. Ebben az elüzletiesedett légkörben alighanem elkerülhetetlen volt az olyan telhetetlen cégek létrejötte. a japán érdekeket is Daniel Ross. Ez a régi ellentét távol tartotta az egyetemi kutatókat attól. amikor a Genetic Technologies csődeljárást kért maga ellen a San Franciscó-i csődtörvényszéknél. hogy az a genetikai krízis. hogy egy hónap sem kellett hozzá. Az „InGen-ügynek” azonban számos olyan résztvevője is van. akik lemaradtak az egyetemi állásokról. Nehogy bármiféle dokumentum fölöslegesen a nyilvánosság elé kerüljön. az ügy alig keltette fel a sajtó figyelmét. Az alapkutatók magatartása tehát kritikus volt az alkalmazott tudomány művelőivel szemben és az iparral szemben általában. A Costa Rica-i alkonzul meglehetősen szokatlan petíciójának meghallgatására zárt ajtók mögött került sor. köztük a nagy tekintélyű tanácsadói testület. amelyet okozott. vita nélkül lezárták. és senki sem nyilatkozik a történtekről. ők pedig hagyományosan kerülik a nyilvánosságot. mindig akadtak kívülálló tudósok. Ma alig van molekuláris biológus vagy kutatóintézet. Hiszen annyira hétköznapinak látszott: Az InGen abban az évben a harmadik kisebb biotechnológiai vállalkozás volt. Costa Rica nyugati partjainál. maga az eset KözépAmerika legfélreesőbb vidékén történt. Ők nem zárkóznak el az elől. Hol vannak már a régi. mivel a hitelezők japán konzorciumok voltak. miféle különös események zajlottak le 1989 augusztusának utolsó napjaiban azon a távoli szigeten. Az sem meglepő. húsznál is kevesebb tanúja volt. ismeretlen maradt a közvélemény előtt. De most már titokban végzik. az InGen jogi tanácsadója képviselte. Még a végén is. amelynek ne volnának kereskedelmi kapcsolatai.laboratóriumokról is volt szó – azoknak való. olyan megállapodást írtak alá. Swain and Ross ügyvédi iroda társtulajdonosa. sietve és a haszonért. hogy a legmagasabb szinten tárgyalják meg a problémát. a Cowan. Nincs mit csodálkoznunk tehát. A megállapodás résztvevői. boldog idők! A genetikai kutatás egyre vadabb tempóban folytatódik tovább. amely csődöt jelentett. 1986 óta pedig a hetedik. . Inc. aki nem tartozik az aláírók közé. s az InGen problémáit csendben. hogy beszéljenek róla.

ŐSLÉNYPARK .

amely semmivel sem volt alábbvaló a chicagóinál. Nagy hasú Sikorsky-típus volt. míg világossá nem vált. Lázas. nem is szólva a ködbe burkolt óceánról. oldalsó ajtót. a készülő üdülőhely valami egészen különösen nagyszabású és bonyolult. Kalapácsütések verték a rendelő hullámbádog tetejét. De ez az eső! Ez a szüntelen. Helyet keres a leszálláshoz. A fiú sápadt volt. Bobbie olyan színvonalon gyakorolhatta orvosi tudását. amely már több mint két éve folyt. Manuel Aragón eszes. Elhiheti – mondta Bobbie. Nem erre számított. egy másik pedig a lábán. izgatott spanyol nyelvű kiáltozás hallatszott. úgy figyelt. kék csíkkal az oldalán. fémvége rozsdás a nyirkos levegőtől. Magának kell segítenie. valami mély berregés. Bobbie pontosan el tudta képzelni. doktornő. és tócsákba gyűlt a földön. Bobbie-nak tetszett Bahía Anasco elzártsága és barátságos népe. és most már a fejük fölött dübörgött. Vajon mi lehet olyan sürgős azon a szigeten. . Átment rajta az exkavátor. Mondták. Bobbie látta. Costa Rica nyugati partján. Egyébként minden a legnagyobb rendben lett volna. Csuromvíz volt minden. – Nem azt. Orvost kerestek. ahol egymást érik az úszómedencék és a teniszpályák. amely közeledett és erősödött. Carter vagyok – mondta a lány. anélkül hogy bármiféle zavaró kapcsolatba kelljen kerülniük a helyi valósággal. rajta felirat: InGen Építészeti Vállalat. Sztetoszkóp lógott a nyakában. – Elesett. Bobbie-n térdben levágott farmer és atlétatrikó volt. – Ed Regis. megállíthatatlan eső! A rendelő túlfelén Manuel egyszerre csak félrefordította a fejét. Azóta minden áldott nap esett. majd megint vissza a parthoz. hosszú hasított seb tűnt elő a vállán. Felcserasszisztense. csak úgy püfölte a fejét és a karját. A sérült szinte gyerek volt még. Egyenruhás férfiak ugrottak ki belőle. hogy két hónapig itt orvoskodjon vendégként. – Hallgassa csak! – mondta. mi az: egy helikopter forgószárnyának ütemes pufogása. San José. ebben a Bahía Anasco nevű halászfaluban. Manuel pedig gyengéden az ajtó felé kormányozta Bobbie-t. amint a helikopter lassan letelepszik a nedves parti homokon. miután két kemény évet lehúzott a chicagói Michael Reese Kórház baleseti osztályán. Így hívták a céget. a víz bőgve zúdult alá a fémcsatornákon. Rázta a hideg. Új hang keveredett az eső zajába. bőségesen ellátott rendelő működött. Ahogy óvatosan felemelte vér áztatta ingét. Sok-sok napsütést remélt. Az utóbbi fehér esőkabátot viselt. jól képzett szakember volt. Roberta Carter nagyot sóhajtott. – Dr. a rendelő bejárata felé. mély. amint hintázva visszalendül a víz fölé a halászcsónakok közelében. – Hallom. Lehetetlen – gondolta Bobbie. – Vinnénk is. amikor elvállalta. hogy a helikopter még ilyen időben is felszállt? Az orvosnő a szélvédőn át látta. hogy a pilóta megkönnyebbülten fújja ki a visszatartott levegőt. a főváros légiúton alig húszpercnyire volt innen. – Ilyen időben képtelenség felszállni! De a zaj csak erősödött. aztán az alacsonyan szálló helikopter áttörte az óceáni ködöt. míg egy fehér ember pattogó hangon parancsokat osztogatott. majd visszatért. s még ebben az isten háta mögötti faluban is jól felszerelt. Óriási cseppekben zuhogott az eső. és szinte feltépték a nagy. és kinézett az ablakon. szanaszét fröcskölt. és eszméletlen. miről lehet szó: a sok-sok tipikus. Leírt egy kört. Figyeljen! Aztán ő is meghallotta. vörös haja kikandikált a „Mets” feliratú baseballsapka alól. A Costa Rica-i egészségügyi szervezet a világ húsz legjobbikának egyike. legfeljebb ha tizennyolc éves. hogy a vendégek nyugodtan játszhassanak és iszogathassák a koktéljukat. Immár három hete volt Bahía Anascóban. Súlyos betegünk van. A helybeliek közül sokan dolgoztak az építkezésen. A vörös hajú férfi kissé meglepetten nézett rá. – Mit történt vele? – Üzemi baleset! – kiáltotta a zajban Ed. Bobbie a sebesült mellett futott. aztán óvatosan oldalt siklik az ütött-kopott fadokk felé. és egy kis kikapcsolódást. csak ebben az időben nem tudjuk átrepülni a hegyeket. amely új üdülőtelepet épített a part menti szigetek egyikén. Alig látott el a rendelőtől a tengerpartig. Két fekete bőrű férfi ernyedt testet hozott felé. – Akkor talán jobb volna San Joséba vinniük – mondta Bobbie. hatalmas amerikai üdülőkomplexus egyikéről.PROLÓGUS A raptor harapása Sűrű függönyökben dőlt a trópusi eső. – Itt az orvos? – kérdezte az odasiető Bobbie-tól.

– Segíteni akar rajta vagy nem? – kérdezte a lány. – Várjon odakint! – Miért? – kérdezte riadtan Ed. amire nem volt felkészülve. – Tovább mossam? – Igen – mondta Bobbie. Semmi talaj fertőzés a sebterületen. hogy megvizsgálja sebeit. – Nem tudom. de a nyelve alig forgott. hogy feltépték a fiú lábát. és ujja hegyével óvatosan megérintette a sebet. csak valami sikamlós. és hívogatva integetett. Megérintette. – Én nem láttam – felelte Ed. mint akit összemarcangoltak – mondta Bobbie Carter. Ha földmunkagép ment volna rajta keresztül. mire félretette a fényképezőgépet. hogy mechanikus balesettel van dolga. A mechanikus traumáknak – az autós sérüléseknek éppúgy. feltépték végig a vállán és ugyanúgy a combján.. A második hasadt seb átvágta a comb sűrű izomzatát. Szörnyű. A fejet. úgy viselkedett. vágások a csuklókon és az alkarokon. Rövid. és letették a vizsgálószoba közepén álló asztalra. Nem tetszett neki a dolog. mindennaposak lehetnek a kisebbnagyobb balesetek. miközben a seb mélységét vizsgálta. – Ez mint jelent? – kérdezte tőle Bobbie. Mint a legtöbb traumatológus. – Azt mondják. a kezet. majd hátrálni kezdett. Van valami jellegzetesség az állatok támadása okozta sebeknek. Rossz a szag! – És keresztet vetett. Ezzel szemben a fiú bőrét darabokra szaggatták. hasított karmolások mindkét tenyéren. Itt ennek nyoma sem volt. aki mindig mindennek igyekszik eleget tenni. A fiú szája megmozdult. hogy a fiú állapota semmi jóval sem kecsegtet. Nyugtalan. – Ismételje el. Bobbie még életében nem érzett ilyen szagot. és fölé hajolt. mély. – Összemarcangolták? – kérdezte Ed. – Nem? – Az ő fülének pedig spanyolul hangzott. – Mennyi ideje történt? – Egy órája. mint egy építésvezető. – Lo sa raptor. nekem elhiheti. hogy látszott alatta a combi ütőér lüktetése.Manuel a rendelő élénkzöld ajtajánál állt. a kart. Valahogyan nem tudta elhinni. mi folyik itt. És a sebnek különös szaga volt. Ekkor azonban a fiú felnyögött. Kis automata Olympus gépéért nyúlt. . ahogy a tekintete a fiú kezére esett. Harapások! Minden arra mutat. a seb mélye is csupa sár lenne. doktornő. Az orvosnőnek újra feltűnt. a halál és a bomlás bűze. Az egyik egy kétéves gyerek. A kéz! Végigfutott a hideg a hátán. – Ed beszéd közben az ajkát nyalogatta. de valami nincs rendben! Manuel habozott. Két marcangolásos betege volt. Manuel a fejét rázta. – De előbb adjon neki blokádot. nem spanyolul van. magával vonszolta az exkavátor. mit jelent ez. igyekvő fajtának látszott. jól emlékezett még azokra az esetekre is. hogy jobb legyen a megvilágítás. „Vajon miért?” – kérdezte magától Bobbie. hogy meg fog halni. Bobbie-nak az volt az első benyomása. Bobbie újra végigvizsgálta. E szavakra Manuel megdermedt. dehogy! Az exkavátor volt. hogy tudja. Inkább. Kitolta a férfit a szobából. gondolta. Ha képzetlen helyi munkások dolgoznak az üdülőhelyi építkezésen. Lo sa raptor. – Tudniillik úgy néz ki. ragacsos habszerűségnek. megdörzsölte két ujja között. semmi zúzódásos elem. mosdassa őt tovább! – Nem doktornő. marcangolásnak látszott. tépett árok futott lefelé a vállától a mellkasáig. Másfelől viszont a test legnagyobb részén nem volt semmiféle sebhely. Manuel megszólalt: – Átmosdassam? – Igen – mondta Bobbie. akinek ellentéte támadt egy bengáli tigrissel. hogyan történt a baleset! – mondta. még egy karcolás sem. Ideges volt. mint a gyári baleseteknek – szinte mindig lényeges összetevője a zúzódás vagy törés. A seb szélein szinte összemorzsolódott a hús. kérem. mint aki valami rosszat tett. – Raptor – mondta. Bobbie pedig a fiúra irányította a lámpát. Bobbie épp elég ideig dolgozott Chicagóban ahhoz.. Mélyebbre hajolt. ami pedig állati támadás esetén ritka. mint valami tisztviselő. ragacsos habra nézett. még a lámpát is úgy irányította. Közepén a váll elmozdult a helyéről. Egy sor felvételt készített a sebről. milyen ideges Ed Regis. És láthatóan olyan helyzetben van. De földnek nyoma sem volt. amelyekkel évekkel ezelőtt találkozott. A férfiak bevitték a testet. Manuel már készítette is az infúziót. – Akkor kérem. A másik egy részeg cirkuszi őr. és lehajolt. És egyáltalán nem úgy nézett ki. Ez valóban állati harapásnak. – Na jó – mondta. Egészen más volt a kép. – Ugyan. Majdnem biztos. Bobbie Carter visszafordult a sebekhez. és becsukta az ajtót az orra előtt. akit egy kutya harapdált össze. Sok volt a hasonlóság a sérülések között. kilátszottak a sápadtfehér csontok. Nem tudta. annyira. Bobbie ismét a sebet borító sikamlós. valami rothadó szag. Rögtön látta.

Nincs már esély rá. – Üdülőhelynek nem éppen közel – mondta Bobbie.. Meg is találta a szótárban. de úgy. de egy ideje átköltöztek a szigetekre. de már későn. a teste csak úgy vibrált. Ismeri ezt a szót? . – Nem! – A férfi elszántan farkasszemet nézett vele. és maga a megtestesült józanság. Azon az éjszakán végre elállt az eső. ahogy a mentők viszik a testet. hogy szinte kirobbant belőle. de közben már látta. – A nyílt tengeren. és visszarántotta. az éjszakában. határozott. amelyet a fiú használt. Bobbie megdöbbent. hogy maga mindent megtett. A sebesült fiú ajkai ismét megmozdultak. A rendelő mögötti hálószobájának magányában Bobbie agyonhasznált spanyol zsebszótárát lapozgatta. – Elena. látta. vissza a helikopterhez.Majdnem. Azonnal rángógörcs fogta el. – Nem szabad! – mondta. ez nem természetes – mondta. – Ez a szag. és a szájára szorította a kezét. hogy hupia. mi az a raptor? Elena ősz volt. A sebesült nyöszörgött. arctalan vámpírokról. Amikor azonban visszafordult az asztal felé. a csillagok alatt elkomorodva kérdezte vissza. „Nos. és látta: úgy sincs semmi értelme. Bobbie elkomorult. Úgy százötven-kétszáz kilométerre a parttól. Bobbie maga előtt látta a fiú két kezét. hanem valamiféle támadásnak esett áldozatul. – Mi az a raptor? – Azt jelenti. és kivitték a holttestet. amelyek elrabolják a kisbabákat. motyogott. soha többé nem jönnek vissza. hogy mindez reménytelen. és hányta magára a kereszteket. Bobbie utánakapott. – Átszáll magába a hupia! – Ugyan. Bobbie benyitott a rendelőbe. hogy szájon át való lélegeztetéssel próbálja éleszteni.. aztán elernyedt. – Jobb így – szólt Manuel. és a kezével próbált védekezni a támadó ellen. Ott. de Manuel vadul a vállába markolt. hogy spanyolul van. legalább a képek megvannak. és nem mozdult többé. A fiú a rángástól a betonpadlóra zuhant. hogy a fényképezőgép eltűnt. és valami ilyesmit motyogott: – Tudom. amit csak lehetett. akik visszajöttek a rendelőbe. Éjszakai kísértetekről volt szó. – Aztán már csak nézték Manuellel. és hirtelen meredten felült. s ő Manuel tiltakozása ellenére is gyanította.. Manuel elborzadva mondta: – Megharapta! – Mi harapta meg? – A raptor. Keze fejével a száját törölgette. és intett Elenának. hogy a fiú összeszorított fogai közé nyomja. Manuel rémülten felordított. hogy a fiút felélessze. Ed nyitott be. Biztos.. Manuel egyre csak hátrált. Elena Morales. doktornő? – Maga tudja. a helybeli bábaasszony volt mellette. – Mi az ördög. majd vért hányt. Az orvos fölé hajolt. Vajon mit akarhatott mondani neki? A szomszéd szobából nyöszörgés hallatszott. Mindkettő csupa karmolás és horzsolás volt. hogy ez a fiú nem üzemi balesetnek. – Hol az a sziget. – Maga ezt nem értheti. Manuel behívta a betegszállítókat. A hiedelem szerint a hupiák valaha Costa Rica hegyei közt éltek.. mint a nyál. Manuel. de aztán a vér láttán hátat fordított. – Remélem. A szónak ez az értelme gyanúsan közel állt a hupia jelentéséhez. Ed tűnt fel újra. hatvan év körüli. „Erőszakkal elragadó”-t vagy „emberrabló”-t jelentett. – Raptor? – Igen. azok sem valami kísértettől származtak. tágra nyílt szemmel bámult jobbrabalra. beteszik. az pedig mennydörögve a levegőbe emelkedik. Az egyik falubéli asszony a szülés első stádiumában volt. Bobbie lenézett a padlón heverő testre. – Sí. ahonnan ezek jöttek? – kérdezte. hogy jöjjön ki egy pillanatra. Mindent elöntött a vér.. Manuel a helikoptert nézte.? – kezdte.. A fiú teste utoljára még rándult egyet. „Raptor” – ez volt a szó.” – gondolta az orvosnő. védekezésre utaló alakzatban. – Raptor – suttogta. Újra hányni kezdett.. A babonában persze nem hitt. És azok a sebek a fiú kezén. amikor a sebesült fiú kinyitotta a szemét. – Ez a hupia! Bobbie éppen vissza akarta parancsolni a dolgára. de a hupiáról már hallott a faluban. a fejét forgatta. az ég szerelmére. Bobbie felkapott egy fadarabot. A Costa Rica-iak nem voltak különösebben babonás fajta.

ahogy a hullámok ki-kicsaptak a partra. és mindenáron be akarta fejezni. – Nem okos dolog ilyenkor kimondani ezt a szót. Fejével a rendelőben nyöszörgő. doktornő.. szülő asszony felé intett. – Ezt a szót ki ne ejtse. A raptor ember. raptor. raptus) ragadozó madár. szóval azt. olyan természetes volt. Legfeljebb kettő. – Láthatóan idegesítette az egész beszélgetés. (lat. – Egy hupia? Elenának még a tartása is megváltozott.. – Gyermekrabló? – Igen. kirabló. Még egy óra talán. – Nem. Nem csinál az semmi olyat. Minden olyan nyugodalmas. aki éjjel jön. Látta a parttól távolabb horgonyzó halászcsónakok árnyékát a sötétben. ha itt az ideje. Merő kíváncsiságból fellapozta kis angol értelmező szótárát. . és elviszi a gyerekeket. meg gyermekrabló kísértetekről kérdezősködött. – Hívni fogom doktornő. doktornő! – Miért ne? – Ne emlegesse most a hupiát! – mondta Elena határozottan. mennyire tiltakozott Manuel az ellen. hogy a raptor spanyol szó volna.– Sí – bólintott Elena. és hallgatta a tenger békés morajlását. – És a raptor? Össze szokta harapdálni meg karmolni az áldozatát? – Harapdálni és karmolni? – kérdezte csodálkozva Elena. és legnagyobb meglepetésére ott is megtalálta: raptor fn. Visszament a szobájába. Szinte elszégyellte magát. amiért vámpírokról. fr. El is indult a rendelő felé. Bobbie felnézett a csillagokra. Újra eszébe jutott. aki újszülötteket rabol. – Azt jelenti.

amelyből az alapvető matematikai szerkezetre következtethetnénk.ELSŐ ISMÉTLŐDÉS A fraktális görbe legkorábbi rajzain alig látható olyan nyom. IAN MALCOLM .

nem? Nézzétek ezt a kilátást! Gyönyörű! – Nem rossz – mondta Tina.és pókmajom.. – Tényleg? – Nézz csak a tükörbe! – Mindjárt hülyére röhögöm magam. amint keresztülhajtott egy gödrön. és milyen jó volna. mostanában leginkább amiatt aggódik. rögtön kiderült. Mike Bowman eddig életében nem hallott arról. – Te Mike! – szólalt meg Ellen a mellette lévő ülésen. Cabo Blanco maga volt a romlatlan természet. A Land Rover zöttyent egyet. Az ötlet voltaképpen a feleségétől származott. nem tévedsz. – Azt mondja a könyv: „Cabo Blanco partvidékét gyakorta látogatják a legkülönbözőbb állatfajok. köztük a bőgő. A harminchat esztendős dallasi ingatlanfejlesztési vállalkozó két hétre üdülni jött Costa Ricába feleségével és kislányával. Elfelejtetted? Tudod. s a látvány lenyűgöző: a sziklaszirteket körülölelő útról az őserdőre és a kék Csendes-óceánra nyílt a kilátás. Ezért aztán keményen megmakacsolta magát. Három kilométernyi tökéletesen néptelen homokfélhold terült el előttük. hogy a családi nyaralás ismét sínen van. hogy ott a helyük. Mike Bowman csatát nyert hősnek érezte magát. apu! Az út lefelé haladt. Ellen fürdőruhába bújt. azt mondtad. Amikor aztán megérkeztek. – És én olyanra is viszlek! Ellen kétkedve ingatta a fejét. – Figyeljetek csak! – vidult fel a kislány. – Hát nem is tudom – mondta Mike bizonytalanul. mint a többi. hogyan szabadulok meg ettől a súlyfeleslegtől! . – Majom? – Tán egy selyemmajom. – Beszámíthatom? – kérdezte Tina. az őserdőn át a tenger felé. Gyönyörű júliusi reggel volt. Mike Bowman kezdte úgy érezni. Ellen heteken át telebeszélte a fejét. – Egy percig némán vezetett.. A kislány nyolcéves volt. és elővette az ennivalót. Ellen púderesdobozt vett elő. – Mi volt az? – kérdezte Ellen. közben aggódva így szólt: – Esküszöm. Mike úgy érezte. hogy micsoda gyönyörű természetvédelmi parkok vannak Costa Ricában. Csakhogy Ellen hajlott a kishitűségre meg az aggodalmaskodásra. a háromujjú lajhár és a fehér orrú ormányosmedve. Iskolai feladatul kapta. ha Tina láthatná az ottani csodákat. aztán eltette a kompaktot. és mennyi ott a fényűző magánklinika. Hirtelen kis fekete árnyék suhant át az úton. – Nem hinném. Nagyot sóhajtott. Valóságos paradicsom. Plasztikai műtétről márpedig szó sem lesz! Marhaság az egész! Ellen csak harmincéves. én is remélem. azzal a kékkel.” Mit gondolsz. És úgy tűnt. A fenébe is. ahol csak mi vagyunk – mondta Mike. és sarat csapott fel. csak bőgőmajom. fogunk látni háromujjú lajhárt. milyen olcsó egy plasztikai műtét Costa Ricában. – Bízzatok bennem! Én nem tévedek. megnézte magát a tükörben. hát nem ő volt az Évfolyam Szépe végzős korában az egyetemen?! És ennek még tíz éve sincs. amikor elérték a partot. – Nézzétek! Nézzétek! – De az árnyék addigra el is tűnt az őserdőben. és már vette is a ceruzát. A partot szegélyező fák árnyékában állította le a Land Rovert. – Azt hiszem. Ahogy elnézte. olyan strandot akarsz. – Csodálatos. – Biztos vagy benne. elképzelésem sincs. hogy szépsége múlandó. – Igen. apu? – Az holtbiztos. ami igaz is volt. hogy vezessen listát az utazás során látott állatokról. hogy nem tévedsz – mondta hátul Christina. hogy jó úton járunk? Órák óta nem láttunk egy teremtett lelket sem.VALÓSÁGOS PARADICSOM Mike Bowman vígan fütyörészve vezette a Land Rovert a Cabo Blanco-i biológiai rezervátum kanyargós útjain. Costa Rica nyugati partján. Kezdett lejtősödni az út. és szép asszony. és Tina felsikoltott. hogy Ellent előre megbeszélt időpontra várja egy San José-i plasztikai sebész. Tina az útikönyvben lévő képeket vizsgálgatta. – Drágám. – Amelyik az ellenkező irányba ment. Az óriási veszekedés persze nem maradt el. apu. a felesége hazudott és becsapta. és Mike Bowman a vezetésre összpontosított. és megnyomkodta a szeme alját. – Alig tizenöt perce találkoztunk egy másik kocsival. – Remélem. – Ebből a majomfajtából már nem egyet láttak útjuk közben. hogy selyemmajom volt – mondta. Mint minden más.

ha legalább látnám! – mondta Ellen Bowman a naptól hunyorogva. Tina viszont megelégelte a napot. majd megzörrent a mangrovesűrű. Itt biztosan minden állat tudja. és elhatározta. ha hazavihetné. mint egy ártalmatlan Muppetshow-figura. És akkor a gyík felkúszott a karján. Elindult felé. mintha nem értené. Tina tétlenül nézegette a lábnyomokat. s már csak egy kis sötét folt a fehér homokon. és rugdosta a mangroveleveleket. Tina két nappal ezelőtt már látott lajhárt a San José-i állatkertben. sötétzöld volt a színe. amint a pici lábujjak belekapaszkodnak a tenyerébe. – Hadd menjen! Hadd érezze jól magát! Átkarolta a felesége derekát. Közelebb jött Tinához. ahogy a kislányra nézett. a partot. A gyík megállt. Felemelte a kezét. félrebillentette a fejét. – Ide figyelj. mint a csirkéé. Alighanem valami tengeri madár lehet. – Nincs nálam semmi! Ebben a pillanatban a gyík minden előzetes figyelmeztetés nélkül a tenyerére ugrott. Az óceán meleg volt. Ellen Bowman körülnézett. Apró mellső lábai piciny gyíkujjacskákban végződtek. aztán visszanézett szülei felé. Ott akart maradni. Ha előbújna egy kígyó. és a feje is úgy ingott menet közben. a súlya lefelé húzta a karját. amelyek libegtek a levegőben. hogy a gyík háromujjú lábnyomokat hagy maga után. ahol van. és rábámult. – Majd később! – kiabált vissza a kislány. Észrevette. Tinának nagyon tetszett. Különben is arról híres. amint hanyatt-homlok rohant a parton lefelé. – Csak ennyi. hogyan fogyhatna le. Tina érezte. Kedves játszópajtás lehetne belőle. Csendben. és ha lehet. amilyen még nincs a listán! A gyík hátsó lábaira állt. pontosan olyanokat. Nem akart napellenzőt felvenni. – Ne hagyd itt a napellenzőt! – szólt utána Ellen. mint a madarak.. adjon neki ennivalót. kilihegte magát. míg csak ki nem merült. Az útikönyv szerint Costa Ricában háromszor annyi a madár. és csiripelt. Ahogy így állt. – Azért nem bánnám. Azon a homokon legalább negyvenöt fok van. moccanás nélkül várt. hogy lássa. hogy. hogy nem érheti baj? – kérdezte. mint az Egyesült Államokban és Kanadában együttvéve.– Istenien nézel ki. de azért nem volt benne biztos. itt több kilométerre nincs egy lélek sem. Csodálkozott rajta. de már megtanulta: jobb. – Biztos. Tina vidáman visszaintegetett. Feltűnt neki. Bánta is. Mások viszont nagyok és mélyen a homokba nyomódtak. – Megyek lajhárt keresni. Úgy nézett ki. míg végül előtűnt a zajok forrása. Mint valami nagy szalamandra. Fejét egy kissé félrebillentette.. nincs nála ennivaló. Újabb állat. hogy nem bántják. hogy végtére is ez természetvédelmi terület. – Szívem. Néhány méternyire tőle egy gyík bújt elő a mangrovegyökerek közül. Alaposan szemügyre vette a fákat. hogy mennyi a madárnyom a homokban. lajhárt látni. – Nézte a kislányát. barna csíkokkal a hátán. gondolta Tina. és meglepetten tapasztalta. nem lehet. nehogy elijessze az állatot. A kislány a lélegzetét is visszafojtotta. Tina már szaladt is a partra. aztán a homokra dobta magát. Tina futott. ha erről nem szól. és boldogan hengergőzött a víz széle felé. hogy az állatka nehéz. – Na és a kígyók? – Isten az égben! – mondta Mike Bowman. hogy visszahúzódik a víztől a pálmafák árnyékába. de aztán eszébe jutott. Nem akart visszamenni. Alig volt nagyobb. A homokot borító háromujjú madárlábnyomok némelyike kicsi volt és olyan halvány. Tina ült egy kicsit. alig hullámzott. milyen messzire került tőlük. Hüllők. nem akarta az anyját hallgatni arról. Lehet. mint a gyík. Tina biztosan gyorsabban futna nála. és ő is meglibegtette az ujjait. hogy megmutassa. Legalább látnám! . vagy harminc centi lehetett. hogy azt várja. A gyík is nyilván szelíd. – A tengerparton nincsenek kígyók! – Miért. hogy nincs nála semmi. – A kígyók hideg vérűek. Az állat nem félt. hívta vissza. Csicsereghet-e egy lajhár? Vagy cincog? Tina ezt nemigen hitte. Ezen a partszakaszon a pálmafák alatt göcsörtös mangrove-gyökerek kusza szövevénye zárta el a szárazföld belseje felé vezető utat. Anyja most már kiáltozva hívta. Tina ücsörgött a homokban. – Ne haragudj! – mondta Tina. A kislány igyekezett nem mozdulni. hogy alig látszott. amikor egyszerre csiripelő vagy cincogó hang ütötte meg a fülét. vastag farkával egyensúlyozott. az arca felé. percek alatt megfőne. mint egy csirke. szívem! – mondta a férfi határozottan. Aranyos volt. és Tinára pislogott. Anyja integetett. Tina lassan és óvatosan előrenyújtotta nyitott tenyerét. újra hallotta a susogást. Nem képesek ellenőrizni a testhőmérsékletüket. édes! – A valóságban Mike inkább túl soványnak látta az asszonyát. felegyenesedett a hátsó lábára. hogy ennyire közel merészkedik. hogy milyen lassú.

ha látnám Tinát – mondta Ellen. Bánatos grillcsirkét talált benne. – Akkor meg mi a baj? – Csak annyi. – Azt hiszem. Miért hinném? – Annyira magunkban vagyunk itt – mondta Ellen. . ugye? – Dehogy szívem. meg valami hússal töltött süteményfélét. hogy semmi baja – szólt Mike. Sikoltozott. Ekkor a kislányuk hangját sodorta feléjük a partról a szél. – Vágytam is. hogy másutt volna. aki a szálloda által összeállított ételcsomagban kotorászott.– Biztos. mint a parton. Nem mintha Ellen bármiből is enne. éppen erre vágysz – felelte Mike Bowman. – Azt azért te sem hiszed. hogy nem bánnám.

– Úgy van. ujjnyom nagyságú harapások. – A kislányuk tehát azt mondta. tökéletesen beszélt angolul. olyan. – Közben precíz. hogy érti a mesterségét. A meglepetés abban állt. Az öböl túlpartján dolgozik. az ödéma is jóval lejjebb húzódott a karján. De láthatják. Guitierrez szaktudása felől. Cruz összevonta a szemöldökét. hogy nem lesz kétségük dr. ha jól értem? – Úgy van. . Még a park határától is távol voltak. miközben a lánya üvöltött a félelemtől és a fájdalomtól. Egy darabig még elnézegette a képet. – Még nem azonosítottuk őket! – vágott közbe az orvos. amikor a duzzadás már a nyakára is átterjedt. egyetlen lánya súlyos beteg. lágy. és szinte elborították az apró. amerikai. Máris alig látszanak. Igen. Bowman és Mrs. és kérdéseket tett fel a nyállal kapcsolatban. délies amerikai tájszólásban szólalt meg. Cruzon látszott. igen – felelte dr. A kislány karja szinte azonnal vörösödni és dagadni kezdett. kézírásos jegyzeteket készített. Mike Bowman mégsem volt nyugodt. és már sokkal könnyebben lélegzik. Kis idő múlva hátralépett.. Láthatják. Ezenkívül lemostam a karját. trikós. Felemelte az oxigénsátor műanyag lapját. és több mintát is vettem abból a ragacsos nyálból.. és kutató sem dolgozott ott már jó ideje. és már öt éve itt van.PUNTARENAS – Azt hiszem. Dr. ceruzalámpával nézett meg közelről minden egyes harapást. dr. – Megkértem dr. Neves kutató.. közel a kislányához. – Végül is ott érte Tinát a harapás. azok a harapások.. Sok idő eltelik még. – És a gyík valamiféle hangot is kiadott. Ő talán képes lesz azonosítani nekünk ezt az állatot. amelyet – Cruz elmondta neki – még vizsgáltak a laboratóriumban. jöjjön ide. Cruz. majd egy kis zsebvonalzó segítségével meg is mérte őket. akik feszülten várakoztak. mire Mike Bowman elfelejti azt az eszeveszett robogást vissza a civilizációba a négykerék meghajtású Land Roveren. s aztán Tina légzése is akadozni kezdett. Amikor Mike odaért Tinához. Ezután áttekintette a polaroidfelvételeket. Tina szerint a hátsó lábain járt. – kezdte Mike Bowman. Dr. egyet a San José-i laboratóriumba küldünk. Guitierrez sortos. amely felegyenesedve jött elő a partra a mangrovemocsárból? – Igen. Dr. mint aki megértett valamit. Egyet az itteni analízishez. Óvatosan felemelte a karját. – Mint valami madár vagy egér. Végigvitte a parton. – Cabo Blancónak nincs állandó személyzete. Amikor bemutatták őt Bowmanéknak. hátha szükség lesz még rá. – Én ehhez nem értek – mondta. Cruz. És itt-ott valami ragacsos habszerűség tapadt a karjához. Marty Guitierrez alaposan végigvizsgálta Tinát. pontosan. amit a kislány rajzolt? – Persze – felelte Mike Bowman. amelyet Tina a felvételi tisztviselőknek rajzolt. De meggyőződésem. vissza a fákhoz. – Igen – válaszolta Mike Bowman. a Reserve Biologica de Cararában. – Szóval ez az állat harapta meg? – kérdezte a képet nézegetve dr. Odaadta a vázlatot. Cruzból szinte sugárzott a szakértelem. Guitierrezt. – Nem ismerek ilyen gyíkot – mondta az orvos. Bowman! – Örülök. igaz? – Tina szerint csiripelt vagy cincogott. Szerencsére lefényképeztem őket a további vizsgálatok érdekében. hogy megismerhetem önöket. körülbelül akkora. Rendbe fog jönni. Cruz. A rajzon a hátsó lábán áll. hogy kiderült. Végül Mike Bowmanhoz és feleségéhez fordult.. Megvan még az a kép. s bólintott magában. Az oxigénsátor átlátszó lapján át bámulta a gyereket. Londonban és Baltimore-ban végzett. már tűnőben vannak. a puntarenasi kórház pedig makulátlanul tiszta volt és hipermodern. – Sajnos nem – felelte dr. egyet pedig itt tartunk mélyhűtve. most már megnyugodott – mondta hangját lehalkítva dr. és nagyon távol vannak az otthonuktól. amely alatt Tina aludt. hogy a Yale Egyetem számára végez biológusként terepmunkát Costa Ricában. Véres volt az egész bal karja. zöld gyík volt. amely ide-oda csúszkált az agyagos földúton. Mr.. – Most már rendben lesz? – kérdezte Ellen. Cruz. – Azt mondja. mint egy csirke vagy varjú. – Véleményem szerint Tina állapota teljesen megnyugtató. – Tiszteletem. Mike Bowman az ágy mellett ült. zöld gyík harapta meg. a karja meg csak egyre duzzadt és vörösebb lett. – Én magam még sosem láttam ilyen harapásokat. – Adtam neki még egy adag szteroidot. – Nos. – Aztán elmagyarázta. hogy egy körülbelül harminc centiméteres nagyságú. – Gondolom. Mindössze tisztázni szeretnék néhány részletkérdést. Akárhogyan is. a kislány hisztérikusan sikítozott. – Nem jöhetne valaki a Cabo Blancóból? – kérdezte Bowman. mint a habos nyál. szakállas férfi volt.

nem mérgező. – Cruzhoz fordult. – Elmagyarázta. hogy az a gyík egy Basiliscus amoratus volt. Costa Ricában és Hondurasban él. – És azt is. Guitierrez bólintott. egyre csak azt mondta. majd elmosolyodott. Már sokkal jobban vagyok. miért volt a lányukon annyi harapás. Reggelre az égvilágon semmi baja sem lesz. „BOWMAN. Ellen Bowman is megszólalt: – Mike mondta maguknak. A farok túl vastag és túl magasra emelkedik. hogy Tina karjának feldagadása allergiás reakció volt. hogy meggyógyított – szólt Ellen Bowman. Minden egyéb szempontból azonban tökéletesen elmegy annak a gyíkfajtának. hogy hosszú nyaka volt – kötötte az ebet a karóhoz Ellen Bowman. – De nyakkendőt nem? – Nem. – A hüllőnyál szerotonint tartalmaz. – Tina korához képest igen jó megfigyelő – tette hozzá Mike Bowman. s a nyálmintát felrakta a hűtőszekrény tárolópolcára. ami azt jelenti. Tina. ahogy mondod. – Igen. Kivette a kémcsövet a szemétkosárból. hogy egy gyík a bölcsőjében harapott meg egy csecsemőt Amaloyában. – Bizonyára – mosolygott Guitierrez. és útnak indította. Azt mondja. CHRISTINA L. A Clínica Santa Maria modern alagsori laboratóriumába befutott a hír. . Ezek közül csak négy honos Latin-Amerikában. – Alighanem fájt is – mondta Guitierrez. – Akad persze egy-két hibás részlet. amelyről szó volt..” – olvasta a kislány nevét az aznap távozó betegek között. – Semmi kétség. hogy Tina jó megfigyelő. – Az állatkerti ápolókat például rendszeresen megharapják a gyíkok. – Guitierrez elmondta. Ezután Mike Bowman Guitierreznek is megmutatta a képet. akkor én ismerem ezt a gyíkot. hogy az egyiken vörös címke van. és előretolta Tinát. és ettől súlyos allergiás reakciót szenvedett. Csak inget. – No és az a ragacsos. A nyál elemzését azonnal leállították. – De egyáltalán. – Hüllők nem hordozhatnak veszettséget. Bowman. amit Tina rajzolt. hogy a San José-i egyetemi laboratóriumba továbbítandó. hogy közönséges baziliszkusz harapta meg a kislányt. Az ügyeletes asszisztensnek azonban sok dolga volt aznap éjjel. – Menj szépen! Köszönd meg Cruz doktor úrnak. ahol maguk jártak. – Meg sem moccant? – ismételte Guitierrez elgondolkozva. A nyaka túl hosszú. habos nyál a karján? – kérdezte Ellen. Hátsó lábára állva a magassága elérheti a harminc centimétert. Guitierrez közönséges baziliszkuszgyíkként azonosította az állatot. Közben így szólt: – Jé. Cruz egy pillanatig értetlenül nézett. – Nem. Higgyék el. hogy valaha is pontosan tudni fogjuk. azt nem. – Köszönöm szépen. miért harapta meg az a gyík? – Asszonyom. Másnap reggel a nappali szolgálatot teljesítő asszisztensnő a távozó betegek listájával a kezében végigellenőrizte a tárolópolcon lévő mintákat. – Azonnal. Szóval nem ritka dolog ez. Elfogadom baziliszkuszgyík rajzának – mondta. – De Tina kifejezetten állította. és megfogta az orvos kezét. – Mérgező a harapása? – Nem. A kislányuk is közéjük tartozik. közönséges nevén a csíkos baziliszkuszgyík. hogy a világ mintegy hatezer gyíkfaja közül mindössze tán egy tucat jár felegyenesedve. – Bizonyosan állíthatom. Az utolsó pillanatban vette észre. Aztán megrázta a fejét. Mrs. – Folyton a veszettség jár az eszemben. nagyon fáj. A vadállatok kiszámíthatatlanok. nem! – mondta dr. Ha éjszakás vagyok a kórházban. – Szerotonin – ismételte Guitierrez. A betegség lefolyása gyógyszerezés mellett normálisan tizenkét óra. – Nem hiszem. meg sem moccant. a gyíkharapás nagyon gyakori – válaszolta Guitierrez. mire kidobta a nyálmintákat. noha már a legelső eredmények több ismeretlen biológiai aktivitású. – Sikítozott. azonkívül a kislány három ujjat rajzolt a hátsó lábaira öt helyett. Mivel foglalatoskodott éppen? – Semmivel. hogy három lábujja volt. Guitierrez. nem komolyabb a dolog.Dr. nehogy elijessze az állatot. – Leesett a vérnyomása az antihisztamin hatására? – Igen – felelte Cruz. – Az irodalom szerint az emberek tizennégy százaléka erősen allergiás a gyíkokra. – Felnyúlt. doktor bácsi – mondta Tina. amely roppant fájdalmat válthat ki. úgy száz kilométerre onnan. másik inget tetszett felvenni? Dr. amely megmarta az amerikai kislányt. mi történt. Ellen Bowman valahogyan nem tudott megnyugodni. reggel mindig inget váltok. amely itt. – Én azonban mégiscsak azt hiszem. – Úgy van.. igen nagy molekulasúlyú protein jelenlétét mutatták ki. A lányuk allergiás rohamot kapott egy baziliszkuszgyík harapásai következtében. A kutató bólintott. Csak azt nem tudom. hogy dr. – Nos. Egyébként alig néhány napja hallottam.

más gyíkharapásról is hallottál a kórházban? – Nem. hogy felhívja Guitierrezt a biológiai állomáson. – Magam is végeztem egy-két ellenőrzést. Tina! – Majd igyekszem. és elmondja amit hallott. – De akkor mi lehetett? – Hát ez az! – mondta Guitierrez. az igaz. míg itt vagytok. Bowmanék távozása után. amikor dr. – Dr. – Meg úgy is ment. dr. mint egy madár. – Azért érezd továbbra is jól magad Costa Ricában. ha hallanál. – Beismerem. Cruz utánuk szólt: – Tina. – És hány lábujja volt? – Három – mondta a kislány. – Hát a lábára? – Aha. emlékszel még arra a gyíkra? – Aha. mint a madaraknak? – Aha – felelte Tina. amit a kislány mond – hallotta Guitierrez hangját. Bowmanék már indulóban voltak. Miért? – Okvetlenül tudasd velem. majd komoly képet vágott. Apropó. – És a gyík lábnyomai is ilyesfélék voltak. hogy baziliszkusz harapta meg. barátom! . bólogatva. Nem. igen rejtélyes. Már nem vagyok biztos benne. Cruz úgy határozott.– Hát ami igaz. és kezet rázott a kislánnyal. egyáltalán nem vagyok biztos. – Olyan volt a lábnyoma a gyíknak. Fel-le ingatta a fejét. hogy megnéztem – mondta Tina. – Különben is. így! – tett néhány lépést. – Három középső ujját szétterpesztve felemelte a kezét. Cruz mosolygott. – Honnan vagy olyan biztos benne? – Onnan. a parton minden madár ilyen nyomokat hagyott a homokban. – Túl korai volna még erről spekulálni.

Állandóan újabb és újabb fajokat fedeznek fel. Ha egy bőgőmajmot lát. Így tehát teljességgel elképzelhető volt. egy cseppet sem – válaszolta a tisztiorvos. a gyíkharapás mindennapos dolog. és nagy reményekkel indult el a partra. Guitierrez még ebből a távolságból is kivette a zöld csíkokat. hogy megvizsgálja. A védettséghez szokott bőgőmajom csak kíváncsian bámult rá. nedves mocsarak és száraz sivatagok. Guitierrez felállt. hogy valaki gyíkharapás következtében kórházba került volna. Nagyjából ott volt. mielőtt a nagyanyjának sikerült elkergetnie. Ez az ökológiai változatosság a legkülönfélébb növényi és állati életformák különösen széles skálájának nyújt otthont. és lekuporodott. s a sugarai a pálmafák alá is bekúsznak. – Nem. – hiába. De csak elvesztegetett egy napot. Ezek után felhívta az amaloyai tisztiorvost. hogy bárkit is baziliszkuszgyík harapott volna meg. A legkeskenyebb részén mindössze százhúsz kilométer széles ország területe kisebb az egyesült államokbeli Maine államénál. Noha Guitierrez nem hazudott. mit tegyen majd a leletével. meg-megállt. s időnként ezzel együtt a viselkedésük is megváltozik. fontos. és elindult a part mentén. végső . „Zöld színű gyík. akkor alighanem több is lesz feljebb a fák között. köztük négyezer méter magas csúcsok és aktív tűzhányók. Lassan haladt. Reggel jó korán megtöltötte légpisztolyát kábító nyilakkal. méghozzá az utóbbi időben egyre gyorsuló tempóban. úgy tűnt. Nem szaladt el még akkor sem. röviden a CSE. Ezen a viszonylag kis területen belül azonban a különböző fajta biológiai élőlények szinte elképesztően változatos sokasága található. hogy új faj kerüljön elő. Nézte. de az állatmaradványokat természetesen el kell küldenie az Államokba. aki megerősítette. kilencnapos csecsemőt megharapott egy állat. Ez az új és jól körülhatárolható típusosság arra vezetette Marty Guitierrezt. kanyargós úton. A gyíkok vírusos fertőzések hordozói. ahol két nappal előbb az amerikai kislány. Máris azon gondolkodott. barna alapon. és előreindult. amennyire csak be tudta határolni. hogy legfeljebb néhány percnyi kábulatot okozhat. mint egész Észak-Amerikában együttvéve. Egy másikat Puerta Soteróban. amikor Bowmanéknak azt mondta. Ez a bőgőmajom azonban. hogy egy bölcsőjében alvó. A majom sorsa egy cseppet sem izgatta. Ezek közül a legveszedelmesebb az úgynevezett centrális szauruszi encephalitis. és azzal folytatta. Az összes eset az elmúlt két hónapban történt. mérsékelt övezetek. Kicsit távolabb egy bőgőmajom sötét sziluettjét pillantotta meg. ahogy lejjebb és lejjebb száll a nap. Ezután egy amerikai nemzetközi számítógépes adatbázishoz fordult további információkért. Guitierrez úgy érezte. hogy Tina Bowman tényleg úgy állatfajt látott. Nézte. Ötezernél is több rovarfaj. Az előzetes jelentést megírja ő maga. barna csíkokkal”. ahol ez a leginkább elő is fordulhatott. és felsóhajtott. közelebb a vízhez. hogy közönséges baziliszkuszgyíktól származzék. melyek közül több az emberre is átterjedhet.A PART Marty Guitierrez a parti homokban ücsörgött. ahogy a délutáni nap egyre lejjebb ereszkedik az égen. Több mint ezer orchideafajta. aki látta is az esetet – gyík volt. hát azért. hogy egy sor harapásos esetről hallott. a parthoz legközelebb fekvő faluban egy gyermeket álmában ért a harapás. Marty végiglapozta az ottani kis könyvtár minden idevonatkozó kötetét. Volt valami a szájában. és elindulhat visszafelé a dombon. így írta le az asszony a gyíkot. atlanti-óceáni és még négy különböző hegylánc. oda. legalábbis olyan közel ahhoz a helyhez. Amikor visszament a carari állomásra. Hamarosan volán mögé ülhet megint. Talpra állt. felsikoltott a dühtől és a meglepetéstől. – Különös – mondta Guitierrez. amely egyfajta álomkórt idéz elő az embernél és a lovaknál. olyat azonban még életében nem hallott. Vásquezben. Nem akart sötétben vezetni azon a csúszós. amely a nagyanyja állítása szerint – ő volt az egyetlen személy. rögtön együtt jár az új betegségek nyugtalanító lehetősége. ha másért nem. esőerdők. ahol Guitierrez ült. és ez az állatfajta gyakran levizeli a betolakodót. míg végül kemény szikrákat vet az öböl vízén. hogy megtalálja az új gyíkot. a Cabo Blancó-i tengerparton. aztán ételmaradékát elejtve a dzsungelbe menekült. Egy biztos: Guitierrez nem látott semmit. Az élőhelyüket vesztett őserdei fajok más területekre költöznek. És Costa Rica pontosan az a hely volt. amit egy új faj felfedezése jelent. felhőerdők. amikor az első lövedék célt tévesztve süvített el mellette. Ám az örömteli izgalommal. Az áldozat mindig alvó gyerek vagy csecsemő volt. Costa Ricában háromszor annyi madárfaj él. Guitierrez arrébb lépett. de baziliszkuszharapásról említést sem talált. egyedül van. nem hordoz-e betegséget. a mangrovefák között. A nyugtatóadag olyan csekély volt. lehet. hogy egy eddig ismeretlen gyíkfaj jelenlétére kezdjen gyanakodni. és sajnálatos okból: Costa Rica erdei fogyóban vannak. van csendes-óceáni. Többször is megharapta a gyereket. Emellett a Tina karján látott harapások átmérője kissé túl nagynak is látszott ahhoz. hogy nem. Lehet. Olyat meg végképp nem. Amikor a második nyílvessző mélyen a combjába fúródott. A biológus a földre vetette magát és célzott a pisztolyával.

idős úr volt a gyíktaxonómia legnagyobb szaktekintélye az egész világon. elegáns. a Columbia Egyetem nyugalmazott. Kinek küldje? A legelismertebb szakember Edward H. Igen. Ez az ezüstös hajú. Simpson. valószínűleg neki fogom elküldeni ezt a gyíkot.azonosításra. címzetes professzora New Yorkban. gondolta Marty. .

és teli volt ragasztva különféle felszólításokkal és figyelmeztetésekkel vagy négy nyelven. csináljon róla egy röntgenfelvételt meg egy pár polaroidképet az irattárunknak. és fehér gőz szállt fel. Ahogy Stone a hengerre irányította a lámpát. A gyíkvér nem mutatott szignifikáns reaktivitást semmilyen vírusos vagy bakteriális antigénre.” Utálkozva húzta fel az orrát. hogy megették. Kyanaszaur-vírussal. Toxicitás-vizsgálatokat is végeztek. Kérdéses a faj azonosítása. Végül is a laboratórium nem olyan régen még venezuelai lólázzal. A laboratórium kényelmes. – Ed Simpson laboratóriumából jött? – Onnan – felelte az asszisztensnő. akiket elsősorban külföldön járt New York-iak betegségeinek megállapítása kötött le. miért küldenek ők egy gyíkot nekünk. Stone visszatette a cipzáras zacskót. Richard Stone odajött a laboratórium végéből. – Csak azt nem értem. és mivel ennél a gyíknál felmerült. amikor az intézet még az Orvosbiológiai Kutató épületének egész negyedik emeletét elfoglalta. – Kezdjünk hozzá. A fehér műanyag henger körülbelül akkora volt. terepmunkán. Stone doktor. A pecsétek érintetlenek voltak. – Oké – mondta Stone. Fémzárakkal volt leszorítva. Nagysága csupán a töredéke volt az egykorinak. nem továbbít-e valamilyen betegséget a harapás. Langat-vírussal és Mayaróval fertőzött mintákat azonosított. a malária és kolera átkától. Sebészlepedőt terített az asztalra. mint amilyen az a valóságban. hogy megvizsgáljuk. Ez magának való. futtassa végig az antitestvizsgálatokat. A század elején. és kirázta a zacskó tartalmát. Műanyag kesztyűt és maszkot öltött. „Nemzetközi biológiai mintatartó” – ez állt a címkéjén. A laboratóriumi válasz már ebéd előtt készen állt. megszokott munkamenetébe sehogy sem illett bele a reggel befutott küldemény. minket kért meg. Az asszisztensnő a mellékelt iratokat tanulmányozta. Stone bekapcsolta a légtisztítókat. dér lepte el. – Látszik bizony – mondta Stone. De a hüllőfajok közti kölcsönös reaktivitás igen gyakori. míg dr. Mihelyt lesz vér. Stone a képre pillantott. csapatostul sürögtek-forogtak itt a tudósok és asszisztenseik. lássuk. „A gyík helybéli gyermekeket harap meg. mihelyt sikerült némi vért kinyernünk ebből a töredékből. Szóljon. – A betegségeket viszont könnyen ellenőrizhetjük. és felmerült. Richard Stone. mit kaptunk. hogy őrizze addig a gyíktöredéket a TBI. Nem is voltak felkészülve az ilyesmire. látta. – Telefonált a titkárnője – mondta Stone. Sziszegve távozó gáz zaja hallatszott. úgy is várni kell. asszisztensnő is csak kettő dolgozott benne teljes munkaidőben. itt egy pozitív találata akadt: a vér enyhén reagált az indiai kristálykobra mérgére. Addig azonban még hetek voltak hátra. amit az asszisztensnője aznap este küldött Marty Guitierreznek. „Azonosítatlan fajú Costa Rica-i gyík részlegesen megrágott töredéke. három lábujjú genetikai anomáliával – olvasta az asszisztensnő. Míg kiolvad. Mi is ez az állat. hogy meggusztálja a küldeményt. – Simpson Borneóban tölti a nyarat. amelyben valami zöld volt. – Az egyik gyerek le is rajzolta a gyíkot. . hogy immár Nairobiban és Sao Paolóban is kiváló intézmények működtek – TBI egykori fontosságának java részét elvesztette. – Na.” Kiemelt a papírok közül egy gyíkot ábrázoló gyermekrajzot. Stone ezt nem tartotta olyan fontosnak. A figyelmeztetések a mindig gyanakvó vámhivatalnokoknak szóltak. Stone egy cipzáras műanyag zacskót talált benne. és bedugta a hűtőszekrénybe. A gyík azonosításának kérdése fel sem merült: azzal így is. és a titkárnő arra kérte Stone-t. hogy a figyelmeztetés hatott. De az orvostudomány sikerei következtében – valamint annak eredményeként. – Fuj! – szólt az asszisztensnő. A henger jéghideggé vált. japán B-encephalitisszel. hogy a telefaxba is belefoglalja. No.NEW YORK Dr. nincs-e valamilyen átadható megbetegedése. mit írnak? – Basiliscus amoratus. – A fajt nyilván nem tudjuk azonosítani – mondta. amelynek TINA állt a tetején. ezért dr. hogy intézményük neve hallatán mindenki valami sokkal grandiózusabb dologra gondol. Kőkeményre fagyott húsdarab hullott ki tompa puffanással. a kupakja pedig csavaros volt. ha problémája van. Simpson hazatér. mint egy másfél literes tejesüveg. a Trópusi Betegségek Intézetének vezetője a Columbia Egyetem Orvostudományi Központjában gyakran mondogatta. nehogy felnyissák. – Ezen látszik. hátha összeáll valami. Aztán lecsavarta a kupakot. hogy megszabadítsák a világot a sárgaláz. ez aztán gyönyörű! – kiáltott fel a Trópusi Betegségek Intézetének asszisztensnője a vámcímke olvastán.

és tudta. Zseblámpája fényében az asszony látta: pofájuk vértől csöpög. s a gyíkok a sötétbe menekültek. hogy odaért volna a mózeskosárhoz. s Elena. bakteriális vagy parazitológiai betegségek szempontjából. és megnyugodott. Costa Ricában úgy vélték. A másik. hogy a gyíkok néhány héten belül letelepszenek. D.Marty Guitierrez elolvasta a faxot. (?) részben megevett állat VÉGZETT VIZSGÁLATOK: röntgen. A kosár peremén három gyík ült körben. sivító hangot. Amint megérintette az ajtó gombját.” A szöveg rövid volt: TÁRGY: Basiliscus amoratus genetikai anomáliával Érkezett: dr. sem immunológiailag nem kimutatható. Az egyik az volt. cincogó. mikroszkópos.. és gyors fejmozdulattal húscafatot szakított ki a csecsemőből. ha egy újszülöttet madár látogat meg. A gyíkok csiripelve-sivítozva szaladtak szét az esős éjszakában. mivé lett a gyermek arca. A vihar miatt kimaradt az áram. a bábaasszony zseblámpafénynél dolgozott. A fonott mózeskosárban fekvő könnyű takaróba bugyolált babának csak az orra volt szabadon. Csuromvíz volt minden. EREDMÉNYEK: Emberre átruházható betegség jelen basiliscus amoratus példánynál sem hisztológiailag. (aláírás) Dr. De már jóval azelőtt. Elena patkányra gyanakodott. hogy a Columbia Egyetem kutatói helybenhagyták a faj azonosítását mint baziliszkuszgyíkot. csak egy csomó véres. M. igazgató Guitierrez két feltevésre jutott a feljegyzés alapján. Gyorsan borogatást tett az anya homlokára. hogy a fertőző betegségek hiánya azt jelenti. Az egyik gyík lágyan csiripelve lehajolt. mint a madarak után. Nyilván madár repült be az ablakon az eső elől. Kalapácsütések verték a rendelő hullámbádog tetejét Bahía Anascóban. az szerencsét hoz. Elena sikítva rohant arrafelé. amikor egyszerre csak meghallotta a különös. mint vízköpők a kút szélén. immunológiai reakciótesztek vírusos. hogy megnézze az újszülöttet. Közeledett az éjfél. és a szomszéd helyiségbe sietett. az elszórtan jelentkező harapásos esetek nem jelentenek komolyabb egészségügyi kockázatot Costa Rica számára. s nem maradt utánuk. de nem menekültek el. és most kapcsolatba került a falusi lakossággal. eredeti nézetei beigazolódtak: újabb gyíkfajta kényszerült új élőhelyre a dzsungelből. Ellenkezőleg. halott. Feladó: „Columbia Egyetem Orvostudományi Központja. Sűrű függönyökben dőlt a trópusi eső. a bábaasszony már látta. . ismét hallotta a csiripelést. háromujjú lábnyom. Richard Stone. és a harapásos esetek megszűnnek. Elena benyitott. Simpson hivatalától ANYAGOK: hátsó szegmentum. Guitierrez biztosra vette. ciripelő. Trópusi Betegségek Intézete. úgy tűnt. Elenát megpillantva kíváncsian félrefordították a fejüket.

és a San Joséba küldött halálozási nyomtatványt így töltötte ki: indokolatlan csecsemőhalál-szindróma. Biológiai aktivitását ugyan még vizsgálták. Még egy töredékét is ideküldték. – De nekem ez dinoszaurusznak látszik. és senki sem tett fel kérdéseket. Elena Morales úgy döntött. az illetékes puntarenasi orvost. nem tesz jelentést a gyíkok rohamáról. így írják le a néhány napos csecsemők között nemritkán előforduló megmagyarázhatatlan haláleseteket. molekulasúlya l 980 000. hogy a gyermek megfulladt. És bármi legyen is. Lévén ez az enzim a génsebészeti beavatkozás egyik jele. – Szóval semmit nem akar csinálni? – A világon semmit. és vállat vont. amely vadon élő állatokban nem fordul elő. Csakhogy a nyálban lévő proteinek között egy igazi rém is akadt: az egyik legnagyobb ismert protein. Gondolom. – Ez nem dinoszaurusz. amit mondok! – szólt Richard Stone. Mint várható volt. én csak tudom.AZ ADATOK TANÚSÁGA Amikor visszanyerte a nyugalmát. – Na és? Annak idején voltak kis dinoszauruszok is! – vitatkozott Alice. és kirázta belőle. amiért nem vigyázott jobban a gyermekre. Stone-nak eszébe jutott. kivette a csomagot. Simpson hazaérkezését.. – Ez egy jelenkori állat rajza. bár szerkezetében primitívebb neurotoxikus méregnek látszott. Alice Levin megnézte a láb és farok fagyott maradványait. – Nem. a hátsó lábán áll. és nem jelentették. A rémlátomásszerű jelenet ellenére nyugtalanság fogta el: baja eshet. az marha nagy dolog volna! – Az lehet. A vitát lezártam. Micsoda képtelen nevek! Tízéves életkor fölött már nem lehetett megjegyezni őket. Maga a gyíktöredék a Columbia Egyetemen pihent a mélyhűtőben. és becsapta az ajtót. meg nem látja Tina Bowman rajzát. ami még egy jó hónapig nem volt esedékes. – Értse már meg. – Mondok valamit. – Az lehetetlen! Csak harminccentis. Stone azonban továbbra is csak a fejét rázta. vagy mit tudom én. így hát azt mondta az anyának. állandóan a nyomában van az egyik műtősfiú. hosszú nyak. vagy ilyesminek. – Higgye el. Richard – folytatta Alice Levin. amikor felhívták Cruz doktort. – Akkor vigye el a Természettudományi Múzeumba. Nagy fej. – Ezt komolyan mondom! – Szégyellném magam – felelte Stone. – Én sem tudom – mondta. csak laboratóriumon belül keletkezett fertőzésről lehet szó. Alice képzetlen. Stone. és beazonosítja. – Stone odament.. az asszisztensek úgy vélték. így is maradt volna minden. nem! – rázta a fejét Alice Levin. Egyszerű asszisztensnő a folyosó végi bakteriológiai laboratóriumból. dr. És élénk a fantáziája. Alice! Ez a gyík nem megy innen sehová! . – Nem akarom. nagy mennyiségű szerotonin volt jelen. – A dinoszauruszt. Ez egy dinoszaurusz. – Stone visszatette a zacskót a mélyhűtőbe. és nem kérdi meg: Nahát! Kinek a gyereke rajzolta ezt a dinoszauruszt? – Micsodát? – fordult feléje lassan dr. Miért. – Ha ez itt mégis dinoszaurusz. amikor egyszer azt állította. tiniszaurusznak hívták. A legkisebb dinoszaurusz nem érte el a harminc centit sem. hová – mondta Alice Levin. – Costa Ricából. vastag farok. – Ellenőrizte valaki? – Nem – mondta Stone. Szakértő vagyok. – Ez egy gyík – mondta Stone doktor. tán nem az? Az én srácaim is folyton ilyeneket rajzolnak. Több figyelemre méltó felfedezést tettek. de a kobraméreggel rokon. Simpson megjön Borneóból. Ott várta. A San José-i egyetemi laboratórium kielemezte a Tina Bowman karjáról vett nyálmintát. Hozzá nem nyúlt. A laboratórium emellett kimutatható mennyiségű gamma-amino-metionin-hidrolázt talált. míg dr. Ott rajzolta le egy kislány. ráér. ha egy Alice Levin nevű asszisztensnő be nem tér a laboratóriumba. Ott van a hűtőben. de sajnos nem az. Éppen ezért nem is tűnt fel a jelentés senkinek. – Nézze csak meg! Teljesen világos. – Elvigyem én maga helyett? Akarja? – Nem – mondta Richard Stone. ez egy gyík.

MÁSODIK ISMÉTLŐDÉS A fraktális görbe későbbi rajzain váratlan változások jelenhetnek meg. IAN MALCOLM .

Grant azonban fel sem vette ezeket a kellemetlenségeket. Néhány húsevő dinoszaurusz portyázott itt-ott a pálmafák között. és algákat gyűjtöttek a víz felszínéről. Olyan információk segítségével. amely csak elkeserítette. Amikor azonban Grant körülnézett ezen a tájon. Lepusztult domboldalon térdelt. mit akarhat Alan Granttól a Környezetvédelmi Hivatal ügyvédje. Snakewater közelében. s az időjárással. És a kis szigetből. A látogató a fehér portól köhögve becsapta az ajtót. Hallotta a hordozható áramfejlesztő zakatolását és a légkalapács csattanásait. A fogak egy sor apró pontocska. Hal nem élt ezekben a vizekben. a földgolyó felmelegedésével vagy az ózonlyukkal kapcsolatos kérdéseket – úgy tűnt – esetenként. amely teljes egészében. Alig három centi volt a hossza. a kihalt életformák tudománya hirtelen fontos lett a modern világ számára. és sokat találgatták. amely tábori laboratóriumul szolgált. A parttól nem messze pedig volt egy kis sziget. – Hé. Pterosaurusok csaptak le a levegőből. – Bob Morris vagyok a KH-tól – mondta. A talaj összetöredezett és megvetemedett a hőségben. Alan viszont tisztában volt vele. mielőtt folytatta volna a feltárást. az ingoványos tóparton. Sok-sok kilométernyi távolságban más sem volt az ég kék kupolája alatt. Ez a terméketlen vidék volt csak. Grantot az elmúlt néhány évben kétszer is felkérték. és kelet felé mutatott. Ez a modern világ ugyanis gyorsan változott. – A San Franciscó-i kirendeltségen dolgozom. Óvatosan. és keze fejével megtörölte a homlokát. míg teljes egészében fel nem tárult az apró. a területe nem nagyobb. Egy kis szerencsével Grant a csontváz többi részét is megtalálhatja. ahol sok tízmillió évvel ezelőtt a dinoszauruszok fészkeltek. csak lekopott dombtetők és porladó mészkőkupacok. ami megmaradt abból az egészen másfajta világból. amint a következő domb vastag köveibe vág. ő valami egészen mást látott. az orra majd a földet érte. Holdbéli táj vette körül. abból lett mára az a szélfúvásos lepusztult domboldal. Lehúzta napszemüvegét. az autó felé. Az ezt követő évmilliók során a sötétzöld. Az órájára pillantott: holtpontos az ürge. Alan! A negyven év körüli. és kezet nyújtott. Ez a sűrű növényzettel övezett sziget jól védett menedékül szolgált: itt rakták le tojásaikat közös fészkeikben a kacsacsőrű. Keskeny felhősávok borították akkoriban az eget. ahová tojásaikat rakták. amely már nyolcvanmillió éve nem létezett. Grant abba is hagyta egy pillanatra. a csapkodó szárnyú étkezősátrat és a lakókocsit. egy húsevő dinoszaurusz kölykének állkapcsa került a napvilágra. Sűrű. s a földből épphogy csak kinőtt Sziklás-hegységtől egészen az Appaleche-hegység éles. Víz alatt volt az egész mai amerikai Nyugat. ahol most Alan Grant folytatta ásatásait.. hogy a paleontológia. türelmesen dolgozott – az egyik kezében fogorvosi véső. Minden figyelmét lekötötte az előtte elterülő húszcentis földdarab. Ez lenne az első húsevő dinoszauruszbébi-csontváz. a tábori laboratórium árnyékából. a domb alján látta táboruk hat indiánsátrát. szaggatott ormáig terjedt. míg csak ki nem száradt. két hektárnál. növényevő dinoszauruszcsapatok. meg lehet magyarázni bizonyos múltból származó információk segítségével. Odalent. a vastagsága legfeljebb kisujjnyi. savas portól. lepattant egy-két csontdarab. hogy Ellie neki integet. Montana legkietlenebb vidékén. A part mentén gyorsan nőttek a növények. A homlokáról a földre csöpögött a verejték. savas tó egyre sekélyebb lett. a másikban puha festőecset –. „Badlands”. Ahogy ásott. hordómellű. A tüdeje égett a szúrós. körülbelül két hónapos korában. A puha térdvédők ellenére is fájt a térde. Másfélezer kilométer széles volt ez a beltenger. csak kagylók és csigák. Aztán látta. Alan! Alan Grant felnézett. L alakú állkapocscsont. A srácok a másik dombon kíváncsian bámultak. s itt nevelték sipítozó kölykeiket. rossz vidék – így hívták ezt a kietlen vidéket. amelyeket a paleontológusok ismernek.. . Sehol egy fa vagy akár egy bokor. – Hé. legalábbis részben. és bekente gumiragasztóval a csontot. Semmi kétség. aki erre járt. perzselő nap és sivító szél. Ritkán jött hozzájuk vendég Snakewaterbe. Csak meddő kő. Több mint negyvenöt fok meleg volt. szakállas férfi felállt. amelyet elsötétített a közeli tűzhányók füstje. Elindult lefelé a dombon. – Látogató! – kiabálta Ellie. Az állat hetvenkilencmillió évvel ezelőtt pusztult el. és ott volt az olyannyira jellegzetes mediális hajlás. széndioxiddal telített volt a légkör.A BELTENGER PARTJA Alan Grant mélyen előrehajolva térdepelt. Hunyorgott a napfényben. Grant látta a porfelhőt és az egyenetlen úton feléjük bukdácsoló kék Ford szedánt. Lelki szemeivel Grant maga előtt látta a hatalmas beltenger ingoványos partvidékét. hogy adjon szaktanácsot.

s azokat. – Parancsoljon – mondta Grant. A lakókocsi légkondicionálója legfeljebb csak harmincfokosra hűtötte le a levegőt. és tudta.. ahogy bemutatta a lányt. hogy ami a paleontológiában fontos. Aktatáska volt nála. amelyek belül nagyobbak. – Mióta vannak itt? – Körülbelül hatvan ládányi ideje – felelte Grant. – És mi a dolga? – kérdezte Morris. – Genetikai vizsgálatra? – visszhangozta Morris. kézzel kell elvégezni. foglalja el a karosszéket. Grant nézte. – Nagyon érti a dolgát. amint Morris pedánsan lesöpri a széket. Ellie térdnél levágott farmert és a köldöke fölött összekötött trikót viselt. Meg is tett mindent. – No és azok? – mutatott a férfi a lakókocsi ablakán át a kint álló. Hegyes orrú cipője csikorgott a kavicson. mindegyiken pedánsán elrendezett. Ellie megmutatta Morrisnak az ecetsavas fürdőt. s közben hátrapillantott Ellie-re. Huszonnégy éves volt. és egy jókora porfelhőt bocsátott ki magából. – De mindaz. miért vagyok itt. nyakkendőben és öltönynadrágban volt. mielőtt ráül. mint az „irodai dinoszauruszvadászoké”. Régen egyszerűen kidobtuk az ilyet. Grant a heverőre dobta magát. de a társasági jópofáskodás sosem volt a műfaja. amikor Morrisnak tátva maradt a szája. Amíg hozzá nem kezdtünk ehhez a munkához. Rosszul tűrte az akadémikusokat. Egy sor hosszú faasztal állt a kocsiban. melege van. Csakhogy állandóan felborította őket a szél. mivel közben odaértek a lakókocsihoz. és egy doboz sört nyomott a kezébe. amelyek túl töredékesen kerültek elő. – Nem sokat adunk az etikettre errefelé – szólt Grant. hogy a modora. és a szélben is szilárdan állnak. – Kinyitotta az ajtót. – Használhatatlan darabok – válaszolta Ellie. azt hittem. Erős ecetszag érződött. Kinyitotta az aktatáskáját. amely arra szolgált. ezért Grant megmagyarázta: – Idekint sörben mérjük az időt. – Olyan csontok. – Ellie tartja bennünk a lelket – mondta Grant.Grant is bemutatkozott. indián rezervátumot látok – mutatott a hegyes tipikre Morris. „feketelábú” sátrak – mondta Grant. vastag műanyaggal befedett. de még az öltözködése is más legyen. – Bejön az irodámba? – Hogyne – felelte Morris. Többfajta sátorral is megpróbálkoztak ezután. a bőre bronzbarnára sült. – Nyilván kíváncsi. de manapság genetikai vizsgálatra kell küldenünk. hogy amikor 1978ban hozzákezdett a munkájához ezen a vidéken. nagyobb csonthalmokra. – Azt hittem. amint a lakókocsi felé indult. Egy másikat Ellie-nek adott. Morris a csontokra pillantott. felrakta az asztalra a lábát. szőke haját hátrakötötte. – Aha – mondta Morrison. Még az egyetemi előadásait is farmerben és tornacipőben tartotta. Morris csak nézett. – Egészen pontosan hatvanhárommal – szólalt meg Ellie Sattler. megsüllyedt fotel és egy ütöttkopott fali asztal állt. Kér egy sört? – Te jó ég. s intett Morrisnak. ingben. – Dehogy – mondta Grant. – Nagyon madárszerűek. és belépett. de az eredmény ugyanaz maradt. – Amikor lefelé jöttem a dombról. – Azok is voltak – felelte Ellie. kényelmesebbek. akiket tömören „irodai dinoszauruszvadászoknak” hívott. Morris értetlenül meredt rá. – Elmesélte. – Nagyon ideillők. Snakewatert éppen a dinoszauruszok fészkelőhelyeinek nagy száma teszi fontossá. – Igen – mondta a lány. a múzeumi kurátorokat. amely megnyikordult. Grant jót mulatott magában. a dinoszauruszok nagyok voltak – mondta. De hát ez valaha a „feketelábúak” földje volt. sóhajtott. – Helyezze magát kényelembe! – mondta. de a déli nap forrósága után ez is kifejezetten hűvösnek érződik. Grant a kocsi végébe kísérte. felszalagozott felcímkézett apró csontminták. Csak a szabadban érezte otthon magát. – A sziú tipik három cölöpre épülnek. de még mennyire! – Morris húszas évei vége felé járhatott.. amit itt lát. Odébb porcelántálak és korsók. – És én készítem el a szokásos helyszíni preparátumokat is. ahol egy szakadt heverő. Száz ládával kezdtük júniusban. az egyik legismertebb ember a maga szakterületén. . mind tele kicsinyek csontjaival és tojásokkal. A lány hátradöntötte hosszú nyakát. és ügyet sem vetett rájuk. az egyetemi világot. azt a szabadban. keresgélt a papírok között. Mi viszont egy tucat különböző hadrosaurusfészket fedeztünk fel. bébiktől származik. Hátradőlt. Míg Grant a hűtőszekrényhez ment. hogy leoldja a mészkövet a finom kis csontokról. Végül kezdtek indiánsátrakat. nyolcoldalú sátrakat hozták magukkal. Grant a denveri egyetem paleontológia-professzora volt. Egyetlenegy fészket találtak csak. a tudomány alig ismert dinoszauruszkölyköket. – A paleobotanika – felelte Ellie. és felhajtotta a magáét. és megrázta a fejét. Eddig mint egy hatvannal végeztünk. – Mint a csirkecsontok – mondta a porcelánedényekbe nézve Morris. Összehúzott szemmel körülnézett a kietlen tájon. a Góbi sivatagban. majd megkérdezte: – Látom. aki a lakókocsi túlvégében fogóval szedegette ki a csontokat a savfürdőből. Grant bólintott. a legmodernebb típusú. ezért gondoltuk. – Ezek négy cölöpön álló. tipiket állítani. – Egyszerűen csak ezek a legmegfelelőbbek errefelé.

– A Hammond Alapítvány a tudományok elismert támogatója. és olyan részén fekszik az óceánnak. – Ezeket az ásatásokat finanszírozta az Alapítvány a múlt évben. még muzeális ékszereket is. Alan Grant 1979-ben akadt az első dinoszaurusztojásokra Montanában. mire kellhet az nekik – mondta Grant. Az összeg. A gondolat. hogy bárki is borostyánt halmozzon. A Hammond Alapítvány kizárólag a hideg éghajlati kutatásokat támogatja.. Kanada. a 80-as . ahol szinte állandó a köd. Alaszka.. Semmi ok. Világszerte segíti anyagilag a kutatómunkát. – Nos – mondta Morris –. – Másnak sincs – felelte Morris. Coloradóban vagy Mexikóban – soha nem kapnak egy fillért sem. – Hogy mit csináltam én? Morris papírlapot nyújtott át Grantnak. de emlékszem rá. hogy bárkinek kellhet. A kibocsátó címe: Farallon Road. mely szerint egy nagyjából tízezres kacsacsőrű dinoszauruszhorda élt egy hatalmas beltenger partjain. Nem vágyott másra. Csupa északi lelőhely. amelyről szólt. Vajon miért? – Hát – mondta Morris –. Európában és Ázsiában. és. – Morris az aktatáskájában kutatott. amin vörös pontok voltak bejelölve. – Évi harmincezer dollárt – bólintott Grant. tizenkétezer dollár. Tudja. – Személyesen is találkozott már vele? Grant megint vállat vont. – Hát persze! – kiáltott fel Alan Grant. – Mindig ugyanaz.. sem katonai értéke nincs.. Sziklás. mi az a borostyán! – vágott közbe Grant. aztán még sok-sokra. Fene fura egy dolog volt. Tudomásunk szerint a Costa Rica-iakat erősen meglepte. – Százötven kilométerre van a nyugati parttól. miért. amely közös fészkeket épített sárból. Ha igaz. az tényleg elég különös. Nem vesz észre valami különöset? Montana. – Tudja. – Ön mit tud az alapítványról? Grant vállat vont. És semmiféle szigethez nem volt köze.. De ekkor. csak hogy folytathassa ásatásait. Morris. elég idős már. – Amennyit mi értünk hozzá. A déli dinoszauruszkutatások – Utahban. A tanulmány.– Hosszú volt az út idáig. és odanyújtotta Grantnak. valahogy megragadták az olvasókat világszerte. és csapatosan nevelte kicsinyeit. – Hát hogyne tudnám! – felelte Grant. A Hivatalnak aggályai vannak a Hammond Alapítvány tevékenységét illetően. közte számos dinoszauruszkutatót is. California. Tudja. Önök is kapnak tőlük némi anyagi támogatást. A negyvenötödik szélességi kör alatt semmi. de csak 1983-ban jutott el odáig. évről évre. – Borostyánt – ingatta a fejét Grant. hogy a gigászi dinoszauruszoknak volt anyai ösztöne – meg a rajzok. – Az utolsó öt évben. – Elképzelésem sincs. És különc. – De miért kérdi? – Azért – felelte Morris –. – Morris további térképeket szedett elő. Kiállítva Alan Grant nevére. Jelenleg az egész világon ők rendelkeznek a legnagyobb magánkézben lévő készlettel ebből az anyagból. minthogy a legjobb dinoszauruszkutatók közül sokan forró égövi tájakon dolgoznak. – De nem ez az egyetlen rejtély – folytatta Morris. A csekk alsó sarkán ez a megjelölés szerepelt: TANÁCSADÓI MEGBÍZÁS (COSTA RICA) FIATALKORI HIPERTÉR. – Maga szerint például mi lehet az összefüggés a dinoszauruszok és a borostyán között? – Borostyán? – Igen. adott neki 1984. Hammond pedig pontosan azt teszi. mint a gazdagok közül oly sokan. Tudni szeretnénk. mert a dokumentumok szerint maga tanácsadói díjat vett fel ezzel a szigettel kapcsolatban. a Hammond Alapítvány voltaképpen eléggé rejtélyes egy szervezet. Valaha Felhő-szigetnek is hívták. már évek óta. – Elővett egy fénymásolt világtérképet. márciusában. írjon könyveket. amelyet az InGen Inc. Grantot szinte ostromolták. – Ezt tulajdonképpen csak azért kérdem. Tudomásom szerint ők támogatják Bob Kerryt az albertai Tyrrellből és John Wellert Alaszkában. Svédország. Grant gyorsan átlapozta a térképeket. Isla Nublar. az. Rá jellemző módon mindent visszautasított. hogy az Alapítvány csak a hideg égövi kutatásokat támogatja. – Mert az öreg John Hammond dinoszauruszbolond. – Egyszer-kétszer. hogy adjon interjúkat. Egy csekk másolata volt. az biztos. Sem kereskedelmi. – És a Costa Rica-i szigete? – folytatta Morris. Tizenhét millió dollárt költött borostyánra az Alapítvány. a száraz fagyanta kemény. Borostyánt mesterségesen is könnyű előállítani. amelyeken aranyos bébik dugták ki a csőrüket a tojásból –. mert az elmúlt öt év során Hammond óriási mennyiségben vásárolt borostyánt Amerikában. Rövid látogatásokra jön csak ide. hogy publikálja is a felfedezését. Viszont mindig lelkes. terméketlen.. akkor térjünk rögtön a tárgyra. Mr. sárga. az egésznek egyszerűen semmi értelme. – Erre emlékszem. Palo Alto. – Tudom. tartson előadásokat. Nyilván másokat is. egyik napról a másikra híressé tette Grantot. miért fordít az alapítvány ennyit a dinoszauruszkutatásra? – kérdezte Morris.

ezekben a zűrzavaros napokban történt. Jó csapat. – Igen. Aztán mi történt? – Hát nézze! – mondta Grant. – Hogyan léptek kapcsolatba magával? – Telefonon. És nagyon magas honoráriumot ajánlott. táplálkozási viselkedés. és a fali asztalra tette. amit az általunk talált kacsacsőrű hadrosaurusok szokásairól tudunk. ő tudja. – Szóval elfogadta a tanácsadói megbízást? – Elfogadtam. – Értem – mondta Morris. Hogy értse: ha valaki. és lemondtam az egészet. Ez úgy nyolcvanöt közepe táján lehetett. területiség. Morris leírt valamit. – Arról. hogy jelentést ír neki. de annyira azért nem fontosak. neki pedig minden kell. – Gennarót különösen a fiatal dinoszauruszok érdekelték. Morris bólogatva jegyzetelt. – Mondja – kérdezte Grant –. reggelig várhatott volna az a telefon. – Grant kiitta sörét. Ötvenezer dollárt. – Gennaro hogyan reagált? – Folyton hívogatott. – És az InGen? Azóta nem volt kapcsolata velük? – 1985 óta nem. – Azelőtt is hallott már az InGenről? – kérdezte Morris. – És mikor kezdte a Hammond Alapítvány finanszírozni a kutatásait? – Ennek utána kell néznem – felelte Grant. – Találkoztak is Gennaróval? – Nem. mivel foglalkozunk mi itt. elvállalna-e egy tanácsadói megbízást. Voltak köztük paleontológusok. Valami Gennaro vagy Gennino nevű pasas. És pénzt ajánlott. – És miféle információkat küldött neki? – Mindenfélét. nem tudja? – Nem. ha a Környezetvédelmi Hivatalt ennyire érdekli John Hammond – az északi dinoszaurusz-lelőhelyek. mire kell neki ez az információ? – Igen – mondta Grant. én tudom. Név szerint is felsorolta őket. s a padlóra állította az üres konzervdobozt. Megegyeztünk tizenkettőben. hogy az InGen cég megkereste. hát én fontosnak tartom a dinoszauruszokat. mitől olyan izgatott. Néha még az éjszaka kellős közepén is. – De nagyjából ugyanakkor lehetett. – Láthatja. A nyolcvanas évek közepén. az a sziget Costa Ricában –. hogy megteszem. tőlem mindenesetre a dinoszauruszok táplálkozási szokásai felől érdeklődött. mindazt. Morris bólintott. akkor miért nem kérdezik meg tőle mindezt? – Sajnos a jelen pillanatban ezt nem tehetjük. Hatvanöt millió évvel ezelőtt kihaltak. azt hitte. Mindent. mondjuk. – Jogász vagy nem. ha írásos anyagot készítek róla. a borostyánfelvásárlás. csak nyugodtan. és dinoszauruszbébiket akart bemutatni. – Nem én. – Nem zavarja? – Engem? Dehogy. Rengeteg csontvázleletünk van. bármi legyen is. Vagyis azt feleltem. Az újszülöttek meg a kölykök. de a táplálkozással kapcsolatban szinte semmi adat. – Múzeumot tervezett gyermekeknek. csak telefonon beszéltünk. – Az InGen jogtanácsosa. – Szóval Gennaro 1984-ben felhívta magát. Fészekrakási szokások. De Gennaro azt mondta. egy Ian Malcolm nevű matematikus Texasból. – Ráuntam Gennaróra.évek derekán. Megígértem. – Miért. Gondolom. Ötvenezer dollár két teljes nyári ásatási munkánkat fedezi. . – És az ötvenezer dollár? Grant megrázta a fejét. – Azt is megmondta Gennaro. – Tehát beleegyezett. nem igazán. hogy egy egész sor köztiszteletben álló tudós tanácsadót alkalmaz. Elmondta. mint én. – A fiatal dinoszauruszok táplálkozási szokásairól. – Donald Gennaro – mondta. hogy nem publikáltunk mindent. meg egypár ökológus. Egy rendszerelemző is. Ehhez képest. hogy elküldöm neki munkánk összefoglalását. – De miért nem? – erősködött Grant. amit tudok. Ennének-e a dinoszauruszok ezt vagy azt? Hát amazt? Legyen-e ez vagy az a kiállításon? Soha fel nem tudtam fogni. És ezt meg is mondtam neki. együttes magatartás. hogy ők mit ettek. Morris ezt is leírta. Morris magnetofont vett elő.

mi történik. – Először a Technológiaátadási Hivatal keresett meg – magyarázta Morris. hogy a vakcina végülis okozhat-e veszettséget így is. A chilei gazdák. az csak egy nagyképű cím a jelentésemhez – felelte Grant. Ebben az esetben a „fiatalkori hipertér” nem más. amelyet génsebészeti manipulációval non-virulenssé. hogy fiatal dinoszauruszokról van szó. ahol fennáll az illegális technológiaexport eshetősége. Morris nemegyszer eljátszott a gondolattal. – Amikor visszamegyek San Franciscóba. Ellie felvette. – A TH nem sokat tehetett. De a TH egyszerűen nem tudta elképzelni. És az InGen Costa Ricába küldte ezeket a gépeket. hogy közöljék: két olyan területre is akadtak az InGennél. ha van rá félmillió dollárja. Felháborító. – Nem tudom adni. Lewis Dodgson. – Belelapozott a jegyzeteibe. hogy bármi rosszat cselekedne – felelte Morris. A lakókocsi túlsó végében megszólalt a telefon. és kijelentették. S ami még ennél is rosszabb: a vírust módosították. A Biosyn így nem tudta. hogy az ökológiai hipertérben történik. A gép minden utasa megfertőződött volna veszettséggel. hogy az átjuthatott az alveolus pulmonárison. De nyilvánvalóvá vált. Az amerikai biotechnológiai cégek pedig hanyatt-homlok rohannak olyan országokba. mint minden más új csúcstechnológiai fejlemény. Mint a háromdimenziós kirakósdi. – Kezdte összecsomagolni az aktatáskáját. magyarán egyszerű belégzéssel is fertőzést okozhatott. A Biosyn cég alkalmazottai a fertőző. alighanem le kell zárnunk a vizsgálatot. Olyan országokba. De a Biosyn úgy módosította a veszettségi vírust. – Hatalmas teljesítményű szuperkomputerek. és így tovább –. felelőtlen disznóság volt. Ám a Biosyn ellen mégsem indult eljárás. – A TH dolga. – Ezek automata génszekvencerek. az amerikai hatóságoknak pedig nem volt semmiféle illetékessége. s így örömmel fogadják. hogy az InGen a világ egyik legnagyobb teljesítményű génsebészeti laboratóriumát állítja fel egy obskurus közép-amerikai államban. itt már végeztem is. hogy nincs viszonteladási szándékuk. tudatlan parasztok voltak. – Szóval ezért kezdtünk nyomozni az InGen ügyében – mondta Morris. ahol azt hiszik. Volt már ilyen a történelemben. Visszahívhatja önt? . nem fertőzővé tettek. Csak összehasonlításképpen: három Cray együtt nagyobb számítástechnikai kapacitást jelent. a tüdő-léghólyagocskán. a génsebészet ugyanolyan. hogy Hammond görbe úton jár. mi az ördögnek kellhet valakinek ekkora teljesítmény Costa Ricában. mint amennyivel bármely más amerikai magáncég rendelkezik. hogy ne zavarják őket az előírások és a szabályok. Annyira újak. Volt már rá eset. hogy figyelemmel kísérje az olyan amerikai technológiai exportot. a biogenetikus. Normális esetben az ember nem kaphat veszettséget. A chilei kormányt lekötötte az országos gazdasági válság. mint a lehető legnagyképűbb megjelölése annak. hogy az egyik részlegükből a másikba vitték. És a Biosyn ma semmivel sem megfontoltabb. hogy bizonyos amerikai biotechnológiai cégek más országokba helyezték át a működési területüket. Egyszerűen kibocsátották a vakcinát. olyan gépek. Az első: az InGen három Cray XMP-t szállított Costa Ricába. élő veszettségi vírust menetrendszerű légi járattal vitték Chilébe a kézipoggyászukban. mit jelent az. megalkothatjuk az állat sokdimenziós térben elhelyezett képmását. – Úgy három hete. De bármelyik géntechnológiai labornak lehet ilyenje. hogy még rá sem kerültek a tiltólistára. – Apropó. – Három Cray – mondta Grant. micsoda veszélyeket hordoz. anélkül hogy tisztában volnának vele. mint azelőtt. – Hipertér: ez multidimenzionális teret jelent.– Mert semmi bizonyítékunk nincs. amelynek esetleg katonai jelentősége lehet. – Az meg mi? Valami számítógép? Morris biccentett. Ők hivatalosan nem foglalkozhatnak a felhasználással. 1986-ban a cupertinói Genetic Biosyn Corporation biológiailag manipulált veszettségi vakcinával kísérletezett egy chilei farmon. sem az érintett parasztokat. Minek? – Azt senki sem tudja. kockára tették az életüket. – Én magam viszont meg vagyok győződve róla. Egyes paleontológusok úgy jellemzik az állat viselkedését. – Nos. hacsak meg nem harapja egy állat. hogy „fiatalkori hipertér”? – Ó. hogy tudták volna. amelyek tájékozatlanok a génkutatások terén. ahol nincsenek előírások. De a virulenciát nem ellenőrizték le. – És konkrétan mit találtak? – Nem sokat – ismerte be Morris. alvását. Ha vesszük egy állat minden viselkedésformáját – táplálkozását. Vajon minek? – Szabad a gazda. bizonyítékaink szerint az InGen huszonnégy Hood szekvencert szállított arra a Costa Rica-i szigetre! – Megint azt állították. Ezek közül a Biosyn veszettségi esete volt a legszemérmetlenebb. És a Hoodok még ennél is aggasztóbbak – folytatta Morris. mozgását. éppen tárgyal. Az ügyletet a cég különböző részlegei közti áthelyezésként írták le. Felhívtak. Nem tájékoztatták sem a chilei kormányt. amelyek maguk dolgozzák ki a génkódot. És azt hiszem. Ennyi az egész. a mai napig a Biosynnél dolgozik. Egy országban. vagy nem. akik anélkül. ha útközben a kapszula eltörik vagy kinyílik. Ez a vakcina élő veszettségi vírusból állt. Bűnös hanyagság. nem exportra – mondta tovább Morris. aki az egész kísérletért felelős volt.

ahogy szinte bezúdul odakintről a forróság. az ajtó felé. és az eredményt jelentik nekünk. – Miért éppen ők? – Versenytárgyalás. – Naiv figura. majd becsukta a lakókocsiajtót. Odaértek a lakókocsi ajtajához. – Nem én. Mekkora volt egy olyan? – Úgy ekkora – mutatta Grant. – Egy nő. . – Szívesen. – Valamiféle maradványok azonosításáról van szó. Ismered? Grant a fejét rázta. hogy az InGen a valóságban mégsem múzeumi anyagot készített elő. Morris a kezét nyújtotta. Ezután a proteineket azonosítják. – Mit gondolsz? – kérdezte Ellie-től. – Hadrosaurusbébit. Grant elindult Morrisszal a kocsi túlsó vége. – Mint egy mókus. – Köszönöm a segítségét és a sört – mondta. tojást vagy bármi ilyesmit? – kérdezte közben Morris. és érezte. mihelyt tudod. Vehették más hasznát is a magától kapott információknak? Grant felnevetett.Morris bekattantotta aktatáskáját. – Kért magától Hammond bármiféle fizikai anyagot a lelőhelyről valaha is? Csontot. – Mit szólsz John Hammondhoz a főgonosz intrikus szerepében? – nevetett Grant. és megpróbál proteineket kivonni belőlük a számunkra. A lány vállat vont. amely megőrli őket. A Columbia Egyetem Orvostudományi Központjában dolgozik. – Melyik laboratórium végzi ezt? – kérdezte Morris. hogy bizonyos genetikai munkát is végeznek itt. – Egy utolsó kérdés – szólalt meg Morris még egyszer. amelyek töröttek vagy valamilyen más okból nem megfelelőek arra. – Nem – felelte Grant. Különben ki telefonált? – Ja? – szólt Ellie. Morris vele nevetett. ahogyan Morris a kocsijához indult. Grant kinyitotta. – Pár hónap ide-oda. – Hát hogyne. – Sattler doktornő említette. és felállt.. Egy pillanatig utánanézett. – Óvatosan vezessen a visszaúton! – mondta Grant. hogy feltegye a napszemüvegét. Morris megállt. – Ez így nem pontos – mondta Grant. – Szerintem John Hammond nagyjából olyan sötét üzelmeket folytat. – Az Orvosbiológiai Szolgálat Salt Lake Cityben. Alice Levinnek hívják. Nem is rossz! Azt magam is megnézném. elküldjük a csontokat egy laboratóriumba. – Még egyszer köszönöm a segítségét. – Amikor olyan kövületeket találunk. Tudnak hadrosaurusbébit etetni. tizenöt-húsz centisre nyitva az ujjait.. hogy azonnal hívd vissza. hogy múzeumba kerüljenek. – Mennyi idő alatt érte el a teljes nagyságát? – Három év alatt – mondta Grant. mint Walt Disney. Nagyon kért. Ők tették a legjobb ajánlatot. – Tételezzük fel. – Nincs annak a laboratóriumnak valami köze az InGenhez? – Én nem tudok róla – válaszolta Grant.

semmi akadálya. az erősebb oldatok nehogy elmarják a mészkövet. hogy baziliszkuszgyík lesz. – De nem gyík. Ám eddig egyet sem találtak. majd a savfürdőkre összpontosította figyelmét. – Nem – mondta Grant. mint később majd a bivalyok. Tömegével kellett itt olyan állatoknak élniük. – És biztos. ez fantasztikus! – mondta Ellie. persze. teljes fogazat. Hogy micsoda? Mi van magánál? – Nevetésben tört ki. Állkapocs. Még előfordulhat. és az elkövető a . azt nagyon kétlem. – Faxon ideküldi a röntgenképét. Minden biológus tudja. – Grant letette a kagylót. Az elmúlt két év ásatásai során a csoport csak kacsacsőrű hadrosaurusokat talált. – Csak nem hiszed. – Miss Levin? Itt Alan Grant beszél..A CSONTVÁZ Ellie Sattler kisimította elszabadult szőke fürtjeit az arcából. így az azonosítás tökéletesen biztos. Grant vállán át Ellie is megnézte a röntgenfelvételt. Egyes területeket a szó szoros értelmében elborított a dinoszaurusztojások héja. – Éppen azelőtt találtam. Szakszerű. Nem is akármilyen. – Vagy triassicus. Lassan fújta ki a levegőt. De. – Micsoda emberek vannak! Ellie megkérdezte: – Mi ez az egész? – Valami gyíkot szeretne azonosítani – mondta Grant. – Átment a telefaxhoz. – Te jóságos Úristen! – mondta halkan Grant. – Nem gyík.. de szinte előre is garantálom. hogy nagyjából egy ragadozó esik minden négyszáz növényevőre. Az afrikai és indiai vadrezervátumokban végzett vizsgálatok. Ezt a földet kétszázmillió éve nem taposta három lábujjú gyík. Ellie csodálta. ami előttük fekszik. – Ó. Grant nem válaszolt. De ahogy nőtt a bizonyosság. – Milyen korú? – Fiatal – felelte Grant. Rendben. – Talán végre fordul a szerencse. hogy meginduljon. Velociraptorkölyök. hogy az a srác jött. a piltdowni ember körüli csalásra csak negyven évvel később jöttek rá. hát akkor megnézem.. egytől három méter magasságig. és kikezdjék a csontokat. hogy valami rendkívül ügyes trükk. legfeljebb négy hónapos. hogy a csalás lehetősége bármikor fennáll. A leghíresebbre. tíz-húszezres csordákban vándoroltak a krétakori síkságokon. az oviraptor. igazán nincs időm. hogy tanulmányozhassa. csupa ragadozó. jól megoldott csalás.. Ez pedig akár az első lépés is lehet az álom megvalósítása felé. – Mellesleg van egy új leletem a számodra. – Tényleg? Grant bólintott. Eléggé valószínűtlen volt tehát. Annyira könnyű a csontváz. hogy a teljes csontvázra is ráakadunk. és várta.. Jó. – Mondom. és a fejét ingatta. négyes horizont. valami álszenzáció az. miként nevelték kicsinyeiket a húsevő dinoszauruszok. Hat sorakozott előtte. De hol vannak a kis ragadozók? Snakewaterben több tucat fészekrakó hely volt. Nem. Talán ez a velociraptor-csontváz azt jelenti. hogy nagy ragadozó maradványaira akadjanak. Rögtön is küldheti. Miféle maradványok. milyen izgalomba jöttél! – mondta Ellie. semmi mást. Rajta kellett tartani a szemét. sajnálom. És kölyök! Ellie tudta: Grant egyik nagy álma.. A röntgenképre meredt. hogy ritkák lehettek. de mégiscsak az. hogy egy tízezer kacsacsőrűből álló csorda mindössze huszonöt tyrannosaurus „ellátására” volt elegendő. Ez azt jelenti. hogy ezek a legelésző dinoszauruszok hatalmas. hogy velociraptor? – Holtbiztos – mondta Grant.. A lelőhely is teljesen érintetlennek látszik. és sok kis dinoszaurusz tojásokat evett. azt mutatják. Fél füllel hallotta Grant hangját. Déli domb. Már rég bebizonyosodott. Ellie először arra gondolt. a velociraptor és a coelurus. – Te. – Két. – Képzelem. egyre élesebben vetődött fel a kérdés: hol voltak a ragadozók? Természetesen számítottak rá. Miss Levin. 5-től 30 százalékos koncentrációig.. amelyek a ragadozók és prédáik népességarányaira vonatkoznak. biztos izgalomba jöttél – ismételte Ellie. hogyan maradhattak fenn egyáltalán nyolcvanmillió évig. A dinoszauruszbébik csontjai pedig ugyancsak törékenyek voltak. mint a dromaeosaurus. hogy megjött a szerencséjük. hogy ez egy amassicus? – De igen – felelte Grant. A növényevőket már vizsgálta ebből a szempontból.

magánál senki sem járt ott kint? – Az az igazság – felelte Grant –. Talán egy csecsemőt megharaphatott. várok. és azt mondja.. – A példányt a Cabo Blanco-i tengerparton szerezték július 16-án. ami azt jelenti.. mint egy csirke. hogy vannak a régmúltból itt maradt. Triászkoriak a cápák is. Kapcsolja csak Mr. – A coelacanthus egy két méter hosszú halfaj volt. a gyík megtámadott egy kislányt.. közel a metatarsális ízülethez. Mindenféle esztelen kérdésekkel zaklat mindenkit. ezt kétlem – mondta Grant. (Igaz. Mr. Egy zoológus pedig leírt egy tízezer éves. – És a kora? Grant bólintott. Mindössze ennyit sikerült megmenteni belőle.. és meglepetten pillantott Ellie-re. hatvanötmillió éve kihalt. – Körülbelül húsz centi a csípőig. azóta kiderült. Mi más lehetne? Megszólalt a telefon. csak döglött állatokat evett. A föld melegebb. A tibia erős és jóval hosszabb. ha pedig nem az. a coelacanthus esetében hatvanötmillió éves. Igen. mivel a középső karom a legkisebb. Tehát történt már ilyesmi. A procompsognathus pedig alig ismert állat. – A kor az tényleg probléma. Először pedig a triászkorban jelentek meg. hogy feltételeztük. akik különben egészen jól ismerik a dinoszauruszokat. nagyjából 220 millió éve. A negyedik és ötödik lábujj csontos csökevénye fent volt. lassan már az egész országot bejárja. Megőrült. Vagy hamisítvány – amit kétlek –. amelyről úgy tudták. úgy mondta: – Ezt a különcöt! Mint mindig! Ezt neked is hallanod kell! Grant lenyomta a kihangosító billentyűt. amely az Északitól a Délisarkig húzódott. A procompsognathus a triászkor elején élt. . – Hammond? Mit akarhat? – kérdezte Ellie. még ennél is sokkal régebbi állatfajhoz tartozott. hogy az egész állat úgy harminccentis lehetett. hogy a British Museumban kiállított. Az Atlanti-óceán keskeny tó volt a majdani Afrika és Florida között. de gyereket nem.. – De tényleg valódi lehet? – makacskodott a botanikusnő. – A helyzet az – mondta –. Akadt köztük egy-két millió éves is. Nem is olyan régen pedig a nagynevű csillagász. kiásott gyümölcspatkányt Új-Guineából.. Működő vulkánok százai voltak mindenütt. 190 millió évvel ezelőtt. A háromujjú láb egyensúlya jó. A nagysága pedig megállapítható. amit látni szeretnének. A mostani földrészek még egyetlen összefüggő szárazföldtömeget alkottak – Pangeának nevezik –. Grant csak a fejét rázta. – Bár ki tudja? A procompsognathus olyan kicsi és könnyű volt. majd beleszólt a telefonba: – Igen. hogy azt tárja a tudósok szeme elé. azt tudjuk. Eszerint az állatot éppen ette egy bőgőmajom. – Te el tudod hinni. Én is örülök. Fiatal procompsognathus röntgenképe volt.. De az a példány. – Lássuk. Fred Hoyle azt állította. akkor újrafelfedezés. míg elő nem került egy élő példány Melbourne-ben egy szeméttartályból. – Ez megint Alice Levin lesz – mondta Grant. Körülbelül. Túl szépnek. Ez volt az a környezet. – Igen. hogy már volt nálam valaki. Tisztára önállósította magát. túlélő állatok.mai napig sem ismert. az Archaeopteryx hamisítvány. Ellie a csatolt feljegyzést olvasta. amikor bolygónk egész arculata más volt. csak úgy..) A sikeres csalás lényege abban áll.. Ellie számára pedig a gyík röntgenképe szinte hihetetlenül tökéletesnek látszott. tíz-húszezer évesek lehettek. A hatalmas kontinenst erdők és páfrányosok borították. amelyben a procompsognathus élt. – Nos – mondta Ellie –. hogy valódi. elküldi-e nekünk magát a példányt is. – Lehet hamisítvány ez a röntgenkép? – Nem tudom – felelte Grant. – De röntgenképet hamisítani szinte lehetetlen. De más példák is vannak. Virágkorukat. mint a bolygó uralkodó állatfajtája a jurakorban élték. Hammondot. ásatásból származó szárnyas dinoszaurusz. – Ellie-re nézett. hogy nincs rá más magyarázat. Természetesen várok. és Ellie reszelős öregemberhangot hallott. – Tényleg? Hogy ön? Ez igaz? Rászorította kezét a membránra. amelyet ők vizsgáltak. Ellie összeráncolt homlokkal nézte a röntgenfelvételt. Még olyanok sem hallottak róla.de újabban az agyamra megy valami környezetvédelmi fickó. A krokodilok lényegében ma is élő triászkori állatok. vagy amit várnak. míg 1938-ban ki nem fogtak egy élő példányt az óceánból. Sűrűbb volt a levegő. amint gyorsan beszél: – . A csípőnél az acetabulum hiánytalan. – Gyorsan megmérte. A legtöbb újrafelfedezett állat viszonylag új keletűként szerepelt a fosszilis őslények listáján. Még egy gyerek is elég félelmetesnek tűnhetett a szemében. A dinoszauruszok hatvanötmillió éve. Ja. A farkon negyvenöt csigolya látszott. és néhány nagy sivatag. – Felvette a kagylót. mint a mai. – No. Hammond. Az ausztráliai hegyi törpe oposszumot csak fossziliákból ismerték. hogy hallom a hangját. mire nemsokára kapott egy élő példányt postán. a krétakorban már ki is haltak. Gondolom. mindenfelé beszél összevissza.. hogy valóságos leletről van szó? Élő állatról? Mint a coelacanthus? – Lehet – mondta Grant. mint a femur. Grant bólintott.

milyen fontos dolga van. hogy a saját szakterületéről van szó. ő semmiféle vizsgálatról nem tud! Most ezt rakja össze! Az az istenverte bürokrácia. víg erőszakosságával a hangjában. hogy megtudjuk. – Ugyanis törvényes úton próbálnám leállítani.. – Csak ennyit kérek. hogy megnézze! – Ragyogóan hangzik. az a kölyök le akar menni Costa Ricába. és kinézett. – Hammond megint a torkát köszörülte. Igen. A mi költségünkre. ez nem éppen a legalkalmasabb időpont arra. – Figyeljen csak! Mondok valamit – szólt Hammond. Eszemben sincs. nem zavart. Tényleg el kellene mennie.. nem mehetek – mondta Grant. – Lehet. már majdnem kész – mondta Hammond. ha megtudnánk a véleményét. de hát.. hogy ott szaglásszon. – Hogy mit? – Hammond beszéde hirtelen lelassult. Tudja. Morrisnak hívják. egy Közép-Amerikában gyűjtött állat részleges töredéke. – Ezenkívül ugyancsak most kaptunk kézhez egy igen rejtélyes és egészen rendkívüli leletet. Értem.. ahogy ez a kormány dolgozik. Grant.. hogy van egy szigetünk odalenn? – Nem én – mondta Grant. – Éppen most találtam egy új csontvázat. és nézzen körül. hogy feltartsam a munkájában. Mi is annak tartjuk. – Az az igazság – mondta Hammond –. Izgalmasnak fogja találni. hogy az hol. higgye el. Szóval amint látja. Grant! Meg fogja látni. – Hammond a torkát köszörülte. Ellie az ablakhoz ment. példányt? – Éppen ma... mint aki oda sem figyel igazán.. amely élő procompsognathidának látszik... . A fene egye meg. Jellemző arra. ha zavarta volna.. – Igen? Remek. – Hol Közép-Amerikában? Közelebbről is tudja? – Valami Cabo Blanco nevű tengerpart. Zavarta magát? Feltartotta a munkájában? – Nem. hogy folytassa. – Pedig van. Megkapta? – Nem. félek. dr. és hétfőre már vissza is érne. valami Morris.. – És mikor vette kézhez ezt a. és. Isla Nublar a neve. mi a fene a bajuk. – Ma. Szóval ma. Már harminc hónapja építkezünk ott. nagy sziget. – A múltkor Ian Malcolmnál járt – ismeri a matematikusunkat Texasból? Akkor hallottam róla először.Hammond felhorkant. – Nem is hallottam róla. A munkát sosem szabad félbeszakítani! De leugorhatna ide ezen a hétvégén. de szerintem mégis le kell jönnie – mondta Hammond. – De hiszen csak egy hétvégéről volna szó – mondta Hammond az öregek idegesítő. hogy éppen ma kapja meg. – Éppen most.. hogy itt hagyjam a. itt van-e még Morris! – mozgott Grant szája. Értem. Nem tudom pontosan. a hét végére levitetek egypár embert azok közül.. Csodás hely! Trópusi őserdő.. Grant Ellie-re nézett. akik tanácsadóként dolgoztak nekünk. Grant! – Érdekesnek hangzik – felelte Grant –.. dr.. Megvettük. – Nem. bármilyen furán hangzik – mondta Hammond. hogy erőszakos leszek magával. én tudom. de Morris autója már eltűnt. – Minden tanácsadónkat felkeresi – mondta Hammond. Visszafordult. és ott kezdtünk dolgozni. Hatalmas park! Jövő szeptemberben nyitjuk. egyszerűen csak zaklatni kezdi az embert egy minden felügyelet nélkül dolgozó kölyök. Komoly gond megfogni az ilyesmit.. Idegesnek hangzik. hm. Hogy eljusson a szigetünkre. aki csak vesztegeti az adófizetők pénzét. – Sajnos. – Ne mondja! Élő állaté? Ez aztán különös! – Így igaz. – De hát a kellős közepén vagyok egy. – Ettől féltem.. Némán mozgó szája szavakat formált: Mi folyik itt? Ellie csak a fejét rázta. de itt elég távol vagyunk a. Egy okoskodó kölyök. – Tudja. dr.. Ez természetes. El kell mennie. de hát tulajdonképpen. Remek lenne. Mindenesetre már telefonáltattam az ügyvédeinkkel a Környezetvédelmi Hivatalhoz. – Biológiai példány. – Értem. Nézze meg jól! A sziget egyszerűen csodás. semmi vád. – Küldtem is róla egy kis anyagot magának. Ha valaki. – Nem jól értettem. százötven kilométerre lehet a parttól. s közben Ellie-re nézett. ez teljesen lehetetlen. A hivatal vezetője erre azt állítja. Elképzelheti. – Közép-Amerikát mondott? – Igen. Semmi panasz. nem? – Igen. mintha éppen most ötlött volna az eszébe a gondolat. – Hát az elég baj.. Nézd meg.. Élő állaté. négy éve? Öt éve? Már elfelejtettem. Biológiai rezervátum lesz belőle. ebben biztos vagyok. A hangszóróban Hammond köhécselt. Élő procompsognathidát mondott volna? – Úgy van – mondta Grant. Látnia kéne. az az oka mindennek. Jöjjön le maga is egypár napra.

Onnan aztán egyenesen lerepülünk. Nagyon helyes. Ide figyeljen. remek! – mondta Hammond nyájasan. Előre is örülök. Kevés holmit csomagoljanak. nem tagadom. Ismeri. magukért jövünk a cég sugárhajtású gépével. hogy ennyi pénzből két nyáron át finanszírozhatnánk a következő expedícióinkat. hogy van egy kis probléma ezzel a szigettel kapcsolatban. – Hát különböző problémáink voltak. hogy minél simábban menjen minden. Igen. Oda tudnak érni addigra Sattler doktornővel? – Azt hiszem. Most kissé szórakozottan szólt a hangja. meg késéseink. És ha Sattler doktornő is nélkülözhető az ásatáson. hogy némileg szorult helyzetbe kerültem itt. és szeretném.– Izé... Mr. Botanikusra is szükségünk van. – Ezt hogy érti? – kérdezte Grant. Legyenek ott holnap délután ötkor! Várni fogom magukat. – Azt szeretném. amint válaszol. A holnapi viszontlátásra! – Ezzel Hammond letette a telefont. ahol maguk táboroznak.. Choteau-ban fogjuk felvenni magukat.. Útlevél sem kell. az az igazság. – Helyes. ugye? Mindössze két órányi autóútra van onnan. – Nézze. Legyen elég annyi. hogy találkozni fogunk. tudja. A legmagasabbat.. Mondjon véleményt! Megfizetem a szokásos hétvégi tanácsadói díjat. igen. ha a kedvemért megtekintené ezt a szigetet. mintha másutt járnának a gondolatai. Az hatvanezer három napra. . A Környezetvédelmi Hivatal szimatolgatása a lehető legrosszabb pillanatban jött.. – Helyes. ő is megkapná ugyanezt. Mit szól? Ellie Grantot nézte. Grant doktor! Beszélt már erről valakinek? – Nem. Szóval nézze. Hammond. azon a magánreptéren. – Remek. Grant doktor.

– Méghozzá potenciálisan veszélyes álmodozó – tette hozzá Ross. Túl nagy rajta a nyomás. Hammond terve nagyon spekulatívnak tűnt. A múlt héten pedig éppen a Hamachi San José-i képviselőjétől kaptam egy értesítést. Eszerint valami újfajta gyík gyerekeket harapdál a tengerparton. Nem hülyéskedhetünk vele. Mi az anyagi pozíciónk ott? – Cégünk tulajdonrészesedése öt százalék – felelte Gennaro. – Helyes – szólt Ross. – Akkoriban úgy látszott. John – mondta Hammond. hogy meg tudja csinálni. Gratulálok. a Costa Rica-i üdülőtelepnek csúszik a határideje. Telefonált s közben főnökét. hogy szegődjön a már akkor közel hetvenéves John Hammond mellé. – Nem bízhatunk Hammondban többé. Ő már péntek reggelre ott lesz. – No és mit mond Hammond? – Állítja.. aki sötét. – Nem hiszek. hogy a következő három hét mindegyikén legyen egy-egy független.. Gennaro úgy emlékezett vissza az egészre. hogy képtelenség. – És Grant beleegyezett. hogy eljöjjön. ahogy Donald Gennaro érezte magát. – Meg fogják mondani neked az igazat? – Azt hiszem. a befektetők meg kezdenek nyugtalankodni. Megkértem Hammondot. Számítógépes rendszerelemző. Velük megyek én is. – Miért. mint valami szédületes vágtára. és Rosshoz fordult. Azonnal körül kell néznünk azon a szigeten. – Az első csoport egy paleontológusból. – Általános vagy korlátolt felelősséggel? – Általánossal.COWAN. hogy miféle bajok vannak odalenn. – Nem lett volna szabad ebbe a dologba belekeverednünk. mint egy temetkezési vállalkozó. amely szöges ellentétben állt azzal. hogy semmi baj azon a szigeten. az volt. – De az egyik legfőbb befektetőnk a Hamachi. – De ezek szerint megcsinálta – mondta Ross. – Értem. hogy nem sikerülhet. – Azzal mindenesetre egyetértek. egyikük pedig – Ian Malcolm a matematikus – nyíltan szembehelyezkedett az egész tervvel. hogy semmit – válaszolta Gennaro. Ross pislogott. igen. – Te szervezed? . Mi a helyzet a helyszíni szakértőiddel? – Olyan szakemberekkel kezdem. A végén majdnem egymilliárd dollárt hoztak össze. Felülvizsgálja a park komputereit. Túl sok a kósza hír. Swain és Rosshoz. kitűnő. okosan járunk el – mondta Gennaro. – Letette a kagylót. – Lehet. S ha még emlékszel. Donald Gennaro a befektetési bankok világából érkezett a Cowan. – Gennaro listát dobott Ross asztalára.. és Gennaro segített felhajtani a pénzt. még valamikor 1982-ben. már nyolc éve! A résztulajdont honorárium fejében fogadtuk el. És akkor mindennek a tetejében jön ez az ügy. Semelyiküknek sem volt különösebb köze a szigethez. részemről rendben. csíkos öltönyében olyan hűvös volt. Kitűnő. – Nem lett volna szabad. Ezen a hétvégén utaznak. – Ez már nem játék. Borotvaélen táncolt az egész. Ross a fejét ingatta. míg sikerül elegendő pénzt összeszedni az InGen Társaság alapításához. igen. – Újfajta gyík? – Igen – mondta Gennaro. – Hammond álmodozó – mondta Gennaro. – De te nem hiszel neki – mondta Ross. olyan vidámságot kölcsönözve a szobának. egy paleobotanikusból és egy matematikusból fog állni. SWAIN ÉS ROSS A San Francisco-i Cowan. – A fenébe is.. – És ki van még? – Egy technikai ember. – Nem – felelte Gennaro. Állította. és helyreigazít egy-két kisebb hibát. Mindjárt az egyik legelső megbízatása. John. Az ügyvédi iroda csúcstechnológiában utazó ügyfeleinek gyakran volt szüksége tőkére. Swain és Ross ügyvédi irodát elöntötte a déli napfény. Senki sem hitte komolyan. Daniel Rosst nézte. Hogy annyi a biztonsági és elővigyázatossági intézkedés. akiket Hammond még a terv kezdeti szakaszában alkalmazott tanácsadóként. helyszíni ellenőrzés. Vizsgálatot folytat ellene a Környezetvédelmi Hivatal. hogy a szárazföldön találtak egy ilyen élő procompso-micsodát. az mit jelent? – kérdezte Ross. Túl sok munkás halt meg. hogy nagyon is ideje utánanézni.

itt Donald Gennaro! Az InGen általános jogi tanácsadója vagyok. Ismeri? A Texasi Egyetem tanszékén van Austinban. Nagy örömömre azt hallottam tőle. – Így esetleg megszerezhetném azt a példányt John Hammond számára. dr. Magánál van ez a példány. mintha nem volna semmi baj. hogy ott lesz – mondta Grant. Maga az állat New Yorkban van. – Akkor jó – mondta Gennaro. csak annyi az egész. hogy holnap látni fogom őt is. Nyilván szeretné látni a saját szemével is.– Hammond maga akarta lebonyolítani a telefonokat. – Hát jó – mondta Ross. akárcsak ön. amíg önök ott tartózkodnak. – John Hammond említette. és kivonult a szobából. Azt hiszem. Előbb csak a rádiótelefon sziszegő zúgását hallotta. megpróbál úgy tenni. Gennaro tárcsázott. ez kitűnő. Üdvözletem Sattler doktornőnek. hogy nem voltunk kapcsolatban. és elmondaná a részleteket is? – kérdezte Gennaro..procom. – Úgy van – szakította félbe Grant. Grant – mondta Gennaro. aki szintén az első tanácsadóink közé tartozott. Jó néhány éve már. majd egy hangot. éppen most beszéltem telefonon John Hammonddal. – Állítólag már holnap indulunk. Örülök. – Az. aki egészen lázba jött a hallatára. – De gondoskodj róla. Apropó. hogy maga is eljön a Costa Rica-i szigetünkre.. Grant doktor. vagy micsoda? – Procompsognathus – mondta Grant. Nem tudom.. – Nos – mondta Gennaro –. ez a pro. Grant? Mármint a valóságos példány maga? – Nincs – mondta Grant. A Columbia Egyetemről hívott fel miatta egy nő. – Itt Grant. hogy leküldjék a szigetre.. egyáltalán emlékszik-e. – Lenne olyan szíves. amit tudott. Fel akar vágni a szigetével. dr. – Egyébként magam is ott leszek. – Emlékszem – szólt Grant. . – Nos.. aminek történnie kell! Légy ura a helyzetednek! Egy hetet adok rá.. – Csak egy röntgenképet láttam. Talán el tudom intézni. – Nos.. amelyet találtak. – Ezzel Gennaro letette a kagylót. hogy meg is történjék. hogy jöjjön ő is. Grant elmondta. csak afféle társasági meghívásról volna szó. hogy ez a Costa Rica-i probléma megoldódjék! – Ross felállt. – Halló. önt is. Felkértük Ian Malcolmot is.. ez a bizonyos példány. hogy szeretném megköszönni. amiért ilyen gyorsan elvállalta. az.

De valami képet ez is ad az Isla Nublar-i munkálatok céljáról. Bélyegző volt rajtuk: IPARI TITKOK. és egy vastag barna borítékkal a kezében a lakókocsi végébe ment. LÁTOGATÓKÖZPONT KASTÉLY MEGBÍZÓ ÉPÍTÉSZEK ISLA NUBLAR ÜDÜLŐKÖZPONT InGen Inc. NEM TERJESZTHETŐ. Inc. hogy magukkal is megbeszélhessem. Kísérőlevél nem volt benne. – Az egyik srác hozta a városból. Főtanácsadó: A.TERVEK – Most jött – szólt másnap Ellie. MUNKAPÉLDÁNY. London. V. belső célra készült jogvédett alkotásai. Projektfőfelügyelő: Dennis Nedry. Kedves Alan és Ellie! Amint látják. Tervezési társtulajdonos: Richard Murphy. kiderült. – A legfelső oldalra lapozott vissza. New York. Szerintem. H. Üdvözlettel John – Nem értem – mondta Grant. Boston (szerkezeti). velünk tudnak jönni. Kanazawa N. a mutatós propagandaanyagok terén még nem állunk valami fényesen. Grantnak feltűnt a kék-fehér InGen-embléma. A. R. Dunning. és mindegyiken ez állt legfelül: „Ezek a tervrajzok az InGen bizalmas.. Kicsinyítve voltak. Makasawa Integrated Computer Systems. Amint felcsapta a könyvet. Végigpörgette a lapokat. kihullott belőle egy papírlap. Tokió. MÁSOLÁS TILOS. – Ezek építési tervrajzok. ahogy felszakította a borítékot. Cambridge. Remélem. Misikawa. Whitney Fields. Főtervező: Theodore Chen. Hammond a feladó. Mass. Amikor kihúzta. T. Palo Alto.” . Ieyasu. nagyon izgalmas! Alig várom. hogy csupa tervrajz. meg BIZALMAS. Murphy és Tsai. Osaka (mechanikai) Shepperton Rogers. Az oldalak be voltak számozva. Ha ön nem írta alá a 112/4A sz. akkor bűnvádilag felelősségre vonható. Kobayashi. Calif. dokumentumot. vastag könyvecskévé összefűzve. A borítón ez állt: AZ ISLA NUBLAR ÜDÜLŐTELEP VENDÉGLÉTESÍTMÉNYEI (TELJES DOKUMENTÁCIÓ: SZAFARIKASTÉLY) – Ez meg mi az ördög? – kérdezte. Adminisztratív társtervező: Sheldon James Harlow. Ashikiga. A. MŰSZAKI MUNKÁLATOK: LÁTVÁNYTERVEZÉS: ELEKTROMOS MUNKÁLATOK: COMPUTER C/C Grant magukat a terveket kezdte nézegetni.

Grant jól látta egy úszómedence körvonalait. /D/TRIC/L/5 (4A + 1). hordozható számítógép hátuljába befutó dróttömkeleget. A látogatók mindig azt hitték.. Többnyire pedig mellettük fut az út is. Mindegyik ilyen területet kódok jelöltek. s volt egy olyan útszakasz. mert különben kockáztatja. amelyet mintha a szó szoros értelmében belevájtak volna egy szikla oldalába. hogy ez a kietlen táj soha sem változik semmit. /LN/OTHN/C/4 (3A + 1). /P/PROC/V/2A. És mielőtt elmegyek. – Üdülőtelepnek látszik. LÁTOGATÓTERÜLET – ez volt az északi szekció megjelölése. – Mint valami állatkert – mondta Ellie. és vizsgálgatni kezdte az elemmel működő.. nem messze attól a szerkezettől. betongátakkal. mint valamiféle betonbunkerek. A főútvonal északról délre tartott. pontosan keresztül a sziget központi dombjain. „Hammond Réz. „Látogatóközpont/Adminisztráció”. De a látogatóterületen belüli többi épületen nem volt semmi különös. kis ablakokkal. de a valóságban szüntelenül . aztán a számítógép képernyőjén tisztán megjelentek a sárga körvonalak. hogy megvan rá az oka – így Ellie. hogy mit jelent: a kerítésekben áram van. – Van megfejtés a kódhoz? – kérdezte Ellie. Aztán Ellie-hez szólt: – Akkor ezt az ősrégi módszerrel fogjuk megcsinálni. és tökéletesnek látszott. aztán egy hosszú. egy sor piramisszerű formával a tetején. – Kész paranoia. És mindet betonból készült vizesárok határolta el az úttól. mintha szántszándékkal nagy. Hunyorgott a napfénytől. de semmit sem talált. A bontás ezúttal hibátlanul sikerült. gondoskodni akarok a lelet biztonságáról.. általában félreeső sarkokban. és Alan Grant előtt ott volt a csontváz gyönyörűen meghatározott képe. – Elektromos kerítések és vizesárkok. vastag falakkal. Grant gyorsan átforgatta a lapokat. és /VV/HADR/X/11 (6A + 3 + 3DB). nagy részét szabad terület töltötte ki. ezek a méretek helyenként döbbenetesek! Nézd meg ezt! Ez a betonárok legalább tíz méter széles. és az órájára nézett. Ha az ember egyszer hozzákezd egy őslelet feltárásához. hajlott területrészekre nézett. a teniszpályák négyszögeit és a növényeket és sövényeket jelölő kerek rajzjeleket. mesterségesnek tűnő tó. az biztos – szólt Ellie. hogy minden területrészen akad egy-két építmény. – Nem késhetem le a repülőgépet. hosszú nyaka hátrahajolva. Mint egy katonai erődítmény! – Akárcsak ezek az építmények – mondta Grant. Az utakat különösen helyezték el. zárt területeket hoztak volna létre. – Ugyan. – Egy pillanat! – Lehajolt. Ezek az építmények mind betonból készültek. Semmi kétség: kis velociraptor volt. amelyeken szinte semmi építmény nem volt. Az egyik srác hallotta. – Hát tudod – mondta Ellie –. Alan! – Nézzétek! – mondta Grant. – Mondom – ismételte Grant. A sziget többi része még rejtélyesebb volt. Grant lehuppant a domboldalra. alacsony épület. ha be is fejezi. és alaposabban szemügyre vették a körvonalakat. amelyeket elválasztott egymástól az úthálózat. aki közben felfedezte. A monitorról eltűnt a kép. – Tán kivették – mondta a lány. egy folyó fölött. Ezen eltűnődtek egy darabig. „Energia (Sólepárlás) Tartalék”.” és „Szafarikastély”. Az oldalnézet vázlatokon látványosnak látszott: hosszú. – Most mi történt? – Elveszett a bemenő integrátor – mondta az egyik fiú. Grant félretette a papírokat. hogy át lehessen látni a kerítés fölött.. hajlatokat formáló területekre oszlott. Újra elővették a topográfiai térképet. hogy elvész. – Elektromos kerítések egy üdülőtelepen? – Méghozzá kilométerszám – tette hozzá Grant. ezen belül pedig az épületek ilyen elnevezéseket viseltek: „Látogatók érkezése”. És az utak a talajszint fölé voltak emelve. Egyre inkább kezdett úgy látszani. meg egy-egy külső épület itt-ott. Ezután következtek magának a Szafarikastélynak részletes rajzai. amelyet Döngetőnek neveztek el. Ebben a pillanatban tompa robaj hallatszott. mentén kis fényjelzés. és így szólt: – Vissza a munkához! – Tűz! Egy kicsit reszketett még a kép. – Lehet. De a sziget legnagyobb része nagy. – A nagy. míg rá nem jöttek. keskeny. Mint a régi háborús filmek náci géppuskafészkei. Az árkokon kívül kerítés volt. – Utálom a komputereket! – mondta Grant. Amennyire Grant látta. A gépet a négyes számú domb tetején egy sörösládára állították. amelyeket vizesárkok és elektromos kerítések választanak el az úttól. Utak és alagutak hálózata borította. – Hát ez furcsa – szólalt meg Ellie. Az oldalnézeti domborrajzokon úgy néztek ki. jobb.– Kissé paranoidnak látszik – mondta Grant. Hat ilyen részterület volt az egész szigeten.

Szóval a velociraptor nagyon-nagyon régen elpusztult már. Leginkább egy mozgó fagylaltárus tolókocsijára emlékeztetett. a hátsótest felé. hogy a tetem kiszárad a napon. Itt – úgy látszott – a csontváz tökéletes rendben van. csak a fej és a nyak hajlik hátra. – Meddig várjak még? – kérdezte Grant. – Ez a bébi alighanem dögevő volt. Az a sok-sok idő. éles fegyverré fejlődött. hogy így hatékonyabban ássanak. A kérdés csak az volt. . s ez forradalmasítani fogja a régészetet. Valóban fiatal példány volt. A Döngető most úgy hét méterre lehetett tőlük. Ennyi telt el azóta. után pedig elálmosodtak. Egy ilyen finom ősleletet még egy kisebb zápor is elmoshat. Feltehetőleg az intelligenciája is hasonló lehetett. Tökéletes. intelligens és könyörtelen. aztán ott felejtettek. – Valahogy torznak látszik – mondta a srác. csontjai finomak. A kicsik csicseregve átmásztak az alvó nagyok testén. hatalmas karommal. A kitekert nyak eszerint a haláltusáját vívó dinoszaurusz végső agóniájának jele. hogy meghatározták vele a leletek kiterjedését. A leletvédelem rendesen annyit jelent.és gyíkfaj egy olyan nyaki ligamentum-összehúzódáson megy keresztül a halála után. Ez azonban még a jövő zenéje volt. A CAST-programnak eddig csak annyi hasznát vették. felnőtt velociraptor azonban valami egészen más volt. hogy felhasítsa vele az áldozat testét – ennél a kicsinél nem volt nagyobb egy rózsatövisnél. Ez a nyakhajlat annyira gyakori volt a fossziliáknál. hogy ez a csontváz oldalirányban is elcsavarodott. amely tökéletesen működött a laboratóriumban. és apró harapásokkal tépkedték a dögöket. Ezek az emberi élmények aligha készíthetnek fel bárkit is. Gondoskodni kellett a védelméről. Aztán mindig fennállt egy váratlan zivatar lehetősége is. a körzetet pedig körülárkolják. ami több. erős. Azokból a hullákból táplálkozott. mert megmérgezték őket a növényekben kialakuló alkaloidák. Eljön az ásatás nélküli felfedezések kora. A húsevők akár a saját súlyuk 25 százalékát is el tudták fogyasztani egyetlen étkezés alkalmával. – Csak az idő. Grant visszament. hogy az emberek nem tudják felfogni a földtörténeti időt. A velociraptor egyébként is könnyű felépítésű dinoszaurusz volt. abból következik. Ez az új eljárás abban állt. háromdimenziós kép nyerhető a csontokról. kerekes ezüstdoboz. s alkalmas volt arra. Alan. Grant részben feltárt csontváza tehát veszélyben volt. Egyformán jól támadott éles fogaival. a velociraptor gyors volt. hogy a bal láb és lábfej a gerinc fölé emelkedik. hogy a Döngető puha ólomlövedéket lő bele a talajba. amely valaha csak élt. s a monitorra nézett. hogy maga az ásás fölöslegessé válik. hogy ez a kis állat elpusztult. esernyővel a tetején. Ennek semmi köze a halál okához. aki egyszer s mindenkorra megcáfolta ezt az elméletet. Grant volt. Bár a termete viszonylag kicsi volt – nagyjából mint egy párducé –. mint a piramisok életkora. Ez esetben a nyolcvanmillió év még mindig 3542 évet jelentene. mint a madáré. Az ezüstnek néhány nap elég a megfeketedéshez. tizennyolc centis. A srácok viszont állították. – De nem hinném. a terepen gyalázatosan érzékenynek és megbízhatatlannak bizonyult. és ennek alapján egyfajta röntgenképet állít össze a domboldalról. amely a felnőtt állatnál hajlott. Az emberi élet egészen más időskálán folyik. ezzel rezgéshullámokat kelt. A berendezés ugyanis. Azt pedzették. Valószínűleg a legfalánkabb dinoszaurusz. Két ifjú legény kezelte. méghozzá szó szerint az ember szeme előtt. Az alma percek alatt megbarnul. amelynek következtében a nyak jellegzetes módon hátrahajlik. amelyet a legképtelenebb helyen állítottak le. Nem volt komoly. míg vissza nem tér. Éppen a következő puha ólomlövedéket töltötték bele. Látszani is alig látszott a képernyőn.folyt az erózió. – Nem is – mondta Grant. Grant tisztában volt vele. Egész nyáron ezt az eljárást alkalmazták. Próbáljuk meg képzeletben az átlagos emberi életet – hatvan évet – egyetlen napba sűríteni. hogy ponyvával fedik le a területet. hogy a számítógép az oka. hogy a dinoszauruszok azért haltak ki. miután a nagyok kielégítették az étvágyukat. amelyeket a számítógép leolvas. hogy igen sok madár. A velociraptor legfőbb jellegzetessége – az egy lábujjú karom. Megint előtte volt az élénksárga vonalakkal kirajzolódó csontváz. – Nem is volt az – felelte Grant. – Már megvan. – Nem tűnik valami félelmetesnek – mondta az egyik srác. változó sikerrel. Ennek meghatározására a számítógépes hangtomográfiát alkalmazták (rövidítése az angol szavak alapján CAST). karmos mellső lábával és leggyilkosabb fegyverével: a hátsó lábán lévő egyetlen. s amelyek ott száradtak a napon. Előadóként az egyetemen Grant más hasonlatokkal igyekezett érzékeltetni a dolgot. Egész nap hallani lehetett a morzsolódó domboldalról leguruló kavicsok zaját. hogy a víz irányított módon folyjék le. hogy felfogja. Nagy. amelyekkel a felnőttek végeztek. mit jelent nyolcvanmillió év. Grant látta. amikor bebizonyította. Aranyos kis cicák lehettek! Egy kifejlett. mekkora árkot igényel a velociraptor csontváza. úgy. hogy egy-két éven belül olyan pontos képet tudnak majd létrehozni a képernyőn ezzel az eljárással. hogy egyes tudósok elméletet alkottak a magyarázatára. A gyermek egy évtized alatt felnő. Egy rakás komposzt egyetlen évszak során lebomlik.

hogy például amikor új hím veszi át az oroszlánfalka vezérségét. Bármi lehet az oka. hogy egy felnőtt támadta meg. Még az is.. milyen legyen a vizesárok. Grant segített leverni az utolsó póznákat. torkukat szaggatják. – Kétlem. amilyenben csak tudja. náluk sokkal hatalmasabb dinoszauruszokra. de fogalmunk sincs a csoport társas viselkedéséről. milyenek lehetnek a dinoszauruszok a valóságban.. hogy a nőstények más hím leszármazottainak felnevelésére pocsékolják az idejüket. Az oka egyértelműen genetikai: a hím célja – hiszen így fejlődött –. az első dolga. lemaradás a csoporttól. Grant utasításokat adott. ahogy maga elé képzelte. – Ha ötig el akarjuk érni Choteau-t. viselkedéstant. bordáikat. – 150 éve ásnak és kutatnak szerte a világon. amely lefedte a domboldalt. akármi. Betegség. és mindezek ellenére alig van elképzelésük arról. hogy olyan tág körben terjessze el a génjeit.. Az afrikai vadasparkban egyes húsevőknél a hetven százalékot is eléri. Oly kevéssé ismerik a dinoszauruszok életét – gondolta Grant. Micsoda látvány lehetett!” – gondolta Grant. hogy valaha is megtudjuk – felelte Grant.. A kölykök leölésével az összes nőstény tüzelni kezd. Egy csapásra azt is megakadályozza.„A velociraptorok falkában vadásztak. hogy az összes kölyökkel végezzen. Elég egy kétméteres négyzetet lefedniük. amint egy tucat ilyen vadállat teljes sebességgel ráront a békésen legelésző. A számítógépes képből tudták. Mindannyian tanultak etológiát. muszáj! . s így megtermékenyítheti őket. – Hogyan pusztult el a bébi? – kérdezte az egyik fiú. Ellie közben kibontotta a ponyvát. – Fogy az időnk! – hozta őt vissza a való világba Ellie. – A vadonban magas a gyermekhalandóság. „Ki tudja? Lehet. hogy az együtt vadászó velociraptorfalkát is egyetlen hím uralta. Azt ugyanis tudjuk. hasukat.” – Mennünk kell! – mondta Ellie. hogy a csontváz viszonylag kis területen helyezkedik el. és tudták. a hátukra ugranak. A diákok bólogattak. hogy ezek az állatok falkában vadásznak.

Donald. Farmer és pulóver. A ketrecet. Hammond imádta a feltűnést. khakiszínű sortok meg trikók és borotvakészlet. Óriási befektetésről van szó! – Akkor sem habozhatsz. amely alig volt nagyobb egy macskáénál. miközben beszélt. valamint Hókuszpókusz bácsit. Csakhogy amikor Hammond az elefántról beszélt. – Én megtettem. Hammondot rettegés töltötte el. Az elefántnak mindig óriási sikere volt. Hogy van a bűbájos felesége? – Nagyon jól. a híres-nevezetes varázslót. viszont az elefánt nem genetikai eljárással készült. de hát már vagy öt éve nem látta. – Értem – mondta. Ez sem volt akármilyen teljesítmény. és harminc centi hosszú. Mutatványosnak született. mint az alvó papagáj kalitkáját. a Sziklás-hegység irányába repültek. valahányszor elfelejt becsomagolni. kedves fiam! – mondta a jól ismert. tapsvihar tört ki a láttán. kelet felé.. fiam? – Köszönöm.. Atherton. Mr. Annak idején. Hátradőlt a Gulfstream-11-es típusú sugárhajtású gép párnázott ülésén. Ekkor Hammond közölte. Hammond minden pénzszerző összejövetelre magával vitte. Az alakja hibátlan. Hammond reszketett. Elizabeth remekül érzi magát.HAMMOND Gennarro titkárnője vadonatúj bőrönddel a kezében sietett be a szobába. Ne is gondolkodj! Csak csináld! Érted. hogy agyaracskája a ketrec rúdjai közé szorult. Én sem tudom. hogy a miniatürizáció folyamatában az elefánt magatartása lényeges változásokon ment át. – Jó utat! – mondta Ross. különösen télvíz idején. hogy pénzre van szükségük. Aztán az elefánt nagyon hajlamos volt a megfázásra. – Amanda születésnapja szombaton lesz. máskor meg fertőzéseket kapott az agyara szegélyénél. s ilyenkor mérgesen horkantott. reszelős hang. – De hát Hammond. mielőtt Atherton gondoskodik az utánpótlásról. – Tudja. mindjárt magának is szeretett volna egyet. Amint elhaladt a csupa üveg tanácsterem előtt. a Stanford Egyetem egykori genetikusa Hammond üzlettársa volt az új vállalkozásban. akkor a földig égeted az egészet. sok mindent elhallgatott. Hogy élvezné az új parkunkat Costa Ricában! Gennaro már el is felejtette. A felesége nem fogadta kitörő örömmel. Atherton egyszerűen fogott egy törpeelefántembriót. 1983-ban. nem szívesen utazik el. Lent várja a kocsi. – Manapság már soha fel sem hív – mondta szemrehányóan Hammond. ha hűvös lenne. Már egy kislányunk is van. azzal kecsegtetett. de semmi köze sem volt ahhoz. amit Hammond sejtetni engedett. Világos? – Úristen. Gennaro – jegyezte meg –. Például azt. jól. és kijött hozzá. – Hát hogy van mostanában. köszönöm. Dan Ross felállt az asztaltól. Donald. Még az árcédula is rajta volt. amit ennyi idő alatt lehetett – mondta a titkárnő. mert aki csak látta a kis állatot. Menet közben tépte le az árcédulát a bőröndről. állandóan egy elefántot hurcolt magával egy kicsi ketrecben. mekkora a baj odalenn. többnyire Gennaro vitte be a terembe. – Fiam. amelynek most jött el az ideje. A titkárnő kiment. Ahányszor csak prüszkölt egyet kicsiny agyarán át. hogy igaza van – mondta Gennaro. – De tisztázzunk valamit. csak az agyara volt csökött. Hammond azt is elhallgatta befektetőjelöltjei elől. és előtűnt az elefánt. ám inkább olyan volt. Meglehet. a lába nem ért le a szőnyeggel borított padlóra. – Van benne tornacipő a maga méretében. amelyet takaró borított. – Lehet. uram – felelte Gennaro.. nehogy az elefántja kimúljék. Az elefánt huszonöt centi magas volt.. Amanda sem. De ha komoly. az apró élőlény szabályos elefántnak látszik. – Nem lehetek ott a kislányom születésnapján. Jó is lesz. az az érzésem. Ráadásul Athertonnak sosem sikerült másodpéldányt előállítani a minielefántjából. pedig igazán mindent megtett. Elisabeth sivalkodó négyéveseket hívott meg a zsúrra. mennyire alacsony ember Hammond. – Hát ez nagyszerű! A gyermek igazi áldás. ha indul. Az is előfordult. miközben szabadulni próbált. hogy Gennaro elutazik. hogy Norman Atherton laboratóriumából ismeretlen csodák egész sora fog majd kikerülni. Gennaro elindult a folyosón. nehogy félreértés legyen. Ahogy az ülésen ült. ami kiviszi a repülőtérre. – Hiányoltam magát. Hammond leadta szokásos beszédét a „fogyasztócentrikus biológiai technológiáról” – ő nevezte el így –... és mesterséges anyaméhben keltette életre. Volt valami gyermeki a pasasban. Lógázta. mint ahogy Gennaro emlékezetében élt. Öregebbnek látszott. Már csak azért is. mint . Dan. Kicsiny teste. pedig Hammond ma már. amit mondok? Gennaro bólintott. – Hammond le van szarva! – mondta Ross. majd egy drámai pillanatban lerántotta a takarót. hormonális beavatkozások segítségével. nehogy lekésse a járatot. mennyi is lehet? Hetvenöt? Hetvenhat? Ott valahol. hogy genetikai céget akar alapítani.

Már meghívtunk húsz gyereket. hogy van az ilyesmi. és kibámult a gép ablakán. amelyet Hammond annak idején a befektetőknek adott el újra meg újra. amelyet Hammond elfelejtett megemlíteni. – Dehogy jelent – válaszolta Hammond. mintha pusztán valamiféle vidám. – Miért? – kérdezte Gennaro. – Akkor egy ellenőrző vizsgálat sem jelent problémát. Különös tekintettel arra. nehogy simogassák. Donald – mondta. földrengés – mindezt megtalálhatja akárhol. Élő látványosságokban. Mind a helyén van. Maga is meggyőződhet majd róla. hogy szembenézzen a valósággal. 1983 szeptembere és 1985 novembere között John Alfred Hammond és az ő „Vastagbőrű Vállalkozása” 870 millió dollárnyi befektetési tőkét gyűjtött össze. így van hol lakni. Úgy viselkedik. Gennaro vállat vont. éppen a hivatalos nyitás előtt.. És még több is összejött volna. – Mennyi? Kétszázharmincnyolc? Az öregúr kuncogott.. hogy az! – Hammond meghúzgálta a sportzakója mellső zsebéből kikandikáló díszzsebkendőt. hogy tizenkét. – Nézze. mint a csík. meg egy bűvészt. Inc. társasági kirándulásról volna szó. . – Hogy ezt megértse. – Emlékszem. igaz? – kérdezte Gennaro. vadnyugat. Az van mindenütt. – Fantasztikus! Na és a többi. – A gyerekek mindig előre beleélik magukat a dolgokba. Már elhalasztották a nyitást. – Már hogyne tudnám – mondta Hammond. örökké mérges. kalózbarlang. így mi biológiai látnivalókban gondolkodtunk. így végül többnyire japán konzorciumok maradtak mellette. Láthatóan élvezte Gennaro megdöbbenését. És hány faj? – Tizenöt különböző faj. „Animatronikus” környezet. – Rengeteg pénzt! – Emlékszem – mondta Gennaro. mennyire kerüli Hammond. hogy életképes-e az egész elképzelés. Várható. hogy voltaképpen az egész utat Gennaro ügyvédi irodája kényszerítette rá. amit tervezett? A létesítmények? A számítógépek? – Minden megvan. Mindennek ellenére Gennaro segítségével Hammond összeszedte a pénzt. Majdnem ugyanazt a beszédet hallotta szóról szóra. – Azt maga el sem tudja képzelni! Egész csordáink vannak! – Kettőszázharmincnyolc. csak éppen az volt teljesen bizonytalan. Nagyralátásban és lelkesedésben nem volt hiány. – De természetesen a Costa Rica-i terv végső céljáról sem feledkezhetünk meg: pénzt akarunk keresni – fűzte hozzá Hammond. Donald. aggályoskodás. És bár Hammond magabiztosan kilencmilliárd dolláros évi bevételt ígért 1993-ra. amely összekapcsolja a legfrissebb elektronikus és biológiai technikákat. – És mindenből a legkorszerűbb. Donald – mondta Hammond. Ez volt az utolsó apróság. legmodernebb szórakoztató parkjáról – vurstlijáról – van szó. – És az állatok? – Az állatok természetesen már ott vannak. Csak a japán befektetőkben volt ennyi türelem.. Amelyek olyan döbbenetesek. Gennaro akarata ellenére elmosolyodott.. néven bejegyzett társaságot. – Az várható volt. elektronizált.egy gonosz kis rágcsáló: gyors. minden – felelte Hammond. – Most van a kislányom születésnapja... a terve mélységesen spekulatív volt. harapós. A repülőgépen ülve Gennarónak az járt a fejében. készen áll már a park a látogatók fogadására? – kérdezte Gennaro. hogy Norma Atherton – ő volt az agy az üzleti tervek mögött – halálos beteg volt. másfelől legalább öt évig nem ígért osztalékot a tőke után. Hammond igyekezett visszatartani az embereket. Tudja. Gennaro megjegyezte. hogy a családját nem hozta magával. Mindennel le kell állnunk. – Ez hihetetlen – mondta Gennaro.. amire szüksége volt. Ez sok befektetőt elijesztett. hol vagyunk már attól! Kétszázharmincnyolc állatunk van. – Ó. – Amúgy is több késésük volt. mozgó dolgok – az is van mindenütt manapság. hogy megindítsa tervezett cégét.. egy kicsit vissza kell térnünk az üdülőtelep eredeti elképzeléséhez. az International Genetic Technologies. – És egyáltalán. Coney Islanden is. – De a szálló már kész. Kísértetkastély. olyan érthetetlen ez az. Valami csodás az egész! Ezért olyan. – Nos. A világ legfejlettebb. hogy bekövetkezik. Könnyen leharapott ujj lehetett volna a vége. amire fel lehet ülni. hogy az egész világ képzeletét megragadják. Nem hullámvasútról meg mindenféle más herkentyűkről. Nincs a világon semmi gond azzal a szigettel. Donald. hivatalosan még nem – felelte Hammond. de hát Hammond egyfelől ragaszkodott a tökéletes titkossághoz. gyógyíthatatlan rákban szenvedett. az eredeti elképzelés szerint azt remélte.. – Ja. – Csak éppen lelassítja a dolgokat.. – Igazán kár.. Az öreg most éppen tudomásul sem veszi. Donald..

. . amit csak lehetett. Hát ezért fektettünk annyit az egész számítógépes rendszerbe. a takarítókét. az állatokat. a jegyszedőkét. – Csak a szokásos késésről. az indítással kapcsolatos késésekről volt szó? – Úgy van – szólt Hammond.– Annak pedig. óhatatlanul adódnak bizonyos problémák. Olyan park kell. Megszólalt a pilóta hangja: – Csatolják be a biztonsági öveket. amely időre elkészült. – Szóval csak a szokásos. több baleset is előfordult – válaszolta Hammond. – Kérem. normális. a számítógéprendszereket. kérem! Rögtön leszállunk Choteau-ban. – Emlékszem. higgyen nekem. a karbantartókét. Mindent automatizáltunk. – Csakhogy a leplezetlen igazság az – mondta Hammond –. Két munkás a sziklaút építésekor halt meg. történt egy-két baleset az építkezés során – mondta Gennaro. a szigeten minden a terv szerint halad! Azon a szigeten minden a legtökéletesebb rendben van! A hangszóró életre kelt. januárban.. amely minimális személyzettel működik. és be is indult? Mert én még nem. – Azt hallottam. Az étkeztetőkét. Maga tán hallott már komolyabb számítógéprendszerről. – Kezét a fiatalabb férfi karjára tette. Donald – mondta –. hogy egy ilyen parkkal igazán nagy pénzt lehessen keresni – folytatta Hammond –. Egy harmadik pedig exkavátorbaleset következtében.. – És összesen három volt halálos kimenetelű. De most már hónapok óta nem volt semmiféle balesetünk. hogy amikor az ember összehozza az egészet. Csökkenteni kell a személyzet létszámát. amikor azt mondom. egyetlenegy a titka.. – Igen. – Munkások haltak meg.

Port fújt és száradt ágakat görgetett ide-oda a szél a repedezett betonon. Sattler foglalkozása. fontos. – Elnézést kell kérjek – mondta Hammond –. ahová megyünk. bármilyen fényűző is a berendezés.CHOTEAU A forró. A gép megállt. a közönség legnagyobb meglepetésére és gyönyörűségére. Mindig is ez volt. Grant és dr. Ez a dolgok rendje. – És meddig leszünk Costa Ricában? – kérdezte Grant. hogy kezet rázzon vele. ahogy Hammondhoz lépett. Engedjék meg. Paleontológusok. Donald úgy véli.. hogy senki se tudjon semmit egészen addig a napig. Donald Gennarót. száraz sivatag a messzeségbe nyúlt. Hammond Gennaróhoz fordult. hogy maga nő! – Pedig előfordul az ilyesmi – mondta Ellie. A gép azonnal meg is indult. . – Nem leszünk odalenn negyvennyolc óránál tovább. és gyorsan gurult feléjük. ahol feltöltik a gépet. kérem! – szólt a stewardess. mintha valami vicceset mondott volna. – Nagyon vigyáztunk rá. a paleontológia még mindig nagy mértékben függött bizonyos gazdag magánemberek adakozó hajlandóságától. – Hát az attól függ – szólt Gennaro. neki sem tetszik a pasas. Gyorsan kezet fogtak. miközben bezárta az ajtót. Ragyogóan szabott Armani-öltönyt és drótkeretes szemüveget viselt. Másnap reggel érnek oda. s egy kék ruhás stewardess kinyitotta az ajtaját. – Rühellek a pénzeszsákok kedvében járni! – morogta Grant. nem tagadhatja meg tőle. A pilóta bejelentette. Grant első látásra ellenszenvesnek találta. izmos férfi volt. – Higgyenek nekem! – mondta Hammond Grant felé fordulva. Grant és Ellie a dzsip mellett állva várták. Gennaro meglepetten megszólalt: – Nahát! Nem is sejtettem. Harmincas évei közepén járhatott. és hozzákezd a leszálláshoz. – A munkánkhoz tartozik ez is. Függetlenül attól. Gennaro zömök. hogy velünk tartanak.. – Nyilván tisztában van vele. – Tisztába kell tenni egy-két dolgot. mi dr. hogy ha John Hammond a segítségét kéri. hogy mielőbb odaérjünk. majd továbbindulnak Costa Ricába. hogy bemutassam munkatársamat. Grant becsatolta az övét. Grant meglepetten tapasztalta. Amikor Ellie is a kezét nyújtotta. hogy négy óra lesz az út Dallasig. – Ez a bizonyos sziget. Míg számos tudományterület – mint például a fizika és a kémia – növekvő állami támogatásban részesült. amíg a karcsú testű Grumman-gép leír egy kört. Dinoszauruszokat ásnak elő. Grant tudta jól. Össze kellett görnyednie. milyen szűk a hely odabenn. Ellie a vállára kapta a táskáját. hogy maga is kíváncsi volt arra a Costa Rica-i szigetre. ahol csúcsos dombok meredeztek. Sattler – mondta Hammond. A patrónus az patrónus. korábban még csak nem is hallottam róla. Ellie vállat vont. – Dr. A kis sugárhajtású gép leszállt. Grant és dr. – Aztán elnevette magát. és Grant tudta. de egy kissé sietős az utunk. Tán valami titkos dolog folyik ott? – Bizonyos értelemben igen – felelte Hammond. – Foglalják el a helyüket. míg hivatalosan meg nem nyitjuk a szigetet. Örülök.

hogy végett vetettek a Hal. – Uraim! – kezdte. Az elmúlt tíz percben egymás között beszélgettek. Az InGen indulásáról 1983-ban. A gyakorlatban ipari kémkedésről volt szó. Egyre feltűnőbben pillantgattak az órájukra. A Biosynnál kapott állást. miszerint nincs pisztráng a patakokban. azután létrehozták a saját változatukat. Nagyszabású földmunkák indultak. a New York-i Zoológiái Társaságtól az indiai Ranthapur Természetvédelmi Parkig. mert embereken akart génterápiai kísérleteket folytatni a Szövetségi Gyógyintézeti Hivatal jóváhagyása nélkül. semmi másról. hogyan működik. amelyet Idaho állam Hal. – Az kell.és Vadvédelmi Hivatalhoz érkező panaszoknak.EGY ÖNMAGÁTÓL ADÓDÓ CÉLPONT Soha eddig még nem fordult elő. Steingarten. Lew – mondta. Ez egy pillanatra elhallgattatta őket. mind a Biosyn ezen a területen működött. mint a madártojás. akik a múlt iránt érdeklődtek: paleobiológusokat. hogy ez a pisztrángfajta néha belehalt a napégésbe. amely olyan tulajdonságokkal rendelkezett. amelyet Milliporus Plasztikgyárnak hívtak. A borostyán felhalmozásáról. hogy fontos döntés előtt állnak. Ezt a halat könnyebb volt észrevenni a patakokban.. Az 1980-as években néhány géntechnológiai cégben felmerült a kérdés: „Vajon mi lehet a Sony Walkman biológiai megfelelője?” Ezeket a cégeket a legkevésbé sem érdekelték a gyógyszerek vagy az egészség. A három Cray XMP szuperkomputerről. Most a termékfejlesztési részleg vezetője volt a Biosynnál. – Aztán 1987-ben az InGen felvásárolt egy jelentéktelen kis céget Nashville-ben. és. Ha minősített többségről van szó. A Costa Rica-i Isla Nublar megvásárlásáról. közöttük egy több mint három kilométer hosszú. szétszedték. emellett olyan kutatókat foglalkoztattak. – Eggyel többre van szükségünk. A szokásos adományokról a világ legkülönbözőbb állatkertjeinek. de.és Vadvédelmi Hivatalánál kötöttek. – Dodgson doktor! Ez mind rendkívül érdekes. a kozmetika és a kedvtelésből tartott állatok iránt érdeklődtek. Világosnak látszott. japán tőkével. Ron Meyer irodájában azt mondták. nem képezte vita tárgyát. Mind az InGen. Papírjaikat rendezgették. – Ehhez meg kell szerezned a beleegyezésüket. Tojásalakúvá lehetett formálni és csirkeembriókat növeszteni benne. mire készül az InGen. kopaszodó. – Mégis. Arra számítottak. génsebészeti úton új. A Biosyn már fel tudott mutatni bizonyos sikereket. De még mennyire! Ha Dodgsonon múlik.. Dodgsonnak immár megvolt a minősített többsége. A tíz igazgató bosszúsan. Harmincnégy éves volt. – Azért jöttünk ma este össze. sekély mesterséges tó kialakítása a sziget . Attól függött. az azt jelenti. kitől kérdi az ember. hogy a kaliforniai Cupertinóban székelő Biosyn Részvénytársaság rendkívüli konferenciára hívta volna össze igazgatótanácsát. Nyílt az ajtó. Kizárólag a szórakoztatás.. a sport. A Biosyn különben is tovább dolgozott rajta. Ez egy mezőgazdasági érdekeltségű cég volt. a hatórás géppel jön San Siegóból. és ő irányította azt a bizonyos hírhedt chilei kísérletet a veszettség elleni vakcinával. A következő évtől kezdve aztán az InGen a gyár teljes milliporus plasztiktermését a maga céljaira fordította. Egy szerződés alapján például. héjaarcú. – Mindeme jelek ellenére – mondta Dodgson – még mindig fogalmunk sem volt. Este nyolc óra volt. de most lassanként mindenki elcsendesedett. kifürkészték. Azonnal felállt. minősített többség kell? – Úgy van – mondta Dodgson. Még a repülőtérről idevezető utat és a forgalmat figyelembe véve is itt kellene már lennie! – Miért. belépett Ron Meyer. És ez így is volt. és gyorsan belehuppant az egyik székbe. hogy vizsgálódás tárgyává tegyünk egy önmagától adódó célpontot: az InGent. – Még valaki hiányzik – mondta Lewis Dodgson. – A karórájára nézett. hogy az 1990-es évekre igencsak megnő az igény a „fogyasztócentrikus biológiai termékek” iránt. – Ezzel egyidejűleg – folytatta a magáét Dodgson – megkezdődött az építkezés az Isla Nublaron. a Biosyn feje azonban ragaszkodott hozzá. Dodgson gyorsan áttekintést adott a dolgok hátteréről. Fogták a konkurencia egy-egy termékét. Egyesek szerint Lewis Dodgson volt nemzedékének legmerészebb genetikusa. s mint mondták. amely leginkább – így mondták – „fordított génsebészet”-tel foglalkozott. tanácskozásra sem kerül sor. merre tart. a szabadidő-tevékenységek. mások szerint a legmeggondolatlanabb. mire várunk? – kérdezte az egyik. Posztgraduális tanulmányai kellős közepén kirúgták a John Hopkins Egyetemről. (De annyi bizonyos. forradalmasította a horgászsportot.. idegesen ült a tanácsteremben. DNS-filogenetikusokat és így tovább. halvány színű pisztrángfajtát hoztak létre. a húsa pedig vizenyős és ízetlen volt.) Az a tény. hogy a cég figyelme állatokra összpontosul. Nem sokkal korábban egy új plasztikfajtát szabadalmaztatott. Tennessee államban. amely nagyrészt az InGen ellen irányult.

az állat újbóli kitenyésztése. Ha elegendő DNS-töredéket sikerül kivonni. – Ugyebár semmiféle törvénytelenségről. Egy ilyen állatkertért az InGen annyit kérhet látogatási díjul.. igen. Valaki a torkát köszörülte.közepén. Mint tudják. mint az összes baseball. a jelek azonban arra mutatnak. Az InGen abszolút tulajdonosa lesz a maga dinoszauruszainak. hogy mi is megcsináljuk a magunk dinoszauruszát? – kérdezte valaki. – Amit ők felépítettek – mondta Dodgson –. Azt hogy lehet? – Lehet. Dodgson véleménye szerint teljesen indokolatlan és értelmetlen volt. az a világ legnagyobb egyedi idegenforgalmi látványossága. Ha pedig ez lehetséges. egy élő állat klónozása is lehetségessé válik. – Micsodák? Állatkák? – Még szép! Ha az InGen képes életnagyságú dinoszauruszokat létrehozni. Pillanatnyi szünetet tartott. Korábban úgy hitték. Az InGen. az állatkertek igen népszerűek. Van gyerek. A pénzemberekkel mindig az a baj. . a Harvard javára.. 1982-ben a dolgok technikai akadályai szinte leküzdhetetlennek látszottak. Az egyik igazgató előrehajolt. – Dinoszauruszokat klónoznak. csak legyen. hogy ez nem így van. A valóságban a szakirodalomban már 1982-ben felmerült a dinoszauruszok klónozásának lehetősége. hogy sikerül DNS-töredékekhez jutni. Sikerült a múltból való. ha állatkertben tartják őket.. Mindössze bonyolult volt. sapkák. akkor törpe dinoszauruszok előállítására is képes. hogy nekik öt év előnyük van. azt hiszem. Befektetik a pénzüket az adott területen. Már sikerült genetikai anyagot nyerni egyiptomi múmiákból és a kvagga. aki megpróbálja. hogy a dinoszauruszokat szabadalmaztatni fogják. – Az állatkert egy hihetetlen méretű üzleti vállalkozás központi része. – Miféle állatok azok? – Dinoszauruszok – mondta Dodgson. A videojátékok. képregények és a szelíd háziállatkák. – Mi az akadálya. amelyek tojásból fejlődnek. A japánok meg egyenesen imádják az állatkertet. hogy nem tartanak lépést a fejleményekkel. – Miféle állatokat? – Olyan állatokat. Éppen annyit változtatnánk a DNS-összetételén. élő dinoszauruszt kapna játszótársul? A saját kis szabadalmazott állatkáját? Az InGen milliószám fog eladni belőlük. egy az 1880-as években kihalt. – Semmi. Lehetségesnek azonban lehetséges volt. hogy a fosszilizáció minden DNS-t megsemmisít. Nagy mennyiségű dinoszauruszcsont porrá őrlésével azonban elképzelhető. A Legfelsőbb Bíróság 1987-ben döntött így. Az ezt követő megdöbbenés és pánik dr. és amelyek igen nagy helyet igényelnek. mi minden lehetséges. A trikók. hogy az InGen egy hatalmas kiterjedésű magánállatkertet hozott létre a szigeten. játékbabák. 1985-re már lehetségesnek tűnt a kvaggaDNS rekonstruálása. de fogalmuk sincs. hogy kicselezzük a szabadalmat. A század végéig szinte lehetetlen utolérni őket.. hogy üdülőlétesítmények épülnek. Elméletben azonban nem volt akadálya. Az elmúlt évben több amerikai járt állatkertben. hogy csak az InGen dinoszauruszeledelével táplálkozhatnak majd. A jelek szerint az InGen valami egészen rendkívülit alkotott. – Persze ha hozzájuthatnánk az ő dinoszauruszuk egy példányához. Jelenleg ötven van belőlük Japánban. – Azt mondta. Ez az állatkert egyedülálló az egész világon. és továbbiak állnak építés alatt. akkor visszafordított génsebészettel elkészíthetnénk a magunkét. Bizalmasan kiszivárogtatták. hogy egy kihalt élőlény pusztán DNS-ének rekonstrukciója után feltámadjon.. zebraszerű állat bőréből. Úgy látszik. És még csak ekkor jönnek a fogyasztási cikkek! A képeskönyvek.. a siker pedig valószínűtlen. és senki más nem hozhat létre ilyet törvényesen. – Pontosan – mondta Dodgson. ha egy kicsi. – És hozzá tudnánk jutni ilyen példányhoz? Dodgson ismét hallgatott egy kicsit. Annak idején. drága. És az InGen génsebészeti módszerekkel úgy fogja alakítani őket. kivéve. Most kiderült. és megszólalt: – De Dodgson doktor! Na és? – Ez nem közönséges állatkert – mondta Dodgson. hogy dinoszaurusz-DNS léteznék bárhol is a világon. Napi kétezer dollárt? Vagy tízezret? . volt. aki ne örülne.és futballmérkőzésekre együttvéve. A DNS manipulációja évről évre könnyebb és könnyebb lett. mi jöhet még? A masztodon? A kardfogú tigris? A mamut? Vagy éppen a dinoszaurusz? Természetesen senkinek sem volt tudomása róla. – Atyaúristen! – suttogta valaki. A génsebészeti úton létrehozott állatok immár szabadalmi védelemben részesülnek. amennyit csak akar. – Nos. kihalt állatokat klónozniuk. S ha ez meg is történik. ez lesz az első példa rá. hadd legyen afféle öleb belőle.

Az értekezlet résztvevői a jegyzetelő titkárnőt és az asztalon álló magnetofont nézték. hogy formális határozatot kelljen hoznunk ebben a kérdésben. uraim – mondta Dodgson. Törvényesen juthatunk az ő DNS-ükhöz. Elegendő látnom a teremben uralkodó hangulatot.. – Csak attól tartok. s az én forrásomnak a következő huszonnégy órán belül lépnie kell. A fejek lassan igent intettek. hogy egyetértéssel találkozik-e. dehogy! – vágott közben gyorsan Dodgson. Csak egy elégedetlen alkalmazott kell hozzá vagy némi helytelenül kezelt hulladék vagy ilyesmi.– Ugyan. – Ön rendelkezik ilyen forrással. Semmiféle törvénytelenségről nincs szó. hogy ide fáradtak. Senkinek a véleménye nem került a jegyzőkönyvbe. amennyiben megteszem a szükséges lépéseket. – Nem látom okát. . Dodgson? – Igen. mivel jelenleg az InGennél kisebb válság történt. igen hamar döntenünk kell. – Köszönöm. dr. rendelkezem – mondta Dodgson. – A többi már az én dolgom. Csak bólogattak némán. Hosszas csend szállt a teremre.. Senki sem szólt.

– Dodgson technikusai éjt nappallá téve dolgoztak két napon át. hol abban. amely megakadályozza a növény kárt. – Jól van. és kiitta a kávéját. Dodgsonnak ehhez nem volt elég a bakteriális DNS. mélyhűtött embriók. hogy az InGen alvállalkozókat és tanácsadókat hívott meg a szigetre. és jól tudta. Nem rossz. – Egy kicsit nehezebb a megszokottnál. Dodgson tartotta vele a kapcsolatot. mi a tét. Rendben. aki hozzá tud férni az embriókhoz. annyi az egész. – Tányérja szélén letörölte a habot. – Ez az? – Ez az. hogy a pasas most hozzá tud férni az embriókhoz. Tizenöt faj. hogy otthagyja a Cetust a Biosyn kedvéért. hogy az InGen a legkörültekintőbb biztonsági rendszabályok segítségével őrzi embrióit. A genetikusnő egyszerűen az egyik keze öt körmére pöttyentett egy-egy cseppet mind az öt törzsből. Dodgson pedig ehhez értett igazán. Hétszázötvenezer dollár. – Egy frászt akarom. hogy összeállítsák. – Az már a maga emberén múlik. Az viszont minden találkozással egyre pimaszabb lett. havonta találkoztak Carlos és Charlie vendéglőjében a Szilikon-völgyben. Mélyhűtött embriókra volt szüksége. Dodgson gyorsan becsukta az aktatáskát. – És ha ellenőrzik a csomagomat? Dodgson vállat vont. – Hát ez meg mi? – nevetett. – Tíz percem van a gép indulásáig. Dodgson doktor! – mondta az. eljött a pillanat. – Térjünk a tárgyra! – mondta a férfi. és hol ebben segített neki egy kicsit. Ilyen embert viszont nem volt könnyű találni. és gyorsan körülnézett. mind a ketten pontosan tudták. mikroszkopikus baktérium. Dodgson azonban tehetetlen volt vele szemben. Egyetlen. Hat hónapja viselte el türelemmel ezt a pasast. A génsebészetileg előállított DNS – súlyra mérve is a világ legeslegdrágább anyaga. 1987-ben rávett egy elégedetlen genetikusnőt. – Késett. ha talál egy olyan alkalmazottat a cégnél. hogy legyen hordozható hűtő a fedélzeten. hogyan működik. és hozzon magával öt génsebészetileg kialakított baktériumtörzset. – Fussunk csak át még egyszer az árfolyamon! . Elfojtotta a mérgét. – A férfi elfordult. – Ez az egész? – Nem az egész. Addigra az embrióknak már San Joséban kell lenniük. Bár az illetőnek nem volt dolga genetikai anyagokkal. akár ötmilliárd dollárt is érhet. – Oké. Az év vége felé Dodgson végre ráakadt egy olyan InGen-alkalmazottra. vagy az úgynevezett „jég-plusz” génjét. – A pénzt akarom látni. Dodgson doktor. csak meg kell találni hozzá a megfelelő vevőt. és néhány hüvelyknyi bepillantást engedett. hajlandó lopni belőlük. Most pedig. Az embere már ott volt.REPÜLŐTÉR Lewis Dodgson belépett a San Franciscó-i repülőtér indulási csarnokának kávézójába. hogy még egyszer végigmenjünk a tennivalókon? – kérdezte Dodgson. Az InGenen kifogni azonban jóval nehezebb feladat volt ennél. öregem – mondta a férfi. A fele. amely a szívinfarktus enziméhez. ugye. szabad szemmel nem is látható. – Álruha? – Sosem lehet tudni – felelte Dodgson. Ránézett Dodgsonra. Ez a tény egy új. és kisétált az ajtón. A pultnál várakozott. és képes kijátszani a biztonsági intézkedéseket. aki a hajóban lesz – mondta a férfi. A férfi mintegy mellékesen lenézett. és észrevette a szalmakalapot a fején. De hogyan szállítsam őket? Dodgson egy nagyméretű Gillette borotvahabos tartályt nyújtott át neki. – Akarja. Gyorsan megmutatta a férfinak. és a padlóra tette aktatáskáját kettejük között. Csak úgy juthat hozzájuk. – Azért gondoskodjék róla. de most már igazán! Dodgson felkattantotta az aktatáska csatját. Dodgson leült mellé. – Nyomja meg a tetejét! A férfi megnyomta és fehér borotvahab fúvódott a kezére. aki megközelíthetőnek látszott. bizarr ipari kémvilágot eredményezett. a sztreptokinázhoz való gént tartalmazza. nem felejtette el? – Nem hát. – Mennyi hűtőgáz van benne? – Harminchat órára elegendő. – Ezt mind a tizenöt fajért kapja. – Gondoskodni fogok – mondta Dodgson. amelyre Dodgson várt – ugyanis ez azt jelentette. – Nem rossz.

– A férfi ellökte magát a bárpulttól. ahová a nagy teherszállítók érkeznek.. További ötvenezer. – Bízza rám! Nyugi! Maga csak hozza a pénzt. hogyan kell működtetni a. tehát. – Maga mikorra ér vissza San Joséba? – Valószínűleg vasárnap. – Remek! Aztán gondoskodjon róla. – Gondoljon arra is. Ott legyen nekem vasárnap reggel a San José-i reptéren! És készpénzben! – Ott fogom várni magát – mondta Dodgson. A feltételek maradnak – mondta Dodgson. – Minden leszállított embrió ötvenezer dollár. hogy a sziget legalábbis tudomásunk szerint. – Nyugodjon meg. – Biztosan – felelte a férfi.. Dodgson nyugtalanul kérdezte: – Biztos. állandó rádiókapcsolatban áll az InGen kaliforniai központjával. ezt a részét már elrendeztem – mondta a férfi. – Nézze... Nem az északinál. hogy tudja. hogy a hajó ott legyen péntek éjjel a sziget keleti dokkjánál. Rendben? – Rendben – mondta Dodgson. A keletinél. – Ne féljen! . Kis pótkikötő.– Ahogy megállapodtunk. tudom. ha életképes.

Sattler doktornő – mondta erre Malcolm. – Malcolm doktor! – kiáltott fel erőltetett kellemkedéssel a hangjában Hammond. itt vagyok. Én hiszek abban. hogy csak két színben jár? – Nem. – Dr. mit vegyek fel holnap reggel. Ellie-nek a szája is tátva maradt. – Csak felrázva. ahol minden adott. mi lesz a végkimenetele mindennek. de nehogy megkavarja! A nyitott ajtón át bekúszott a gépbe a nedves dallasi levegő. hogy a fekete egyenesen a legjobb a forróságban. ha netán tévedésből szürke zoknit vennék a fekete nadrághoz. talán a profi sport még unalmasabb. Igen hatékony. hogy a matematika valami olyasmit írjon le. még a vászoncipője is. vagy nagyobbakat hajigálnak ide meg oda.MALCOLM Dallasban magas. Kifejezetten felszabadító érzés. – Maga hívta meg! – mondta. de a valóságban a gondolkodást száműztük. el fogja hinni nekem. mint a popsztárok. hogy tapsolhasson nekik. ezek nem is olyan triviális ügyek. – Nevetséges! Malcolm vállat vont. De ettől függetlenül is. John! Igen. – Semmi problémánk! – vágta rá gyorsan Hammond. iszik-e valamit. és senki sem gondolkodik. Matekos vagyok. Malcolm volt a leghíresebb az új matematikus nemzedék azon tagjai között. Nem fogom arra vesztegetni. A neve természetesen nagyon is ismerős volt Grant számára. adott. én csak két színt hordok: feketét és szürkét. hogy Malcolmot mindenekfölött szórakoztatja ez az egész kirándulás. hogy feketében járjon? – kérdezte tőle Ellie. – De nem unalmas. hogy ez a sziget nem fog működni – folytatta Malcolm. és egymáshoz is jól illenek. a valóságban a fekete szín tökéletesen megfelelő a melegben. a divat még a sportnál is érdektelenebb. Ha visszaemlékszik arra. nincsen egy kicsit túl meleg ahhoz. De nem. hogy az életem értékes. Való igaz: néha már-már úgy viselkedtek. Másodszor szinte kizárólag nonlineáris egyenleteket alkalmaztak kialakulóban lévő tudományterületükön. Először is szinte állandóan számítógépekkel dolgoztak. Malcolm elvigyorodott. nagyon örvendek. – Maga nagyon csinos. tetőtől talpig feketében. Azt hittük. – Ez a két szín minden alkalomra megfelelő – folytatta Malcolm –. Malcolm sorra kezet fogott mindenkivel. az meg nem. – Grantnak az az érzése támadt. – Ian Malcolm. Rémes világban élünk. Ezek a tudósok több szempontból is szakítottak a hagyományos matematika elefántcsonttorony-világával. harmincötéves férfi szállt a gépre. úgy beszéltek és öltözködtek. egy cseppet sem. A stewardess megkérdezte. Harmadszor minden jel szerint arra törekedtek. úgy bámulta a matematikust. ami a valós világban ténylegesen létezik. kopaszodó. hogy az – egy idősebb kolléga szavaival – „felháborító módon előtérbe helyezte a személyiséget”. – És merem remélni. amelyet maguk „káoszelmélet”-nek neveztek el. hogy az ember így vagy úgy fog viselkedni. De azért. Hidegen hagyta Hammond haragja. mindent összevetve. – Méghogy leállítani! – Hammond felpattant mérgében. Malcolmnak nagyon határozott véleménye van mindenről – szólt közbe magyarázólag Hammond. mindannyian tudjuk. a világ meg még fizet is. a zoknija. Adott. a nadrágja. Hammond Gennaro felé fordult. – Mondja. . maga el tud képzelni unalmasabb dolgot a divatnál? Jó. akik nyíltan hirdették: őket az érdekli. – Az első perctől kezdve megjósoltam! – benyúlt puha bőr aktatáskájába. mint az öltözködés! – mondta Malcolm. – Egy álló napon át képes volnék gyönyörködni a lábában. – És milyen okosan tette! – mondta erre Malcolm. A maga régi nemezise megérkezett. – Egy Diet Coke-ot kérek – mondta. – És természetesen teljesen őrült – tette hozzá Malcolm maga. hogy száműzni fogjuk a papírt. hogy ez érdekelni fogja. és így mutatkozott be. – De ha jobban belegondol. s ezt a módszert a hagyományos matematikusok mélyen megvetik. – Én mindig mondtam. „hogyan működik a való világ”. Őszintén. Le kell állítania az egészet. és széttárta a karját. azt hiszem. hogy olyasmivel foglalkozzam. amit a fekete testek sugárzási tulajdonságairól tanult valaha. – Hello. Amikor felnőtt férfiak ütőkkel kis labdákat csapkodnak. Fekete volt az inge. Malcolm leült az egyik párnázott ülésre. Hát nem döbbenetes? Eljött az információ társadalmának kora. – A jelek szerint ugyanis maguknak komoly problémájuk van. Végül pedig mintha csak hangsúlyozni akarnák az akadémikusi világból való kilépésüket. – Nem vagyok hajlandó azon törni a fejem.

a káoszelmélete pedig sekélyes. Évszázadok óta rendre meg is oldjuk őket. A gép szárnyalt az éjszakai égen. akkor sem tudnánk megjósolni. Az az új elmélet. hogy minden véletlen és kiszámíthatatlan? – kérdezte Gennaro. – Annak a tanácsadói véleménynek a másolatát. Nem volt nehéz elképzelni. de ott segítek. ami turbulenciával. amelyek semmiféle nehézségeket nem jelentenek a matematikusok számára. egy bizonyos szélsebességgel és egy bizonyos nedvességgel indítok. mint a kerengő bolygók. Egy pillangó meglebegteti a szárnyát Pekingben. egy bizonyos sebességgel és egy bizonyos hajlásszögben. A káoszelmélet eredetileg azokból a kísérletekből nőtt ki. Olyasmikre gondolok. Ez a nonlineáris dinamika. – Erről van szó? – Nem – felelte Malcolm. Elkezd eltérni tőle. – Úgy van – mondta Malcolm. bonyolult rendszer. – Ez a lineáris dinamika. széllel és nedvességgel. amelyet annak idején készítettem az InGen-nek. – Rendben. amelyek során az 1960-as években számítógépekkel próbálták meg modellezni az időjárást. – Na jó! – sóhajtott Malcolm. Grant tisztában volt vele. – Idáig értem – mondta Gennaro. – Ha azonban van egy másfajta rendszerem. – Akkor menjünk vissza a legelejére. amelynek a segítségével oly sok . A rendszer kényesen érzékeny a kezdeti feltételekre: az egészen apró különbségek felerősödnek. Átlapozta a tanulmányt. – Nem tudná ezt esetleg emberi nyelven is elmagyarázni? – Dehogynem – mondta Malcolm. a holdra tartó űrhajók. Most meg hová megy? – Telefonálnom kell! – morogta Hammond. Ezeket le lehet írni úgynevezett lineáris egyenletekkel. amely leírja őket. örvényléssel kapcsolatos. A vér folyása a szíven át. sebessége és szöge. hogy sokak számára a modora bántó. hogy Hammond szigetének csődöt kell mondania? – Pontosan. Ezeket nehéz megoldani – sőt általában nem is tudjuk megoldani őket. a dolgozatom legalább addig is ad egy kis munkát maguknak. Ezért hát nem is tudtuk megjósolni az időjárást. Amit azonban az első kutatók mégiscsak megtanultak a számítógépes modellekből. Az időjárás. Könnyen megoldhatók. – Vagyis a káosz abban áll. – A káoszelmélet miatt? – Pontosan.– Elhoztam az eredeti tanulmányom másolatát maguknak – mondta. A vízköpőből kiömlő víz. hogy a rendszer viselkedése igen érzékenyen függ a kezdeti feltételektől. Például bármi. de az egyenletekre éppen hogy csak rápillantott. – Hát az idegen attraktorok? – Azt sem. és New Yorkban megváltozik az időjárás. A repülőgép szárnya fölött áthaladó levegő. Gennaro szólalt meg: – A tanulmányának tehát az a végkövetkeztetése. amellyel a fizika nehezen boldogul. – Már nem tudom követni – szólt közbe Gennaro. – De hol is kezdjük? Tudja. – Ha mást nem. Illetve még pontosabban a rendszernek a fázistérben való viselkedése miatt. amelynek majdnem azonos a súlya. mi az a nonlineáris egyenlet? – Nem. A tárgyak szabályszerű mozgására. mint az első. – Csakhogy van másfajta viselkedés is. Körülbelül tíz évvel ezelőttig. rövid kifejezés minderre a „pillangóeffektus”. Az időjárás egyetlen hatalmas. – Azt hiszem. az úgynevezett káoszelmélet. hogy még ha meg is értenénk. – A fizika nagy eredményeket ért el bizonyos viselkedésfajták leírása terén. – Jó. Ha fogok egy ágyút és kilövök belőle egy bizonyos súlyú lövedéket. és igen hamar nagyon más lesz! Zivatarok lesznek napsütés helyett. hogy a matematikai rész egy kicsit bonyolult. – Valójában a rendszer viselkedésének komplex változatosságán belül rejtett szabályszerűségeket találunk. az az volt. Ennek pedig az az oka. – Szünetet tartott. Az időjárás előrejelzése teljességgel lehetetlen. Lehet. – Végül is hosszú az út – szólt Malcolm a többiekhez. bonyolult rendszernek a működése mindig is érthetetlen maradt a számunkra. kezdem érteni – mondta Gennaro. Turbulens dolgokat nonlineáris egyenletekkel lehet leírni. aztán kilövök egy másik lövedéket. az ingák. Gennaro félrelökte a tanulmányt. hogy Malcolmnak bőven van ellensége. Ennek a hatalmas. amelyet egy bizonyos hőmérséklettel. gördülő golyók és a többi. akkor mi fog történni? – A két lövedék nagyjából ugyanazon a helyen fog célba érni. és a szomszéd kabinba ment. a második rendszer nem fog nagyjából ugyanúgy viselkedni. – A leggyakrabban használt. például az időjárás. és felnézett a mennyezetre. Ezért a fizika sosem értette meg az eseményeknek ezt az egész csoportját. Ezért válhatott a káosz olyan tágabb elméletté. aztán pedig megismétlem majdnem ugyanazzal a hőmérséklettel. nevezetesen a Föld atmoszférájának kölcsönhatása a földfelszínnel és a nappal.

Egyfajta rendet találunk a mélyén. miért olyan biztos abban. továbbá ki tudjuk számítani a szögeket. hogy ez a nagyon egyszerű rendszer – az asztal meg a biliárdgolyó – kiszámíthatatlanul viselkedik. de eljutunk oda is. hogy Hammond szigete csődöt mond. ha mielőtt ítéletet mond. már megint? – kiáltott fel Gennaro. Hátradőlt az ülésen. amely hamarosan kiszámíthatatlan módon kezd majd működni. hogyne! – mondta Malcolm. meg tudjuk jósolni a golyó jövőbeni viselkedését. Tudniillik szinte azonnal elkezdik éreztetni hatásukat az egészen kicsiny tényezők: a labda felszínének apró egyenetlenségei. Elméletileg ez igen egyszerű rendszer. – Csakhogy a valóságban – folytatta Malcolm – kiderül. látná is a szigetet. – Baj van azzal a szigettel! Egyetlen katasztrófa az egész.. – Halálbiztos. egy-két pici mélyedés az asztalban és így tovább. Sőt voltaképpen tökéletesen fölösleges. Mivel ismerjük a labdának átadott erőt és a labda tömegét. – És maga mindezt azért tudja. Elméletben az egészen távoli jövőig ki tudjuk számítani a golyó viselkedését.. És a lehető legrövidebb időn belül felborítják az ember gondos számításait. és az elkezd visszapattogni az asztal oldalairól. azt. – És most jön Hammond terve – folytatta Malcolm. Vagyis minden olyan rendszer. hogy minden komplex rendszerben – az olyanokban. – Nézze. mondjuk. Elméletben. Az első. majdhogynem newtoni. ahogy az egyik oldalról a másikig pattog. – Az is egy látszólag egyszerű rendszer – állatok.minden tanulmányozható a tőzsdétől a tömegzavargásig vagy az epilepsziás roham alatti agyhullámokig. – És maga biztos az elméletében. mert. – De nem volna mégis jobb. A káoszelmélet két dolgot állít. amelyben zűrzavar és kiszámíthatatlanság uralkodik. – Értem. Az elméletből egyenesen következik. – Megértem magát – mondta Malcolm –. Vegyük például a biliárdgolyót. – De mi ez az alapvető rend? – Lényegében a rendszer fázistérben való mozgása jellemzi – felelte Malcolm. azazhogy az egyszerű rendszerek is viselkedhetnek komplex módon. Vagyis kiderül. hogy a sziget igen rövid idő múlva előre nem látható módon kezd el viselkedni. hogy bekövetkezzék. A második ennek épp a fordítottja. az elméletből – mondta Malcolm. amelyekben a falakhoz ütődik. Érti? – Értem – mondta Gennaro. Meglökünk egy biliárdgolyót. – Rendben – bólintott Gennaro. – Ó. hogy mit is hozott létre Hammond valójában? – Nem. engem csak az érdekel. A részleteknek nincs jelentősége. . állatkerti környezetben –. hogy legfeljebb egy-két másodpercre tudjuk előre meghatározni a jövőt. hogy hol lesz három óra múlva. – Igen. – Jézus Mária. amely csak arra vár. mint az időjárás – van egy alapvető rend. Meg lehet jósolni.

Egyre alacsonyabban szálltak a víz fölött. Kapaszkodjanak. s a helikopter robogó árnyát figyelte. folyton csokoládét rágcsált. amint ki-kinyúlnak a ködből. de jól látszottak a csipkés szirtfokok és a csapkodó tenger hullámai. Még mindig közel voltak a fák. Amint odaérünk. hat-hétszáz méterrel magasodtak a tenger fölé. hölgyeim és uraim! – A helikopter gyorsan ereszkedett. Grant a szemét meregette. – Általában nem ilyen sűrű – nyugtatta Hammond.. de a világon semmit sem látott. . és legszélesebb pontjánál öt kilométer széles. vulkanikus sziklatömb. – A vulkáni eredet nyomai az egész szigeten megtalálhatók – mondta. Ennek a legnagyobb része az elmúlt tíz évben ment végbe. – Már csak egypár perc – mondta Hammond –. a fenyőerdőre nézett. Összterülete közel hatvan négyzetkilométer. Ez és az uralkodó áramlatok az oka annak. A hegyek túloldalán ismét átlépték a felhőréteget. – Persze sokkal nagyobb – jegyezte meg Hammond. hogy a szigeten lévő számítógépekkel van dolga. A pilóta tekintete bal felé pásztázott. hogy. mint Közép-Amerika többi országában – magyarázta Hammond –. Grantot meglepte az erdőpusztulás nagysága. a keze ragacsos volt tőle. – A pilóta egyenesen a nyílt óceánnak vette az irányt. Nyugatnak. de már itt is vagyunk! Robogott velük a helikopter.. Grant hallotta a recsegést a fülhallgatójában. egy Dennis Nedry nevű férfit.. tovább a part mentén. Elmagyarázta. hogy maga is nyugtalan. amint a pilóta a toronnyal beszél. – Bahía Anasco – mondta a pilóta. A hegytetőket köd borította. hogy találkozzék velük. aztán a felhők szaggatott foltjain át kijutottak a napfényre. aztán jobbra. – Úgy negyven perc lesz az út – hallatszott Hammond hangja valamelyik hátsó ülésből. San Joséban felvettek még egy utast. A sziget látványa szinte misztikus volt. Az alacsony dombok felmagasodtak Grant szeme előtt. A legnagyobb magánállatkert Észak. és a sziget északi vége felé vette az útját. – Több helyen gőzjáratok is vannak. ezúttal lefelé ereszkedve. majd meglátják. egyiket a másik után. Az erdő borította hegyoldalakat zöld köd koszorúzta. amint lába alatt eltávolodik a talaj. mert megzavarja az állatokat. és senkinek sem nyújtott kezet. – Tizenhárom kilométer hosszú.ISLA NUBLAR A motor felbőgött. és meglátjuk Isla Nublart. Grant ismétlődő elektronikus sípjelet hallott a fülhallgatóban. de nem kapott választ. csipkézett szigetet pillantott meg. de a hangján hallatszott. és lompos.. hogy Isla Nublar ködös területen fekszik. és máris sűrű köd vette körül őket. – Úristen! Tiszta Alcatraz! – szólt Malcolm. szélkoptatta dombokat látott mindenütt. – Hogy a jó istenben csinálja ezt? – kérdezte Malcolm. – Arra fenn. – Nem örülök neki. ott láthatják a Cabo Blancó-i természetvédelmi területet. Néha viszont nagyon izgalmas. Motyogott valamit. Némelyik ág egészen közel volt. Elhúztak egy kis part menti falucska fölött. az ingére alufóliadarabkák tapadtak. mégis nagymérvű a defolsztáció. az erdőpusztítás. és forró a talaj az ember lába alatt. Grant sziklás. majd mélykékké.és KözépAmerikában. Aztán egyszerre csak halványan kirajzolódtak a fenyőfák zöld ágai. hogy lásson valamit a sűrű ködön át. A helikopter emelkedni kezdett. hektárszám. amely meredeken emelkedett ki előttük az óceánból. Gyönyörű partszakaszok vannak arrafelé. a szárnyak forogni kezdtek odafönn. Grant a plexiüveg buborékon át nézte. aki odarepült. – Halászfalu. A víz zölddé vált alattuk. pörgő árnyakat vetve a San José-i repülőtér betonjára. A pilóta hangja félbeszakította: – Megkezdjük a leszállást. Reggel tíz óra lehetett. Kövér volt. – Sajnos magán a szigeten kell leszállnunk – mondta Hammond. zord. hogy Isla Nublar voltaképpen nem is igazi sziget. Lecsupaszított. inkább tengeri hegy. A helikopter gyorsan süllyedt. – Jézus! – nyögte Malcolm. Hegyes-völgyes sziklás volt alattuk a táj. – Észak felé mutatott. amely kiemelkedik az óceánból. és átrepült a hegyek fölött. és Grant megpillantotta a nyugati part szegélyét. ahogy. a hegyek felé tartottak. A hegyek a sziget csúcsánál emelkedtek a legmagasabbra. – Costa Ricában jobban működik a népességszabályozás. A napfény visszatükröződött a víz felszínéről. A gép emelkedett.

mint az Olympic-félsziget. A sziget legnagyobb része trópusi. Kitárta az ajtót. mindenkit! Csak óvatosan. kérem! Keskeny. fluoreszkáló keresztet pillantott meg a lába alatt a plexiüvegen át. mint a Csendes-óceán északnyugati partvidéke Észak-Amerikában. a „szélborotva” miatt. kanyargós ösvény vezetett le a dombról. Grant meglepődött. Grant felsóhajtott. Lejjebb érve teljesen kikerültek a ködből. Óriás. és így már egész kiterjedésében láthatták a szigetet. mintegy megbúva a növényzet sűrűjében. és Grant most már jobban látta a tájat. és kicsatolta a biztonsági övet. Meglehetősen eltér a szárazföldi vegetációtól. Nagy kiterjedésű. Baseballsapkát viselt. Egy kicsit olyan volt. Grant lenézett. A rotorok zaja halkult. no de az a lényeg. . Hűvös és nyirkos volt a levegő. A kereszt sarkainál erős lámpák villogtak. amely déli irányban messzire nyúlt. Grant a pilótát nézte. Ez azonban csak mikroklíma. – Az elsődleges ökológiai környezet itt a lombhullató esőerdő. Ez néha nagyon veszélyes ezen a csúcson. hogy megérkeztünk! Biztos talaj van a lábunk alatt. – Hello! – mondta vígan.. majd elhalt. Az építkezés bonyolultabb volt. amely a magaslatokon ilyen. fehér épületek tetejét látták odalenn. – Helyesen látja – mondta Ed Regis..A sípjel hangosodott. Egy férfi szaladt a helikopter felé. amely alól kikandikáltak vörös hajfürtjei. Az erősen koncentrált. az északi dombok lejtőin. aztán a gép egy huppanással máris a leszállóhelyen ült. és. A pilóta egy kicsit igazított az irányon. – Ha így jövünk. gyorsan kell leszállni az egymás fölötti ellentétes irányból mozgó széláramlatok. egyre vékonyodott a köd körülöttük. mint gondolta. amely inkább klasszikus esőerdő. Ahogyan lefelé haladtak. – Ed Regis a nevem! Isten hozta önöket Isla Nublaron.

Grant felnevetett. hogy választ adjon a tudományterületét régóta foglalkoztató kérdésekre. hogy a sziget biztonságos legyen. – Uramisten! – mondta megint Ellie. szürke nyakakat. Regist. amikor az ötödik és hatodik nyak is a pálmafák fölé nyúlt. Szédült. Abban a pillanatban újabb fej emelkedett a növényzet fölé. kövessék Mr. hogy valaha is látni fogja életében. Atyavilág. aztán a többiek is beszálltak a kórusba.. – Valami baj van? Grant a fejét rázta. szólni sem tudott a megdöbbenéstől. – Mi az? – kérdezte Hammond nyugtalanul. válaszolok rá. És most. És gyors.. aki a legközelebbi épületek felé indult. Hiszen olyasvalamit látott. közepes nagyságú ősgyíkfajta tagjai. úgy hallgatta egy percig. – De hát életszerűnek is kell lenniük. Ugyanolyan jóindulatú. Gennarónak a szava is elakadt. később délután pedig a parkba visszük magukat. és tágra nyílt szemmel bámulta a pálmafák fölé magasló. mire számítson – évek óta erre várt –. és akkor ha van még kérdésük. ívelt. Az új genetikai technológia elképesztő hatalma. Döbbent agyában szinte önmaguktól megindultak a tudományos asszociációk: észak-amerikai növényevők. de valahogy a lelke mélyén mégsem hitte.. az. csúf. Ennek a hosszú nyakú állatnak azonban szinte légiesen kecses és egyben méltóságteljes volt minden mozdulata. ez jól látszott – túlontúl is gyorsan mozogtak. És most mégis itt van! A ködben mozgó állatok tökéletes apatosaurusok voltak. Grant szinte bénultan állt. Grant csak állt a domboldali ösvényen. ez a hatalom most vált teljesen világossá a számára. amiről korábban azt tartotta: nem más. – Nyilván szeretnék tudni. Túlméretezett zsiráfokra emlékeztették Grantot. Az őshüllő éber érdeklődéssel pislantott le rájuk. Nemrégiben Berman és McIntosh a koponya külső jegyei alapján új osztályba sorolta őket. – Uramisten! „A dinoszaurusz szép!” – ez volt az első gondolata. D. Ezek az állatok azonban – bár nem voltak vízben. Még mindig nevetett. mint diplodocusokat. A csoport Ed Regis nyomába szegődött. 1876-ban.. amiről elképzelni sem tudta. Istenhez imádkozott. kissé bugyuta volt a tekintetük. és elindult lefelé a lejtőn. – Ha jól feltételezem. Az ösvény fölött kézzel írt ákombákomokkal a következő felirat állt: „Isten hozta! Üdvözöljük önt a Juraparkban!” . – Üdvözölnek bennünket a szigeten. Coloradóban és Oklahomában. amely segített nagy testtömegének fenntartásában. hogy a saját szemével látta. Mindannyian a fák fölé magasló állatot bámulták. Fejük és nyakuk igen aktívan vándorolt ide-oda a pálmafák fölött – meglepően aktívan. – Ez a hívó szavuk – szólt Ed Regis. élő dinoszauruszok! Valódibbak már nem is lehetnének! Gennarónak ez járt a fejében: „Egy vagyont fogunk keresni ezzel a szigettel. Montanában. Semmi esetlenség vagy bizonytalanság nem volt a viselkedésében. mintha csak túl meredeken futna lefelé a lába alatt az út. Először csak egy állat hallatta. hogy bejárhassák az összes létesítményt. hogy mi olyan vicces: az. Ő mindvégig tudta. A vacsoránál találkozunk újra. késő jurakori szint. de máris kezdi elfogadni – és azonnal arra használja friss megfigyeléseit. hogy alig néhány másodperce látja az állatot. A Morrison-féle formációs rétegekhez kapcsolódó példányok kerültek elő Utahban. majdnem mint egy elefánt. kövér és esetlen lényekként ábrázolták őket. Az őshüllők nézték. túlpörgetett. – Azok bizony – mondta Hammond. most pedig.A FOGADTATÁS – Te jóságos Úristen! – szólalt meg halkan Ellie. nem? Újra hallották a trombitáló hangot a távolból. Cope. majd harmadik. aztán egy negyedik. lelkesítő szöveg. Közhasználatú nevükön „brontosaurusok”. Első felfedezés: E. hogyan tovább – szólalt meg Hammond. A könyvek túl nagyra nőtt. Hagyományos vélemény szerint a brontosaurus idejének nagy részét sekély vízben töltötte. – Úgy szerveztük. Végül is nem magyarázhatta meg. és csak nevetett tovább. ahogy az emberek megérkeznek. hogy be is következik mindez. kérem. mint reklám. Egy vagyont!” Őszintén reménykedett. dinoszauruszt nézni. Alig kapott levegőt. mekkorák ezek az állatok! Óriásiak! Mint egy ház! És annyi van! Valódi. és mély trombitáló hangot hallatott. – Igen életszerűek. az arca csupa pára. ezek nem animatronikus modellek – mondta Malcolm.

egyre tisztábban jelennek meg a részletek.HARMADIK ISMÉTLŐDÉS Ahogy a fraktális görbét újra rajzoljuk. IAN MALCOLM .

a gondosan kialakított növényi környezet mindenütt azt sugallta. Már nem látták a dinoszauruszokat. Százötven éve.” Továbbmentek az ösvényen. hogy most a valóságot maguk mögött hagyva egy új világba lépnek be. Ezután az anyagcsere vizsgálata következett. az emberi faj története dióhéjban: „Sokan úgy gondolták. A klasszikus dedukció logikai módszerével több bizonyítékból vonták le új következtetéseiket. – De szeretném közelről is látni őket. és – szemben a csúszómászókkal – felnevelték kicsinyeiket. Azok voltak a legjobb paleontológusok. hogy egy-két másodpercnél tovább a hátsó lábukon maradjanak. A gyíkoknak nincs elég energiájuk. a kutatási tanulmányok.A JURAPARK Beléptek a pálmák magasban összeboruló. a földben hagyott. mindez nincs többé. zöld alagútjába. Az emlős az anyagcsere révén képes testhőmérsékletté alakítani az elfogyasztott ételt. – Gondolom. hogy a fogaikat is lássam. hideg vérű hüllők voltak. hogy melegen maradjanak. amelyekből arra a véleményre jutottak. fosszilis lábnyomokat. az őskori trópusok világába. ez egy kissé megváltoztatja a maga tudományterületét. A kongresszusokon még mindig akadtak kollégák. De az tény. az egyetemi laboratóriumok a csonttálakkal. arra utaltak. Tizenöt éven át dúlt a vita a melegvérűség fölött. Csak nem ilyen hamar. Vagyis a dinoszauruszok testtartása melegvérűségre utal. amely szerint a dinoszauruszok lassú mozgású. amelyben Grant kulcsszerepet játszott. – Igen – mondta Grant. Sokan úgy gondolták. Ráadásul az északi sarkkörön túl is találtak dinoszauruszmaradványokat. mely a látogatói főépülethez vezetett. amely a megkövült csontokban és a rég kihalt óriások nyomdokaiban kereste a támpontokat. A dinoszauruszok azonban valószínűleg nem ezt tették. meleg vérűek voltak-e a dinoszauruszok. Végül a csoportos élettel kapcsolatos tanulmányok. Addig nem lehetek egészen biztos a dolgomban. a dinoszauruszokkal kapcsolatos tudományos vizsgálatok főként következtetésekből álltak. Amerre csak a szem ellátott. hogy fölnyomja a vért a brachiosaurus hat méter hosszú nyakán át a fejéig. amely ahhoz volt szükséges. melyek az élethez szükséges hőmennyiséget a környezettől vonják el. – Egész jól néznek ki – szólt Ellie Granthoz. Oda az egész – a múzeumi termek az óriás csontvázakkal és a köréjük sereglő iskolás gyerekekkel. hogy erre csak egy négykamrás. – Íme. – Nem látszik elkeseredettnek – jegyezte meg Malcolm. – Nem is vagyok. és sok közülük felegyenesedve a hátsó lábán járt. A teknősök elhagyják a tojásaikat. Most azonban. akik a legügyesebben tudtak következtetni. Grant megrázta a fejét. Vége a dinoszauruszok paleontológiái vizsgálatának. Szeretném felemelni a lábujjuk begyét. de a hangjuk még hallatszott. azazhogy a dinoszauruszok gyors mozgású. előbb-utóbb bekövetkezik. a tudományos folyóiratok –. Kikalkulálták a nyomást. megvizsgálni a karmukat. egyszerűen nem vág össze az ásatási eredményekkel. amelyben a hüllők fennmaradása elképzelhetetlen. Malcolm felnevetett. amennyiben a dinoszauruszok klónozhatók – nos. megtapintani a bőrüket. amióta csak az első óriás állatcsontokat felfedezték Európában. Vizsgálták a járást is. hogy jól néznek ki. akkor Grant kutatási területe egyszeriben átalakul. a hüllő nem. amiből az a következtetés adódott. A jelenleg élő állatfajok között felegyenesedett testtartás csak a meleg vérű emlősöknél és a madaraknál fordul elő. – Ez mindent megváltoztat. A paleontológián belül minden nagy vita ezen a módon folyt. amelyek a talaj közvetlen közelében kúsznak. meleg vérű szív lehetett képes. Az első a testtartás volt. Már egy ideje folynak a viták erről. s amely a körül zajlott. akár az ember. . élénk állatok voltak. de a gyűlölködés nehezen múlt el. Ezzel szemben a dinoszauruszok egyenes lábon álltak. köztük az a haragos összecsapás is. hogy a dinoszauruszok olyan gyorsan futottak. Csak nem ilyen hamar. a Yale Egyetem tanáraival az élen – gyanítani kezdte. olyan hideg környezetben. Ez a mozgékonyság megint csak meleg vérre utal. A paleontológia lényegében egyfajta detektívmunka volt. Grant a fejét ingatta. amelyek legnagyobbrészt éppen Grant munkáján alapultak. akik nem álltak szóba egymással. hogy az a felfogás. hogy a dinoszauruszok összetett társadalmi életet éltek. A gyíkok és hüllők rövid. előbb-utóbb bekövetkezik. kinyitni a szájukat. hajlott lábú csúszómászók. a hideg vérű állatokéba. míg végül általánosan elfogadták az új látásmódot. A tudósok mindaddig a hüllők osztályába sorolták be a dinoszauruszokat. Egy idő után azonban néhány kutató – főként John Ostrommal és Robert Bakkerrel.

akkor annak a DNS-éhez hozzájuthattak volna. Grant lakosztályában a világosbarna szín uralkodott. amely vízesésként csordult túl. harcolnak a fényért. Aki azt hiszi. amelyekkel kommunikálnak. A növény Serenna veriformans volt. Az ember a vonzó zöld levelek puszta érintésétől is rosszul lehet. amire eddig nem gondoltunk – mondta erre Grant. amelyet Ellie mindig roppant izgalmasnak látott. Mint amikor van egy fénymásolónk. nehogy versenytársaik kinőhessenek. A szoba még nem volt teljesen kész: a szekrényben egymásra rakott lécek tornyosultak. csatorna: Triceratops-terep 4. a fosszilizáció pedig nagyrészt elpusztította és szervetlen anyagokkal helyettesítette be a DNS-t. annak nyilvánvalóan sejtelme sem volt róla. amitől ehetetlenné lesz – és ugyanezt teszi minden duglászfenyő az erdőben. hogy belehal. a tetején kártya. másokat mérgekkel. hogy a természet abból áll. ma azonban közönségesen csak Brazília és Kolumbia nedves árterületein fordul elő. mozognak. Igen. Fagyott vagy mumifikálódott DNS-t azonban mindeddig senki sem talált. megint másokat táplálnak. szinte biztos. sőt bizonyos szempontokból még gyilkosabb harcban. olyan vegyi anyagot termel ki. már önmagában is arra utalt. Vannak terpének. – Hát nem csodás? – ismételte Ed Regis. dinamikus folyamat ez. De tudta. míg itt vannak nálunk a Juraparkban. mert ezek segítik a szaporodásukat. táplálkoznak. A probléma az volt. csatorna: Hypsilophodont-felföld 3. Ellie szólalt meg: – Igazi dinoszauruszokat nem lehet reprodukálni. mint amilyennek képzelték magukat. csak éppen nincs mit lemásolni vele. Igen gyakori a több mint kétszáz millió éves kövületekben. és állandó kölcsönhatásban vannak az állatokkal: egyeseket kérgekkel és tüskékkel tartanak távol maguktól. Soha eszükbe sem jut.– Az egyetlen kérdésem csak az. rettenetesen téved. alacsony épületet látott. ha növényekről van szó! – gondolta magában Ellie – Puszta küllemük alapján választják ki őket. Egy kerítésen túl fürdőmedencéhez értek. hogy a veriformans spórái egy halálosan mérgező béta-karbolin alkaloidát tartalmaznak. hogy valaki halált okozó páfrányokat telepített az úszómedence köré. hogy közelebbről is megvizsgálja a páfrányokat. Ugyanis valódi jurakori páfrányokat látnak! Ellie megállt. a fürdőszobában villanydróttekercs hevert a földön. A puszta tény azonban. Ha egy duglászfenyőt bogarak támadnak meg. – Hacsak nincs valami olyan módja. amelyet a növények kifejlesztettek. Összetett. amelyet mumifikált a sivatagi környezet. ragadozók (és a gyermekek) számára. honnan szedték a DNS-t? – kérdezte Grant. csatorna: Húsevők földje . Persze ha fagyott vagy tőzegmocsárban fennmaradt dinoszauruszt találtak volna.” Ellie azonban jól tudta. de csak azért. amelyekkel a növények megmérgezik a talajt maguk körül. hogy esetleg lehetségessé válhat egy-egy régen kihalt állatfaj – mint például a dinoszaurusz – újraklónozása. még annak legtávolabbi részén is. – Hát nem csodás? – kérdezte Ed Regis. Csakhogy az aki úgy döntött. hogy a legtöbb embernek fogalma sincs minderről. hogy minden ismert dinoszaurusz kövület volt. Ez reakcióként megy végbe. alkaloidák. – Nézzenek előre! Ott a mi Szafarikastélyunk! – Ellie látványos. hajlanak és tekerednek. ürítenek. hogy ezzel a páfrányfajtával díszíti a fürdőmedencét. amelyet a megrohamozott fa választ ki magából. Regis igazat mondott. A Serenna veriformans mérge csupán egyetlen kisebb példája annak a sokoldalúan kimunkált vegyi fegyvertárnak. – Fogalmam sincs – felelte Grant. „Milyen naivak az emberek. különösen párás napokon. A klónozás tehát lehetetlen volt. Londonban és Tokióban afelől. hogy a növények voltaképpen élőlények. széthordják magvaikat és virágporukat. amelyek ehetetlenné teszik őket a rovarok. szaporodnak – és védekeznek. a nádfonatú bútorokat zöld őserdői mintás huzat díszítette. Hatalmas páfrányokkal volt beültetve az egész terület. A toxin ötvenszer mérgezőbb az oleandernél. és buzgón végzik az összes életfunkciót: lélegeznek. hogy a földtörténet során a növények éppoly kemény versengésben fejlődtek ki. Az a zöld háttér csupa élet. hogy a Jurapark tervezői korántsem voltak olyan gondosak. A sarokban televíziókészülék állt. mert nem tudunk igazi dinoszaurusz-DNS-hez jutni. – Ezek a növények. Nem volt miből klónozni. csatorna: Sauropodák ingoványa 5. hogy igazi őskori atmoszféra alakuljon ki. Használhatatlan volt az egész modern génsebészeti technológia. amelynek tetejéből egy sor üvegpiramis magasodott ki. melyen ez volt olvasható: 2. vagy olyat. – Ott fognak lakni. Grant tudott róla. válaszul arra az alleokemikáliára. nagyban hozzájárulnak ahhoz. A növények nőnek. hogy az állatok valamiféle zöld háttér előtt mozognak. és leömölve kisebb sziklamedencéket alkotott. mint az állatok. – Például mi? – kérdezte Ellie. ha pedig egy gyerek egy keveset a szájába töm. és vannak feromonok. már amennyiben hozzá lehet jutni a szükséges dinoszaurusz-DNS-hez. mint a képeket a falra. hogy komoly spekuláció folyik Berkeley-ben.

bement a hálószobába. Látta a kastély tervrajzait. és acélkeretbe helyezték. Fekete acélkeretet szerkesztettek az üvegfalon kívülre. de az csak sistergett. képet nem adott. és az ágyra hajította táskáját. de nem emlékezett rá. így árnyékcsíkok hullottak az ágyra. csatorna: Velociraptorok völgye 8. – A lány körüljárta a szobát. Pontosan az ágy felett nagy. Átment a hálószobából a nappaliba. de semmiféle szépítő igyekezet nem tudta eltakarni a fém vastagságát és háromméteres magasságát. csatorna: Stegosaurusok délvidéke 7. – Úgy emlékszem. Sátorszerű érzést keltett. Grant megállt egy pillanatra. – Kicsik az ablakok – mondta. Az ablakok az úszómedencére néztek. Sajnos azonban az üveget erős rácsok védték. Ennek nem kellene okvetlenül így lennie.6. amikor bejöttünk? Grant bólintott. Hát a kerítést megfigyelted-e. piramis formájú üvegtető volt. . csatorna: Pterosaurusok hegye Kellemkedően mesterkéltnek érezte ezeket a neveket. Látszott is nyers. ez a kerítés sem szerepelt a terven – szólt Ellie. oda nem illő kidolgozásukon. – De meg ám! Szerintem is. – Mintha csak erődöt csináltak volna ebből az épületből. Mutatósra tervezték és feketére festették. ahhoz voltak hegesztve a rácsok. Egyébként nem tűnt fel neked semmi. hogy rácsok lettek volna az üvegtetőn. – Az üveg edzett. Az ajtók is acélborításúak. hogy kovácsoltvasszerű legyen. hogy utólag kerültek a helyükre. Grant az órájára pillantott. mintha a csillagos ég alatt aludna az ember. „Rejtély!” – gondolta Grant. – Csak úgy mellesleg: azok a páfrányok mérgezőek. Alan? Már ami a szobákat illeti. Ellie lépett a szobába. Kikapcsolta. Bekapcsolta a készüléket. – Megváltoztatták a tervet. – Hát ennek az okát biztosan megkérdezzük majd – mondta. Az egész kastélyt hüvelyknyi vastag acélrácsokból készült kerítés vette körül. – Húsz perc múlva indul a szigetnéző túra.

öregeket is. és mindenfajta adatot pontosan számon tart. Grant felfedezése. márciusban kiugrik. amint azt bizonyára már mindannyian felismerték. mielőtt távozunk. amelyen ez állt: AMIKOR DINOSZAURUSZOK URALTÁK A FÖLDET. aki dinoszauruszként azonosított egy korábban ismeretlen állatot. Ezek a gyíkharapások szórványosan jelentkeztek a part menti falvakban. high-tech építészeti stílus” – állapította meg magában Grant. idegenforgalmi látványosságot nyújtva. amely egy New York-i laboratóriumban van. hogy magát a valóságos töredéket. hozzáteszem. Március múltán már nem érkezett jelentés gyíkharapásról. – Biztos vagyok benne. és onnan szólt Granthoz. Grant doktor. Ezt a dinoszauruszt csak egy töredékből ismerjük. Májustól kezdve azonban szinte mindvégig magas. a kérdésem egyszerű. mely a Costa Rica-i parton került elő. amely szintén bizonyíték lehet. a keze összefonva a mellén. Ismaloyától Puntarenasig. és kellő biztosítást nyújt-e a tekintetben. így önök közvetlenül is megvizsgálhatják majd. ez egy olyan sziget. Ez emeletes volt. hogy a lehető legjobb benyomást keltsék. látható vasbeton szerkezettel és fémgerendákkal. Márciustól kezdve olyan jelentéseket kaptak. Ez fenyegető tartásban helyezkedett egy kiállítási terület bejáratánál. légi úton ideszállítsák. A hangja enyhén visszhangzott a teremben. szeretném összefoglalni. – Két olyan tény van. Kis előadóterem volt benne. később bővebb részleteket is előadhat. – Egy: a csecsemőhalandóság január és február hónapokban alacsony. Hammond hátul ült.AMIKOR DINOSZAURUSZOK URALTÁK A FÖLDET A látogatóépületben jöttek össze. – Hamarosan bejárjuk a létesítményeket – mondta Gennaro. amit el kell döntenünk. majd áprilisban ismét alacsony. miért is vagyunk itt. akik mélyen aludtak. Ez év júliusában találták. Kissé távolabb más kiállítóvitrinek álltak: MI AZ A DINOSZAURUSZ? és A MEZOZOIKUM VILÁGA. és mi az. De a kiállítás még nem volt készen. Gennaro felmászott a színpadra. egészen júliusig. csupa üveg. Ez a látványosság még nem nyílt meg a turisták előtt. Rendelkezésemre bocsátották viszont a következő grafikont. melyek szerint egyes csecsemőket gyíkok haraptak meg a bölcsőjükben – sőt. „A legutolsó. hogy Mr. ha óhajtja. Ellie-hez és Malcolmhoz. – Nos. de egy éven belül megnyílik. ahol génsebészeti úton előállított dinoszauruszok természetes parkszerű környezetben mozoghatnak. amelyet a Közegészségügyi Szolgálat készített a csecsemőhalandóság alakulásáról a part menti településeken az év folyamán: – Hadd hívjam fel a figyelmüket e grafikon két jellegzetességére – mondta Gennaro. amit meg kell tudnom. szabadon. miután állítólag megharapott egy amerikai kislányt a parton. hogy a dinoszauruszok nem juthatnak ki innen? Gennaro leoltotta a lámpákat a teremben. – Costa Ricában kitűnő a közegészségügyi szolgálat. Az első dr. Hammond és munkatársai úgy fognak bemutatni mindent. Biztonságos-e a sziget? Biztonságos-e a látogatók számára. Közben egy második tény is a tudomásunkra jutott. mindenütt drótok és kábelek borították a padlót. Intézkedtem. Lényegét tekintve. Ebben a hónapban szenvedte el a harapást az amerikai kislány . Mielőtt azonban nekiindulnánk. amelyet egy Tyrannosaurus rex-robot uralt. amellyel foglalkoznunk kell.

– Az állatkertek nem reprodukálják a természetet – mondta Malcolm. – Igen. biztosan tudom. – Megtakaríthatunk magunknak egy csomó időt – szólt közbe Malcolm. A másik dolog.. – Én máris megmagyarázom magának az egészet. Én pedig ehhez hasonló módon. De ennek a parknak nem az állatkert a mintája. ha értem! – Pedig roppant egyszerű. Az itt tartott állatok sohasem keveredhetnek a Föld nagyobb ökoszisztémájával. mit beszél. Annyira önmagáért beszél matematikailag. De ha jobban megnyitják. Úgyis tudná. amely arra utal. hogy valami más jelenség. csepp. – Valószínű. akkor váltakozva kapnak nagy és kis cseppeket. ez a jele. folyamatosan kezd csepegni: csepp. de tudniuk kell. amit maguk itt létre akarnak hozni. – Nem is szöktek soha! – morogta Hammond.. csepp-csepp. Például a csapból csepegő vízre. – Beszéljünk nyíltan. izolált világot alkossanak. ahol. – Uraim. Valamire. – Hülyeség! – fakadt ki Hammond a háttérben. Én nem vagyok sem környezetvédő. – Miért? – Amiatt. hogy valamilyen tényező hatással van a csecsemőhalandóság alakulására.. Igen. hogy izolálható. – De megvalósítható. hogy nem okozhatják a szökött dinoszauruszok? – Mert ez nonlineáris jel – felelte Malcolm.. vagy abban reménykedni. és igen csekély mértékben módosítják. úgy. Az. hogy ők okozzák. csepp. Ez valami sokkal nagyobbra törekszik. az a rejtélyes. hogy állatok jutottak a szárazföldre a szigetről. Csepp-csepp. kéthetenkénti kiugrás. – Egyszerűen megvalósíthatatlan. mondjuk. – De miért nem? Tán nincsenek állatkertek. A szándék szerint ezen a szigeten a levegő kivételével – amely szabadon folyik – minden tökéletesen izolált. Elő sem kellene vennie a zsebszámológépet. hogy tereket képezzenek az állatok tartására. ami inkább valamiféle földi űrállomással rokon. hogy nem lehet így sikeresen lemásolni a természetet.. – Egy: igen valószínű. A következtetésem ezért az. Gennaro csak a fejét ingatta. hogy valami rendszeresen váltakozó jelenség hatásáról van szó. váltakozó grafikont fognak kapni. – Kettő: a Közegészségügyi Szolgálat grafikonjának szinte bizonyosan semmi köze a szökött állatokhoz. – Maga pimasz kis nyavalyás! – sziszegte Hammond. Valahogy így. egy olyan komplex rendszer. ha bármiféle új betegség kezd elterjedni egy közösségben. – Szóval ezek azok a tények. Az állatkertek fogják a már létező természetet. Azt pedig nem hiszem. Grant szólalt meg: – És ezt honnan tudja? – Figyeljék meg: a grafikon magas és alacsony pontok között ugrál – mondta Malcolm. Folyamatosan ezt tesszük! – Már elnézést – mondta erre Malcolm –. Mintha azt kérdezném magától. de ezt nem jelentik a parti falvakban működő egészségügyi dolgozók. mennyire nem értik az egészet! Hát mennyit . – Ilyen fokú izoláció egyszerűen nem lehetséges – mondta szárazon Malcolm. hogy adóval tartozik. Felállt és elhagyta a termet. hogy vannak szökött dinoszauruszok? – Ez Gennaro kérdése volt. Újra kigyulladtak a fények. Uraim! – mondta Gennaro. A turbulencia váltakozást hoz létre... Még ezek a minimális módosítások is nemegyszer csődöt mondanak. így van? – Így. máris – felelte Malcolm. A természetről alkotott képünk roppant módon leegyszerűsített. mint amilyennek hajlandók vagyunk elfogadni. sem ökológus. Ha csak egy kicsit elcsavarják a csapot. amely valójában sokkal kifinomultabb és érzékenyebb. hogy több száz szabadult volna el. – Ez sok összetett rendszerre jellemző. például egy új influenzavírus okozza a grafikonon megjelenő fluktuációt. amire felhívnám a figyelmüket. – Roppant sajnálom – vonta meg a vállát Malcolm –. Az állatok rendszeresen megszöknek. hogy kell-e adót fizetni egymilliárd dollárnyi jövedelem után. Se be. amit „természetnek” nevezünk. Próbálják ki maguk is. – De akkor miért állítja. – Máris?! – kérdezte meglepetten Gennaro. hogy egy kis örvénylés is jelentkezik. Van valamelyiküknek bármiféle. ahol szabadon kóborolnak a rég kihalt élőlények. de a tény az tény marad. – Nos. – De ugyanakkor az a véleménye. se ki nem mehet semmi. az én szempontjaim szerint ez lehetetlen vállalkozás. hogy ellenőrizze. Hogy egy olyan. És ilyen típusú. – Sok száz dinoszaurusz kellene ahhoz. ez a sziget kísérlet egy múltbeli természeti környezet újjáteremtésére. – Kutya legyek. – Jó – mondta Gennaro. de maga nem tudja. amelyekre magyarázatot keresek. Nézze. Sohasem szökhetnek ki innen. hogy nincs is mit számolni rajta.is.. és azt is elszúrjuk. A Közegészségügyi Szolgálat gyanakszik rá.

Donald! – De igen. Tizenegy év körüli.. Két gyerek jött lefelé a domboldalon Ed Regis vezetésével.vagy nyolcéves. a rotorok hangja halkult. mennyire az! – Én pedig ragaszkodom hozzá.. – Válnak a szüleik. Mindannyian követték. Gennaro halkan felnyögött. – Szia. és szinte suttogva mondta: – Uramisten! – Nyugodjon meg. majd kis távolságra Gennarótól és Hammondtól megálltak. – Ez az én szigetem – mondta Hammond –. mert a befektetőiknek súlyos aggályaik vannak. és állítjuk. A kislány kissé félszegen integetett. hogy kockára teszi az. ha el kell hallgattatnom. ha tudomásul vesz valamit. – Majd később megbeszéljük. parazitikus fertőzöttséget okoz. – Nem fog elhallgattatni. és azt hívok ide.. A hegy lábánál álltak.. – Valóban. – Jó lesz. nagypapa! – mondta. Gennaro üvöltött: – Agyalágyult vénember! Elment a maradék esze is? – Most aztán elég! Ide figyeljen! – mondta Hammond. – Elindult kifelé a teremből. jön a helikopter. hogy szörnyű veszedelmes hely. – Hát nem veszi észre.. – És be fogom bizonyítani. Attól tartunk. – Hogy mit csinált?! Kit hívott meg?! – Nyugodjon már meg! – szólt Hammond. Nem szeretnék ráijeszteni a gyerekekre. – Bármit hablatyol is az a bolond matematikus. Nyakán kiduzzadtak az erek. és tönkreteszi az egyiptomi gazdaságot. ugyan – nyugtatta Hammond. talán hét. – Az Isten verje meg! – mondta Gennaro. – A maga szigete e pillanatban komoly vizsgálat tárgya.. hogy megvizsgálhassa. és.. „Mets” feliratú baseballsapka alá gyűrte szőke haját. – Elnézést – vágott közbe Gennaro –. – Nem! – kiáltotta Gennaro. a vállán baseballkesztyű lógott zsinóron. szemüveges kisfiú volt az egyik.. és kihúzta magát. hogy rakja őket vissza a helikopterre! – kiáltotta Gennaro. hogy a segítségével felélesztjük a vidéket. – Nem lehet – mondta Hammond. Építünk egy. – Ugyan. Gennaro túlordította a helikopter zaját. – Ez a hely tökéletesen biztonságos – mondta Hammond. Grant megfordult... Ehelyett elpusztítja a termékeny Nílus-deltát. nem vesztették-e el fölötte az uralmat. jó? – szólt Hammond. – A gép már el is ment. – Megjöttünk! . csak egy vidám hétvégét akartam szerezni nekik. Alighanem a példányt hozza Grant doktornak..kell még bizonygatni? Hányszor kell rámutatni a tényekre? Megépítjük az asszuáni gátat. de úgy hallom.. – Maga vesz tudomásul valamit! Ez itt nem piknik! Nem társasági kirándulás.. a másik egy valamivel fiatalabb kislány. A két gyerek ügyesen sietett lefelé a helikopter leszállóhelye felől az úton. akit csak akarok.. – Nem igaz. Jogomban áll.

Alan Grant az egyik vezére azoknak. ha rá tudom venni a családunkat. Aztán egy kövér. amikor hirtelen ráébredt: tudja. – Azt mondja. – Azt mondtad. Alex! – Indulj te. tetőtől talpig feketében. hogy nekem is ez a bajom. – Mi volt az a könyv. nem te. A többi felnőtt meg zavarodottan. Rengeteg ásatást végzett egy Tojásdomb nevű helyen Montanában. hogy valami nincs rendben. Tim nagyot nyelt. – A bácsit ismerem – mondta Tim. feszengve álldogált mögöttük. Granttal kell beszélgetnie. és így szólt: . amit azért hívtak így. és a magasba dobta baseball-labdáját. Timmy? – kérdezte a szakállas. Tim hallotta. És jó illusztrátor is. – Menjünk be mindannyian a látogató központba. és elmesélte a család utolsó kirándulásának történetét a Természettudományi Múzeumban. ki kell menned – szólt a húgára. és sportoljon. ki a szakállas! – Nyitva felejtetted a szád! – szólt Lex. Felöltötte az anyja legidegesítőbb tartását. Timmy? – Tizenegy. – És mióta érdekelnek a dinoszauruszok? – kérdezte Grant. Előbb nagypapához vitte őket. hogy Grant doktor szegődött melléje. amit Alan Grantról tudott. a keze a csípőjén. Timothy? – kérdezte a kislány. mert hátramaradt. hogy dr. mert sok dinoszaurusztojást találtak ott. egyetemista kinézetű pofa következett. vörös képű. – Nem. végül pedig egy sovány férfi. és éppen a szőke nő lábát nézte. ha valakinek dinoszauruszokon jár az esze – mondta Lex. – Azt én tudom. Tim elszégyellte magát. Alexis gonoszkodott. dehogy – mondta Tim. – Agyadra mentek a dinoszauruszok? – kérdezte a szakállas férfi. – Apu szerint Timmynek agyára mentek a dinoszauruszok. Neki kellett meglódítania: – Indulj már. fiatalabb férfival. Timmy! – Ne légy undok! – mondta a kisfiú. – Olvastam a könyvét. aztán kezdődhet is a kirándulás. akinek a számítógépekkel volt valami dolga. – Már egy ideje – felelte. vagy tévedek. – Néha elmegyünk a múzeumba. csak a fejével biccentett. De Ed Regis már hozzá is kezdett a bemutatáshoz.A KIRÁNDULÁS Tim Murphy egyből látta. aki még csak kezet sem nyújtott. – Az előbb még sürgős volt. A nagyapja javában veszekedett a vele szemben álló. amint Gennaro odasúgja a nagyapjának: „Ezért meg tudnám ölni!” – aztán a kisfiú felnézett. Alexis is megérezte a feszültséget. A többiek valahogy összemosódtak Tim szemében. – Nem. – Nekem ki kell mennem – mondta Lex. De Timmy alig hallotta a húgát. akivel az előbb vitatkozott. Az járt az eszében. – A papádat nem különösebben érdekli? Tim bólintott. – Előbb bemutatlak titeket – szólt rá Ed Regis. – A dinoszauruszok letűnt világa – felelte Tim. Tim megpróbálta rendbe szedni a benyomásait. Ki kell mennem. – Naná! Most ismerkedtél meg vele. Volt ott egy szőke nő sortban. – Mondok valamit! – szólt Ed Regis. akik azt hirdetik. A papámat. – Mindjárt megyek is – válaszolta Lex. Az apja ránézett az egyik csontvázra. Ő rajzolta a képeket a saját könyvéhez. Ez olyan természetjáró fajtának látszott. Zavarban volt. – Őszintén szólva félek. aztán az a férfi következett. Lex mérgesen villantotta rá a szemét. Grant professzor több dinoszaurusztojást talált. aki mindkettejüket megpuszilta. – Hány éves vagy. Ez izmos ember volt. – Apu szerint hülyeség. és Gennarónak hívták. – Mindenki elindult. és észrevette. meg egy szakállas férfi farmerben és mintás hawaii ingben. hogy a dinoszauruszok meleg vérű állatok voltak. mint bárki más a világon. hogy Timmy inkább menjen a levegőre. Mindjárt hozzá is kezdhetünk a bejáráshoz. de Ed Regis vidám hangon mondta: – Mindenkinek bemutatlak benneteket.

és Lex is ezt akarta. Tim a fejét rázta. hol vannak a csigolyák – mondta bosszúsan az apja. amiért az apjuk elment. nekem elég nagynak látszik. hogy a Természettudományi Múzeumban lévő csontváznak téves a csigolyaszáma? – kérdezte az apja. – Te tudod. Végül megszólalt az apja: – Mit nézel annyira? – Számolom a csigolyáit – mondta Tim. – Tudod. ha egy idő után nem vitatkozik az apjával. a jura a régibb.– Ez aztán jó nagy! Tim erre azt felelte: – Nem. és el akarja kapni a meccset a tévén. hogy az apja válik az anyjától. Nem az 5072-es számú volt? – De igen – felelte Tim. – Semmit – felelte a kisfiú. hogy jobb. Aztán mentek tovább a következő látnivalóhoz. Az apja szó nélkül nagy lépésekkel a sarokban álló teremőr felé vette az útját. – Én csak azt mondtam. ellenkezik-e. Aztán az apja azt mondta. kréta. – Mit csináltál megint? – kérdezte Timtől az anyja. és az elmúlt néhány hét során olyan undok lett. hogy jura meg kréta? – Ó.. – És én ezt higgyem el neked? – Pedig az. hogy az anyjának pasasa van. uszoda. Ennek több van. és Lexnek persze nem is említette. Az volt az érzése. s bár kezdetben ez egy kicsit furcsa volt. Tudja. miről beszél Grant. Ennyi az egész. az életben nem láttam ilyet! Te tényleg teljesen belebolondultál a dinoszauruszokba. hány csigolyának kell lennie a farkon! Esküszöm. Mármint így mentek annak idején. Tim pedig nem látott több dinoszauruszt. kisfiam – mondta az apja. . A kislánynak a szíve is majd megszakadt. – A csigolyáit? – Igen. – Évek óta ígérik. a tyrannosaurus ott a múzeumban. ezt honnan tudtad? – kérdezte. és megszorította egy kicsit. javította ki magát Timmy gondolatban. és hátrább lépett. – Egy biztos. apu. aztán megkérdezte: – Na és mért számolod őket? – Azt hiszem. De hát az ő családjában általában mindig így mennek a dolgok. – Hát nem tudom! Nekem elég nagynak látszik. így csak morgott valamit. a leghatalmasabb ragadozó. – Hát nem éppen – mondta Grant. – Tessék? – kapott észbe Tim. biztosan minden másképp lesz majd. Egy camposaurus. hogy erre sosem kerül sor. A gerincén. ez csak közepes nagyságú. amely valaha élt a földön – Tim hosszasan álldogált. apu. pedig pontosan ezért jöttek. Téves. – Mondd. – Én is tudom. – És mi ez? Jura? – Jézus! Dehogy. A kisfiú viszont már megtanulta. – A te nagyapád szigetén. – Hát olvastam – felelte Tim. Aztán az apja visszajött. – Azt akarod mondani. – Majd séta közben elmesélem neked. ami itt folyik – mondta Grant. ez még csak nem is felnőtt! Az apja összehúzott szemmel méregette a csontvázat. de nem volt biztos benne. – Na. A vállára tette a kezét. Állt még egy kicsit mellette. Csak úgy százmillió év – mondta Tim. Tim voltaképpen nem bánta. Az apja már el is költözött. – És a kréta a legrégibb? – Dehogy. – A mamám szerint ez csak valami üdülőhely. – Timhez fordult. hogy a dinoszaurusz hibás. Az egyik csontváz előtt – Tyrannosaurus rex volt. – Hát ez döbbenetes. hogy az már. – Honnan tudja? Grant elmosolyodott. Egy tyrannosaurusnak csak harminchét csigolyája lehet a farkán. – Az 5072-es volt? – kérdezte Grant. hogy a tyrannosaurusnak túl sok csigolyája van a farokrészén. Most. – Kréta? No és mi a különbség aközött. De most már lehet. mindegy – mondta az apja. Fura kifejezés ült az arcán. hogy lássa. Nem értette. – Miért nem? – Amiatt. hogy kijavítják. hogy a Mets játszik. így hát a család távozott a múzeumból. semmiség. – De apu. hibás. Az őr ugyanis természetesen megerősítette. tenisz meg ilyesmi..

mindenféle nyomtatott felirattal: FŐÁLLATŐR. amelyen újabb jelzés állt: B BIOLÓGIAI VESZÉLY VIGYÁZAT! BIOLÓGIAI VESZÉLY Ez a laboratórium megfelel az USG P4/EK3 sz. Hát mit ért ő ahhoz. Ő nem óvó bácsi. amin ez állt: ZÁRT TERÜLET BELÉPÉS CSAK ENGEDÉLLYEL Tim a felirat láttán izgalomba jött. Mint azt az ügyet múlt januárban. hogy jól végezzék a dolgukat. ha beteg lesz valami munkás? Most meg szaros idegenvezető és óvó bácsi. minden konkrétum nélkül. Megalázónak érezte. Aztán látta. amikor megszólalt Ed Regis: . ha valaki ezt választja foglalkozásul. A folyosón félúton üveg válaszfalhoz értek. de még mindig a legkülönbözőbb feladatokat varrták a nyakába. Nem vesztegetheti az idejét arra.. És ami azt illeti.. Ehelyett Ed Regis nyakába zúdult. Hardingé vagy Owensé. még ha fontos személyiségekről van is szó. Csupán a San Franciscó-i és londoni PR cégekkel és a New York-i és tokiói ügynökségekkel való kapcsolattartás egész embert követel – különösen mivel az ügynökségek előtt még mindig el kell titkolni. A másik falon ajtók. amelyeket finom köd vett körül. Egy még hiányzott. A kreatív embereket dédelgetni kell. az általános vállalkozóé. Elhaladtak egy felirat mellett. Regis már hét hónapja tartózkodott nagyrészt a szigeten – hol jött. – Sasszemmel figyelje az unokáimat. amint távolabb hátul Sattler doktornő is kilép a fürdőszobából.és propagandaszakmával. genetikai előírásoknak Alatta további jelzések: VIGYÁZAT! Teratogenikus anyagok Terhes nők számára e terület tiltott! VESZÉLY! Itt radioaktív izotópokat használnak Potenciális rákkeltő hatás! Tim egyre izgatottabb lett. A cégek csak figyelemfelkeltő hadjáratot folytathattak.. – Maga felel értük az egész hétvégén! Ed Regisnek ez a legkevésbé sem tetszett. Ő a Jurapark reklám. Erkélyre nézett. akkor kezdjük a kirándulásunkat a második emeleten. Az egyik fal üvegből volt.. és pálmákra. Végigmentek a második emeleti folyosón. miközben várakozva toporgott a látogatóközpontban. VENDÉGSZOLGÁL ALIGAZGATÓ. Teratogenikus anyagok! Amikből szörnyetegeket hoznak létre! Borsódzott a háta. és megszámlálta a fejeket.és propagandafőnöke. hogy tudósokat kalauzol a látnivalók között. és csalódást érzett.„Tessék. Az Harding dolga lett volna. De hát éppen ez a baj az egész reklám. hogy mit kell csinálni. – Rendben. még csak nem is idegenvezető. hol ment –. és ettől idegesek voltak. úgy vigyázzon rájuk! – parancsolt rá az öreg. Senki sem tekinti szakembernek. most meg egy vacak óvó bácsit csinál belőlem!” – dohogott magában elkeseredetten Ed Regis. és még ezer dolgot kell elintéznie a nyitásig hátralévő év alatt. Tim a többiekkel együtt haladt Ed Regis nyomában felfelé az emeletre vezető függő lépcsősoron. Bátorítani. barátaim. Hátrafordult. mi lesz az üdülőtelep igazi látványossága.

aztán Loy eljárását alkalmazzuk. Megálltak az ablakoknál. kartondobozokban és a nagy. hogy dinoszauruszok vérét szívták? – De. és csapdába ejti őket. hogy az emlősök vörös vérsejtjeinek nincs sejtmagva. Természetesen ezt nem tudhatjuk biztosan. Nekünk a teljes dinoszaurusz-DNS-típus kell. – Borostyánból. Tátva maradt a szája. Hosszú. őskori fagyanta. amely olyan volt. Természetesen a számuk nőni fog. a főgenetikusunk. – Grant csak ingatta a fejét. Csak két ember volt odabenn. mint megkövült.. Ennek az az oka. – Biztosan szeretnék megtekinteni ezt a termet – mondta Ed Regis –. Csak a törvényelőírások miatt vannak ott. biztosítom. De önöket valószínűleg az izgatja. Az ajtón ez a felirat állt: EXTRAKCIÓ. Egy asszisztens borostyánt helyezett alá. Ami nem más. – Nos – mondta Wu –. – A genetika kicsit bonyolult dolog. aki legombolt gallérú. – Ha ebben a légyben van idegen vérsejt. – Én viszont még mindig nem értem – ismerte be Grant. – És maguk az ő technikáját alkalmazzák? – kérdezte Grant. – Csak nem azt akarja mondani. Ed Regis becsúsztatta a kártyát a nyílásba. ami ott van nem reprodukáljuk. valamilyen kihalt lény DNS-ét. hogy klónozhassuk. – Csak kiegészítésképpen – felelte Wu. akik kétcsövű sztereomikroszkópba bámultak. kurtán biccentett. Maga dr. nyakkendőben volt. s így a vörös vérsejtjeikben nincs DNS. de egyelőre csak ennyien vannak. És innen szerezzük meg. A videomonitoron nézték. Mr. Itt a központi vezérlőterem. – Aki baloldalt áll. Mindössze húsz ember működteti az egész telepet. karcsú testű férfi volt. – Gondolom. Sőt. – Nyilván feltűnt önöknek. az ön számára is nyilvánvaló. amíg ki nem vonjuk. honnan vesszük a dinoszaurusz-DNS-t. amely egy legyet zárt magába.. Villogó számítógép-monitorok sora nézett szembe vele. Az eljárása olyannyira kifinomult. – Mellette pedig a parkőrünk. a többség azonban videoképet közvetített a park különböző részeiről. Szerencsés esetben igen. Némelyik képernyőn adatok látszottak. – Vért szívtak – ismételte Grant. ha megőröljük a csontokat. mit is csinálunk mi itt. mint egy űrhajós irányítóközpont kicsinyített mása. Ezt csináljuk immár öt éve. A szoba tele volt sárga kövekkel. kihúzható tálcákon. – Ördögi! És be is jöhet. hogy akár ötven nanogrammnyi anyag is elég a sikerhez. Ilyenkor a kövület teljes épségben megőrzi őket. rövid ujjú ingben. minden teljesen veszélytelen. de őskori emberi maradványokból is nyert vérsejteket így. aki a harmincas éveinek közepén járó. Robert Muldoon. – A fagyanta – magyarázta Wu –. Wu. – Muldoon jól megtermett. Egy emlős . igen. Odalépett az egyik mikroszkóphoz. – Ez tényleg nagyon ügyes – mondta Malcolm. aztán Malcolmra. Ingzsebére akasztva hordta napszemüvegét. hogy húsz százalék nem elegendő a mi munkánkhoz. – Legalábbis megpróbálom – mosolygott Henry Wu. hogy be is jön! – mondta Wu. és meg nem vizsgáljuk. ez is biztonsági kártyával nyílott. Felpillantott a csoportra. – Átvezette őket az ajtón. és cigarettázott. széles vállú férfi volt khakiruhában.. – És aztán maguk a rovarok pedig megőrződtek a borostyánban. amint hosszú tűt szúr a borostyánba. John Arnold – mutatott Regis egy sovány férfira. hogy itt a szigeten a személyzet létszáma minimális. a híres fehér vadász Nairobiból. Négy laboratóriumi köpenyes asszisztens volt benn.. vagy nagy felbontású videoképernyők képeit nézték. de húsz százalék még mindig kinyerhető. Álltak és beszélgettek. Innen ellenőrizzük az egész parkot. – Hát az oldódó proteinek legnagyobb része kiázik a fosszilizáció folyamatában. A túloldalon őr állt. Ed Regis a csoporthoz fordult. Tim zöld fényben úszó kis szobát látott odabenn. Grant Ellie-re nézett. a fény felvillant. Sárga kövek voltak az üvegpolcokon. és paleo-DNS-t nyerünk. gyakorta ráfolyik a rovarokra. Regis bemutatta Henry Wut. az a főmérnökünk. valójában két lehetséges forrásunk van. amelyek nagyobb állatok vérét szívták. Biztosíthatom magukat. A borostyánban mindenféle rovar megtalálható – köztük csípős rovarok is. Mindegyik kő fekete tintával volt felcímkézve. Loy arra használta. majd visszafordult a számítógép-monitorokhoz. ki fogjuk tudni vonni belőle. hogy proteint vonjon ki kihalt ausztráliai erszényesekből. mint az emlősökét. s az ajtó kinyílt.– Ne törődjenek a jelzésekkel. egyenesen az őskori légy légcsövébe. – Ó. – Felmerült bennem a kérdés – mondta Grant. honnan szerezzük a dinoszaurusz-DNS-t. A Loy-féle antitesteken alapuló kivonási technika alkalmazásával néha közvetlenül is nyerhetünk DNS-t a dinoszauruszcsontokból. Egy függőleges üveglapon ott állt az egész park átlátszó térképe. de előbb nézzük meg. Ő fogja elmagyarázni. – Felemelte az egyik sárga követ. és bepillantottak az elsötétített helyiségbe. Ez egy gramm ötvenmilliárdnyi része. és akárcsak a laboratóriumi terület többi ajtaja.. – Dr. de eredményes! – Dinoszaurusz-DNS-t voltaképpen könnyebb ezzel a módszerrel kivenni. – Milyen az arány? – kérdezte Grant. lassú folyamat volt. ha jönni kezdenek a vendégek. és elismerően bólintott.

még mindig több. Hangos. l 61 121 181 241 301 361 421 481 541 601 661 721 781 841 901 961 1021 1081 1141 1201 1281 GCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGC GGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCG Nsp04 TGTTCCGACCCTOCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGC TGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTG □ BrontIV CCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAA AGTAGGACAGGTGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAG 434 [nxT] AoliBn ATCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACT CCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCTGGGCT GGCGTTCGCGACOCGAGGCTGGATGGCCTTCCCCATTATGATTCTTCTCGCTTCCGGCGG CCCGCGTTGCAGGCCATGCTGTCCAGGCAGGTAGATGACGACCATCAGGGACAGCTTCAA CGGCTCTTACCAGCCTAACTTCGATCACTGGACCGCTGATCGTCACGGCGATTTATGCCG Nsp04 CACATGGACGCGTTGCTGCCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAA CAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAA 924 Caol11 DinoLdn GCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGG CTTTCTCAATGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTG ACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCA ACACGACTTAACGGGTTGGCATGGATTGTAGGCGCCGCCCTATACCTTGTCTGCCTCCCC GCGGTGCATGGAGCCGGGCCACCTCGACCTGAATGGAAGCCGGCGGCACCTCGCTAACGG CCAAGAATTGGAGCCAATCAATTCTTGCGGAGAACTGTGAATGCGCAAACCAACCCTTGG CCATCGCGTCCGCCATCTCCAGCAGCCGCACGCGGCGCATCTCGGGCAGCGTTGGGTCCT 1416 DnxT1 SSpd4 GCGCATGATCGTGCTACCCTGTCGTTGAGGACCCGGCTAGGCTGGCGGGGTTGCCTTACT ATGAATCACCGATACGCGAGCGAACGTGAAGCGACTGCTGCTGCAAAACGTCTGCGACCT – Itt egy kis töredéknyi dinoszaurusz-DNS tényleges szerkezetét látják – mondta Wu. e célra nagy kapacitású számítógépeket használunk. hogy a DNS hibás. A számítógép kiválaszt egy sor enzimet. Az első dolgunk ezért az. hogy miként állítható elő egyetlen protein – mondjuk egy hormon vagy egy enzim. Türelmetlenül pislantgatott a következő ajtó felé. Ha napi nyolc órán át minden másodpercben megnéznénk egy-egy ilyen ernyőt. – Íme a mi csúcstechnológiás automata mosodánk – mondta dr. A képre mutatott. Ez is olyan jel. azok a tornyok ott a terem közepén. Több monitor volt a teremben. rozsdamentes acéldobozok sorakoztak. ami sokkal ritkább. Nos. igen nagy sebességgel. Önök lényegében e pillanatban egy hihetetlen képességű genetikai gyár kellős közepén állnak. hogy a szekvencia négy alapvető vegyületből áll. egyenként kétméteres. a falak mentén pedig csípőmagasságig érő. 1 61 121 181 241 301 361 421 481 541 601 661 721 781 841 901 961 1021 1081 1141 1201 1281 1341 GCGTTGCTGG GGTGGCGAAA TGTTCCGACC TGCTCACGCT CCGTTCAGCC AGTAGGACAG ATCGGCCTGT CCAAACGTTT GGCGTTCGCG CCCGCGTTGC CGGCTCTTAC CACATGGACG CAAGTCAGAG GCGCTCTCCT CTTTCTCAAT ACGAACCCCC ACACGACTTA GCGGTGCATG CCAAGAATTG CCATCGCGTC GCGCATGATC AGAATGAATC AACATGAATG CGTTTTTCCA CCCGACAGGA CTGCCGCTTA GTAGGTATCT CGACCGCTGC GTGCCGGCAG CGCTTGCGGT CGGCGAGAAG ACGCGAGGCT AGGCCATGCT CAGCCTAACT CGTTGCTGGC GTGGCGAAAC GTTCCGACCC GCTCACGCTG CGTTCAGCCC ACGGGTTGGC GAGCCGGGCC GAGCCAATCA CGCCATCTCC GTGCT AG ACCGATACGC GTCTTCGGTT TAGGCTCCGC CTATAAAGAT CCGGATACCT CAGTTCGGTG GCCTTATCCG CGCTCTGGGT ATTCGGAATC CAGGCCATTA GGATGGCCTT GTCCAGGCAG TCGATCACTG GTTTTTCCAT CCGACAGGAC TGCCGCTTAC TAGGTATCTC GACCGCTGCG ATGGATTGTA ACCTCGACCT ATTCTTGCGG AGCAGCCGCA CCTGTCGTTG GAGCGAACGT TCCGTGTTTC CCCCCTGACG ACCAGGCGTT GTCCGCCTTT TAGGTCGTTC GTAACTATCG CATTTTCGGC TTGCACGCCC TCGCCGGCAT CCCCATTATG GTAGATGACG GACCGCTGAT AGGCTCCGCC TATAAAGATA CGGATACCTG AGTTCGGTGT CCTTATCCGG GGCGCCGCCC GAATGGAAGC AGAACTGTGA CGCGGCGCAT AGGACCCGGC GAAGCGACTG GTAAAGTCTG AGCATCACAA TCCCCCTGGA CTCCCTTCGG GCTCCAAGCT TCTTGAGTCC GAGGACCGCT TCGCTCAAGC GGCGGCCGAC ATTCTTCTCG ACCATCAGGG CGTCACGGCG CCCCTGACGA CCAGGCGTTT TCCGCCTTTC AGGTCGTTCG TAACTATCGT TATACCTTGT CGGCGGCACC ATGCGCAAAC CTCGGGCAGC TAGGCTGGCG CTGCTGCAAA GAAACGCGGA AAATCGACGC AGCTCCCTCG GAAGCGTGGC GGGCTGTGTG AACCCGGTAA TTCGCTGGAG CTTCGTCACT GCGCTGGGCT CTTCCGGCGG ACAOCTTCAA ATTTATGCCG GCATCACAAA CCCCCTGGAA TCCCTTCGGG CTCCAAGCTG CTTGAGTCCA CTGCCTCCCC TCGCTAACGG CAACCCTTGG GTTGGGTCCT GGGTTGCCTT ACGTCTGCGA AGTCAGCGCC . Adenin. Nedry már a következő munkafázisunkra kíváncsi – szólt Wu. amely elvégzi a feladatot. Inkább hatalmas madarak. Wu. a kövér ürge pedig. Mr. – Ez tipikus példa. mint aki már rég tisztában van az egésszel. Két. thymin. hogy kijavítsuk pontosabban a számítógépnek kell ezt tennie. – Azok a dobozok a fal mentén Hamachi-Hood típusú automatikus génszekvencerek.klónozásához fehér vérsejtet kell találnunk. amelyeken olyan gyorsan futottak az adatok. Akkora. A dinoszauruszoknak azonban magvas vörös vérsejtjeik voltak. Tim látta. zümmögő zajt hallottak. a Cray XMP szuperkomputerek működtetik. Dennis Nedry. ugyanis láthatják. teljesen közönyösnek tűnt. Igen. mint két évig tartana. míg végignéznénk a teljes DNS-sort. Ezeket. hogy a dinoszauruszok egyáltalán nem hüllők voltak. – Látom. Úgynevezett restrikciós enzimek segítségével kimetszi a DNS-t. Ennyi DNS-ben valószínűleg van valami utasítás is arra nézve. a bőrük pedig pergamenszerű. – Megfigyelhető. A teljes DNS-molekula hárommilliárdnyit tartalmaz ezekből az alapokból. guanin és cytozin. ott lenn az 1201-es sorban. kerek torony állt a terem közepén. hogy követni sem lehetett őket. amely sok más mellett arra utal. mint a vörös. hogy Grantot még mindig nem sikerült meggyőzni. mint a mai madaraknak. hogy mi módon azonosítjuk a kinyert DNS-t. Wu lenyomott egy billentyűt. Az általunk kivont DNS legnagyobb része töredékes vagy hiányos. Tolóajtókon át egy hűtött terembe léptek. és megállította az egyik képet. – Arra.

amikor a cég megbízást adott neki. Nedry rögtön arra gondolt. Ma a számítógépeink néhány óra alatt elvégzik. A sötét csíkok a képen restrikciós töredékek: enzimek által lebontott.-intézet közelében.. hogy egy ilyen képet dekódoljon. a szűrés pontjai. Ott azonban közölték. Amint látják. . Mint az 1201-es sorban látják. Nagy utat tettünk meg a hatvanas évek óta. De az InGen valami sokkal nagyobbat akart. Azzal szerzett hírnevet magának. Nedry nem értette a dolgot. hogy 3xl09 mezőnyi adattárolóra van szükség. 1 61 121 181 241 301 361 421 481 541 601 661 721 781 841 901 961 1021 1081 1141 1201 1281 1341 GCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGC GGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCG TGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGC TGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCBAGCTGGGCTGTGTG CCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAA AGTAGGACAGGTGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAG ATCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACT CCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCTGGGCT GGCGTTCGCGACGCGAGGCTGGATGGCCTTCCCCATTATGATTCTTCTCGCTTCCGGCGG CCCGCGTTGCAGGCCATGCTGTCCAGGCAGGTAGATGACGACCATCAGGGACAGCTTCAA CGGCTCTTACCAGCCTAACTTCGATCACTGGACCGCTGATCGTCACGGCGATTTATGCCG CACATGGACGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAA CAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGOAA GCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGG CTTTCTCAATGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTG ACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCA ACACGACTTAACGGGTTGGCATGGATTGTAGGCGCCGCCCTATACCTTGTCTGCCTCCCC GCGGTGCATGGAGCCGGGCCACCTCGACCTGAATGGAAGCCGGCGGCACCTGGCTAACGG CCAAGAATTGGAGCCAATCAATTCTTGCGGAGAACTGTGAATGCGCAAACCAACCCTTGG CCATCGCGTCCGCCATCTCCAGCAGCCGCACGCGGCGCATCTCGGGCAGCGTTGGGTCCT GCGCATGATCGTGCTAGCCTGTCGTTGAGGFCCCGGCTAGGCTGGCGGGGTTGCCTTACT ATGAATCACCGATACGCGAGCGAACGTGAAGCGACTGCTGCTGCAAAACGTCTGCGACCT ATGAATGGTCTTCGGTTTCCGTGTTTCGTAAAGTCTGGAAACGCGGAAGTCAGCGCCCTG – És íme a felülvizsgált DNS-képlet. mint a kirakós játék. De a DNS-molekula még így is túl nagy. – Barney. dehogy! – felelte Wu. és elvégezhetjük a helyreállítást. például így: – Most olyan DNS-töredéket találunk. Ehhez hozzászokott. hogy tervezze meg a park vezérlőrendszerét..– Ez ugyanaz a DNS-szekció. meg is tudjuk találni. A komputer most újra kombinálja őket. amikor egy laboratóriumnak négy évébe került volna. A nukleotidáknak csak kis százaléka változik fajról fajra. amelyek állatról állatra különbözőek.I. amelynek tanúi voltak. Ezt elemezzük. ezért felkereste Barney Fellowst a Symbolicsnál. hogy tévedésről szó sincs. az M. és megtudjuk. mint ez. milyen bázispárokat kell bevinnünk. Néhány éve. hogy világméretű telekommunikációs rendszereket hozott létre multinacionális cégek számára. Hárommilliárd mező! Nedry már azelőtt is dolgozott nagy rendszereken. hogy a számítógép döntse el. Egy kicsit olyan ez. – Ó. és még ez is éppen elég nagy munka. illetve mások. a massachusettsi Cambridge-ben. hogy az InGen valami ilyesmiben mesterkedik. De azt is tudnunk kell. hogy csak valami tévedésről lehet szó. Csak a számítógép nagyon gyorsan végzi el. szerinted miféle adatbázisnak lehet szüksége hárommilliárdos tárolásra? – kérdezte. majd analizált. Dennis Nedry ásított. csak ki vannak jelölve rajta a restrikció. mint a mai DNS. hogy helyrehozzuk a sérülést. Már régesrég eljutott arra a következtetésre. – Vagyis a teljes DNS-sorral dolgoznak? – kérdezte Grant. A művelet. Ezek nemegyszer több milliónyi adattal dolgoztak. úgy. amely átfedi a sérülési területet. az egyik tervparaméter úgy szólt. melyiket használja. kis dinoszaurusz-DNS-szekciók. amelyet a komputer állított helyre. hogy megkeresi az átfedő kódszekciókat. A paraméter pontos. – Az lehetetlen volna. Hétköznapi esetben hagyjuk. és azonnal felhívta Palo Altót. Mi másodpercek alatt elvégezzük. E célból különböző metszettöredékeket kell összerendeznünk.T. két enzim metsz be a sérült pont mindkét oldalán. Az összképnek csak azokat a szekcióit vizsgáljuk. mi hiányzik. egy közönséges laboratóriumban hónapokat vett volna igénybe.

hogy a DNS-sel csinálnak valamit – mondta Barney.. mint valaha a Manhattan Terv. Amikor visszafordult a többiekhez. – Nem tudom elképzelni. ki készítette az algoritmusaikat? – Nem én – felelte Nedry. éppen úgy fejlődik. amit azért elmondhatsz? – Biotechnológiai cégről van szó. hogy a megrendelő soha nem volt hajlandó elárulni. Bizonyos adatbázis-kereső eljárások rengeteg memóriát zabálnak fel. – Tudta. vagy: „Tervezzen egy modult vizuális megjelenítésre!”. – Mi a rendszer? – Multi-XMP. kinyitotta az ajtót. – Micsoda? Multi-XMP? Szóval nem is egy. Dr. Hátul volt egy rész. Valóban ezt akarják. akkor honnan tudják meg. Óriási vállalkozás volna. az atombomba elkészítése volt. mire kellenek az alrendszerek. Lehet. – Aztán hozzálátott. hogy vannak gondok. milyen állatot takar a kód? – Két eljárásunk van erre – válaszolta Wu. – Vagy esetleg csak DNS-töredékeket elemeznek. Ez már logikusabban hangzott. a legkevésbé sem lepte meg. De ehhez tíz év összehangolt munkájára volna szükség. a keresés így is napokig fog tartani. viszont RAM-érzékeny algoritmusaik vannak. Elérték a következő ajtót. Az utasítás csak ennyi volt: „Tervezzen egy nyilvántartási modult!”. már ami a rendszertervüket illeti. – Ezt én is tudom. szinte kétségbeesetten. – De hát ez őrület! – mondta Barney. hogy javítsa ki „az általa nem rendezett problémákat”. de nincs. hogy algoritmusokat keressek. Most pedig. De mégis. aki a DNS-molekula analízisével foglalkozna. aztán meglátjuk. béta-alkaloidák – mutatott az ultraibolyafény alatt sorakozó injekciós fecskendőkre. Leellenőriztem. de ez már nem kötötte le a figyelmét. ha meg akarnak találni valamit. – Biotechnológia. és a számítógép segítségével nagyjából meghatározzuk. „Dühítő!” – gondolta Nedry. – Ez a cég igen titokzatos. mi lesz belőle – mondta. hogy a sejtmitózist. Időigényes eljárás. – Ugyan ne hülyéskedj! – mondta Nedry. – Akkor nyilvánvaló. melynek során kielemeznék a teljes emberi genetikai fonalat. – Írtál alá titoktartási megegyezést? – Hát persze – felelte Nedry. Vagy hetekig. . de megoldható. Ezért a világ legveszedelmesebb mérgei közül tartanak itt néhányat. – Nincs. Dr. – Hárommilliárd rögzített adattal – mondta erre Barney. – No és a másik? Wu megvonta a vállát. míg elkészültek. Szerette a technikai dolgokat. hanem több Cray? Azt a mindenit! – Barney a homlokát ráncolta. – Van. Wu becsúsztatta az ellenőrzőkártyát. – Véletlenül egy nullával többet írtak. – Megnövesztjük. Szerencsére nem az a feladatom. amelyben laboratóriumok sora venne részt szerte a világon. optimisták – mondta Nedry. amelyre ez volt írva: FERTILIZÁCIÓ. – Tudod. és megtervezte az ellenőrzőrendszereket.. Még csodálkoznak? Teljes pánikban parancsolták ide. hogy optimisták. legalább akkora. Mindjárt bemutatom maguknak. Szinte minden munkájánál megkívánták a titoktartást. – Hát én továbbra is arra tippelek. – Igen – mondta Nedry. hogyan csináljuk. – Többnyire ezt tesszük. hol illik bele az evolúciós sorba. a kéz vagy más fizikai jellemző. – Kivihetetlen. – És ez egy magáncég – tette hozzá Nedry. Több mint egy évbe került neki és programozóinak.. mint bármi más egy szervezetben. Wu elmagyarázta. Tim újabb termet látott. colchinoidák.– Ez csak tévedés lehet – mondta nevetve Barney. de a felhasználásról egy szót sem közöltek. a láb. – No és mi? – DNS-molekula. A dolgot különösen megnehezítette.. Csak arra kértek fel. és ismét elgondolkodott. az osztódást pontosan megadott pillanatokban megszakítsák. – Helotoxinok. Grant éppen ezt kérdezte: – És amikor a számítógép kielemezte a DNS-t. hogy egyes biológusok egy humángenetikai projektum létrehozását tervezgetik. hogy a DNS-munka megkívánja. – Igen-igen. és villámsebes algoritmusokat. – Van még. Tim türelme egyre inkább fogyott. A tervparamétereket megkapta. hogy a rendszer felépült és beindult. hogy tárolókapacitást és memóriát hozzak létre az egész rendszer számára. amelyet teljes egészében kék ultraibolyafény világított meg. ahol megint csak fehér ruhás laboránsok ültek mikroszkópoknál. és beléptek. A DNS éppúgy átmegy egy időbeli evolúciós folyamaton. amit elmondhatsz? – Ne haragudj – felelte Nedry –. – Az első a filogenetikai feltérképezés. Vagy kettővel. Még ha a leggyorsabb processzorokat használod is. mire kellhet egy ilyen adatbázis? Barney elkomorult. Ahogy az út folytatódott. mi máshoz kellene ez. mi lehet a. – Bármely élő állattal másodpercek alatt végeznek. Sötétben tapogatózva kellett dolgoznia. így tehát fogjuk az ismeretlen DNS-t. – Nem tévedés. azaz génsebészet – tűnődött Barney.

Az inkubációs periódus állatonként különböző. – Egy kicsit meleg és nedves a levegő odabenn – mondta Wu doktor. A STEG pedig stegosaurust jelent. bedugják a kezüket a ködbe. Amikor először készítünk kivonatot. Kinyitotta a keltető belső ajtaját. Ott például a TRIC azt jelenti. És vigyázzanak a fejükre. aztán Grant professzor tett fel újabb bonyolult kérdéseket. – Mit jelentenek a számok? – Azok a kódok a különböző DNS-fajtakivonatokat azonosítják – mondta dr.Tim szívesen hallott volna többet is a mérgekről. Háttal nekik fiatal. A termet fölülről TV-kamerák és mozgásérzékelők ellenőrzik. – Nem sok – felelte a nő. ha jól emlékszem. Grant elmosolyodott. – Harminchét Celsius-fok körül tartjuk a hőmérsékletet – mondta –. Rongydarabok és játékok hevertek szanaszét a padlón. tojástól tojásig. A kód így szólt: XXXX-0001/1. Nehéz fejben tartani ezt a rengeteg nevet. de pillanatnyilag mind üres. a polcok teli fagyasztott embriókkal. – Ez egy új DNS-fajta – mondta Wu. óránként megfordítják a tojásokat. Kis növényevő. A következő terem felirata ez volt: KELTETŐ. majd itt kikeltetjük. Hosszú asztalokon ültek a tojások. Timnek pedig elege volt ezekből a komplikált laboratóriumokból. de dr. azonnal jelezze! Wu becsúsztatta ellenőrzőkártyáját a nyílásba. De számítógépes elemzéssel mintegy ötszáz változóval dolgozunk. – Az első négy betű jelöli az állatfajt. további kétszáz tojáson belüli és a többi magából a genetikai anyagból származik. amikor néhány napon belül egyszerre százötven állat jön a világra – bár a legnagyobb részük természetesen nem marad meg. amin természetesen javítani szeretnénk. – A hüllőtojások nagy mennyiségű fehérjét tartalmaznak. milyen. de egy csepp vizet sem. Úgy háromszáz dinoszaurusznemről tudunk eddig. mint a kórházakban. A harminchárom százalékot is eléri. milyen állat lesz. majd megy tovább. a relatív légnedvesség pedig száz százalék. Ha bármelyikük rosszul érzi magát. de általában mintegy két hónap. kérem. és hófehér. Amint látja „Feltételezett Coelu” van odaírva. A tojások mind mozogtak. és így tovább. amely elborította az asztalokat. míg felnőnek? – A dinoszauruszok gyorsan érnek. és a külső ajtó egyetlen szisszenéssel elhúzódott. Az életben maradási arányunk körülbelül nulla egész négy százalék. . halvány körvonalaikat el-elmosta a sziszegő. majd megkérdezte: – Van valami éppen kikelőben? – Nem. Wu tovább duruzsolt arról. hogy triceratops. A fajokat betűkkel és számokkal jelzik az egyes asztalokon: STEG-458/2 vagy TRIC/390/4. amely egy rugalmas karral lenyúlva sorra minden tojást megérint. hogy ugyancsak fent halad egy automata hőérzékelő. rajtuk felirat: FOLYÉKONY N 2 Aztán hatalmas. amelyet keltetünk. A szenzorok állandóan mozognak. – Csak egy raptorbébi. sosem tudjuk még biztosan. hogy megkönnyítsük a személyzet dolgát. embernagyságú hűtőszekrények következtek. Wu doktor elmondta. – És meddig tart. Az embriókat mechanikus módon helyezzük be. – Ebben a keltetőben több mint egy tucat kivonat termékét állítottuk elő. – És ez az asztal itt? – kérdezte Grant. Tim hatalmas. Az embrióknak az őket körülvevő környezetből kell kinyerniük a vizet. Legalábbis úgy feltételezzük. fehér köpenyes nő ült a földön. alacsonyan mozgó pára. A dinoszauruszokat szerette volna látni. hogy megtermékenyítetlen krokodilpetesejteket használnak. A tojások némelyike átereszti a bőrolajokat. nyitott termet látott maga előtt. és hőérzékelőkkel vizsgálják a hőmérsékletüket. Magasabb O 2-koncentrációval is dolgozunk. Még Sattler doktornő is kezdte elveszteni az érdeklődését. Van még kérdésük? Nincs? Akkor menjünk az óvodába. és behelyettesítik a DNS-t. ahol az újszülöttek vannak. A tojások maguk plasztikból vannak. Ezért a pára. Kerek szoba volt. és mindegyik más-más DNS-kivonatfajtát képvisel. amely infravörös fényben fürdött. mindegyik ezüstfóliába csomagolva. tehát valószínűleg Coelosaurus lesz. Képzelheti. – Pontosan. Lágyan himbálóztak. – Nem tudjuk pontosan. A terem egyik oldalán nagy tartályok voltak. Kettőtől négy éven belül elérik a teljes nagyságukat. Wu. Lépcsőzetesen próbáljuk időzíteni. és összesen kétszázharmincnyolc élő állatot nyertünk. így tehát máris jó néhány felnőtt példányunk van a parkban. e pillanatban nincs. Lex unatkozott. Volt benne néhány olyasfajta inkubátor. Egyébként azok az X-esek ott már bármelyik nap kikelhetnek. – Hadd figyelmeztessem önöket még egyszer: semmit se érintsenek meg ebben a teremben. Kathy? – kérdezte dr. – Jurakori atmoszféra – jegyezte meg Grant. – Háromszáznegyvénhétről – szólt közbe Tim. mi fog kinőni belőle. – Mink van ma idebenn. Ebből százhúsz környezeti. Aláfirkantva ez állt: „Feltételezett Coelu”. Wu. Nedry ásítozott. és beléptek. pittyent egyet. Azt mindannyian látták. A keltető munkásai derékig párában jártak. hogy minden asztalon 150 tojást tartanak.

– Egyik állatunk sem képes a szaporodásra. vadon. és teljesen száraz. – A legtöbb dinoszaurusz tojásfogakkal születik. és ellenőrizzük a tojáson belüli fejlődési környezetünket. hogy közelebbről is lássa. – És a második ok? – A Juraparkban csak nőstény állatok vannak. de egyenesen állt erős hátsó lábain. A kis gyík abban a pillanatban felugrott. – Hé! – Tudnak ugrani – mondta Wu. – Ragadozó. – Ez olyan. – Nos. – Legalábbis míg meg nem nő egy kicsit. – Nem bánnám. Hegyes orrukkal lyukat ütnek a tojáson... aztán a nyakához dörgölte a fejét.– Hadd lássuk! A nő felkelt és félreállt. Az állatkának alig volt súlya. Mélysárga volt. Mindannyian nőstényként kezdjük életünket. hogy mind nőstény. . teljesen biztos – felelte Wu. Téves lehet a sugárzási dózis vagy esetleg nem arra az anatómiai területre irányul az állatnál. és alánéz? – A nemi szervek fajonként különbözőek – mondta Wu. Gyíkfeje volt. és fészket raknak. – Szerintem ugyanis a besugárzás mint eljárás csupa bizonytalanság. Félrebillentette a fejét.. barna csíkokkal. terméketlenek. Még tojásfoga sem. – Éppen most ástam ki egy raptort – mondta Grant. – No és. hogy mind nőstény – mondta Malcolm –. Azért tudjuk. legfeljebb ha egy kiló. és hogy is mondjam?. A kis velociraptor megszaglászta Timet. mint egy tigris. Ez esetben két egymástól független ok is van rá. Némelyiket mi magunk megszokásból hímként kezeljük – például a Tyrannosaurus rexet gyakran „nagy fiúnak” nevezzük – de a valóságban mindegyik nőstény. ezek kis szarvacskák az orrhegyen. Kétágú. testét kiegyensúlyozta a vastag. Biotechnológiai szempontból nézve nőstényeket könnyebb tenyészteni. úgyhogy most egy darabig nem adunk neki. hogy enni adjon neki – mondta Wu. – Ez mind igaz! – vágott közbe Wu. némi aggodalommal a tekintetében. Először is sterilek. – Azt akarja. kis nyelve ki-be járt. másokat bonyolultabb.. ha ezt egy kicsit bővebben is kifejtené – mondta. Tim kacarászott. dülledt szemek rámeredtek. hogy a gonádszövetet pusztítjuk el. De ha magában hagyjuk. Malcolm szólalt meg. azt hogyan ellenőrzik? Valaki végigjárja őket. egyenes farok. úgy leste az őt bámuló vendégeket. A sötét. Tim megfogta a velociraptort. amikor kritikus kérdéssel kerültünk szembe. nyilván az ön számára is nyilvánvaló. hogy minden gerinces embrió alapvetően nőstény jellegű. – Mit eszik? – Egeret. hogy miért nem képesek szaporodni ezek az állatok. és Grant feje fölött egyenesen Tim karjába repült. Amikor vadon tenyésznek. Nyilván tudják. mint egy gyík – hallotta Nedry hangját Tim. hogy ne is szaporodhassanak – felelte Wu. – De mi történik az őserdőben? – Az őserdőben? – Úgy értem. A padlón lévő állat hossza úgy ötven centi lehetett. – És minden esetben. Ilyen egyszerű – mondta Wu elégedett mosollyal. – Tojás fog? – kérdezte Nedry. Csak ennek a segítségével tudjuk pótolni a Jurapark állományát. – De mi teljesen meg vagyunk győződve róla. Bőre meleg volt. Valamilyen pótlólagos hatás – például a fejlődés egy megfelelő pillanatában beadagolt hormon – kell ahhoz. De hogy válaszoljak a kérdésére. mert besugarazzuk őket röntgensugarakkal. Ellenőrzésünk alatt tartjuk a kromoszómáikat. De éppen most evett. – Egyeseket könnyű felismerni. mert – a szó szoros értelmében úgy készítjük el őket. miközben lehajolt. Ezért van a neveldénk. Barátságos. és hosszú orra. Egyébként a bébiknek egyáltalán nincs is foga. aztán a személyzet segíti ki őket. – Szóval ki kell őket segíteni – mondta a fejét ingatva Grant. – De hát arra nem képesek – mondta Wu. felemeli a dinoszauruszok szoknyáját. amelyikre kellene. – Velociraptor mongoliensis – bólintott Wu. – Biztos maga ebben? – kérdezte Gennaro. milyen lényeges. A segítségükkel törnek ki a tojásból. – Ó. – Már a bébik is tudnak. mint egy kis majomé. – De miért nem tudnak szaporodni? – kérdezte Grant. mint az orrszarvúé. Azaz mindig legalább két kontrolleljárásról gondoskodtunk. Egyébként a felnőttek is. többszörös biztosítási rendszert terveztünk. és magához ölelte. – Velociraptor – mondta halkan Grant. hogy a növekvő embrió hímmé alakuljon. És higgyék el: nem képesek szaporodni. Ez itt csak hathetes. ami azt illeti. – Nem bánt? – Nem. A fejecske centiméterekre volt Tim arcától. az embrió természetszerűen nősténnyé fejlődik.

– Nem maradhatnék itt. Grant – mondta Regis.A kis raptor hátradőlt. és újra meghimbálta mellső lábait a levegőben. hogy megnézze az arcélét.. Grant közelebb lépett. – Ezt nem szereti – mondta Regis. hogy bejárjuk magát a parkot. Regis újra megszólalt: – Grant doktor! Kérem szépen! – Nem lesz semmi baja.. – Grant doktor! Ezek a lények nem a mi világunkból valók. Az órájára pillantott. Az állat erre élesen felsivított. Grant azonban egyszerűen képtelen volt távol tartani magát az állattól. én nem bökdösöm. – De hát. – Most inkább ne – felelte Ed Regis. akik piszkálják és bökdösik őket. Tim látta a kis karmokat mindkét „kéz” három-három ujján. hogy itt a lehető leghumánusabb módon bánjunk az állatokkal – folytatta Regis. hogy öt perc alatt elpusztulnak. – Nem szereti. – Most már semmi baj. elkapott egy rongydarabot. Újra közelebb ment. A raptor tovább visítozott.. – Azonnal! – Regis kezdett feldühödni. bocsásson meg. Tim megsimogatta a kis raptort. és ránézett. fontos. – Minden rendben. de Grant oda sem figyelt. Az tüstént abbahagyta a visítást. – Kérem. Van. és. Egy olyan korból származnak. hogy játszam vele egy kicsit? – kérdezte Tim. – De kicsiny korukban ezek az állatok rendkívül érzékenyek. amikor még nem találkozhattak emberi lényekkel. Timre bámult. – A gyík szívverése még mindig gyors volt. Tim a mellkasán érezte kicsi szívének gyors dobogását. amelyet mi terveztünk nekik.. dr. miközben a gyík izgett-mozgott és tekergett. és pici karmaival huzigálni kezdte a másik végét. hogy minden lehetősége meglesz rá. hogy később alaposan megvizsgálja őket. ha elveszti a testi kontaktust. kicsi – mondta. és hirtelen vad haraggal sziszegett Grantra. – De kérem. . – Ígérem. Az átengedte a raptort a tudósnak. amely Tim karjaiban pihent. a szájába vette. Tim elengedte a velociraptort. – Úgy véljük. A kis velociraptor kitátotta a száját. és itt az idő. és kritikusan szemügyre vette a kis élőlényt.. – Elképesztő – mondta Grant. Grant visszanyújtotta az állatot Timnek. Aztán magasra emelte. és megvizsgálta.. Megtekinthetik az összes dinoszauruszt az élőhelyükön. – Megengeded? – kérdezte Timtől. kitapogatta a csontokat. Most megszorította a farkát. Aztán a raptor visszabújt a nyakába. Grant a hátára fordította az állatot. – Grant doktor! Tegye le! -mondta Ed Regis. amely átszaladt a szobán. – Három óra van. amely – úgy gondoljuk – adrenokortikálisan közvetítődik. Többet is elvesztettünk posztnatális stressz-szindróma következtében.

nem sok a tetem – mondta Wu. Egy kiváltó gén nem működik. Szóval ami a lényeg: kiderült. hogy Afrikában van egy olyan ganajtúróbogár-fajta. hogy a tetemek eltakarítására? – Arra is. – Éspedig? – Nézze! – mondta Wu. – Malcolm Granthoz fordult – hogyan is hívták? – Procompsognathus – mondta Grant. hogy tetemes méretű. nagy testű állatfajhoz tartoznak társult lények. Nagyjából mint ma a sakálok. – Maga nem tudja pontosan? – kérdezte mímelt megdöbbenéssel Malcolm. de még így is több olyan állatunk járkál odakünn. Aztán meg – folytatta – meg kell értenie. amikor azt hittem. Így aztán takarítási célokra sok kompira volt szükségünk. mi maradhat egy csordányi olyan állat után. Ilyenkor aztán. Akkor képzeljék el egy brontosaurus ürülékét. mint amilyeneket itt tartunk. Legalábbis az őshüllőfécesz nem bomlik le egykönnyen. „vissza a rajzasztalhoz”. amely tízszer annyi. hogy kéthetenként élelmiszert kell a szigetre hozatnunk. A procompsognathusok pedig valódi jurakori dögevők. mármint ha vannak tetemek. Vagy valami más probléma lép fel a genetikai sorban. már túl vagyunk a húsz fajon. Sok hasonló. . de emlékezetem szerint a megcélzott populáció ötven állat volt. amelyek az ürülékük lebontására specializálódtak. hogyne! – vágta rá Wu. Hány különböző fajt állítottak eddig elő? – Nem tudom egészen pontosan – felelte Wu –. és még több az öt és tíz tonna közötti. Három csoportban. Bizonyára tudják. – Ez tényleg probléma – mondta Malcolm. hogy a kompik megeszik a nagyobb növényevők ürülékét. hogy miként oldjuk meg. de azt hiszem. Kifejezetten törekedtünk arra. – Azaz nem ez volt a fő cél. így aztán sokat ürítenek. A tetejébe pedig a dinoszauruszok kihalása óta eltelt hatvanmillió év alatt a jelek szerint azok a baktériumok is eltűntek. Az ő ürüléküket viszont könnyedén lebontják a mai baktériumok. Wu doktor. aztán egyszerre csak közbejön valami váratlan hiba. – Az első tucat után abbahagytam a számolást. Ed? – Annyi. Belőlük éppenhogy szokatlanul sokat állítottunk elő. Lehetetlen. egy-egy állatot tökéletesen megcsináltunk mármint DNS-s szempontból. És a legnagyobb állatok nem emésztik meg az élelmüket valami nagyon jól. – Ezt úgy érti. Utána pedig próbálják elképzelni. Egy hormon nem választódik ki. Tizenöt fajnál. míg el nem értük a számot. e pillanatban tizenötnél tartunk. de állíthatom. hogy a Jurapark környezete annyira hiteles legyen. – Volt. Te tudod. – A második probléma viszont a hulladék eltávolítása. hogy ezt megtehessük. – Hány kompit tenyésztettek ki? – A pontos számot már elfelejtettem. Én nem tudom. Ez óriási feladatot jelent a számunkra. De most csak tizenöt van. amennyire csak lehetséges.. – Ezen a szigeten van néhány igen nagy növényevő. hogy folyton szemmel tartsák. a problémát megoldottuk. láttak-e már elefántürüléket – mondta Wu –. és újraemésztik. – És miért? – Nos. Wu mosolygott. – Újra elmosolyodott. hogyan csináljuk. – Pontosan azért épült a vezérlőterem. – Ötven állat – mondta Malcolm – egy kicsit sok ahhoz. ami az alapvető dolgunk –. Egyfelől táplálnunk kell őket. És ezt el is értük vagy legalábbis nagyon megközelítettük. hogy a legnagyobb őshüllőket ne tenyésszük ki. De mivel az összállatállomány mindössze kétszázharminc-valahány. amely kifejezetten elefántürüléket eszik. A kompik voltaképpen egy egész másfajta hulladékfeldolgozáshoz kellenek. – Biztosíthatom. – Pokoli sok időt fordítottunk rá. – És van a tizenöt között. amit elpotyogtat. amelynek a testsúlya meghaladja a harminc tonnát. – A kompik nagyon jellegzetes állatok. hát azt szerettük volna. hogy néha azt hisszük. tervezői kifejezéssel élve. Tizenöt. Hat hónaponként előállítottunk egy-egy csoportot.. Elölről kezdjük a munkát ezzel az állattal. Látni fogják. hogy ilyen kis sziget bármilyen ideig ellássa ezeket az állatokat. Körülbelül futball-labda nagyságú minden darab. amelyek megeszik a tőlük származó trágyát.A VEZÉRLŐ Útban vissza a vezérlőterem felé megszólalt Malcolm: – Még egy kérdésem volna. Vagyis ha elegendő kompink van. hogy az – mondta Wu mosolytalanul. és az az igazság. – Szóval hoztak már létre procompsognathusokat vagy mifenéket? – Ó.

tudja? – Látni fogjuk őket a kirándulás során? – Nem – mondta Wu. Kényelmetlen csend támadt. így zárt karámban tartjuk őket. hogyan készülnek az állatok. – Íme a vezérlőterem – szólt Ed Regis. Hacsak nem jutnak exogén lizinben gazdag étkezési forráshoz – ezt mi adjuk nekik tabletta formájában –. – De még mennyire. Az egyik fontos dolog. – De az állat. mégpedig két okból. Beültettem egy gént. akin most először látszott némi bosszúság. hogy minden helyesen működik-e. Az életformák egy olyan. – Kínából való. – Mi történik ott? – kérdezte Ed Regis. amelyek rohanó számokat mutattak. mi sem vagyunk bolondok. mi annak az állatnak a magyarázata – mondta Wu. – Amelyik megharapta az amerikai kislányt? – Igen. hogy így legyen – jelentette ki Wu. – De ha ezek közül a kompik közül csak egy megszökne a szigetről. némileg paradox a dolog... ó nem! Lényegében a mi foglyaink. hogy ezt bármi módon meg lehetne úszni. hogy tökéletesen alakul? Ezeket az állatokat még soha senki nem látta eddig.. A vastag üvegablak mögött sötét volt a terem. Végül is remélem. hogy összehasonlítsák a mi állatainkat az ásatási maradványokkal és kövületekkel. egy jó kikötő vagy akár egy jó dokk. Először is ott vannak az ellenőrzési eljárások: az állatainkat minden néhány percben megszámolja a komputer. ami a szigetről hiányzik. maga azt mondta. hogy mongoliensis. hogy képtelenek legyenek megállni a külvilágban. Van felnőtt raptor is itt? – Igen! – vágta rá Ed Regis. – Most. Ha csak egy is hiányozna. mielőtt magunk is. – Nyolc felnőtt nőstény. – Félbehagyta a mondatot. módjuk lesz rá. hogy vadon életképesek legyenek. a Juraparkban. és nem tudjuk. mondok valamit.. természetesen. hogy a mai világban nem volna ragadozójuk. Wu mosolygott. aki egyszerre csak zavartnak látszott. – És a másik ok? – A szárazföld több mint százötven kilométerre van innen. hogy csak egynek sikerül. hogy néha létrehoznak egy állatot. Csak itt élnek meg. – Nem tudom. – A velociraptorokat még nem sikerült teljesen integrálnunk a park egészébe... és egy nagy hajó képét. egy rég letűnt ökológia részei. Tudjuk másolni a DNS-t. – És ezt honnan tudja? – Onnan. – Megnézhetném őket ott? – kérdezte Grant. – Ja. Kizárt. . A monitorokat mind kikapcsolták. Ezért lizindependenssé tettem őket.. – De egyet biztosan tudok: semmiképpen sem lehetett a miénk. kiderül róla. – Éppen egy kis antirrhopust ástam ki. mint ön. hogy van! – mondta Grant. de ahogy növekszik. amíg nem látjuk a valóságban. Kívülről kell azt a szervezetükbe juttatni. – Hát akkor azt hiszem. A nőstények igazi vadászok. – Tudom. Nem akarjuk. hogy hibádzik valahol. amikor erősen hullámzik a tenger. – Egy darabig még nem – mondta vidáman Regis.– Biztosan – mondta Malcolm. Wu Regisre nézett. Wu. hogy előbbutóbb a paleontológusoknak. – Egy sem szökhet meg.. Az ördög vigye el! – Dokkolnak! – Kéthetenként jön az ellátóhajó a szárazföldről. hogy magam gondoskodtam róla. amely minden jel szerint tökéletes. Ellie Wu doktorhoz fordult. – Magam is sokat gondolkoztam ezen. akár el is mehet megnézni őket. de a fejlődés során sok az időzítési kérdés. – Nem hiszem. amely létrehoz egy – és egyetlen – hibás enzimet a proteinanyagcserében. amely sok millió éve kihalt. de a bennlévő férfiak oda sem figyeltek. amelyiket a parton találtak? – kérdezte Wu a szemöldökét felhúzva. – Megkopogtatta az ablakot. Hajóval is közel egy napig tart az út. éppen dokkolnak. és ily módon igazolják a fejlődési sort. ha van kedve. ahonnan magát a parkot ellenőrizzük és vezéreljük. – Hát hogyne. amíg itt várakozunk – az órájára pillantott –. – Az az állat jár a fejében. Grant is megszólalt: – De honnan tudják. Lehet. – Igen – mondta dr. és kijutna. bonyolult hálózatáé. amit az előbb láttunk – mondta Ellie –. A mi állataink pedig a külvilágban tizenkét órán belül elpusztulnának. várnunk kell egy kicsit. akkor tizenkét órán belül kómába esnek. azonnal észrevennénk. Ennek eredményeképpen az állatok nem képesek a lizin nevű aminosav termelésére. Tudjuk. – Nézzék. Kivétel nélkül – mondta Wu. hogy már tudják. Elég kényes ügy behozni a hajót. Sőt. a velociraptor.. – Érdekes – szólt Grant. Azt hiszem. hogy egy állat tökéletesen alakul. Eltarthat egypár percig. és elpusztulnak. Például az.. Ezeket az állatokat génsebészeti úton olyanná tettük. Nem szabadok. Semmi sem tartaná korlátok között őket. de mégis tételezzük fel. bizonyára látni szeretnék azt a termet is. Falkában vadásznak. hogy ezek őskori állatok. három kivételével. – A borostyánlelőhely után – mondta Wu. – Arról beszélt az előbb.

és játsszunk egyet. Ezenkívül több olyan fosszilis lelet került elő. menjünk le. A társaság egy földúton haladt tovább. és nagy. – Ugyanúgy. te meg én. kivel beszél – mondta Grant. – Talán a komputerekhez kell? – Lehet. egyfajta hatalmat gyakorolnak az óriások fölött. mint a Deinonychus – felelte Tim. Felnézett Regisre. Legyek zümmögtek a levegőben. mint a szüleik. akik ennyire nyíltan rajonganak a dinoszauruszokért? Grant szívesen elnézegette a gyerekeket a múzeumokban. bár ma már a Deinonychust is a velociraptorok egyikének tekintik. – Vagyis mennyire intelligensek? – kérdezte Malcolm. ahogy tátott szájjal bámulják a föléjük magasló. . aki benézett. Bekukucskáltak. Még mindig semmit sem látott. Grant mekegést hallott. Rejtélyesek. A külső kerítés mentén elektromos zúgás hallatszott. amely falkában vadászott. hogy még a kis gyerekek is megtanulják a dinoszauruszok neveit. Valamiféle jelképes szülők. El is tűnődött nemegyszer. Majd csikorgó léptek közeledő zaját. – Kis termetű húsevő. ahol egyetlen nagyobb prédaállatot több raptorcsontvázzal együtt találtak meg. amíg beengednek a vezérlőbe. hogy némelyikük meglehetősen intelligens volt. csak közvetett bizonyítékaink vannak. Maguk mögött hagyták a látogatóterületet. hatalmas csontvázakat. Előre mutatott. Az erőmű kétemeletnyi mélységbe nyúlt lefelé a talajszint alatt. amit olyan izgalmasnak találnak. de dinoszaurusznak kicsi – a súlya hetven és százötven kiló között volt. A tetején szögesdrót. A gyerekek pedig szeretik őket. hogy a dinoszauruszok alighanem meleg vérűek voltak. – Egy puszta üdülőhelynek nem lehet szüksége minderre – jegyezte meg Malcolm. Feltételezhető. ahogy a paleontológusok végül is megbékéltek azzal a gondolattal. Grant gyanította: ez lehet az oka. Végül arra a következtetésre jutott. – Biztosan generátor – mondta Ellie. Elhaladtak egy pálmafasor mellett. Ellie veregette meg a vállát. Grant horkantó hangot hallott. csakhogy beszélgessenek valamiről. hogy kimondják ezeket a nehezen kiejthető neveket. és elhaladnak a gépház mellett. Villanylámpák éles fénye világította meg. hogy a gyerekek azért szeretik a dinoszauruszokat. és északnak indult. Grant szerette a gyerekeket – hogyan is lehetett volna nem szeretni olyan emberkéket. sokan közülünk kezdik azt hinni. – Valószínűleg a dinoszauruszokat etetik velük – mondta Malcolm. hogy falkában vadászott. mert ezek a titokzatos óriások valamiképpen a föléjük tornyosuló. Túloldalt kétrétegű. Gyors volt és erős. Grant Ellie-vel és Malcolmmal együtt megkerülte az épületet. ami falkatámadásra utal. valamiféle szaglászást. Másfél méteresek is megvoltak.– Nekem is – csatlakozott hozzá Ellie. láncszemekből készült. amelyben kecskék voltak. – Méghozzá nagy – felelte Grant. – Azt attól függ. – Mit tudsz a velociraptorról? – kérdezte Grant Timtől. – Ha megkerülik a házat. mintegy felmérve a férfit. Újra és újra elcsodálkozott. Aztán hosszú. és egy kis állatkarámhoz ért. Intelligensebbek a legtöbb dinoszaurusznál. – Hát ez meg minek? – kérdezte Ellie. hogy a velociraptoroknak csoportosan kellett vadászniuk. – Nem látok semmit – súgta egy idő után Tim. – Egy kisváros ellátásához is elég az az energia. És persze a raptoroknak az agyuk is nagy volt. – Nem játszana velem egy kicsit? Dobhatnánk egyet-kettőt. négy méter magas kerítéshez értek. acéltetejű betonkunyhót pillantottak meg. hogy ők az urak. – Én is mennék – lelkesedett Tim. További másodpercek teltek el. – Tudod mit. A kerítéseken belül sűrű csoportokban elhelyezkedő nagy páfrányokat láttak. – Miért ne? – felelte Regis. Alig néhány métert kellett megtennie. furcsák és ijesztőek. amikor egy-egy hároméves azt rikoltotta: – Stegosaurus! – Azzal. és enyhe benzinszagot éreztek. és áthaladt egy sűrű bambuszsövényen. és nemsokára már hallották a generátorok mély zümmögését. Arra pedig. Mintha onnan jött volna a zúgás. amit itt fejlesztenek. hogy vajon mi az. A gyerek a nyomukban kullogott. – Helyes a válasz – mondta Grant –. mert csak így győzhették le a nagyobb prédát. Az egyik maga az állat külső megjelenése. ellenőrizhetetlen tekintélyt testesítik meg. – Halvány fogalmam sincs. mint ahogy a szüleiket is szeretik. már láthatják is a karámot – mondta Regis. néma csend. De ezt senki sem tudja biztosan. Süvítő turbinák és csővezetékek hatalmas rendszere futott le a földbe. – Ssssss! Grant várt. – Én nem – mondta Lex. Gyors számolás alapján ötven-hatvanra becsülte a számukat. kimutatják. alacsony. – De ne menjenek túl közel a kerítéshez! Te is mennél? – kérdezte a kislánytól.

sziszegő. amely fülként szolgált.. hogy rendbe szedje benyomásait. nem tarthatott tovább hat másodpercnél. majd visszaugrottak a páfrányok közé és eltűntek. ötöt. A fej nagy gyíkra. A néger férfi bólogatott.. egy más világra. Ropogva.. Hihetetlen. részben eltakarták a levelek. savanyú. de csak rövid távon egy-két méteren. kettesével repkedtek a forró szikrák. hogy szinte a mozgásukat sem látta. – Az – mondta Grant. Vannak óriásgyíkok. – De valahogy úgy tűnt. Egy emlős számára. Pergamenszerű volt a bőre. balról és jobbról egyszerre. hogy hű de intelligensek – jegyezte meg Malcolm.. Az állatok vicsorogtak. és áramütést kapnak. De azok az állatok ott a kerítés mögött becslésem szerint legalább kétszer olyan gyorsak. hogy észrevették. s lényegében azonos színű a nemrég látott bébivel: sárgásbarna. Egyes alligátorok ugyan elég gyorsan mozognak. két méter magas testekről. éles karmú hátsó lábuk felemelve. – Nem valami okosak. A látogatók döbbenetükben mind előreléptek. Grant csak valamiféle elmosódott képet észlelt az erős. amelyek számára ösztön az orvtámadás. – Gepárdsebesség – mondta Malcolm. ahogy előretörtek. – Ez aztán gyorsaság! – mondta Ellie. Grant még mindig azon igyekezett.. Lassan több fej is előbukkant. hüllőszerű hangot adtak ki magukból. hogy az ember egy másfajta életre kell emlékezzen. mi? – kérdezte Malcolm. A harmadik állat csak ekkor támadt. – Egyiküknek sem esett baja?! – Semmi bajunk – felelte Grant. hogy az emberek irtóznak a csúszómászóktól. Az állatok figyelték őket. Nem is csoda. Tim rémülten felsikított. aztán egész testükkel a levegőbe lendültek. mint bármelyik élő csúszómászó. mély. mint a tigris csíkjai. – Tudja mit. A rohamozó raptorok döbbenetes sebességgel tették meg a majdnem tízméteres távolságot a kerítésig. A szemek nem pislogtak. A támadás hirtelen jött. Három fogóujj volt a kézen. egyensúlyozó farkokról. Malcolm is megjegyezte: – Figyelemre méltó a gyorsaságuk. vöröses sávokkal. az elejétől a végéig. a merev.. A fej 70-80 centi hosszú lehetett. – Megszólaltak a vészjelzők – mondta a benyomott. esetleg krokodilra emlékeztette Grantot. A két nagy sötét szem hidegen meredt rájuk. Az egész támadás. elég gyorsan ahhoz. – Azt azért nem mondanám. A néger elhallgatott. hogy elkapjanak egy embert. – Pontosan. itt-ott megszenesedett kerítésre nézve a férfi.. és mellmagasságban vágódott neki a kerítésnek. – Állandóan ezt csinálják. – Száz-százhúsz kilométer óránként. a hidegség. – Te jó isten! – szólalt meg Tim. A hegyes orr-részről hosszú fogsor haladt hátrafelé egészen a hallójárat nyílásáig. Csak enyhén rothadó szag és lassan elillanó. Aztán nekirepültek az előttük feszülő kerítésnek. Hideg tekintettel meredtek rájuk. mint például a másfél méteres indonéziai Komodo-sárkány. amelyek stopperral mérve óránként ötven kilométeres sebességgel futnak. Amint visszafelé sétáltak. A némaság. Alligátorok vagy más nagy csúszómászók között lenni mindig is egyet jelentett azzal. és hátat fordított. sötétebb. Horkantások hallatszottak a kerítés túloldalán a növények mögül. van valami leírhatatlan idegenség abban.. – Falkában vadászó állatok. A kerítésnek rohannak.A páfrányok között Grant megpillantotta egy állat fejét. hogy. Ahogy Grant figyelte. A kéz finoman. Hunyorogva pillantott Malcolmra a délutáni napsütésben. Ugrott. Akár a madarak. Mozdulatlan volt. Grantnak megborsózott a háta. négyet. mintha hirtelen rontanának előre. mindegyik hajlott karomban végződött. amint röpködtek körülötte a szikrák. az állat nem mozdult. A sebesség valóban döbbenetes volt – az állatok olyan gyorsan törtek elő. mint amilyen az ember is. hogy elválassza egymástól a páfrányokat az állat arca előtt.. – Falkában vadászó állatok – mondta fejét ingatva Grant. Ez az állat persze nyilván nem fogta fel. A velociraptorok sziszegve zuhantak vissza a földre. a tempó – minden annyira más. a csapdába ejtés. ahogyan a hüllők vadásznak áldozataikra. señor? Örüljön. . Az állatok vicsorogva morogtak.. „Ez vadászik ránk!” gondolta. Öldösik az embereket rendesen. látta. égett bűzfelhő maradt utánuk. a hajlott karmú végtagokról és a hegyes. éles fogakkal teli tátott szájakról. fekete bőrű férfi futott feléjük. lassan és óvatosan félretolta a páfrányokat. hogy ott az a kerítés – mondta. – Magukra támadtak? – Igen. – Sokkal gyorsabbak. amely már eltűnt a föld színéről. Hárman. De mintha nem is bánnák. Grant hármat számolt meg. hogy egyetlen mellső végtag nyúlik fel lassan. Overállos.

– Úgy van. mint valami modern faj túlméretezett változatát. Isten tudja. minek vélnek. – Én azt mondanám. hogy így van. a kor legnevesebb brit anatómusa a Dinosauria – „rettenetes gyíkok” – latin elnevezést adta nekik. amikor nemhogy emberek. hogy az Úr nem engedheti az Ő teremtményeit kipusztulni. Mondjuk az afrikai kígyászsasnak vagy a kazuárnak. Amikor az 1820-as és 30-as években az első óriási csontok napvilágra kerültek. mint a kazuárt. hogy az emberi lényeket könnyű megölni. azon egyszerű oknál fogva. – Hogy csinálják így.. élénk madár fölött. – Sőt. mint az oroszlán vagy a tigris. – És ez az összehangolt harcmodor. Jó. hihetetlenül gyors vadászok valóságos látványához képest. – Valójában nagyon is közel van ahhoz. hogy a nagyragadozók. A bágyadt hüllő képe fokozatosan győzött a gyors. amit a paleontológusok valaha hittek. ha tehetnék? – Azt hiszem. Csak a szemükkel kommunikálnak. a tudósok kezdték ostoba. hogy meggyőző állat-e ez a maga számára? Tényleg dinoszaurusz? – Igen. – Megölnének és megennének bennünket. és végez vele. nem született emberevők. Most azonban be kellett látnia. mint egy mai ló. amire én voltaképpen rá akartam térni – mondta Malcolm –. – Bárhogy is legyen – mondta Malcolm –. – Azért kérdem – mondta Malcolm –. – Meglepi ez magát? – Nem igazán – felelte Grant. én is úgy tudom. – És ezek a dinoszauruszok tényleg minket akartak megtámadni? – Igen. Végül is olyan korból valók. de a mozgásuk inkább olyan. Ehhez összehangoltság kellett. mert a közvélekedés szerint semmilyen faj nem halhatott ki. visszatérni az élénkebb dinoszauruszképhez. Később tisztázódott. mint a Tenontosaurust. hogy a dinoszauruszokban keveredni látszanak a gyíkok. Igen ám. mert úgy hallottam. hogy ötszázkilós állatokat is leküzdjenek. Csak az elmúlt években kezdtek egyes kutatók. hogy ez az istenfelfogás téves. és a csontok kihalt állatokéi. mint a madaraké. olyan a bőrűk és általában az egész külső megjelenésük. és ez is volt az uralkodó nézet vagy negyven évig. de milyen állatokéi? 1942-ben Richard Owen. hogy eltérő sajátosságok keverékét mutatják. Szóval azon gondolkodom: vajon ők is csakúgy tanulták – valahol. lassú mozgású. Owen felismerte. a velociraptor voltaképpen pontosan ugyanolyan benyomást tett Grantra. élénk lények voltak. hogy több dinoszauruszfajta felegyenesedve járt. nyelv nélkül? – Ó. no és persze madaraknak. – Márpedig akkor ezeknek a dinoszauruszoknak még felkészületlenebbnek kell lenniük. ugyanolyan villámgyorsan és halálosan veszedelmesnek látta. úgy mentek tovább. hogy a dinoszauruszok csípője madárszerű. Azért volt ez így. Azonkívül pedig a jelek arra mutattak. Kis emlősöknek. Egy csimpánzcsoport becserkész egy majmot. Szerintem az. nem gyíkszerű. Owen elképzelése szerint a dinoszauruszok gyors mozgású. – Úgy van – mondta Grant. az akkori tudósok kötelességüknek tartották úgy magyarázni őket. struccszerű új-guineai madarat. mint Grant. – Várható volt – felelte Grant. mikor –. Különösen feltűnő volt. – Igen. amely maga is olyan sebes volt. A jelenkori világban csak néhány igen kis emlősnek ilyen gyorsak a reflexei. amikor meglátnak bennünket. ez a karmos.. ezek után most már roppant kíváncsi vagyok arra a vezérlőteremre! . Például a kobraölő mongúznak. hogy embert ölni könnyű? Mindannyian elnémultak. – A csimpánzok is mindig anélkül támadnak. az az. amelyek életükben száz tonnát is nyomhattak –. de amikor napvilágra kerültek az első igazán gigászi leletek – olyan – állatok maradványai. kihalásra ítélt óriásoknak látni a dinoszauruszokat. és hasonló a gyorsaságuk és a ragadozóösztönük is. – Az ásatások tanúbizonysága szerint a velociraptorfalkák képesek voltak rá. a krokodilok és a madarak jellegzetességei. Csak ez után válnak emberölővé. a nyelv egy cseppet sem szükséges az összehangolt vadászathoz – mondta Ellie. – Nos. ez így van? Ezeknek az állatoknak valahol a fejlődésük során rá kell jönniük. hogy az elképzelései messze elmaradtak e nagy. Magát Grantot kollégái kifejezetten radikálisnak tartották a dinoszauruszviselkedésről vallott nézetei miatt. – Szóval ezek a velociraptorok hüllőnek látszanak. de még nagyobb emlősök sem léteztek. Ugye. igen.

mint rekonstruáltuk a múltat vagy annak egy verzióját. John. – A szórakoztatásnak pedig semmi köze a valósághoz. – Rendben van. A szórakoztatás a valóság antitézise. Attól félek.. A harmincnégy éves Wu nagyon is tudatában volt annak.4-ES VERZIÓ – Volt valami gondja a társasággal? – kérdezte Hammond. de bizonyos tekintetben nem kielégítőek. milyenek voltak az életben. – De hiszen azt kértem magától. hogy amióta csak dolgozik. El kellene indítanunk a 4. nem teljesen – mondta Wu. a pálmafák sűrűjében. – Komolyan az a véleményem. – Nézze – kezdett bele mégis –. hogy hatalmas állatokat lássanak. És én éppen ezekről a részletekről szerettem volna ma beszélni önnel. – Micsoda? Háziasított dinoszauruszokat?! – horkant fel Hammond. És az a helyzet. ami a várakozásaiknak megfelel. Hammond egyenesen az egyetemről – posztgraduális tanulmányai kellős közepéből – emelte ki. és adott neki állást. a világon szinte senki sem látott még valódi dinoszauruszt.4-ES VERZIÓ. – Nem – felelte Henry Wu. Mint a film. amelyet Wu magával hozott. Ami múlt. és az valami egészen más. – Kérem. háziasítottabb dinoszauruszokat is. Nem tettünk mást. – És meg is kaptam! – Tudom – mondta Wu... – Az emberek nincsenek hozzászokva ahhoz. Senki sem tudja. Ezt akarom. hogy azt akarják – mondta Wu. hogy ezek igazi dinoszauruszok. amelyek mindegyikén a parkban mozgó állattok látszottak. – De miért? Mi a baj velük? – Voltaképpen semmi – felelte Wu –. – Fel-alá járt a nappaliban. – Jobbat a valódinál? . Henry! – mosolygott Hammond.4-es verziót. Jobbat is elő tudok állítani. hogy a látogatók azt fogják hinni. A nappali levegős volt. – Természetesen vannak bizonyos gyakorlati következmények is – mondta Wu. nagyon sajátos. – Kinek kellenek háziasított dinoszauruszok? Az emberek az igazit akarják látni! – De hiszen épp erről van szó! Én nem hiszem. – Maga le akarja cserélni az egész jelenlegi állatállományt? – kérdezte Hammond. Nem meggyőzőek.A 4. amikor itt állunk. hogy én az egyszerű beszédet szeretem. Hammond nagyot sóhajtott. hogy valahogy fel vannak gyorsítva. A kávézóasztalon ott hevert a dosszié. – Jobbat? Milyen szempontból? – Hogy csak egy dolgot mondjak: túl gyorsak – mondta Henry Wu. – De hát Henry! Ezek igazi dinoszauruszok! Hisz épp maga mondta! – Tudom – mondta Wu. Hammond elegáns bungalójának nappalijában álltak. Én pedig azt mondom. az múlt. Tekintheti esztétikai kérdésnek is az egészet. Hammond szolgálatában áll. – Csakhogy. – Semmi a világon. Azt nem is lehet újjáteremteni. kivéve azt. vagyis ebben a pillanatban. Hogy fogja ezt megmagyarázni Hammondnak? Hogyan lehetne? Hiszen Hammond alig-alig fordult meg a szigeten. amelyek ilyen gyorsak. mint aki kellemetlen szagot érez. Hammond a homlokát ráncolta. John Hammond úgy ráncolta össze az orrát. – Azt akarják látni. és közben a szobában lévő képernyőkre mutatott –. és. Henry! Megint elvont eszmefuttatásokkal akar szórakoztatni? Tudja. – Úgy van. – De könnyen kitenyészthetnénk lassabb. – Maga mondta. – Esztétikai? – kérdezte csodálkozva. és? – A jelenleg meglévő dinoszauruszaink igaziak – mondta ismét Wu.. hogy ez a park a szórakoztatást szolgálja – folytatta Wu. – Hát szóval. Vagy fél tucat tévémonitorral szerelték fel. hogy fontolóra kellene vennie a második fázissal kapcsolatos javaslataimat. hogy jobbat is tudunk ennél. atyai módján nézett a tudósra. és igaz. és kényelmes.. – Elfogadták a magyarázatát? – Miért ne fogadták volna el? Végül is őszinte beszéd volt. Hammond a maga szokásos türelmes. Baj csak a részletek körül van. – elhallgatott. Ez állt rajta: ÁLLATFEJLESZTÉS: A 4. nagy vonalakban.. most. A monitorokra mutatott. A ház a park északi szektorában bújt meg. – Inkább ne csapjuk be önmagunkat! Mi itt nem teremtettük újjá a múltat. A mostani dinoszauruszaink igaziak. amit szeretne megértetni vele.

És azért is megtettünk mindent. hogy a világ a legteljesebb mértékben elégedett lesz. amelyek szabadalmaztathatóvá tették őket. mint a régi fénykép. amelyet retusáltak. mit mond Wu. Wu megdöbbenten pislogott. amikor kezdtünk felkészülni az állatok majdani fékentartására. A lézer. – De akkor a dinoszauruszok nem volnának valódiak. hogy minden erejét összeszedve kitalált valamit – szerinte a legjobbat –. Maga nagyon keményen dolgozik régóta. Mert öt hosszú év után a Jurapark a befejezéséhez közeledett. hogy el sem jut Hammond tudatáig amit mond. eszébe ne jussanak az egyetemek! Te jó Isten! . – Ha nem haragszik meg az őszinteségemért. John Hammond pedig többé már nem is figyelt rá. Ez itt nem a valóság! – Reményvesztetten vállat vont. minthogy lámpalázas és ideges egy kicsit. A legteljesebb mértékben. fantasztikusat! – és most eljött az idő. A legkülönfélébb eszközök egész tára áll a rendelkezésünkre – és most mind túl lassú! Muszáj igazodnunk a helyzethez. akár a genetika területén. – Miért? – Miért? Nézzünk szembe a tényekkel! – felelte Hammond. Én azonban meg vagyok győződve róla. Csupa bizonytalanság volt minden. és fantasztikus munkát végzett – komolyan mondom. békésebb verziót az állatkertünk számára? Hammond ismét elkomorodott. amikor munkatársául választotta. A fontos dolog ma már nem az egyetemeken történik. a MRI. – Az elkerülhetetlen volt. és állítsunk elő pontosan olyan dinoszauruszt. mi lesz a doktori programokkal. a tranzisztor. A kutatóintézetben mindenki tudta. a lyukakkal. – Természetesen. – Emlékezzék vissza. – Végül is ezek az állatok már amúgy is módosítottak. A dinoszauruszok DNS-e olyan volt. Henry! Megszólalt a telefon. Nem akartunk várni. – Norman mindig azt mondta.– Miért ne? – kérdezte Wu. Látta. Két héttel a temetés után John Hammond felkereste Wut. Hatalmas áramütőket gyártottunk. Ha komoly eredményt akar elérni akár a számítógépek. ágyúkat. így azt sem tudtuk. Ez csak egy állatkert. – Az egyetemek ma már nem az ország szellemi központjai. azaz a mágnesrezonanciás diagnosztikai képalkotás. Nevetséges még a gondolat is. egyenes módon közelítette meg Wut. – De hisz most sem azok! – mondta Wu. Lemaradtak. Különösen a kezdet kezdetén. a szekvenciában előforduló hiányokkal. és mindenki nyugtalankodott a pályája miatt. Gondolnunk kellett a befektetőinkre. Mi sem természetesebb. – Legalábbis.. ha tartja valamire a saját tehetségét. Atherton halálakor a gyász mellett teljes zavarodottság lett úrrá az intézetben. – Mik a tervei ezután? – Nem tudom. már negyven éve nem. óriás villanycsősz-szerkezeteket. Huszonnyolc éves volt akkor.. de itt-ott kijavítva és tisztázva. a mikroprocesszor. én azt hiszem. Sőt. A második világháború óta minden igazán fontos felfedezés. Henry! – Beszéd közben finoman kifelé kormányozta Wut a szobából. De Hammond olyan célratörő. Tudja. és amelyet mi magunk is könnyebben kezelhetünk? Egy lassabb. – Figyeljen rám. a komputertomográfia. találmány magánintézetekben született. honnan lesz majd pénz. hogyan értethetné meg főnökével az elképzelését. Hammond megvonta a vállát. Henry! – mondta Hammond. De hiába. a régi szép időkben. Senki sem tudta. mi volt 87-ben. Volt idő. gépkocsira szerelt. Az egyetemeken megállt az idő. hogy Muldoon katonai felszereléseket akar? LAW-rakétákat és lézervezérlésű fegyvereket? – Muldoont hagyjuk ki ebből. De én azt mondom: miért kellene itt megállnunk? Miért ne folytassuk a munkát. amikor Henry Wu posztgraduális diákként Norman Atherton laboratóriumában készült a doktorátusára Stanfordban. – Rosszul teszi – mondta nyersen Hammond. Lényegében azonos az eredetivel. hogy azt nem lehetett elfelejteni. amikor Hammond nagyon is odafigyelt arra. – De John – próbálkozott még Wu. mire lesz szükségünk. jó? – mondta Hammond. hogy gyorsítsuk a növekedésüket. Hogyan magyarázza most el neki. a személyi számítógép. és sorolhatnám a végtelenségig. amit elért. Kutatás. mi a valós helyzet a DNS-kiesésekkel. amelyek villanyárammal töltött dróthálókat lőnek ki. Hogy kételyei támadtak. – Valamilyen egyetemi állásra vágyik? – Igen. és az ő érveinek lényege pedig technikai természetű volt. meg lizindependenssé. hogy Atherton valamiféle kapcsolatban volt Hammonddal. amelyeket Wunak úgy kellett kitöltenie. hogy felvegye. hogy maga kezd begyulladni. Mindet a mi kívánságaink szerint állították elő. Hogy mielőbb elérjék a felnőttkort. Hammond pedig elindult. amit ne tudna maga is. Olyan géneket vittünk be. de mégis csak kitalálta. a gyermekbénulás elleni vakcina. de a részleteket nem ismerte senki. aminek eredményeként. hogy maga a legjobb genetikus az intézetben – mondta. Ne nézzen olyan meglepetten! Nem mondok semmi olyat. – Ezt próbálom megértetni magával. – Én nem aggódom. amilyet szeretnénk? Amely elfogadhatóbb a látogatók számára. és a vállára tette a kezét. a hologram. Wu még mindig azon törte a fejét. Akkor még egyetlen teljesen felnőtt egyedünk sem volt. Hammondot sosem érdekelték a technikai részletek. hogy néhány ember lássa.

hogy én semmi okot sem látok rá. – Miről van szó? – Részleteket nem mondhatok. – És rengeteg pénzem annak. És most minden valószínűség szerint a világ hamarosan tényleg tudni fogja. Henry. ahogyan azt Hammond ígérte. Senki sem szól bele. Én ötéves szerződést ajánlok magának. Az adminisztráció pedig nem állt közel a szívéhez. – A hüllőkkel könnyebb a dolog. hadd menjen. úgy jobb. Ezt megígérhetem. hogy ki kellene javítanunk a valóságot pusztán azért. Ehelyett azt kellett tapasztalnia. és évi tízmillió dolláros költségvetést. . de nemegyszer félelmetes nyomás nehezedett rá. És nem is azért vállalta az egészet. az egész világ tudni fogja. A technológiák megértek. Persze az elmúlt évek azért nem egészen úgy zajlottak. mert azt képzeljük. amiről senkinek sem tartozik számadással. És ez az. – Nem. ami egészen más. Már itta John Hammond szavait. hogy tapasztalata és munkája révén neki is azok közt kell lennie. – De nem azonnal. – Én munkáról beszélek – folytatta Hammond –. – Gondolja csak végig. hogy a dinoszauruszok a madarakhoz álltak közelebb. Az előállításukra létrehozott technikát olyan pontosan kidolgozták. – Ne is haragudjon. Volt. Ez az.. hogy a befolyása napról napra csökken. Mi kell a tudósnak a munkához? Idő és pénz. igazi teljesítményről.. Ám végül mégis sikerült. Honnan szerez több asszisztenst. a DNS meg túl hosszú! Elismerést szeretne. Wu hosszan hallgatott. – Hol is tartottunk. hány kérdőív. ami valószínűleg megvalósíthatatlan. Az utolsó két évben pedig Wu már elsősorban adminisztrátor volt. Lehet. A klónozáshoz még tíz-tizenöt év kell. Feltéve. hogy a jövőben is kell még változtatásokat végrehajtanunk. legalábbis ilyen rövid idő alatt. amiről senki sem hitte. A dinoszauruszok már léteztek. John Hammondnak pedig többé már nem volt szüksége Henry Wura. Helyes. mi mindenen kell keresztülmennie. Hammond akkor nevetett. – Hogy próbáljon megvalósítani valamit. Elérte. Amit változtatnunk kellett a genomon. mit tett. mihelyt rájöttek. a közelébe se menjen az egyetemeknek! Akkoriban Wu bizony nagyon is vágyott rá. Jól van. Madárklónozást végeztek. A tanszékvezetőség. nem több. De maga a munka is irányt változtatott: már nem is hüllőklónozásról volt szó. És Henry Wu úgy vélte. – Ne aggódjon! Ha sikerül. – Te jó Isten! – ismételte a szavát Hammond. Mindenki más egyszerűen félreáll az útjából! Túl szépen hangzott ahhoz. de én meg azt hiszem. – Jól van. gondolta Wu. Végül ezt kérdezte: – És mit kér cserébe mindezért? – Hogy kísérelje meg a lehetetlent – felelte Hammond. ha szükséges? Nagyobb helyiséget a kutatásaihoz? Mennyi idejét veszi el mindez? Egy nagy tehetségű ember nem vesztegetheti az idejét bizottságokra meg beadványokra. hogy az lehetetlen volna – mondta Wu. hogy az már szinte rutinszerűnek volt mondható. Az egyetemi pénzügyi bizottság. mint az emlősökkel. Henry. hogy mit csinál. ez már csak ad neki jogot a beleszólásra. mire költse. amit a vonal másik végén mondanak. Maga dönt. aki beleszóljon. – De a későbbiekben publikálható? – makacskodott Wu. jogi vagy más okokból. de sokkal nehezebb. Ötvenmillió dollárt.Wunak a szava is elakadt. Így tisztességes. amit látniuk kell! Ez a kötelességünk. – Rendben lesz – mondta Hammond a telefonba. hogy igaz legyen. – Ja persze. hány hozzájárulás kell hozzá! Az ügyvezető bizottság. hogy megszépítsük a valóságot. Henry – mondta Hammond enyhe éllel a hangjában –. azt muszáj volt. hogy bekövetkezik néhány alapvető fejlemény. közben Wura mosolygott. Beszéltünk mi már azelőtt is erről. hogy mihamarabb elismerést szerezzen magának. – Nekem öt évem van – mondta Hammond. Az élet túl rövid. hogyan tovább. de nagy általánosságban hüllők klónozásáról van szó. például az ellenálló képesség fokozatára vagy más célból. De azt nem hiszem. akik eldöntik. Hallgatta egy kicsit. Sokkal.. – Én nem hinném. de félek. nem érti. – Letette a kagylót.és támogatási kérelem. aki kutatócsoportokat és számítógép-vezérlésű génszekvencerek egész ütegeit irányította. – Tudom.. Henry. hogy lehetséges. – Publikálható lenne a munkám? – Előbb-utóbb igen. barátom! És Hammond mosolyogva kinyitotta előtte az ajtót. Öt évi hajsza után már csak egy év van hátra a park nyitásáig. csak hogy egyáltalán belekezdhessen valamibe! Hány ösztöndíj. amit az emberek látni szeretnének. Most igazi dinoszauruszaink vannak odakinn. igaz? Ha elismerésre vágyik. igenis értem! És azt is őszintén meg kell mondjam magának. aki már most hajlandó megpróbálkozni vele. Henry? – A második fázisnál – mondta Wu.

– Mennyire pontos a helyzetmegjelölés? – Másfél méteren belül van. akikkel dolgozott. – Szóval az ellenőrzőrendszereinkre kíváncsi? – kérdezte Gennarótól Arnold. – Hogy csinálják? – Mindenütt ott vannak a mozgásérzékelőink az egész parkban – válaszolta Arnold. – Ez igen – mondta elismerően Gennaro. megmutatom én magának a park összes állatát! – morogta Arnold. hogy sosem találkozik az útjuk. néhány pedig rádió-teleméteres. Még ha nem is nézzük a videomonitorokat. – Arnold pöfékelt. mint a véreb. Fölpislantott a többiekre. Ha kivetíti az ember a nagy és a kis rexet.9 . A „kis rex”. csupaideg. – Például vegyük az állatkövetést. – Ez a mi fiatal T-rexünk. avult szemléletű kutatónak nézik. látható. hogy ezért régimódi. – Az meg mi? – A számítógép minden tizenötödik percben megszámlálja az állatokat kategóriánként is – mondta Arnold. mellettük kódszám. – Ez jelen pillanatban kettőszázharmincnyolc állat. – Követ el hibát a számítógép valaha is? – Csak a bébiknél. Azokat néha összekeveri. de nem bánta. – Arnold leütött egy billentyűt a gépén. De az irkafirka egyetlen területen belül helyezkedett el: közel a lagúna délkeleti partjához. Ezért aztán zavarodottan és elkedvetlenedve állt – a szó szoros értelmében elveszetten – egy idegen földrajzi terepen. Malcolm pedig egyenesen elemében van. – Például? – kérdezte Gennaro.A VEZÉRLŐ A lesötétített teremben Grant végignézett a számítógép-monitorok villódzó során. Aztán ott a kategória szerinti számlálás. s közben székestül feléjük fordult. – Még fiatal. – Hol van a nagy rex most? – kérdezte Gennaro. Persze a mozgásérzékelők nem jelzik az állat faját.1 3. hogy Gennaro tökéletesen otthon érzi magát. felnőtt rextől. és megint új cigarettára gyújtott. – Fogalmazzunk úgy: ha most kihajt kocsival. és mekkora a mozgásterülete – mondta Arnold. Azt viszont azonnal észrevette. – Újra lenyomta a billentyűt.1 3.9 3. Tudta. A bébik szinte mindig a nagyok csordájának közepében maradnak. És ellenőrzi. ha nyomon van. Grant soha nem érzett ilyesmit. némelyiknek egészen különleges érzéke volt a komputerekhez. hogy olyan lett. semmit sem ismert. Idegen. És igyekszik távol tartani magát a nagy. A térkép kitisztult. Az ő összes mozgása a parkon belül az elmúlt huszonnégy órában. – Az előző huszonnégyben. Nem szerette a számítógépeket. az összes állatot pontosan ott fogja találni. szimatoló hangokat hallatott. Csupa pötty. A vonalak a térképen sűrűn rajzolódtak egymásra. egyfajta intuíció. negyvenöt év körüli férfi volt. a számítógép figyeli őket. – Csak időben tudjuk érzékelni. – Ott van. de a videóról közvetlenül megkapjuk a képazonosítást. mint a karácsonyfa. – Meg az előzőben. – Így: Állatok összesen Faj Tyrannosaurus Maiasaurus Stegosaurus Triceratops Procompsognathida 238 Várt 2 21 4 8 49 Talált 2 21 4 8 49 Ver 4. Arnold újabb billentyűt nyomott le. zavarba ejtő szerkezeteknek érezte a számítógépeket. mint egy kisgyerek firkálása. Egyik cigarettáról a másikra gyújtott. ezért közel marad a vízhez. olyan kicsi a képük. A srácok közül. kék vonalak gyulladtak ki. – Nekünk hihetetlen ellenőrzőrendszereink vannak! – mondta. ahol a térkép szerint vannak. és egyetlen világító. ni! – És a kis rex? – A fenébe is. akik a teremben voltak. Annyi fénypont gyúlt ki sorra a gépen. amelyből semmit sem értett. hol van. és a nagy függőleges üvegtérképen csipkés. hol van mindenki.3 3. De amiatt nem aggódunk nagyon. A főmérnök sovány. – A legtöbbjük merevkábeles. és rögtön ideges lett. – Megint lenyomta. kódszámmal ellátott folt jelent meg a lagúnától északnyugatra fekvő mezőn. – Milyen időközönként mérik be őket újra? – Minden harminc másodpercben. Még az operációs rendszer és a felhasználói program közti alapvető különbséget sem fogta fel igazán. Halk.

– Bizonyos szempontból valóban hasonló dolog a szoftverhez. A gondolat. Mégiscsak élőlényekről van szó. – Jól van – mondta Malcolm. mert a víz mozgása és a felszínen keletkező légáramlás megzavarja a szenzorokat. Nem tudta volna megmagyarázni. amikor csak akarom. Az egyik othnieliánk belegabalyodott egy fa ágaiba. Most foglalkozunk a gondolattal. Vagyis az egyednek vagy az A csoportban. És ha baj van. Ellenőrizhetem az állatokat vizuálisan is. hogy követniük kell! – vágta rá türelmetlenül Malcolm. – Tehát negyvenkilenc procompsognathidát jeleznek. ahol nem tudjuk használni őket. a dzsungelben. – Verziószámuk van? Mint a szoftvernek? Új kibocsátás? – Nos. hogy az ember beleszeressen ezekbe az állatokba. hogy áttérünk a 4. amelyik mindet el-elkapja. igen – felelte Arnold. hogy én azt gyanítom.3 4. hogy tévedek? – Két módon – felelte Arnold. – Természetes. Teljesen új szemmel néz körül. Ha netán valamelyik állat érzékelő nélküli területre lép. mozgásérzékelők segítségével történik. igaz? – Igaz. – Először is követni tudom az egyedek mozgását a többi kompihoz képest.1 3. De szinte mindenütt másutt ott vannak. – Pillanatnyi azonosítási képek. Egy stegó belepusztult abba a bélbetegségbe.0 3. – Csak egy-két hely van.. mert két különböző adatgyűjtőmódot hasonlít össze. – Öt percen belül? – Úgy van. mert így szólt: – Nézze. és megfulladt. csoportban mozognak. Egy hypsilophodonta leesett. Tegyük fel. hogy némelyikük nem a helyes faj.9 4. de. A legfrissebb verziónk a 4. – Értem – mondta Malcolm. leadja nekünk a figyelmeztetést. Arnold alighanem észrevette az arckifejezést.Othnielia Velociraptor Apatosaurus Hadrosaurus Dilophosaurus Pterosaurus Hypsilophodontida Euplocephalida Styracosaurus Microceratops Összesen 16 8 17 11 7 6 33 16 18 22 238 16 8 17 11 7 6 33 16 18 22 238 3.3 2. Wu doktor laboratóriumainak új verziót kell készítenie.9 4. – És mi a helyzet a fizikai elszigeteléssel.0 3.1 vagy 4... mint a szoftvert. Két kompicsoportunk van a parkban. Például a folyón. Hogyan bizonyítják be.1 – Amit itt látnak – mondta Arnold –. Nem az állatkövető-adatokon alapszik. – Ezek a képek. valahogy taszította Grantot. minden számlálás szenzorok.4-es verzióra.1 3. tökéletesítik és modernizálják. – Vagyis az összes állatot láthatja. és figyeli. öt percen belül tudnánk. – De térjünk vissza a számlálás kérdésére! Ha jól értem. vagy a B csoportban kell lennie. Ha pedig nem jön. Grant szólalt meg: – És mi az ott a jobb szélső oszlopban? – Az állatok kibocsátási verziószáma.3. A kompik társaslények.. nem szabad. Néha akad velük valami baj. de ösztönösen viszolygott tőle. a fékentartással? – kérdezte Gennaro.. és a számítógép vészjelzést adott. hogy élőlényeket úgy sorozatszámoznak. Ha egy állat hiányozna. Mindegyik esetben mihelyt az állat megszűnt mozogni. ha akarja? – Igen. Amint felfedezünk a DNS-ben valami zűrt. Wu laboratóriumainak muszáj új verziót készítenie. Az egésznek az a lényege.. miért – túlontúl is új volt az egész –. hogy a számítógép nem hibázhat. Gombokat nyomott meg. dr. hogy senki se feledje: úgy állították őket elő. Grant doktor. Az ember teremtményei.1 4. a számítógép megjegyzi. – És ki is próbálták már ezt a valóságban? – Hát ha úgy vesszük – mondta Arnold. – Volt egy-két állatpusztulásunk. – És ezek a szenzorok mindenütt ott vannak a parkban? – A földterület kilencvenkét százalékát lefedik – mondta Arnold. az egy teljesen különálló számlálóeljárás. – Igen. mire az egyik monitoron gyorsan peregni kezdtek a kompik képei egytől negyvenkilencig számozva. Fontos. Nekünk pedig figyelemmel kell követnünk az éppen kinn lévő verziót. – A másik a közvetlen kép – folytatta a mérnök. Az elmúlt öt percben belüliek. a számlálás leállt. és kitörte a nyakát. – Kijuthatnak a körülzárt . mikor jön ki onnan.

nehogy megszuvasodjanak. – No és a mechanikus rendszereik? – A vasutakra gondol? – kérdezte Arnold. – Azt most inkább ne – szólt közbe Gennaro. Önálló az energiaellátása. – Dehogy. s a táblán narancsszínű vonalhálózat tűnt fel. csak az egyszerűség kedvéért hívjuk őket „vasutaknak”. – Rengeteg eszközünk van hozzá. A rendszer nem kommunikál a külvilággal. és van egy „Madárházvasutunk”. amelyikhez alkalmazkodtak. ahol a csónakok víz alatti síneken haladnak. gondolom. de még egyik sem működőképes. hogy az állatok kiszabadulhatnak. – Ezek az árkok mindenütt legkevesebb négy méter mélyek. – Csak nem olyasfélék. és megszólalt: – Akkor kimegyünk és szépen visszahozzuk – mondta. – No és ha megszökik egy a szigetről? – Az kevesebb. Először is ott vannak a vizesárkok. hogy megtörténik. Arnold újabb cigarettával pöfékelt. hogyan kell a gondját viselni egy krokodilnak vagy egy elefántnak.. – De ha mégis kiszabadulna egy? – kérdezte Gennaro. Sehogy sem tetszett a gondolat. az az. érzékenynek látjuk ezeket az állatokat. mint problémánk – húzta fel a szemöldökét Arnold. – Nyolcvan kilométernyi. Utána az elektromos feszültség alatt tartott kerítések következnek. – Élénkvörös vonalak ragyogtak fel a hatalmas képernyőn. hogy ne menjenek a közelükbe. Ezek új állatok. Gennaro? Ez egyetlen állatkertet sem izgat. Ezért sokat tudunk arról. Megint elfogta a bosszúság. – Félelmetes! – Ezek szerint – mondta Malcolm –. – A puszta feltételezés kedvéért – makacskodott tovább Gennaro. – Van „Dzsungelfolyó” nevű járatunk. hogy nemigen van problémájuk. Gennaro. hogy az ember már több száz éve tart emlősöket és hüllőket állatkertekben. – Megbolygathatja-e valaki? Arnold a fejét rázta. Grant hirtelen felkapta a fejét: vasutak? – Még egyik sem működik – mondta Arnold. hogy dinoszauruszok egy vurstli célját szolgálják. Az állatok hamar megtanulják. amit maguk is megtesznek majd. amikor az állatok belepusztulnak a saját betegségeikbe. azzal az úttal. – Azt kell megérteniük – folytatta Arnold –. amely teljesen más. mert ahogy Mr. Bennünket ez a kérdés nem is foglalkoztat.területekről? – Az teljességgel lehetetlen – felelte Arnold. – Betegségek? – kérdezte hirtelen riadalommal Gennaro. olyan jól működik a rendszerük. bennük víz van. Ha jól látom. Más sincs. maga kapott már náthát állatkerti alligátortól. Ennyi az egész. Az a legfőbb gondunk. – Ezek igen drága állatok. vagy más állatokat fertőznek meg. és elnyomta a cigarettáját. tehát nem befolyásolható távolról. Arnold erre csak horkantott egyet. elektromosan töltött hálók. – Hullámvasútjaik lesznek? Mint egy vurstliban? Arnold megnyugtató hangon válaszolt: – Ez itt egy állatkert. Muldoon megköszörülte a torkát. négy méter magas kerítésrendszerünk van. – Mi a helyzet magával az ellenőrzőrendszerrel? – folytatta a kérdezősködést Gennaro. Csend lett. Mi törékenynek. Akarják látni a nagy rex egészségügyi anyagát? Az oltásait? A fogászati kartonját? Nem semmi! Látniuk kellene. Ami viszont kifejezetten izgat. Nem képesek szabadon megélni. – Félelmetes egy rendszer! – mondta. mint amelyikből valók. Ezek génsebészeti úton előállított állatok. amelyek ezeknél az állatoknál előfordulnak. A legnagyobb gondunkat a betegségek jelentik. modem segítségével. Nagyon vigyázunk rájuk. A számítógép minden szempontból független. nem értünk hozzájuk. – Miért. Túráink vannak a különböző területek bejárására.. Grant elkomorult. . amely magának a szigetnek a védő körzetét veszi körül. és független a pótellátása is. mint amelyek magukat aggasztják. A számítógéprendszer teljesen biztonságos. Hatvanötmillió év után hozták vissza őket egy olyan világba. A kerítésekben tízezer voltos áram fut. – A rendszer „meg van keményítve” – így mondják. – Lenyomott egy billentyűt. Lézer sokkfegyverek. És egyszerűen nem tudjuk. Arnold mondta. ahogy az állatorvosok kikefélik azokat a hatalmas fogakat. nyugtatólövedékek. Csakhogy a dinoszauruszokról eddig még soha senki sem próbált meg gondoskodni. hogy valamelyik látogató megkapja? Arnold ismét csak horkantott. – Tegyük fel. A többi vasút pedig csak hat. ezek drága állatok. – Megeshet. hogyan óvjuk meg őket. Mr. A nagyobb állatoknál a vizesárok akár tíz méter mély is lehet. ebből valami hatalmas balhé lesz a szárazföldön. De ennek figyelésére is vannak programjaink. Gennaro bólintott. A park az alapvető „Dinoszauruszvilággal” nyit. Bennünket sem. Többszörös elkerítéssel dolgozunk. tizenkét hónappal azután kerül sorra. Egyik sem halálos. – Várjon egy pillanatra! – szólt közbe Grant. Mr. beleértve azt a harmincöt kilométert is. a maguk fő aggálya az. mint huszonnégy órán belül elpusztul.

– Nos – mondta Arnold –. ilyen görbét sosem volna szabad látni itt. – Én meg azt hittem. így azonnal lefordítható. Fel sem nézett a billentyűzetről. sőt igen gyorsan – mondta Arnold. Gennaro megdöbbent. normális megoszlás ezen a szigeten éppenséggel szörnyen aggasztó! – Aggasztó? – De még mennyire! Abból kiindulva. hogy az állatok többsége egy átlagos központi érték körül összpontosul. amit Mr. Dennis Nedry a szoba túlsó sarkában ült egy terminálnál. indul a kirándulás. – De hát hogyan? Hiszen maga is látta! Minden állatot figyelnek. Nem látom. – Így van. – Csoportonként is tudnak vizsgálatokat végezni? Megmérni őket vagy akármit? Arnold gombokat nyomogatott. – Nem? – kérdezte Malcolm. Hogy szökhetne meg akár csak egy is? Malcolm csak mosolygott.. Új kép jelent meg az ernyőn. – Amit tudok. – Ezt mind meg tudjuk csinálni. Tudom. Ezek vannak a görbe elején és végén. melyik pillanatban hol vannak. hogy az a szép. hogyan juthatott volna akár egyetlen állat is ki a szigetről. – Igen. – Ez az a rendszer.Malcolm viszont tovább kérdezősködött: – Az egész parkot ebből a vezérlőteremből tudják irányítani? – Igen – felelte Arnold. A számítógép önállóan képes követni az állatokat. Nos hát – kérdezte újra Arnold –. ha nincs több kérdésük. Nedry tervezett? – kérdezte Malcolm. amit Wu doktor mondott nekünk.. és negyvennyolc órára feltölteni a vízvályúikat. és a billentyűkkel dolgozott. – Az – szólt szórakozottan Nedry. A lényeg. Olyat. én terveztem – mondta Nedry. A vezérlőben ülő szakemberek pedig abból indulnak ki. szóval. hogy egy természetes világot kell látniuk. Kifelé menet Gennaro megjegyezte: – Nekem ez igen jó rendszernek tűnik. – Ha kell. – Csak alapfeltételezések kérdése az egész. – Csak egy-két kisebb hibát kell kiigazítanom. amire számít az ember – mondta Malcolm. mindezt akár felügyelet nélkül. Mindet meg tudják nézni. – Várjon már! – mondta meglepetten Gennaro. hogy kijutottak innen állatok? – Nem hiszem. amit a végén mutattak nekünk. van még kérdés? – Nincs – felelte Malcolm. . hogy a tudósok és műszakiak megpróbáltak egy teljes. – Fantasztikus rendszer – mondta büszkén Arnold. hogy az állatpopuláció normális Poisson-féle megoszlást mutat. Minden egészséges biológiai populáció ezt a fajta megoszlást mutatja. – Az teljesen nyilvánvaló – felelte. etetni őket. Annyi automatika van beleépítve. Pedig ha bárki csak egy kicsit is belegondol. – Úgy van – válaszolta Malcolm. – Csak egy van – szólt közbe Malcolm. rá kellene jönnie. Tudják. egymagam is elboldogulok. – Feltételezések? – ráncolta a homlokát Gennaro. Csokoládérudat majszolt. új biológiai világot létrehozni. Maga azt hiszi. úgy látom. – Nézze! A Jurapark lényege. néhány pedig vagy nagyobb. – És ez éppen az a fajta görbe. Azt látjuk. ez teljesen nyilvánvaló. – A számítógép a videoképek leolvasása közben mértéket vesz. mint azon a grafikonon. vagy kisebb a többinél. már elég.

megint nem tudom követni – szólt Gennaro. . Ha tetszik.– De hát miért nem? – kérdezte Gennaro. – Nem baj. hogy még természetesebbnek hasson. A Jurapark nem a való világ. hogy a kirándulás mindent világossá tesz majd – mondta erre Malcolm. Egy bizonyos értelemben igazi park. csak nem az. amelyet azért manipuláltak. Biztos. talán leginkább a hagyományos japán kertekhez hasonló. És a Jurapark minden. manipulált természet. – Félek. – Mert az egy normális biológiai populáció görbéje.

mint a különféle fenyők és a mocsári ciprusok. – Végig nyílt rádiókapcsolat lesz a kocsik között. mint vegetáriánus óriásokat. és megkérdezte: – Én nem mehetnék velük? – Nekik fontos megbeszélnivalóik vannak – mondta Ed Regis. Egy sor Toyota Land Cruiser gördült fel a látogatóközpont alatti mélygarázsból. egy számítógép-vezérlésű lézerlemezjátszó. – Nekem muszáj nyíltan beszélnem.. Két antenna ringott a tetőn. vezető nélkül álltak elő. – No. – Akkor kezdjük a műsort. – De engem érdekelnek a technikai dolgok – erősködött Tim.. mint egy CDROM. A cikászok a dinoszauruszok kedvenc eledelei közé tartoztak. erre! – kiáltotta Ed Regis. hogy kerítések és a tartófalak zöld növényekkel vannak befuttatva. Reményeink szerint idővel majd szabadon hajtunk az állatok között. – Ezek elektromos kocsik – jegyezte meg.A KIRÁNDULÁS – Erre. hogy mi is halljuk magukat itt. Tim örült. hogy. kellő felelősséggel végezte-e a munkáját Hammond. kérjük. és a belső képernyőkön felirat jelent meg: ISTEN HOZTA ÖNÖKET A JURAPARKBAN! Ünnepélyesen zengő. – Az útba ágyazott kábel vezeti őket.. mert a műszerfalba két számítógép-monitor volt beépítve. – Ez Richard Kiley. hogy felvilágosítson engem.. és amelyet önök immár a maga valójában láthatnak. Tim nézte. A Land Cruiser alacsony. – Technikai dolgok. – Kérjük. jellegzetes növényzetet. minden kocsiba kettőtől négy utas szálljon! – ismételgette egy magnóra vett hang. – A fene egye meg! – szólt Gennaro.. mély férfihang szólalt meg: – Kedves vendégeink! Üdvözöljük önöket a Juraparkban! Önök most belépnek a történelem előtti kor ősi. – Tíz éven aluli gyermekek csak felnőtt kísérettel utazhatnak. Ed Regis lenyomta a rádiótelefon gombját. hogy meggyőződjek. És akkor – az Isten verje meg! – jön maga. meg egy doboz. kvarc szemüvegféle kukucskált ki a térképből. Volt ott még egy hordozható walkie-talkie. A két fekete bőrű férfi rájuk csukta az ajtót. Richard Kiley folytatta: – Mindenekelőtt figyeljék meg az önöket körülvevő. Ed Regis kifejezéstelen mosollyal arcán lenyomta a gombot. de egyelőre helyezkedjenek el kényelmesen. miről beszélnek olyan nagyon – szólalt meg Ed Regis. és. Bekapcsolta a kocsik közti rádiórendszert. és megszólalt: – Ezeket a könnyű súlyú. amint Grant. Tim Lexre pillantott. Látnak még benettitidákat és ginkókat is. Két szafari-egyenruhás néger férfi nyitogatta az ajtókat a beszálló utasok előtt. meg valamiféle rádióadó. amelyek átrágják magukat a krétakor és a jurakor százmillió évvel ezelőtti mocsaras erdein. Rámutatott az első kocsira. hogy az első ülésre ülhet. – Szeretnék velük menni! – Úgyis hallani fogod.. A Land Cruiser lassan gördült előre a növényzeten át. Tim és Lex beszállt. De a legtöbb . és tanácsot adjon. Kérjük. A Land Cruiser elektromos zümmögéssel elindult. – Egyébként közlöm. hogy szellemi társasjátékot űzzön velem! Enyém ennek a cégnek öt százaléka. Tim észrevette. minden kocsiba kettőtől négy. miről beszélnek – mondta erre Regis. Az előttük haladó kocsiban a három kutató és Gennaro látható izgalommal beszélgetett és mutogatott. Gennaróval együtt beszáll az első Land Cruiserbe. rendben? Harsonaszó hangzott fel. a pálmafák történelem előtti ősei. – Nem takarékoskodtunk semmilyen téren. mindörökké letűnt világába. aki öklével bele-belecsapott a kesztyűjébe. Nem én hívtam ezeket az istenverte kölyköket. – Általában úgy szoktuk elképzelni a dinoszauruszokat – mondta Richard Kiley –. mi a fenének van maga itt?! – hallatszott Gennaro dühös hangja a hangszóróból. miért vagyok itt – mondta Malcolm. és több fura. mit képzel. A dinoszauruszok világában akadtak maibb növények is. nem azért. a nagy színész – mondta Ed Regis. egy olyan világba. – Nem tudom. elektromos Land Cruisereket a Jurapark természetvédelmi politikájával összhangban a mi külön megrendelésünkre gyártotta az osakai Toyota cég. A mellette álló nő parafasisakot osztogatott. Ezeket is látni fogják még. és élvezzék ezt az automatikus irányítású társastúrát. – Egy kis szünetet tartott. tömzsi pálmafákból álló fasoron haladt át. – Én tisztában vagyok vele. Ed Regis pedig utánuk. hogy fokozzák az igazi őserdei hatást. Ellie Sattler és Malcolm az ügyvéddel. és enyém a feladat. A dzsipek némán. minden kocsiba kettőtől négy utas szálljon. amelyet gigászi élőlények uraltak – egyikük sincs ma már a föld színén –. mint az afrikai vadrezervátumokon. – Azért van itt. szalagjukon „Jurapark” felirattal meg egy kis dinoszauruszforma emblémával. mindenki. ami leginkább úgy nézett ki. halljuk. A fák önöktől jobbra és balra úgynevezett cikászok. Jött a második kocsi.

mellettük pedig a velük kapcsolatos számadatok. gyors állatok. olyan mint a libagágogás. A váratlan zajra az egész hypsilophodontanyáj hirtelen magasra ugrott. és ötujjú kezével megvakarta a fejét. majd fogaskerék-csikorgás hallatszott. mint az előbb. a mai Angliától Közép-Ázsián át Észak-Amerikáig. a Juraparkon át. A fejek eltűntek. – A nagy zöld fatörzs közepe táján. Egyik sem mozdult. Maga a név: „hypsilophodonta” is „magasélű fogat” jelent. hogy talán nem is csak olyan kicsivel lesznek nagyobbak. A fa foltos árnyékában mozdulatlan.. – A neves múlt századbeli dinoszauruszvadász. erős hátsó lábuk és hosszú farkuk mind láthatóvá vált a délutáni napfényben. nagyjából akkorák. Az egyik felnyúlt. – Hol vannak? – kérdezte Lex. Némelyik hypsilophodonta rágcsált. Ott rés nyílt a növények között. Állatorvosaink itt a Juraparkban arra gondolnak. – Elég unalmas – mondta Lex. Erdős lankát láttak maguk előtt.. Tim is elnevette magát. talán meg is látnak belőlük egyet-kettőt. úgynevezett othnieliák – szólt a hang. A fejek színe tompazöld volt. miután láttuk ezeket az érdekes növényevőket. Őket láthatják maguk előtt a sík területeken. A kocsi villanymotora beindult. amelyeket látnak. Tim a műszerfalra nézett. Mind balra néztek. amelyek lefelé haladtak a karcsú nyakon. ugyanannak a fának magasabb ágain. – Jobbra! – mondta. a formája meg egy hátsó lábán álló gyíké. Mind nagyjából egyforma nagyok voltak. A Land Cruiser egy kis magaslaton megállt. mint ahogy azt az emberek hiszik. Akkora lehetett. és a CD-ROM felzümmögött. – Ezek nem csinálnak semmit. annak az az oka. de ez nem biztos. De lehet. hogy gombáról vagy valami allergiáról lehet szó. hogy bőrpanaszaik vannak. Egyetlen dinoszaurusz sem volt sehol. Néhány ugrás. – Kis termetű. Ha balra néznek. De hát a történelemben ezek az első olyan dinoszauruszok. mint egy póniló. mint egy kis majom. hogy erősebb állkapcsuk és fogazatuk segítségével jobban el tudták rágni a növényeket kortársaiknál. Hypsilophodontáknak hívják őket. mozgott az állkapcsa. és el is tűntek. Tim még két állatot vett észre feljebb. – Ha vakarózni látják őket. – Dinoszauruszok a fákon? Tim látcsővel pásztázta végig a vidéket. – A fákon? – kérdezte döbbenten Lex. A monitorokon most hypsilophodonták képei jelentek meg. – A csorda törzse az önök alatt lévő füves síkságon tanyázik – mondta a hang. amely sárgás fűvel borított mezőre nyílott. – Az egy othnielia – jegyezte meg Tim. amelyen keresztül kelet felé be lehetett látni a terepet. Nyilván valamilyen automatikus rendszer keresett valamit a lemezen. és az átlagdinoszaurusz akkora volt. náthás hang szólalt meg. amelyeket élve lehet vizsgálni. hosszú farkával egyensúlyozott. mint az ugráló kenguruk. A hatás komikus volt. Úgy véljük. – Az intelligenciájuk nagyjából megegyezik a közönséges tehénével. Úgy röpködtek a levegőben. Abban a pillanatban egymás után hat gyíkfej bukkant elő a tőlük közvetlenül balra elterülő füves réten. méla jelleget kölcsönzött az állatnak. Othniel Marsh tiszteletére kapták a nevüket. Meglátják! A Land Cruiserek folytatták útjukat dél felé. A legkisebbek nem voltak nagyobbak a közönséges házimacskánál. Lelógó. Tim úgy gondolta. és ezeknek az állatoknak az önélesítő fogaira utal. továbbhaladunk a kicsivel nagyobb dinoszauruszok felé. – Egyszerű párzási hívóhanggal előcsalogathatók. . A fű egy méter magas lehetett. mire a fejek megint előbukkantak. sikerük titka abban rejlett. sötétbarna és fekete pöttyökkel. Marsh a Yale Egyetem professzora volt. A fej nagyságából ítélve egy méter-egy méter húsz centisek lehettek. Mi is ilyen átlagos nagyságú állatokat keresünk fel először.dinoszaurusz nem volt akkora. amelyek az állatokat követik nyomon. A hangszóró megismételte a hangot. ugyanabban a sorrendben. – Most. – A hypsilophodonták a dinoszauruszvilág gazellái – mondta a hang. hogy a Land Cruiser képernyőit ugyanazok a mozgásérzékelők irányítják. de talán a fákon az ágak között is. A mozdulat valamiféle elgondolkodó. Az adólámpák villogtak. – A hypsilophodonták nem valami okos állatok – magyarázta a hang. pontosan ugyanúgy. mint egy őzike. s közben egész testük. amelyek egykor mindenütt a világon jelen voltak. – A kis állatok. zöld állatka ült egy ágon. – Az egyik hangszóróból a kerítésnél elnyújtott.

– Szóljanak a karbantartásnak. Az. Közben a Disney cég szórakoztató parkjai egyre fejlettebb és bonyolultabb elektronikusan vezérelt hullámvasutakat és más „járművek”-et kezdtek alkalmazni. szálláshely-biztosítás. a főállatorvos néha járt odakint. – Jelentéktelen apróság – jegyezte meg Hammond. és „Pteratopskastély”-t a madárházban. Arnold – válaszolt egy hang a rádiótelefon hangszórójában. hulladékeltávolítás. Most. – Pedig azok – mondta csendesen Muldoon. Hammond! – mondta. – Ó. az alkalmazottak pedig elég modortalanok. – Igen. és ez el nem vette a kedvét a fegyver készítéstől. hogy ma először járják be a parkot igazi látogatók. miért. Mr. nemhogy egy egész park tökéletes működését megszervezni. „Párizs egy nagy tematikus park – mondta egyszer egy nyaralás után –. ami mindig a jövő év szeptemberét jelentette –. leggyilkosabb lények. . az állatok egészsége és általános jóléte. A stegosaurusoknak gyakran kisebesedik a nyelve. De még ha a raptorok nem is szabadulnak ki soha – mondta Arnold –. Csak éppen maga sosincs itt. biztonság. azért annyira talán mégsem rossz a helyzet! – mondta Hammond. – Betege vagyok. ha visszajönnek! – Igen. Hogy a legveszedelmesebb. a végén már a valóságot is egy kissé sajátos nézetből láttatta vele. pedig kettő már bele is pusztult. bár kissé túl drága. a virginiai Óvilágot és a houstoni Csillagvilágot. még láthatta a két Land Cruisert dél felé haladni a parkon át. – Mindet el kellene pusztítani! – Rádiójeleket sugárzó nyakörvekkel akarta ellátni őket – mondta erre Hammond. és új cigarettára gyújtott. – Nincsenek jelentéktelen apróságok. Az állatápolók csak az egyes etetőházakhoz jártak. A triceratops-nőstények ölik egymást az uralomért. hogy Arnold maga ritkán ment ki a parkba. Ujjain kezdte számolni a szempontokat. míg meg nem született első gyermeke. Arnold hátratolta a székét a vezérlőpanel központi konzoljától.. és nem tudja – felelte Arnold. Állatgondozás és ellátás. Nagyon is érezte súlyát annak. – Nem hiszem – felelte Arnold. A látogatók soha nem fognak erre gondolni. – Egy: a Juraparkban megvan egy szórakoztató park minden problémája. Mérnök létére hozzászokott az elnyúló határidőkhöz – sokszor emlegette a „szeptemberi nyitás”-t. És azonnal le is rágták a nyakörveket. – Dehogynem. No és a velociraptorok. miért. etetés és tisztaság. hogy a Jurapark eredendően veszedelmes hely. védelem a rovarok és más kártevők. de műszaki szempontból a Jurapark a történelem legnagyralátóbb tematikus parkja. zárórendszerek fenntartása és a többi. hogy nézzék át a BB4-es és BB5-ös kocsikat. úgy lett egyre elégedetlenebb az elért haladással. szállítás. – Maga nyilván nem így látja. Nem tudjuk. Muldoon némán figyelt a sarokból. Amint kinézett. Mr. és nagy „tematikus” parkokat tervezett Amerika szerte: a kaliforniai Varázshegyet. mint róluk. és sok embert csábítottak át a repülőgépgyártás és az űrhajózás területéről. Arnold ezer kisebb részlet felett nyugtalankodott. aki éppen belépett a terembe. a sorbaállók ellenőrzése. Egyébként ők is jobbára a vezérlőből nézték a parkot. és hatnál kisebb csoportokba kell szétválasztani őket. és hasmenést kapnak.. hogy állandóan ilyen parkokon dolgozott. a többségük veszélyes – mondta tovább a magáét Arnold. – Én pedig hozzájárultam. Arnold részt vett az orlandói Disney World építésében. Kettő: ehhez jönnek egy nagy állatkert problémái. Csak félig szánta viccnek. élelmiszer-kezelés.” Az utóbbi két évben Arnold feladata az volt. A hypsilophodonták bőrkiütésben szenvednek. hogy lassanként az egész világot le lehet írni a „tematikus park” metaforájával. és néha megbetegszenek tőle – csak azt nem tudjuk pontosan. – Maga örökösen aggodalmaskodik – mondta Hammond. Az igazság az volt. hogy olyan állatpopulációról kell gondoskodnunk. Az 1960-as évek végéig a tengeralattjáróról kilőhető Polaris rakétákon dolgozott. amelyeket valaha is hordott a föld a hátán. – Különben is. a betegségek és allergiák ellen. Harding. – El kellett halasztanunk az „Út a dzsungelfolyón”-t a dilophosaurusok miatt. – Hagyjuk már a velociraptorokat! – vágott közbe Hammond. amikor azt állította. Járműkarbantartás. hogy másról sem hallok. még ha szakemberek is. – A tyrannosaurusok isszák a lagúna vizét. Arnold rendszerszervező mérnök volt.A VEZÉRLŐ – Csikorognak a fogaskerekek az áttételváltásnál! – szólt John Arnold a vezérlőterem félhomályában. hogy látogatók jártak a terepen. Tapasztalatból tudta. véleményem szerint akkor is el kell fogadnunk. kinek az oldalán áll maga? – E pillanatban tizenöt kihalt állatfajunk van. míg sikerül a hibákat kiküszöbölni egyetlen parki berendezésből is. – Egy lószart! – mondta Hammond. amelyről eddig soha senki sem próbált. hogy állítsa fel és hozza működőképes állapotba a Juraparkot. A mindig feszült Arnold most különösen ideges volt. hogy néha évekbe telik. Végül pedig itt az a példátlan feladat. de én igen. Ennek okát sem ismerjük. s ahogy közelgett a szeptember.

amely az összes kártyával nyitható ajtót vezérelte. Bármit is mondott a magnó. Az egész biztonsági rendszer tehát csak a fő energiarendszerrel működött. mi történik. amelynek az volt a feladata. például: Az állatetető program tizenkét óránként állt vissza a kiindulópontra. volt. fekete-vörös csíkok voltak. magas úton haladt. Bármennyire különösek vagy egzotikusak is ezek az állatok. – Közvetlenül alattunk pedig a mezozoikumi dzsungelfolyónk látható. minden áramkimaradásnál kikapcsolt. Nem mintha nem bízott volna Nedryben. hogy ellenőrizze. elsápadt. végső soron úgy fognak viselkedni. Megnézte a grafikus kijelzést a jobb oldali monitoron. Kezdettől fogva ez volt a tervezők megingathatatlan meggyőződése. Felépítése megfelelt a húsevők alapvető formájának: súlyos farka volt. és rájuk parancsolt: mondják le minden hétvégi programjukat. aki a szoba sarkában dolgozott egy terminálnál. Tartsák nyitva hát a szemüket. amely az Isla Nublart a szárazfölddel összeköti. és az állatok megtalálják majd a helyüket. erre az elektromos sebváltók kezdenek el vacakolni! A sebváltók! – Az ég szerelmére. hajlott taréj haladt végig a fejtetőn a szemektől az orrig. A taréjon papagájra vagy tukánra emlékeztető. Az állat halk huhogó hangot hallatott. Csak szerette tudni. amelyeket most látnak: Dilophosaurus. úgy hogy a kocsik belsejében lévő CD-ROM-okat megfelelően irányítsák a mozgásérzékelők. amely még nem nyílt meg a látogatók előtt. hogy egymaga el fogja végezni az összes javítanivalót a hétvége alatt. csak minden második nap működött. amely az elektromos Land Cruiserek mozgását követte. – Íme. mint bármilyen más állatkerti állat a világon. ahol ha szerencséjük van – megpillanthatnak egy igen ritka húsevőt. Három méternél is hosszabb testét sárga és barna foltok borították. hogy ne kerüljön az ételbe. hiba hiba után. és akadt közöttük néhány ilyen furcsa is. Tim csak egyetlen állatot látott. hogy minden telefonvonalra szüksége lesz. és nem kapcsolt vissza. Éppen most kerülték meg a madárházat. minden egyes példánynál makacsul kimutatta a Phagostum venulosum nevű parazita jelenlétét. John Arnolddal viszont azt közölte. A vízmedret sűrű növényzet fogta közre mindkét oldalról. – Maga csak tartsa rendben a műszaki részt. és nem lehetett kikapcsolni. – Ha tisztességesen megcsinálta volna már kezdetben – kezdte Hammond. de jól! Benn a Land Cruiserben a monitor lángvörös taréjú. hogy vannak problémák. oldalszám. Timék kocsijában azonban mindenki kifelé meresztette a szemét. Az automata fekáliaanalízis (közkedvelt nevén „autókaka”). madárszerű fejet mutatott. – Ne fogja az állatokra! – Igen. mint a leopárdot. a mélyben robogó vizű folyó. Nedryre pillantott. Azonnal hívta munkatársait Cambridge-ben. mennyit ettek az állatok. A kocsi szakadék felett húzódó. ott vannak! – mondta a hang. – Azoknak az állatoknak a neve. Következésképpen a személyzet nem tudta pontosan felmérni. – Addig is. hogy semmi haszna Nedryt felbosszantani. – Tim alumíniumlemezeken csillanó napfényt látott a távolban. Arnold egy billentyűnyomással újabb ablakot nyitott a saját monitorán. és reagálni fognak rájuk. Hiszen szoktathatók. erős hátsó végtagjai és hosszú nyaka. Amikor a teljes listát megpillantotta. A folyó mentén haladtak észak felé. Míg Nedry dolgozott. Ezek nem technikai kérdések. próbáljuk meg azért az arányérzékünket megtartani! – mondta Hammond. nem pedig huszonnégy óránként. Arnold tudta. Heteken át igazítgattuk. Hammond! Nem műszaki okokból történtek! Gondok vannak az állatokkal. V-alakot alkotva a dinoszaurusz fején. De Timnek leginkább a fej keltette fel az érdeklődését. mint valami bagoly. Denys Nedry abban a tévképzetben érkezett ide. Középütt összefutottak. Mr. – Ha balra néznek – szólt a hang –. – Éppen elég műszaki késésük volt – jegyezte meg Hammond. láthatják a Jurapark madárházának kupoláját. A biztonsági rendszer. noha az a valóságban egyiknél sem fordult elő. amikor a rendszer a tartalék energiaforrásra állt át. megszólalt a vészjelzés. így bepillanthatott abba. de Arnold csillapítóan érintette meg a karját. Beletanulnak ellátásuk rendszeres ismétlődéseibe.mert a pterodactylusok olyannyira kiszámíthatatlanok. – Szükségszerű. Tényleg csak a főattrakciót. hogy programadatokat továbbítsanak ide-oda közte és programozói között. . nincsenek-e paraziták az állatok székletében. És így tovább. A takarékossági program. elképzeléseik gyökere. Valójában a hibák listája immár százharminc tételre rúgott. amelynek tíz óra után minden nap le kellett volna tompítania a lámpákat. A program erre automatikusan beadagolta a szükséges gyógyszert az állatok eledelébe. – Nagy ez a rendszer – mondta Arnold. és ivott a vízből. a parkon végigvivő „Dinoszauruszvilágot” sikerült működőképes állapotba hoznunk. hogy rendben működjenek. a vasárnapi etetéseket viszont nem volt hajlandó rögzíteni. mit csinál Nedry a sarokban lévő klaviatúrán. Két széles. – Ez az átkozott komputer örökösen csak gondot okozott! – Meglesz az oka – mondta Nedry. A dilophosaurus hátsó lábára kuporodott a folyónál. míg éppen dolgozik. Ha viszont az ápolók kiöntötték a tartókból. hogy van a számítógép? – szólt Hammond. hogy hétfőig túlórázhassanak. Mind kell ahhoz.

ha a hátsó felüket vakarják. Ez pedig nem más. mint egy képeskönyvben – mondta Lex. A chef.. ám annál veszedelmesebb tagja a Jurapark állatállományának. és elfordult a triceratopsoktól. amit következőként látunk majd. elsősorban dögevők lehettek. Rövidlátó. A szemük fölötti szarvak másfél méter magasra íveltek. ismert nevén Tyrannosaurus rex. a világhírű francia Le Beaumaniére-ből jött hozzánk. – Más dinoszauruszokkal ellentétben – mondta a hang – a Triceratops serratus nem jól lát. mint a fordított elefántagyarak. hogy az állkapocsizomzatuk túl gyenge volt ahhoz. Fogadni mert volna. Alain Richard. és elfogyaszthatja prédáját. és hagyják magukat simogatni. a Les Gigantes épületét.ezek a jó kedélyű szörnyek egy letűnt világból éles ellentétben állnak azzal. hogy Grant professzor is legszívesebben ezt tenné. – A vendéglőt még építeni sem kezdik novemberig. de nem látott semmit. Lex! – szólt Ed Regis. hogy még egy utolsó pillantást vethet a dilophosaurusra. Olyan formájú volt az orruk is. meleg levegőn át. – A tudósok azt hitték. – Micsoda? – Tim elvigyorodott. Tim két állatot látott mozdulatlanul állni egy nagy fa árnyékában. Ez aztán a meglepetés! Mérges dinoszauruszok! Szívesen megállíttatta volna a kocsit. valószínűleg már látják is őket. Triceratopsok – gondolta. a hatalmas zsarnokgyík. A dilophosaurus szép. – Ha felnéznek a jobb oldalon lévő szirtfokra. – Remek! A Tyrannosaurus rex! – kiáltott fel Tim. Ezek is megrohannák a kocsinkat. és maga mögött hagyta a folyót. – Ez már igen! A dilophosaurus jellegzetes huhogó hangja ismét feléjük úszott a délutáni. . – Az még egy kicsit odébb van – szólalt meg Ed Regis. Tim felnézett a szirtre.. Tim hátranézett. és hajlamos rá. Harcias külsejük ellenére a valóságban egészen szelídek. hogy mérgezők. – Remélem. és igen erős. s a színük is hasonló. A hang közben folytatta: – . A dinoszaurusz ezután kedvére elbánhat vele. – A triceratopsoknak legyező alakú taraj van a fejük mögött. ott látják remek. Lecsavarta az ablakot. Regis bácsi? – Te csak ne félj! – mondta Ed Regis. Különösen kedvelik. – Hé! Hülye dinoszaurusz! Mozogj már! – Ne zargasd az állatokat. Ha jobbra néznek. – De igazán azok? – Nos hát igen. hogy áldozatokra vadásszanak. A Land Cruiser befordult egy sarkon. rinocéroszszerű szarv. – A mai arizonai óriásgyíkhoz vagy a csörgőkígyóhoz hasonlóan a dilophosaurus is hemotoxint választ ki a szájában elhelyezkedő mirigyekből. Ma már azonban tudjuk. kedves utasaink! Itt biztonságban vagyunk. mint a rinocéroszoké. A harapás után perceken belül eszméletlenség lép fel. Akkorák voltak. – A dilophosaurus az egyik legkorábbi húsevő dinoszaurusz – mondta a magnetofonhang. – Miért nem mozdulnak már? – kérdezte Lex. és úgy vélték. Tartásukban azonban ott volt a rinocéroszok vadsága is. hogy látnának bennünket! De aggodalomra semmi ok. Csak ülnek ott. háromcsillagos éttermünk. mint ezek a bambák – mondta Lex. mint a világ történetének leghíresebb ragadozója. ha olyan közel volnánk. – De miért ne? Ezek hülyék. Orruk közelében egy harmadik. ha nem automatikus az egész. Szállodai szobájukból telefonon foglalhatnak asztalt. mint a mai rinocéroszok. Ez tömör csontból van. hogy mozgó tárgyak láttán meglepődjék. Lex. ami támadást vált ki belőle. Ezek az állatok egyenként hét tonnát nyomnak. – Őskori szafariutunkat folytatva most elérkezünk az ornithischia csoportba tartozó növényevőkhöz. remélve. az jobb lesz. – Ezek tényleg mérgesek.– De jól néz ki! – szólalt meg Lex. A Land Cruiser lassan továbbhaladt. Lex kényelmetlenül mocorgott az ülésén. Ismerik ápolóikat. mint egy elefánt.

délebbre. hanem az egész fejét a vízbe dugja. – Nézzék őket! – mondta Hammond. a bajsza acélszürke. – Szeretek néha idejönni este. A lagúna élő víz. amely magán-vadrezervátumot épített Észak-Amerikában. ha tehetné. Nem a kezét használja. fokozatosan merült a párás horizont alá. Kenyában nőtt fel.” 1986-ban egy San Franciscó-i cégnél vállalt munkát. elhiheti. Érdekes nézni. Ezek nem látszanak. csak a cikászok halk zizegése hallatszott. Néha órákig áll a lagúnánál.A NAGY REX – Az óriás tyrannosaurus viszonylag későn jelent meg az őstörténet színpadán. lehajló nyakát látták. a vízparton az apatosaurusok kecses. – Hol van a T. Kulcsait az ujja körül pörgetve. Grant azonban nem volt meghatva. – Várjanak csak egy kicsit! Halk. Hangja fémesen szólt a hangszóróban. Ez már-már szabály. Nyugatra a nap már lefelé szállt. Regis nevetett. mert érzékeny a bőre. rex? – Jó kérdés. Mint a madarak. nagyvadak nyomában járó vadászok kalauzaként töltötte élete legnagyobb részét. rex. hogy csalódni fognak – mondta Regis. de nyugodtak lehetnek. Aki elnézte ezt a tájat. egy kötél végén a mező közepén. A veszély kedvéért jöttek! – Pontosan ez az. Grant sóhajtott. és könnyen leég a naptól. igaz? – hallották Ed Regis hangját a kocsik közti rádiótelefon hangszórójából. bégető hangot hallottak. amitől félek – szólalt meg Muldoon. majdnem mindig elbújik. s az árnyak egyre hosszabbra nyúltak. Alig győzik türelemmel. És csak ücsörögni. Malcolm elnevette magát. s a kecske riadtan mekegve ott maradt. hal is van benne. egy letűnt világba. – Illúziórombolásból jeles! – Mégsem hiszem. ötvenéves férfi volt. és Muldoon osztotta Arnold minden félelmét. a kis T. – Vadászna is. a termete kétharmada a kifejlett példánynak. hogyan csinálja. zebrák és vízilovak területi . a súlya másfél tonna. Szinte sosem látni kinn a szabad terepen. – A kicsi? – Igen. Majd kiesnek. – Kihajolnak az ablakon. meghatározta az oroszlánok. – Félénk?– döbbent meg Malcolm. Puha fényben fürdött a Jurapark egész tája. Távolabb. Százhúszmillió éven át uralták dinoszauruszok a földet. A Land Cruiser egy dombtetőn állt. rex területét teljesen körülzártuk árkokkal és kerítésekkel. ugyanaz Robert Muldoon az állatkertek területén: felülmúlhatatlan tudású és szakértelmű tervező. azért. A mező közepén kis ketrec emelkedett a magasba. mint a vadállatok életének szakértője. a szeme mélykék. nézi azokat az állatokat. kétéves. A lagúna felszínén rózsaszín félholdak himbálództak. amely a lagúna széle felé lejtett. Erdővel borított területre tekintettek le. A kicsit gyakran látni lenn a lagúnában. különösen nappal. Robert Muldoon jól megtermett. hogy odalenn vadászik az apatosaurusokra – mondta Grant. hogy végre lássák. amelyek ott ittak. felnőtt tyrannosaurus. feszülten figyelte a Land Cruisereket. úgy figyelnek. – A Tyrannosaurus rex félénk? – Nos. De most nem látom. hogy valóban évmilliókat utazott visszafelé. elefántok. – Már csak percek kérdése – szólt Regis. – Lehet. az igaz. Muldoon jelölte ki a különböző állatok körleteit. De a T. aki a vezérlőterem monitorát figyelte. a londoni Sunday Times-ben ezt írta róla egy cikk: „Ami Robert Trent Jones a golfpályán. A másik teljesen kifejlett. – Egy kicsit félénk. Két és fél méter magas. könnyen beleélhette magát. hogy „élőben” járták be látogatók a Juraparkot. nem mehet sehová. A kicsi megtanult halat fogni. Hidraulikus szerkezet emelte ki a föld alól. Fiatal még. A ketrec rácsai lesiklottak. – De akkor hol van? – Rejtőzik – felelte Regis. és akárcsak apja. Csend volt. és csak mozgatja a korcs mellső végtagjait tehetetlen haragjában. 1980 óta azonban főként természetvédelmi csoportok és állatkerttervezők tanácsadójaként dolgozott. – Ez bejött. – De miért nem? – Úgy gondoljuk. védtelenül. Nemzetközi hírnévre tett szert. Kibámultak az ablakon. Ez volt az első eset. de ebből csak az utóbbi tizenötmillió évben éltek tyrannosaurusok.

az egy dolog. hogy egyet is megöljenek. a vezetőség úgy döntött. amíg fel nem boncolnak egy dilophosaurust. Aztán egyszerre csak megérezték a szagot. A rádiótelefonon át Grant Lex ijedt hangját hallotta: – Mi lesz a kecskével? Meg fogja enni a kecskét? – Gondolom. amelyeket egy zárt helyiségben tartottak. hogy milyen nehéz egy négytonnás elefántot elejteni. különösen azzal a vakmerő kis diktátorral. A raptorok karámját is átépítették. két építőmunkás halt bele. hogy otthagyja Afrikát. És a raptorok legalább olyan intelligensek. s ez gyakran szembeállította őt a Jurapark kaliforniai vezetőivel. hogy hét különböző toxikus enzimet tartalmaz. Senki sem tudta. mint a csimpánzok. Könnyedén meg tudnak szökni. mint például a vaddisznó. hogy az örvös tatu notórius szökevény? Vagy a jávorszarvas? Pedig a jávorszarvas legalább olyan ügyesen nyitja ki a ketrecajtót az orrával. hogy eltávolítják a méregzacskót. bólintott. hogy némelyik dinoszaurusz túl veszedelmes ahhoz. amitől Muldoon félt. és orrukkal emelik fel az ajtózárat. Muldoon egy évre elvállalta a dolgot. az alagsorban. Mások. Arnold. és elektromos érzékelőkkel szerelték fel. hogy megjelenjen a T. Ugyancsak megdöbbent. amelyeket most az ujja körül pörgetett. hogy parki körülmények között tartsák. Példának okáért még csak nem is gyanította senki. Felfedezték azt is. erős futók és elképesztő ugrók. Azt is megjelölte. igen – felelte neki valaki. hogy kivizsgálják a dilophosaurus-mérget. de sikertelenül. egy harmadik pedig egy életre megnyomorodott. egyes dinoszauruszok súlya pedig ennek a négyszerese volt. nekik is ügyes kezük van. az valami egészen más. Mint a csimpánzoknak. két különböző állatnál. már érdekesebb volt. Akár a velociraptoroknak. hogy legyen a Jurapark fővadőre. Mellső lábuk egyetlen lendülete elég volt ahhoz. Az ajánlat egybeesett azzal a vágyával. az kétségtelen. hogy némelyik látogató akár meg is vakulhat. ha nemis voltak éhesek. És vállról indítható LAW-rakétákat. – Amíg még idefent van. romantikátlanul nézni az állatokat. És nem is fogja tudni. – Hé! – kiáltott Dennis Nedry a sarokban lévő billentyűzet mellől. Miután Muldoon kijelentette. De ki feltételezné. aki le nem vette a szemét a megfigyelő képernyőkről. A két Land Cruiser a dombtetőn állt. ösztönös vadászok voltak. és valóban kiszabadult egy. hol választódik ki a méreg. Az öles öröméért öltek. amelyet feléjük hozott a szellő a domboldalon. Halálos karmok voltak mind a négy végtagjukon. A szobához csak Muldoonnak volt kulcsa. míg az egyik ápoló kis híján meg nem vakult belé. Lázasan rángatta a kötelet. Villámgyorsak voltak. amikor kisült. jó? Grant a kocsiban várakozott. és türelmesen kivárják. Öltek akkor is. és sosem hagyták futni az áldozatot. ott várták. Amikor aztán bekövetkezett. Muldoonnak az volt a véleménye. hogy még mindig túl keveset tudtak az állatokról. A jávorszarvasok állandóan megszöknek. Az eset után a vendégkastélyt átépítették: súlyos. hogy bizonyos állatok különösen hajlamosak rá. Minden vadász tudta. Az állatorvosok kétszer is megpróbálták. Muldoon ennél is jobban aggódott a velociraptorok miatt. amelyről kiderült. Kimondott tehetségük van hozzá. rácsos kapukat szereltek fel. Muldoon meg volt győződve róla. lézervezérlésű rakétakilövőt. hogy dinoszauruszokat klónozni a laboratóriumban. hogy a park valójában génsebészeti úton előállított ősállatok gyűjteménye. Sokkal intelligensebbek voltak a többi dinoszaurusznál. hogy semmiféle fegyver nem lehet a szigeten. hogy szabályosan kibelezzen egy embert. Van. Némán figyelt. A veszély részben abból adódott. csakhogy a vezetés nem engedte. Minden állatkerti szakember tudja.igényeit és életkörülményeit. Akkoriban ez már szinte rutinfeladat volt. A vezetés elszörnyülködött. hogy kiszabadítsák magukat. A kecske mekegése hangosabbra. Ezek született. míg elpusztulnak. Ellie lehalkította a rádiót. a rothadás és bomlás már-már hulladéktelepi bűzét. hogy akkor felmond. és melyeket kell elválasztani egymástól. Csakhogy afrikai évei alatt Muldoon megtanulta sajátos módon. A következő munkája. oda-vissza rohangált. milyen állatokat lehet egymás mellett tartani. Gondjukat viselni a vadonban. hogy a dilophosaurusok mérgesek lehetnek. dobjon meg egy kólával. a fizetés pedig kitűnő volt. Végül is beszereztek két. amelyek figyelmeztettek egy esetleges újabb szökésre. hogy köpni is képesek a mérget. Muldoon puskákat is akart. . hogy a dilophosaurus tizenöt-tizenhat méternyire is el tud köpni. környörgőbbre vált. és mintha csak arra születtek volna. míg meg nem figyelték őket. amint a szigeten őshonos patkányokra vadásznak – megharapják a rágcsálókat. magas védőkerítéssel vették körül. mint az elefánt az ormányával. – Lemegyek – mondta. kompromisszumot kötöttek. amellyel ajtókat tudnak nyitni. Ragaszkodtak hozzá. külön e célra készült. Ráadásul erős tépőfogaik voltak. Aztán úgy egy éve ajánlatot kapott. aki most mellette állt a vezérlőteremben. És még akkor sem gondolt rá senki. amelyik ki tudja nyitni a ketrecajtót. A munka persze érdekes volt. mint például a majmok és az elefántok. aztán félreállnak. rendkívül intelligens. hogy kitörjenek a ketrecből. és az ablaküvegeket is acélráccsal erősítették meg. és különböző tárgyakat manipulálni. Miután ez felvetette a lehetőségét. Ezek voltak a kulcsok. rex. egy Tigrisvilág nevű indiai park Kasmírban. ahelyett hogy harapták volna. Ezek után Hammond végre beleegyezett. és kitálal a sajtó előtt. amelyek szakították a húst.

a tyrannosaurus fogai közé kapta a kecske maradványait. Amikor aztán a húsevőnek sikerül leterítenie egy állatot. Malcolm hátradőlt az ülésen. és elvegye a zsákmányát. A mai tudósok azonban a sikeres vadászattal járó erőfeszítést hozzák fel indokul – néha órákig kell türelmesen ólálkodni a végső támadás előtt –. Aztán meredten nézte a Land Cruisereket odafenn a dombtetőn. Az egyik hatalmas hátsó végtag leszorította a tetemet. – Lát bennünket? – kérdezte suttogva Malcolm. hogy bűntudatuk van. A tyrannosaurus hirtelen tétovázni kezdett áldozatának teteme fölött. A Land Cruiserre bámult. – Kitűnő! A tyrannosaurus ismét felemelte fejét. – Mint egy madár – szólt Ellie. négyszögletes fejre meredt. Hatalmas teste teljes egészében előtűnt. mint egy ház! Grant a hatalmas. mint az oroszlán vagy a tigris. és hangtalanul visszavitte a fák közé. Súlyos. gyakran hirtelen óvatosak lesznek. kinyílt. A kecske a mező közepén volt kikötve. A mekegés elhallgatott. de Grant egy pillanatig semmit sem látott. Nagy lendületes lépéssel megtette az utat a kecskéig. mindenfelé figyelt. – Vajon meddig fog még várni? – suttogta Malcolm. Hallották a csontok visszataszító roppanásait. – Talán két-három percig. apró. Nagy. – Hát persze – mondta a rádión át Regis. A Land Cruiserek elindultak. hogy megtámadja. . óvatosan figyel. előttünk fog-e enni. az iszonyatosan nagy állkapcsokra és fogakra. nem közeledik-e egy másik ragadozó. Talán. Csend lett. majdnem harminc méterre a fáktól. mihelyt elejtették áldozatukat. mintha végül mégiscsak győzött volna az óvatosság. A tyrannosaurus állkapcsa csak egyet mozdult. A nagyobb húsevők. Ez a tyrannosaurus is valószínűleg egy másik tyrannosaurus megjelenésétől tartott.Grant odasúgta: – Már itt a fiú! – A lány – javította ki Malcolm. és átharapta torkát. Sápadtnak látszott. Félig eltakarták a pálmafák felső ágai. lehajolt. Aztán rádöbbent. Ide-oda nézett. a préda legtöbbször elmenekül. hogy a nagyobb vadak kedvük szerint bánnak el a kisebbekkel. nagy feje ide-oda forgott izmos nyakán. hogy túl alacsonyan pásztáz a tekintete: az állat feje hat és fél méterrel volt a talaj fölött. És a tyrannosaurus még mindig várt. – Itt marad – mondta Regis. Malcolm csak suttogni tudott: – Jóságos Atyaúristen! Ez akkora. vagy elhurcolja a zsákmányát? A tyrannosaurus lehajolt. – Öööu! – hallatszott Lex hangja a hangszóróban. tépett húscafatok lógtak ki a szájából. Tévedés azt hinni. másfél méter hosszú. Aztán rágni kezdett. – Hát ez fantasztikus! – mondta. Gennaro a homlokát törülte. A tizenkilencedik századi zoológusok azt képzelték. – Hölgyeim és uraim: íme a Tyrannosaurus rex! – mondta a magnószalag. amiért öltek.. A tyrannosaurus némán kiugrott a fák közül. és némán továbbhaladtak a növényzeten át. majd összerándult. – Mitől tart? – kérdezte Malcolm. Az óriás állat azonban még mindig nem bújt elő a fák közül. Az óriás állat újból a kecske fölé hajolt. rángó mozdulatokkal forgatva a fejét. – De gusztustalan! Aztán. és megszaglászta a kecske tetemét.. és a balsiker gyakoriságát. – Valószínűleg egy másik tyrannosaurustól – súgta válaszul Grant. míg a fogak tépni kezdték a húst. – No nézzük.

de a tudományban apatosaurus az elnevezésük. Miután becsukta az ajtót maga mögött. és lement a lépcsőn.Jézusom. mintha pléhdobozban beszélne. Van egy elmélete. és mind jól működik. – . – Lóg az eső lába – mondta az égre pillantva Ed Regis. Megpróbálhat ráijeszteni a japán befektetőkre. és szélesre tárta a súlyos ajtót. hát ez itt csak egy állatkert. A pálmafák felső ágainak leveleit rágcsálták. mint egy egész csordányi mai elefánté együttvéve. mi a baja. Azért festették rájuk az átlós vörös sávot. A fegyverterem ajtaján nem volt semmiféle jelzés.. hogyan sül el ez az egész. brontosaurus – mondta a felvett hang –. hogy vonják vissza a pénzüket. ha belegondolok. mi lenne. – Uramatyám. Muldoon elment a dzsip mellett.. ha egy ilyen állat egyszer kiszabadul! – mondta Gennaro. amelyek bárhová eljuthattak a parkban. mert az valamilyen ismeretlen okból visszariasztotta a triceratopsokat attól. Látniuk kellett. hogy egy állat megszökjék. amelyeket most látnak.. Másik hóna alá két szürke rakétát dugott. – Nincs az az isten. megteheti? – kérdezte meglepetten Wu. Muldoon kiszállt a liftből. ami megállítsa! – Nincs bizony. Nagy apatosaurus-csorda legelészett a lagúna partján. De ő inkább beledöglik. Bármi volt is a nehézség. Jóval kisebbnek látszottak a másik fajtához képest. mindig sikerült megoldani viszonylag kis módosítással a következő verziónál. Hammond szólalt meg a vezérlőteremben: – A fene egye meg! Miért ilyen negatívok mindannyian? – Még mindig arról beszélnek. Amint maga mögött hagyta a garázst.. tudják jól.. majd visszatértek a látogatóközpontba. – Vállat vont. hogy a hadrosaurusok a valóságban egy cseppet sem kicsik. Talán látják. Az ég szerelmére. Ugyanígy tudta azt is. hogy a természetet nem lehet utánozni. a dzsip hátsó ülésére tette a fegyvert. – Várjuk ki. és rávenni őket. az alapjában véve mind a kód megjelölhető problémája volt.. – Ez a Malcolm – mondta keserűen Hammond.. odabólintott a földszinti őrnek. Várjuk meg. amely konkrét rendellenességet okozott a fenotípusban: egy enzim nem indult be vagy egy protein nem nyílt ki. hogy a park lényegében tökéletes. hogy a komplex rendszerek nem működhetnek rendben. hogy képesnek tartsák rá: segédkezet nyújt egy olyan rendszer kiépítéséhez. hogy nekimenjenek a kocsiknak. Bent fegyverállványok sorakoztak. hogy az általuk . Tim persze tudta.A VEZÉRLŐ Henry Wu arra lépett be a vezérlőterembe. Okozhat gondot. Több mint harminc tonna a súlyuk. ugyanúgy. Ezek voltak az elektromos kocsik. hogy mindent kézben tartunk. Több kacsacsőrű hadrosaurus is volt ugyanazon a részen. Arnold elnyomta a cigarettáját. hogy a Jurapark problémái sem alapvető problémák.. Wu lelke mélyéig meg volt győződve afelől. Ami azt jelenti. Nincsenek ellenőrzési hiányosságok. Kulcsával kinyitotta. Malcolm kiemelt egy Randler gyártmányú. Vagy két tucat Land Cruiser töltötte meg az alagsort. a két benzinnel működő autó egyike – a másikat az állatorvos.. – Azoknak a nagy állatoknak a közismert neve. vállra emelhető rakétakilövőt és egy doboz gáztartályt. Csak azt remélem. Vagy botrányt csinál a San José-i kormánynál. még az állatok közé is. nem sikerül úgy ráijesztenie Gennaróra. hogy egyetlen ilyen állat súlya nagyobb. és rádión át érkező hangokat hallgatja. A Land Cruiserek újra megálltak. amelyek végtelen láncot alkotva bejárták a parkot. – De megkísérelheti. mint ahogy a parkot magát is megterveztük. nem? Tele van velük a világ. Hosszú nyakukon ülő kicsiny fejük tizenöt méternél is magasabbra nyúlt. ahol ilyesmi egyáltalán megeshet. Nem tudom. Úgy szólt a hangja a hangszóróból. Bármilyen probléma jelentkezett is a DNS-nél. egyszerűen nem fordulhat elő. hogy az bezárassa a parkot. – Nem értem. – Hatalmas. ahogy az ő paleoDNS-e is az. csak bebizonyíthassa az elméletét. ha egy állat kiszabadulna? – kérdezte Wu. hogy mindenki a sötétben ül. – Miért. Harding vitte el még reggel –. – Mi hiszünk a parkban. – Ez az oka mindennek! Kezdettől fogva ellenünk volt. Wu egyenesen sértőnek találta. a hátsó fal felé. Olyan súlyos dolog. mi lesz a vége – mondta. hallotta a mennydörgés távoli moraját. – Dehogy – felelte Hammond. és természetes ellenfelei sincsenek. ezúttal az őshüllő-ingovány közelében.. Csak az apatosaurusok sokkal nagyobbak. Úgy terveztük és állítottuk elő az állatokat. A sarokban állt egy vörös sávos dzsip.

hogy megtekintsük az utolsó történelem előtti állatot. Lex – mondta Ed Regis. ahányszor csak felmásztak a fákra. Nagy méretükhöz képest kecsesen mozogtak. A száraz földet kedvelik. Tim. Egyesek szerint pedig az ultrasaurus és a seismosaurus még a brachiosaurusnál is nagyobb. Azonnal felismerte. lejjebb ereszkedett és fenyegetőbbnek tűnt. ez egy olyan szellemvasútféle. A valóságban a brachiosaurus háromszor akkora volt. A kocsik programozva vannak. – A brontosaurus a legnagyobb a dinoszauruszok között. mint a felnőttek a karámban. az az. Hirtelen az egyik szélen halványsárga állatot látott felvillanni. – Nem lehet visszamenni? – kérdezte döbbenten Grant. mint a könyvelők! Eleve csak hibákat keresnek. Mennydörgés zaja morajlott fel. – Láttam! Ott a mező közepén! – Mit? – Egy raptort! Ott a mezőn! – A stegosaurus közép-jurakori állat. Egyszerűen nem lehetett az. – Remek – mondta Malcolm. meg újakat talált. – Nem – felelte Regis. – Csak előre tudunk menni. – De fiatalabb. majd újra lejöttek. amely mintegy százhetvenmillió éve fejlődött ki – mondta a hang. A seismosaurus súlya akár száz tonna is lehetett! Az apatosaurusok mellett a hadrosaurusok a hátsó lábaikra állva ágaskodtak.. mekkora lehetett? – Idősebb. Ha tudnák. aztán megjönnek a legelső látogatóink. Tim nem is vette a fáradtságot. A felnőttek azonban ennek ellenére gondozzák őket. – Szerinted mit láthatott a gyerek? – Szerintem is csak oti lehetett. annyi időt töltenek a fákon. nem úgy. és nézzük meg! – Azt nem lehet – mondta Ed Regis. mint az a bébi. a brontosaurusok kerülik a mocsarakat. én nem hiszem – mondta Ed Regis. – Nem tudjuk rákényszeríteni. Észre sem veszik a csodát. Tim pedig visszanézett a hadrosaurusokra. – Éhes vagyok – szólalt meg Lex. és úgy vizsgálják végig. – Csak egy másodpercig láttam – mentegetőzött Tim. már kikelt állapotban helyezték a többi közé néhány hónappal ezelőtt. és Arnold lassú beszédet hallott: . A nagyok szájából kihulló levelek után kapkodtak. itt Malcolm professzor – vágott közbe egy hang a rádiótelefonon át. – De én láttam! Állítsák meg ezt a kocsit! A rádiótelefonban hangzavar hallatszott. Barnás csíkok voltak a hátán. Roppant gyorsan mozgott. amit a könyvekben állítanak. – Az otik kivételt jelentettek a percről percre való megfigyelés alól. – Hé! – kiáltotta. lóg az eső lába – ismételte Ed Regis. – Ugyan. Ellentétben ugyanis azzal. – Mondtam. – Azonnal állítsák meg a kocsit! – Mi az? – kérdezte Ed Regis. Ez körülbelül feleakkora. Azok rendszeresen átugranak a kerítésen. – Én csak egyetlen dolgot kérdeznék tőled ezzel a raptorral kapcsolatban. Az ég sötétebb lett.. A felnőtt állatok körül több kis hadrosaurus ugrált. – Sajnálom. hogy ők is hozzájussanak a levelekhez. – Hol? – Az előbb a mezőn. hogy raptor volt – mondta makacsul Tim. amelyeket most látnak. hogy nem raptor volt – mondta Ed Regis. hogy felépítjük ezt a csodálatos parkot. Azok kétméteresek voltak. – Kattant a rádiótelefon. – Menjünk vissza. amit ma láttunk – válaszolta Tim. hogy át is éljék a csodát. – Tim. hogy kijavítsa. amint a hír elindult Granthoz és Malcolmhoz. – Nehézségeink vannak az otik követésével. – A fiatal állatokat. – Biztos vagyok benne. A számítógép folyton el-elvesztette őket. raptort látott. A vezérlőben Arnold Wuhoz fordult. Arnold bólintott. Biztos valamelyik oti volt. a stegosaurust – mondta a magnóról a hang. – Az nem lehetett raptor. Mit mondanál. ezt a fantasztikus látványosságot. – Tim azt mondja. A kocsi megindult. mennyi bajunk van velük! – Én pedig tudom. – A Jurapark dinoszauruszai nem szaporodnak – magyarázta a hang. – Az az ő bajuk – mondta Arnold. – Gyorsan! Állítsák meg a kocsit! – Most pedig tovább haladunk. – Amit egyszerűen képtelen vagyok felfogni – szólt Hammond –. – Ebből a jellegzetes növényevőből több példány is él itt a Juraparkban. – Lehetetlen.frekventált terület a lagúna mentén nem mocsaras. mint a többi állat. Sírdogálni kezdett.

hogy újra használható legyen. a déli mezőkön – felelte Arnold. A hajó pótlása. a dokkban horgonyzó hajó látszott. Így aztán nincs jó kikötőnk. jobb lenne. de gondolom.. Hammond lemondóan legyintett.. Biztosan megállnak. hogy lássák. Arnold visszafordult a fő konzolsorhoz. – Küldje őket el innen! – Megadjuk az engedélyt a távozásra. de ahogy tőlünk délre ezt a viharzónát elnézem. – Laboratóriumi dolgokról van szó. Arnold bekapcsolta a videomonitort. Lenyomta az adógombot. John. A videomonitoron látták. hogy egy hajó így süllyedt el. – Viszlát két hét múlva! – mondta a hang. még várhat két hétig. ha eloldozhatnánk a köteleket. hogy nem horgonyzunk biztonságban. és szükségem van rájuk. – Ami azt jelenti. mit csinál Harding.. Tudod. – Nekem kell az a berendezés – szólalt meg Hammond. Magam is láttam. mint az északin. Volt már rá eset. – Most hol vannak? – kérdezte Hammond. amint a legénység a fedélzeten eloldozza a köteleket. – Mennyi van még hátra. John. . – Engedélyt kérsz a távozásra? – Igen. hogy vihargátat építsenek a móló védelmére. plusz a kikötő megtisztítása. – Úgy látom. – Az lehet – mondta Arnold. A Land Cruiserek éppen gőzt pöfögő mezőkön haladtak át. – Arra viszont sajnálta a pénzt. Valami berendezés. itt az Anne B a dokkban. Nem ellenőriztem a listát. Még nem fejeztük be a kirakodást.. Akkor aztán a többi költség is a maga nyakába szakad. Szeretnék lelépni. Ha nő a vihar. amelyen a sziget keleti oldalán. a hullámzás odacsapdossa a hajót a dokkhoz. és százötven kilométerre vagyunk a parttól. Jim? – Már csak a három utolsó konténer.– Ööö. mielőtt túlságosan megnő a hullámzás. addig meg hajó sem köthet ki. hogy mindjárt a stegóknál lesznek. Anne B – szólt bele a rádióba Arnold. – A sziget déli csücskén nagyobb volt a vulkánikus tevékenység.

– Mekkora területen mozog az állat? – Úgy tizenkét négyzetkilométeren. – Igen. – Az bizony – mondta Ellie. A bordó színű nyelv bágyadtan lógott ki az állat szájából. – Akkor nem valószínű. . nézd meg a nyelvét! – szólt Grant. ezüstös hólyagokat. de sehogyan sem jutott eszébe. Nemcsak hathetenként betegedne meg. – Nem tudják biztosan – mondta Ellie. – El kell ismernem. dagadt. Beteg. – A nyugtatónak van hatása a pupillára? – kérdezte. – Folyamatosan táplálkoznak? – Hát persze – felelte Harding. Veszedelmesnek látszó. Az állatorvos ráirányította lámpáját. – Ez dr. hogy Ellie is jól láthassa a finom. – Egy ekkora állatnak napi két-háromszáz kilónyi anyagot kell elfogyasztania. – Rengeteg bajunk van ezekkel a stegókkal – mondta az állatorvos. Állandóan legelésznek. mi az. és a rávetődő fényre sem húzódott össze. amit ismert. ahol Grant és az állatorvos a földön térdeltek. – Ellie. Egy férfi jött elő az állat mögül. nehéz légzés és súlyos hasmenés – mondta Harding. nehézkesen lélegzett. – Mi a baja? – kérdezte Tim. Talán ez a jellemző szaga. – Érdekes. Lex felhúzta az orrát. – Egyensúlyzavarok. Igazi bűzzel csak húsevők büszkélkedhetnek.A STEGOSAURUS Amint a Land Cruiser megállt. – Döbbenetes! – mondta. a hátán vízszintes páncéllemezek. a tekintete üres. És ne feledd. – És mik a szimptómák? – kérdezte Ellie. Vörös csíkos dzsip parkolt mellette. és a stegosaurus szájába bámultak. dezorientáció. s a mozdulatlan stegosaurus felé igyekezett. – Csakhogy ez a pupilla ki van tágulva – mondta a biológusnő. Ellie is kiszállt. De afelől kételyei voltak. – Azért büdös. – Körülbelül hathetenként előveszi őket. azért nem mozog. ez tényleg nagyon különös állat – mondta Malcolm. mint egy igen buta lóé. – Egy állandóan legelésző állat folyamatosan beteg lenne. – És ez farmakológiai hatás. – Apró vízhólyag – mondta Ellie. Az biztos. az állatorvosunk – szólalt meg Ed Regis a rádióban. Tiszta folyadék ömlött ki a felszakadt hólyagokból. Előrementek az állat apró fejéhez. – Érzéstelenítette a stegót. Hátranézett. ha mérgező növényt enne. A pupilla összeszűkül. méteres tüskék álltak ki a farkából. Megkaparta körmével a nyelvet. pergamenszerű lemezek a hátán enyhén lefelé lógtak. – Ez tényleg jó nagy – mondta. – Fuj! – mondta Lex. Miotikus hatása van. az orvos lenyugtatózta. A legtöbb növényevőnek nincs erős szaga. Nyugodtan állt. a teste hatalmas. Az ürüléknek sem. mert beteg? – kérdezte Lex. Semmi kétség: a stegosaurus pupillája kitágult. hogy egyáltalán létezni tudjon. amint a második Land Cruiser is megállt. s minden lélegzetvétellel valami nedves hangot adott ki magából. Harding. – Pontosan – mondta erre az állatorvos. Lassan. Meg valami másra. és a két gyerek kiugrott belőle. Grant már kinn is volt a kocsiból. – Lehet. A stegosaurus hét méter hosszú volt. – Nem fertőző? – kérdezte Lex. – Ellie már előbb megérezte a stegosaurus különös szagát. – Megengedi? – kérdezte Ellie. Rothadó halra emlékeztette. meg sem mozdult. A nagy. – Örökösen betegek. – És hogy szaglik! – Tényleg szaglik. Harding is megnézte. hogy növényi mérgezésről volna szó – mondta Ellie. Az el-elkeskenyedő nyak végén azonban képtelenül apró fej ült. Ellie a gőzoszlopokon át szemügyre vette a stegosaurust. Elvette a zseblámpát az állatorvostól. hogy stegosaurust még soha nem szagolt.

és a zúzakövek bontották le a növényi rostokat. hogy ettek volna belőlük. és távolabb ment a réten. A nyugat-indiai orgona bogyója éktelenül keserű.– Nagyjából ezen a környéken? – kérdezte Ellie. azt hiszem. de ennek semmi köze sincs az óceánhoz. valahonnan a távolból. – Viszont csak hathetenként betegszenek meg. – Milyen gyakran jönnek ide a stegosaurusok? – Körülbelül egyszer egy héten – mondta a férfi. többnyire mindig éppen ezen a területen vannak. Lehet. És fura kis halmokat alkotnak. törékenynek tűnő bokrokat? – Nyugat-indiai orgona – bólintott Harding. – „Mi magyarázhatja a szabályos időközönkénti mérgezést?” – Látja azokat az alacsony. mi az. aztán néhány hét múlva kisimul a felületük. mert mind simák. öregem! Ne kímélje a kesztyűt! – kiáltotta Lex. már tudta is. Nyílt réten álltak. Ott is van egy halom – mutatott rá az egyikre Ellie. Mindenütt. és. hogy mérgező. de a biztonság kedvéért többször leellenőriztem az ürüléküket is. – De nem jut semmire – mondta Ellie.. . A Melia azederach. és új köveket nyelnek. Sok madár és krokodil kis köveket nyel. – Fura kis halmokat? – kérdezte Grant. – Ssss! – szólt rá Tim. – Nem dobálna velem valaki egy kicsit? – hallotta Lex hangját a háta mögött. pupillatágulás. Egyes tudósok szerint a dinoszauruszoknak is volt zúzájuk. nyálkahártyák hólyagosodása. – Legalábbis észak és kelet felé mozognak innen – mondta Harding. – Közel lehetünk a parthoz. – Csuda! – mondta Grant. izmos zacskóba gyűjti. – Ellie – szólt. – Az állatok nem eszik – ismételte az állatorvos. közben legelnek. végigsimította a köveket a kezével. Semmi a világon. Mintegy követte paleontológusi ösztönét. Állandóan figyeljük őket a kamerákkal. – Nézd csak ezt! – Ide. – Biztos? – Igen. s ezeket az emésztő csatornába lévő kis. ezért felkérődzik őket. kövekkel. – Ha ezt nem tudnám. A kislány olyan erővel dobta vissza. hogy igazad van. – A stegók lassú hurkot írnak le a lakóhelyük táján. A rét itt-ott köves volt. hogy elrágták volna az ételt. Egyes csontvázakkal együtt találtak is kis kőhalmokat az abdominális rész közelében. s ezzel a könnyebb emésztést segítik. A kínaiak halméregként használták a növényt. hogy a dinoszauruszfogak túl kicsik voltak. Mihelyt rámutatott. állítanám. – És még ott a hathetes szünet – emlékeztette az állatorvos. Teste a talaj fölé hajlott. hogy közelebbről is megvizsgálja a növényeket. A kövek valóban lecsiszolódtak. Balról. – Találsz valamit? – kérdezte Grant. Kisebb kőhalmok voltak rajta szanaszét. Ellie sóhajtott. Zúzakőhalmok. De ezt soha nem sikerült bizonyítani. Erre utalt. – Úgy van – mondta Harding. – Zúzakövek – morogta Grant. ilyen kis halmokban hagyják. mielőtt az elérné a gyomrot. Amitől megbetegszenek. hogy az állatok egyben nyelték le az ételüket. Ezeket a köveket lenyelik. Ezek a kövek kis halmokban álltak. – De ahányszor megbetegednek. amit zúzának hívnak. és időnként gőzoszlopok emelkedtek a magasba a földből. Ezért feltételezték. de mintha csak úgy lehajigálták volna őket oda. Aztán hirtelen abbahagyta. – Biztos vagyok benne. – Igen. A kövek közt bogyókat látott. – Elindult a mezőn. Egy hét alatt járják be. – A növények épek. És velük együtt lenyelnek bogyókat is. A zúza izmainak mozgása révén a kövek összezúzzák a kemény növényi élelmet. Nehéz elképzelni. – De unalmas! – szólalt meg Lex. Megnézte a kőhalmot. hullámverés hallatszott. és Gennaro odadobta neki a labdát. az ég rózsaszín az egyre lejjebb szálló szürke felhők alatt. aki csatlakozott hozzá. azaz a nyugat-indiai orgona több mérgező alkaloidát is tartalmaz. De az állatok nem eszik. Ellie a földet vizsgálta. hogy az állat a Melia-mérgezés összes klasszikus szimptómáját együtt mutatja: eszméletvesztés. „Érdekes rejtély!” – gondolta Ellie. – Érdekes – mondta Ellie. Késő délután volt. – Igen. A stegók sosem esznek az orgonabokrokból.. Semmi jele. és túl kevéssé kopottak. hogy megcsípte Gennaro kezét. hogy az állatok csak a bogyókat eszik. – Sattler doktornő gondolkodik. – Tudjuk. – Igaza van – mondta. – Csak köveket – mondta. Ez viszont értelmetlennek tűnik.

. és egy szigeten akarja elhelyezni őket? Szép álom! Bűbájos. hogy senki sem hajlandó végighallgatni a matematikai következtetéseket. De úgy látszik. más a föld. Nyilvánvaló. – Ehhez az én személyemnek semmi köze. Ez a szerencsétlen állat olyan állapotban van. megvan az oka. Lényegénél fogva kiszámíthatatlan. akkor képesek leszünk előre meghatározni az időjárást.. Azt a rengeteg pénzt. Csak nem fog terv szerint menni. Hammond bólintott: – Tudtam. – Előre látható volt ez is – mondta Malcolm. hogy lássa. – Hozott kólát? – kérdezte Nedry. . Megkíséreltük a lehetetlent – és jó sok pénzt is pocsékoltunk rá. Valami bogyót esznek. – Azért hozták létre a számítógépeket az 1940-es évek végén. mint a Heisenberg-féle bizonytalansági relációé vagy Gödel teorémájáé. – Ezért olyan rossz a vétel. hogy milyen kevesen hajlandók odafigyelni rá – mondta Malcolm. Ez a káoszelmélet. Minden más. – Odalenn vannak a déli csücsökben – mondta Arnold.a stegó. és hallotta. más a növényzet.. Mert a jelenségnek egész osztályai vannak hatalmas kategóriák. hogy egyáltalán alapozni kezdtek itt. – Szóval ez a káoszelmélet? – Igen. Ma jót nevetünk azon. Csakhogy azok meglehetősen akadémikus elméletek. semmilyen körülmények között nem lehet előre kiszámítani. rájöttek. Ősállatot akar létrehozni. Tudja. Az oxigéntartalom csökkent. Az egész evolúció lényegében arról szól. Filozófiai jellegűek.. – . hogy bizonyos jelenségeket soha. ami nem látható előre a maga elmélete alapján? – Nézze – mondta Malcolm. – Igen. – Miről van szó? – kérdezte Muldoon. Ez volt a tudósok dédelgetett álma Newton óta. mintha ólmot akarnánk arannyá változtatni.– Hé. Egyenesen a monitorhoz ment. Gennaro a dinoszaurusz mellett állva tovább folytatta a labdahajigálást. mi a baj a stegókkal. Merő bolondság az egész! Ugyanolyan értelmetlen. Ez a stegosaurus százmillió éves.. Azt mondja. Nem alkalmazkodott a mi világunkhoz. ne olyan vadul! – mondta. mi történik. – Rajtam nincs kesztyű! – Anyámasszony katonája! – mondta megvetően a kislány. hogy ha van egy komputerünk. hogy zihál! – És a többi terület? – A dolog lényege. Hallgassa csak. és most tessék! Gennaro hátrafordult a hangra. hogy az élet minden akadályt leküzdve tör előre. hogy az állatok egészsége az egyik ilyen terület. A káoszelmélet viszont a mindennapi életre vonatkozik. úgy látszik. és hihetetlen. Ha eleget tudsz. mint egy ember háromezer méter magasság fölött. Muldoon válaszra sem méltatta. mások a rovarok. Mint az időjárás. Sokkal nagyobb. mivel próbálkoztak valaha az alkimisták. egy olyan gép. más a napsugárzás. hol jelentkeznek majd az eltérések. – Én minden információt jóval azelőtt megadtam Hammondnak. – Nem akartam filozofálni. de közben Malcolmhoz beszélt: – No és ez a beteg dinoszaurusz hogy illik az elméletébe? – kérdezte. amelyek lényegüknél fogva kiszámíthatatlanok. Gennaro mérgében visszavágta a labdát. az előrejelzés csupán a dolgok követésének funkciója. – Maga ezt mondta neki? – csodálkozott Gennaro. ez. hogy a park nem lehet képes az életformák kordában tartására. Az időjárást sosem lehet egy-két napnál hosszabb távra megjósolni. talán veszedelmesen is. amit a hosszú távú időjárás-előrejelzésre költöttek – vagy félmilliárd dollárt csak az elmúlt néhány évtizedben – egyszerűen elbocsátották. amely egyszerre sok változóval képes dolgozni. mindent kiszámíthatsz. És miért nem? Mert rendkívüli a jelentőségük az emberi élet szempontjából. – Ez már valamivel jobb – mondta Lex. Fájdalmasan. – Malcolm megrázta a fejét. Már észrevettem. – És? – A káoszelmélet ezt az egészet kihajítja az ablakon.. Mindjárt átváltok egy másik csatornára. hogy előbb-utóbb megfejtjük ezt is mondta. hogy rajtunk ugyanígy fog nevetni a jövő nemzedéke. – Gyerünk már! – sürgette Lex. Új területekre terjed át. amiről mindenki annyit fecseg összevissza. mert egyes matematikusok – mint például Neumann János – úgy gondolták. amint Muldoon visszatért a vezérlőbe. Az élet kiszabadul a korlátok közül. Más a levegő. nagy vonalakban. miért építették eredetileg a számítógépeket? – Nem én – felelte Gennaro. végre. Az emberi elme végre megfejti az időjárás rejtélyét! Azt hitték. Sőt azt is megmondtam. Gennaro ingerülten rázta a fejét. – Egyáltalán van. Harding hangját hallotta a rádión át. Ellie és Grant a mező túloldalán kiabált és integetett. amint belecsapódik a kesztyűbe. de az élet mindig utat keres és talál a maga számára. és meg sem fordul a fejünkben.

ez bizony dinoszaurusztojás. halvány. fehér töredéket. Ujjhegyén a halványuló fény felé tartotta a posta bélyegnél nem nagyobb. Harding megrázta a fejét. Ami azt jelenti. hogy igen nagy tojásról van szó. – Elárulja a belső felület mintázata. – De hát nem szaporodhatnak! Lehetetlen! – makacskodott Harding. Mintha háromszögformákból állna. Malcolm is megszólalt: – Azt is meg tudja állapítani. – Nos. Hacsak nincsenek struccok is itt a szigeten. – Több tucatnyi madárfaj él itt a szigeten! Grant a fejét ingatta. – Látom. – Minden állat nőstény! – Én csak annyit mondtam. Alan? – Száz százalékig – felelte Grant. ez dinoszaurusztojás héja? – Igen. – Ez egy velociraptortojás. a belső hajlás. nemrég ástam ki két ilyen mintázatú tojást a montanai lelőhelyemen. – De a dinoszauruszok nem képesek szaporodni! – A jelek szerint mégis képesek – mondta Gennaro. melyik fajé? – Igen – mondta Grant. Teljes bizonyossággal. felfelé hajló vonalmintázatot lát rajta. – Nézze meg a hajlatát! A héj már-már lapos. – Biztos benne. . hogy ez dinoszaurusztojás – felelte Grant. Ha megfordítja.– Nem túl meggyőző – jegyezte meg Gennaro. – Ez biztos csak egy madártojás – mondta erre Harding. – Szóval azt mondja.

9 4.1 4. jó? Kérjük meg Mr. .3 4. kérem! – Semmi akadálya – mondta Arnold. ha lehet. Kétszázharminckilenc.1 3. – Akkor tudna keresni a gép más állatszámot is? – Mennyire gondol? – Legyen mondjuk eggyel több. mint mindig! – Hammond alig tudta titkolni megelégedettségét. elégedett – szólt Hammond.0 3.3 4.9 3.A VEZÉRLŐ – Teljes képtelenség! – fakadt ki Hammond a vezérlőteremben. Malcolm hangja szólalt meg: – Tegyünk egy kis próbát. – Az csak madártojás lehet.0 3. – Jól látszik a maguk monitorán is? – Látjuk – mondta Malcolm.1 3. hogy minden állat megvan.3 2. Arnoldot. Tegye meg. rá tudja adni a Harding doktor kocsijában lévő monitorra is.3 3.9 4. Egy pillanat múlva a vezérlő képernyőjén megjelent a kiírás: Állatok összesen Faj Tyrannosaurus Maiasaurus Stegosaurus Triceratops Procompsognathida Othnielia Velociraptor Apatosaurus Hadrosaurus Dilophosaurus Pterosaurus Hypsilophodontida Euplocephalida Styracosaurus Microceratops Összesen 238 Várt 2 21 4 8 49 16 8 17 11 7 6 33 16 18 22 238 Talált 2 21 4 8 49 16 8 17 11 7 6 33 16 18 22 238 Ver 4. Egyszerűen nem lehet más! A rádió reccsent.3 2. Ha jól értem.1 3. – Egy pillanat – mondta Arnold.9 3.1 ?? 3.1 3. – Akkor azt is látják.0 3.1 Hammond kiegyenesedett ültében.9 4. – Helyes – mondta Malcolm.1 4. Egy pillanat múlva a gép kiírta: Állatok összesen Faj Tyrannosaurus Maiasaurus Stegosaurus Triceratops Procompsognathida Othnielia Velociraptor Apatosaurus Hadrosaurus Dilophosaurus Pterosaurus Hypsilophodontida Euplocephalida Styracosaurus Microceratops Összesen 239 Várt 2 21 4 8 49 16 8 17 11 7 6 33 16 18 22 238 Talált 2 21 4 8 50 16 8 17 11 7 6 33 16 18 22 239 Ver 4. miután hallotta a jelentést a rádión.1 3. most azonnal. futtassa le az állatszámlálást.1 3.9 4.1 3.3 3. – Most? – Igen. Összeráncolta a homlokát.1 – Remélem.9 3.0 3.

Aztán megjelent az első össz-szám. – Gombokat nyomott a monitoron. – Kutya legyek. ha tudom – felelte Wu. Állatok összesen 244 – Kettőszáznegyvennégy? – kérdezte döbbenten Hammond. A hangja emelkedett. – De honnan? – Fogalmam sincs. Hibajelzés villogott a képernyőn. hogy valami hiba van a vizuális követéssel. mert abból indultunk ki. HIBA: Keresett param. hogy az operátor adott számú állatot tápláljon be és csak annyit keres. Állatok összesen 262 – Várjanak már! – szólt Hammond. Állatok összesen 270 – De hát honnan jönnek ezek?! – kérdezte Arnold. A gép biztosan mezei egereket számol. Mit beszél? – Egy pillanat – mondta Arnold. A rádió recsegett. – Nos. Egy pillanat múlva azonban a gép írni kezdte: . Mr. – Nedry! Már megint elszúrt valamit? – Én ugyan nem – mondta billentyűi mellől Nedry. hogy meggyorsítsuk a számlálást. – Majdnem biztos.– Hát ez meg mi az ördög? – Előkerült még egy kompi. igaz? – Igaz – felelte Wu. nem hiba. akkor megkérné mélyen tisztelt számítógépét. Lex. Hammond Wuhoz fordult. Az ernyőt figyelte. – Én úgy tudtam. hogy mindig is azt tette! – Hirtelen megpördült a székével. De úgyis hamarosan megtudjuk. hogy nem is lehet több. Állatok összesen 239 – Nem értem. – Mi folyik itt? – A gép számolja az állatokat a parkban – mondta Wu. mennyi lesz még? Aztán a kislány hangja hallatszott: – Éhes vagyok! Mikor megyünk már haza? – Nemsokára. – Igazat beszél – mondta Arnold. vagy mit tudom én. – Mi egyszerűen csak azért használtuk mindig a kétszázharmincnyolcas alapszámot. A számok az első sorban futni kezdtek. 300 állat nincs – Hiba! – bólogatott Hammond. hová akar kilyukadni ez! – mondta idegesen Hammond. – Ezek az állatok nem képesek szaporodni. – Gondoltam! Én mindvégig éreztem. – Nem képesek szaporodni. háromszáz állatot? – Mit beszél ez? – kérdezte Hammond. Nézték ahogy a szám tovább emelkedik. – Ehhez kell egy-két perc. – A gép engedi. – Az összes állatot. mondjuk. – Félek. mit. hogy keressen nekünk. hogy hibának kell lennie valahol. én igen – szólt Arnold. – Háromszáz állatot. – Én is ilyesmire gondolok – mondta Arnold. Állatok összesen 283 Gennaro hangját hallották a rádióból: – Atyaúristen. De ez puszta kényelmi lehetőség. Arnold.

hogy három „tételben” vittek be a három különböző időpontban kikelt állatokat? Hat hónapos időközönként? – De. – Önök csak annyi dinoszauruszt követtek.1 4. Henry – mondta Malcolm. A probléma az.Állatok összesen Faj Tyrannosaurus Maiasaurus Stegosaurus Triceratops Procompsognathida Othnielia Velociraptor Apatosaurus Hadrosaurus Dilophosaurus Pterosaurus Hypsilophodontida Euplocephalida Styracosaurus Microceratops Összesen 292 Várt 2 21 4 8 49 16 8 17 11 7 6 33 16 18 22 238 Talált 2 22 4 8 65 23 37 17 11 7 6 34 16 18 22 292 Ver 4. – De nem lehet több! – szólt közbe Wu. hányat bocsátottunk ki. Csakhogy a probléma nem ez. – Nem! – Még ha nem is fogadja el Grant doktor tojáshéját bizonyítékul. – Hát ez az! Nem maga mondta. – Akkor olyan görbét kellett volna kapniuk. – Sajnos mégis több van. – Úristen! – nyögte Arnold. ezért úgy tervezték az eljárást. – Ilyet: .. Attól tartottak.1 3. mint amit vártak.3 ?? 4. – Szaporodnak. Nézze csak meg a kompik magassági grafikonját. hogy elveszíthetnek állatokat.9 4. – Abszolút normális. a saját adataik is ezt igazolják.3 4. amely három csúcsot mutat a három különböző generációjú csoportnál. hogy több van. amennyit vártak. Arnold majd lehívja magának. – Nem vesz észre rajta semmi különöset? – Poisson-féle megoszlás – mondta Wu.0 3. – Tudjuk..1 ?? ?? ?? 3.9 3. ha a vártnál kisebb a szám. hogy azonnal tudomást szerezhessenek róla. amely kikerült – mondta Malcolm a billentyűket ütögetve. amennyinek a jelenlétére számítottak.1 Reccsent a rádió: – Íme a hiba az eljárásukban! – hallatszott Malcolm hangja.1 ?? 3. Annál pedig nem lehet több.

A kompik szaporodnak! Wu a fejét ingatta. Ennek így egyszerűen nincs értelme. És nagy növekedés a kisebb állatok számában. azért ez még nem a világ vége – mondta Hammond. Henry! Ez a maga műve! – De hát ha egyszer mind nőstény! – mondta Wu. a maiasaurusoknál és a hipsziknél. – Pedig szaporodnak. – Azt jelenti. a maiasaurusok. Henry – felelte Hammond. hogy tisztában vagyok. Itt valami tévedésnek kell lennie. – Nem értem. hogy jól elszúrta az egészet! – Az kizárt! – Szaporodó dinoszauruszok vannak odakint. a hipszik – és a velociraptorok! – Úristen! – kiáltott fel Muldoon. – Velociraptorok szabadon a parkban! – Ugyan..– Csakhogy maguk nem ilyen görbét kaptak – folytatta Malcolm. hogyan. Kattant a rádió. jó. Méghozzá hét különböző helyen! .. – Csak három kategóriában van növekedés. – Ezek a számok szerintem is alátámasztják. – Lehetetlen. Azok közül is kettőben igen kicsi. – A maguk görbéje szaporodó populációt mutat. És nézze meg a számokat! Kis növekedés a nagy állatoknál. akárcsak az othnieliák. Wu szinte ráförmedt: – Mit beszél? Tisztában van azzal. öt kategóriában. – Nincs tévedés – szólalt meg Grant hangja. mit jelent ez? – Persze. hogy a szigeten szaporodnak az állatok.

– Arnold elhallgatott. hogy a teljes egész összeállításához más fajoktól vett DNS-töredéket kellett használnia? – Esetenként igen – mondta Wu. – Ötven létszám fölötti állat táplálkozásához nem lehet elég néhány fészekalja tojás. további információkat kaphatunk. Nem csak egy lenne. megvizsgálnunk őket. – Szaporodóhelyek? – kérdezte Wu a rádión át. Aztán ahogy múlt az idő. – Nem is elég – mondta Grant. és megszámolnunk a megmaradt tojástöredékeket. hogy madár-DNS-t vittünk be. Malcolm ellenkezett. hogy a hiányzó állatokat megölték-e. – Amikor a dinoszaurusz-DNS-t készítette. Pontosan így volt.. – De miért olyan kevés a nagy állat? – kérdezte Wu. – Igen. – A raptorok éjszakai állatok – felelte a paleontológus.. Sokan voltak. akkor ezek az adatok arra utalnak. – Nem. – Ez igaz – mondta Grant. Malcolm megkérdezte. Nem szaporodhatnak.. – Figyeli valaki a parkot éjszaka? Csend volt a válasz. – Akkor hogyan fogjuk megtudni? – Nekem csak egy ötletem van – mondta Grant. – Hát egyszerűen csak feltételeztük. – Béka-DNS? Miért éppen béka-DNS? Ekkor türelmetlenül közbeszólt Gennaro: – Nézzék. hogy az adja meg a választ a kérdésre. Esetleg kisebb rágcsálókat. ha alaposabban megvizsgáljuk a népességi grafikonokat. Ezen már Grant is törte a fejét. . – És azt hiszem. a gond fokozatosan megszűnt. természetes okokból múltak-e ki. – Akkor nézzen! – mondta Grant. – De hol vannak ezek a fészkek? – Meg kell találnunk őket! – mondta Grant. – Meg kell lelnünk az egyes dinoszauruszfészkeket. És azt hiszem. – De azt akkor sem fogjuk tudni. megvizsgálni az okát. A raptoroknak is kettő. – A dinoszauruszok félreeső helyeken raknak fészket. – Lehetséges. hogy a kompiknak két fészkük van. Grant és társai behajoltak a dzsip ajtói fölött. azt nem fogjuk – ismerte el Grant. sőt talán a tojásból kibújt újszülötteket is. Mennydörgés morajlott a távolban. néha pedig hüllő-DNS-t. – Akkor hadd találjam ki. gondjuk volt a patkányokkal. – De ez legalább kezdetnek valami. hogy az átlagos fészekalja mintegy nyolc-tizenkét tojás. Nemrégiben értesült egy elgondolkodtató német vizsgálatról. És kezdhetjük felbecsülni.A SZAPORODÓHELYEK Az ég egyre sötétedett. akkor nyolctól tizenkettőig kellene terjednie az újabb maiák számának is. – Ezt az adatok alapján nem tudjuk eldönteni. meg fogja találni a választ is. amikor maguk a szigetre jöttek. – És eszükbe sem jutott. Az otiknak egy. – Csakhogy a parkban szabadon járkáló kompik és raptorok alighanem eszik a nagyobb állatok tojásait. Volt. hány állat kelt ki eredetileg. hány hiányzik. – És kétéltű-DNS-t? Konkrétan béka-DNS-re gondolok. – De ez még mindig nem világos – mondta Wu. vagy pedig tényleg elhagyták-e a szigetet. különféle madaraktól. töredékes darabokkal dolgozott. – Attól mindig marad a tény. – Előfordult. – Ha a maiák fészkében a tojások száma nyolctól tizenkettőig terjed. – De hát sosem láttunk ilyet – szólt Arnold a rádióban. Mi a helyzet az egerekkel és patkányokkal? Ismét nem érkezett válasz. – Gondoltam – mondta Grant. hogy az összes állat nőstény.. jó? – mondta Grant. – Az első időben. Utána kell néznem. – Fészkekről van szó – mondta Grant. de azért ne feledkezzünk meg a főkérdésről: jutottak-e állatok a szigetről a szárazföldre? Grant válaszolt neki. – Nézze! – mondta Wu. Azok alapján talán meg tudjuk határozni. És a hipsziknek és a maiáknak szintén egy-egy. igaz? – Igen – felelte Wu. hogy valami mást is esznek. ez mind roppant izgalmas. – Feltételezem. Gyanította. – Ha feltételezzük. úgy lesték a műszerfalba épített képernyőt. – Csak így lehet véghezvinni a feladatot.

– Magam is kezdtem már várni azt a vacsorát. Mi ülünk az első kocsiban. – Bizalmas beszélgetésről van szó – mondta erre Malcolm. – Szóval Mandelbrot valami sajátos dologra jött rá a maga geometrikus eszközeivel. megszólalt Tim: – Most szeretnék az első kocsiban ülni Grant professzor bácsival. – Én viszont sietek vissza – mondta Grant. – Az az igazság. Néhány esőcsepp csapódott a szélvédőre. hogy a számítógép segíthet ebben. – A fraktálok egyfajta geometriát alkotnak – fraktális geometriának hívják –. Nem igazán. – Én azt hiszem. – Viszlát a táborban! – mondta. Felfedezte. – Jó. Malcolm furcsán hallgatagnak tűnt. – Az az érzésem. amit minden iskolában tanítanak – tudod. Próbáltál már ilyennel nézni éjszaka. négyszögek. Grant megjegyezte: – Gondolom. Amikor odaértek a Land Cruiserekhez. hogy az a sort ilyen hatással van rá? – Mással is megesett már – mondta Grant. Aztán beszállt. fiúk? Hogy hangzik egy daiquiri? – Megpaskolta a kocsi fémvázát. ígérem – mondta Tim. és rámosolygott. és odaszólt Grantnak: – Már előre látom. – Készítek egy-két fotót a stegóról Harding doktor gépével. és a nagy hegy egy kisebb csúcsát nézed. Timmy! Ed Regis elnézte őket. és majd Harding dzsipjével megyek vissza én is. Ahogy visszafelé haladtak a halványuló fényben. és elindult a két Land Cruiser irányába. Szóval a fraktálok alighanem a valósághoz kapcsolódnak.– És hogyan fogjuk megtalálni ezeket a fészkeket? – Azt hiszem – mondta Grant –. – Hadd üljenek ők ketten a hátulsó kocsiban. Úgy érzem. Sattler doktornő lehet az indíték. Azok a vízhólyagok a nyelvén holnapra már feltisztulnak. Tim? – szólt közbe Ed Regis. – Én még maradok egy kicsit – mondta Ellie. és már futott is az első kocsihoz. Tim? Rendkívül érzékeny infravörös szűrő van a lencséjében. – Klassz! – vágta rá Tim. Malcolm szólalt meg: – Vajon mi lehet a közelebbi oka. és futva ment az első kocsihoz. és használhatod az éjszakai nézőt. maradok – mondta Gennaro –. ilyesmi –. milyen lesz a visszaút! Grant és Malcolm beszállt a második kocsiba. Ha közelebb mégy. veszélyes ponthoz érkeztünk. A hegyek és a felhők fraktális formák. – Te! – mondta Lex. Sattler doktornővel együtt. gömbök. – Nem ér a nevem! Nem ér a nevem! Mindent csak neked lehet. van egy bizonyos csipkézett hegyformája. – Gondolod. – Miért? – Megérzés. a fraktális geometria minden jel szerint valós tárgyakat ír le. hogy inkább rettegés fogott el. milyen jólesne egy finom kis banános daiquiri! Mit szólnak hozzá. – Én éhes vagyok! – Jó. – Igazán türelmes voltál. Malcolm válaszolt: – Sajnos Grant professzornak és nekem megbeszélnivalónk van. – Én is akarok nézni vele. akkor menjünk! Elindultak. hogy különböző nagyságrendekben? – Például egy nagy hegynek – mondta Malcolm –. Vörös fény villant fel a műszerfalon. – Én csak ott szeretnék ülni. annak is ugyanolyan formája van. amivel látni lehet a sötétben. – Induljunk! – szólt Ed Regis. van egy kis sikerélményed. menjünk – mondta Grant. Az intuíció roppant fontos dolog. ha távolról nézzük. hogy különböző nagyságrendekben a dolgok szinte azonosnak látszanak. A közönséges euklideszi geometriával szemben. – Nem – közölte Tim. – Hisznek a matematikusok az intuícióban? – Teljes mértékben. hogy a mi kitűnő jogászunk maradni akar? Grant vállat vont. amely egy Mandelbrot nevű ember nevéhez fűződik. A Land Cruiserek finom. Nem is szólva arról. És voltaképpen . – Körülbelül húsz perc múlva ehetnek is – mondta Ed Regis. – Visszamehetünk már? – kérdezte Lex. Már ami az elméletedet illeti. – Tényleg? – Malcolm áttért a tegezésre. Intuíció. Egyébként a fraktálok jártak az eszemben – mondta Malcolm. kockák. – A gyerekkel megyek. – Te tudsz valamit a fraktálokról? Grant megrázta a fejét: – Nem. – Én is – tette hozzá Malcolm. elektromos zúgással megindultak. amelyek a természet világában léteznek. – Tudod mit. Valami módon. Hiszen beigazolódott. Meg sem szólalok. – Mi az.

hogy az a fajta egyszerű linearitás.ahogyan lefelé haladsz a skálán. De valamilyen okból továbbra is makacsul úgy teszünk. és alig tudta kivenni a részleteket. mint egy egész élet. érintkezések sora. kiszámíthatatlanul. . hogy éppen ez most miért aggaszt téged – mondta Grant. mint egy évé vagy tíz évé. mint ami beépül magába a lét szövedékébe. Amint nézte. és a kislány izgatott hangját hallotta: – Oda nézz. A való élet nem egymással belsőleg összefüggő események sora. Látták. Grant bekapcsolta a rádiótelefont. A dolgok valahogyan visszafordulnak önmagukba. és a néhány méterrel előttük haladó. de a gyerekek teljesen izgalomba jöttek – mondta. az előttük levő kocsiban a gyerekek az óceán felé mutogatnak. amely a dolgok normális rendjén kívül esik. amely a partra és az óceánra nézett. – Malcolm hátradőlt az ülésen. Hogy a dolgok hirtelen megváltozhatnak. hogy a hirtelen változás valami olyasmi. Ásított. visszatérésre utal. irracionális változást. – Keresse mélyen lent! Grant lejjebb billentette a látcsövet. és futva közelítette meg az ő kocsijuk ablakát. Timmy! Látod? Ott van! Malcolm összehúzott szemmel a hajót kezdte nézni. mint a gyöngyök a nyakláncon. A linearitás csinált. – Mélységes igazság ez. – Mandelbrot egy bizonyos azonosságot fedezett fel a legkisebbtől a legnagyobbig. Most értek a partvonalhoz. De már egészen besötétedett. de. Egy nap olyan. amelyek úgy követik egymást. – Történéseknél? – Vegyük a gyapotárakat – mondta Malcolm. amely közel áll a valósághoz. amely ismétlődésre. Olyan sötét volt már. – Nem látok semmit. látjuk. – Mi azonban beleringattuk magunkat abba az elképzelésbe. Most közvetlenül a merülővonal fölött pásztázta a hajótestet. lát valamit a hajón. hogy az egész létezésednek ugyanaz a véletlenszerűség a jellemzője. Végigpásztázta a szállítóhajó hosszú testét. Baleset.. mint egyetlen napodé. amit adottnak fogadtunk el mindenütt – a fizikától a szépirodalomig – egyszerűen nem létezik. Az egész életed formája ugyanaz. – És a káoszelmélet arra tanít bennünket. Kissé távolabb a parttól. amely egész világegyetemünk szerkezetét érinti. hogy szinte csak egy sziluettet látott. az egyre lejjebb ereszkedő felhők alatt Grant észrevette a szállítóhajó sötét körvonalait. És életed végén rájössz. Grant felkapta a távcsövet. – Mi történt? – kérdezte Grant. hogy egy nap áringadozásainak görbéje alapvetően ugyanolyan. de a végén azon kapod magad. hogy feljebb. – Elnézést – mondta –. Valójában az élet olyan találkozások. – Nem – mondta Malcolm. És ez a nagyságrendi azonosság történéseknél is jelentkezik. Megcsapta az orrát a vulkáni gőz kénszaga. Vagy túl van azon. – Miért álltunk meg? – kérdezte Malcolm. – A gyapotárak több mint száz évre visszamenőleg kitűnően dokumentáltak. amit csak mikroszkóppal látsz. így is fel lehet fogni a dolgokat – mondta Grant. És minden így van. Ha megvizsgáljuk a gyapotárak ingadozását. – Nem egészen értem... – Lát valamit? – kérdezte Ed Regis. másik Land Cruisert nézte. mint a nagy hegynél.. – Nem – felelte Grant. amelyik viszont nagyjából ugyanolyan. Valamiféle állatot – mondta Regis. – Van maguknál távcső? – Minek? – A kislány azt állítja. ami utána következik. – De én látom – vágott közbe türelmetlenül Lex. de el sem jutsz oda. mindvégig felfedezhető ugyanaz a fraktális forma. és könyökével megtámaszkodott a Land Cruiser ablakának peremén. – Ez tulajdonképpen egyfajta világlátás – mondta Malcolm. egészen az icipici szikladarabokig. Az azonosságról alkotott fraktális elképzelésnek ugyanis van egy olyan aspektusa is. eltervezed. hogy elintézed ezt vagy azt. mint egy hét görbéje. amelyben minden esemény teljes mértékben egy csapásra megváltoztathatja mindazt. Belekezdesz valamibe. ami egyet jelent azzal. mintha nem volna igaz! E pillanatban a kocsik hirtelen zökkenve megálltak. A végénél! Tessék a végénél figyelni! – De hát hogyan láthatnak bármit is ebben a fényben? – kérdezte értetlenül Malcolm. kigyulladtak a hajó utazólámpái. Ed Regis kiszállt az első kocsiból. – Csak így lehet felfogni! Legalábbis ez az egyetlen olyan felfogás. – Hát gondolom. radikális. hogy a történések kiszámíthatatlanok. sőt akár pusztító módon is. – A hajóról beszélnek? – Úgy tűnik. – Jó. Pedig beépül – szögezte le Malcolm. mint amikor két autó összeütközik. Nem úgy fogjuk fel a hirtelen.. amely Puntarenas felé vette az irányt. mesterséges világlátás. minden előzetes figyelmeztetés nélkül. mint a halálos betegség. Csak úgy ragyogtak a sötétbíbor kora estében. amit ellenőrizni tudunk. – Mélyen lent vannak – mondta Lex a rádión át.. hogy egész mást csinálsz.

– Szóval egyedül mi tudunk a hajón lévő állatokról. mintha ragyogó zöld levélalagúton haladna át. Éjszaka az egész utat bevilágították a hatalmas fényszórók. Lehet. mintha mind bedugult volna. Aztán kiegyenesedett. – Legalább kettő. – Akkor bocsánat! – mondta Nedry. – Ásított. – Ne izguljon! Inkább hívja a vezérlőt. Sistergő légköri zörejeket hallottak. Légköri zaj sistergését hallotta a rádióban. monoton sistergést hallott benne. – És miért nem tudunk beszélni velük? – Nem tudom – felelte Arnold. – Egypárat megnyitok a következő adás végén. Muldoonnak mindennap ez volt a legkedvesebb pillanata. ha van. – Jézus. fokozatosan. – Talán kikapcsolták a rádiókat a kocsikban. most tényleg hozok magamnak egy kólát. – Ezzel valami baj van! – mondta Regis. pedig valaha magunk is így láttunk. lassan. – Micsoda lompos alak! – szólt Hammond. – Még mindig nincs kapcsolata a vezérlőteremmel? – Eddig nincs. – Ne nyúljanak a konzolomhoz. Ide-oda cikáztak a tatnál lévő felépítmények körvonalai között. Arnold felvette a telefont. és lekapta a rádióadót a műszerfalról. hogy a vihar az oka – mondta Muldoon. – És Hardinggal? Őt el tudja érni? – Nem. de azonnal! – kiáltott rá Nedry. Kölykök. Nagy esőcseppek folytak szét a szélvédőn. úgy tizenöt perc múlva. De elég megbízható. – Úgy látom. – De azt hiszem. oké? Az ajtó becsukódott. – Megszakítja az adatfolyamatot! – Az összes telefonvonalat elfoglalta? Még a belsőket is? – A külső kommunikációra szolgáló vonalakat valóban mind igénybe vettem – mondta Nedry. – Tetszik már látni? – kérdezte Lex. – Az – mondta Arnold. Malcolm a fejét ingatta. Hét órakor az egész szigeten kigyúltak a kvarc reflektorfények. hogy két lábon járó állatok. Grant elkomorult. hogy kikapcsolta a készüléket. – Holnap délelőtt tizenegy körül kell odaérnie. és szóljon nekik. akkor az. Elrohant az első Land Cruiserhez. – A vihartól származó interferencia. hosszú hétvégém lesz. – Valószínűbb. Grant beleszólt a rádióba: – Mennyi idő alatt éri el a hajó a szárazföldet? – Tizennyolc óra alatt – válaszolta Ed Regis. Játszottak. – A Land Cruiserek újra elindultak – szólt Arnold. meg a kattanásokat. – Olyan éles a látásuk. s az egész tájat hatalmas ékszerré varázsolták. Grantnak olyan érzése támadt. amint legörnyed. Csak egy kis ideig voltak a szeme előtt. de még a halványuló fényben is megállapíthatta. – De miért álltak meg? – kérdezte Muldoon. de máris! – mondta Grant. – Pedig úgy látszik. – Az órájára pillantott. – Jézus Mária! – nyögte Ed Regis. amit nem szeretnénk. Azt hiszem. – Az a hajó a szárazföld felé tart! Malcolm megvonta vállát. – Állandóan próbálok elérni valakit – mondta Ed Regis. – De a belső vonalaiknak működniük kellene. – Nagyjából. nem egész egy méter magasak. – Hazafelé tartanak. amely dél felé nyúlt. A hajó tatja irányába mozgatta a távcsövet. . és visszanézett rájuk. amilyenre mi már nem is emlékszünk. hogy azok az állatok a szárazföldre kerüljenek! – Mennyi idő alatt érünk vissza a bázisra? – Innen még tizenhat-tizenhét perc – felelte Ed Regis. – Felkapta a válltáskáját.– A gyerekek látnak – válaszolta Grant. érti a dolgát. semmi mást. és az ajtó felé indult. – Ez mi? – kérdezte. – Nem működik. Látták. Ed Regis benyúlt. tegye vissza. – Látom. Az út mentén a vulkáni gőz felhői szivárványt szőttek a ragyogó kvarcfények köré. hogy hívják vissza a hajót. – Az Isten szerelmére. ahogyan sorra váltotta a csatornákat. és a testüket merev farok tartja egyensúlyban. – Mindkét rádióval baj van! – kiáltotta. És ekkor ő is meglátta az állatokat. A vezérlőben Muldoon a parkra néző nagy ablakok előtt állt. – Mik ezek? – Raptorok – mondta Grant. Már próbáltam. – Nem tudom hívni a vezérlőtermet! – Akkor induljunk. és egyenletes.

Mert hogy sosem lehet tudni. amely körül folyékony nitrogén fehér felhője gomolygott. „Itt járt Zorro!” Harmadsorban azonban Nedry ezzel biztosította be magát a jövőre. és kinyitotta a „járható” hűtőszekrényt. – A külső ellenőrzőmonitorok elsötétedtek. Az az átkozott Nedry! Nedry! Ez meg hová a fenébe tűnt el? Dennis Nedry óvatosan kinyitotta a FERTILIZÁCIÓ feliratú ajtót. Az egyik oldalon kisebb. alufóliába csomagolva. – Biztos pillanatokon belül újra kigyullad a fény. – Most mi van? Lex szólalt meg: – Nem akarok megállni! Miért álltunk meg? – Ez csak valami áramkimaradás vagy ilyesmi lehet – mondta Ed Regis. hogy ő maga programozta így. Nedry pedig nem tehetett mást. és kis csőállvány siklott ki belőle. mint egy gardróbszekrény. Visszaejtette a tartályt a táskájába és behúzta a zárat. s a tartály deres lett a kezében. és elővette a Gillette borotvahab tartót. A polcok nagyrészt műanyag zacskókban lévő reagenseket és folyadékokat tartalmaztak. elképzelte. Mindegyik embrió üvegtartóban volt. az összes olyan ajtó zárja kioldódott.Egyszer csak érezte. Nedry elhúzta a villámzárat a válltáskáján. szándékosan. A biztonsági rendszer hiányosságai az élen álltak a Jurapark hibalistáján. Belépett a fertilizációs terembe. Az ő segítsége nélkül órák alatt sem tudják megszüntetni a zűrzavart – de néhány perc múlva már Nedry is ott lesz. hogy bejuss. Nedry hajlandó volt végighallgatni a mondókáját. hogy Nedry nem megbízható. Apatosaurus. majd megáll. Sem a fények. semmi. Ahogy visszalépett a folyosóra. mekkora lehet a riadalom a vezérlőben. s látta. – Kiment az áram? – Igen. Szabályosan megzsarolták. és becsúsztatta őket a borotvahabtartályba. hogy hozzák rendbe! Arnold felkapta az egyik telefont. Dodgson azt mondta. de nem volt hajlandó fizetni is érte. hogy a periméter. amelyet csak biztonsági kártyával lehetett kinyitni. hogy itt szó sincs hibáról. A hűtő akkora volt. nincs olyan rendszer a parkban. . Lecsavarta az alját. nem juthat-e valakinek eszébe. A nagy számítógépek tervezői csak ritkán tudnak ellenállni a kísértésnek. Nedry gyorsan mindegyikből kikapott kettőt. Ezután visszacsavarta a tartály alját. Rengeteg kellemetlensége volt a Jurapark tervei miatt. benne polcok a padlótól a mennyezetig. és visszatért a főlaboratóriumba. És nem tagadta. felhívták a figyelmüket. Hallotta a kiszabaduló gáz szisszenését odabenn. – Ez meg mi az ördög! – kiáltott fel Arnold a monitorokra meredve. az egész személyzet vacsorázni ment. Nincs olyan helyiség. az ajtaja vastag kerámia. – Mi van a két Land Cruiserrel? – Valahol a Tyrannosaurus-domb közelében állnak. hogy a tartály belseje csupa henger alakú üreg. hogy ő bizony ki tudja játszani a Jurapark biztonsági rendszerét. Arra hivatkoztak. hogy a Land Cruiser lelassul. amint kezdik felfogni. Kinn a parkban viszont nincs áram. ahová ne tudna bejutni. Perrel fenyegetőztek. hogy ne hagyjanak a maguk számára egy titkos bejáratot. leveleket írtak Nedry más ügyfeleinek. és végrehajtotta a Hammond által kívánt változtatásokat. Hadrosaurus. Nedrynek megfordult a fejében. ahol a megtermékenyítés zajlott. A biztonsági kódok teljes összevisszaságban. az épületben minden teljesen rendben. Nedry elhagyta a hűtőt. amelyen ez állt: TARTALMA: BIOLÓGIAILAG ÉLETKÉPES ANYAG. és fordított egyet a tetején. FENNTARTANDÓ MINIMÁLIS HŐFOK -10°. – Mi történt? – kérdezte Malcolm. a védőövezeten belül. a telefonvonalak mind bedugaszolva. mi történt. Kinyitotta. Egy lélek sem volt a laboratóriumban: ahogy előre sejtette. Tudniillik szántszándékkal így programozta be az egészet. és helyrehozd a zűrt. nitrogénes hűtődobozt látott. poliénnel ledugaszolva. Az InGen nagymérvű módosításokat követelt az egész rendszerben. Klasszikus rejtekajtót épített magának. – Hát akkor hívd a karbantartókat. mindig van rá mód. Két percig sem tartott az egész lopás. Mindkét kezére vastagon szigetelt kesztyűt húzott. de csak sziszegést hallott: Nedry komputerei beszélgettek egymással. és pillanatok alatt mindent rendbehoz. Részben a józan ész is ezt diktálja: ha a felhasználó ügyetlenségből lezárja a rendszert – aztán téged hív segítségül –. amikor tapogatózni kezdett volna Lewis Dodgson a Biosyntől. Semmi sem működik. hogy ez az eredeti szerződésben is benne van. Bőven kitart míg visszaér San Joséba. Azzal. mi történt. sem a TV-kamerák. de csak odakint. a védőövezet területén mindenütt megszűnt az áramszolgáltatás. Másfelől ez afféle titkos aláírás vagy jeladás. mint hogy lenyelte a külön költségeket. És még csak sejteni sem fogja senki. harminchat órára elég a benne lévő hűtőanyag. Később azonban. Tyrannosaurus. Itt. Az embriók fajok szerint voltak elrendezve: Stegosaurus.

– Most van igazán baj! – Mi van? – kérdezte Muldoon. – A kerítések?! – kérdezte döbbenten Muldoon. – Biztos. és behozom az utasokat a Land Cruiserekből – mondta. de mintha senki sem vett volna észre semmit. ódabólintott az őrnek. hogy a biztonsági rendszer kikapcsolásával az összes elektromos védőkerítés is kikapcsolódik. ha kiszállnak. Lemaradhatnak. és egyenesen a keleti dokkhoz. mit fognak tenni az emberek a kocsikban. – Értesítem az őrséget – mondta erre Muldoon. – Az igazi az. hogy a sokkhatást el kell kerülni. persze. a kocsik újra elindulnak. de az ördög nem alszik.. befelé a parkba. Látta. és a partot nézte. – Én mindenesetre kocsiba ülök. – Igen. hogy a dzsip kigördül a föld alatti garázsból. Amikor beszállt. A dzsip nem volt a helyén. – Kiszabadulhatnak az állatok. valami fura. akár bennük ülnek az utasok. Nem valószínű. hogy a személyzetből néhányan futva igyekeznek fedél alá az eső elől. hogy ebben az esőben elhagynák a kocsikat. – Valószínűleg nem fog történni semmi. az elektromos kerítések – felelte Arnold.Dennis Nedry vigyorogva lesétált a földszintre. „Mi az ördög folyik itt?!” . milyen hamar megtanulják. És onnan ismét három perc vissza a vezérlőterembe. Az eredményt megérezték. – Teljesen össze van kavarva minden! – Hiába nyomkodta a gombokat a konzolon.. Elfordult az ablaktól. Majdnem. Leért a garázsba. – Ajaj! – mondta Arnold. – Az egész épületben minden tárvanyitva áll. és percek alatt ki. Muldoont jobban nyugtalanította. mert mihelyt visszakapcsolódik az áram... Az egész szigeten kialudtak a fények. Innen a parkba. Gyerekjáték! – Az istenfáját! – dühöngött Arnold.. hogy puszta előrelátásból betette a rakétakilövőt. szürke csőszerűséget vett észre az utasülésen. benzinmotoros dzsiphez ment. mint egy rakétakilövő. miközben elfordította az indítókulcsot. Nedry az órájára pillantott. Valószínűtlen volt hát. kivéve a főépület közvetlen körzetét. és a dzsip felé indult. Muldoon az ajtó felé indult... és tudta.. – De ez a legkisebb baj – folytatta Arnold. gondolta magában. ahol fényesen ragyogtak a lámpák. „Nincs itt! Mi az Isten?!” – Muldoon döbbenten bámulta az üres parkolóhelyet. ami biztos! Muldoon lesietett a lépcsőn az alagsorba. Alig két-három stimulációs esemény elég egy kísérleti galamb betanítására. – Egy sincs áram alatt az egész szigeten. Egyetlen ajtó sincs már zárva.. Muldoon átnézett a vendégkastélyra. gondolta. és a karbantartóúton keletnek tart. Muldoon ismerte az állatokat. – Csak nem azt akarod. Muldoon az ablakoknál állt. mit lehet tudni. A motor felberregett. – Cigarettára gyújtott. – Az a hülye Nedry kikapcsolta a biztonsági rendszereket – mondta Arnold. Nem szerette volna.. és már jó néhányszor súrolta a kerítést mindegyik. Így azonnal indulhat. Milyen szerencse. s így éppen nem látta. hogy a kerítések áramtalanul maradtak. nem nyugtalanította olyan nagyon. de mégis. hogy a dinoszauruszok most megközelítsék a kerítést. és folytatta az útját az alagsorba. A dinoszauruszok többsége már kilenc vagy annál is több hónapja van a helyén. Három perc az egész. Az. akár nem. Az elektromos Land Cruiserek szabályos sora mellett elhaladva a fal mellett parkoló. – De igen – mondta Arnold.

IAN MALCOLM .NEGYEDIK ISMÉTLŐDÉS Elkerülhetetlenül kezdenek megjelenni a belső kiegyensúlyozatlanságok.

– Vajon mi lehet a probléma? – Talán rövidzárlat keletkezett az eső miatt. – Ezt nem jól vettük. amely a füle táján helyezkedett el. Kezével megkereste az igazítógombot. Négy vagy öt perce. Még szép. Még a föld is megremegett. végképp nem. Akkorát. s az időjárás is mindegy neki. Ásított egyet. amely sebesen átkelt az úton a két kocsi között. – Tim! Ott vagytok?! . Az volt az érzése. ami azt jelentette. de már csak egy szemvillanásnyi ideig látta a sötét alakot. Mit számíthat egy tyrannosaurusnak a napszak? Az eső csak zuhogott tovább. Klassz! Grant az első szélvédőn át éppen feléje bámult. és fokozta az erősséget. hogy maradunk! – morogta. akkora. – Mi az? – kérdezte Grant doktor. hogy a tyrannosaurusok előjönnek-e éjjel. – Jézus Mária! – Mi volt az? – Hatalmas. – Maradjatok a kocsiban! – Maradunk. Mindenki elhallgatott. Az ablakokon patakokban folyt le a víz. Tim megint végigpásztázta a levélsövényt. foszforeszkáló fény villant fel. – Csak a húgom beszél összevissza. elektronikus zöld volt. – Mióta ülünk itt? – kérdezte Malcolm. Csak az eső dübörgött a kocsi tetején. Feszültség volt a hangjában. amint leakasztja a rádióadót a műszerfalról. benne Grant doktor és Malcolm doktor. A kocsik villanyárammal mennek. – Nem tudom. Az eső zaját hallgatva Tim érezte. hogy megnézze őket! Vajon csillogna-e a szeme a sötétben? Az volna csak az igazi! De semmit sem látott. de hát itt ragadtunk. – De nem villámlik. aztán megszólalt Grant hangja: – Láttok minket magatok mögött? Tim elvette a rádiót Ed Registől. hogy elálmosodik. Egy pillanatra éles. hogy ijedtében összerezzent. A hangszóróból egy pillanatig csak légköri recsegés hallatszott. – Minden rendben? – Semmi bajunk. mint egy tyrannosaurus.. A nézőn át a levelek színe fényes. kicsikém.. hogy a tyrannosaurus éjjeli-nappali állat. hogy valahol a tyrannosaurus-rész közelében vannak. mögötte a drótkerítés zöld szerkezetének egy-egy darabja látszott. Hátrakapta a fejét. Tim látta. Lex szólalt meg. Éjjeli állatok volnának? Tim nem emlékezett biztosan. – De még alig esett. még a nézővel is alig. s most idegesen nyomkodta bőrkesztyűjét. Ed Regis felhorkant: – Ömlik az eső. Grant bácsi. Azon kezdett gondolkodni. A Land Cruiserek egy domb lefelé tartó lejtőjén álltak. Izgis lenne ezzel a nézővel tyrannosaurust látni! Micsoda szám! Hátha a tyrannosaurus a kerítéshez jön. – Látjuk. – Mennyi időre ragadtunk itt? – Amíg helyre nem állítják az áramot. hogy olvasott-e erről. Lex – mondta Ed Regis –. de nem látott semmit. Tim jóformán ki sem látott. Ne tessék félni! – Kikapcsolta az adógombot. – Igazi felhőszakadás! Aztán Lex szólt: – Éhes vagyok! – Tudom. aztán elektronikus zöld és fekete árnyalatokban tisztán kivehetővé vált a hátulsó Land Cruiser. és az utat szegélyező növényzetet vette szemügyre. – Aha.A FŐÚT A Land Cruiser tetején hangosan dobolt az eső. Erre megint csend következett. aztán fel is hagyott a próbálkozással. Az éjszakai nézőkészülék súlyosan nehezedett Tim homlokára. Tim megfordult. ugye? – Mindig félt a villámtól. ami az utakba épített kábelekben fut. mint a kocsi. – Micsoda eső! – szólalt meg Ed Regis. majd az út bal oldalát szegélyező pálmafák felé fordult – és abban a pillanatban akkora dobbanást hallott. amikor történt.

kitörölhetetlenül. keményen zuhogott. A kép ott maradt az agyában. Olyan volt a felszíne. mi történhet az emberrel. vagy akármi is volt az. – Ez csak villám. minden idők legszörnyűségesebb támadója. s nem tud úrrá lenni a remegés felett. Aztán sötétség és újra csend. mi van ott? – Igen. Lex szipogva sírdogált tovább. – Csak áll a kerítésnél. – Mi a fene volt az? – kérdezte Malcolm. látom. négy. várva a véget! Tennie kell valamit! Valamit! Reszkető keze a műszerfalnak ütődött. A levelek mögött. s a kerítésen át nézte a két Land Cruisert... amiért nem figyelt eléggé. és nem látta az állatot. majd figyelem – mondta Tim. Timnek az volt az érzése. de aztán. Az csak állt ott. Nézte a tyrannosaurust a készülékkel. kicsikém – nyugtatta Ed Regis. – Oké... Tim egy kicsit szégyellte magát. rázták a leveleket. Tim tovább pásztázta a sövényt. Tim. három. Mekkora a feje! Egyik kocsiról a másikra nézett. Timnek végigfutott a hátán a hideg. Egyszerre szégyellte magát és rettegett. – Én nem sokat látok innen.. A nézőkészülékben úgy látszott. Ed Regis érezte.. Tim az út szegélyét pásztázta. És ekkor megpillantotta a tyrannosaurus hatalmas fejét. mintha kavicsokkal lenne kirakva. Himbálózott a levegőben. De azt tudta. aki éppen kinézett az ablakon. hanem maga a rex! Sokkal. Csak úgy libegett a nadrágszára.. amely valaha a földön járt! – Atyaúristen! Amikor a tyrannosaurus elbődült. Tim nézte a tyrannosaurust. Újabb szünet következett. – Én jól látom. Nem ülhet itt tétlenül. Mintha pontosan Timet bámulta volna. A kisfiú lehunyta szemét. és számolni kezdett: egy. És ez nem is raptor. egyedül Ed Regisnek volt fogalma arról. Mozgásba jött minden.. és nagyon közeli. – A tyrannosaurus volt az? – kérdezte Ed Regis. Bevizelt. hogy egyre jobban reszket a térde. – Történik most valami? – Semmi – mondta Tim. aztán megragadta a kerítést.. – Jézus Mária! – kiáltott fel Ed Regis. újságíróagya valamelyik zugában Ed Regis még mindig reklámszöveget írt. magasabbra. kettő. vagy szemcsés. – Azt nem hiszem. hogy Grant doktor igyekszik úgy beszélni. A legnagyobb ragadozó. – Jaj. ne. Csak áll. hogy melegség terjed végig belül a nadrágjában. megpillantotta a kisebb.. – Igen. Tim? – Nem – felelte Tim. Iszonyú rettegés fogta el..Felkapta a rádiót.. de sokkal nagyobb! A leghatalmasabb húsevő. cseppjei verték. csak az eső dübörgött tovább. – Tim? – Igen. Aztán hirtelen nagy csattanással fehér villámfény hasított végig az égen. Lex sírva fakadt. – De nem láttad? – faggatta Ed Regis. Mintha életre kelt volna maga a táj is. – Éppen elmulasztottam. Aztán vissza.. a kerítésen túl valami vaskosat látott. Tim? – Igen. Tim feljebb nézett. ahogy a tekintete lefelé haladt az óriási fejtől és állkapcsoktól a test felé.. Állj! Valami van a levelek között. az iszonyú volt. hogy muszáj tennie valamit. milyen a dinoszaurusztámadás. . – Nem. – Rajtad van az éjszakai nézőkészülék.. A tájat ismét bevilágította a villám. De ez nem fa volt.. Az úton volt valami. Mintha egy másik világból jött volna az üvöltés. Grant professzor. Az óriás állat a fejét forgatta. mint a fa kérge.. Tim tekintete a nézővel tovább haladt felfelé. Grant bácsi? – Látod. Ő tudta.. itt vagyunk! – Láttad. De ugyanakkor érezte.. aztán még feljebb kúszott. Nem volna szabad itt lennie! Mindannyiuk közül.! – Semmi baj. és bömbölt egyet a vakító fényben. A mennydörgés csattanása fülsüketítő volt. akik a kocsiban ültek. hogy a szeme élénkzölden ragyog. hogy rá ne ijesszen a húgára. Az eső sűrűn. amely valaha is a földet taposta. – valahol. Látott raptor marcangolta testet. Tim nézője vakító zöldet villant. izmos mellső végtagot..

és látta. de már csak annyit látott. – A kisfiú azt mondja. és mennydörgés robaja töltötte be a levegőt. A Land Cruiser ajtaja nyitva himbálózott. – Hogy mit csinált? – Elszaladt. – Hová megy. Tim hallotta. – Tim? – Igen. Az bömbölt. A mellső lába a kerítést markolta. mert az óriás eltakarta. Kattant a rádió. És azt hiszem. – Tim lekapcsolta a rádiót. Az állat fejét nem is látta. és behúzza a nyakát az esőben. Grant bácsi. – Zárd már be az ajtót! – kiáltott rá a bátyja. – Nincs áram a kerítésben? – hallotta Malcolm kérdését a rádión át. mozdulatlan óriásként. Hátsó lába karma beleakadt a földre tiport kerítés hálójába. – Mi van veletek? – Regis bácsi elszaladt – mondta Tim. Amikor újra odanézett. Nem férhet hozzátok. a belső borítás egyre vizesebben csillogott. amint kiszabadítja lábát a kerítésből. Tim előrehajolt. és elnémult. A villám fényénél látták. nem is moccant. – Nem szabad jézusozni! – szólt rá Lex. hogy Ed Regis kilép az ajtón. – Oké. ki az ömlő esőbe. a tyrannosaurus pontosan ugyanúgy állt ott. mint kell. mint valami monoton sirámot. hogy visszanyerje látását. a kerítésben nincs áram – mondta Tim. Tágra nyílt szemmel bámulta. és megpróbálta becsukni az ajtót. – Itt hagyott! Itt hagyott! – ismételgette. Grant professzor. mi van veletek? – kérdezte ismét Grant. Lex? A kishúga némán bólintott. hogy nyugton maradjatok. el a dinoszaurusztól. – Hallottad ezt. – Tim! – Tessék. Visszanézett a tyrannosaurusra. és egy ugrást tesz előre. és becsukni az ajtót helyette. és becsapta az ajtót. éppen amikor ismét villám ragyogta be az eget. és ne hívjátok fel magatokra a figyelmét jobban.– Jézus Mária! – mondta megint. hogy nyílik az ajtó. – Tim. csukd be az ajtót! Reccsent a rádió. és intően mozgatta az ujját. Megint a rádió: – Tim! Ott vagy?! A kisfiú megragadta a készüléket. A zajt elnyomta a mennydörgés hangja. csukd be az ajtót! – De Lex csak sikítozott. Hirtelen elfordította a fejét a tyrannosaurustól – a szemüveg oldalt csíkot húzott –. . nem képes kinyitni a kocsit. – Timmy! Visszaugrott. Nem maradt más hátra: Timnek ki kellett szállnia a hátsó ajtón. Azt hiszem. – Nem esik bajotok. olyan magasan tornyosult a kocsi teteje fölé. – Az a lényeg. és futni kezdett. Most a két kocsi között állt. Grant bácsi. amint a tyrannosaurus gigászi hátsó lábának egyetlen csapásával leszakítja a drótkerítést. – Hé! – kiáltott fel Lex. nincs áram a kerítésben! – Lex! – ismételte Tim –. s egy pillanatra a fehéren világító mennyboltra rajzolódott a hatalmas alak árnyképe. Tim fölnézett. Az eső patakokban folyt lefelé a csupa izom hátsó láb kavicsmintázatú bőrén. Tim már nem látta Grant doktorék kocsiját.. Tim? – szólalt meg Grant doktor hangja a rádióban. mint az előbb. de a hátsó ülésről nem érte el a kilincset. Tim ebben a pillanatban fogta csak fel. és esetlen mozgással egy lépést tett előre. – Itt hagyott minket! – Mi történt.. – Zárd be az ajtókat! Húzódj a kocsi közepére! És fogd be a szád! Odakünn a tyrannosaurus a fejét forgatta. – Maradjatok a kocsiban! Húzzátok össze magatokat! Ne mozduljatok. majd eltűnt az erdőben. Ed bácsi?! Ed Regis egyszerűen sarkon fordult. Állkapcsáról csöpögött az esővíz. Végre Lex is meglátta az állatot. – Oké. Újabb villám hasított keresztül az égen. és ne üssetek semmi zajt! – Jó. – Itt hagyott! Itt hagyott! Tim hunyorgott. hogy az állat a kerítésbe kapaszkodik! Nincs áram a kerítésben! – Lex. de a kislány sikoltozni kezdett: – Itt hagyott! Itt hagyott! – Elment! – nyöszörögte Lex. – Itt vagyok! – Lexhez fordult. Le sem vette a tekintetét a dinoszauruszról.

. Tim nehézkesen felkapaszkodott. és kezdett előrekúszni. bőr fedte húst. A tyrannosaurus kinn állt az esőben az első lökhárítónál. a pofája nyitva. Tim a lökéstől elterült az ülésen. idegtépő fémcsikorgás hallatszott. Ekkor olyan ütés érte a Land Cruisert. Ott megállt. iszonyú zaj töltötte be a kocsi belsejét.. Csörgött a vér a pofájáról. Ekkor az óriás fej ismét lezuhant. Gyorsan újra felült. sikálták a fémet. félrebiccentve hatalmas fejét. A tyrannosaurus megint a kocsi orrához verte a fejét. gondolta. Tim szédült. és megint eltűnt a szem elől. mellső lábai a semmit karmolászták. dörgő morgást hallatott. ahogy a levegőt szedte. ő maga pedig pontosan mellé esett. a kocsi mögött az állat felhorkant. és mögöttük ott a dinoszaurusz óriás feje. Volt még annyi hely. Felnézett. – Semmi bajunk – mondta. amint a fej rohanvást közeledett hozzá. és a fémtető benyomódott. Úgy tűnt. és az ablak mellett megállt. Igyekezett kikerülni a tető hajlását. amint gödrében forog. – suttogta Lex. Fogak csikorogtak. Tim kinyúlt. kapkodva szedte a levegőt rémületében. A fej végül felemelkedett. Nedvesen csapkodott körben a kocsiban – Tim érezte a dinoszaurusznyál forró habját –. ahogy a kocsi az oldalára zuhant. Jobboldalt nem látott mást az ablakon át. A fej hirtelen elhúzódott. és döbbenten látta. Újabb csapás rázta meg a kocsit. Tim az ülést markolta. Hunyorgott a sötétben. hogy látott minket. Benézett a kocsiba! Húga szaggatottan. A kislány valahol az első ülés alatt feküdt a padlón. amely minden lélegzetvételére előre-hátra himbálózott. A tyrannosaurus a kocsinak támaszkodott. egyenesen a sebességváltó dombjára. A tyrannosaurus a Land Cruiser elejénél állt. csak repedezett. Lenéz. felemelt farok teljesen eltakarta az oldalablakokat. és összevegyült az esővízzel. „Nem fér hozzám – gondolta Tim. és megszorította a karját. s látta: az első szélvédő kitörött. Mély. ahogy a Land Cruiser hintázott a kerekén. A rugók hangosan nyikorogtak. Az egész világ félrebillent. Talán az állat nem is látja őket. A tyrannosaurus Timre nézett. A tyrannosaurus még kétszer lecsapott. és bevágta a fejét. remélve. – Nem hiszem. – Semmi baj – súgta vissza Tim. megzavarodott attól.. s a szélvédőn repedés pókhálója futott szét. hogy fél szemmel meredjen rá. hogy csendben marad. Pontosan odament. Vér csöpögött a Land Cruiser benyomott tetejére. Az állat ide-oda rázta. Üvegcserepek záporoztak Tim körül mindenfelé. – Tim! – szólt Grant doktor. amint a karmok a kocsi tetejét szántották. Lex mellett találta magát. A hatalmas. Eltűnt. és teljesen eltakarta az összevissza repedt szélvédőt. Az ablakok a sárba mélyedtek. A hatalmas fej lassan ismét felemelkedett a kocsi oldala mentén. Az éjszakai nézőszemüveg lecsúszott a homlokáról. Feszült arckifejezéssel meredtek előre az ablakon át. majd hatalmas. Tim hátrafordult. Az óriás fej lebukott a sáros talaj felé. megvagytok? Tim megragadta a rádiót. ami vele történt. Tim érezte az állat forró.. ahol az előbb Tim kiszállt a kocsiból. Hátul. hogy az egyik hátsó láb felemelkedik. Látta őket. amely egybeolvadt a mennydörgéssel. – Túl nagy!” Aztán a fej a magasba lendült. Fogait a Land Cruiser hátuljára erősített pótkerékbe mélyesztette. A kocsi hátsó része egy pillanatra a magasba emelkedett. kifejezéstelen hüllőszemet. Ahol Ed Regis is kiszállt. Lex ismét felnyögött. A fém begörbült. és egyetlen fejmozdulattal leszakította azt a kocsiról. és Grant és Malcolm kocsijára nézett. – Tim. Tim látta. A fej közeledett a kocsihoz. és a padlóra gurult. és az egész Land Cruiser a levegőbe emelkedett. amint Lex tehetetlenül az oldalablakra zuhan. A tyrannosaurus feje a motorházfedőnek csapódott. . és Tim a villám fényénél látta. vastag nyelv siklott a kocsiba a nyitott szélvédőn át. az állkapcsok tárva. mintázott. Tim a villámfénynél látta a dülledt. – Lex! – suttogta Tim. bűzös leheletét. hogy a kislány fejének egyik oldalát teljesen elborítja a vér. Éles. Most oldalról ismét megkerülte a kocsit. A tyrannosaurus állkapcsai ekkor rácsapódtak az ablakkeretre. Tim heves fájdalmat érzett a fején. az első ülésre. a mellkasa süllyedt és emelkedett.. és bepislantott. aztán sarat fröcskölve visszahuppant.. majd a tyrannosaurus felüvöltött. Aztán nyöszörgést hallott. hogy felüljön az első utasülésen. A tyrannosaurus bömbölt. Visszanézett Grant doktorék felé. hogy az egész kocsi meglódult. oldalt fordult. őrá! Tim torkát jeges rémület szorította el.A tyrannosaurus most körüljárta az ő kocsijukat. s a vér melegét érezte a szájában. – Lex? Sehol sem látta a húgát. – Timmy. Tim letette a rádiót. Eszméletlennek látszott. Csak csipkés üvegszilánkok maradtak a keretben. Tim szíve vadul kalapált.

De nem. a villogó szemet. – A kislány volt az? – szólalt meg végre Malcolm.. – Úgy hangzott. óriás farka himbálózott a levegőben.. A másik kocsi nem volt ott! Grant nem hitt a szemének. és megint bolondul elfordult a világ. De alighogy elindult. Hatalmas zuhanás következett és Timnek egy pillanatra még felfordult a gyomra. a pálmafák tetejét.. . Röpködött a sár a lába nyomán.. hogy a fák közé rohanjon. Grant távolról. – Timmy! – ordított Lex. tompán a kislány sikítását hallotta az eső zaján át. hogy szűnjön a remegés. a tyrannosaurus túl közel van.. – Úgy hangzott. Aztán a kocsi egyetlen éles. És nem tett semmit. Grant számára nem volt teljesen tiszta. olyan közelről. kirúgta az ajtót. szembe fordult vele. – Atyaúristen! Mi lett a kocsival?! Grant hunyorgott.. A tyrannosaurus dühödten üvöltött.. Malcolm erre elfordította a kilincset. hogy valami lassan kúszó kimerültség lesz rajta úrrá. ha a kihalt állatok kihaltak maradnának. Nem sokat – felelte Grant. – Látsz valamit? – kérdezte Malcolm a szemét meregetve. Mellette vágtatott a tyrannosaurus. megpróbált látni valamit az eső csíkozta szélvédőn át. hogy késő. mert a következő pillanatban vadul megfordult körülötte minden – látta. Tim pedig látta. Újabb villám. A tyrannosaurus hátat fordított. Újabb villám csapott le. hogy reszket a hidegtől és a félelemtől. és szaglászik a földön. – Mi történt? – kérdezte Malcolm. lassú léptekkel egyenesen feléjük jött. a karmok fémes csikorgással siklottak le róla.. hogy fájt.. és bömbölt egyet. Mi történik itt? A hatalmas állkapcsok nyíltak és csukódtak. hogy tudják: most éppen lehajol. Arcát és testét csak úgy hasogatta a jéghideg eső. de Tim nem tudott válaszolni. Ilyen közelről rémisztően hangos volt az üvöltése. amikor a tyrannosaurus egyszerre csak megpördült. de nem támadott. mint valami rongybaba. A dinoszaurusz sötétben állt előttük az úton. talán csak eltakarja. Vagy eszik valamit ott. aki még mindig mozdulatlanul állt. Érezte. A kocsi tetején dörömbölt az eső. hogy talán jobb volna. Megszólalt Malcolm: – Tudod. és Malcolm teste úgy repült a levegőben. Olyan hatalmas a dinoszaurusz teste. s a tyrannosaurus legfeljebb három méterre volt tőle. vakító fény pillanatában elborzadva látta. ahogy elhalványult a villám fénye. és füleltek mindketten. – Nem.. hallotta. de már nem hallotta. vannak pillanatok. nem takarta semmi. Aztán a kocsi megint a magasba emelkedett. nem hallja-e a kislányt. Baljós. mi történt ezután. és lecsapott a kocsi tetejére. és Grant a hirtelen felvillanó. hogy a tyrannosaurus ordítva előreveti magát. és előbb az egyik. igen. fémes csikordulással kiesett a tyrannosaurus fogai közül. – De tényleg ő volt? – Nem tudom – válaszolta Grant. de ahhoz elég jól látták. Állt a Land Cruiser mellett. Grant megfeszítette izmait.– Timmy! – sikított Lex bele a fülébe. amint a tyrannosaurus újból lecsapta a kocsit. A másik kocsiban Malcolm rémülten kapott levegő után. Érezte. Hirtelen magához tért. Grant már látta. és tisztán látta: a kocsi eltűnt. mintha ő lett volna. Meredt tekintettel bámult előre. Fülelt. majd hatalmas feje lebillent. Grant érezte. Grant megmeredt. hogy dörömböl a szíve. – Nem tudom. Indult volna. amint a pálmafák törzse lefelé elsiklik mellette –. a földet is megpillantotta valahol mélyen maga alatt. mielőtt végleg elsötétedett. majd az óriás hátsó láb felemelkedett. és a kislány kizuhan a kocsiból a sárba. Addigra már Grant is kint volt a kocsiból. aztán a másik szemével a Land Cruisert nézte. Malcolm futott. – Hm! Van valami javaslatod arra nézve. hogy enged alatta az ajtó. A dinoszaurusz – az alakja elmosódott az eső áztatta szélvédő üvegén – most az ő kocsijuk felé tartott. A tyrannosaurus ismét elbődült. Kezét az ajtóborítás féméhez szorította. a húga meg ráesett. bőrig áztatta az eső. alig néhány centiméterre Granttól. és belekapaszkodott a bátyjába. és futásnak eredt. elnémult a világ. Tim hasító fájdalmat érzett az oldalában. Nem védte. Ültek a kocsiban. Neked nincs ilyen érzésed most? – Dehogy nincs – mondta Grant. Félrebillentette a fejét. amikor az embernek határozottan az az érzése támad. érezte a tyrannosaurus forró bömbölését. hogy most mit tegyünk? – Halvány fogalmam sincs – felelte Grant. Csak állt.

aki mozdulatlanul állt. hogy az állat a kocsi hátuljára erősített gumit szagolgatja. Az az arcán érezte az állat meglepően forró leheletét.. Láthatatlan. Fekete. hogy érezze. az óriás fej emelkedett. hogy amíg nem mozdul. azután a fej visszalendült. és hogy lássa: csak úgy rohan felé a föld. Grant körmét a tenyerébe vájta. miként válik hidegebbé a világ. Mi történt? Lehetséges volna. hogy a tyrannosaurus nem látta őt? Pedig úgy tűnt. A száj kinyílt előtte. Grant azonban most már kezdte érteni. nem. Agyának egy távoli. A fej lassú ívben lebillent. a szíve dörömbölt a mellkasában. bizonyára nem. mintegy a tehetetlen düh mozdulataként. a húsevő undorító bűzét. és egyetlen mozdulattal felrúgta a kocsit. hogy arcul vágja. Bömbölésével próbál ráijeszteni. és látta. A tyrannosaurus belebőgött az éjszakába.. Végül. bőven volt rá ideje. hát inkább zavarodottnak látszott. addig biztonságban van. De hogyan lehet az? Grant hátralesett. az okot. hogy a saját teste repül a levegőben. Újra Grant felé közeledett. hátha ijedtében megmozdul. amiért. az édeskés vérszagot. Aztán a kocsi hátulja felé haladtában belökte az ajtót. hogy érezte a szájában rohadó hús szagát. Ha valaminek. hogy ne üssön semmiféle zajt. Orrával megpiszkálta a kereket. Szédelgett a félelemtől. De a tyrannosaurus nem szimatolt kutya módjára. várta az elkerülhetetlent. és egyenesen Grant felé tartott.. a kocsi vége felé. hogy ott van valahol. Ám a nagy fej elsiklott mellette. Az állat nem látja őt. de sejti. kitágult orrlikainak ürege csak centiméterekre volt Granttól. . a tyrannosaurus nem látja őt! Ha mozdulatlanul áll. s ezzel egy időben meglepő élményben volt része: átélte. Olyan közel volt az állat. Kétségbeesetten igyekezett megőrizni mozdulatlanságát. amíg kibírja. Grant pislantott egyet. és elárulja magát. Mintha valahogy lassan történt volna az egész. Grant égő fájdalmat érzett. felemelkedett a hatalmas hátsó láb.A láb a sárba vágódott. Ezúttal az állat megállt félúton. Teste megfeszült.. Nem. kívülről figyelő zugában meg is találta erre a választ. Bekukucskált az elülső szélvédőn. és az ajkába harapott. s az állat horkantva megvizsgálta a kocsit. Grant számára azonban már világos volt.

és képregényt olvas. – Hello. Harminc-negyven perc alatt így is vissza kell érnünk – tette hozzá Harding –. Az egy kicsit hosszabb. – Én vinném – mondta Muldoon –. meg egy másik az állatápolóknak. – Ezt nem értem – mondta. – Tudtál már beszélni a Land Cruiserekkel? – Nem jönnek be a rádión – felelte Arnold. Megfordult a dzsippel. de működnie kellene. Megint azon törte a fejét. Ez gyenge. de onnan sem kapott választ. – Felvette a rádiót. ha beszólok Arnoldnak a vezérlőbe. azt azonban Arnold nem tudhatta. míg a karbantartók csapata ide ér. csakhogy azok a keleti garázsban vannak. – Megszakadt minden rádió-összeköttetés. Vagy ameddig megtaláljuk Nedryt. és nem is jelentkeztek be. – Mekkora fa! – Ki tudjuk kerülni – mondta Harding. Letette a készüléket. Aztán egyenként újra életre keltek. – De jó lesz.VISSZAÚTON – Az ördögbe is! – szólt Harding. és a vezérlőben egyszerre elsötétedett minden monitor. de egyik sem felel. – Biztos a villám – mondta Gennaro. – Szólt már valaki Hammondnak. dehogy! – mondta haragosan Arnold. hogy egy modemen át egy egész rendszer működésképtelenné válhat. és bumm! Leáll az egész. De lehet. – Visszamegyek a fordulóig. vidd valamelyik kiszolgáló járművet. A Land Cruiserek csupán elakadtak az esőben. hogy a gyerekek még nem jöttek vissza? – Az ördögbe is. az egész teste megfeszült. aki visszaért a helyiségbe. Várhatnak egy kicsit. A villám impulzusa a telefonvonalon át visszamászik a számítógépbe. az élelmet szállító teherautóknak meg a többinek. Mind a hat csatornát megpróbáltam. Kevesen tudják. – Semmi – mondta. és ordibáljon nekem! Pillanatnyilag minden rendben. hogy kapunk némi bepillantást abba. majd két kilométerre innen. míg Harding behozza őket. – Próbálja meg a Land Cruisereket hívni – szólt közbe Ellie. hogy vannak rádiók a kocsikban. hogy kutassák át utána az épületet. Már öt perce elküldte az őröket. Nincs többé előhívható állomány. aztán rátérünk a szervizútra. Villám sújtott le. – Van egy utunk a látogatók számára. – Ha ki akarsz menni és megnézni. Órákig is eltarthat. – Biztos – felelte Harding. mert a fő kommunikációs rendszer kiment. Aztán hátradőlt. nem kellene itt maradnunk. – Ők meg nyilván visszaértek a táborba. Szerencsénkre van még egy úthálózat – mondta magyarázólag Harding. és már kívül esnek ennek a kis készüléknek a hatósugarán. Arnold megkönnyebbülten sóhajtott. . A képernyők felvillantak. – Valaki még azt az istenverte dzsipet is elvitte! – mondta dühösen Muldoon. John? A készülék csak sistergett. Akárhogy is. és hátramenetbe kapcsolt. és eltávolítja azt a fát. hol lehet Nedry. Nincs számítógép. Tudom. Öt perce! Ha Nedry az épületben van. – Azt kell használnom. lehet. – Nyilván a vihar az oka – mondta Gennaro. Nincs file. és forgatni kezdte a csatornakereső tárcsát. és újra délnek indult az éjszakában. azt hiszem. és nem olyan látványos. És Harding hol van? – Gondolom. visszafelé tart. milyen modemeket használ Nedry az adatátvitelhez. hacsak nem tévedünk el. hogy a kis csirkefogó újra bekapcsolja a rendszereket. Visszamegyünk erre a szervizútra. Ha szűnik valamit az eső. hogy érdekesnek fogja találni. – Na tessék! Harding benzinmotoros dzsipjében ültek. Nincs többé RAM. Úristen! Csak ne most! Ne most! Még ez hiányzott! Hogy a viharban mindenhol kimenjen az áram! A hálózati áramkörök persze mind impulzus védettek voltak. már meg kellett volna találniuk. A kövér disznó biztosan valahol a vécén ül. – Az nem jó jel – mondta Muldoon. De az őrök nem tértek vissza. válasz nem érkezett. Harding újabb csatornákkal próbálkozott. minthogy a vén szaros itt ugráljon. s szemüket meresztve igyekeztek a suhogó ablaktörlőn túli világot pontosabban kivenni a szélvédőn át. John! Hallasz. Arnold mereven előrehajolt. hogyan viselkednek az állatok éjszaka. és összecsuklott a székben. – Más sem kell.

– Miért. – Megpróbáltam. te nem tudod? Arnold megrázta a fejét. mit. de ha be kell jutnom magába a kódba. Nem tudok rájönni. az órákig is eltarthat. Szükségünk van Nedryre! Azonnal meg kell találnunk azt a marhát! . De Nedry csinált velük valamit.

hogy kigyulladjon a digitális kijelző. hogy neki fog rohanni –. egyre beljebb vonzotta. FESZÜLTSÉG 10. Nem is emlékezett semmiféle útelágazásra. bagoly huhogott halkan az erdőben. és megpördült a tengelye körül. és megpillantotta a folyó sötétlő áramát. míg a dzsip végül csúszva megállt. De akkor hol a dokk? Kis híján sokkot kapott. tudta. Rátaposott a gázra. Kivéve ezt az átkozott vihart. az orra alig fél méternyire a faltól. újra be kell hatolnia a komputerbe. Az egész elképzelés lényege – a terv ezen alapult – az volt. Hat perc múlt el. és megnyomta a gombot. de Nedry úgy érezte. Dennis! – jegyezte meg magának hangosan. hogy szinte fájt a verése. még mielőtt bárki is észrevehetne akármit. És ezzel már benn is volt magában a parkban. aztán kétségbeesetten forgatta a kormányt ide-oda. Fel kell adnia az eredeti tervet. Rossz irányba fordult volna az útkereszteződésnél? Aligha. hol a fenében van. hogy meg is valósítsa mindezt. az eső hangjával együtt. hogy jobban lásson az esőmosta szélvédőn át. hogy látni akarja a pénzt. mire a dzsip megcsúszott. hogy a lába puha talajba süpped. Inkább rá kellene jönnie. Egy darabig nem mozdult. de tartania kellett a menetrendet. A dolog lényege. Órájára pillantott. Egyszóval mindenre gondolt. A fékre taposott. Már el kellett volna érnie a keleti dokkot. úgy. Valami átfutott előtte az úton. Arra az esetre. de hol?!” A folyó több kilométeren át húzódik a dzsungelen keresztül. de az túl soká tartana. leadja az embriókat. A folyó! Az őserdei folyónál van! „Az istenit! – káromkodott magában. Nincs már választása. és szélesre tárta. Mintha csak válaszolna. Balra lesz! „Ez az istenverte vihar! – gondolta. A számítógép automatikusan megjegyez minden telefonhívást. hogy Nedry a kocsival elmegy a keleti dokkba. Gyorsan hajtott – túlságosan is gyorsan –. Megtehetné. Fehér villanás a fényszórók előtt. mert hamarosan hiányolni fogják a vezérlőteremben. Nedry a szalagról készült másolatot is mellékelte az embriókhoz. Miután Nedry felveszi a kapcsolatot Dodgsonnal. bugyborékoló hang erősödött. és becsukta a kaput maga után. . míg hirtelen kibukkant a növényzet közül. Keskeny úton vezette a dzsipet. Hol a pokolban van? Megkerülte a beton útakadályt. ÉRINTÉSE ÉLETVESZÉLYES!” Nedry azonban puszta kézzel nyúlt hozzá. mert feltűnik a távolléte.000 VOLT. Újra az órájára nézett. amelyet esővíz csíkoz. Leveleken csattanó esőcseppek. és megpróbálja valahogy értesíteni Dodgsont. amikor Nedry odaér. hogy az út két méter magas szürke betonakadályokban végződik. Mély lélegzetet vett. hogy a dinoszauruszok kipusztították már az efféle állatokat. Hol van már az az átkozott dokk? Gyorsan hajtott. egyre idegesebb lett a terve miatt. fuccs az egész tervnek! Nedry pedig nem várhat soká. Nedry mindent a legaprólékosabban kidolgozott. van rá esélye. s a túloldalon. Nedry egy szörnyű pillanatig azt hitte. Nedry szinte észre sem vette. ha netán Dodgson megfeledkezne a pénz hátralévő részéről. talán másfél kilométernyire a keleti dokktól. Igyekeznie kell. holnap estére. behajtott. Az igazi indok persze egészen más volt: Nedry titokban magnóra akarta venni a beszélgetésüket. Csak nem az óceán? Nedry sietősre fogta lépteit. Nagy patkánynak látszott. minthogy visszamegy a vezérlőbe. Már a hetedik perc is elmúlt. mormoló víz zaját hallotta. – Bajban vagy. Azt hinné az ember. hogy szervezzen meg egy újabb találkozót a számára a keleti dokknál. hogy egy oposszum megélhet itt. és előrehajolt a kormány fölött. helyreállítja a számítógépet. és meglátta.NEDRY A táblán ez állt: „ELEKTROMOS KERÍTÉS. és lassan kiengedte a levegőt. és törölnie a hívásra vonatkozó feljegyzést. hogy kifutott az időből. hogy szétfröcskölnek a fején a súlyos esőcseppek. de nemsokára meg kell pillantania a partot és az óceánt. végig az úton. egészen odáig ment. A mormoló. Fura. olyan kemény esővel. amikor befordult a sarkon. – A folyónál. – A végén még mindent elront!” – Mert ha Dodgson hajója nincs a keleti dokkban. majd kiszállt. Visszament a dzsiphez. hogy közben néven is nevezi Dodgsont. Kinyitotta a kaput. Egy azonban biztos: nem maradhat tovább idekinn a parkban. Kiszállt a dzsipből. belerohan a falba – sőt. Visszanézett. és már legalább öt perce volt úton. hogy valahol rossz felé fordult. Csak az ablaktörlők ütemes surrogását hallotta. Biztos. hogy Dodgsont is rávette arra az indulás előtti utolsó találkozóra a San Francisco-i reptéren azzal az ürüggyel. Fekete őserdő szegélyezte az utat mindkétfelől. és néhány másodpercen belül vissza is ér. hogy visszamegy odáig. érezte. Sűrű dzsungel mind a két oldalon. Nem tehet mást. Az állat vastag farkát maga után húzva gyorsan befúrta magát a bozótba. Vagy oposszumnak. ahogy menet közben a szeme egyre inkább hozzászokott a sötétséghez. Igazi trópusi vihar volt. Érezte.

és hortyogó lélegzetvételének hangját is halványan felfogta. A dinoszaurusz nem mozdult. És huhog. Egy pillanat múlva a kocsiban lesz. kínzó fájdalmat érzett a szemében. Jókora zajt csapott futás közben. mint a bagoly hangja. hogy a feje ismét felcsapódik. de még így is hallotta. Még közelebb van! A sötétben belebotlott a gyökerekbe. hogy lábára állítják. És a keze is viszketett. szinte üvöltő fájdalmon át. aztán egy hirtelen mozdulattal felkapta a fejét. és újra hallotta. Visszapillantott a dinoszauruszra. védekezésül a támadás ellen. Valahogy nem egészen olyan volt. irányt vesztetten.. Kifejezetten úgy hangzott. és vadul csapkodott a levegőben. s a lélegzete csak távoli sípszóként szólt azon az állandó. mintha sav ért volna hozzá. hogy az nem más. amitől villogó fényfoltok tűntek fel szorosan összepréselt szemhéjai mögött. A saját beleit tartja a kezében! A dinoszaurusz felszakította a hasát! Kidőltek a belei! Nedry összeesett. támad-e az állat. . hogy az állat előtör a növények közül. s amint érezte. már tudta. értetlenül odanyúlt. A dinoszaurusz immár közel volt. az. vakon az inge feltépett széleit tapogatta. Amint hallgatózott. hogy közeledik. mégsem látott semmit. végső kívánsága maradt. de gusztustalan! Csakhogy a nyakán a bőr már kezdett viszketni és égni. mint a tűz. Úristen. Nyál! A dinoszaurusz leköpte! „Undorító!” – gondolta. s a rettegése leírhatatlan volt. csak villogó fényfoltokat a fekete háttér előtt. Valami nagy. s még a lélegzete is elakadt a fájdalomtól. érezte. hogy meggyőződjön. s amikor ezt felfogta. Kíváncsian. Odakapott a kezével. A kín fokozódott. De nem közel. Semmit sem látott. És úgy tűnt. hogy eltakarja. Nedry kinyitotta a kocsiajtót. s a fején két vörös. Várt. Nedry érezte. Hallotta lágy. és aztán tűnés innen a pokolba! Félig futva. hogy minél hamarább véget érjen minden. V-alakú taréj futott végig. mintha a tarkójáig érő tüskéket döftek volna mindkettőbe. zörgő hangot hallott az aljnövényzetben. És közel. aztán valami furcsa. Lenézett. mint a saját bele. habos csomót pillantott meg átázott ingén. Nedry rogyadozott. zihálva. és szinte azonnal újabb nedves ütést érzett. ezúttal a nyakán. A dinoszaurusz szembeköpte! De mire felfogta ezt. amelyről tudta: azonnal bekövetkezik. Megint hallotta a halk bagolyhuhogást. arca a nedves földbe nyomódott. közben visszapillantott a dinoszauruszra. már csak egyetlen. Köpés.. a dzsungelből. és ekkor megdermedt. hogy valami nedvesen a mellének csapódik. A dinoszaurusz meredten nézte őt. Térdre esett. a fény alkotta tisztás peremén. és távol tartotta. De látni nem látta. mintha valami nagy dolog közeledne felé lassan az őserdőn át. közelről jön.Nedry visszaindult. pocsékul érezte magát. éppen az inggallérja felett. A háromméteres test sárga volt. Megreszketett alatta a föld. s érezte. Összeszorította a szemét. látta. mintha tüzes kést döftek volna a hasába. hogy síkos hab csurog lefelé az orra két oldalán. és egy nagy. Talán megijesztette az autó fényszórója. de ez nagyon furán nézett ki. De nem támadott. valahonnan jobb felől. csapódó. Célba vette a kocsi világító fényszóróját. Nedry nem járta végig az utat a többiekkel. amint Nedry valahogyan lábra állt. Előrenyújtotta kezét. Megvakult! A huhogás erősödött. fekete foltokkal. és iszonyattal fogta fel. meglepően meleg masszát érzett. nem támad-e mégis. hogy a dinoszaurusz foga közt van a feje. huhogó kiáltását. Letörölte a kezével. Négykézláb kúszott tovább a víztől csöpögő bokrok között. huhogó hangját. és nem látta a dinoszauruszok különféle fajtáit. az oldalára dőlt. Összecsuklott. de már látta maga előtt a dzsipet. És akkor újabb. Leste. csöpögő. félig mászva megkerülte az akadályt. A dinoszaurusz tíz-tizenkét méterre állt tőle. s ezúttal megállt. Majdnem olyan érzés volt. hogy kinyissa a szemét. és valami pikkelyesre és hűvösre zuhant. Az útakadály függőleges falát súroló reflektorfénytől kezdte jobban érezni magát. Egy nagy dinoszaurusz! Ki innen! Nedry futásnak eredt. Bőrig ázott. Hányinger és szédülés fogta el. és Nedry érezte: a dinoszaurusz közeledik. Az állat már ott volt. és noha a fájdalom ellenére rákényszerítette magát. Nedry várt. amikor hirtelen szörnyű. a fájdalom már teljesen úrrá lett rajta. Az állat lába volt az. égő fájdalom hasított belé. aztán megint újabb fájdalom hasított a fejébe mindkét oldalon. csak ismét hallatta halk. és imbolyogva a kocsi oldalának dőlt.

nem messze a laboratóriumoktól. amelyet Hammond önmagának építtetett. Ha valami probléma volna. Csak attól félek. Ha pedig ezek az állatok valóban szaporodnak. és vadon is megélnek. hogy a korral jár. hogy folytonosan el-elkalandozik. Az épület a park egy félreeső zugában bújt meg. – Nem működik a monitora – mondta Hammondnak.. hogy minden úgy legyen.. Követte a tekintetével. És mindennek eredményeképpen még csak foglalkozni sem hajlandó azzal a valósággal. nem kérek – felelte Henry Wu. Henry. Nem keveset kell rendbehoznia ezen a hétvégén. – Vagy tán Nedry még mindig nem végzett az adatátvitellel. de folyton hajtani kell. régi történeteit meséli újra meg újra. Az öreg valahogyan más volt. amit a sziget keleti részén szedtek. – De engem egyik sem nyomaszt annyira – mondta Hammond –. minden! Még a lizin-függőség is gyanúba kerül. Wunak el kellett ismernie. hogy én ezt már nem érem meg. és utánanéz a különböző DNS-együttesekről készült számítógépes kimutatásoknak. – Semmi nem megy már le a torkomon. s szinte azonnal követte a mennydörgés csattanása.. a gyerekek nem ijednek meg egy kis vihartól. Mert ha a dinoszauruszok tényleg szaporodnak. – Talán át kellene mennem a vezérlőbe.. Wu engedelmesen megmártotta kanalát a fagylaltban.. – Köszönöm. és megnézni. falra erősített videomonitorára. nekem vannak bizonyos félelmeim ezzel a parkkal kapcsolatban. A képernyő sötét volt. Wu hallotta. aztán felpillantott a helyiség egyetlen. – Csak egy kicsit kóstoljon meg belőle. Hammond vállat vont. hogy azonnal a laboratóriumba megy. Belekósolt a fagylaltba. hallgatag szolgálólányt. Wu azt tervezte. igazán elegáns. Tipikus aggastyánszenvedély: fagylalt! De azért.. Wu egész vacsora alatt azon tűnődött. A világon minden gyerek imádja a dinoszauruszokat. pillanatnyilag más problémáink is vannak – komorodott el Wu. amelyek arra utalnak. És a vacsora is kitűnő volt. de más. – Ó. hogy a bungaló. dehogy – mondta Hammond. hogy ne kelljen szembenéznie a tényekkel. – Én azt hiszem. – Mindjárt beszólok Johnnak a vezérlőbe. a vonalak egyszerűsége. Hammond azonban makacsul ragaszkodott hozzá. ismétli önmagát. hogy a személyzet még nem is volt teljes. akkor az egész Jurapark kétségessé válik: a genetikai fejlesztési eljárásaik. és letette a kagylót. hogy bizonyítékként fogadja el őket). hogy nem láthatom azokat a ragyogó. ha csak egy árnyalatnyit is.. Mégis volt Hammond viselkedésében valami. dísztelensége már-már japános tisztaságot sugároz. ami nyugtalanította Wut. mi a helyzet – mondta Wu. – A telefonkagylóért nyúlt. azt nem hinném – felelte Hammond. Talán az öreg végül mégiscsak szembenéz a tényekkel! – Miféle félelmei? – Hát tudja.. Ezt azonban még mind úgy is fel lehetett fogni. – María gyömbérfagylaltja egyenesen mennyei! – No. – Nincs arra semmi ok. Miután Grant kétéltű-DNS felől kérdezősködött. Henry! – szólt Hammond. Részben pedig egyfajta érzelmi kiegyensúlyozatlanságban: hol hirtelen felfortyan. Eltántoríthatatlan akarat. önfeledten boldog gyerekarcokat. arról már tudnánk. Henry! Henry Wu lelke hirtelen megkönnyebbült. jó. Egyfajta ellenállás. hogy vacsorázzon vele. S ha még . – Tényleg? – pillantott oda az. – Wu elnézte a szép. eltolva székét az asztaltól. Henry – mondta Hammond. és az utolsó pillanatig keményen kézben kell tartani. Wut szinte sokkolták azok a jelek (még ő sem tudta rávenni magát. a Jurapark igazából gyerekek számára készült. amibe belefogtunk. Csakhogy volt még valami ezen túl is. ha azt akarjuk. Tudja. – Hammond bungalójának ebédlőjében ültek. különösen ha figyelembe vesszük. A mi diadalunk ez a park! Megvalósítottuk. – De azért a fagylaltnak hagyjon egy kis helyet. hogy végre a saját szemükkel láthatják a csodás állatokat. Henry Wu halogatás nélkül utána akart nézni az adatoknak. hogy a telefonból csak zörej szól. – Friss gyömbérből készült. és boldogok – igazán boldogok – lesznek itt! Ragyogni fog az arcocskájuk az örömtől. Nedry zseni a maga műfajában.A BUNGALÓ – Még egy kis kávét? – kérdezte udvariasan Hammond. ahogy neki tetszik. – Remélem. hogy a dinoszauruszok szaporodnak. – De nem tehetek róla. John Hammond végül is már majdnem hetvenhét éves. miben is áll ez a másság. – Nyilván bedöglöttek a telefonvonalak is – mondta. hol meg könnyes érzelmesség lesz rajta úrrá. – Ez közel volt – jegyezte meg Wu. minden rendben legyen. amely most a szigetét fenyegeti. Ó! María tért vissza a szobába két tányér fagylalttal. Részben talán abban. mint az. Hogy én már sosem fogom látni azokat a ragyogó arcocskákat. Odakünn felragyogott a villámfény. – Ugyan. a kontrolmódszer. – Biztos a vihar az oka.. ahogy kimegy a szobából. és hátradőlt.

ne legyünk kitéve a kormány beavatkozásának. A fejét csóválta.. Semmi okot sem látok arra. hogy bárhol is vagyunk a világon. Az anyja francia. hogy idejöjjön. Ronda kövér alak. és persze nekik a pénzük is sokkal több. sikerül valami csodaszert készítenie a rák vagy a szívbaj ellen – mint a Genentechnek. Felemelte a kezét. Én személy szerint sosem segíteném az emberiséget semmiben! Wu nem először hallotta már ezeket az érveket. és María némán kivitte az edényt. amely arra késztetett bennünket. – Akkor keressék a kastélyban! – mondta Arnold.és más mellékes bevételek pedig megduplázzák ezt az összeget. Henry. mint a Genentech és a Cetus. akkor az az ő előjoga. Státusszimbólum lesz belőle. – Ha már a világ többi részéről van szó. maga mit csinálna? Olyan termékeket. Tegyük fel. – Én jól ismerem mindezt. A szórakozás senkinek sem létszükséglet. televíziós-. De ami még nagyobb baj: külső erők is beleszólnak a piaci viszonyokba. Addigra a közvetlen bevételek meghaladják majd a tízmillió dollárt. reklám. Akkor aztán valami közbejön. Ismét mosolygott. nem engedi! A betegek nem fognak ezer dollárt fizetni egy adag életfontosságú gyógyszerért. Ott lesz a „Jurapark Japán”. ugye? – Úgy van – felelte Arnold. – Ha maga biotechnológiai céget akarna alapítani. És ha napi ötezer dollárt kérnék a parkomért? Ki szólna bele? Ki akadályozná meg? Végül is senkinek sem kényszer. Nem adják ki az engedélyeit. ő fizette a fejlesztést és a vizsgálatokat. ha ő találta fel a gyógyszert. igaz? Parancsol még egy kis fagylaltot. Elutasítják a szabadalmi kérelmét. . és érthetetlen problémákba ütköztek. – Évi húszmilliárd dollár! – mondta halkan Wu. De azt hiszi. – A jó édesanyját! – kiáltott fel Muldoon. hogy a gyógyszerek útjában rengeteg az akadály. John.. – Igen. és ez nagyon óvatos becslés – mondta Hammond. fel lesznek háborodva. Üzleti szempontból tehát az emberiség igen rossz befektetés. hogy mennyit kér érte: amennyit akar. Azt pedig minden amerikai imádja. mi volt az az eredeti cél. de találják meg nekem! – Az a helyzet. amelyek célja. Hammond végzett a fagylalttal. mennyire más minden. Szóval bizonyára emlékszik. Lewis Dodgson azt hiszi. Arnold.emlékszik. hogy Hammond megint valamelyik régi beszédének előadására készül. A magas árat pedig. Mr. Négy éven belül nyitni fognak. Csak a Szövetségi Gyógyszerészeti Hivatal engedélyezési eljárása öttől nyolc évet vesz igénybe. És azt is tudta. hogy Hammondnak igaza van: egyes génsebészeti úton előállított gyógyszerek valóban indokolatlan késéseket szenvedtek. Henry. Nem avatkozik bele semmiféle kormány. a betegséget? Nagy ég. amitől észretér – és sokkal olcsóbban adja majd a gyógyszerét. – Nos – folytatta Hammond –. Hammond elmosolyodott.. akkor gondoljon bele. Mondjuk. egyenesen növeli a park vonzerejét. talán emlékszik. – Mr. Történik valami. – A garázsba?! Mikor? – Úgy tíz-tizenöt perce. nemhogy rablásnak vennék. Hammond szomorúan ingatta a fejét. hogy a génsebészet újonnan kifejlődött technológiája révén pénzt keressünk.. ha szerencséje van.. – Találják meg! – Azt hiszem. – Már bérbe is vettünk egy jelentős részt az Azori-szigeteken a „Jurapark Európa” számára. Sok-sok pénzt. hogy ebbe az irányba mozduljon a cég: az. nézzenek körül mindenütt. nincs az épületben. ha idelátogat valaki. – Vizsgálják át a karbantartó épületet. Meg a japánok is. – És mégis. – Az őr habozott. „Rablás!” – fogják kiabálni kórusban ők is. hogy kis otthoni állatkákat állítsunk elő gyerekeknek. A két következő park építési munkálatai már a jövő év elején megkezdődnek. Wu már tudta. – Kövér. Muldoon megpördült a sarkán. aki a főhallban van. Pedig hallom.. Az ember azt hihetné. és semmilyen más szervezet sem. a raktárat. ha a tömegszórakoztatással foglalkozik. azt mondja. – Szóval Jimmy. a szándékunk kezdettől fogva az volt. Nem fizet a Vöröskereszt. Henry? – Megtalálták?! – förmedt rá Arnold a vezérlőterembe lépő őrre. hogy az emberiség leküzdje a járványokat. ezt tervezem. adagonként ezer vagy kétezer dollárt lehetne kérni érte. dehogy! Micsoda szörnyű ötlet! Az az új technológia igen alacsony hatékonyságú alkalmazása volna. mind gyógyszergyártással kezdték. látta a kövér embert lemenni a garázsba. Nedry az a kövér ember. Mr. Guam közelében pedig még régebben vásároltunk meg egy szigetet. Henry. Arnold – mondta az. – Nem idevalósi – mondta rápillantva Hammond. – Nem. – Semmi szükség nincs rá. hogy hálásak lennének. – Haitiből jött. Adjunk új gyógyszereket az emberiségnek! Igen-igen nemes cél! Csak az a baj. hogy szélsőséges spekulációkba bonyolódjunk. a kereskedelmi. hogy a kormány ezt meg is fogja engedni magának? Nem. a legelső géntechnológiai cégek. Ahelyett.

– Már közel vagyunk az őserdei folyóhoz – mondta vezetés közben Harding. aztán továbbállt. mint általában a kétéltűeké: a mozgásra van beállítva. hogy a maga parkja éppúgy nyomásnak lesz kitéve. Hirtelen ismét a fékre taposott. Nem vagyunk más. – Magnóról lejátszottam nekik egy tyrannosaurus-üvöltést. imádni fogják! A dzsip hátsó ülésén Ellie Sattler kibámult az ablakon. hogy megnyissam a Juraparkot a világ gyermekeinek örömére.. hogy nem is igazán vannak ragadozó ellenfeleik. És én mondom magának. Szinte sosem jövünk ki kocsival éjszaka. – Valószínűleg akkor sem reagálnának. és amikor visszafelé tartottam. Nem mintha túlságosan izgatnák őket a tyrannosaurusok.. – Nem egészen. – Közben ő és Hammond átköltöztek a nappaliba. – Én nem erre gondoltam – szólt közbe Wu. . aki megakadályozzon benne. A technológia ragyogó. – Ez nem Amerika! Még csak nem is Costa Rica! Ez itt az én szigetem! Én vagyok a tulajdonosa. – Egészen jó előadásban van részünk ma este – mondta. trombitálna. nem – felelte Harding. – Vállat vont. Vagy akár leállíttatni. amit akarnak. – A szó szoros értelmében persze látnak. – Bizonyára érdekes lenne a tudósoknak. Hammond felsóhajtott. A kis zöld procompsognathidák átszaladtak az út túloldalára. kellemetlen szagú tárgy a környezetükben. mint egy teljesen kifejlett ló. Csak kutatni! Nos. – És tudja. tudja? Felmásznak egy fára. A csapat hat állatból állt mindegyikük akkora volt. aztán leültek a hátsó lábukra. Az apatosaurusok sietség nélkül. – Azt hiszem. – De hát mégiscsak látnak! Vagyis ha kiszállnánk a kocsiból. még csak rá sem néztek a dzsipre és a világító fényszórókra. nagy meglepetésben lesz részünk. Harding menetbe kapcsolt. de rémségesen drága. hogy lezárassák. A reflektorok fényében Ellie egy apatosauruscsordát látott átvonulni az úton. egy kicsit bal felé. Meg a tyrannosaurus is tudja. amelyet a faxon láttak. – Csakhogy ezt egyszerűen nem tehetik meg! – mondta Hammond. bőrük csillogott az esőben.. mert kutatni akarnak! Ez minden. hogy miért nem? Hát természetesen azért. ezért nem is érdekes. hogy kutatásra használják őket. Attól rögtön mozgásba indultak. de amióta csak az apatosaurusok átkeltek előttük az úton. ahol a létrehozott állatok egyszerűen túl drágák ahhoz. Ujjával játékosan megfenyegette Wut. – Nekem az az érzésem – mondta Wu –. zöld állatokból álló csorda előtt. És nincs az az isten. zajtalanul mozogtak. Henry. hogy csak szórakoztatóipari tevékenységgel tartható fenn. tapasztalni fogja. – Elnevette magát. – Különös – jegyezte meg Harding. A kocsi csúszva megállt. Ezek az állatok azonban nem mutattak félelmet. Egy hasonló nagyságú elefántcsorda megijedt volna a kocsi érkezésétől. És ezt tudják jól. mint egy ház –. – És akkor mit csinált? Harding szája mosolyra húzódott. éppen csak nem vesznek tudomást rólunk. Amely nem jelent fenyegetést. hogy szemügyre vegyék a kocsit..A dzsip hirtelen. Csakhogy az ember eljut addig a pontig. Nem haladni akarnak. és körülfogná a kocsit. és egy kis vizet nyalt fel egy pocsolyából az út közepén. Az apatosaurusok akkorák. Csicseregtek egy kicsit. mindig is ez volt. hogy kijöttem éjszaka egy-egy beteg állathoz. – Vajon ezek hová mennek? A kompik nem éjjeli állatok. Az állatok továbbhaladtak. de a vizuális rendszerük olyan. Henry! – mondta bosszúsan Hammond. így nincs tapasztalatuk az autóról. még Montanában. éppen egy kis. – Bocsánat! – szólt Harding. Harding megvonta a vállát. amely akkora lehetett. csikorogva fékezett. hogy a tudósok megpróbálják majd korlátok közé szorítani a tevékenységét. csak valami furcsa. és kivárják a reggelt. ezek az apróságok órákig is elzárták az utat. Nem eredményeket akarnak elérni. – Arra van. A dinoszauruszok látási élessége kiváló. Ez volt az az állat. semmit sem láttak. és a nagy ablakon át gyönyörködtek a parkot korbácsoló vihar látványában. és láthatná őket!” – tette hozzá magában. mint a Genentech gyógyszerei. hogy kutassanak. „Procompsognathidák – gondolta Ellie. Egyetlen farokcsapással ki tudnák törni egy tyrannosaurus nyakát. – Bárcsak itt lenne Grant. aztán továbbsiettek az éjszakába. – Nem látnak bennünket? – kérdezte Ellie. Mozdulatlan dolgokat szinte alig látnak. – Nézzen már szembe a tényekkel. hogyan – mondta Hammond. – Vagy legalábbis a gazdag gyerekekére. Előfordult már. folytathatjuk az utat – mondta. meg egy bébiből. Már vagy húsz perce hajtottak az eső áztatta vadonon át. – Ezek kompik. Az a helyzet. – Ilyen az élet! – De ha megpróbálkoznak vele. – Nem tudom elképzelni. A bébi még le is hajolt. – Lehet.

– El nem tudom képzelni. Vonzzák őket a döglődő állatok. ha utánuk mennénk? – kérdezte Ellie. A kompik dögevők. mint a keselyűk. – Ezek szerint haldokló állatokhoz tartanak? – Haldoklóhoz vagy döglötthöz.– Akkor most miért vannak idekinn? – kérdezte Ellie. Több kilométernyi távolságból is megérzik a haldokló állatot. – Hát magam is kíváncsi vagyok – felelte az állatorvos. merre tartanak. a kompikhoz. – Mi lenne. és elindult vissza. – Végül is miért ne? Nézzük meg. Megfordult a kocsival. . és borzasztóan jó a szaglásuk.

majd továbbvonult. émelygő gyomra valóban azt az érzést keltette benne. Ez volt az utolsó. ügyetlenül felkelt. Mozog az egész kocsi! Tim óvatosan. s azokon át látszott a talaj. Nem lesz képes kinyitni az ajtót. de az is beragadt. Csend lett. vigyázva Tim hátranyúlt. de legfőként a feje – rettenetesen. Lassan. hogy közelebbről is megvizsgálja a kilincset. mintegy hét méterrel a föld fölött. Rosszul volt: továbbra is úgy érezte. Négykézlábra kuporodott. látta. Tim egy pillanatra eltűnődött. még az ingét is bemocskolta. mint az előbb. Fejfájása miatt csak lassan. s amely olyan volt. Savanykás epeízt érzett. a számlap is összegörbült. ritmusos.. És legszívesebben álomba menekült volna az elől a roppant fájdalom elől. Támasztékot keresve a kormánykerékbe kapaszkodott. – Hogy jut ki innen? Horkantó hang hallatszott. a gyomra émelygett. s a hátára gurult. De a levelek közt itt-ott rések voltak. Tim nyöszörgött. de annak üvegje betörött. fokozatosan tért vissza az öntudata. Nehézkesen felkönyökölt. Ekkor eszébe jutott a hátsó ajtó. az arca a kocsiajtó kilincséhez nyomódott. amire emlékezni tudott. mert Tim a hátán feküdt. Elfordult a hányáshalomtól. és megforgatta a hátsó ajtó kilincsét. Fájt az egész teste. mindkét karja. – A rohadt életbe! – mondta. Amint megmoccant. fájdalom hasított az arccsontjába. amely vagy hétméternyire alatta volt! Tim értetlenül bámult.. s a Land Cruiser nyikorgása. s a kormányt látta maga fölött. Először csak sűrű levélzetet látott. A talaj. s ide-oda ringott a szélben.TIM Tim Murphy a Land Cruiserben feküdt. Ki kell jutnia innen! . amelyet folyamatosan hallott. Óvatosan. csak arra. A farka ide-oda libegett. csak a szél zaja a levelek közt. Az oldalán fekve ring előre-hátra. mint aki tengeribeteg. De úgy látszott. hogy ez igaz is: a Land Cruiser tényleg mozog. – A rohadt életbe! A rohadt életbe! – ismételgette Tim. amely mozgott a szélben. A stegosaurus hangosan szuszogott. Lecsatolta és félredobta az órát. de annyit meg tudott állapítani. hogy az egész kocsi folyamatosan mozog vele. és behunyta a szemét. s Tim látta. hol lehet. Sattler doktornő és az állatorvos? Utoljára a stegosaurus közelében látta őket. hogy kifelé görbült. méghozzá az utasülés ajtaján. hogy hosszú tüskék vannak rajta. amikor elindult feléjük a tyrannosaurus. de még mindig hullottak rá vízcsöppek a törött első szélvédőn át. Azon túl pedig szélben mozgó faágakat. többé nem hallatszott más. Bent volt a Land Cruiserben. Most jutott el a tudatáig az az állandó. majd a Land Cruiser hangos reccsenéssel helyzetet változtatott. mint egy himbálózó hajó pallóinak nyikorgása. A Land Cruiser egy nagy fa ágai közt hevert az oldalán. Az ajtókilincsen állt. lüktető fájdalommal. Kíváncsian vizsgálgatta az üvegcserepeket. s ezért nem tudja elfordítani. hogy az út közepén parkoltak. Kinyitotta a szemét. úgy bámult kifelé. a lába. és körülnézett. amely szemmel láthatóan meggyógyult. A Land Cruiser azonnal megingott a súlypontváltozástól. mintha valami hajón himbálózna ide-oda. ahol a kilincsnek nyomódott. Valami sötét forma haladt el alatta. A Land Cruiser még egy méterrel lejjebb került. és szimatoló hangokat hallatva csoszogott tova. Áthajolt az első ülésen. Most mit tegyen? Lábujjhegyre állt. Az utasajtón állva átkukucskált a műszerfal fölött. A kerék üresen forgott a kezében. Ki kell jutni innen! Tim lenézett a lábára. nyikorgó hang. Már alig esett. s a keze fejével letörölte a száját. Vajon hová lettek a többiek: Gennaro. míg a hányinger elmúlt. Semmire sem emlékezett. Mikor is volt az? Az órájára pillantott. Tim lenézett. a kocsi az oldalára billent. Nem a tyrannosaurus volt. s kinézett a kitört szélvédőn át. Még a számokat sem tudta kivenni. amint tovább himbálózott. Amikor azonban megint kinyitotta a szemét. apránként szedte a levegőt. Megpróbálta letekerni az ablakot. mozog vele minden. Csak aludni vágyott. – A rohadt életbe! Reccs! Ezúttal még hangosabban. ő pedig Grant doktorral beszélt. A stegosaurus volt az. Szédülő feje. Szeretett volna jobban látni. Ez a test széles volt. Tájékozódni próbált. hogyan tört be a szélvédő. mintha mozogna az egész világ. Az agya lüktetett. Nem látta valami jól a sötétben. Nem emlékezett rá. Újra elfogta a rosszullét. és azonnal elhányta magát. s ezzel egyidejűleg egy-két méterrel lejjebb esett a fán. szédült. gömbölyded. Hátha azt ki lehetne nyitni. Beragadt az ajtó.

Egy vastag faágon feküdt. és elforgatta a kilincset. pedig. Pontosan olyan ostobán. és elindult arrafelé. Kétoldalt az ajtókeretbe kapaszkodva Tim lassan leereszkedett az ajtónyíláson át. fémes csengéssel-csattanással a Land Cruiser is földet ért. az ajtó pedig szélesebbre nyílt. Hallotta a csoszogást a sötétben. ahonnan jött. néma volt. mint valami óriásira nőtt teknős. A kocsi horpadt orra csak centiméterekkel volt a fiú arcától. . hogy a stegosaurus visszajött. Befelé hajlott. Valamikor szeretett fára mászni. Nyilván a Land Cruiser zuhanásának hangja csalta oda. nem menekülhet előle. Látta. Szűk volt a nyílás. aztán ránehezedett. aztán a Land Cruiser elszabadulva zuhanni kezdett. és Tim tudta. Bekapcsolta. Az ajtó kitárult. míg úgy oda nem szorította testét a fa törzséhez. és lejjebb kúszott. és a főúton találta magát. még a levegő is kiszállt belőle. Bemászott a Land Cruiser összezúzott első szélvédőjén át. vakító fény az agyában. Felvette magára.. egyre sebesebben rohant Tim felé. Olaj csepegett Tim arcára. egyenesen felé. Aztán már csak zuhant. Nézőjén keresztül látta a másik Land Cruisert. meg a nézőt. a kocsi pedig repül. lefelé – és megakadt egy fél méterrel lejjebb lévő faágban. A kocsi üres volt.. ágról ágra ütődött a teste.. mély lélegzetet vett... Aztán újra: reccs. és visszacsoszogott arra. puffant. Tim átsietett rajta. és kipottyantotta Timet a Land Cruiserből.Tim megmarkolta a kilincset. de a tyrannosaurus könnyedén letiporta. a lába kilógott a kocsiból. Sem Grant doktornak. akármilyen gyorsan mászik is lefelé. Lába meg-megcsúszott a nedves ágakon. Ügyes mászó volt. Lenyúlt. alacsonyan tartotta fejét. mint valami őt üldöző vadállat. hallotta. Úgy mozgott. és felsisteregtek. szinte lépcsőt formáztak. A kerítés négy méter magas volt. Hamarosan a hasán feküdt a lejtősen elhelyezkedő ajtón. És ott megállt. A kisfiú még mindig vagy négy méterrel lehetett a földtől. rovátkolt lemezek két sorban futottak végig a hátán. amikor a Land Cruiser egy végső nyikordulással lassan. A Land Cruiser nyöszörgött. Közel voltak egymáshoz az ágak. hogy a parkon belül van valahol. Nagy ütődéssel megállt. éppen akkor. balra nézve meglátta az összeroncsolt kerítést. Tim felnézett. és éppen annak az ágnak ütközött. s forró. Reccs! – hallatszott megint. A kocsi megmozdult. A néző azonban működött. de a helyzete megmaradt.. hogy mi a baj: zárva van! Tim felhúzta a zárórudacskát. egy arc. ahogy tudott. sötét árnyéknak tűnt felette. de nem tévedhet el! Tudta. Az ág abban a pillanatban meghajolt. alighanem közel a főúthoz.. Ha legalább tájékozódni tudna! Alig látni valamit a sötétben.. Lélegzetét visszafojtva lassan visszakúszott a hátsó ülésbe. nagyon lassan orrával lefelé fordult. Ütődött. A kisfiú zuhant. Mászni kezdett lefelé. mint valami sátáni száj. elektromos szikrák esője hullott és ropogott szanaszét. minden testrésze fájt. A stegosaurus tovább közeledett.. – Menj innen! A kő tompa puffanással verődött vissza a lemezekről. és látta a megnyugtató. Odafutott. bután mozgott. Ekkor eszébe jutott az éjszakai nézőszerkezet. A nagy. Tim nekidőlt az összevissza horpadt Land Cruisernek. ahogy a Land Cruiser úgy tör át az ágakon a nyomában. és látta. és hozzávágta.. újabb ágat talált. égő fájdalom. zöld rácsozat és a fényszórók éppen Tim feje fölött hintáztak. keze-lába lelógott. Az állat morgott. És ezen a fán jól lehetett mászni. A dinoszaurusz esetlenül. sem Malcolm doktornak semmi nyoma. a gyomra égett a fájdalomtól.. És lassan. lassan megfordult. – Menj már innen! Menj! Újabb követ vágott hozzá. és előretolta. a keze ragacsos lett a gyantától. és körülnézett a sötétben. Tim erőt vett magán. hogy szinte belebújt. ez most már biztos! Tim sietve kúszott lefelé. A nagy.. A Land Cruiser nagy.. sietni próbált. áthaladt a sűrű növényzettel borított sávon. hogy odafönn meghajlik az ág a Land Cruiser súlya alatt. aztán legelőször Tim válla ütközött a puha talajnak.. Vissza kell jutnia a többiekhez valahogy. melyen a fényszórók a szemek. foszforeszkáló zöld képet. amelybe kapaszkodott. így hát egyszerűen elengedte az ágat. Recccs! A kocsi megmozdult. Ekkor azonban a fiú rájött. és benézett. aztán eltörik. amikor hangos.. Tim lassan lábra állt. gurult. egy rándulás. amely a stegosaurus fejét találta el. és megtalálta a rádiót. és megpróbálta erőltetni. így hát otthagyta. A fiú összehúzta magát. de Tim úgy gondolta.. Alig egyméternyit haladt még csak lefelé. amelyek égették a fiú bőrét. amelyen alig néhány perce még Tim hevert. amely az oldalán hevert. kifér rajta. és megindult. majd kihunytak körülötte a nyirkos földön. de az meg sem moccant. A rádió összetört. Egy kicsit kalimpált a levegőben – míg valami szilárdat nem ért a lába – egy ágat –. Tim felkapott egy követ.

Azt jelenti. Felvette. hogy az a szubsztancia. ahogy egyedül állt ott az őserdei úton. hogyan zajlott le a támadás. egy felborult. hogy olyan DNS-t használjon. üres. De ki menne oda éjjel? A számítógép sípolt. amely szinte egyidős a Földdel magával. Még most sem volt világos a számára. Szabadon alkotott. – Átnyújtott egyet Arnoldnak. a grafikont a csúcsot. mindent. Elindította a keresőprogramot a számítógépen. Ha egy ember DNS-ét összehasonlítjuk egy semmi kis baktériuméval. – Nincs. A DNS-molekula olyan régi. – Lex! Rémlett. Végül aztán abbahagyta. és lehívta a DNS-sel kapcsolatos nyilvántartásokat. Muldoon kinyitotta a dobozt. – Félórája. Amint megpillantotta a képernyőt. Nem volt ott senki. Egyszerre csak megragadta a tekintetét valami halvány dolog az út mentén.. hogy egy-két perc. – Biztos. egyszál magában.. rózsaszín bébijeiket hintáztató emberek nemigen gondolnak bele. aztán próbáld a kocsikat hívni! Henry Wu kinyitotta a FERTILIZÁCIÓ feliratú ajtót. és levegő után kapkodott rémületében. – Nedrynek még mindig nincs nyoma? – kérdezte Muldoon. azt látjuk. Felkelt. A DNS akkora molekula. – Harding dzsipjének már itt kellene lennie. Töltsd föl úgy húsz percig. Megnézte a mélyhűtő ajtaján lévő rekordert. Benne maradt? Vagy kijött belőle? Összezavarodtak az emlékei. hogy a fejlődése lényegében több mint kétmilliárd éve befejeződött. amelyben hat hordozható rádió adó-vevő volt. – Vidd a töltőt is! Ezek a mi vésztartalék rádióink. Lex baseball-labdája volt. Még nincs. . és valahonnan az út egy távolabbi részéről jött. A DNS-nek ez az alapvető konzervativizmusa arra bátorította Wut. A régi gének egy-két újabb kombinációját – és azt is ritkán. Halk volt. csakúgy örvénylett körülötte a zöld színű világ a nézőn át. de mondanom sem kell. Végül is a legtöbb élőlény DNS-e teljesen azonos. és egy darabig csak nyöszörgött. mit talált a gép. és belépett az elsötétített laboratóriumba. Arnold elnyomta cigarettáját. A mai világban sétafikáló. – Mióta már? – kérdezte a terembe lépő Muldoon. és körbejárta a laboratóriumot. egyből elfelejtette a mélyhűtőt. – Szétosztom ezeket az épületben lévők között. Ez furcsa. Jól tudta. hogy az első adatkeresés befejeződött. Wu habozás nélkül a számítógép-terminálhoz ment. Azóta alig mutatott bármi újat. mint a szobrász az anyagot vagy a márványt. Rabul ejtette. amilyet csak akar. Csak állt az úton. mint számítógépen. míg lefut. Úgy megsajnálta magát. hogy az elemeknek legfeljebb tíz százaléka más. hogy be is dugja őket az áramba. ám valahonnan továbbra is nyöszörgés hallatszott. senkinek sem jutott eszébe. és letörölte róla a sarat. Ez annyit jelentett. – Lex! Mintha összezárult volna körülötte az éjszaka. Még rágondolni is rossz érzés volt. Nem tudta pontosan felidézni. Dinoszauruszainak előállítása során Wu úgy manipulálta a DNS-t. jelezve. Méghozzá nem is régen – a legutóbbi félórában. kocsi mellett. amely mindennek a közepe – amely körül az élet tánca valaha elkezdődött –. A laborosok nyilván még mindig vacsoráztak. amely jelezte a hűtő hőfokának változásait az elmúlt időszakban. hogy két vagy három percig is eltart. közben puszta beidegződésből ellenőrizte a műszereket. hogy minden fajnál tíz gigabitnyi optikai lemezkapacitásra volt szükség ahhoz. hogy beleült a hideg esővízbe az úton. Ezeket nem is lehetett volna másképp tárolni. és itt lesznek. Hegyes csúcsot vett észre a grafikonon. Fekete fémdoboz volt a kezében. A DNS hihetetlenül ősi anyag. valaki járt a hűtőben. hogy megnézze. Maga Wu sokszor meg sem tudta különböztetni az egyik DNS-fajtát a másiktól. Körbe-körbe forgott. hogy Lex is a Land Cruiserben volt. Mind a tizenöt fajt le kellett ellenőriznie. hogy az összes ismétlődés és változat tárolható legyen.Hová lettek? Hová tűnt mindenki? Hirtelen pánik fogta el. miért tulajdonít Grant ekkora fontosságot a béka-DNS-nek. hogy iszonyatos mennyiségű információt kell végigkeresnie. amikor a tyrannosaurus megtámadta őket. voltaképpen egy olyan vegyület. gondolta. Wu odament.

hogyan idézi elő ez a szaporodást. azaz béka-DNS. A többi állatban nincs.0-3.7 Az eredmény egyértelmű volt: minden szaporodó dinoszauruszfajban van rana-.9 3. . Azt azonban többé nem tagadhatta.0 2.4-2.1-3. hogy Grantnak igaza van. töredék len >0/ RNA=töredékeket tartalmazó DNS Verzió Maisaurus Procompsognathida Othnielia Velocilaptor Hypsilophodontida 2.0-3.1-2. Wu még mindig nem értette.7 3.7 1. A dinoszauruszok szaporodnak! Futva indult a vezérlőbe.LEITZKE-FÉLE DNS-KERESŐ ALGORITMUS DNS: Verziókeresési kritériumok: RNA/összes.

Ettől Tim egy pillanatra meghökkent. A kislány értetlenül bámult. de ezen kívül úgy tűnt. Nem jönnél ki inkább? Lex megint kezdte a csőbe veregetni a fejét. – Tim remélte. Remegett a hidegtől. Furcsa érzés fogta el. – Hát anyu? – Ő sincs itt. és ezt kérdezte: – Hol van Grant doktor bácsi? – Nem tudom. oda. – Nagyon kényelmetlen lehet ott benn.LEX A kislány egy nagy. – Miért nem? – Állatok vannak odakinn. és az orrát ráncolta. Valószínűleg túl sötét volt hozzá. Lex! Megtaláltam a labdád! – Na és? A bátyja most másképpen próbálkozott. de egy pillanat múlva már válaszkiáltást hallott. – Gyere már ki! Lex szótlanul megrázta a fejét. Ekkor hallotta. nem esett baja. hogy már útban is vannak ide. Tim a nézőjén át megkönnyebbülten látta. de . de a néző segítségével Tim mindent látott. Meglepetten körülnézett. Lex évek óta nem használta ezt a szót. – Lex. Aztán kijött. igaz is. – Egyáltalán van kint felnőtt? – kérdezte a kislány. egy kis alvadt vér tapadt a homlokára. Fogadok. Leült a fűre a csövön kívül. Igencsak pocsék félórát töltött el két nagy szikla közé fúródva az út alatti domb lejtőjén. – Még nincs – felelte a bátyja. – Nézd. Baseball-kesztyűjével a szájában előre-hátra hintázott. Lex azonban nem mozdult. Csak ütögette a fejét a csőhöz. Lex. Nagy kő esett le a szívéről: a húga sértetlennek látszott. és letörölte arcáról és kezéről a hideg sarat. Jobb felől jött. méteres vízvezetékcsőben kuporgott. – Az állatok elmentek – mondta. Tim! A kislány nem válaszolt. mi van nálam! – mondta a kezét feltartva Tim. és várt. Magához ölelte a térdét. Tim megint hallotta a kongó hangot. de egyébként nem volt semmi baja. ahol a kislány láthatta őt. hogy „állat”. Odabenn sötét volt. Meg hideg is. nagyjából a Land Cruiser irányából. – Hová? – Azt nem tudom. – Ülök itt egy kicsit – mondta. mely az út alatt húzódott át. – Elment. amelyet Tim alig néhány perce hagyott ott. – Titeket kereslek! Ed Regis reszketegen talpra állt. Nedves volt alatta a föld. én vagyok az. Kiabálni kezdett: – Hallóóóó! Hallóóó! Grant doktor? Grant doktor! Timet egy kicsit nyugtalanította a zaj – esetleg visszacsalhatja a tyrannosaurust –. hogy Grant jön feléjük. – Ott van az az óriás. – Hála Istennek! – szólalt meg. csak mindenféle csúfnevet. – Itt? Mikor? – Az előbb – ismételte Lex. de már nincs itt. – Apu odakint van? – Nincs – felelte Tim. – De biztosan mindjárt itt lesznek. hogy amit mond. hogy Lex megmozdul a csőben. – Pihenek. és újra meg újra a cső falába verte a fejét. hogy lássa. – Láttam. – Ő otthon maradt. – De hiszen az előbb itt volt. Nem volt jobb ötlete. A Tyrannosaurus rex. Tisztában volt vele. Lex. Jókora darabon elhasadt az inge a vállán. amikor még a csőben voltam. – A labdád. hogy ez nem valami óriási rejtekhely. ahogy a fejét verdesi a falhoz. – Hová ment? – Honnan a csudából tudjam? – mondta Lex.

És ez most a legfontosabb. Grant is. azt is lehúzta. ahol van. Nagy volt a csend. túl az úton meg egyszerre csak kiszakadt a föld a lába alól. közben igyekezett leküzdeni a rettegést. – Hát nem megmondtam. Lehet. sem ijedtég nem hallatszott benne. – Jó. Jobb válla csúnyán összehorzsolódott. tehát legokosabb. mi történt ezután. Mindkét gyerek tud menni. de közben már arra gondolt. valahogy úgy. hogy úgy látszik. és az is feldagadt. – Hallóóó! Megmerevedett. Kiköpött. és ő úgysem tehetne értük semmit. hogy meleg vér fröcsköl a szájába. Szeretnek belemászni az ember. ha marad. Tim orra dagadt volt és fájt. Most át kell vennie a dolgok irányítását! Felmászott. élnek-e. de hiába próbált újra meg újra erőt venni magán. vagy félórán át. Megint jött a pánik. a lába ép.. sárral borított nyílásban. mi a teendő. és akkor úrrá lett rajta a borzalom és a szégyen. hogy megmentse őket. Lex nem mutatott semmiféle fájdalmat. Sem fájdalom. Ed Regis nem nagyon emlékezett. és csak a tyrannosaurus járt a fejében. meg hogy ott elég volt számára a hely. Csak makacs. hogy ezután valahogy bemászott a sziklák közé. ahogy az ember egyből kijózanodik. meleg helyeket. Lehet. aligha maradhattak vagy maradhatnak életben. és elbújt. vissza az útra. Ő viszont idelenn van. Malcolm is. Emberi hangot hozott a szél. már fogalmazta a mondókáját. És olyan nagy csend van. Atyaisten. Ahogy jön felé. és elindult hazafelé. Annyival is rövidebb a menekülés útja. mi történt a gyerekekkel. hogy zuhanás közben megsérült. – Hallóóó! Grant doktor! Te jóságos ég! Hiszen ez a kislány! Ed Regis figyelte a gyerek hangjának tónusát. ahogy ott gubbasztott a sziklák közé bújva. Az arcához nyúlt. Mit is meséltek a munkások? A piócák még az ember alsóneműjébe is bemásznak. hogy mindenki megmaradt. mi történt valójában. gondolta Regis. csak a saját menekülésére gondolt! Tudta. Végül aztán. Sáros víz fröccsent a lába nyomán. hogy különben is reménytelen a dolog. Ő pedig tehetetlen. Eltüntette a rejtőzködés nyomát. ahogy a pocsolyákba taposott. talán mégsem kellene odamennie. Elindult fölfelé a dombon a Land Cruiserekhez.. Azzal nyugtatta magát. és dagadt húst tapintott. Alan Grant végigsimított a kislány testén. mint egy vértől dagadó pióca teste. hogy a duzzadt hús nem más. de ő nem állt meg. Már nem is szégyellte. rettegett. és nem tudott világosan gondolkodni. csak futott. nem bírt megállni. ami mintha elzsibbadt volna. fel az úton. Így hát Regis maradt a sziklák között.. Nem is tehetett volna semmit. Grant tartott tőle. Az alkarján is észrevett egy piócát. hogy most vissza kell mennie. egy kicsit megszorította mindkét karját és lábát. gyerekes szólongatás. hogy nem az történt. már kezdte átgondolni. és kísérletet tenni. hogy Lex szólt hozzá. jó. és hogy mit fog majd szólni mindehhez Hammond. Lihegett. Szeretik a sötét. Ami végül mégiscsak mozgásra késztette. de azért mégiscsak meg kellett győződnöm róla. Ezek az őserdei dombok teli vannak piócával. Rajta kívül senki sem fogja tudni. Ha a gyerekek odafenn vannak az úton. Azt tudta. sziklás lyukak is. Hátborzongató ez a hatalmas csend! Ed Regis sarkon fordult. és hogy esetleg a többiek még élnek. de fájni nem fájt. hogy bátor ember. hátha történt a gyerekkel valami. hiszen mindig azt hitte magáról. A kocsi felé. De csak a dinoszauruszt látta maga előtt. hogy eddig bujkált. Látta sötét nyomát. amit gondolt. Ed lassan a tudatára ébredt. levegőt is alig kapott. és képtelen volt megmozdulni. hogy a tyrannosaurus még mindig arra jár. gurulni és zuhanni kezdett. Ha pedig történt. Egyáltalán nem is látta a kocsikat. főleg a szája sarkánál. Miért hagyta abba a kiáltozást? Ed Regis ment tovább. Ekkor jött rá. amikor azonban kibújt a sövény sűrűjéből. míg valami szikla felfogta a testét. s érezte. Valahogy a domb aljára került. De úgy látszott. egy pillanatra megzavarodott. lassan megnyugodott egy kicsit. mint valami patkány. És teli vannak a sötét. hogy eltörött. korábban sem. szóval valószínűleg erre futotta az erejéből. ha a kocsiját leinti a rendőr. És amint mászott kifelé a sziklák közül. hogyan is irányítsa a dolgokat ettől a pillanattól kezdve. futott. Máris összeszedte magát. Regis letörülte a hideg sarat a szájáról és a kezéről. A srác nem volt ennyire szerencsés. a domb lábánál. A Land Cruiserek meg nyilván odafönn vannak a dombtetőn. Rémlett. és nem gondolni rá. és bizsergett. Egyszerűen elszaladt. az valami különös érzés volt a szájában. és magukra hagyta őket. végül valahogy sosem sikerült. Lehet. biztosan az egész testét elborítják! Hiszen végiggurult a dombon. Ott feküdt a hideg. Fura érzés volt. utánakiáltott. már tervezte is a következő lépést. mert most már tudta. hogy semmi bajom – kérdezte Lex bosszúsan. amikor megtudja. és undorodva az erdőbe hajította az állatot. hányingertől reszketve Regis letépte ajkáról a piócát. És ettől a felismeréstől egyetlen pillanat alatt magához tért. Csodálatos: a homlokán lévő kis vágástól eltekintve teljesen sértetlen. .megbénította a rettegés. és veszélyhelyzetben is megőrzi a lélekjelenlétét. Már nem hallotta a kislányt. amely az ajkát szívja. a tyrannosaurus elment – de legalábbis nem támadott –. Szinte odabenn van a szájában! Borzongva.. amiért ott hagyta a gyerekeket. vagy elpusztultak. és igyekezett összeszedni magát.

lenyomta. Grant alig tudta elhinni. A kislány kalimpálva ellenállt. Grant elgondolkodott ezen. hogy elmondhassuk. mitől óvja. Meg nem moccant.. de nem mozdult: erős. foltos mintákat rajzolt. s ahogy a nagy fák ágai mozogtak a szélben. csapdába kerülünk. ahol Regis állt. – Így találkozunk velük. És szólnunk kell. Grant azonban a fejét rázta. amikor a tyrannosaurus belerúgott. – Remélem. Rávetült a többire. Lex azonban követte a bátyját. Ott állt egy nagy fa mellett. mint egy bocs vagy egy kölyökkutya. Grant lenézett Regisre. ami közvetlenül azelőtt történt. látta a mozgó árnyakat. Lex is. – Igen. Odalenn. és lefelé mutatott a dombról. csak azután indult tovább. de mégsem látszott komolynak. De csak egy pillanat kellett hozzá. és főként a legkevésbé sem akadályozta vagy korlátozta a mozgásban. hogy Lex lássa. A „kicsi” volt az. a maga két és fél méterével. Milyen állat lehetett az? Csak egy lehetőség jutott az eszébe: a kis tyrannosaurus. Esetlenül mozgott. Az erdő továbbra is néma maradt. mint a kölyökállatok. És egy dolog járt a fejében: az a sötét árny. Tim óvatosan előrehajolt. Megint hallották a kilégzés hangját. és a gyerekeket. horkantó hang hallatszott: a kiengedett levegőé. Reccs! Hallották. és Grant után szaladt. hogy észrevette volna. ezért faleveleket tapasztott a sebre. aztán lassan kilesett a fa mögül. Csak halvány emlékei voltak arról. A tyrannosaurus számára gyermekjáték lett volna. távolabb az úton. – Csak mi. hogy Regis feszes testtartása ernyed egy kicsit. halk. – Vissza kell mennünk a civilizációba. nagy. és kikukucskált. vagy tíz méterre a Land Cruisertől. a domb lábánál Ed Regis állt meredten. és vele együtt maga is a fa aljánál lévő göcsörtös gyökerek közé bújt. – Nem hiszem. Grant látta. – Ne hagyjatok itt. Ed Regis eltűnt. de Grant a legközelebbi fa törzséhez húzta. hogy Grant tekintete újra megtalálja. ahogy egy ág eltörik. hogy még egy árnyék van ott. A fiatal tyrannosaurus csoszogva elindult lefelé az ösvényen. A tücsökciripelés és békakuruttyolás állandó háttérzaja hirtelen elnémult. eltekintve attól a karmolt sebtől. hogy nyögve felült az erdőben. Kezdetben vérzett a mellkasa. hogy még él. Grantot leginkább egy ló légzésére emlékeztette. szögletes fej. az a legokosabb – felelte Grant. Lex türelmetlenül megráncigálta Grant ingét. hogy mindőjüket megölje. és lemutatott a dombról. Odalenn sötét volt az út. Elhaladt a fa mellett. – Ne mozduljatok! – szólt Grant. – Én nem akarok itt maradni – mondta erre Lex. mozdulatlanul. Lex is meghallotta. Tim. ti. amit akkor kapott. Nem tudta eldönteni. . – Akkor menjünk lefelé az úton a szállodához – mondta Tim.. De hát akkor miért nem tette? – Éhes vagyok! – szólalt meg Lex. a hang ismét feléjük sodródott a széllel. elvesztette-e az eszméletét egy időre. Minden lépésnél megállt. – Hát még én! – mondta erre Grant. ahogy az emlékek lassan visszatértek. nem tart soká – felelte neki Grant. Muszáj visszajutnunk. majdnem. Malcolmot kereste. igyekezett valamiféle értelmes rendbe rakni őket. – De én éhes vagyok! – mondta megint Lex. – Ne mozdulj! – mondta Tim. – Akkor várjunk itt? – kérdezte Tim. hajlott nyak. és beleszagolt a levegőbe. Ekkor a domb alja felől emberi köhögést hallottak. Az erdő halálos csenddel vette körül mindannyiukat. mi van a hajón. ahányszor csak levegőt vett. valahonnan egészen közelről. ha értünk jönnek. mert felhagyott a küszködéssel. – Ha valamelyik dinoszaurusz odalenn van. azt hiszem. s egy idő múlva alvadni kezdett a vér. Tim azonnal követte őket. Alig volt hangosabb a szélnél. amelyeket a holdfény vetett a fa törzsére – és ekkor vette észre. Aztán. Az út mindkét oldalán magas kerítés van – mondta Grant.Grant maga szintén sértetlen volt. Grant a szájához emelte az ujját. – Csak mi tudunk róla? – kérdezte Tim. így jelezve. Halkan mint egy sóhaj. mi történik. Ez ugyan égett. Lex szóra nyitotta a száját. Grant betapasztotta tenyerével a száját. ne hagyjatok itt. és átölelte a törzsét. és futásnak eredt. Regis elfordította a fejét. hogy maradjanak csendben. még mielőtt a támadás megkezdődött volna. Csak csendes levélsusogás hallatszott. és ekkor egy tyrannosaurus lépett ki az ösvényre. igyekezett kilesni a tyrannosaurust a fa túloldalánál. amely áthaladt a Land Cruiserek között az úton. – Várjuk be. de semmi jelét nem adta. hogy ez jó volna. hogy lenézzen a dombról. s a szél zúgása. Akkor aztán útnak indult. a réseken átszűrődő holdfény állandóan változott. míg ideér valaki. tudni szerette volna.

ám ekkor az utolsó pillanatban a kölyök megint ugrott. A támadás balról jött. ez játszik vele! – ismerte fel Grant az odalent folyó színjáték lényegét. Az ifjú tyrannosaurust láthatóan zavarba hozták a fura hangok és mozdulatok. Aztán hirtelen elnémult a sikoly is. mert Regis többé nem mozdult a helyéről csak felült az ösvényen. Lehajtotta a fejét. A férfi felugrott. Regis még vagy fél percig a fa mellett maradt. Ekkor apránként visszatértek az erdő zajai: egy béka óvatosan brekegett. Regis pedig üvölteni kezdett. Szó már nem érkezett felőle. – Hé! – ordította estében Regis. – Vissza. Már nem ölelte a fát olyan szorosan. hagyta. aztán a kis tyrannosaurus lehajtotta rá a fejét. nekiugrott. és az eltávozott dinoszaurusz irányába nézett. hogy eloszlassa a feszültséget. Regis most óvatosan jobbfelé oldalazott. ahogy a feje előrelendült. mintha elijeszthetné. Kiabálva feltápászkodott. egyetlen tücsök ciripelt. a fák és a magas sövény irányába. te hülye! Hallod? Vissza! – Úgy kiáltozott. A kicsi bömbölt. de mihelyt Regis még néhány lépést tett. és feldöntötte Regist. de nem támadott. amely előtte állt. aki elterült a földön. Grant tépett. és megrázta a vállát. és tovább hátrált. egészen magas hangon. de a kölyök nem üldözte. – Jaj. és alighanem a földhöz szegezte a hátsó lábával. amint Grant mindkettőjüket kézen ragadta. . csak sikoly. mint valami oroszlánszelídítő. és a dinoszaurusz meghátrált. Megint csak hagyta. te! Vissza! – kiabálta közben. A kölyök felkapta a fejét. Kilépett az út közepére. és Regis ismét elterült a hátán. zajos kis állatot. és fémes kongással a földre pottyant. aztán rákezdett az egész kórus. A kölyök kíváncsian bámulta tovább a fura.Odalenn az úton az állat most kiesett Granték látóköréből. Ám az őserdő még mindig néma volt. rákiáltott a dinoszauruszra. hogy talpra álljon. és kíváncsian megszaglászta. Éjszakai nézője lecsúszott a homlokáról. véres húscafatot látott a pofájában. mert hirtelen hányinger fogta el. és a kezével hessegette. és a dombtető felé nézett. De a tyrannosaurus rávetette magát. Jóságos ég. Regis tovább kiáltozott: – Jól van! Hallod?! Most aztán tűnés! Menj a fenébe! Tűnj el innen! – s közben távolodott a dinoszaurusztól. – Vissza. és rohanni kezdett velük. Regis ellépett a fától. ne! – nyögte halkan Lex. A kölyök bömbölt. – Hagyd már abba! – ordította Regis. hogy talpra álljon. Regis az öklével verte az orrát. Tim még éppen fel tudta venni a szemüveget a földről. Regis megnyugodni látszott. – Menj innen! Tűnés! Tűnj el! Menj már! – kiabálta Regis teljes erőből. és újra leterítette. s amikor a kölyök felemelte a fejét. Mellette Tim elfordult. amelyek apró martalékától jöttek.

.. majd recsegni kezdett a rádió... – John? Mondd meg Muldoonnak. John. és vadul hadonászik a kezével.. és a kompikat követjük. a folyó közelében. – Lenyomta a gombot a rádiókészüléken. recsegő adásfoszlányok mozaikját... Tíz percbe sem tellett. Muldoonnak kell. vissza... – Mondom: a garázsban. Harding újból benyomta a gombot. Hirtelen zúgni. – Tán vissza kellene mennünk! Harding vállat vont.. – Igen.nem. sik. maga csirkefogó! Az istenit! Állítsa vissza a rendet ebben a parkban. – Valamit a kocsiról – mondta Ellie. hogy Muldoon rohan feléjük. és toporzékolt kicsi lábával. Majd: – . . Félreérthetetlen feszültség volt Arnold hangjában. tek. Ellie előremutatott. Újabb recsegés.. Ezt már legalább két perce folytatta. – John? Ott vagy? Elég rosszul hallunk! John? Villámfény borította el a tájat. – Attól tartok. – Ez viszont érthetetlen – jegyezte meg erre Harding. a kocsitokra.. – Azt mondja. tűnt..bi. milyenek a műszaki emberek. – Mit mond? – kérdezte Gennaro... ell. azonnal. hát megkerültek! – kiáltott fel Harding..A VEZÉRLŐTEREM A kompik árnyéka az út mentén suhant az éjszakában.. – Szinte reflektornak látszik... A készülék megreccsent. – .. kocsi. s már fel is tűntek a Szafarikastély barátságos fényei. akadt. – . ha minden mindig előírásszerűen történik. Grant ásatásánál Montanában mindig Ellie kezelte a rádiótelefont... légy szíves.. amint azt kérdi: – . – .. John! Máris indulunk vissza.Moldoo. Arnold.. s a dzsip bőgve száguldott velük az úton a sötétségben. látták.. – A többi kocsi elakadt az úton a viharban. mintha valami baj volna ott – komorult el a botanikusnő. Megint recsegés. Harding megvonta a vállát.. Roppant érdekes. ezzel nem megyünk semmire – mondta Harding. John..vagytok? – Ó. távolabbra az úton.. – Kikapcsolta a készüléket. – Az istenit magának.. marha. – Johnnak gyakran van gondja. – Szó sem... gatsz rám. – . Csak akkor jó nekik. Gennaro összeráncolta a homlokát. Amint azonban Harding fékezett a látogatóközpont előtt. – No végre! Lenyomta a gombot. hogy vigye a másik kocsit! Ott van a garázsban.. a maga kocsija kell neki. miközben Henry Wu döbbenten álldogált a sarokban. – Megvan – szólt Ellie.... megvagyunk! Itt vagyunk a folyó közelében.. ide! – Ez úgy hangzik. – Csak azt tudnám. mi ez a nagy izgalom! Harding magasabb sebességre kapcsolt.. – Akkor miért nem viszi a másik autót? – Lenyomta az adógombot. – Másfél kilométerre a hipsziktől. hogyan kell összeállítani a zavart.. Aztán Arnold feszült hangja szólt ismét. csak a tiétek.. Az autó a garázsban van! Megint légköri zavar....tok..hol.. – John? Ismételd. neki. Hosszan sercegett utána a készülék. Hosszú évek tapasztalata megtanította rá.. Harding benyomta a gombot.. – Azt hiszem. Aztán: – . Légköri zavar sercegése.. Harding dzsipje némi távolságból követte őket. hogy Muldoonnak kell a kocsink? – Úgy hangzott – felelte Ellie..edry. Tudja.. Felismerték John Arnold hangját. de azonnal! És hozza vissza az unokáimat! Rögtön! – John Hammond a vezérlőben állt. Rendben... ordítozott..... és megfordult a kocsival.. – Hát jó.ség. – Nem valami fény az ott? – Meglehet – felelte Harding.. és Muldoon el akar jutni hozzájuk. Kompikat követünk. Fülsiketítő mennydörgés...

főmodulok/ */ */ Call Libs Include: biostat. hogy állítsa már elő a limuzinjukat. azonnal szólunk. mint amelyet most Arnoldnak meg kellett oldania.lev {void MeterVis $303} Random(3# *MaxFid) on SetSystem(!Dn) set shp_val. mint az összes többi vállalati vezetőember. az ordítozás leginkább csak hátráltatja a dolgokat. A műszaki rendszerek teljes mértékben közömbösek az emberi emóciókkal szemben. és azt képzelik. – Áttekintéssel? Az egy örökkévalóságig fog tartani. Belépett a színfalak mögé. – Miért nem iszik egy kávét odalenn a büfében? – kérdezte Arnold. – Mit csinálsz. nem lesz Malcolm-effektus – felelte erre Arnold.sys Include: sysrom. – Nekem mondod? – kérdezte Arnold. Lehet az a Disney-cég vagy a haditengerészet. hogy Nedry nem fog visszajönni. a lépésenkénti utasítássort. melynek legnagyobb része dokumentálatlan. mi történhetett. John? – Ellenőrzöm a kódot. ehhez pedig nyugodtnak. – Ha lesz valami újság. hogy ha ordítoznak az emberrel. hogy a Jurapark programja több mint félmillió sornyi kódot tartalmaz.obj to lim(Val {pd}) NextVal Arnold immár nem csupán használta a számítógépet. s nincs hozzá magyarázat. vagy sem. ha hallok Muldoonról – válaszolta hűvösen Arnold. És lehet. Hammond – szólt Arnold –. */Jurapark. ami azt jelenti. Gombokat nyomott le a konzolján. Meter Vis return Term Call 909 c. Mr. majd minden rendbejön. – Most pedig volna szíves végre dolgozni hagyni? – Azt Isten verje meg magát! – ismételte Hammond. bármennyire szélsőségesek is legyenek. – Hallani sem akarok semmiféle Malcolm-effektusról itt! – mondta Hammond. fárasztó feladat állt előtte. Hammond is csak olyan. Muldoon már úton van. hogy pontosan azt tegye. Éppenséggel nem volt boldogító a számára a tudat. és rájönnie. akit Arnold valaha ismert. – Nyugalom. mint most is. Sosem értik a technikai gondokat. ezek a menedzserpofák mindig egyformák. figyelmesnek kell lennie. hogy megvizsgálja a kódot.vst Include: net. amely eligazítja a komputert. Az olyan problémákkal szemben viszont. 7*tty]} if ValidMeter(mH) (**mH). A számítógép fütyül rá.sys Include: pwr. – Nekem? . amit ön mond. amikor Arnold számára lényegében már bizonyossá vált. Aprólékos. hogy neki magának kell behatolnia a számítógép kódrendszerébe. hogy ordítoznak-e vele.obj to lim(Val {d}) SumVal if SetMeter(mH) (**mH).– Nos. és új cigarettára gyújtott. uram. Wu lépett hozzá. – Arnold elfordult.mdl */ */Initialize SetMain [42]2002/9A {total CoreSysop %4 [vig. hogyan viselkedjék. mit sem ér bármiféle ordibálás. Sőt. hogy ez néha így is van – ha a titkárnőjükkel ordítoznak. ValdidMeter(Vdd) return on SetSystem(!Telcom) set mxcpl. mire az ismerős monitorképek megváltoztak a szeme előtt. – Jelenteni fogom önnek.

ahol megfogta a bokát. hogy Muldoonnal megy. de egészen lassan. és letépte! – Muldoon felegyenesedett. Benne szerszámkészlet. Gennaro kinyitotta a hátsó ajtót.. Muldoon taposta a gázt. – A T. jobb. – Álljon meg! – kiáltotta. zuhogó esőben. – Már egy teljes órája. – Azt hiszem. hogy mibe és miként lehet becsomagolni egy letépett lábat. nehogy rosszul legyen. A lábszár húsa halvány. hogy a dzsip reflektorfényénél megnézze. ha ezt magunkkal visszük – mondta. Elrohant Gennaro mellett. majd felfutott egy dombra. hogy megpróbálnák rádión segítséget kérni. nincs-e valami ott hátul! Valami takaró vagy afféle.. mi az. ahol valamikor a térd volt. aztán vissza. egy kartondoboz. kerékabroncs.. és barna papucscipőt. és Gennarót megint elfogta a hányinger. és leguggolt a láb fölött. és odébb lépett. hogy semmi hír a többi kocsiról. és mélyeket lélegzett. – Nem kétséges. úgy kérdezte: – Mi az? – Egy láb – válaszolta Gennaro. – Ezt nem harapták le. és. Addigra már Muldoon is kinn volt a kocsiból. Úristen. Lejjebb Gennaro fehér zoknit látott. Megint csúszott egyet a kocsi az éles kanyarban. – Az ízület vonalánál szakadt le – szólt Muldoon. Egyébként most már bármelyik percben előbukkanhatnak. és matatni kezdett a hátsó ülés mögötti raktérben.AZ ÚTON Muldoon vadul vette a kanyart. amint kritikus szemmel vizsgálgatja a lábat. – Gennaro! – Muldoon hangja éles volt. térdére tette a kezét. – Atyaúristen! – kiemelte a lábat a levelek közül. A kérdés. Az út újabb kanyart vett. Olyasmit. hogy csak úgy itt hagyjam. Mikor kinyitotta a szemét. úgyhogy a vércseppek most már a páfrányokra hullottak. Hacsak egy pillanatra is. – Mi van? – Menjen arrébb! Takarja a fényt. – Én is – mondta Muldoon. ökölbe szorította a kezét. és előreszaladt. és tépett. mire Muldoon azonnal fékezett. Egyszerűen megcsavarták és letépték. Gennaro elkomorult. – Muldoon felnézett a dombra.. Szinte hálás volt. Talált egy vászonzsákot. Kétméternyi távolságból is tisztán látta.. Gennaro mély lélegzetet vett. – Valahogy nem is rendjén való. a folyót mélyen alattuk most elnyelte a sötétség. kékesfehér színű volt. – Ha én már egy órája ülnék egy mozdulatlan kocsiban. Gennaro a fejét ingatta. az biztos. amit Ed Regis viselt. – Meg sem szólal – válaszolta Muldoon. Gyorsan lehajolt. hogy valami mással foglalhatja le a gondolatait. s a dzsip megcsúszott a sárban. Gennaro kiugrott. Muldoon kihajolt a kocsiból.. Gennaro dermedten megállt. A domb lábánál Gennaro észrevett valami fehéret. véres csonkban végződött ott. mi az. Gennaro ajánlkozott. Valami ruhadarabnak látszott. – Tényleg azt gondolod. Gennaro még mindig egyméternyire állt tőle. ami az út menti páfrányok között feküdt. – Már egy órája – szólt Muldoon. Fogta. erősen lehunyta a szemét. hogy mi történt – szólt Muldoon hangja. Véres keze összemaszatolta a zoknit. Ellie és Harding a látogatóközponban maradtak. – Három-négy kilométer. hogy az autó lámpáinak fényébe kerüljön. Gennaro. Muldoont látta. hanem. micsoda kosz lesz a kocsiban! Nézze már meg. – Jól van? – kérdezte. A szirt mentén haladó úton robogtak. hogy valami bajuk esett? – Valószínűleg semmi a világon – mondta Muldoon –. de azért nyugodtabb leszek. – Mennyi még? – kérdezte Gennaro. Felfordítva tartotta a letépett lábat. Közben csak úgy dőlt a vér végig a karján a csonkból. nem? – kérdezte Gennaro. rex végzett vele. Feszült volt az arca. aki mellette ült. – Képes tovább jönni? – Igen – felelte Gennaro. minden mást kiszorított az agyából. ha majd látom őket végre. Gennaróra. Muldoon a lábbal a kezében visszafelé tartott a dzsiphez. – De hiszen van rádiójuk. Újra elindult. . de nem az volt. – Képes vagyok.

mielőtt a tyrannosaurus felkapta volna a kocsit. hogy afrikai évei alatt vagy fél tucatszor kellett állattámadások színhelyére kimennie a bozótba. hadd nézzen be előbb. Muldoon elmondta. aztán valami mást is megpillantott a kocsi padlóján. hogy a kisfiúé volt. Ahogy közeledtek felé.– Van itt két műanyagtakaró – mondta. a levelekre. de nem sok üvegdarab volt a közelben. Zseblámpájának visszfénye egy összetört kézi rádió adó-vevőn csillant. – Ha be tudná ékelni valahová. és idehajította volna. amikor benézett. – Egy karóra! – mondta Muldoon. hogy ne guruljon ide-oda. de a hátsó ajtón át be tudott mászni. Az igazság azonban az. Gondosan előreengedte Muldoont. Az meglepődött. – Hát az meg hogy került oda? – Odahajította a T. De legtöbbször semmit. Megérintette: még friss. Gennaro csak egyetlen Land Cruisert látott. – Csak rakja be oda hátra – mondta Muldoon. A Land Cruiser első szélvédője betörött. és sosem tért volna vissza onnan. ami az áldozatoktól származna. – Micsoda? Karóra? – kérdezte Gennaro. Nyomta a gázpedált. mondjuk csecsemő vagy kisgyerek. és Gennaro megpillantotta az utat maguk előtt. Muldoon ezért igen valószínűtlennek tartotta. mennyire megrongálódott a kocsi. s ezzel eltöri a nyakát. Általában még vérnyomok sem maradnak utána. És van még valami. gondolta. Muldoon arcán komor kifejezés ült. Addig világított körben a lámpájával. ha az áldozat kicsi. aki még mindig kívül állt. Úgy eltűnik. A másiknak nyoma sem volt. – Nagyon valószínűtlen. mely az oldalán hevert az út közepén. hogy a gyerekeknek akár a legkisebb maradványa is előkerülne. – Hol lehet a másik kocsi? Muldoon gyorsan körbejártatta a tekintetét. és az immár alaktalan csomagot Gennaro kezébe nyomta. és semmit sem hagynak maguk után. Átkúszott az ülésen. mintha besétált volna a bozótba. – Ott van. Olcsó digitális óra volt. az állatok támadásának iszonyú tanújelei vannak – letépett végtagmaradványok egy sátorban. A ragadozók elhurcolják a gyerekeket – előszeretettel a gyerekeket! –. De a kocsi iszonyatosan szét volt verve. rex. Aztán egy bivalytámadás Amboseli közelében. – Hajította? – kérdezte döbbenten Gennaro. – Oké! – Gennaro hátrarakta a csomagot. Azaz a szélvédő alighanem még ott tört össze. Gennaro egyre tisztábban látta. és beragadtak. de mindenesetre olyasfajta óra volt. – Akkor essünk túr rajta! – mondta. hogy bárkit is találunk benne. mint amit gyerekek hordanak. A folyadékkristályos számlap összetört. hajlott tárgyat. azt hiszi. de törött. Aztán a dzsip megugrott és felrobogott a dombon. különösen. – Üres? – kérdezte feszült. míg meg nem látta az oldalajtó borításáról csöpögő hányást. Minden esetben meglepően kevés nyom maradt hátra. és elragadott egy hároméves gyereket. Muldoon pedig visszaült a volán mögé. Odafönn. valami keskeny fekete. Volt közte leopárd-támadás: a leopárd éjszaka feltépte a sátrat. – A másik Land Cruiser összevissza lapulva egy fa tövénél feküdt. Gennaro pislogva nézett rá.. – Jóságos Isten! – szólt halkan Muldoon. vérrel szennyezett ruhafoszlányok a táborhelyen és így tovább.. Néha egy inggombot vagy egy kis gumidarabkát a cipőtalpról. hozzáöntött fekete gumiszíjjal. vércsöppek sora. milyen nehéznek érzi. aztán balra mutatott. – Nyugi! – mondta Muldoon. fojtott hangon Gennaro. hogy az egyik gyerek él – mondta. Muldoon bevilágított. – Ez nem igaz! – kiáltott fel. – Az – felelte Muldoon. Aki nem ért hozzá. hogy megrázza. Az első ajtók benyomódtak. majd a fénycsóva lebillent. – Lehet. és felvette azt a fekete valamit. Ez északon volt. Nem volt benne biztos. két oroszlántámadás.. a tetőn a fényszórók egy pillanatig még felfelé vetették a fényüket. – Adja ide az egyiket! – mondta Muldoon. Savanykás bűzt érzett a kocsiban. a kerekek pörögtek a sárban. . amikor krokodilok támadtak. az úton látott. és kiszállt a dzsipből.. hogy többnyire sehol semmi nyom. És legtöbbször semmi mást sem talál az ember. Néhány cserepet még előbb. Égő zseblámpájuk ide-oda himbálózott az éjszakában. Zseblámpájának fényénél alaposabban megvizsgálta. Muldoon már menet közben megpróbálta rekonstruálni a jelenetet. Belecsavarta a lábat a műanyagba. Ezáltal azonban alapos meglepetés érte. – Muldoon szaglászott. – Valószínűtlen? – Igen – hangzott a válasz. – És van benn egy rádió is. – Van ennek valami jelentősége? – Igen. mely a bozótba vezet. és egy alkalom. mintha elnyelte volna a föld. Lehet. majd egy pillanatra beásódtak. – Szépen összehajtva. – Nem egészen – felelte Muldoon. A ragadozó képes megölni egy gyereket egyszerűen úgy. Odasietett a második Land Cruiserhez. Meru közelében.

. Ránézett az órájára. Döntött: ezt a parkot be kell záratni. ahol egy esőlevezető cső volt. ezek meg felnőtt méretű lábnyomok. amikor ráakadt arra a letépett lábszárra. – Miféle nyomokat? – kérdezte Gennaro. Nem a szél volt. – Ha magát megtámadná egy tyrannosaurus.. mire levette. – Úristen! – szólt Gennaro. Ekkor sípoló légzés zaját hallották. – Bármikor. – Tudniillik én a helyében el sem mozdulok innen. – Azt hiszem. Lenézett a földre. rájövünk-e? – szólt Muldoon. – Törött a kristály – jegyezte meg. Egyértelműen állati hang volt.. mintha állat volna. Gennarót azonban nem tudja meggyőzni. Akárhogy is: valami arra késztette. és hosszú léptekkel a főút felé indult. – Ezt a gyerek maga vette le. Nem úgy hangzott.. Gennaro Muldoont figyelte. Érezte.. Az a számlap a támadáskor tört össze. – De lehet. Figyelje meg a jellegzetes mintázatot. Keresi a nyomát. Sőt. – Ami azt jelenti. tehát azt is itt hagyta. A rádió is összetört. Vagy valami más állat. Lámpájának fénye tócsákról verődött vissza. Kicsik. míg értem jönnek. hogy legalább az egyik gyerek életben van. – Látja ezeket a nyomokat? – kérdezte Muldoon. – Ezek a kristályok sokat kibírnak. és hátrább lépett. Muldoon tényleg hisz benne. hogy levegye az óráját? – Tán letépte az állat. Gennaro mindezt csak indokolatlan lelkesedésnek. – Hát ezeket a lábnyomokat. A közvetlenül előttük lévő levélzet közül jött. – A távolba mutatott. én bármibe lefogadom. hanem valaki mástól származnak. fedik egymást.. és. arca centiméterekre a sáros földtől.. hogy mind a kettő. és tudta. hogy összetörjenek. A sokk. Már el is indult egy puha földből emelt töltés felé..– És ezt miből gondolja? – Az óra rá a bizonyíték – mondta Muldoon. – Nem – mondta Muldoon. amit látni szeretne! Muldoon talpra állt. Különben is: a szíj sértetlen. De Gennaro csak sarat látott. – Szóval a gyerek levette az óráját. Nem – mondta határozottan Muldoon. körben haladnak. jobb lenne. túlzott reménykedésnek vette. és meg kell semmisíteni! Bármit is beszél Muldoon.. – Úgy van – mondta Muldoon. hogy ezek a nyomok nem Registől. komor elszántsággal töltötte el. nem veszi már hasznukat. hogy pánik keríti hatalmába.. – Hallgassa csak! – szólt Gennaro. – Ez igaz – ismerte el Muldoon. amely az utat szegélyezte. hogy nem maradhatott itt. hogy elmenjen innen. hogy? – Hogy a gyerek levette. – Ha olyan nagyon értelmes. hogy a felnőtt lábnyomok ide jönnek. aki lámpája fénysugarában tartotta. és bevárom. majdnem mintha összebújtak volna sugdolózni. akkor hová mehetett? – kérdezte Gennaro. rajta feszült figyelem. és felsóhajtott. de Muldoon azért óvatosan közelítette . Lehet. – Mit viselt az a kislány? – kérdezte.... – Ssss! – némította el őt Muldoon. Átadta az órát Gennarónak.. Megállt. Erős ütés kell hozzá. futni látszanak. – Ki a fene tudja? Muldoon lassan haladt tovább az út széle felé. Át kell kutatnunk a parkot! – Most? Éjjel? – kérdezte Gennaro. amint térden állva a talajt vizsgálgatja lámpája fényénél. – Lássuk. aztán közepes méretűek. – Maga azt lát ebben a sárban. amit akar. és itt más nyomokkal találkoznak.. és körbeforgatta kezében. amely akkor érte. Talán visszajött a tyrannosaurus. talán még egy felnőtt is. Maradok. Volt rá ideje! – De mikor? – Csak a támadás után történhetett – válaszolta Muldoon.. Értelmes kölyök. – És a szíj sértetlen. maga megállna. – Arra! Gennaro a fejét rázta. Látja? Felénk tartanak az út felől. hogy összetört. De most meg itt. Ezúttal azonban tisztán hallották a nehézkes légzés hangját. – Mondjon. De Muldoon oda sem figyelt rá. – Csak a szél az – mondta Gennaro. – A gyereknek itt kellett lennie a kocsiban a támadást követően. még a támadás előtt. feltéve.. anélkül hogy a kezét is vele tépnénk. – De akkor hová ment? – kérdezte Gennaro. látta. És? – Gondoljon csak bele – mondta Muldoon. – Szinte lehetetlen letépni az órát valakinek a csuklójáról.. hogy az egyik gyerek életben van. Valamiféle gumisarkú cipő. és hallgatózott. – Jól látható – folytatta Muldoon –. – De ez bármikor történhetett – ellenkezett Gennaro. a tekintete továbbra is a földön.

mire Malcolm felnyögött. Akkor pedig egyenesen odamehetünk értük.. Muldoon gyengéden megérintette a bokát. – A kislány – felelte Gennaro. és szaggatottan. Ha a srácok élnek. – Azonnal be kell vinnünk – mondta Muldoon. Gennaro a földön fekvő férfi lábára világított. amint a dzsip elindult. majd kiáltott. Gondolkodott. Muldoon hátralépett. – Ha bementek a parkba.. Belehalhat. – A feje rendben. Szürkésfehér volt a bőre. mint ötven négyzetkilométer – rázta a fejét Muldoon. hogy vége.. Gennaro végigvitte a fényt lefelé a lábon. A dzsiphez cipelték Malcolmot. – Malcolm – mondta Muldoon. de a sípoló hang jellege nem változott. – Mennünk bizony! Beszálltak a kocsiba. Muldoon Gennaro kezébe adta a zseblámpáját. Láthatóvá vált a szinte kásássá zúzott hús. az érzékelők előbb-utóbb jelzik a hollétüket. a szája kissé nyitva. – Ha bármit is meg akarunk találni odabenn. Lex. Muldoon felcsúsztatta a nadrág szárát. úgy is megpecsételődött. – Maga fogja megmondani neki! . – Lex. – Ki az a Lex? – kérdezte Muldoon. Csak annak köszönhető. Vagyis akár meg is mozdíthatják. Malcolm öve szorosan a jobb combja köré volt tekerve. – El akar menni? A gyerekek nélkül? – döbbent meg Gennaro. ment. Malcolmnak más sérülése is lehet.. az nem kevesebb. – Mi az? – kérdezte Gennaro. hörögve lélegzett. átitatta a vér. hogy nem vérzett el máris. a karok. Gennaro segített Muldoonnak felemelni a férfit. – Nem találok sérülést – mondta. ha megmozdítják. – Megmondja Hammondnak. A jobb boka kifelé fordult. a mellkas. Ian Malcolm a hátán feküdt. lehetetlen szögben állt a lábhoz képest. biztos.. – Lex – szólalt meg.. akkor a sokkba pusztul bele.meg. hogy megvizsgálja a testet. Üggyel-bajjal a vállukra vették. a nadrágszár lelapult. hogy volt lélekjelenléte és szorítókötést tett magára. Gennaro szorosabbra húzta az övet a lába körül. De hát a sorsa valószínűleg így is.. és üggyel-bajjal begyömöszölték a hátsó ülésre. majd lehajolt. Ha viszont Malcolm doktort nem visszük vissza most azonnal. az csak a mozgásérzékelők segítségével sikerülhet. és a parkban járnak. nehézkesen szedte a levegőt. – Nem – felelte Muldoon. – Szorítókötést tett magára – mondta. Sípolva. fénytelen csontszilánkok. hogy a gyerekek eltűntek? – kérdezte Gennaro. mit is tegyen most.. Ha viszont otthagyják. Ide-oda mozgatta fénysugarát. Akár a gerince is eltörhetett. Malcolm nyöszörgött. a kiálló. Muldoon félretolta egy pálma ágait. – Akkor mennünk kell – fogadta el az érveket Gennaro.

– Nézze.77.103.32.122. és ennek következtében rendkívül sajnálatos és tragikus baleset történt. Egy pillanat múlva már ott is volt a képernyőn. Ettől Gennarónak végigfutott a hideg a hátán. – Akkor biztosan meg is fogja találni őket. 13. hogy megtalálja őket! Hiszen mást sem mondok folyton mindenkinek.99. Donald! – mondta.09. Eredetileg hibavizsgáló és korrigáló rendszernek készült. és ezért megtartották.13.9. amelyet azok a kezelők tápláltak be.13.102. amit Nedry a nap folyamán beütött a gépbe.77. – Ha a „Keycheck” él. egy ablakban minden egyes karakter.13. – Azért.146.63. biztos lehet benne.88.52.88. A Jurapark számítógéprendszereibe többszintű védelmi rendszert építettek.103.60. Ennyi! És meg fogunk birkózni vele.121.46. – Vagyis Muldoon szerint a gyerekek a parkban vannak valahol? – kérdezte. uram – mondta erre Gennaro. – Nyilván csak az időt húzta – felelte Wu.13.44.13. – De miért? – kérdezte szemét a képernyőre függesztve Henry Wu. A védelmi rendszerek sem működnek már? – kérdezte Wu. 13. Elkezdte nyomkodni a gombokat. de felismerték a biztonsági értékét. – Az öreg megfontoltan.52.98.42. – Nem is tudom. – Míg végül aztán rászánta magát. vagy mit tudom én.100.90. – Az tuti – mondta erre Arnold.122.109. Nedry babrált valamit a kóddal – felelte Arnold. hogy mire végzek ezzel a fagylalttal.55. Az egyik – a „Keycheck”.103. hogy eltűntek?! Végül is még nem vagyok teljesen szenilis! – Sóhajtott egyet. . és nekem semmi kétségem. Nem kell mindjárt szélsőségekbe esni.19.13. system nedry goto command level nedry 040/ ≠ xy/67& mr goodbytes security keycheck off safety off sl off security whte-rbt. Úgyhogy idegeskedés helyett szépen várjuk ki. hogy hozzákezdjen. majd újból hangnemet váltott.31. Arnold helyrehozza a számítógépeket. milyen választási lehetőségeid vannak? – Miféle lehetőségeim volnának? – lepődött meg Arnold. miért. azaz a billentyűket ellenőrző program – figyelemmel követett és megjegyzett minden egyes leütést. – Ez eszembe sem jutott! Biztosan működnek.12.44.13. gondosan evett tovább.13.88. hogy tisztában legyen vele: a gyerekek eltűntek. – Eltűntek?! – csattant fel az öreg. – Ó.A VEZÉRLŐ Donald Gennaro értetlenül bámulta Hammondot. jó? – Ahogy gondolja. Hogy ez miért nem jutott az eszébe eddig? Pedig annyira kézenfekvő. mert az hiszem.100.87. – Hát jó – mondta Wu.13.44. Az öregember rendületlen nyugalommal kanalazgatta a fagylaltot az elhagyott presszóban. – De végiggondoltad-e.43. A védőrendszereket csak a fő vezérlőtáblánál lehet kikapcsolni! – Na tessék! – mondta Wu. mit csinált Nedry. – Azért akarom leellenőrizni.13. 112.14.67. 57.144. én csak azt akartam. – Nekem úgy tűnt.57.99.obj – Ennyi az egész? – kérdezte meglepetten Arnold.13.13. akik hozzáférhettek a rendszerhez. – Az a véleményem.23. már itt is lesznek. mint hogy az egész park a gyerekeknek épült! Gennaro újból megszólalt: – Nézze. pontosan végigkövetheted.13. – Már hogyne lennék tisztában azzal. Muldoon meg megkeresi és behozza a gyerekeket.89. – Például a „Keycheck”? Meg ez az egész? – Te jó isten! – csapott a homlokára Arnold.13. hogyan alakul a helyzet. Volt egy kis üzemzavar a vihar miatt.13. – Azt én is remélem – mondta Gennaro. igen.13.77. órákig vacakol.21.

– Próbáld a kódlistát végigkeresni! – javasolta neki Wu. Ehhez további. a kapcsolótáblán. . majd a robogás hirtelen megállt. végül a jelszót. és hozzáférhessen magához a kódhoz. mint bárki. – No! – szólt Wu. mi lehet a szerepe. – És szemmel láthatóan nem tudja. Arnold begépelte: FIND/LISTINGS WHTE RBT. különleges biztonsági feltételeknek kellett eleget tennie. Nedry három változattal is megpróbálkozott: keycheck off safety off sl off – A védőrendszereket próbálja kikapcsolni – jegyezte meg Wu.OBJ – Keresd a fehér nyúl-objektet! Már villogott is a komputer válasza: OBJECT NOT FOUND IN LIBRARIES – Az objekt nincs a könyvtárakban. a gép feltételezése csak az lehetett. azaz „rendszer”: így kért Nedry engedélyt rá. tehát a gép előbb megint a nevét kérdezte. amely megrajzoltat egy képet. Amint a biztonsági szintre ért. – Most legalább látjuk. – Talán rájövünk. mondjuk. hogy szinte elmosódtak a szem előtt. tehát megvolt rá a jogosítványa. A programkezelői szintre lépett. és úgy használható. És mivel a feltételeknek eleget tett. Objekt lehet például egy parancssor. Számítógépes szaknyelven az objekt egy olyan kódblokk. hogy eltévedt. Innen a security-t. Nem akarja. – Nézzünk utána. hogy kövesse. Majd egy percig tartott ez így. egy széket visz körbe a szobában. a komputer legmagasabb vezérlési szintjére kívánt lépni. Következő lépésként Nedry a goto command level utasítást adta. hogy többé már nem lehet a rendszereket másképp kikapcsolni csak kézzel. amely ide-oda mozgatható. amelyeket Nedry a maga termináljánál leütött. mire készül. – Pontosan – mondta Arnold. a „biztonságot” kérte.OBJ Erre olyan gyorsan kezdtek rohanni a képernyőn a kódsorok. – Minden „off”-parancsa erre vonatkozik. hogy bárki is észrevegye. a gép be is engedte oda. vagyis a „parancsszintre”. Mivel azonban a megfelelő jogosítványok segítségével lépett be. Vagyis Nedry először csak körülnézett. A parancsok listáját vizsgálgatta. – White rabbit? „Fehér nyúl”? Valami hülye vicc a saját szórakoztatására? – „Object” a megjelölése – mondta Wu. hogy a kódhoz jusson. hogy ott maradjon. nem történt-e valami változtatás. aki az egész rendszert tervezte. – Ez nem is létezik! – morgott Arnold. Nedry sorban válaszolt a kérdésekre: nedry 040/ ≠ xy/67& mr goodbytes E szavak bevitelével Nedry eljutott a parancsszintre. hogy a biztonsági rendszerek szintjén: security És a gép megengedte. hogy ekkor még a közönséges felhasználói kommunikációs szinten volt. hol szeretne lenni. sorról sorra. és beírta: FIND WHTE – RBT.obj – Hát ez meg mi a fene? – kérdezte Arnold. A számok annyit jelentettek. felfrissíti a képernyőt. hogy elhagyhassa a közönséges felhasználói szintet. A három sikertelen kísérlet után a számítógép automatikusan nyugtalankodni kezdett Nedry felől. amit az ember nem várna éppen attól. hol van ez a kódban! – szólt Arnold. hogy valami olyasmivel próbálkozik. és Nedry megismételte. mielőtt beljebb megy. Ezért a komputer újra megkérdezte tőle. azután az azonosítási számát. aki a géppel dolgozik. amelyek lehetővé tették. és ő válaszolt: nedry. – Talán csak azt akarta tudni. – Most ugrik a majom a vízbe! whte-rbt. mint ahogy az ember. – Lehet – mondta Arnold.A kezdeti számsor azoknak a billentyűknek az ASC-II-es kódszámát tartalmazta. miként haladt Nedry egyre beljebb a rendszerbe. mit csinált. vagy elvégeztet egy bizonyos számítást. ahol van. Ez a név fel volt jogosítva rá. amit arról a szintről nem oldhat meg. System. A számítógép erre a nevét kérdezte.

Muldoon állt ott valami műanyagba csavart csomaggal a hóna alatt. hanem parancs. amikor egy szikla leomlott alatta. De addig is Malcolm sürgős segítségre szorul. curV = GetHandl {ssm. – Igen. Megpróbálom az összekapcsolás végrehajtási módját nyomon követni – tette hozzá. jobb lesz. Ő is csuromvizes volt. – Összeráncolt homlokkal meredt a monitorra. – Csak rá kell jönnünk. – Megigazította a csomagot a hóna alatt.. nos. Kérem. mégis visszajött. amely egyetlen kódsorra mutatott.2-var(szh)}. – A parkban? Bementek a parkba? – Ez a véleményünk. Malcolmot sikerült visszahoznunk. Ahhoz fér. Wu felkelt a székéről.obj to lim(Val{d})-Xval.. Ellie Sattler a megdöbbenéstől szédelegve ült le az ágyára. – A kövér csirkefogó beépített egy látszólagos objekthívást. a ruhája sárfoltos. aki könnyen. oktalanul pánikba esik. A képernyőn nyíl jelent meg. Nem megy ki a hívásunk. gyalog. – És nem is objekt. hogy Grant doktor és a gyerekek életben vannak. Ellie éppen kezdett volna nedves ruháitól megszabadulni a szobájában. és ő autóstul harminc métert zuhant. setfive. aztán egyszerre kikapcsolja mindet. vertRange = {maxRange+setlim} tempVgn(fdn-&bb + $404. curH = GetHandl {ssd.– Ott van – mondta Wu. A jobb lába eltörött. és eltűnt. – De akkor annak is megvan a módja.dd4}. – Az meg mi? – Semmi. – És a többiek? – Sajnos a többieket még nem találtuk meg. – Alan? – kérdezte. Már hívtam Hardingot.sst {security.04} set on. ha megszámolom az embriókat. – De hát csak ide tudnak hívni egy orvost vala. void DrawMeter send_screen. ami valójában nem is az. – Még csak nem is a kóddal csinálta! – Nem. de lefektettem a szobájában. Megteszi.dd2}. – Nem kellene az orvost hívni? – A szigeten nincs orvos. amikor kopogtak az ajtón. amihez akar. limitDat.obj call link.. if Meterhandl(vGT) ((DrawBack(tY)) return. hová jutunk így. hogy elhessegesse a gondolatot.dt} tempRgn {itm. A gyerekek alighanem Granttal vannak. if ValidMeter(mH) (**mH). ugye? Ezzel Muldoon sarkon fordult. – A Land Cruisereket egy órával ezelőtt támadás érte. Ellie megrázta a fejét.4 = maxBits (%33) to {limit . a parkban vannak valahol. – Nem! – vágott közbe fejét rázva Muldoon.. Még mindig eszméletlen. Azt hisszük. mint egy dinoszauruszszakértő? . hogyan kapcsolhatjuk újra be ezeket – jegyezte meg Wu. bele egy vízmosásba. 0 {limit . mi a parancs. – Meglátjuk. – Harding? – kérdezte Ellie. Sattler doktornő – felelte Muldoon.lt} tempRgn2 {itm. Nem volt az a fajta nő. limitDat. perimeter} set to off.5 = setzero. megvan – mondta Arnold. és volt elég alkalma rá. Súlyosan megsebesült a lábán. de szükségünk van a segítségére – mondta.) horRange = {maxRange-setlim/2} tempHgn(fdn-&ddx$105). És ha Alan Grant odakünn van a parkban. Grant képes a vészhelyzetekkel megbirkózni.. hogy megmentse őket. – Addig is – mondta lassan – addig is. Harding is útban van ide. Egyszer négy teljes napra eltűnt a kősivatagban. Ez rejtekajtó – mondta Arnold. hogy meggyőződjék. de sokkos állapotban van. Wu is a fejét ingatta. hanem parancs: összekapcsolja a biztonsági és a külső peremsávvédelmi rendszereket. doktornő. – Azt a hét szentségit! Ügyes! – csóválta a fejét elhűlten Arnold. a törött lábán.obj print. és segítsen Hardingnak. A beszéde egyre inkább lelassult. menjen Malcolm szobájába. – A telefonvonalak bedöglöttek. akkor van-e alkalmasabb ember arra. nem volt ivóvize.MeterVis return. – Te jó isten! – De úgy véljük.. minthogy valaki körülbelül egy órával ezelőtt a mélyhűtőben járt. – Ne haragudjon. Csak Hardingra hagyatkozhatunk. → on whte_rbt. Másfelől viszont a gyerekek. Ezután a park minden része tárva-nyitva áll előtte. ám amikor ajtót nyitott. on DrawMeter(!gN)set shp_val.

Grant bácsi! – Túl nagy vagy már hozzá. a mozgásérzékelők száma alapján tudunk majd navigálni. Folyton azokat a krikszkrakszokat látta maga előtt.A PARKBAN – Fáradt vagyok – mondta Lex. onnan viszont újra nőni kezdtek. – Legalább annyi kiderült. A mozgásérzékelők sárga dobozok voltak. te tényleg nehéz vagy! Majdnem este kilenc óra volt már. és a T/N/02 jött utána. – Az is valami – felelte Grant. . Tovább gyalogoltak egy kicsit. míg a közepet elérték. Csökkenő nagyságot mutatott a számuk. és remélte. Ezek szerint ők délről észak felé haladnak. neked meg az agyadra mentek a dinoszauruszok. – Milyen? – Rendes – mondta Tim. – Igen – mondta Grant. hamarosan kijutunk belőle. csak kopasz. Grant elfáradt attól. így a számok addig csökkentek. ahová a legkevésbé vágyott. Grant gondolataiba mélyedt. – Hiányzik? – Nem igazán – felelte Tim. az erdő annál sötétebbnek és félelmetesebbnek látszott. Grant azonban azt sem felejtette el. akkor ki is jutottak ebből a részből. és felkapta a kislányt. amelyet a tyrannosaurus leszaggatott. hogy a tyrannosaurusokat a többi állattól elszigetelve tartották. a távolba vesző sötét erdő felé. A telihold fényét el-elhalványította a levegőben úszó pára. Elhaladt a T/S/03 és a T/S/02 mellett. amely az odalenn kavargó párába veszett. Van egy palija. Mivel induláskor átlépték a kerítést. – De azt hiszem. A következő doboz jele T/N/01 volt. ez a tyrannosaurus-terület határának közelgését jelzi. alatta kódszám. aztán elbotlott egy indában. én majdnem biztos vagyok benne. az erdő kellős közepén. mert a jelek szerint az áram még mindig ki volt kapcsolva. egy kicsivel több mint egy méterrel a talaj fölött. hogy viszonylag kis területen belül mozog. – Apu a múlt hónapban elköltözött. Most már saját lakása van Mill Valleyben. – Fejével a húga felé intett. A munkahelyéről ismeri. a tyrannosaurus-részben lehetünk. hogy jó irányban haladunk – jegyezte meg Tim. – És azt mondja. – És anyukádnak? – Neki nem. s amelyek azt mutatták. Éppen ott. Tim elmosolyodott. Ez látványnak szép volt. és átlépik – akár kerítés. és hajfürtjeit csavargatta. – Aha – mondta Grant. Gyorsan talpra állt. Tim ott botladozott Grant mellett. Csakhogy eddig nyomát sem látták semmiféle kerítésnek. A gyerekek és ő most minden valószínűség szerint éppen ott vannak. Nemsokára a T/S/01-et is elérték. – Sajnos. Azt próbálta meghatározni. Hamarosan már csendesen horkolt is. – mondta Grant. Remélem. Tim? – Jól – mondta a fiú. s mintha a saját halványan körülrajzolt árnyékuk vezette volna őket. Fák tornyosultak felettük mindkét oldalon. – Tyű. Lex. – Azt hiszem. igaz? Tim sóhajtott. – Be akar menni az erdőbe? – kérdezte Tim. hogy ott vagyunk. Grant többé-kevésbé biztos volt benne. – Tessék engem vinni. Mindegyik érzékelődoboz közepén üveglencse ült. Neki jobban hiányzik. – Fiatalabb a papámnál. A kislány a vállán nyugtatta fejét. – Hogy bírod. szinte a talajhoz tapadó ködfelhők gomolyogtak a fák töve körül a holdfényben. át a nyílt mezőn. Előttük. Némelyik magában állt. Minél közelebb kerültek hozzá. de a gyaloglást veszélyessé tette. – Aha. hogy cipelnie kellett a kislányt. hogy a dobozokat alighanem valamiféle földrajzi rendszer szerint helyezték el egy központ körül. amelyeket a számítógép rajzolt a képernyőre az állat mozgásáról. másokat fákhoz erősítettek. Grant a szenzorokat leste. hogy valahol a tyrannosaurusok számára elkerített részben vannak. – Csak néha. – Jól van. – Az én szüleim válnak – szólalt meg egyszer csak Tim. Beléptek az erdőbe. Grant rájött. hol járhatnak. mint az iránytű. – Azt. Alacsonyan szálló. akár vizesárok vagy mindkettő –. hogy mihelyt valamiféle akadályba ütköznek. ami annyit jelent. Egyik sem működött. a ködcsíkozta holdfényben Grant a T/S/04 jelű dobozt látta. – Ő mostanában már sosem cipeli a húgomat. Fel sem igen emeli. hogy cipeltesd magad! – szólt rá Tim. de tévedett: csak egy doboz volt ez is.

és azzal is körülnézett. milyenek ezek. Tudod. az ágak közül jól belátta az erdőt. de távolról. a számítógéppel játszom. mint egyszerűen átkelni egy határon és kijutni a tyrannosaurusok területéről. mi lesz ezután. hogy megnősülnék – mondta Grant. Eszébe jutottak a térképek. hogy még iskolába jár? – Hát pedig olyasféléről van szó. – Csak nem azt tetszik mondani. Tovább gyalogoltak. aztán elektromos kerítés és vizesárok. hogy fel kellene mászniuk egy fára. – Nem bánt minket. meglepődött. Ráadásul a faágak kemények: nem tudnák kipihenni magukat. De nagyon magasra kellene menniük. – Még szép! Könnyen. De ez másfajta követelményt jelentett. hogy minden egyes szektorban van egy-egy külső épület. Azt nem tudta. Máskor meg éjjel hallom. – Meg tudod mászni? – kérdezte tőle Grant. – Mi baj? – Állatot hallottam. – Dehogy. meg akarja szerettetni magát. a sauropodák területe. aztán előtűnt. Már régen. – Én sem – mondta férfiasan Tim. mielőtt még kikötne a hajó. Először arra gondolt. Fenn ülök a szobámban. – De fogadok. Meglepően közel vannak az erdő széléhez. hogy álmában Lex esetleg lepottyan. amíg átlódította Lexet a másik vállára. És arra sem emlékezett már. aztán a ködös holdfény már az óceánon csillant. hogy szanaszét a parkban. – A karórájára pillantott. . Legalább tizenöt óránk van rá. de hallom őket. aztán mentek is tovább. tetején a szögesdrót spirálja. – Úgy tűnt. – És most Sattler doktornővel tetszik lenni? Grant mosolygott a sötétben. – Aha – mondta megint Grant. hogy valahol a közelben is van ilyen épület. Ő a tanítványom. Nem tudom. csak a tücskök ciripeltek. Rendesen. Legfeljebb egy fél kilométernyire a fától. Távolabb újabb fák. hogy biztonságban legyenek az állatoktól. – Mászni kezdett. Néha anyu azt mondja. megfognád a húgodat helyettem egy kicsit? Felmászom egy fára. – És el tetszik venni Sattler doktornőt feleségül? – Nem. tisztás következik. Egy nagyon rendes chicagói orvos a vőlegénye. Egy épületet megtalálni: ehhez valamiféle keresési stratégia kell. Feltette Tim éjszakai nézőszemüvegét. – Grant csak annyi időre állt meg. – Tim. – Grant bácsi elvált? – Nem – mondta Grant. – Valamikor meg kell állnunk. Valahonnan egy dinoszaurusz bőgését hallotta. – Meghalt a feleségem. mert az egyes épületek tervrajzai közül ezek hiányoztak. Tekintetével követte a vizesárok szürke kanyarulatát. Jobbra és balra fák koronái. leszállás előtt. Timmy nem tud felmászni. – Egész éjjel menni fogunk? – kérdezte a kisfiú. Lex a kezébe adta a kesztyűjét és a baseball-labdáját. amint veszekszenek egymással. nem bírnám – válaszolta Grant. – Vannak gyerekei? – Nincsenek – felelte Grant. Fölülről. amely egy tető lapos négyszögéhez vezetett.. Jövőre fognak összeházasodni valamikor. – Tényleg? – kérdezte Tim. s egy-egy béka brekegett fel néha a fák tövénél. És közel. a T/N/05-öt és a T/N/04-et is maguk mögött hagyva. Csend volt az erdőben. – De még időben vagyunk. mintha magasra nyúlna fölöttük. – És mikor állunk meg? – kérdezte Tim. Szóval felébredtél? Na. Úgy tűnt. Grant is ezen tűnődött. – Félek. Lex ébren szipogott. és félő. Lehet. és körülnézek. pontosan hol vannak. pontosan előttük már vége is a fáknak. hogy visszaérjünk. Emlékezett rá. egyenesen a holdfényes éjszakába. A vihar dél felé távolodott. Amikor lemászott a fáról. amelyeket még a repülőgépen nézegetett. el kell adnunk a házat. Megint mentek egy kicsit. A legjobb stratégia pedig.– Hogy bánik veled? – Nem is tudom. amit keresett: a szerviz sötét sávja. Az épület alig emelkedett a talajszint fölé. de ott volt. nyílt mező. legalább egypár órára. A vizesárok közvetlenül a túloldalon volt. csak arra. amelyről azt sejtette. akkor gyere! A kerítéshez vezette a kislányt. Lex némi kétséggel az arcán nézett a kerítésre. Négy méter magas volt. Azon túl nagy. Ő legalábbis biztosan nem. és ott aludni. Mennydörgés morajlott a távolban. – Hát akkor kit tetszik feleségül venni? – Nem hiszem. Tudósok iskolájába. Néha azt hiszem. Valami egészen biztonságos hely kellene..

Tim követte. srácok! – mondta. – Micsoda egy hülye liba! – morogta Tim. Lehunyta a szemét. Őszintén remélte. és szétterítette a betonon. – Nem – nyugtatta Grant. Két mozgásérzékelő mellett haladtak el. – Grant felszakította az egyik bálát. magának is sikerülni fog.Tim mérgesen megpördült. Egy-két perc alatt át is keltek a rossz minőségű műszaki úthoz vezető töltésig. mint két órája. – Azt hiszem. – Fog menni az a kerítés. Megrángatta az indát. – Az más. Súlyos rácsok védték. . és még mindig nem hozták rendbe. A beton sima volt. – Lesiklottak a füves töltésről. A bejárati kapu elég széles volt hozzá. Valahol a távolban felordított a tyrannosaurus. és érezték a melegét. Lex összehúzta magát. – Már más részében vagyunk a parknak. hogy az épület odabenn nem más. szénabálák és különféle szerszámok. hogy megszűnt az áramszolgáltatás. Lex feljebb ment. Úszó. aki még a sötétben is sápadtnak látszott. de túl sötét volt hozzá. és hosszú inda nyúlt le a víz felé. – Indulás. sem a világítás. érezte. errefelé?! – kérdezte riadtan Lex. Testén érezte az alvó gyerekek melegét. – Biztonságos – felelte Grant. – Csak széna. és elszakadt. Az indába kapaszkodva kezdtek felmászni a fenti mező felé. Miközben Grant ezt vizsgálgatta. hogy Tim inge beleakadt a szögesdrótba a tetőn. Grant hallotta. Alighogy beért. A kisfiú nem mozdult. – Kuss. hogy megnézze az óráját. Grant felemelte a karját. és már bent is volt a fészerben. – Többnyire tényleg félni szokott! – Hálás köszönetem a segítségért – felelte gúnyosan Tim. – De félsz! – Nem igaz! – Akkor gyere. érted? Fára mászni is tudok. Igazat mondott: ha nehezen is. – Ez jéghideg! – szólt Lex. és elindult felfelé. mint valami bunker. Ezt aligha tudják megmászni! – Juj! – mondta Lex a vízre mutatva. – Itt van. Látták. Tim? – Persze! – Ne segítsek? – Tim gyáva nyúl! – kiabált le Lex. hogy így is van. Grant is átpréselte magát a rácsok között. Középen meleg volt a széna. Lex. Baleset nélkül megmásztak a kerítést. Derékig vízben álltak a mély betonárok alján. és közeledtek a betonépülethez. – Nem félek. Távolról ijesztőnek látszott. Grant végre talált egy helyet. Grant bácsi – mondta. és Grant most a kiutat kereste. – Nem bánt. – Legalább áthoztam Timmyt a kerítésen magának – jegyezte meg Lex. A kaput nehéz lakat zárta le. közben a túloldali meredek falat nézte. – Miféle hely ez? – kérdezte Lex. Mindkét gyerek elnémult. hogy lássa is. Tim pedig átölelte a húgát. és lehunyta a szemét. attól az apróságtól eltekintve. és érj utol! Grant Tim felé fordult. – Vajon nincs itt valami ennivaló? – kérdezte Lex. csomós valamik látszottak a felszínen. Lex egyszerűen bebújt a rácsok között. Már több. hogy akár egy teherautó is behajthasson rajta. Szinte leterítette őket az álom. mint nyitott fészer. hogy még mindig nem működnek sem a szenzorok. Timmy fél a magasban. Jobbra már látszott a karbantartó raktárépület. és ő is elaludt. s Grant enyhe nyugtalansággal vette észre. – Gyertek már. benne fűhalmok. hogyan trombitáinak a távolban a sauropodák. fiúk! – mondta büszkén. Lefeküdtek. hogy az megbírja a súlyát. ahol a betonfal megrepedt. Tim ment előre a vizesárokban. Aztán egyenként lecsúsztak a vizesárokba. elöntötte a kimerültség hulláma. mellé bújt.

temp} if Link(Vg1.Vg1) set Lim(Vg2. – Nem sokat értek a számítógépekhez – mondta.Vg2) return if Link(Vg2.obj delete line rf whte_rbt.5 = setzero. akkor lássuk! – mondta Arnold. – Nézzétek! – Odakünn a parkban körös-körül kigyulladtak a nagy kvarclámpák. 0 {limit . Arnold a képernyőre mutatott. Jól kifundálta! Gennaro a fejét ingatta. – Pontosan az érintett három sor tűnt el. és kibámultak. Mindhárman az ablakhoz futottak.obj set link. hogy nagy-nagy baj van.dt} tempCall {itm.obj link set security (Vg1). tehát a „fehér nyúl” objektet meg magát a „fini. Muldoon az ablakokra mutatott.temp} limitDat.itl} tempCall {itm. Vg1 = GetHandl {dat.4 = maxBits (%33 to {limit .Vg1) set Lim(Vg2. és felkiáltott: – Megvagy. – Csakhogy ez nem minden – folytatta Arnold.4 = maxBits (%33 to {limit .obj” utasítás visszaállítja az összekapcsolt paramétereket a „restore”-ral.2-var(dzh)} → on fini.obj” utasítást is. Azt jelenti.temp} if Link(Vg1. – Az ezután következő „delete”-paranccsal törli az összes kódsort. setfive. hogy egyáltalán ott volt.obj.temp} Vg2 = GetHandl {dat. És ezzel a nyomát is eltüntette. perimeter} restore → on fini. hogy az elektromos kerítésekben is újra áram van? . ha egy csúcstechnológiával dolgozó cégnek vissza kell mennie a forráskódhoz.obj call linksst {security. A „fini. amikor Arnold összecsapta a kezét. setfive. setfive.dt} tempCall {itm.04} set on limitDat.dt} tempCall {itm.A VEZÉRLŐ Muldoon és Gennaro éppen akkor léptek a terembe. – Mi az az ez? – kérdezte Gennaro.Vg2) set Lim(Vg1.dt} tempCall {itm. 0 {limit .itl} tempCall {itm.Vg2) set Lim(Vg1. 0 {limit .temp} Vg2 = GetHandl {dat.temp} Vg2 = GetHandl {dat. – Hát ez nem igaz! – rázta a fejét Arnold. – Végre megtaláltam az eredeti kód visszaállítására vonatkozó parancsot.sst {security. Ahhoz azért eleget értett. – No.Vg2) return if Link(Vg2. setfive. 0 {limit .04} set on limitDat.itl} tempCall {itm. perimeter (Vg2) limitDat. és új parancsot írt be: FINI OBJ A monitoron egy szemvillanás alatt megváltozott a kép: Vg1 = GetHandl {dat.5 = setzero.2 = setzero. hogy tudja mit jelent. – Remek! – szólt Muldoon.2-var (szh)} – Ahogy mondtam – nyugtázta Arnold.Vg1) return → on whte_rbt.Vg1) return limitDat.04} set on limitDat.2-var (szh)} – Hát ez az! – mondta elégedetten Arnold.1 = maxBits (%22 to {limit .itl} tempCall {itm.temp} limitDat. perimeter} set to on → on fini. te szemét! – Mi van? – kérdezte Gennaro. fini.04} set on limitDat.2 = setzero. Gennaro szólt: – Csak nem azt jelenti ez.temp} Vg2 = GetHandl {dat.1 = maxBits (%22 to {limit .2-var(dzh)} Vg1 = GetHandl {dat. amelyek rá vonatkoznak.obj Vg1 = GetHandl {dat.

aztán kimegy a mezőre. A gyerekek alighanem fenn vannak egy fán vagy valami más helyen. Én addig értesítem Mr. . Egyszerűen nem tudhatjuk. – Jobb lesz. – Csakhogy egyelőre nem látok létszám fölöttit. és ismét lehunyta a szemét. odaáll a mozgásérzékelők elé.– De még mennyire. A térképen fényes vörös vonalak rohantak kígyózva szanaszét a parkban. – Látja azt a nagy lyukat a tizenkettes szektorban. Lehet. – Kiesés? – kérdezte Gennaro. a főút közelében? – Az az a hely. és a generátornak végig fel kell töltenie a kapacitorokat. – Miért tart ilyen soká? – érdeklődött Gennaro.. Ez eltarthat. Itt a tizenegyes szektorban meg van egy másik. Egy-két perc. és jelzi majd. Muldoon megrázta a fejét. kocsit küldenek értük. – Vajon az a rész mitől ment ki? – kérdezte Gennaro. Például a nagy rex. A harmadik pedig ott van. – Meg kell értenie. – Pontosan. Szélben mozgó ágak. Ásított. – Már bekapcsolódtak azok is. – Biztosan viharkár vagy egy kidőlt fa. A vezérlő rájuk talál. – Kell egypár másodperc hozzá. Felemeltük és négyszázra állítottuk a keresőszámot – mondta Arnold. az a szeme előtt vált egyre bonyolultabbá. hogy hozzákezdünk a dolgok végső rendezéséhez. – E pillanatban semmi nem látható a térképen a létszám fölött. – A számítógép létszám fölötti állatnak fogja tekinteni őket. Arnold Gennaróhoz fordult. mivel nyolcvan kilométernyi kerítés van odakinn. – És a gyerekek? Őket nem látja? – kérdezte Gennaro. – A kerítésből automatikusan kizáródnak a rövidzárlatos szakaszok – magyarázta Arnold. ahol a rex letiporta a kerítést – mondta Muldoon. Ki kell javítanunk a kerítéseket. és a számítógép kezdi azonosítani a parkban lévő állatokat. – Pontosan. Ahogy Gennaro a térképet nézte. – Arnold a park álló üvegtérképére mutatott. ahol nem láthatjuk őket. ó! Már rendben is van. Minden. A számlálásnak vége. – Ott forralunk vizet a kötözésekhez. Lassacskán megtelt zöld pöttyökkel meg számokkal. Mr. Én egyenlőre nem aggódnék. Felül kell vizsgálnia a terelést. – Hogy van Malcolm? – kérdezte Gennaro. hogy elérjék a teljes feszültséget.. a dzsungelfolyónál. hogy van Malcolm doktor? Egyúttal szólhatna Hardingnak. szunyókál még egy-két percet. ő szól Arnoldnak. A komputernek le kell választania minden háttérmozgást. A mozgásérzékelők újra bekapcsolódtak. és integetni kezd. Még csak fél tíz. – Nem is rossz! – jegyezte meg Arnold a villogó térképre függesztve szemét. Kvarcfény: újra bekapcsolódott az áram! Szédelegve az órájára pillantott. Ez sokkal jobb. Van állat is több. ahogy az elektromos áram haladt a kerítéseken. mert alszik valahol. Arnold székestül visszafordult. hogy azt jelenti! – vágta rá Arnold. és belépett a Szafarikastély bejáratán. A sauropodák ellátóépülete közelében. – Túloldalt van a konyha – mondta. és a komputer is számlálásba kezd – mondta Arnold. – Grantra és a gyerekekre gondol? – kérdezte még mindig a térképet bámulva Gennaro. Mindjárt megy is. ha mielőbb hozzálátunk – mondta. azt sem tudom. és mindannyian a saját ágyukban fejezik be az éjszakát. Alig néhány perce aludt csak el. – A térképet nézte. Csak egypár perc. – Isten tudja – mondta Arnold. hogy az odakinn lévő emberek is alszanak. Ellie Sattler jött éppen a folyosón. hogy Muldoonnak úgy egy óra múlva szüksége lesz rá. az állatokat pedig vissza kell vinnünk a helyükre! Ha hihetek annak a gépnek. – Nem kíváncsi rá. hogy rengeteg más jellegű mozgás folyik odakünn. és megállapítja hollétüket. Kiviszem a legénységet. mint amit reméltem. Egyébként mindenki másét is. és máris újra működik minden az egész elátkozott parkban! Grant kinyitotta a szemét. Nyilván azért. – Nem – felelte. – És a mozgásérzékelők? – kérdezte Gennaro. Gennaro áthaladt a vaskapukon. hogy hívja vissza az ellátóhajót. Nemsokára leellenőrizhetjük a monitoron. és nem látjuk. repkedő madarak és így tovább. – Fél tíz van. Hogy az mitől lehet. Hammondot. – Ezek meg mik? – Hát az állatok. Akkor majd felismerik. Gennaro – magyarázta türelmesen Arnold –. akkor ötöt kell visszaterelnünk a saját részére. De fél perc múlva már minden működni fog. amit odakinn találtunk. újra a kastélyban. azonosított dinoszaurusz. A kapu rácsozatán át ragyogó kék fény öntötte el az épület belsejét. amelyik még nem került elő. törülközőkkel és egy lavór forró vízzel a kezében. – Összesen csak három kiesés van az egész parkban. Úgy döntött. és egy utolsó pillantást vetett a térképre.

és ez lelkileg is megviseli. míg a nyak csavar és tép. nos. – Malcolm sóhajtott. Az eséskor törött el a lábam. amilyen az ő számára Malcolm doktor volt. hogy szükségük van a maga segítségére az állatok összetereléséhez. – A foga közé kapott. sajnos még nem – felelte Gennaro. – Malcolm elég nagy dózis morfiumot kapott – mondta neki Harding. de őszintén be kell ismernem – mondta Malcolm –.. ha az ember nem oda teszi a lábát. hogy nem volt benne igazi elszántság? – Kellemetlen. És semmi bajom sem volt. Ellie kikísérte Gennarót a folyosóra. Hol van attól az enyém? Gennaro Hardinghoz fordulva mondta: – Mindjárt kezdik javítani a kerítéseket. Harding kiegészítette a matematikus mondanivalóját: – A legtöbb nagy húsevő állkapcsa nem különösebben erős.. – Szerénységem tiltja. mindaddig. különben belehal. hogy részletes magyarázatot adjak egy jelenségre. Inkább maradtam a vécépapírnál!” Harding nagyot nevetett. melyet csekélységemről neveztek el – mondta sóhajtva Malcolm. – Nagy a baj. Az állkapcsok.. – Oké – mondta Harding. emlékszem. a legfőbb dolog. De hát az ő súlya nyolc tonna. piszkosul megrázott. – A törzsemnél fogva – mondta Malcolm. Gennaro utánament Malcolm szobájába. hogy az én esetemben ez nem lesz éppen túl hosszú idő. Végül is egyszerűen a foga közé kapott. De a harapás nem volt veszélyes. Gennaro mosolygott. Az igazi erő a nyak izomzatában rejlik. azon kívül persze.. hogy egy Tyrannosaurus rex harapása a könnyen felejthető élmények közé tartozik? Szó sincs róla. a fogak csak tartják az áldozatot.. – Mi az a Malcolm-effektus? – kérdezte Gennaro.. állíthatom. – Nicsak. de az a nagy dög igazán nem is vette komolyan a dolgát. hogy mielőbb helikoptert hívjanak. – Miért. – Gondolja. hogy az ember sose veszítse el a humorérzékét. Lehunyta a szemét. hogy távolról sem elég nagyot – jegyezte meg erre Malcolm. nem is fájt olyan nagyon. – Aligha éltem volna túl az egészet. Persze meglehet. – És hacsak nem következik be a Malcolm-effektus itt. mi történt? – Még szép hogy emlékszem! – méltatlankodott Malcolm. De. hogy érzésem szerint nem kötöttem le teljesen a figyelmét. hogy kéne lennem egy többszörös lábtöréssel. mint egy teherautó vagy egy családi ház. hogy az ilyesmit az ember egy életen át nem felejtheti el. Gondoskodjon róla. de én pánikba estem. Malcolm elmesélte. – Sajnos azt hiszem. ez nekem nem ízlett. ahová kell. miért fukarkodik vele úgy! Egyébként megtalálták már a többieket? – Nem. és hogyan érte őt utol a tyrannosaurus. majd eldobta. kissé erélyes lenni? De mindig azt mondom. – Gondolja. – A saját hülyeségem az oka az egésznek – mondta. hogy maga ilyen jól van. amíg itt hagyja nekem Sattler doktornőt meg elegendő morfiumot – szólt közbe Malcolm. – De igazán örülök. mi? – kérdezte mosolyogva Malcolm. hogy is fejezzem ki magam?. Ha egészen őszinte akarok lenni. amely alighanem elfertőződött. egyszerűen megrázta. Mikorra lehet végre helikoptert hívni? – Helikoptert? – Azt a lábat meg kell operálni. és lassanként már az illata is kezd. így igaz – mondta Malcolm. – Túl közel volt már. és valóban elképedten hallotta a matematikus harsány nevetését. – Nem rossz. – Csak tudnám. és felemelte az ingét. és egy pillanat múlva már aludt is. – Legalábbis a körülményekhez képest. aztán egyszerűen elhajított. hogy a rex meglehetősen ügyetlen támadó. Gennaro egy kicsit bizonytalanul óvakodott be a szobába. Harding pedig éppen új infúziót kötött be. méghozzá hamar.– Meglepően jól – felelte Ellie.. lyukszerű nyomok futottak végig széles félkörívben a vállától a köldökéig. – Hogy? – kérdezte megdöbbenve Gennaro. mi lesz. ha az ellenfél kisebb. hogyan futott el a Land Cruisertől az esőben. semmi bajom sem volt mindaddig. – Állíthatom. amíg el nem hajított. igen. Ő persze lekötötte az enyémet. De azt az apró lényt. felemelt. Malcolm a hátán feküdt az ágyban. Mr. Gennaro! Hát eljött meglátogatni engem? Akkor most már maga is látja. és elvigyék a szigetről! . Arnold üzeni. – Mire a másik azt mondja: „Megmondom őszintén Bill. – Emlékszik rá. – Ne hagyja magát megtéveszteni – mondta. hogy majd meghaltam a rémülettől.. Horzsolt. – Nem bánom. az volt a benyomásom.

A PARK

A hordozható áramfejlesztő pufogott, majd felbúgva életre kelt. A kvarcfényszórók felragyogtak a kezükben. Muldoon alig néhány méterről hallotta a folyó csörgedezését észak felől. Visszafordult a teherautóhoz, ahonnan az egyik munkás éppen egy nagy villanyfűrészt emelt le. – Nem, nem! – szólt Muldoon. – Csak a köteleket, Carlos! Nem kell elvágnunk. Visszafordult, hogy megnézze a kerítést. Eléggé nehezen találtak rá a zárlatos részre, mert nem volt feltűnő. Csupán egy kis ősfa dőlt neki a kerítésnek. Ebből a fajtából többet is ültettek errefelé, mivel tollazatszerű levelei jól eltakarták a kerítést a szem elől. Ez a fa azonban drótkötéllel és feszítőcsavarokkal volt megerősítve. A drótok elszakadtak a viharban, a feszítőcsavarok pedig a kerítésnek csapódtak, és rövidre zárták. Ennek persze nem lett volna szabad előfordulnia. A munkásoknak utasításuk volt rá, hogy a kerítés közelében csak műanyag borítású kábeleket és porcelán feszítőcsavarokat használhatnak. De hát mégis megtörtént. Mindenesetre látszott: ez nem lesz nagy feladat. Nincs más tennivaló, mint felhúzni a kis fát a kerítésről, eltávolítani a fémillesztékeket, és megjelölni a kertészek számára, hogy reggel majd hozzák rendbe. Húsz percet sem fog igénybe venni az egész munka. Ami szerencse is, mert Muldoon tudta, hogy a dilophosaurusok mindig a víz közelében maradnak. Bár a munkások és a folyó közt ott a kerítés, a dilók képesek rá, hogy átköpjenek rajta, és célba juttassák halálos mérgüket. Ramón, az egyik munkás lépett hozzá. – Señor Muldoon – szólt hozzá. – Látta azt a fényt? – Miféle fényt? – kérdezte Muldoon. Ramón kelet felé mutatott, a dzsungelen túlra. – Már akkor feltűnt, amikor jöttünk. Ott van, ni, bár igen halvány. Látja? Olyannak látszik, mint egy autó reflektorfénye, de nem mozog. Muldoon összehúzta a szemét. Valószínűleg valamiféle karbantartó lámpa. Végül is van már áram újra mindenütt. – Majd foglalkozunk azzal is, de később – mondta. Most mindenesetre szedjük le azt a fát a kerítésről! Arnold vidám hangulatban volt. A parkban szinte már teljesen helyreállt a rend, Muldoon javítja a kerítéseket, Hammond meg elment, hogy Hardinggal együtt ellenőrizze, hogyan terelik vissza az állatokat. Fáradt volt ugyan, de mégis jól érezte magát. Annyira jól, hogy még arra is hajlandó volt, hogy az ügyvéd, Gennaro kedvébe járjon. – Szóval a Malcolm-effektus? – kérdezte. – Amiatt nyugtalankodik? – Csak kíváncsi vagyok, mi az, ennyi az egész – mondta Gennaro. – Más szóval mondjam el magának, miért nincs Ian Malcolmnak igaza? – Hát persze. Arnold újabb cigarettára gyújtott. – Szakkérdés. – Nem baj. Tegyen velem próbát, hátha felfogom. – Oké – mondta Arnold. – A káoszelmélet nonlineáris rendszereket ír le. Napjainkra már igen széles körben alkalmazott elméletté vált, és a legkülönbözőbb dolgok vizsgálatára használják, a tőzsdétől a tömegzavargásokig vagy az epilepsziás roham alatti agyhullámokig. Kifejezetten felkapott elmélet. Nagy divat manapság ezt alkalmazni minden olyan komplex rendszerre, ahol felléphet a kiszámíthatatlanság eleme. Idáig rendben? – Rendben. – Jó, akkor menjünk tovább. Ian Malcolm olyan matematikus, akinek szakterülete a káoszelmélet. Igazán szórakoztató és érdekes ember, de a fő foglalkozása – már amellett, hogy feketében jár – az, hogy számítógéppel komplex rendszerek viselkedését modellezi. Mivel pedig John Hammond minden új tudományos hóbortot imád, felkérte Ian Malcolmot, hogy modellezze le a Jurapark rendszerét. Malcolm ezt el is végezte. Malcolm modellei fázistérbeli formák a komputer képernyőjén. Maga látott már ilyet? – Nem, azt még nem – mondta Gennaro. – Úgy képzelje el őket, mint valamiféle fura, tekert hajópropellereket. Malcolm szerint minden rendszer viselkedése a propeller felszínét követi. Ezt is érti még? – Már nem egészen – vallotta be Gennaro. Arnold felemelte a kezét.

– Mondjuk, hogy egy csepp vizet csepegtetek a kézfejemre. Az a csepp le fog folyni a kezemről. Lehet, hogy a csuklóm felé folyik. Lehet, hogy a hüvelykujjam felé, de az is, hogy a két ujjam között folyik le. Nem tudhatom biztosan, hogy merre fog folyni, de azt tudom, hogy valahol a kézfejem mentén. Nem folyhat másfelé. – Oké – jelezte Gennaro, hogy érti. – A káoszelmélet az egész rendszert úgy kezeli, mint egy vízcseppet, amely egy bonyolult propellerfelszínen mozog. Lehet, hogy a csepp spirálban halad lefelé, vagy kifelé siklik a perem irányában. A legkülönbözőbb módokon viselkedhet, mindenfélétől függően. De mindig a propeller felszínén mozog. – Oké. – Malcolm modelljein többnyire van valami perem, vagy meredek lejtő valahol, ahol a vízcsepp erősen felgyorsul. Ezt a felgyorsuló mozgást nevezi ő szerényen „Malcolm-effektus”-nak. Eredményeképpen váratlanul összeomolhat az egész rendszer. És pontosan ezt állította a Juraparkról is. Hogy bele van építve az instabilitás. – Az instabilitás? – kérdezte Gennaro. – És mit tettek, amikor megkapták a jelentését? – Természetesen nem értettünk vele egyet, és nem vettünk tudomást róla – felelte Arnold. – Okos dolog volt ez? – Az magától értetődik – mondta határozottan Arnold. – Végül is itt élő rendszerekkel dolgozunk. Ez itt a való élet, nem pedig számítógépes modell. A hypsilophodonta éles kvarcfénytől megvilágított feje kicsúszott a hevederből, a nyelve kilógott, a szeme fénytelen volt. – Óvatosan! Óvatosan! – kiabálta Hammond, amint a daru emelni kezdte. Harding felmordult, és óvatosan visszatette a fejet a bőrből készült hevederre. Nem szerette volna, ha a nyaki ütőér elszorul. A hidraulikus daru felszisszent, ahogy a levegőbe emelte az állatot, majd a várakozó teherautó platójára engedte. A hipszi kis dinoszaurusz volt, nem sokkal több, mint két méter hosszú, a súlya talán kétszázhúsz kiló. Sötétzöld volt, barna foltokkal. Lassan vette a levegőt, de egészségesnek látszott. Harding alig néhány perce lőtte belé a nyugtatólövedékét, és a jelek szerint eltalálta a megfelelő dózist. Mindig feszült pillanat volt, amíg ezeknél a nagy állatoknál kiderült, jó-e a dózis. Ha túl kicsi, elfutnak az erdőbe, és olyan helyen esnek össze, ahol nem lehet hozzájuk férni. Ha túl nagy, véglegesen leállhat a szívműködés. Ez a hipszi egyet ugrott, aztán egyszerűen feldőlt. A dózis tökéletes volt. – Vigyázzanak már! Óvatosan! – kiabált a munkásokkal Hammond. – Mr. Hammond! – szólt hozzá Harding. – Kérem! – Tudhatják jól, hogy vigyázni kell... – És vigyáznak is! – mondta Harding. Mire a hipszi leért, ő is felmászott a platóra, és a tartószíjba igazította az állatot. A nyakára csúsztatta az EKG-nyakörvet, amely a szívverést ellenőrizte, aztán felkapta a nagy, elektronikus hőmérőt, és bedugta az állat végbelébe. A hőmérő pittyegett. Harmincöt nyolc. – Hogy van? – kérdezte idegesen Hammond. – Kitűnően – felelte Harding. – Alig egy fokkal csökkent a hőmérséklete. – Az túl sok! – mondta erre Hammond. – Túl alacsony! – Gondolom, nem akarja, hogy felébredjen, és leugorjon a kocsiról! – fortyant fel Harding. Mielőtt idejött volna a parkba, Harding a Sand Diegó-i állatkert főállatorvosa volt, és a világ legismertebb madárgondozási szakértője. Járta a világot, hol Európában, hol Indiában, hol meg Japánban adott tanácsokat a különféle egzotikus madarak tartásával kapcsolatban. Először nem is érdekelte, amikor megjelent ez a fura kis ember, hogy állást ajánljon neki egy magánállatkertben. Ám amikor megtudta, mit hozott létre Hammond... Ezt nem lehetett kihagyni! Hardingnak volt tudósi vénája, és az a kilátás, hogy ő lehet az első olyan könyv szerzője, melynek a címe, mondjuk: Állatorvosi belgyógyászati kézikönyv: a dinoszauruszok megbetegedései, vonzó volt. A huszadik század végére az állatorvostudomány igen előrehaladott. A legjobb állatkertekben szabályos klinikák működtek, amelyek alig különböztek a kórházaktól. Egy világszínvonalú, gyakorló állatorvos számára már nem volt mit meghódítani. De elsőnek lenni egy egész új alosztály gondozása területén: az már valami! És Harding sosem bánta meg a választását. Jelentős szakértelemre tett szert ezekkel az állatokkal kapcsolatban. Most pedig azt akarta, hogy Hammond fogja be a száját. A hipszi horkantott és megrándult. Még mindig gyengén lélegzett, és még az okuláris reflex sem működött. De ideje volt már, hogy induljanak. – Mindenki a fedélzetre! – kiáltotta Harding. – Gyerünk, vigyük vissza ezt a kislányt, ahová való! – Szóval az élő rendszerek – folytatta Arnold – nem olyanok, mint a mechanikai rendszerek. Az élő rendszerek sosincsenek egyensúlyban. Eleve instabilak. Elképzelhető, hogy stabilaknak látszanak, de akkor sem azok. Minden mozog, változik. Bizonyos értelemben minden az összeomlás peremén van. Gennaro összevonta a szemöldökét. – De hát bizonyos dolgok nem változnak: nem változik a testhőmérséklet, meg mindenfajta...

– A testhőmérséklet állandóan változik – vágott közbe Arnold. – Állandóan! Először is változik ciklikusan huszonnégy óránként: reggel alacsonyabb, délután a legmagasabb. Aztán változik a hangulattal, a betegséggel, a mozgással, a külső hőmérséklet következtében, a tápláléktól függően. Örökösen fel-le ingadozik. De ezek csak apró hullámvonalak a grafikonon. Ugyanis minden pillanatban vannak erők, amelyek felfelé nyomják a hőmérsékletet, és mások, amelyek lefelé húzzák. Belső instabilitás jellemzi. És az élő rendszerek minden egyes vonatkozásukban ilyenek. – Vagyis azt mondja, hogy... – Malcolm elméleti ember – mondta Arnold. – Ült az irodájában, és készített egy matematikai modellt, de az meg sem fordult a fejében, hogy azok amiket hiányosságoknak lát, voltaképpen szükségszerűségek. Nézze, amikor rakétákkal dolgoztam, volt egy jelenség, amelyet úgy hívtunk: „rezonáns kitérés”. Ez azt jelentette, hogy ha egy rakéta csak egy kicsit is instabil, amikor elhagyja a kilövőállást, egyben már reménytelen is. Elkerülhetetlenül irányíthatatlanná válik, és nem lehet visszahozni. Egy enyhe kis billegés addig fokozódhat, míg az egész rendszer összeomlik. De ezek a kis billegések az élő rendszereknél lényegi sajátosságot jelentenek. Pontosan ezek jelzik, hogy a rendszer egészséges és reakcióképes. Malcolm ezt sosem értette meg... – És maga biztos abban, hogy nem értette? Nekem úgy tűnt, nagyon is tisztában van az élő és élettelen... – Nézze! – mondta Arnold. – Itt a bizonyíték az orra előtt! – A monitorokra mutatott. – Egy óra sem kell hozzá, és a park egész rendszere helyreáll. Egyetlen dolgot kell már csak tisztáznom: a telefonvonalak dolgát. Azok valamilyen okból még mindig halottak. De minden más rövidesen működni fog. És ez nem elmélet. Ez tény. A tű mélyen a nyakba fúródott, Harding pedig befecskendezte a medrint az elérzéstelenített nőstény állatba, mely az oldalán feküdt a földön. A dinoszaurusz szinte azonnal kezdett magához térni. Hortyogott, és rugdalózott erős hátsó lábával. – Vissza! Mindenki, vissza! – kiabálta Harding, és maga is gyorsan felugrott, és hátrált. – Húzódjanak vissza! A dinoszaurusz nehézkesen talpra állt, és részegen imbolygott. Megrázta gyíkfejét, szemét a kvarcfényben hátráló emberekre meresztette, és pislogott. – Nyáladzik – jegyezte meg nyugtalanul Hammond. – Az csak átmeneti – mondta Harding. – Abbamarad. A dinoszaurusz köhögésszerű hangot hallatott, aztán lassan elindult a mezőn át, távolodva a fényszóróktól. – Miért nem üget? – Majd fog – mondta Harding. – Szerintem még egy jó óra kell hozzá, hogy teljesen helyrejöjjön. De semmi baja. – Visszafordult a kocsihoz. – Jól van, fiúk! Akkor menjünk vissza, és intézzük el a stegót. Muldoon nézte, ahogy az utolsó cölöpöt is beverik a földbe. A drótkötelek megfeszültek, a fa elvált a kerítéstől, és felemelkedett. Muldoon látta a megfeketedett, elszenesedett csíkokat az ezüstszínű drótkerítésen, ott, ahol a rövidzárlat keletkezett. Több kerámiaszigetelő is szétrepedt a kerítés aljánál. Ezeket ki kell cserélni. De csak akkor, ha majd Arnold kikapcsolja az áramot a kerítésekben. – Vezérlő, itt Muldoon! Kezdenénk a javítást! – Rendben – szólt Arnold hangja. – Kezdjétek! Kikapcsolom a szakaszotokat. Muldoon az órájára pillantott. Halk huhogást hallott a távolból. Bagolynak hangzott, de Muldoon tudta, hogy valamelyik dilophosaurus az. Ramónhoz lépett, és így szólt: – Gyerünk, fejezzük be már! Szeretnék a többi kerítésszakaszhoz is eljutni! Eltelt egy óra. Donald Gennaro a vezérlőteremben lévő világító ellenőrzőtérképet figyelte, hogyan villognak és változnak rajta a pöttyök és a számok. – Most mi történik? Arnold a kapcsolótáblánál dolgozott. – Még mindig a telefonokat próbálom rendbehozni. Hogy gépet hívhassunk Malcolmért. – Nem arra gondoltam, hanem arra, hogy mi van odakinn, a parkban. Arnold a térképre pillantott. – Úgy tűnik, nagyjából végeztek az állatokkal és két szakasszal. Ahogy mondtam magának, a parkban visszaállt a rend. Mindenféle Malcolm-effektus nélkül. Voltaképpen már csak a harmadik kerítésszakasz van hátra, és... – Arnold! – szólt a hangszóróból Muldoon hangja. – Tessék. – Láttad már ezt az istenverte kerítést? – Várj egy pillanatig! Gennaro az egyik monitoron magas szögből közvetített képet látott, amely egy mezőre nézett le. A fű ingadozott a szélben. A távolban betontető látszott.

– Az ott a sauropodák ellátóépülete – magyarázta Arnold. – Ilyen épületeket használunk a felszerelések, a táplálék meg a többi tárolására. Mindenütt ott vannak a parkban, minden elkerített állatrészhez tartozik egy. – A videokép pásztázott. – Körülforgatjuk a kamerát, hogy jobban lássuk... Gennaro megpillantotta a drótháló fénylő, fémes falát. Egy helyen leszaggatták, a földre taposták. Muldoon dzsipje és emberei éppen ott voltak. – Ejha! – szólt Arnold. – Úgy látszik a rex bement a sauropodarészbe! Muldoon a rádión át válaszolt: – Megvan a mai vacsora. – Ki kell hoznunk onnan! – mondta Arnold. – Aztán mivel? – kérdezte Muldoon. – Semmink sincs, ami egy rexhez elég. A kerítést rendbehozom, de be nem megyek oda napkeltéig! – Ez Hammondnak nem lesz ínyére. – Előbb visszajövök. Majd aztán beszélünk róla. – Hány állatot fog megölni a rex? – kérdezte Hammond. Idegesen járt fel-alá a vezérlőteremben. – Valószínűleg csak egyet – felelte Harding. – A sauropodák nagyok. A rexnek több napra is elég, ha eggyel végez. – Ki kell mennünk, és még ma éjjel be kell hoznunk – mondta Hammond. Muldoon megrázta a fejét. – Én ugyan be nem megyek napkelte előtt! Hammond fel-le hintázott a talpán. Mindig így tett, ha dühbe jött. – Nem felejtette el, hogy maga az én alkalmazottam? – Nem, Mr. Hammond, nem felejtettem el. Csakhogy az a tyrannosaurus odakinn teljesen kifejlett, felnőtt példány. Hogy képzeli, hogyan fogjuk el? – Vannak nyugtatólövedékes puskáink. – Igen, vannak. Húszköbcentis lövedéket tudnak kilőni. Ami egy két-háromszáz kilós állatnak elég is. Az a tyrannosaurus viszont nyolc tonna. Még csak meg sem fogja érezni. – Rendelt nagyobb fegyvert is... – Három nagyobb fegyvert rendeltem, Mr. Hammond, de maga kettőt kihúzott a listáról, és így csak egyet kaptunk. Az az egy pedig már nincs meg. Nedry elvitte magával, amikor meglépett. – Az is jókora ostobaság volt! Ki hagyta, hogy meglépjen? – Nedry nem tartozik rám, Mr. Hammond – mondta erre Muldoon. – Szóval azt akarja mondani – kérdezte Hammond –, hogy e pillanatban nincs, ami megfékezhetné a tyrannosaurust? – Pontosan ezt akarom mondani – felelte Muldoon. – Ez nevetséges! – mondta megvetően Hammond. – Ahogy gondolja, Mr. Hammond. De ez a maga parkja itt. Maga nem akarta, hogy bárki is árthasson a kincset érő dinoszauruszainak. Hát most aztán itt van: egy rex van odabenn a sauropodák között, és ha a feje tetejére áll, akkor sem tehet ellene semmit! – Ezzel Muldoon sarkon fordult, és kivonult a teremből. – Hé, várjon már! – kiáltotta Hammond, és utánasietett. Gennaro a képernyőket nézte, s közben a folyosóról beszűrődő hangos szóváltásra fülelt. Halkan odaszólt Arnoldnak: – Mintha mégsem lenne még teljes a rend odakünn a parkban! – Maga csak legyen nyugodt! – mondta Arnold, és újabb cigarettára gyújtott. – A park megvan. Néhány óra múlva már hajnalodik. Lehet, hogy vesztünk egy-két dinót, mielőtt kihozzuk onnan a rexet, de higgye el, a park megvan, és nem lesz vele semmi baj.

– Így már jobb – mondta Lex. . Aztán Lex nevetését. van itt elég széna. hogy egy szénabála halad el a szeme előtt futószalagon. s a betonépületben ismét csend lett. csontos csipkézet a nagy. – Akarja velem együtt etetni Ralphot? A kis triceratops felnézett Grantra. meleg és árkos. Nyüszítő hangot hallott a sarokból. Végül is akár egy órába is beletelhet. Igaz. olyat. – Nem kell félni tőle – mondta Lex. csakhogy az a csipkézet szélénél beakadt. Még mindig majdnem hat óra addig. mint egy póniló. ahogy megint beléhasított a fájdalom. és a padlóra hullott. – Elég rosszul néz ki. megnyalta száját. Percről-percre világosabb lett. Lex felé tolta az orrát a rácson át. Ez állt rajta: SAUROPODÁK ELLÁTÓÉPÜLETE /04/. a telefonok még mindig nem működnek. Vastag farkát ide-oda lengette örömében a rácson kívül. Grant előrelépett. a mennyezet felé. szerszámokkal és más effélékkel. hogy a telefonok még mindig nem működnek. Grant ásított. Grant közelebb ment. úgy viselkedsz. Nyögve a hátára gurult. – Hol van Tim? – Pisil – mondta Lex. mintha összeverték volna. ahogy kezdődött. Újabb horkantás hallatszott. és semmi jelét nem mutatta a félelemnek. Aztán a kongás elhallgatott. és teste megrándult a hirtelen fájdalomtól. A bébi erre hirtelen izgalomba jött. csak elektromos sistergés szólt belőle. és aktiválni az egyik mozgásérzékelőt odakinn. Ralph! – hallotta Lex hangját. csikorgó zajra ébredt. amelyet ütemes. – Ez itt Ralph – mondta. s a szemével követte a kislányt. Szereti a szénát. éppoly hirtelen. Ki kellene mennie. éles fogakat és a csőrszerű felső állkapcsot. Reggel volt: végigaludta az éjszakát! Gyorsan az órájára nézett: öt óra. – Nagy szám volna dinoszauruszon lovagolni! Grant kinézett a rácson át a nyílt mezőre. Az agya lüktetett. és körülnézett az épületben. és a rácsnál találta a kislányt. – Oké. Grant bácsi – szólt Lex. Erre aztán felült. ha simogatják. – Szereted a szénát. Ralph Lexről Grantra nézett evés közben. Tisztára feldagadt az orra. Ezúttal közelebbről. És az sem tetszett sehogyan. – És nagyon éhes. és látta. – Komolyan mondom. – Azt azért inkább ne! – Pedig fogadok. amely odakint állt. sárga fény ömlött be az oldalablakokon. és gyengéden megérintette az állat nyakát. gondolta. csak egy perc – mondta Lex. Nem voltak még szarvak a fején. Ralph! Grant befordult a sarkon. aztán felszisszent. rózsaszínű malacra emlékeztetett. – Ő a barátom. – Tán még lovagolhatnék is rajta – mondta Lex. mint amikor futball-labdát simogat az ember. és telefonkészüléket talált benne.. – Miért hívod Ralphnak? – Mert pont olyan. lágy szemek mögött. Szereti. Marékkal nyújtotta a szénát egy állatnak. Jól sejtette hát: a sauropodák számára elkerített területen vannak. Kinyitotta a dobozt. Kinyitotta a szemét. az állat mögé.HAJNAL Grant hangos. Mindkét oldalt kilógott a széna a szájából. – Rágd meg rendesen. Most. majd tágra nyitotta. mint Ralph. Az egy srác a suliban. gépies kongás követett. aki tovább etette a szénával. – Nagyon rondán eszik – mondta Lex. és észrevette Grantot. hogy az valamiféle raktárhelyiség. ha emberrel találkozik. Lágy. de amikor a füléhez emelte a hallgatót. – Rosszul is érzem magam. mi.. nagyjából akkora. – Egészen szelíd – jegyezte meg Lex. csak valamiféle hajlott. Úgy látszik. míg a hajót vissza lehet hívni. hogy hagyná! – erősködött Lex. – Megveregette a bébi fejét. Ralph. Szürke fémdobozt pillantott meg a falon. Hirtelen mély horkantás hallatszott. mint valami hatalmas lóé. hogy egy dinoszaurusz aligha reagálhat valamiféle megszokott módon. mintha sose kapnál enni a mamádtól. – Nyugi. – Ne légy malac. Két további bála ment a nyomában. Grant látta a karcsú. mint a rozsdás kerék nyikorgás. szénakazlakkal. amely egy nagy papagájra emlékeztetett. Grant lassan felállt. Ralph? Az állat bőre száraz volt. és úgy fájt az egész teste. Álmosan nyújtózkodott egyet. Tőle jöttek a sivalkodó hangok. míg a vezérlőből a segítségükre jönnek. a nap fényénél látta. s közben újabb maréknyi szénát söpört fel a padlóról. Megpróbálta a rácsokon át visszahúzni a fejét. – Meg lehet simogatni. Ralph? Megfordult. és hatalmas. – Tim is. úgy várta a folytatást. mire az állat ijedtében felsivított. A kölyökállat befejezte a rágást. Grantnak eszébe jutott. és felszisszent. Triceratops-bébi volt.

Ralph felágaskodott a hátsó lábán, s már-már kétségbeesetten igyekezett kiszabadulni a rácsok mögül. Ide-oda forgatta a fejét, odadörzsölte a rácsokhoz. – Nyugi, Ralph! – szólt rá Lex. – Segítsünk neki. Nyomjuk ki – mondta Grant. Ő maga felnyúlt Ralph fejéhez, nekifeszült, és egyszerre nyomta az állatot oldalt és hátra. A csontcsipkézet hirtelen kiugrott, a bébi a rácsokon túlra lódult, elvesztette az egyensúlyát, és az oldalára pottyant. Aztán árnyék vetült rá, és fatörzs szélességű láb jelent meg a szemük előtt. Öt hajlott körmű lábujja volt, mint egy elefántnak. Ralph felnézett és nyüszített. Hatalmas fej tűnt elő: két méter hosszú volt, rajta három, hosszú fehér szarv, mindkét nagy barna szem fölött egy, a harmadik kisebb, pedig középen, az orrhegy fölött. Felnőtt, teljesen fejlett triceratops volt. A hatalmas állat lassan pislogva megvizsgálta Lexet és Grantot, majd kinyúlt a nyelve, és végignyalta Ralphot. Az nyüszített, és boldogan dörzsölte magát a vastag lábhoz. – Ez az anyukája? – kérdezte Lex. – Úgy néz ki – felelte Grant. – Megetessük a mamát is? A felnőtt triceratops azonban már lökdöste is Ralphot elfelé az orrával. Kezdte eltávolítani a rácsoktól. – Inkább ne – mondta Grant. A kölyök elfordult a rácstól, és elment. Az óriás anya időről-időre meg-meglökdöste orrával, mintegy kormányozva kicsinyét, míg el nem tűntek a szem elől. – Szia, Ralph! – integetett Lex. Közben Tim is előjött az épület árnyából. – Mondok valamit – szólt Grant. – Én most fölmegyek a dombra, és működésbe hozom a mozgásérzékelőket, hogy értünk jöjjenek végre. Ti ketten addig itt maradtok, és megvártok engem! – Nem! – mondta erre Lex. – Miért nem? Itt maradtok. Itt biztonságban vagytok. – Nem fog itt hagyni minket, Grant bácsi! – mondta konokul Lex. – Így van, Timmy? – Így – erősítette meg Tim. – Hát jó – sóhajtott Grant. Kifurakodtak a rácsok között, és kint álltak a mezőn. Közeledett a reggel. Meleg, nyirkos volt a levegő, az ég lágy rózsaszín és bíborszínekben derengett. Fehér köd tapadt mélyen a talajhoz. Egy kissé távolabb az anya- és a bébitriceratopsot látták, amint kacsacsőrű hadrosaurusok csordája felé haladnak. Közben a leveleket legelészték a lagúna mentén. A hadrosaurusok közül néhány térdig a vízben állt. Ittak. Lapos fejük leereszkedett, és szembetalálkozott saját tükörképével a víz felszínén. Aztán újra felnéztek, fejük himbálózott. A víz szélénél az egyik bébi kimerészkedett, felnyüszített, majd hanyatt-homlok igyekezett vissza. A nagyok elnéző türelemmel figyelték. Délebbre további hadrosaurusok legelésztek az alacsony növények között. Néha felágaskodtak, és hátsó lábukra álltak. Mellső végtagjukat egy-egy fatörzsön nyugtatták, hogy elérjék a magasabb ágakon lévő leveleket is. Messze távolban hatalmas apatosaurus nyúlt ki a fák közül, kicsiny feje ide-oda himbálózott hosszú nyakán. Olyan békés volt a látvány, hogy Grant alig tudott bármiféle veszélyre gondolni. – Jujj! – kiáltott Lex, és hirtelen lekapta a fejét. Két gigászi szitakötő zúgott el mellettük. Kiterjesztett szárnyuk fesztávolsága legalább két méter volt. – Mi volt ez? – Szitakötők – felelte Grant. – A jurakor az óriás rovarok kora volt. – Csípnek? – kérdezte Lex. – Nem hiszem – válaszolta a tudós. Tim megállt, és előrenyújtotta a kezét. Az egyik szitakötő letelepedett rá. A fiú érezte a hatalmas rovar súlyát. – Vigyázz, megcsíp! – figyelmeztette Lex. A szitakötő azonban csak lassan, méltóságteljesen meglebegtette áttetsző, vörös eres szárnyait, aztán mihelyt Tim megmozdította a karját, újból a levegőbe emelkedett. – Merre megyünk? – kérdezte Lex. – Arra. Elindultak a mezőn át. Odaértek az első mozgásérzékelőkhöz, egy háromlábú állványra erősített fekete dobozhoz. Grant elé állt, és lengetni kezdte előtte a karját, de semmi sem történt. Ha a telefonok nem működnek, ki tudja, tán a szenzorok sem működnek még. – Keresünk egy másikat, és azt is megpróbáljuk – mondta, és messzebbre mutatott a réten. Ekkor valami nagy állat üvöltése hallatszott a távolból.

– Az ördög vigye el! – morgott Arnold. Kávéját szürcsölte, és kivörösödött szemmel bámulta a képernyőket. Az összes videomonitort kikapcsolta, csak a számítógép kódját vizsgálta még mindig. Időnként úrrá lett rajta a kimerültség: immár tizenkét órája dolgozott egyfolytában. Wuhoz fordult, aki közben visszajött a laboratóriumból. – Nem találom. – Mit nem találsz? – Még mindig döglöttek a telefonvonalak. Egyszerűen nem tudom visszakapcsolni őket. Azt hiszem, Nedry a telefonokkal is csinált valamit. Wu felemelte a kagylót, s hallotta benne a sistergést. – A hangzása után modem. – De nem az – mondta Arnold. – Tudniillik lementem az alagsorba, és az összes modemet kikapcsoltam. Amit hallasz, közönséges háttérzörej. Csak úgy hangzik, mintha egy modem adná. – Vagyis a telefonvonalak eldugultak? – Lényegében igen. Nedry igen alaposan eldugaszolta őket. Valamiféle záróparancsot épített be a programkódba, amit most már meg sem tudok találni, mert kiadtam azt a parancsot, amely törölte a programlista egy részét. De a jelek szerint a telefonokat lezáró parancs még mindig ott van a komputer memóriájában. Wu értetlenül vonta meg a vállát. – Akkor meg mi a baj? Indítsd újra! Kapcsold ki a rendszert, állítsd le, és kiüríted a memóriát. – Azt még sosem csináltam – mondta Arnold. – És félek is tőle. Lehet, hogy az újraindításkor az összes rendszer visszajön, de mi van, ha mégsem? Én nem vagyok számítógépes szakember, és te sem vagy az. Legalábbis nem igazán. És működő telefonvonalak nélkül még csak tanácsot sem tudunk kérni senkitől, aki az. – Ha a parancs RAM-rezidens, akkor nem fog jelentkezni a kódban. Végigkutathatod a RAM-et, de azt sem tudod, mit keresel. Szerintem az egyetlen, amit tehetsz, a leállítás és újraindítás. Gennaro rontott be. – Még mindig nincs egyetlen rohadt telefonunk sem! – Éppen azon dolgozunk. – Éjfél óta erre hivatkoznak! Közben Malcolm állapota egyre romlik. Orvosi ellátásra van szüksége! – Ez azt jelenti, hogy le kell állítanom a rendszert – mondta Arnold. – Nincs garancia rá, hogy minden újra működésbe jön utána. Gennaro felemelte a hangját. – Ide figyeljen! Súlyos beteg van odaát a kastélyban. Ha nem jön az orvos, meghal. Ha nincs telefon, nem tudunk orvost hívni. És valószínű, hogy már eddig is meghaltak négyen. Úgy hogy gyerünk, kapcsolja ki a gépet, állítsa le, és hozza rendbe a telefonvonalakat! Most, azonnal! Arnold habozott. – Nos? – kérdezte Gennaro. – Nézze, a helyzet az, hogy a védőrendszerek nem engedik, hogy a számítógépet lezárják, és... – Akkor kapcsolja ki a rohadt védőrendszereit is! Nem képes felfogni végre, hogy egy ember meghal, ha nem kapunk segítséget? Miféle alak maga? – Hát jó! – sóhajtott Arnold. Felállt, és a főkapcsolóhoz ment. Felnyitotta az ajtaját, és feltárultak a védelmi rendszer kézi kapcsolóbillentyűi. Sorra, egyenként lekattintotta őket. – Maga akarta – mondta Arnold. – Hát most megkapja. Lecsapta a főkapcsolót. A vezérlőterem elsötétült. Minden monitor elsötétedett. Ott álltak hárman a sötétben. – Mennyi ideig kell várnunk? – kérdezte Gennaro. – Harminc másodpercig – felelte Arnold. – Fuu! – szólalt meg Lex, ahogy áthaladtak a réten. – Mi baj? – kérdezte Grant. – Ez a szag! – mondta Lex. – Büdös, mint a rothadó káposzta. Grant habozott. A távoli fák felé tekintett a réten át, nem mozog-e valami. De semmit sem látott. Szellő is alig lebbentette az ágakat. Béke és csend honolt a kora reggeli tájon. – Azt hiszem, képzelődsz – mondta. – De én nem... Ekkor felhangzott a gágogó hang. A hátuk mögül jött, a kacsacsőrű hadrosaurusok csordájától. Először csak egy állat kezdte, aztán sorra vették át a többiek, míg a végén az egész csapat hangosan gágogott. Izgatottság lett úrrá rajtuk. Tekeregtek, forgolódtak, kisiettek a vízből, védelmezően köröztek a kicsik körül... „Ők is érzik a szagot” – gondolta Grant.

A tyrannosaurus hátborzongató ordítással rontott elő a fák közül, talán ötven méterre tőlük, a lagúna mellett. Óriás léptekkel rohant, ki a nyílt mezőre. Ügyet sem vetve rájuk, a hadrosaurusok felé tartott. – Megmondtam! – sikította Lex. – De énrám senki sem hallgat! Távolabb a kacsacsőrűek vadul gágogtak, és futásnak eredtek. Grant érezte, reng a föld a lába alatt. – Gyerünk, gyerekek! – Megragadta Lexet, és felkapta a levegőbe, Timnek pedig a kezét fogta meg, úgy futott velük a füvön át. Futás közben még meg-megpillantotta a tyrannosaurust odalenn a lagúnánál, amint a hadrosaurusokra veti magát, amelyek védekezve lengették vastag farkukat, s hangosan, egyfolytában gágogtak. Aztán növények és fák recsegését-ropogását hallotta, s amikor ismét hátranézett, a kacsacsőrűek már rohamoztak is. Az elsötétült vezérlőben Arnold az órájára pillantott. Harminc másodperc. A memóriának most már üresnek kell lennie. Újra felkattintotta a főkapcsolót. Nem történt semmi. Arnold gyomra összeszorult. Lekattintotta a kapcsolót, majd ismét föl. Még mindig nem történt semmi. Izzadság öntötte el a homlokát. – Mi baj? – kérdezte Gennaro. – Ó, én marha! – kiáltott fel Arnold. Ekkor jutott eszébe, hogy a védőrendszer kapcsolóit is be kell kapcsolnia, mielőtt újraindítja a gépet. Felkattintotta a három védelmi kapcsolót, és visszaengedte rájuk a takarót. Aztán lélegzetét visszafojtva újból felkattintotta a főkapcsolót. Kigyúltak a fények a teremben. A komputer sípolt. A monitorok zümmögni kezdtek. – Hála Istennek! – sóhajtott hangosan Arnold. A főmonitorhoz sietett. Címkesorok jelentek meg a képernyőn: ŐSLÉNYPARK – RENDSZER INDUL
INDÍTÁS AB(0)
Biztonság Fő SetGrids DNL Kritikus zárak Kontroll Áthaladás Monitor Fő View VBB TeleCom VBB TeleCom RSD Parancs Fő Belépés TNL Reset Revert Eloszt. Fő Elektromos Fő Fűtés Hűtés Vész Világ. FNCC Params

INDÍTÁS CN/D
Hidraulika Fő Ajtók Interface GAS/VLD Fő II Robbanás Tűzveszély Mester Fő SAAG Rnd Közös Interface Séma Fő Zoolog. Fő Javítás Raktározás Státus Fő Biztonság/ Egészség

Gennaro a telefonért nyúlt, de az még mindig hallgatott. A statikus elektromosság zaja megszűnt, immár teljes volt a némaság a készülékben. – Ez most mi? – Várjon már egy pillanatig! – szólt Arnold. – Újraindítás után a rendszer összes moduljait manuálisan kell beindítani, azaz kézzel, egyenként. – Miért manuálisan? – kérdezte Gennaro. – Nem hagyna dolgozni? Az Isten áldja már meg magát! Wu szólalt meg: – A rendszer tervezésekor nem vették számításba, hogy valaha is szándékosan le kelljen állítani, így aztán, ha leáll, a gép feltételezi, hogy probléma van valahol. Ezért megkívánja, hogy mindent kézzel indítsanak. Máskülönben ha valahol rövidzárlat lenne, a rendszer elindulna, rövidre zárulna, megint elindulna, aztán megint rövidre zárulna, és így tovább, egészen a végtelenségig. – Oké! – szólt Arnold. – Elindulhatunk. Gennaro felkapta a telefont, és tárcsázni kezdett, de hirtelen abbahagyta. – Atyaúristen! – kiáltott fel. – Oda nézzenek! A videomonitorokra mutatott. De Arnold nem figyelt rá. A térképre meredt, ahol a lagúna mellett szorosan egymás mellett lévő pontok egy csoportja egyszerre csak összehangolt mozgásba kezdett. Gyorsan haladtak előre, egyfajta örvénylő mozgással. – Mi történik ott? – kérdezte Gennaro. – A kacsacsőrűek – válaszolt fakó hangon Arnold. – Menekülésbe kezdtek.

A kacsacsőrűek meglepő gyorsasággal rohamoztak. Hatalmas testük szorosan összetapadt, gágogtak és bőgtek, a kicsik pedig azon igyekeztek, hogy el ne tapossák őket az óriás lábak. A csorda nagy, sárga porfelhőt vert fel. A tyrannosaurust Grant nem is látta. A kacsacsőrűek egyenesen feléjük rohantak. Lexet még mindig a karjában tartva, Grant Timmel együtt futott egy kiemelkedő, köves dombra, amelyen nagy tűlevelű fák csoportja állt. Teljes erőből rohantak, közben érezték, hogy reng a föld a lábuk alatt. A közelgő csorda fülsiketítő zajt csapott, akkorát, mint a beindított hajtóművek a repülőtéren. Megtöltötte a levegőt, belefájdult a fülük is. Lex kiabált valamit, de Grant nem tudta kivenni, mit mond. Alighogy felkapaszkodtak a sziklákra, máris körülvette őket a csorda. Grant látta az első hadrosaurusok hatalmas lábát, amint elrohantak mellettük. Minden egyes állat öt tonnát nyomott. De aztán semmit sem látott tisztán, olyan sűrű porfelhő borította be őket. Csak villanásszerűen tűnt föl egy-egy hatalmas test, gigászi végtag, fájdalmas bőgések hallatszottak, amint az állatok ide-oda forognak, köröznek. Az egyik kacsacsőrű egy nagyobb sziklafalnak ütközött, feldőlt, és elgurult mellettük, ki a mezőre. Alig láttak a köveken túl a hatalmas porfelhőtől. Belekapaszkodtak a sziklákba, hallgatták a visításokat és gágogásokat, a bőgést és a tyrannosaurus rémisztő üvöltését. Lex Grant vállába mélyesztette körmét. Újabb hadrosaurus csapta neki óriás farkát a sziklának. Forró vér fröcskölt rájuk a nyomán. Grant várt, míg a harci zaj egy kissé eltávolodik bal felé, aztán lökdösni és tolni kezdte a gyerekeket föl egy nagy fára. Gyorsan másztak fölfelé, kezükkel tapogatva ki az ágakat, míg az állatok körülöttük rohangáltak fejvesztve az óriás porfelhőben. Hat métert haladtak fölfelé, ekkor azonban Lex Grantba kapaszkodott, és nem volt hajlandó továbbmászni. Tim is elfáradt, Grant pedig úgy gondolta, már elég magasan vannak. Lenézve a porfelhőn át látták odalenn az állatok széles hátát, amint forognak, lökdösődnek és gágognak. Grant a fatörzs durva kérgének támaszkodott, köhögött a portól, lehunyta a szemét, és várt. Arnold igazított egyet a kamerán, ahogy a csorda odébb haladt. Lassan leülepedett a por. Látta, hogy a hadrosaurusok szétszóródtak, a tyrannosaurus pedig már nem fut, ami csak azt jelenthette, hogy a vadászat sikerrel járt. Elejtette valamelyik állatot. A tyrannosaurus most a lagúnánál volt. Arnold a videomonitorra pillantott, és így szólt: – Ki kell küldeni Muldoont, hogy megnézhesse, mennyire súlyos a helyzet! – Mindjárt szólok neki – mondta Gennaro, és kiment a teremből.

A maiasaurusoknak felfelé görbült az ajkuk. tesz egy próbát. amint az állat rágcsált tovább. ahogy az állat eszik. – Ne dühítsd! – szólt Tim néhány ággal magasabbról. A kacsacsőr kinyílt. amitől úgy néztek ki. A meleg ajkak ismét megérintették a bokáját. az ágon. hogy ne is moccanjon. és lerágcsált néhány kisebb ágacskát arról a nagyobb ágról. hogy az kis híján leesett a fáról. A hadrosaurus elhúzta a fejét a fától. ahol volt. alig néhány méterre tőle. hangos.” . hogy Grant semmiféle fenyegetettséget nem érzett. mosolygó szája mulatságos külsőt kölcsönzött a dinoszaurusznak.A PARK Halk. Grant megszemlélte a két hosszúkás légnyílást a lapos felső csőr fölött. amely egy csőrszerű száj irányában keskenyedett lefelé. és körülbelül egy perc múlva a hadrosaurus ismét közeledni kezdett a faághoz. Úgy gondolta. a hadrosaurus folytatni kezdte az evést. mint a tehén tekintete. s a hatalmas fej lebillent. éppen annyit. hogy a kétéltűek csak a mozgó dolgokat látják. az állkapcsok felhagytak a rágással. – Na és akkor leenged bennünket? – kérdezte Lex. Úgy látszik. míg a kicsi végez az evéssel. és hatalmas. John Hornerrel együtt Grant volt az első. Ha valami nem mozog. bizonytalanul viselkedett. s a hang forrását kereste. mit is tegyen. lágyak voltak. hogy itt vagyunk. hogy lássa a felnőtt állat lába körül totyogó-nyomakodó bébit. Az állkapcsa már előre rágó mozgást végzett. mintha folyton mosolyognának. A lapos kacsacsőr fölött kidudorodó szemek jámborak. ebből elég! – szólt Lex. aki a karján ült: – Hé! Ez meg mi? A hadrosaurus a zajra rémülten trombitált. és figyelte. – Na. visszhangzó gágogása pedig úgy megijesztette Lexet. de annyira békés és nyugodt. Valami meleg. és vizsla szemmel nézegette az ágat. aki leírta ezt a fajt. míg a bébi a hátsó lábára állt. A bébi csiripelt. Kinyitotta a szemét. – Én itt nem maradok. mint a kétéltűeké. Mozgására a hadrosaurus megint rémülten trombitált. ropogó hang. Noha igazi óriás volt. Zavarodottan. Az anya türelmesen megvárta. A békák vizsgálata kimutatta. Megint gágogott. Csak a szem mozgott. – Nem – felelte Grant. míg az hátrált a fától. S noha a bal szem pontosan rámeredt. késő-krétakori maiasaurusok egy példányával találta szemben magát. fekete tollakkal. amíg azok már gondoskodni tudtak magukról. és megszólalt Lex. ez meg éppenséggel úgy viselkedett. amikor már kiderült. világosbarna fejet látott. Maradt. például a rovarokat. Köhögött egyet. Nyilván folytatni akarta a legelést. – Ez buta? – kérdezte Lex. Vigyázott. hogy el akarja ijeszteni őket onnan. Grantnak az volt a benyomása. Ekkor kinyitotta a szemét. és megette a szája két sarkából kilógó ágakat. Grant talán azért is döbbent meg annyira. egy hosszú pillanat eltelte után. Kacsacsőrű hadrosaurus. hogy nincs veszély. Az anya félrebillentette a fejét. mert az általános vélemény szerint a maiasaurusok védelmezték a tojásaikat és a kicsinyeiket. „Ez tényleg nem lát bennünket. a dinoszauruszoknál is így van. és újra négy lábra ereszkedik. A kicsi sötétdrapp volt. egészen addig. Némán vártak. Grant makacs csiripelést hallott. De a jelek szerint nem igazán tudta. már csak azért is. hogy ilyen közelről látja az állatot. amelyen Grant és Lex ült. Grant elképedt. nedves dolog csiklandozta meg Grant bokáját. – Csak ráijesztettél. mint egy tehén. A paleontológus egy kicsit arrébb mozdult. – Vagy mi lesz? A hadrosaurus háromméternyit elhátrált a fától. „Döbbenetes!” – gondolta Grant. azt egészen egyszerűen nem látják. amelyen Grant ült. Valószínűleg éppen a Montanában talált. és mozdulatlanul várt. Felfelé hajló. az biztos! – Elkezdett lefelé mászni a fáról. Pontosan így volt a tyrannosaurus is – azaz még egy klasszikus példa arra. Aztán. Az állat nyilván nem érezte Grant szagát. Eszébe jutott. Nem mintha félt volna: a kacsacsőrű dinoszauruszok minden faja növényevő volt. Látta a lapos fogakat a szájában. és még egyet trombitált. mert ezt az állatot bizonyos értelemben a sajátjának érezte. – Egy perc múlva pedig a szó szoros értelmében elfelejti. ha nem mozgunk! – gondolta. Grant végleg elképedt. A nevük ezt jelentette: „jó anyagyík”. a hadrosaurus valamilyen okból nem reagált a jelenlétére. mint amikor ég a tűz a kandallóban. hogy a múlt éjjel a tyrannosaurus sem látta. A hadrosaurus abban a szempillanatban megdermedt. hogy a látószervük úgy működik. és ott totyorászott az anyja lábai alatt. A hadrosaurus tovább legelt. mellső lábait az anyja állkapcsának támasztotta. A nagy egészen a földig leengedte a fejét. Aztán a nagy fej újra Grant irányába emelkedett.

Az út a talajszint alá volt süllyesztve. visszanézett rájuk. porcelánszigetelőket ládástul. – Ide kíván jönni. feltekerve és penészfoltosan a nedvességtől. és hátat fordított a monitoroknak. kerítéshez való dróttekercseket. s a levegőben savanyú szag érződött. Grant a raktárépület mélyében kotorászott. És egy kis dokkhoz vezet. alacsony betonépületre mutatott. ötven kilós műtrágyás zsákokat.. Grant az órájára nézett. Fárasztó volt figyelni..Mindenesetre a maiasaurust most már láthatóan túlságosan idegesítették a fáról lemászó fura kis lények. mint a szárazföldön. Grant egy pillanat alatt átlátta a tutaj előnyeit. pótgumikat a dzsiphez. – Szóval látni nem láttad? – Nem.. Kiteregette a térképeket a padlón. Körülöttük mindenütt lelapult a fű. és két műanyag evező a betonfalra akasztva! – No jó – mondta Grant. – Jöjjön maga! Itt vagyok a genetikai laboratóriumban Wu doktornál.. ahol az éjszakát töltötték.. Egyszer még megállt. Most reggel hét óra van. zöld pamutháló. most azonban. Ha tutajjal hajóznak a folyón lefelé. látni akarták a hadrosaurusok csapatos menekülésének eredményét. – Akkor menjünk azzal! – mondta. úgy látszik. – Miféle tutajjal? Tim a lapos tetejű. Odakint volt Gennaróval együtt. Húsz méterre lehetett tőlük a réten át. Arnold.. Betonozott út vitt tőle egyenesen lefelé. Két másodpercenként új és új kép tűnt fel. Arnold nagyot sóhajtott.. és látta is: Ott van a betonfalban. Mintha az Úr hangja szólalt volna meg. egészen bizonyosan gyorsabban haladnának. hogy már felkelt a nap. gyerekek! – mondta. Egy utolsó trombitálással arrébb lökdöste a bébit. Mr. Visszahajtogatta a lapokat. Lex megrázta magát. Arnold vizuális keresőmódra állt. ezért felülről nem volt látható. – Jobb lesz. ahol vannak. magunknak kell visszamennünk. nem vesznek észre minket. aztán folytatta útját. ha indulunk. s figyelte. Kattant a rádiótelefon hangszórója: – Mr. – Éhes vagyok. Mr. Hordószám tolta félre a növényirtó szereket. Kinyitotta.. Grant felnézett. közben lesepert egy jókora pókot. Mindkét gyereket finom porréteg borította. – Ide tessék nézni! – Fémdobozt nyújtott át Grantnak. mindenáron meg akarta találni a kocsit. Egy autónak is elég széles. – De hol a tutaj? – Ott kell lennie valahol – felelte egy kicsit bizonytalanul Tim. – Mivel pedig a mozgásérzékelőkről. Hammond? – Nem. – Hű! – szólalt meg Tim. Nyilván ez is karbantartó út. beszélhetnék magával egy pillanatig? Hammond volt. Muldoon pedig ragaszkodott ehhez. hogyan pásztázzák a monitorok a parkot. Talált viszont egy térképcsomagot. Hogyan jussanak le a lagúnához? A térképek szerint hátsó ajtónak is kell lennie az épületben. hogy megtalálják Nedry dzsipjét.. lámpákat és kábeleket. közvetlenül a lagúna partján. – Csak tessék keresni! Meglesz! Cementzsákok. – Én ugyan nem! – mondta Lex. Itt várjuk. – Láttam ott egy tutajt – mondta. Több mint tizenkét kilométert kell még megtenniük. ahol most voltak. amely egy falra akasztott fémszekrény hátuljába volt bedugva. a lagúnához.. és méltóságteljes lassúsággal elindult. tutajt nem talált. csak feltételeztem. de ez volt a leggyorsabb módja. . – Én itt semmiféle tutajt nem látok. Hiába kutatott tovább Grant a különféle holmik között. egyenesen keresztülhalad a madárházon. Eszerint a lagúna folyóvá keskenyül – folyóvá. – Miért nem megyünk tutajjal? – kérdezte Tim. talált fűnyíró felszerelést. Vérfoltok látszottak a földön. azt a részt. A dokkra pedig olvashatóan ez volt felírva: TUTAJRAKTÁR. amit korábban láttak –. A térképek topográfiai részletességgel ábrázolták a sziget fő területrészét. hogy ott van az is. Arnold – mondta Hammond. Kellettek a fegyverek. Leértek a földre. rézcső. Sokáig nézegette a térképeket. üres olajtartályokat. – Én oda nem megyek soha többé! – Pedig muszáj! – Miért? – Mert szólnunk kell a hajóról – mondta Grant. és onnan a látogatóépülettől alig nyolcszáz méterre folyik tovább. – Várj egy pillanatig. északnak kanyarodik. Nincs más választásunk.

és szinte elborították az elejtett hadrosaurus vörös lábait. A dinoszaurusz aludt tovább. s a tyrannosaurus orra előtt a dokkra lépett. Grant biztosra vette. Grant már úszott az izzadságban a feszültségtől. – Nyugi – mondta Grant. hortyogásának ritmusa sem változott. bár a nagy állat nem adta jelét. Grant a dokkhoz kötözte a hajót. A ritmikus hortyogás erősödött. Grant megfordult. a pisztolyt pedig a nadrágja övrészébe dugta. Elérték az út végét. – Az biztosan a dokkban lesz – felelte Grant. Néma rángásoktól reszketett a teste: köhögését próbálta visszafojtani. hogy beleolvadjon a növényzetbe. hogy elhessentse az orra körül röpködő legyeket. Grant csendesen kinyitotta az ajtót. Eltartott egy pillanatig. . és egy hevedert. körülbelül ujjnyi vastagok. Szinte abban a pillanatban rémület ült ki az arcára. A gumi hangos sziszegéssel terjeszkedni kezdett. igen. A zaj rémisztően hangosnak tűnt. Utána Tim is beszállt. néhány kötegnyi kötél és két nagy gumikocka. egy légpisztolyt talált benne. mely az oldalán feküdt a tyrannosaurus mellett. – Remélem. Elindultak az úton. Grant mérgesen bökdöste a levegőt az ujjával. Hang nélkül jelezte Timnek és Lexnek. De semmilyen más mozdulatot nem tett. hátsó lába előrenyúlt. Lex arcára undor ült ki. amikor Grant hirtelen megdermedt. A hevedert a vállára dobta. de most már folyamatos búgó. és benézett. és megtalálta a felfúvóhengert. és a szájára szorította a kezét. honnan jön. Csak ült ott. Fából ácsolt fészerféle állt a dokk végénél. alattuk a padlón több tekercs drótháló. míg rájött. véres fogain. Távolodni kezdtek a dokktól. Kétoldalt a töltés lejtősen magaslott föléjük. A feliratuk: MORO-709. és becsúsztatta őket az evezővillába. elég nagy az a tutaj – mondta Lex –. nyílvesszőszerű lövedékkel. terepszínűre festve. Végighúzta a gumitutajt a dokk pallóján. és hosszan. majd sssz. – Ez ügyes volt. Ezeket is betette a tutajba. Mentek az úton. Lex hátradőlt. aztán hívó mozdulatot tett a gyerekek felé. visszaintett: – Nem! Grant újra mutatta: – De igen! A tyrannosaurus csak aludt tovább. majd visszadőlt. – Valószínűleg – felelte Grant. de az állat csak megváltoztatta óriás testének helyzetét. Ott mászkáltak a legyek a pofáján. Grant a padlóra húzta az egyik kockát. Az állat nyögött. ahogy közeledtek a lagúnához. Grant izmai megfeszültek. mert én nem tudok úszni.Amikor Grant kinyitotta. A hatalmas állat aludt tovább. és már a szemük előtt volt a betondokk. horkantott. és a tyrannosaurusra lesett. – Talán tudunk majd halat fogni – mondta a kislány. Grant a vállán az evezőkkel. A zümmögő hang attól a légyrajtól származott. – Na és a csónak? – kérdezte Lex. – Nyugtatólövedékek? – Gondolom. hortyogó hangot hallottak. zizegő zaj is kísérte. Erre Lex némán elindult. ahol vannak. neki a fatörzsnek. hupp! – teljes nagyságában kipattant a pallón. Grant felkapta az evezőket. és visszament a fészerbe két mentőmellényért. de Grant nem látta. de meg sem mozdult. lazán szétnyitott állkapcsán. Mocorogni kezdett. már futni készült. A tutajok! Grant visszanézett Lexre. Tim! – mondta Grant. aztán a férfi további gesztusai a csónakba irányították. hogy látja őket. Mély. Nyitva volt a szeme. A kislány mozgó szája némán formázta: – Nincs tutaj? Grant hevesen bólogatott: – De van! A tyrannosaurus felemelte mellső lábát. hogy maradjanak. Kikapcsolta a hevedereket. A tyrannosaurus volt ott! Egyenesen ült egy fa árnyékában. Vagy féltucat sárga mentőmellény függött a falon. a tyrannosaurus alszik. és nagyot sóhajtott a megkönnyebbüléstől. Az hangos csobbanással zuhant a vízbe. Ülve. – Biztosan lesz ott tutaj? – kérdezte az orrát összeráncolva Lex. – Gyertek! Lex. A tyrannosaurus alig húsz méterre volt. Hat darab volt belőlük. csak a feje emelkedett és süllyedt minden egyes horkantással. és mindketten magukra öltötték a mentőmellényt. Meglepően nehéz volt. a pisztolyhoz való. amely felhőként vette körül. dörögve böfögött. Kezével az arca előtt legyezett. ritmikus. Ő maga lassan elindult. az arca holtsápadt a félelemtől.

Tim áthajolt a tutaj oldalán. és a tenyerében tartott vizet a húga felé nyújtotta. és visszanézett. – Nem tehettem róla! – Ssss! Grant evezett. dühösen Tim. és hátsó lábával megvakarta a füle tövét. – Lex. Grant hallotta reszelős. Ő meg nem tud úszni. – De hát honnan tudhattam volna? – kérdezte a kislány. kimutatva a hajlott fogak hosszú sorait. de azok könnyű műanyagból voltak – ez fegyvernek mit sem ér! A tyrannosaurus hátravetette a fejét. hogy a tyrannosaurus tud úszni! Minden könyvben benne van! Különben is. Grant egyetlen lendülettel körbefordította a csónakot. – Különben sem számít – mondta a kislány. Tágra nyitotta a pofáját. és a torkára mutatott. Grant vadul evezett. Tim tudta. hortyogó légzését. A tyrannosaurus megint lábon járhat. hogy a tyrannosaurus eddig nem is úszott. A tyrannosaurus megrázta a fejét. Grant bácsi! – könyörgött sírva Lex. – Nem akartam! Grant hátralesett a vállán át. egyenesen a csónak felé tartott. fulladozó. Addigra már olyan látványt nyújtott. és kapaszkodjatok bele valamibe! – Grant a tyrannosaurust nézte. és északnak kezdett evezni. A lövedék megvillant a fényben. – Már elég messze vagyunk. amely válaszul érkezett. hogyan úszik. amint közeledett feléjük. aztán újra elköhögte magát. – Akármit! Grant előhúzta övéből a légpisztolyt. neki a tutajnak. Grant célzott és lőtt. a víz ismét elsekélyesedik. aztán izmainak egyetlen rándulásával előrevetette magát. – Inkább húzódjatok le. Meghajlította a tutajt. „Pontosan mint egy krokodil – gondolta elkeseredetten Grant –. A kezében tartott evezőkre pillantott. hisztérikusan Lex. Lex megragadta a tutaj peremét. De későn.. csiklandozza odabent. Grant evezett. hogy ha valami érzékeny ponton találja el az állatot. amikor alig néhány pillanat múlva már csak a feje legteteje látszott ki a vízből. a szemek és az orrlyukak. . Egy korty víz kellett volna. Máris gyorsan haladt a nyomukban a lagúnában. a szemén vagy az orrán. Bőséges lakomája alaposan elálmosította. mint egy krokodil. hanem gyalogolt. Aztán megint ásított. Timmy! – sikította kétségbeesetten. de hatalmas fejét magasan a felszín fölött tudta tartani. hallgass! – szólt rá Tim. Ők már kis híján elérték a közepét. nagyobb buborékok tűntek fel a vízen. – Belefulladt? – Dehogy – mondta Grant. te kis hülye! – ordított rá Tim. A tyrannosaurus lustán ásított. A parton azonban a tyrannosaurus feltápászkodott.. – Mit tetszik csinálni? A tyrannosaurus már csak egy-két méterre volt. – Nem tehettem róla. úgy pedig sokkal gyorsabban halad. Grant csak akkor fogta fel. ahogy csak bírt. – Dehogy nem tud.. – Egy fenét nem! Te szerencsétlen! – Hagyjátok abba! – szólt rájuk Grant. közben visszanézett a partra. és a vízbe merült. Lexből hatalmas köhögés robbant ki. a tutaj vadul himbálózott a loccsanás keltette hullámzásban. A csónakban Lexből apró. hatalmas farkát ide-oda himbálva. különösen a sekély vízben. és üvöltött. – Csináljon már valamit! – sikította Lex is. Szánalmasan kicsinek tűnt a kezében. amint az óriás fej a gumicsónak alatt kipattant a vízből. mintha csak fegyverdörrenés visszhangzana körös-körül a tájon. talán akkor. és az állat pofájába csapódott. és úgy úszott. csak nagy bugyborékok maradtak utána a felszínen.. A lagúna szélessége itt nem volt több száz méternél. – Mindenki tudja. A tyrannosaurus most a csónak mellett bukkant a felszínre. az kiemelkedett a vízből. A fej mögött időről időre előtűnt a vízből a hát hajlata és a farok hosszában futó árkok. A parton a tyrannosaurus lelépett a dokkról. Ekkor azonban váratlanul egy másik ordítást hallottak.. Az állat most mellmagasságig a vízben volt. és csak egy hajszállal tévesztette el annak gumiperemét. – Kapaszkodjatok! – kiáltotta.. Az óriás fej a vízbe csapódott. és újra felordított. a lagúnába merítette a kezét... gurgulázó hangok törtek elő. de volt némi esélye. minden hüllő tud úszni! – A kígyó sem tud. mielőtt visszaesett volna a felszínre. szélesre tárta a pofáját. akár egy kutya. minden erejével a lagúna közepére igyekezett juttatni a tutajt. – Nem tehetek róla – súgta a kislány. Ha továbbhalad. majd gyűrűző hullámvonal indult el közvetlenül a felszín alatt. Csak úgy forrt a nyomában a víz. A tyrannosaurus a víz alá süllyedt. és vadul megpörgött. a világ legnagyobb krokodilja!” – Bocsánatot kérek. A víz fölött sodorta feléjük a szél. és csak lassan tért magához.Mindig a legrosszabbkor jön rá a köhögés! – Lex! – súgta összeszorított szájjal. ez mit jelent: valami kaparja. A kislány kétségbeesetten ingatta a fejét. Újabb.

a pofája még mindig teli tépett hússal. majd magasra emelte a fejét. amint a tutaj a lagúna egy kanyarulatát megkerülve északnak tartott.Amikor visszafordult. Grant bácsi? – kérdezte Lex. Még mindig alig kapott levegőt. A vízbe dugta egy kicsit a kezét. Lihegve feküdt a tutaj alján. – Jól van. mintha a világ legképtelenebb kívánságának kellene eleget tennie. A „nagy” is látta ezt. és gyors úszással a part felé indult. . – Elmegy! – sikította Lex. a folyó felé. s a reakció egy pillanatot sem váratott magára: azonnal megfordult. amit én mondok? – O-ké! – sóhajtotta a kislány. amelyet húzott. lehunyta a szemét. hogy mostantól fogva azt teszed. amint a dokk mellett felvágtatott a dombra. Lexnek igaza volt. neki a tutaj gumiperemének. A „kicsi” gyorsan még egyszer lecsapott a fejével. Grant az ifjabbik tyrannosaurust pillantotta meg a parton. A tutaj egyenletesen úszott észak felé. A leölt sauropoda mellett kuporgott. – Akkor hogy lehet. – A folyó árama. Nyilván elértük. és a nyomot nézte. hogy megvédje prédáját. Alig tizenöt perc telt el azóta. A „kicsi” belemart a tetembe. elrobogott a megölt sauropoda teteme mellett. – Elmegy! Rá. fenyegető ordítását. rá. és eltűnt a domb mögött. és elüvöltötte magát. A nagy tyrannosaurus üldözőbe vette. Grant az evezéstől kimerülten dőlt hátra. Az órájára nézett. úgy zihált. és alig hitt a szemének: negyed nyolc volt. Hatalmas testéről csak úgy repkedett a víz. és elaludt. mennyi az idő. aztán sürgősen menekülésre fogta a dolgot. – Megígéred. mintha el akarná tulajdonítani a zsákmányt. Még hallották távoli. – Elfáradtam – mondta Grant. – Nem is tetszik evezni – szólalt meg. hajrá! Hülye dinoszaurusz! A parton kihívóan ordított az ifjú tyrannosaurus. Grant hátradőlt. a hotel irányába. A felnőtt állat erre szinte kirobbant dühében a vízből. hogy utoljára megnézte. – Az áramlat észak felé vitte őket. és összecsapta kezét örömében. hogy mégis haladunk? Grant felült. Legalább két órának tűnt. Mellkasa vadul süllyedt és emelkedett.

ÖTÖDIK ISMÉTLŐDÉS Most kezdenek igazán súlyossá válni a rendszer hibái. IAN MALCOLM .

nos. – És azt honnan tudja. Gennaro kikászálódott a dzsipből. Szeret veszélyesen élni? – Miért ne? – mondta Gennaro. Muldoon sebességbe kapcsolt. A húgysavtól olyan fehér. Nagy kört írtak le a kocsival a letiport rész körül. Reccsent a rádió. – Látja azokat a krétafehér darabokat a fűben? Az hadrószéklet. amely a dzsungelfolyónak tartott. és elindult a füvön. Az állat pusztulása után. látja azt az óriási vágást a lapockák alatt. aztán befelé fordultak. Forróság uralkodott errefelé. hogy a tyrannosaurus nem később jött? – A harapások elrendeződéséről – felelte Muldoon. – Ennyi rohadt légy! – morogta. Valóságos csatatér terült el döbbent tekintete előtt: legalább százméternyi laposra tiport fű minden irányban. a rex a hadrosaurusok között járt. – A rex odakinn van valahol – mondta kisvártatva hunyorgó tekintetét a napfényes tájra függesztve. ugye? – az pedig csak a T. és egy keskenyebb üzemi útra fordult. hogy nem sok mozgást látok arra. rex elkapta. amely most a telep térképét mutatta. Sűrű légyraj reppent fel a fűből. Itt Muldoon kiszállt. hallgatta a légyzümmögést. De a hadróval az a nagy harapás végzett. – A példány száma HD/09. ahonnan a kis othnieliák ugrottak elő. De ha odanéz – térdmagasságú halomra mutatott a fűben –. – Az ürüléknyomokból – felelte Muldoon. – Ugyan. A váratlan zaj két kis othnieliát riasztott föl a letaposott fűből. Vígan utolér. Gennaro ujjaival dobolt a műszerfalon. – Dzsipben vagyunk. a négykerék-meghajtással is legfeljebb. és odasietett. Egy nagy pálmafa gyökerestül kidőlt. – Muldoon lehajolt a legyek közé. éppen előttük. s a forró levegőben ingadozó távoli pálmafákra meredt. Muldoon közben a dzsipben lévő komputermonitorral bajmolódott. Gennaro – rázta a fejét Muldoon. Semmi kétség. az a tyrannosaurus széklete. egyre távolabb a dzsiptől. Nagy vértócsák szanaszét a füvön. Mellette Muldoon felkattintotta a rádióját. Muldoon beindította a motort. szinte bűzös volt az őserdő. rex lehetett. és megvizsgálta a jobb láb sarkát. ahogy az esetlenül széthajigált végtagokat nézte. Mr. Szám volt rátetoválva. míg el nem érték a mezőn azt a részt. – Fiatal hadrosaurus – mondta a tetemet bámulva Muldoon. ez a kölyök elszakadt tőlük. ha nyolcvan-száz kilométeres sebességgel tudunk haladni. A dzsip keresztülrobogott a keleti utat szegélyező pálmafasoron. – Van egy hírem a számodra – mondta Arnold. és a T. Aztán egyszerre csak megállt. a lábai szanaszét. – Híred? Micsoda? – Megtaláltam Nedryt. A kimúlt állat húsát harapásnyomok tömege tépte szét. – Mi az? – kérdezte Gennaro. rajta a rácsbeosztás vonalai. – Hozza a rádiót! – mondta neki Muldoon. Kölyök. a rex gyorsabb a dzsipnél. Valami különös valótlanságérzet fogta el. – Mihelyt letérünk erről az útról. – De tény. Az otik ilyenek. – Mire várunk? Muldoon nem felelt azonnal. Az neki semmi.KERESÉS Gennaro ült a dzsipben. – Ezek az otiktól származnak. és rácsavarta a kupakot. . Sötét alakot látott a fűben. Muldoon szólalt meg mellette: – Semmi kétség. fojtó. – És nincs valamirevaló fegyverünk. – Muldoon sóhajtott. – Vezérlő? – Itt vagyok – hangzott John Arnold hangja a készülékből. rajta száradt vér. – Még egyszer meghúzta a whiskys üveget. egyre kisebb koncentrikus körökben haladtak. Gennaro a tetem fölé hajolt. – Meglódult az egész csorda. Vártak és figyeltek. – Ezt miből gondolja? – kérdezte tőle Gennaro. tőlük jobbra pedig egy kiemelkedő köves magaslat. – Látja ezeket a kicsiket itt? – A hasra mutatott. Már távolról megérezte a kezdődő rothadás savany-édes szagát. Dögevőktől. – Van még egy döglött hadrónk. Megpróbálhatjuk.

– Nem – mondta Grant. aztán felhasították a hasát.. ha a szemébe kapja az ember. gyerünk! – Na és ő? – mutatott a holttestre Gennaro. törékeny testű. Szürke fémcsőfélét vett elő. Amint közelebb értek. – Amikor Gennaro hátrálni kezdett. aki sosem tudja. hogy Lex a csónak orrában feláll. Nyolc óra. Látta. a belek kiszakítva. – A 1104-es szektor éppen előttünk van. amelyek nem messze kuporogtak a hátsó lábukon. Beült a kormány mögé. Az egyik felugrott. – Kompik – szólt Muldoon. mint a régi. Két órán belül kimosható antiveninnel. Nem mintha ez jelentett volna valamit ennek a nyomorult csirkefogónak. Békésen lebegtek a vízen a hol itt. mennyit ér az? Gennaro csak a fejét rázta. még mintha egy kicsit gyorsabban is haladtak volna. Távolabb az úton Gennaro betonakadályt pillantott meg. száradt hányadéké. – Valahol kétmillió és tízmillió dollár között – mondta Muldoon. Gennaro csak a szemét forgatta. Kezdett elege lenni abból. – A kislány az ágak között szaladgáló apró dinoszauruszokra mutatott. ami valami kísértetiesen emberi jelleget adott nekik. – Aminek látszanak – válaszolta Muldoon. Némelyik annyira lecsüngött. míg Muldoon kinyitotta a hátsó ajtót. – Nagy tétekben játszott az ürge. – Mit tetszik gondolni. – Indított. – Akkor sem. rászólt: – Csak óvatosan! Nehogy rálépjen valamire! Gennaro figyelmesen átlépett Nedry holtteste fölött. A forró levegő szinte állt az ágkupola alatt. Visszanézve Gennaro látta. mert nem te vagy a kedvence. De leginkább csend volt. – Hé. azt az egész vörösséget. de nem végzetes. Tátott szája és duzzadt nyelve körül legyek rajzottak. Megtörölték a pofájukat és az állukat. mit kell tenni! – De igenis tudja! – sóhajtott a húga újra. – Hiszen nem is a kompik voltak! – Hogyan? Muldoon a fejét ingatta. Nagy göcsörtös gyökereik a víz széléig nyúltak. – Megrázta a fejét. – Látja azokat a foltokat? Az ingén meg az arcán? Érzi ezt a szagot? Olyan. Tim élénkvörös bogyófürtöket látott az ágakon. mígnem fák és az alácsüggő levélzet odafönn egyesülve a napot is eltakarták. Ronda egy halál! Talán mégiscsak van igazság ezen a földön! A procompsognathidák sivalkodtak. Érezte jól. . Kisfiús arca most puffadt és vörös volt. s az ágak közt ugrabugráló kicsiny dinoszauruszok csiripelését. ezt észrevette. – Rakéták. Egy tucat procompsognathida állt az erdőszélen. Muldoon a csövet a másik dzsiphez vitte. nem nagyobbak a kacsáknál. hogy a kompik folytatják a lakomát. Borzasztó fájdalmas. kicsi ragadozók. Nézze azokat a sérülésnyomokat a szaruhártyák körül. – A dilophosaurus köpése.. – Ez dilónyál – mondta Muldoon. – Éppen ő az. A kis dinoszauruszoknak ötujjú kezük volt. Sőt. hogy Grant a főnök. – Bárcsak itt volna apu! – mondta. Tudja. – Mit vitt el? – kérdezte Gennaro. – Csak azért. és a magasba nyúl. és az embereket figyelték.. hogy megnézze a kis kompikat. – A mindenit! – szólalt meg Muldoon. Izgatottan csicseregtek.. amint a két férfi kiszállt a kocsiból. Tim néha madárdalt hallott. Lex. Két sötét hengert nyújtott oda Gennarónak. Gennaro már látta is a kocsi mellett a holttestet. és a faágakat nézte odafönn. és fel-le ugráltak. és zöld volt – ám ahogy a dzsip odagurult és fékezett.– Távirányítású videokamerával találták meg – mondta. egyik lábát átharapták. – Nekünk dolgunk van. – Hogy ő? – kérdezte Muldoon. úgy csipegette az orra húsát. és egy rozsdamentes acélból készült dobozt. – Ő mindig tudja. Grant az órájára pillantott. A kislány kelletlenül sóhajtott. mit kell tenni. és. A folyómeder egyre szűkült. hogy megérinthették. a zöld alakok szétszóródtak. mint eddig. – Ezek mik? – kérdezte az. hol ott feltűnő fényfoltok között. Közelebb és közelebb kerültek egymáshoz kétfelől a partok.. A dilók megvakították. Dennis Nedry a hátán feküdt. – Megtalálták a kompik. Gennaro gyorsan elfordult. ezek a bogyók ehetők? – A fákra mutatott. rátelepedett Nedry nyitott szájára. te mit csinálsz! – kérdezte. mellette egy parkoló dzsipet. – Ne beszélj hülyeségeket! – vágott közbe mérgesen Tim. Teste össze volt marcangolva. – Wu szerint tizenöt embriót. – Nyilván rossz helyen tért le a szemét kis csirkefogó – mondta Muldoon.. – Miért nem? Azok a kis dinoszauruszok eszik őket. és betette hátulra. – No. A mellettük elhaladó fákra függesztette szemét. Alaktalanul olvadt össze a környezettel. Grant immár éberen feküdt a hátán.

tőlük északra. de Grant felemelte a kezét. amit akarok. – Nézzétek! Nézzétek! A madárház óriás kupolája tornyosult közvetlenül előttük. – Nagy szám! – mondta erre Lex. halványsárga kis dinoszauruszok ugráltak ágról ágra. Grant nem felelt. kit érdekelnek a dinoszauruszok? Csak az egészen kis fiúkat – mondta Lex. – Sehol sem jelentkezik – szólalt meg Arnold hangja egy perc múlva ismét. A geodetikus szerkezet mintázata tompán csillogott a könnyű párán át. s a letiport füvet nézték. és csak most fogta fel. Percek múlva azonban a tető már oly magasan felettük ívelt. Kikászálódtak a csónakból. Grant eddig csak távolról látta. – Úgy emlékszem. Immár a kupolán belül sodorta tovább őket a víz. Vérfagyasztó sivítás hangja szólt valahonnan távolabbról. – Szerintem szándékosan nyitottnak készült – válaszolt rá Grant. – Tudod. – Ha igazán nagyok. Mindhárman felfelé meregették a szemüket. ahol a hadrosauruscsorda futásnak eredt. – A francba! – dühöngött Muldoon. Aztán a kötelet egy fához erősítette. A mozgásérzékelők sem találják. az hétszentség! – Újra a sauropoda részben voltak. De aztán elnémult. – Na ne mondd! És ezt honnan tudod? – Aputól. Csőrös fejük volt. és elindultak a pálmafák sűrű erdején át. milyen hatalmas a valóságban: legalább négyszáz méter volt a kupola átmérője. – Hátha lesz itt egy telefon – válaszolta Grant. – De hát akkor kiröpülhetnek a madarak. . Onnan. Tim kiabálni kezdett dühében. – Ennyit a mozgásérzékelőitekről! Hát Grant meg a gyerekek? Őket látjátok? – Őket sem találják a mozgásérzékelők. Fenn a levelek között alig félméteres. lábuk meg-megcsúszott a sáros parti emelkedőn. akkor nem – mondta Grant. ott. – Utánanézünk – válaszolta Arnold. – Mi az. csend legyen! – Miért? – kérdezte Lex. – Meg akar állni? – kérdezte Tim. és nem a sport. és kilépett a vonalból. és ha. – A part felé kormányozta a tutajt.. ahová a folyó tartott. Az elemek között vékony háló feszült.. – Microceratopsnak. – Eddig miért nem nézett utána? Miért nem követte nyomon? – Honnan tudjam? – kérdezte Gennaro. A rádióba beszélt: – Merthogy itt nincs. nemcsak engem. hány száz tonnát nyomhat az üveg. hogy hívják ezeket? – kérdezte Tim. mint a papagájoknak. s Grant először arra gondolt. hogy nem jelentkezik? – Nincs a monitorokon.Tim szótlanul elfordult. hogy üveg nincs is ott – csak a gerendázat. hogy szinte teljesen beleveszett a ködbe. Grant kihúzta a tutajt a vízből. van itt egy második szálló a kupola alatt – szólt Grant. A tyrannosaurusnak nyoma sem volt sehol. – Ez nincs befejezve – szólalt meg Lex. téged a számítógépek érdekelnek. ha nem több. csak bólintott. – És akkor most mi az öregistent csináljuk? – kérdezte Muldoon. Muldoon Gennaróhoz fordult. – Gyerekek – mondta –. – Vagy mozgásérzékelők. – Várjatok! – volt Arnold válasza a készülékből. – Hát hol a fenében van az az átkozott rex?! – kérdezte dühös hangon Muldoon. – Meg kell próbálnunk felvenni a kapcsolatot a vezérlőteremmel. – Azért ne félj! Apu téged is szeret. mert ő is meghallotta. Jó. A folyó bevitte őket a kupola pereme alatt. míg rá nem jött. – Én azt mondok. Múlik az idő. Na és? – Apu igazi sportbolond – magyarázta Grantnak Tim. – Utánanézünk – utánozta gúnyosan Arnoldot. – Tudod. – Néhány pillanat múlva már látták is egy épület tetejét a fák fölött. – Azt hittem. nagyon is érdekel.

. A kapcsolótáblánál ült. – Tudom. Ez pedig ténylegesen annyit jelent. – Egy cseppet sem egyértelmű mennyire is buták azok az állatok valójában – mondta Malcolm. aztán elveszett. de az nem éppen a legbiztonságosabb útvonal. De lehet. – És Grantot meg a két srácot sem leli. – A park minden rendszere újra működik. a dactylusokat már a kupola alatt helyeztük el. – Maga szerint Grant és a gyerekek is kerülik a megfigyelést? – Ők holtbiztosan nem – mondta Malcolm. nem? – Hát legalábbis nem találom. A szobájában volt. vagyis tizenegy órája. – Még hogy nem elégséges? – csattant fel Arnold. Vagy a folyón vannak. – Jó. Malcolm köhögött a vonal túlfelén. tudniillik keresztülhalad a madárházon. súlyos sérülésekkel tudtuk csak kihozni onnan. ott összecsukják a szárnyukat. Szombat reggel nyolc óra volt. A mi halevőink ugyanis területi alapon állnak. – El nem tudom képzelni. amely csak az övék. a dzsungelfolyót. – Pedig egyszerű az oka – mondta Malcolm. hogy valami más problémájuk van. mit. – És ha csónakon jönnének a vízen? Idehozná őket a folyó? Egészen végig? – Igen. – És a dactylusok nem szenvednek sérüléseket ettől? – Eddig még soha. Azóta. Nem értem.. hogy bármely állat szabadon járhat-kelhet a parkban. Mint kiderült. Ő meg a gyerekek biztosan minden mozgásérzékelőnek integetnek. Az eredeti terveken a fák tetejével egyező magasságú szállóépület szerepelt. miért. – Alig tudtuk felállítani. Lehetetlen ott végiggyalogolni. ez óriási hiba volt. – A mozgásérzékelők által lefedett terület nem elégséges. a repülési magasságuk szintjén nézhették volna a látogatók a pterodactylusokat. hadd szokják. hogy nincsenek ott – tette hozzá aztán jóval bizonytalanabbul. magasan a talaj felett. – Hiszen kilencvenkét százalékát. – Felsiklanak a madárház kupolájának tetejéig. Egy ilyen húsz-huszonöt kilós állat úgy leterít egy embert.. hogy Nedry tönkretette a Juraparkot irányító számítógépet. – Grant nem bolond. – Területin? – Méghozzá keményen – mondta Arnold. A vezérlőterem padlóját lassan beborították a papírtálcák és a félig elfogyasztott szendvicsek maradványai. Már hívtam orvost magához. hacsak nem tért nyugovóra ismét. – Nem látom a rexet. A szárazföldi terület kilencvenkét százalékát lefedik – mondta Malcolm. hogy ezt tudják. Arnold türelmesen. – Például a rexet? – Semelyik rendszer nem jelzi. egyenként sorra keltette életre a különböző rendszereket. – Támadnak? – De még hogy! Azt látni kell – mondta Arnold. miért volnának a folyón. amit keresek.. Ő nyilván éppen azt szeretné. . de még ha így is volna – vitatkozott Arnold –. Négy dactylusunk van most a madárházban – ezek voltaképpen cearadactylusok. az állatok túl buták ahhoz. ott hívta fel Arnold. ha mondjuk egy üzemutat követ. de Grantot meg a gyerekeket sem. igaz? – Nem. mintha egy halom tégla csapná fejbe. hogy az a bizonyos fennmaradó hányad topográfiailag egységes. Nagyon összeszűkül a part. és újabb csésze kávét hajtott fel. – Szóval ha azok a gyerekek a madárházban vannak. amely egyáltalán bemerészkedik az általuk kijelölt területre. Magyarán egybefüggő területről van szó. Onnan a kupola alatt. amelyek halevők. – De a mozgásérzékelőkkel gondja van. és kikerülheti a megfigyelést. a kastélyban. – Miért nem szerepelt a madárház a túra útvonalán? – kérdezte Malcolm. – Nincsenek! – vágta rá Arnold. Arnold kimerült. – Én legalábbis őszintén remélem.. amiről nem tudunk. – És mi baj velük? – Míg az épületen dolgoztunk. a partot vagy mit tudom én.A MADÁRHÁZ – Egyszerűen nem értem – mondta a telefonba John Arnold. és zuhanásba kezdenek. és bármely más állatot megtámadnak. – Megküzdenek egymással a maguk területéért. – Csakhogy ha a maradék területet kivetíti a térképre. látni fogja. amely a szemük elé kerül.. ha észrevennék. miközben megint elfogta a köhögés. Jók már a telefonok is. Több munkásunkat ájultan. Körülbelül húsz perce indult északnak a lagúna partja mentén. és hibátlanul funkcionál.

Mint valami óriási denevér. Pillanatok múlva elborította őket. hogy az egyik dactylus hátsó karmaival a kislány vállába kapaszkodik. és a hajába markolt. Futottak a réten át. nagy szárnycsattogással elrepült fölöttük. mint az első. Ugyanakkor meglepte. s a hatalmas árnyak csapkodva libbentek el fölöttük. hogy kiterjesztett szárnyuk távolsága legalább öt méter. Aztán egy másik füttyszót. s látta.. valami okból nem fejezték be – mondta Grant. Aztán Grant felhőárnyat vett észre előttük a füves réten. – Tűnés! – kiáltotta Grant. úgy húzott el közvetlenül a fejük fölött. kecsesen megfordult. Grant a fölöttük magasló kupola rácsszerkezetének árnyékát nézte a földön. Az egyik dactylus csigavonalban leereszkedett. repülő állat döbbenetes látványa. Még a napot is eltakarta. Amikor lejjebb ereszkedtek. menjünk vissza a hajónkhoz! Előbújt a nap is. – Nem láthatnak minket? – kérdezte. és kézen ragadta a gyerekeket. majd egy harmadik és egy negyedik is. Grant egy szemvillanásnyi ideig látta fogakkal teli csőrét és a szőrös testet. visítva. Óriás. ott . Csak cearadactylusok lehetnek. Fenn a magasban a pterodactylus mély füttyszót hallatott. – Akkor gyerünk. Miközben Grant nézte őket. hátulról jött. mély füttyszót hallottak. A levegőt is valami jellegzetes. mint amit az épület oldalán is észrevett. Hosszú. és sikítva feléjük zuhant. – Gyerünk! – mondta. A hatalmasra tárt szárnyak közt feszülő rózsaszín hártya egészen áttetszően vékony volt. és újabb néhány métert futottak mindhárman. repülő dinoszauruszok. Meleg levegő fuvallata csapta meg őket. éppen amikor a két dactylus fütyülve. – Ez meg mi? – Nem tudom. De már talpon is volt. sivító hangot hallattak. Halat esznek. ahogy a tutaj felé igyekeztek. Igyekezett titkolni a csalódottságát. Sokkal gyorsabban repült. magával rántva a gyerekeket is. – Ez egy szeméttelep! – Úgy látszik. az – felelte neki Tim. és vidámabbá varázsolta a reggelt. Hiszen oly szépek. és felnézett az égre. amikor elvette a kezét. fejük pedig mint a krokodilé. amely az erdő túlfeléről jött válaszul. Grant érezte. „Halevők – jutott eszébe. melyeken átsütött a napfény. – Hogy lehet az. Mintha csak valami hatalmas árnyék húzott volna el fölöttük. Közben valami ijesztő. – Ez egy pterodactylus? – Igen. – Megharapott! Megharapott! – Véres volt az ujja. Kis. pergamenszerű szárnyai. egy második pterodactylus is megjelent az égen. Látta. – Nem hiszem. hogy ezek nem közönséges pterodactylusok. hogy nem fejezték be az épületet? Vadvirágokkal beszórt. Grant nem szólt. Éppen futni kezdett volna. hogy éles karmok tépik fel az ingét a hátán.. a korai krétakor repülő sárkánygyíkjai. a testük szőrös. – Jaj! – kiáltott fel Lex. Grant ugyanezen töprengett. hogy a talajt és a növényzetet mindenütt ugyanannak a fehér anyagnak a széles csíkjai borítják. Biztos a madarak potyogtatták el. – Hát ezek tényleg nagyok! – Aztán egy cseppnyi szünet után megint megkérdezte: – Biztos. sötét alakokká összehúzódva zuhantak a föld felé. gondolta. – Hű! – szólt Lex. Hátrafordult. s látta. savanykás szag töltötte be. – Megharapott! – Mit csinált? – döbbent meg Grant. hogy nem bánthatnak bennünket? – Majdnem teljesen biztos. Fenn a magasban kisebb repülőgépnek látszottak. miközben a két madár oldalra billentve ismét megfordult a magasban. alacsony fűvel borított tisztásra léptek. oly kecsesek és méltóságteljesek voltak a levegőben sikló. Felkászálódott. – De vajon ezek miért nem szerepelnek a kiránduláson? – kérdezte Tim. amikor Lex rémülten felsikított. Grant látta rajta a madárürülék fehér csíkját. Felnézett. Az órájára nézett. Túl nagyok hozzá. Grant eszében azonban az járt. hogy az állatokban minden nagyságuk ellenére van valami törékenység. felrántotta Lexet. és visszafelé vitorlázott feléjük. hogy egy hatalmas sötét alak siklik el fölöttük. Megint az utolsó pillanatban nyomta le a gyerekeket a földre. elvarázsolta az óriás. Fenn a magasban két újabb dactylus csukta össze a szárnyát. Ám ez az árnyék igen sebesen mozgott. Grant az utolsó pillanatban vetette magát a földre. Ekkor csapott le a második dactylus. – Mik ezek a fehér izék? – Gyíkürüléknek látszanak. láthatóvá vált. és savanykás szag maradt a levegőben utána.” Lex kezével beárnyékolta a szemét. Szinte megbénította. – Juj! – kiáltott fel Lex. – Fuj! – mondta undorral Lex. – Talán mert nincs még kész az épület – mondta Lex.– Ez egy kastély? – kérdezte utálkozva Lex. – De büdös van itt! – szólt Lex. közben hallották a közeledő süvöltést. – Dél-Amerika és Mexikó.

– Biztos már nem is él szegény! – Dehogy nem. Mintha sátorban lett volna. Az az ütéstől a hátára zuhant. kis szárnykarmaira emelkedett. Fogadok. mi volt a stegosaurusnál? Tegnap este? – Hogyne. hogy Lex karjával próbálja védeni a fejét.. és üldözőbe vették az elsőt. amikor mind nőstény. és vadul csapkodott a karjaival. nem volt más. – Nos. hogy ennyivel is hamarább érnek majd vissza. s megint összeértek a fák. az állatvilágban a szaporodásnak és a szexualitásnak szinte elképesztően sok változata létezik. De lehet. elvesztette az egyensúlyát. sok helyütt a három métert sem érte el. De a madárházban lezajlott kaland után Grantnak valahogy nem akarózott újra elhagyni a vizet. Grant felnézett. hogy visszaérjenek. visszafordult a hátáról. amely sivítva. És különleges méret. nem hallott. Talán nyolc-kilenc kilométert. Az állat sivított. Grant elképedten megállt. s Grant a szőrös testre esett. amikor elhagyják a tutajt. Grant megint az órájára nézett.. Lex sikoltozott. Lex felnyúlt. fel a magasba. Grant csak találgatta. De még mindig ott az a probléma. Egyelőre különben is jó tempóban haladtak. Grant ellökte magát a dactylustól. csak a csapkodó szárnyak. és megdöglenek. Kellemes érzés volt. mire a dactylus váratlanul elfüttyentette magát. míg nehézkesen a levegőbe emelkedett. Most sebesebben haladtak. aztán a többiek nyomába eredt az is. hegyes pofájával. hogy semmi baja. s a lecsüngő ágak is gyorsabban siklottak a fejük fölött. – Én is remélem. csipogva csapkodott a szárnyaival. Az állat fel akart emelkedni. – Én is – mondta Tim. – Mi történt? – kérdezte Grant. Küszködés közben többször is a kislány feje felé kapott hosszú. Tud járni a szárnyain! Lederer elképzelése helyes! De aztán a többi dactylus is rájuk vetette magát. és egész testével az állatra vetette magát. amint a vízen lebegve maguk mögött hagyták a madárház kupoláját. Karmos lábak kapkodtak vadul a mellkasa felé. Ez akár azt is jelentheti. A folyó jobban elkeskenyedett. Hogyan szaporodhatnak. miközben futni kezd. – Nos. amióta elhagyták a raktárépületet. – Ez igaz. – Tetszik még emlékezni. és ez esetben alighanem hatástalan. szélviharban. A negyedik dactylus esetlenül csapdosott. – Csak azt remélem. mi történt. Ekkor azonban a kislány hozzávágott valamit. – Pedig márkás volt. és elindult rajtuk. hogy jó néhányat. de biztos. és csapkodott a csőrével. hány kilométert tehettek meg eddig. – Kíváncsi lettem volna. A sebességtől egy kis szellő támadt körülöttük a faágak alatt. Nem látott.. – Jól vagy? – Persze. De azt is jelentette ez. mint eddig bárhol. felugrott. Grant pedig szédült. Grantnak semmi más nem jutott eszébe. és felemelkedett. megfulladnak tőle. Abban a pillanatban a magasba emelkedett a másik kettő is. hogy meglovagoljam – sóhajtott a kislány álmosan a meleg naptól.. ha mind az? – Hogyan? – kérdezte Tim. s a tetejében még be is sugarazzák őket. ahol az éjszakát töltötték. Lex örömkiáltásban tört ki. Lex szólt közbe: – Timet nagyon izgatja ám a szex! Oda sem figyeltek rá. Már előttük is volt a csónak a parton. – Miért tetszett a béka-DNS-ről érdeklődni? – A szaporodás miatt – felelte Grant. Szerintem. hogy a dinoszauruszok mindegyike nőstény. Lex sikított. pergamenszerű hártyák. odarohant. és hátrébb húzódott. engedi-e. hunyorogva igyekezett kivenni. hogyan szaporodhatnak a dinoszauruszok. miközben az óriás szárnyak a teste körül suhogtak. Tim átölelte a húga vállát. ez itt be is fog bizonyosodni. s az áramlás is felgyorsult. A három dactylus haragos sivítással üldözőbe vette az elsőt.csapkodtak kétfelől Lex mellett. Ismét útnak indultak. csakhogy Lex túl nehéz volt neki. És máris lecsapott az első. – Nincs rá magyarázat. hogy esetleg már csak egy órányi gyalogútra lesznek a szállótól. Aztán a felmagasló part ismét összezárult. te buta – mondta a kislány. s a meleg gumitest alatt átfolyó víz halk mormolását hallgatta. – Az jutott eszembe. a besugárzás köztudottan igen megbízhatatlan eljárás. Magukra maradtak a réten. hogy megérintse a lecsüggő ágakat. hogy vajon hogy van Ralph – mondta Lex. a sivítás és a száraz. – Pedig de nagy szám lett volna Ralphon lovagolni! Tim fordult Granthoz. Tim meg teljes hangerővel ordít. Nyolc harminc. sem Grant. sem Tim. . s borzadva látta. Már csak két és fél órájuk van rá. Grant hátradőlt a tutajban. – Elvitték a kesztyűmet – mondta Lex. hogy még annál is többet. Grant elrántotta a fejét az állkapcsok elől.

amelyet aztán a nőstény később magához vesz. mint ez. Megint felhangzott a vicsorgó morgás. Ezt képtelenek felfogni. Miért. Megszökik. Dühödten rázta az ágakat. Töltse fel a fürdőkádakat! Ellie elkomorult. hogy éppen csak elfért rajta a tutaj. – Figyeljetek csak! Morgást hallottak. A szűk látókörű gondolkodás eredményeként. – A Malcolm-effektus értelmében katasztrofális változások várhatók. – Mondja. – Nem azt kérdem. Nincs igazi látókörük. amint a hajót magával sodorta az áramlat. – Úgy hangzik. igaz? – Semmi bajom vele. Wu is olyasféle. A tutaj úszott velük tovább. – Akkor menjen végig az összes szobán itt az emeleten. Vannak állatok. Attól. mintha egy csomó bagoly volna ott – szólt Tim. ami közvetlenül a szemük előtt van. mint az embereknél. hogy bármi olyasmit tenne. szaladgáltak és ugráltak fel-alá. amely egy kicsit távolabb. Grant pedig vadul evezni kezdett a túloldal felé. amit mi szexnek hívunk. Hogy kiszámíthatatlan lesz.. majd felordított. a csónak előtt haladt. Reszkettek az ágak a nyomukban. de azt már nem feltételezzük róla. Aztán a huhogások is. – De nem is egy van belőlük. Mind a kettő technikai szemmel nézi a világot. A hatalmas állkapcsok a tutaj felé kaptak. Az órájára pillantott. Ez a fajta kapcsolódás nem kíván olyan nagy fizikai különbséget hím és nőstény között. Grant fülelt. mennyi vizünk van? – Mit tudom én? Elég folyik a csapból. – De mi van a békákkal? Hirtelen sivalkodás zaja hangzott fentről a fák közül. az biztos. ott sivítoztak. Tim és Lex tehetetlenül nézték. Mennyi van összegyűjtve? Eltéve. amelybe ismétlődő. Szűk látókörűen gondolkodnak. Tovább indult a folyó mentén. Ha a tyrannosaurusnak sikerül áttörnie. huhogó kiáltás vegyült. előttük volt a folyón. – Gyűlölöm! Gyűlölöm! – mondta Lex. Olyan keskeny volt a folyó. De a fák túl sűrűn szegélyezték a folyópartot. – De hiszen Arnold szerint az összes rendszer kifogástalanul működik. mint amilyet általában el szoktunk képzelni. vagy jobban hasonlít egymásra. Aztán visszahúzta a fejét. s a microceratopsok rémülten szaladtak szerteszét. rángatta és forgatta a fejét. Látták a tyrannosaurus óriás.. hogy csak nézőköre van valakinek. hogy létrehozunk egy állatot. Malcolm sóhajtott. Mintha csak alagútban hajókáztak volna. Van egyáltalán? Ellie vállat vont. A tyrannosaurus tovább követte a folyót. Nem látják a következményeket. Ellie megkérdezte: – Maga nincs valami nagy véleménnyel Arnoldról. mire készül? Földrengés lesz? – Valami olyasmi – mondta Malcolm. és nem adta fel. – Továbbá – folytatta Malcolm – Walkie-talkie-jaink vannak-e? Hát zseblámpáink? Gyufánk? Petróleumfőzőnk? Ilyesmi? – Körülnézek. hogy élőlény módjára fog viselkedni is. Tim bólogatott. – Mi csinálja ezt? – kérdezte Lex. amelyeknél a hím és a nőstény sokkal egyformább. A kis microceratopsok mind a másik partra menekültek. . A hím spermahordozót bocsát ki magából – ebben van a sperma –. és otthagyta őket. Nem látják a környezetüket. Aztán végre felhagyott a hiábavaló próbálkozással. a sorsuk megpecsételődött. De műszaki ember. Lex rémülten sikított. amely anélkül szaporodik. A tyrannosaurus fennakadt a sűrű növényzeten. A hangok egy kanyar mögül jöttek. hogy megállítsa a hajót. és rést keres a fák között. de a folyó szélessége csak három méter volt. – Pontosan olyankor szokott bekövetkezni – felelte erre a matematikus. Malcolm felnyögött. De megint csak csődöt mondott. sötét alakját a partot szegélyező fákon keresztül. Újra hallotta a huhogást. s ott megragadott egy ágat. hogy a tyrannosaurus újra meg újra kísérletet tesz rá. hogy áttörjön. – Hé! – kiáltott fel Lex. Csak nézőkörük – én legalábbis így hívom. amint északnak tart velük együtt. Mert olyan nincs. Már kis híján kilenc. A gumiperemek gyakran a földet súrolták.– Például nagyon sok állat van – mondta Grant –. így jöhet létre egy olyan sziget. A tutajban Grant. A túlpartra evezett. – Nem kaphatok morfiumot? – Még nincs itt az ideje – mondta Ellie. Grant megrendülten dőlt hátra a csónakban. A következő pillanatban a tyrannosaurus óriás feje tört át bal felől a levelek sűrűjében. – Fogalmam sincs – mondta Grant. – Nincs. s ezt „célirányos” gondolkodásnak mondják. Csak azt látják.

Mellékhatások. mert nem történt semmiféle haladás – felelt saját szónoki kérdésére Malcolm. Malcolm felsóhajtott. Négyszáz éve létezik a modern tudomány. . ha elérik. Mindig marad nyoma. helyes-e. ahol tiszta volt a levegő. mi az igazság a természetben. mire jó és mire nem. és megszakította a monológot: – Nem gondolja. hulladék meg mellékhatások. hogy egyszerűen ilyen az emberi természet? – kérdezte Ellie. Ami voltaképpen igaz is. Hogy csak értékeljék. és elvégezték a maguk felfedezését.. Szó sincs róla. így aztán csak az számít.. Ezzel megnyugtatják magukat. – Te jóságos ég! – mondta. Mindig. gyönyörűek a naplementék. miszerint ők azt kutatják.. – A nők ma ugyanannyi órát fordítanak háztartási munkára. Ennyi idő után már tudnunk kellene. – Dehogy – felelte Malcolm. ha ők nem teszik meg. – Úgy látszik. – Hát azért. minden. hogy eltúlozza. Hiába a porszívó. A fennmaradó időben játszhatott. dehogy! – mondta Malcolm. – Nem is tudom. s immár egész társadalmak igyekeznek „tudományosak” lenni ezen a földön. Gondoljon bele! Heti húsz! Harmincezer évvel ezelőtt! – Maga visszafordítaná az órát? – kérdezte Ellie. Muszáj. Melléktermékek. – Ez olyan. – Kér egy kis vizet? – Nem. hát majd megteszi más. tette. – Csak a hulladék marad. – Csakhogy a tudósok pontosan ezt akarják. Hogy beilleszkedjenek a természet rendjébe. A felfedezés – gondolják ők – elkerülhetetlen. – A teljesítmény. ami jólesett. alhatott. Ezért hát arra összpontosítanak. Abba soha bele nem gondolnak. hiába az úgynevezett haladás. hogy ott jártak a tudósok. harcias behatolás. Kizárólag a nyugati iskolázás eredménye. Mindenhová be kell dugniuk a műszereiket. Minden felfedezés erőszakot tesz a világon. s a világ többi részén – szinte mindenütt – rosszul lesznek tőle. hogy csak nézzék a dolgokat. az eredmény. mint 1930ban. akiknek csak „nézőkörük” van! Ne az övék legyen a hatalom! – De hát mi lesz akkor a haladással? – Miféle haladással? – kérdezte bosszúsan Malcolm. hogy meglegyen az élelme. az az. ha az emberek felébrednének végre. nem hozzák rendbe a földet az ásatás után? – Nem. ami a fejükben jár. amit látnak. És természetes világban élt. – Kopár vidéken – mondta a fejét ingatva Malcolm. a mikrohullámú sütő. és egyre katasztrofálisabb a hatása. – Megvonaglott a fájdalomtól. – Vagyis ásatásra még jut. Muszáj valami természetellenes dolgot tenniük. hogy a tudósok pontosan így akarják! Melléktermék kell nekik. de a helyrehozatalra már nem? – Kopár vidéken dolgozunk. Hatalmas arzenálra van hozzá szükség. a ruházata és a fedél a feje fölött. csak éppen nem ez hajtja őket. A részecskegyorsítók felsebzik a tájat. – Csak azt szeretném. Gondolom. mint 1930-ban. – Eltúlzom? Hogy néznek ki a maguk ásatásai úgy egy év múlva? – Hát elég pocsékul – ismerte be Ellie. hogy ők legyenek az elsők! Ez a tudomány játszmája. – Te jó ég. – Harmincezer évvel ezelőtt.. Mindez beleépült a tudomány szövetébe. ugye. a lascaux-i barlangrajzok korában az ember heti húsz órát dolgozott. – Nagyot sóhajtott. – Ez izgat legkevésbé. – Szóval ültetik be a terepet. csak megfigyeléseket végezzenek. hogy szalonnás rántottát reggelizünk. a mosogatógép. Csak azt szeretném megértetni magával. Még a legtisztábban tudományos felfedezés is agresszív. hogy nyomuk maradjon. Grant az egyik ágtól a másikig kapaszkodva hajtotta előre a hajót a dzsungelfolyó sötét alagútjában. és lehunyta a szemét. hogy el tudnak-e érni valamit. Aztán megpillantotta a dinoszauruszokat. és radioaktív melléktermékek maradnak utánuk. Miért telik ma is ugyanannyi időbe kitakarítani a házat. Ez a tudós dolga.. mint „az igazság keresése”. A hangok nem szűntek.. és hátrahanyatlott. arra már nincs pénz. Roppant kényelmesen „értelmezhetetlennek” mondják az efféle megfontolásokat. Senkit sem hajtanak olyan elvont dolgok. Az nem lehet. kérdem én? Ellie nem válaszolt. utána pedig a szó szoros értelmében megváltozik a világ. a szemétledobó.. Megmondjam magának.. mi a baj a mérnökökkel és a tudósokkal? A tudósoknak részletesen kidolgozott elméletük van rá – baromság az egész! –. szépek voltak a fák. tiszta a víz. mintha azt mondaná: az az emberi természet. Itt az idő a változásra! – Mielőtt elpusztítanánk a bolygót? – kérdezte Ellie.– Nem gondolja.és szárítógép. a morfiumtól filozofikus leszek. – És miért nem? Ellie megvonta a vállát. Az űrhajósok szemetet hagynak a Holdon. Ellie kihasználta az alkalmat. a mosó. – De akkor mi a válasz? – Szabaduljanak meg azoktól. Mert.

a foltok is kisebbek a hátán. Két ívelő taréj futott végig a fejük tetején. A tyrannosaurus felüvöltött. alighanem meglátta a tutajt. amelyek még mindig hátat fordítottak a folyónak. mint a száradt hányás szaga.. vicsorogtak és huhogtak. szertartásszerű ismétlődés volt a viselkedésükben. A dilophosaurusok trombitálása hangosodott. – Grant tudta. ivott. végre kaptunk egy kis segítséget. Alul a hasuk élénkzöld volt. a szemüktől az orrukig. – Csak ez hiányzott! A tutaj hosszan. . bármi is történjék! Oké? A tutaj lassan sodródva elindult a folyón a huhogó dilophosaurusok felé. Lex Grant lábánál feküdt. Kettő állt a folyóparton.– Nem ezek azok. – Hiszen ez párzási rítus! – Nem tudunk elmenni mellettük? – kérdezte Tim. aztán huhogott. A jobb oldali állat erre visszahuhogott. A bal oldalon álló állat lehajolt. – Ez mi? – kérdezte Lex. – Akárhogy is! A dilophosaurusok csak ittak és huhogtak tovább. hosszú fogsorait. aztán elvonult. és ne moccanjatok. a dilók erre huhogtak.. Az megint át akart törni a növényzeten. nem törődnek semmivel. Az egyik dilophosaurus úgy tűnt. Dilophosaurusok. – Most mit csináljunk? – kérdezte megint Tim.. V alakot formázva a fejen. csúszott a köves. Ilyenkor nem esznek. Grant felkapta a fejét. – Egek! – mondta. Háromméteres testüket sárga és fekete foltok borították. – Ha tudnám! Leült a tutajban. – Nem.. Mindkét állat elfordult a folyótól. A mozgásuk viszont madárszerű volt. gyerekek! Most lefeküsztök a gumipadlóra! Megpróbálunk olyan gyorsan elhúzni mellettük. Lex suttogva kérdezte: – Szálljunk ki. a másik pedig visszahuhogott neki. és a lábukkal dobogtak a sárban. – De a csónakban nem mehetünk el mellettük – mondta Lex. Ahogyan Grant már sejtette. Órájára pillantott. Puff! A tutaj megállt. A tutaj elúszott mellettük.. hogy a jobb oldali állat kisebb. amint egymásra morogtak és huhogtak. amely kölcsönösnek tűnt. hogy efféle rítusaikat az állatok néha órákig művelik egyfolytában. Ám a következő pillanatban. hogy átférjenek a folyót szegélyező fák között. s ekkor különös szagot éreztek. Grant pedig visszafojtotta a lélegzetét. – Ezek megmérgeznek! – Pedig muszáj – mondta erre Grant. és az is ivott. A dilophosaurusok egyszerre csak izgatott tülkölésbe és bőgésbe kezdtek. éppen a víz legszélénél. Kilenc óra húsz. Utána elölről kezdődött az egész. pontosan ugyanúgy. és rémült szemeket meresztett rá. – Ide figyeljetek. Grantnak feltűnt. A dilophosaurusok kisebbek voltak a tyrannosaurusnál. Édeskés és undorító volt egyszerre. A tyrannosaurus még egyet bömbölt. szinte tükörképét adva az első állat mozdulatainak. a taraja nem annyira élénkvörös. amennyire csak lehet. kimutatta csupasz. és menjünk gyalog? Grant nemet intett a fejével. De egyet ne feledjetek: ki ne nyissátok a szátokat. Valami furcsa. pontosabban fennakadtak a part víz alatti részén. aztán felkapták a fejüket. A tutaj még egy utolsó kanyart megkerült. Közeledtek a dilophosaurusokhoz. Aztán fokozatosan felgyorsult. idegtépően csikorgott. Tágra nyitotta száját. Grant elmosolyodott. A dilophosaurusok méterekre voltak tőlük. Zátonyra futottak. tülköltek. – Azt hiszem. és most ellenkező irányba nézett. úgy hajoltak rá a vízre. A szag szinte kibírhatatlanul undorító volt. sáros talajon. Ráadásul a mozgásuk is gyorsnak látszott. elég kicsik ahhoz. Folytatták az utat a folyón. – Óriási! – suttogta Lex a csónak fenekén. A tutajt továbbsodorta a víz lefelé a folyón. De aztán ismét mozgásba jött. Grant nagyot sóhajtott válaszul. Grant ennek ellenére előhúzta a légpisztolyt. De aztán újra elhuhogta magát. amelyek mérgezőek? – De igen. A tutaj folytatta útját. s a folyón túli fák felé tülköltek. hogy igyanak belőle.. meglepődött. mint a gyíkoké. és megvizsgálta a tárat. még mindig csak néhány méternyi távolságra a dilophosaurusoktól. ameddig így állnak. – Ellökte a tutajt a parttól. a dilók tülkölése a tyrannosaurusnak szólt.

A TYRANNOSAURUS

A dzsip bukdácsolt a tűző napon. Muldoon ült a vezetőülésben, mellette Gennaro. A nyílt mezőn voltak, egyre távolabb a növényzet és a pálmafák sűrűjétől, mely a folyót szegélyezte, s jelezte, merre halad: úgy száz méterre keletre tőlük. Emelkedőhöz értek, és Muldoon fékezett. – A szentségit, de nagy a hőség! – mondta, és karjával megtörölte a homlokát. Meghúzta a térde között tartott whiskys üveget, aztán odanyújtotta Gennarónak. Gennaro megrázta a fejét. Nézte, hogyan rezeg, csillámlik a táj a reggeli fényben. Aztán a kocsiban lévő komputerre és a műszerfalba épített videomonitorra esett a tekintete. A monitor a park egyes részeit mutatta, a távirányítós kamerák képeit. Még mindig nem volt nyoma sem Grantnak, sem a gyerekeknek. A tyrannosaurusnak sem. Reccsent a rádió. – Muldoon? Muldoon felkapta a mikrofont. – Ja! – Működik a géped? Megvan a rex! A 442-es kockában van. Most megy át a 443-ba. – Pillanat – mondta Muldoon, és igazított egyet a monitoron. – Igen. Már megvan. A folyó mentén halad. – Az állat észak felé lopakodott a folyópartot szegélyező növényzet mentén. – Vigyázz rá! Csak bénítsd meg! – Ne izgulj! – szólt Muldoon. Hunyorgott az erős napfényben. – Nem esik baja. – Ne feledd: a tyrannosaurus a park legfőbb látványossága a turisták számára! Muldoon kikapcsolta sercegő készülékét. – Barom! – mondta. – Ezeknek még mindig a turisták a fő gondjuk. – Beindította a motort. – Hát akkor látogassuk meg Rexit, és adjunk be neki egy adagot. A dzsip nagyot zökkent egy göröngyön. – Maga ezt élvezi! Látom, alig várja – szólt Gennaro. – Ami igaz, az igaz. Régóta várom, hogy belelőhessem a tűt abba a nagy dögbe – felelte Muldoon. – Tessék, ott van! Nagy rándulással megálltak. Gennaro a szélvédőn át megpillantotta a tyrannosaurust. Pontosan előttük volt. A folyó menti pálmafák között haladt. Muldoon kiitta a maradék whiskyt, az üveget pedig a hátsó ülésre dobta. Kilövőcsövéért nyúlt. Gennaro a videomonitorra pillantott, amelyen pontosan látszott a dzsipjük és a tyrannosaurus. Nyilván egy kamera van valahol a fák közé rejtve. – Ha segíteni akar – szólt hozzá Muldoon –, akkor nyissa fel az egyik fémdobozt ott a lábánál. Gennaro lehajolt, és felnyitotta a rozsdamentes acélból készült dobozt. Habszivaccsal volt kibélelve. A habszivacsban négy henger nyugodott, akkorák, mint egy-egy literes tejesüveg. Mindegyiken rajta volt a felirat: MORO-709. Kivett egyet. – Pattintsa le a tetejét, és csavarjon bele egy tűt! – rendelkezett Muldoon. Gennaro megtalálta a műanyagból készült tűdobozt. Egy-egy tű átmérője akkora lehet, mint az ujjhegyéé. Rácsavart egyet a lövedék végére. Látta, hogy a másik végén kerek ólomsúly van. – Tulajdonképpen ez az ütőszeg – magyarázta Muldoon. – Találatkor összenyomódik. – A térdére fektette a légfegyvert, és előrehajolt. A kilövőszerkezet súlyos, szürke, cső alakú fémből készült, és leginkább valami tankelhárítóra vagy páncélökölre emlékeztette Gennarót. – Mi az a MORO-709? – Szabványos állatnyugtató – felelte Muldoon. – Ezt használják az állatkertekben világszerte. Próbálkozzunk kezdetnek ezer köbcentivel! – Felnyitotta a tárat, amely akkora volt, hogy belefért az ökle. Belecsúsztatta az egyik lövedéket, és becsukta. – Remélem, ez elég lesz – mondta. – Egy elefánt átlagosan körülbelül kétszáz köbcentit kap, csakhogy annak két-három tonna a súlya a Tyrannosaurus rexé viszont hét, és sokkal vadabb az elefántnál. Nem mindegy a dózis szempontjából. – Miért? – A dózist részben az állat súlya, részben a temperamentuma határozza meg. Mondjuk hogy ugyanannyi 709-est lövünk be egy elefántba, egy vízilóba meg egy rinóba. Az elefántot megbénítjuk vele, csak áll ott, mint egy szobor. A vízilovat már csak lelassítjuk. Elég álmos lesz, de mozog tovább. Ugyanettől azonban a rinó csak begorombul, és

támadni kezd. Másfelől viszont, ha több mint öt percen át kergetünk autóval egy rinocéroszt, fogja magát, és holtan esik össze az adrenalinsokktól. Fura egy kombinációja az erőnek és az érzékenységnek. Muldoon lassan a folyó felé vezette a dzsipet, egyre közelebb a tyrannosaurushoz. – Igen ám, csakhogy ezek mind emlősök. Sokat tudunk róluk, mert az állatkertek mind a nagy emlősökre épülnek, ők a főattrakciók: az oroszlánok, tigrisek, medvék, elefántok. A hüllőkről már jóval kevesebbet tudunk. A dinoszauruszokról meg senki sem tud semmit. Ezek új állatok. – Hüllőknek tekintik őket? – kérdezte Gennaro. – Nem. – Muldoon sebességet váltott. – A dinoszauruszok nem illenek bele a már ismert kategóriákba. – Elrántotta a kormányt, hogy kikerüljön egy sziklát. A kocsi megcsúszott, de folytatta útját. – Voltaképpen rájöttünk, hogy ahány dinoszaurusz, annyiféle. Éppen úgy, mint az emlősök. Egyesek szelídek és aranyosak, mások gonoszok és vadak. Némelyik jól lát, némelyik nem. Van, amelyik ostoba, és van, amelyik igen-igen intelligens. – Mint a raptorok? – kérdezte Gennaro. Muldoon bólintott. – A raptorok okosak. Nagyon ravaszak. Mondok magának valamit. – Egy kis szünetet tartott. – Az összes eddigi problémánk semmi ahhoz képest, mi lenne itt, ha egyszer a raptorok kiszabadulnának a karámjukból. Na! Azt hiszem megérkeztünk, ennél közelebb már nem mehetünk a mi kis Rexinkhez. Előttük a tyrannosaurus átdugta a fejét az ágak közt, s a folyót leste. Megpróbált átjutni. Aztán néhány méterrel lejjebb ment a víz folyása mentén, és újabb kísérletet tett. – Vajon mi az ördögöt láthat ott? – szólt Gennaro. – Ki tudja? – mondta Muldoon. – Lehet, hogy a microceratopsokat akarja elkapni, amik az ágakon ugrálnak. Ha igen, azok jól megfuttatják. Muldoon a tyrannosaurustól körülbelül ötven méterre állította le a dzsipet, és körbetekerte a kormányt. A motort nem kapcsolta ki. – Üljön a volán mögé! – mondta Gennarónak. – És csatolja be a biztonsági övet! – Még egy lövedéket elővett, és az ingébe akasztotta, aztán kiszállt. Gennaro a kormánykerék mögé csúszott. – Gyakran csinálja ezt? – kérdezte. Muldoon böfögött. – Eddig még soha. A hallójárat mögött próbálom eltalálni. Aztán, meglátjuk, mi lesz. – Tíz métert ment a dzsip mögött, aztán fél térdre ereszkedett a fűben. A vállára támasztotta a nagy fegyvert, felcsapta a teleszkópos irányzékot. Célba vette a tyrannosaurust, amely még mindig tudomást sem vett róla. Halvány gázfelhő csapott fel, és Gennaro fehér csíkot látott a tyrannosaurus felé robogni a levegőben. De láthatóan nem történt semmi. Aztán a tyrannosaurus lassan megfordult, és kíváncsian szemügyre vette őket. Ide-oda ingatta hatalmas fejét, mintha hol az egyik, hol a másik szemével nézné őket. Muldoon levette a kilövőt a válláról, és betöltötte a második lövedéket. – Eltalálta? – kérdezte Gennaro. Muldoon a fejét rázta. – Eltévesztettem. Az a rohadt lézeres irányzék.... Nézzen körül, nincs-e elem a dobozban. – Hogy micsoda? – kérdezte Gennaro. – Elem – felelte Muldoon. – Körülbelül ujjnyi nagyságú. Szürke jelzés van rajta. Gennaro hátrahajolt, hogy belenézzen az acéldobozba. Közben érezte a dzsip remegését, a motor halk berregését. Nem látott elemet. Ebben a pillanatban a tyrannosaurus felüvöltött. Rémületes volt az állat hatalmas mellüregének mélyéről előtörő, mennydörgő bömbölés, amely szinte betöltötte a tájat. Gennaro iszonyatosnak hallotta. Hirtelen kiegyenesedett, megragadta a kormánykereket, a másik keze pedig máris a sebességváltón nyugodott. Megszólalt a rádió is: – Muldoon, itt Arnold! Azonnal tűnés onnan! Vége! – Tudom, mit csinálok – morogta Muldoon. A tyrannosaurus rohamra indult. Muldoon nem vesztette el a fejét. Miközben az állat vad iramban vágtatott feléje, a vadász lassan, módszeres alapossággal ismét a vállára emelte fegyverét, célzott és lőtt. Gennaro ismét látta a felszálló füstfelhőt, és az állat irányába robogó lövedék csíkját. Semmi hatás. A tyrannosaurus folytatta a támadást. Most azonban Muldoon már talpon volt, futott, és közben kiabált: – Indulás! Indulás! – Gennaro sebességbe tette a dzsipet, Muldoon pedig az oldalajtóra vetette magát, miközben a kocsi nekilendült. A tyrannosaurus sebesen közeledett. Muldoon egy lendülettel feltépte az ajtót, és bekászálódott a dzsipbe. – Gyerünk már, a szentségit! Gyerünk!

Gennaro tövig nyomta a gázpedált. A dzsip vadul ugrált, bukdácsolt. Az egyik pillanatban olyan magasan volt az orra, hogy csak az eget lehetett látni a szélvédőn át, a következőben már zökkenve földet is ért, és vadul száguldott tovább. Gennaro a bal oldali fasor felé tartott. Nem változtatott a kocsi sebességén, míg csak a visszapillantó tükörben meg nem látta, hogy a tyrannosaurus egy végső üvöltéssel megfordul. Gennaro lassított. – Te jóságos ég! Muldoon a fejét ingatta. – Esküdni mertem volna, hogy másodikra eltaláltam. – Szerintem nem talált – mondta Gennaro. – Biztosan letört a tű, mielőtt az ütőszeg belőtte volna a szert. – Ismerje már be, hogy nem talált! – Na, jó! – sóhajtotta Muldoon. – Hát akkor nem találtam. Döglött volt az elem abban az átkozott lézeres irányzékban. Én tehetek róla. Ellenőriznem kellett volna! Gyerünk vissza, és hozzunk még egy-két lövedéket. A dzsip északnak tartott, a hotel felé. Muldoon felemelte a rádiót. – Vezérlő! – Itt vagyok – szólt Arnold. – Megyünk vissza a bázisra. Keskeny volt a folyó, és robogott. Egyre jobban száguldott velük a tutaj is. Lassan kezdték úgy érezni magukat, mintha valami angolparki robogón ülnének. – Juhúúúúú! – kiabálta Lex. – Gyorsabban! Gyorsabban! Grant előreszegezte tekintetét. Még keskeny és sötét volt a folyó, ám már látta, hogy távolabb a fák sora véget ér, azon túl pedig vakítóan süt a nap. A messzeségből dübörgés hallatszott. Úgy látszott, mintha valami különös, egyenes vonalban véget érne ott a folyó... A tutaj azonban még mindig csak gyorsult, rohant velük előre. Grant az evezők után kapott. – Mi van ott? – Vízesés! – mondta Grant. A lecsüngő ágak sötét öleléséből a tutaj egyszerre csak vakító, délelőtti ragyogásba siklott, s a robogó áramlat egyenest a vízesés pereme felé röpítette. A zuhatag a fülükben dübörgött. Grant evezett, ahogy csak bírt, de csak arra futotta az erejéből, hogy újra meg újra körbefordítsa a tutajt. Az megállíthatatlanul közeledett a perem felé. Lex Granthoz hajolt. – Nem tudok úszni! – A férfi látta, hogy nincs becsatolva a mentőmellénye, de tehetetlen volt; rémisztő sebességgel érték el a peremet, s a vízesés mennydörgése már az egész világot betöltötte. Grant mélyen a vízbe döfte az evezőjét, érezte, hogy megakad, és megtartja őket, pontosan a vízesés peremének legszélén. A gumitutaj rezgett az áramlatban, de nem zuhant le. Grant teljes erejéből az evezőnek feszült, s a vízesés széléről lenézve látta, hogy legalább tizenöt méter magasan vannak, alattuk pedig kerek, habzó tó. S a habzó tóban, rájuk várva, ott áll a tyrannosaurus. Lex kétségbeesetten sikított, aztán a csónak megfordult, a hátulja egyszerre csak eltűnt, ők pedig egyenként kihullottak belőle, ki a levegőbe és a dübörgő vízbe, s megkezdődött a halálos zuhanás. Grant csapkodott a karjával, aztán egyszerre csak lassú, néma lett a világ. Úgy érezte, percekig zuhan. Volt ideje megfigyelni, hogy Lex narancssárga mellényébe kapaszkodva repül mellette, hogy Tim lenéz a mélybe; volt ideje meglátni a vízesés jeges, fehér falát s a fortyogó tavacskát odalenn, miközben lassan némán hullott felé. Ostorcsapásként érte, amikor a víz felszínének vágódott a teste, majd belemerült. Hideg, fehér zubogó buborékok ölelték körül. Billegett, pörgött, egy pillanatra látta a tyrannosaurus lábát, amint elsodródott mellette, végig a tavacskán, aztán továbbsiklott a tavon túli folyómederbe. Úszni kezdett a part felé, meleg kövekbe kapaszkodott, lecsúszott, majd egy ágat ragadott meg, és végre sikerült felhúzódzkodnia, kikerülnie a főáramlatból. Zihálva, lihegve, hason kúszva kivonszolta magát a sziklákra, és éppen akkor pillantott vissza a folyóra, amikor az üres barna gumitutaj tovabukdácsolt mellette. Aztán Timet pillantotta meg, amint az áramlattal küszködik. Odanyújtotta a kezét, és a köhögő, reszkető kisfiút kihúzta maga mellé a partra. Grant újra a vízesés felé nézett. Látta, hogy a tyrannosaurus hirtelen egyenest a lábánál lévő tó vizébe meríti fejét. Az óriás fej ide-oda csapkodott, rázkódott, vizet fröcskölve mindenfelé. Valami volt a foga között. Aztán újra felemelte a fejét. Lex narancssárga mellénye lógott ki a szájából.

Egy pillanattal később maga Lex is a felszínre bukkant a tyrannosaurus hosszú farka mellett. Arccal lefelé feküdt a vízen, kicsi testét lefelé sodorta a folyó árama. Grant utána ugrott a vízbe, újból megmerítkezve a fortyogó áramlatban. Egy pillanat múlva már a kövekre is húzta a kislányt, mint valami élettelen, elnehezült súlyt. Szürke volt az arca. A szájából ömlött a víz. Grant fölé hajolt, hogy szájon át adjon neki mesterséges légzést, ám a kislány köhögni kezdett. Aztán sárgászöld folyadékot hányt, majd újabb köhögési roham fogta el. Szempillái meglibbentek. – Hello! – szólalt meg. Erőtlen mosoly jelent meg az arcán. – Megúsztuk! Tim sírva fakadt. A kislány ismét köhögni kezdett. – Abbahagynád? – kérdezte aztán. – Most meg mit bőgsz? – Csak! – Féltettünk téged – mondta Grant. Fehér anyagdarabkák úsztak lefelé a folyón. A tyrannosaurus éppen a mentőmellényt szaggatta szét. Még mindig háttal állt nekik, a vízesés felé fordulva. De bármelyik pillanatban megfordulhat, és észreveheti őket... – Gyerünk, gyerekek! – adta ki a parancsot Grant. – Hová megyünk? – kérdezte köhögve Lex. – Gyere már! – Grant búvóhelyet keresett. Amerre a folyó haladt, arra csak nyílt, füves mezőt látott, amely nem nyújthatott menedéket. A folyón felfelé viszont ott állt a tyrannosaurus. Grant ekkor keskeny földutat vett észre a folyó mentén. Úgy látszott, felfelé vezet, a vízeséshez. A földben pedig világosan látszott egy férficipő lenyomata. Felfelé haladt az úton. A tyrannosaurus most végre megfordult. Morgott, s a füves rét felé nézett. Úgy tűnt, megértette, hogy áldozatai kicsúsztak a karmai közül. A vízfolyás irányában kereste őket. Grant és a gyerekek gyorsan lekapták a fejüket a partot szegélyező hatalmas páfrányok közé. Közben Grant óvatosan a folyással ellenkező irányban vezette őket. – De hát hová megyünk? – kérdezte rémülten Lex. – Visszafelé tartunk! – Tudom – mondta Grant. Megint közelebb kerültek a vízeséshez. Nőttön-nőtt a zaj. A sziklák csúszóssá váltak, az út sarassá. Függönyként borult rájuk a pára, mintha felhőn haladtak volna keresztül. Úgy látszott, hogy az ösvény egyenest a robogó vízbe visz, amint azonban közelebb értek, kiderült, hogy a valóságban a vízesés mögé vezet. A tyrannosaurus még mindig lefelé lesett, a folyás irányába, s a hátát mutatta nekik. Sietve igyekeztek az ösvényen a vízesés felé, és kis híján sikerült is a zuhatag vízfüggönye mögé kerülniük, amikor Grant látta, hogy a tyrannosaurus megfordul. De a következő pillanatban már teljesen a vízesés mögött voltak, s Grant többé nem látott át az ezüstös vízfüggönyön. Megfordult és meglepetten nézett körül. Kis mélyedést látott, alig nagyobbat egy beépített szekrénynél, ám ez a mélyedés tele volt gépezetekkel; zümmögő szivattyúkkal, nagy szűrőkkel és csővezetékekkel. Vizes és hideg volt minden. – Látott minket? – kérdezte Lex a zuhatag dübörgését túlkiabálva. – Hol vagyunk?! Mi ez a hely itt? Meglátott? – Várj egy kicsit! – mondta Grant. Nézte a berendezést. Nyilvánvalóan szabályszerű szórakoztatóparki gépezet volt. Akkor pedig áramnak is kell lennie, ami hajtja, tehát lehet, hogy egy telefonkészülék is van valahol a kapcsolattartás végett. Keze a szűrők és csövek között kutatott. – Mit tetszik csinálni?! – kiabálta Lex. – Telefont keresek. – Majdnem tíz óra volt már. Alig több mint egy órájuk van már csak rá, hogy kapcsolatba lépjenek a hajóval, még mielőtt az partot ér. A mélyedés hátsó falában ajtót talált, rajta felirat – 04.sz. KARBANTART. – de zárva volt, nem is mozdult. Nyílás volt mellette a falban a biztonsági ellenőrzőkártya számára. Az ajtó mellett egy sor fémdobozt látott. Sorra nyitogatta őket, de csak kapcsolók és órák voltak bennük. Telefon sehol. Az ajtót pedig nem volt mivel kinyitni. Majdnem elkerülte a figyelmét, hogy az ajtótól balra is van egy doboz. Kilencgombos billentyűtáblát talált benne, amikor kinyitotta. Imitt-amott penészfoltok voltak rajta, de úgy nézett ki, mintha az ajtó kinyitására szolgálna, s Grant szinte biztosan érezte, hogy az ajtó mögött telefonkészülék van. A doboz fémlapjára valaki számot karcolt: 1023. Grant benyomta ezt a számot. Szisszenve nyílt az ajtó. Sötétség tátongott odabenn, s betonlépcsők sora vezetett a mélybe. A hátsó falon felirat állt: 04/22. sz. SZOLG. GÉPK. TÖLTŐ, s egy nyíl mutatott lefelé, a lépcsők mentén. Lehet, hogy valóban autó van odalenn? – Gyerünk, gyerekek! – Azt már nem! – jelentette ki Lex. – Oda én nem megyek! – Ne hülyéskedj, Lex, gyere! – mondta Tim. – Szó sem lehet róla! – válaszolta a kislány. – Nincs világítás, nincs semmi! Én nem megyek oda. – Hát jó – mondta Grant. – Érezte, nincs idő vitatkozni. – Ti itt maradtok, és én lemegyek. Mindjárt visszajövök. – De hová tetszik menni?! – kérdezte Lex hirtelen riadalommal, a hangjában. Grant válasz helyett belépett az ajtón. Az elektronikus sípszót hallatott, majd becsapódott a háta mögött.

Mintha kútba zuhant volna, úgy borult Grantra a vaksötétség. Egy pillanatnyi meglepett zavarodottság után visszafordult az ajtóhoz, és végigtapogatta nyirkos felszínét. Sehol egy gomb, kilincs vagy zár. A falakat is végigkutatta az ajtó két oldalán valami kapcsoló, vezérlődoboz vagy akármi más után... Semmit sem talált. Már a pánikkal küzdött, amikor a tapogatózó ujjai egy fémhenger körül zárultak össze. Végigfuttatta rajta a kezét. A pereme kidudorodik, a teteje lapos... zseblámpa! Bekapcsolta. Meglepően erős volt a sugár ragyogása. Visszatekintett az ajtóra, és látta, hogy azt nem lesz képes kinyitni. Meg kell majd várnia, míg a gyerekek nyitják ki. Addig is... A lépcsőhöz indult. Nedvesek, penésztől síkosak voltak a lépcsőfokok, óvatosan kellett haladnia. Félúton lefelé szimatoló hangot hallott, és betonon kaparászó karmok csikorgását. Előhúzta kábítópisztolyát, és óvatosan továbbhaladt. A lépcsők a saroknál bekanyarodtak, s amint arra világított, különös visszfény csillant fel. Egy pillanat múlva már ki is vette, mi az: egy autó! Villanyautó volt, mint egy golfkocsi, s egy hosszú alagút felé fordult az orrával, amely úgy tűnt, kilométerekre nyúlik. A kocsi volánja mellett vörös fény parázslott, vagyis valószínűleg fel volt töltve az akkumulátora. Ismét felhangzott a szuszogó hang. Grant megperdült a tengelye körül, s csak azt látta, hogy valami sápadt, halvány alak emelkedik fel, majd tágra nyitott pofával repül felé a levegőn át. Gondolkodás nélkül lőtt. Az állat rázuhant, ledöntötte a lábáról, s Grant rémülten hengergőzött félre, lámpája vadul himbálózott összevissza. De az állat nem kelt fel, s amikor végre szemügyre vette, Grant egy kicsit nevetségesnek érezte magát. Velociraptor volt, de még kölyök, egyévesnél is fiatalabb. Valamivel nagyobb lehetett egy fél méternél, de legfeljebb akkora, mint egy közepes méretű kutya. Alig lélegzett, ahogy ott hevert a földön, a nyakából kiállt a tű. Alighanem túl nagy az adag a testsúlyához képest, gondolta Grant, és gyorsan kihúzta. A velociraptor kissé ködös tekintettel nézett rá. Valami különös, szinte érezhető intelligencia sugárzott az állatból, s egyfajta lágyság, amely szöges ellentétben állt azzal a fenyegetéssel, amely a karámban tartott felnőtt példányokból áradt. Megsimogatta a velociraptor fejét, remélve, hogy megnyugtatja. Végignézett a testén, amely enyhén reszketett, ahogy fokozatosan hatni kezdett a nyugtató. És döbbenten látta, hogy hím. Fiatal állat, és hím! Nem lehetett kétség afelől, hogy mit lát. Ez a velociraptor vadon született! Felfedezésétől izgatottan sietett vissza a lépcsőn az ajtóhoz. Lámpájával végigpásztázta a lapos, egyenletesen sima felületet s a belső falakat. Végigfuttatta a kezét az ajtón, és csak ekkor fogta fel igazán, hogy nem tudja kinyitni, hogy fogoly, s hogy erre nincs kiút, hacsak a gyerekekben nincs annyi lélekjelenlét, hogy kinyissák az ajtót. Tompán hallotta is a hangjukat az ajtó túloldaláról. Lex az öklével dörömbölt az ajtón. – Grant bácsi! – kiabálta. – Grant doktor! – Nyugi! – szólt Tim. – Visszajön! – De hová lett? – Ide figyelj! Grant professzor tudja, mit csinál. Egy perc, és itt lesz – mondta Tim. – De most legyen itt! Azt akarom! – kiáltotta Lex. Csípőjére szorította összezárt öklét, könyökét szélesre feszítette. Dühösen toporzékolt. Ekkor azonban iszonyatos bömbölés reszkettette meg a levegőt, s a tyrannosaurus feje áttört a zuhatag vízfalán. Feléjük nyomult. Tim megdermedt, és bénult rettenettel nézte, amint az óriás száj hatalmasra nyílik. Lex sikított, és a földre vetette magát. A fej ide-oda ingott, majd visszahúzódott. Tim azonban továbbra is látta az állat árnyát a vízfüggönyön. Beljebb rántotta Lexet a mélyedésbe, éppen abban a pillanatban, amikor újabb üvöltés hangzott fel, s az állkapcsok ismét áttörtek a zuhatagon. A vastag nyelv ki-be járt. A fejről fröcskölt a víz mindenfelé. Aztán megint visszahúzódott. Lex remegve bújt Timhez. – Gyűlölöm! – mondta. Hátrahúzódva lekuporodott, de a mélyedés csak egy-két méteres volt, az is teli mindenféle gépezettel. Nem volt hová bújniuk. A fej újra feléjük közeledett a vízesésen át, ám ezúttal lassan, majd megállt, s az állkapocs megpihent a földön. A tyrannosaurus tágra nyílt orrlikakkal szaglászott, szívta a levegőt, ám a szemei még mindig kívül voltak a vízesésen. Tim fejében ez járt: „Nem lát minket! Tudja, hogy itt vagyunk, de nem lát át a vízen!” A tyrannosaurus szaglászott. – Mit csinál? – szólalt meg újra Lex. – Ssss!

Mélyről jövő morgás, aztán az állkapcsok lassan szétnyíltak, és kisiklott a nyelv. Vastag volt, kékesfekete, kis, kétfelé ágazó bemélyedéssel a hegyén. Másfél méteres hossza könnyen elért a mélyedés hátsó faláig. Súrlódó zajjal végigsiklott a szűrőhengereken. Tim és Lex a csövekhez tapadt. A nyelv lassan balra csúszott, majd jobbra. Loccsanva ütődött a gépezeteknek. Felfelé hajló hegye körültapogatta a csöveket és a szelepeket. Tim látta, hogy az izommozgásai olyanok, mint egy elefánt ormányáé. A nyelv a mélyedés jobb oldala mentén visszahúzódott. Közben végigsiklott Lex lábán. – Juj! – szólt halkan a kislány. A nyelv abban a pillanatban megállt. Hegye hátragördült, mint egy kígyó, kezdett felemelkedni a kislány teste mentén... – Nehogy megmozdulj! – súgta Tim. ...végig az arcán, aztán föl tovább Tim vállára, s végül a kisfiú arca köré tekeredett. Tim összeszorította a szemét, amint a nyálkás izomköteg az arcához ért, és eltakarta. Forró volt, nedves, a bűze mint a vizeleté. A nyelv immár teljesen körbetekerte, majd lassan, nagyon lassan húzni kezdte a nyitott állkapocs felé. – Timmy... Tim nem bírt válaszolni; száját betapasztotta a lapos, fekete nyelv. Látni látott, de szólni nem tudott. Lex a kezét rángatta. – Timmy, gyere! A nyelv továbbhúzta, egyre közelebb a hortyogó szájhoz. Forró lehelet csapta meg a lábát. Lex rángatta, de hiába: nem bírt a bátyját fogva tartó izomerővel. Tim elengedte, és mindkét kezét a nyelvnek feszítette, megpróbálta felfelé nyomni a fején, letolni magáról. Mozdítani sem tudta. Sarkát szinte beásta a sáros talajba, de az sem használt. A nyelv csak vonszolta előre. Lex a dereka köré fonta karjait, úgy igyekezett visszatartani, közben kiáltozott, de semmihez sem volt elég az ereje. Tim kezdett csillagokat látni. Lassan egyfajta békesség szállta meg, megnyugvás, beletörődés az elkerülhetetlenbe, amint végzete felé vonszolódott. – Timmy? És ekkor a nyelv szorítása hirtelen lazult, és kezdett letekeredni róla. Tim érezte, amint lecsúszik az arcáról. Undorító, fehér, habos ragacs borította a testét, ám a nyelv erőtlenül a talajra hullott. Az állkapcsok lecsapódtak, ráharaptak a nyelvre. Sötét vér patakzott elő, s összekeveredett a sárral. Az orrlikak szaggatott horkantásokkal ugyan, de még tovább szedték a levegőt. – Mit csinál ez?! – kiáltotta Lex. Aztán lassan, nagyon lassan a fej kezdett hátrafelé csúszni, kifelé a mélyedésből, hosszú nyomot hagyva maga után a sárban. Majd végül teljesen eltűnt, s ismét csak a lezúduló víz ezüstfüggönye volt a szemük előtt.

A VEZÉRLŐ

– Oké – szólalt meg Arnold a vezérlőteremben. – A rex lefeküdt. – Hátratolta székét, szája széles mosolyra húzódott, rágyújtott az utolsó cigarettára, és összegyűrte a kiürült dobozt. Ez is megvan hát: az utolsó lépés, ami még hiányzott ahhoz, hogy a parkban teljesen helyreálljon a rend. Már csak az maradt hátra, hogy kimenjenek, és a helyére vigyék az állatot. – A jó édesanyját! – morogta a monitort figyelve Muldoon. – Hát szóval mégis csak eltaláltam akkor. – Gennaróhoz fordult. – Csak éppen egy óra kellett hozzá, hogy meg is érezze. Henry Wu elkomorult a kép láttán. – De vízbe is fúlhat ebben a testhelyzetben... – Nem fog vízbefúlni – vágott közbe Muldoon. – Nem találkoztam még állattal, amellyel nehezebb lett volna végezni. – Gondolom, ki kell mennünk, és el kell szállítanunk. – Majd kimegyünk – mondta Muldoon. Nem hangzott valami lelkesnek. – Értékes állat! – Nagyon jól tudom, hogy értékes állat – mondta erre Muldoon. Arnold Gennaróhoz fordult. Nem tudott ellenállni a kísértésnek, hogy legalább egy pillanatra ki ne élvezze győzelmét. – Szeretnék rámutatni – mondta –, hogy a park immár teljes egészében ismét rendben működik. Bármit is jósolt Malcolm matematikai modellje. Újra minden az ellenőrzésünk alatt áll. Gennaro azonban az Arnold feje mögötti képernyőre mutatott, és ezt kérdezte: – Az meg mi? Arnold megfordult. A rendszer állapotát jelző kocka volt a képernyő felső sarkában, normális körülmények között mindig üres. Arnold meglepetten látta, hogy most a következő felirat villog rajta sárgán: TART. ENERGIASZINT ALACSONY. Egy pillanatig nem is értette. Miért lenne alacsony a tartalékenergia szintje? A főáramforrásról működnek, nem a tartalékról. Arra gondolt, talán a gép rutinellenőrzést végez a tartalék áramforrás állapotáról, talán az üzemanyag-tartályok szintjét ellenőrzi, vagy az akkumulátortöltést... – Henry – szólt Wuhoz. – Nézd csak ezt! – Miért a tartalék áramforrásról működteted a rendszert – kérdezte az. – Dehogy működtetem arról! – mondta erre Arnold. – Pedig úgy látszik. – Az lehetetlen. – Nyomtasd ki az állapotnaplót! – kérte Wu. – Ez a feljegyzéskor azt tartalmazta, mikor milyen volt a rendszer állapota az elmúlt órákban. Arnold lenyomott egy gombot. Nyomtató zúgása hallatszott a sarokból. Wu odament. Arnold a képernyőre meredt. A kocka színe villogó sárgáról vörösre váltott, s az üzenet most így szólt: TART. ENERG. KIMERÜL. Számok kezdtek futni rajta húsztól visszafelé. – Mi a jóisten történik itt?! – kérdezte döbbenten Arnold. Tim óvatosan tett néhány lépést a sáros ösvényen, a sötétből a napsütésbe. Kilesett a vízesés mögül. Látta: a tyrannosaurus a vízben lebegve az oldalán hever odalenn. – Remélem, megdöglött – mondta Lex. Tim látta, hogy él. A dinoszaurusz mellkasa most is mozgott, s az egyik mellső végtag görcsösen rángatózott. De valami nem volt rendben vele. Ekkor aztán Tim észrevette a fej hátsó részéből kiálló, tartályszerű lövedéket. – Kábítót lőttek bele – mondta. – Hála Istennek! – sóhajtott fel Lex. – Majdnem megevett bennünket! Tim figyelte az állat nehézkes légzését. Önmagát is meglepte azzal, hogy sajnálatot érez. Szégyenérzet fogta el, hogy egy ilyen hatalmas állatot így megalázva lát. Nem akarta, hogy elpusztuljon. – Nem ő tehet róla – mondta. – Jó vagy?! – kérdezte Lex. – Kis híján megevett bennünket, és nem ő tehet róla! – Húsevő. Csak azt tette, amit muszáj neki. – Nem mondhatnád ezt, ha most éppen a gyomrában volnál! – vágott vissza Lex. Ekkor hirtelen megváltozott a vízesés hangja. A fülsiketítő dübörgés lágyabb, halkabb lett. A víz mennydörgő fala elvékonyodott, aztán már csak folydogált... És leállt.

– Ez a sor mit jelent? – kérdezte a listára mutatva Muldoon. Kikap.Tart. feliratú ajtó lassan feltárult. Majd elektromágneses zárszerkezet kattanása hallatszott. Grant lépett elő. – Jóságos ég! – mondta kétségbeesetten Arnold.: Kerítések (N. Operatív . Biztosan az áram. s amikor újra indítottad.: Tart. en. hogy ez a normális! Pontosan így kellett történnie! Hiszen ésszerű: először a tartalék generátor gyújt. tartalék áramra álltál át. mert a fő hálózati generátor indításához nagy impulzus szükséges. – Leállt az áram – tette hozzá Tim. Bekap. [Kód] [AV12] [AV12] [AV12] [AV0] [AV0] AV0 AV0 AV0 AV1 AV04 AV05 AV06 AV08 AV09 AV09 AV09 AV09 AV09 AVZZ Operatív . hol azt – az egész park mindvégig a tartalék áramforrásról működött. Operatív . 1. Operatív . en. s a gépek elhallgattak. – Ezt gépek működtetik. en.. Kikap. Operatív . en. mint a rosszul elzárt vízcsap. Idő 05:12:44 05:12:45 05:12:46 05:12:51 05:13:48 05:13:55 05:13:57 05:13:59 05:14:08 05:14:18 05:14:19 05:14:22 05:14:24 05:14:29 05:14:32 05:14:37 05:14:44 05:14:57 09:11:37 09:33:19 09:53:19 09:53:39 Esemény Bizt. en.Tart. hogy Arnoldnak le kellett volna zárnia a fő áramforrást. Valaki elzárta az áramot. . en. majd a terem világítása is kialudt. en. és a 04. Hunyorgott a napfénytől. Egymás után.: Tart. Vészjelz. és beengedte a fényt az ablakon át. Ott álltak fenn a barlangszerű. kialudtak a fények. Operatív . Bizt.Tart. AV09 . View Állapotellenőrz.: Kerítések (N. Indítóparancs Monitor-Hálóz. en. Bizt. – Vízesések nem szoktak leállni – jegyezte meg Lex. AV0 Áll Wu folytatta: – Ma reggel öt óra tizenhárom perckor állítottad le a rendszert. így tervezték a rendszert.) Működő. srácok. Leállásparancs Indítóparancs Bizt. és kigyulladtak a fények.Tart. így azután amikor a vezérlőben újra kivilágosodtak a képernyők. AVZ2 Operatív .Tart. mit találtam! Arnold bénultan meredt maga elé. míg Arnold rá nem döbbent.Tart. és így szólt: – Kösz.: Tart. en. egyenként sötétedtek el a monitorok. 2. en. Egyszerre kezdett el kiabálni mindenki. csak most kezdte igazán felfogni. Operatív . – Mi nem is csináltunk semmit – mondta Lex. nézzétek meg. Wu pedig odahozta a kinyomtatott listát.-Hálóz. Sőt. KARBANTART..) Vészjelz. üzemanyag (0%) Rendszerállapot Operatív Operatív Operatív Áll Áll Áll Áll Áll Indul . üzemanyag (10%) Vészjelz. Parancs-Hálóz. mi mindennel járhat. Operatív . onnan bámultak lefelé. sz. 05:14:57 Vészjelz. en. en. még csak eszébe sem jutott. A jelek szerint a főáramforrás a reggeli leállás óta be sem volt kapcsolva. S ez igen-igen szerencsétlen dolog volt. 3.Tart. Pedig nem volt. Bizt.Tart. sötétség borult az egész vezérlőre. – Gyertek. Operatív .Tart.Tart. Odalenn a tó felülete meg sem rezdült. gépezettel teli mélyedésben. Bekap. TeleCom-VBB Schematic-Hálóz.– Timmy! – szólt Lex. 2. Ez érthetetlennek tűnt. ügyesek voltatok! Sikerült kinyitnotok az ajtót.. Muldoon kinyitotta az elsötétítőket. – Megállt a vízesés! Már csak cseperészett.Tart. – Ezt nézd meg! – mondta Wu. csak a tartalékforrás kapcsolt be. üzemanyag (20%) Vészjelz. Kikap.Tart. en.: Tart. 3.. aztán hol ezt tették. összevissza. Bizt. s ennek következtében – mialatt a rexet hajkurászták. en.Tart. Labor-Hálóz. – A hátuk mögött sorra kikapcsolódtak a szivattyúk és szűrők. Bekap. egyik a másik után. Bizt. üzemanyag (1%) Vészjelz.Tart. Amikor újra ráadta az energiát. Csakhogy eddig még nem adódott rá alkalom. AVZ1 Operatív . Operatív . hogy a fő áramforrás még nincs helyreállítva. Tim a fejét rázta. – Az most nem érdekes – mondta Grant. Á.Á. 1.

úgy közeledtek. – A tartalék viszont nem fejleszt elegendő áramerősséget ahhoz. kérem. Nem múlnak ki gyorsan. Akkor menjen a többiekkel a kastélyba. A raptorok már dühödt vicsorgással közeledtek Arnoldhoz. Muldoon pedig a lövedékeket kezdte adogatni neki. Muldoon erre hirtelen nagyon gyorsan kezdett beszélni. de a rendszer mindvégig a tartalék energiaforrásról működött – válaszolta a főmérnök. – Ez minden. Alig vette észre. felkapta a szürke rakétakilövőt. felbillentve a kilövőt. és hordozható rádiókészülékeket nyomott az ott lévők kezébe. Most pedig indíts! Hammond szinte sírt. – Az istenit. úgy. a farok ide-oda csapkodott. – Még a velociraptorkarám kerítésében sem? Arnold felsóhajtott. Leértek a földszintre. – És az mit jelent. . és maradjon benn. fordítva tetted be! morogta Muldoon. – Mi az? Meggondolta magát?! – mordult rá Muldoon. ám ott Muldoon hirtelen megállt. – Öt órája! Lehet. s mintha csak valami óriás paradicsom durrant volna szét. amit remélhetünk. Gennaro hátán végigfutott a hideg. de semmi sem történt.Á. hogy nem is érdemes a szívükre célozni. hogy szétszórt az idegrendszerük. aki elboldogul a számítógépekkel. amikor a bal oldali állat egyszer csak a szó szoros értelmében felrobbant. Elektromos sistergés hallatszott. Mr. a másik kettő kétfelől támadott. Muldoon kilépett az ajtón. – Az a baj ezekkel a dinókkal – mondta Muldoon –. – Te jóságos Úristen! – kiáltotta Muldoon. hogy az elektromos kerítések működni tudjanak. vállán a rakétaindító. Gennaro lihegett. és irodája felé sietett a folyosón. úgy fröcskölte be a vér az épület falát. de lépést tartott vele. – Gennaróhoz fordult. a lábak a levegőt rugdalták. Mindenesetre nem vettem észre. – Muldoon belépett a „Főállatőr” feliratú szobába. Gennaro a derekára csatolta az övet. – De mit akar csinálni az állataimmal? – Most nem ez a kérdés. így azokat a rendszer automatikusan áramtalanította. – Muldoon elfordult tőle. – Gennaro becsúsztatta a lövedéket a kilövő végébe. – Tölts! – szólt. hogy azok a szörnyetegek azóta szabadon vannak! Ekkor valahonnan a távolból sikoly hallatszott. – Jó. Hammond. – Egyik hengert nyitotta ki a másik után. hogy elbánjunk a raptorokkal. Sajnos csak hat lövedékünk van. – Van kedve megint veszélyesen élni? – Nem igazán – felelte sápadtan Gennaro. A törzs alsó része összecsuklott a földön. – Egyikben sem? És most sincs? Hajnali öt óra óta? – Nincs. te a vezérlőben maradsz! Te vagy az egyetlen. Hammond! – csattant fel Muldoon. szinte hadart. – Hátha mégis segítségre lesz szüksége – mondta Gennaro. és egy rudat lóbált feléjük. Én Arnoldnak segítek. hogy beindítsa a fő áramforrást. Az újra töltött. az íróasztala mögött. hálóval megerősített töltényövet nyújtott oda Gennarónak. – Tedd fel! – Észre sem vette. és mindegyikbe beleejtett egy tartályt. Olyan vastagok a bordáik. hogy a gép figyelmeztetést küldött a rendszer állapotáról a vezérlőben lévő monitoroknak – felelte Arnold. Ráadásul igen erős a testfelépítésük. Kiabált. hogy Gennaro mellé szegődött. s a lábukat vagy a hátsójukat is alig lehet komolyan megnyomorítani. – A kerítések miatt. A raptorok száma a karámban viszont nyolc. Arnold a gépház épületének vetve hátát három raptort igyekezett távol tartani magától. – A kérdés az: mit csinálnak az állatok velünk? Aztán szó nélkül sarkon fordult. közben lefelé nézett az erkélyen túli gépház felé. Törzsének felső része a levegőbe röpült.– Azt. menjen vissza a kastélyba! Ne vitatkozzon velem! Menjen máris! Zárja be a kapukat. Az állatok szinte szabályos katonai alakzatban szóródtak szét. én ezt akkor ugyan nem tudtam. hogy a gránát Gennaro markába esett. míg ti a terepen voltatok. Hat henger és hat fémtartály volt benne. Muldoon felhördült: – Mit beszélsz?! Nem volt áram a kerítésekben? – Nem volt. Egy középen maradt. Összehangoltan. Széles. hogy közben tegezésre váltott. még akkor sem. hogy „Vészjelzés: Kerítések (N. – Abban sem. – Az megeshet. – A legtöbb. Wu. hogy hatot kinyírunk. kiléptek az üvegajtón. Gyerünk! Maradj mellettem! Nálad vannak a lövedékek. Közben körbejárta a termet. – Te láttad ezt a figyelmeztetést? Arnold a fejét rázta. és futva elindult a folyosón. uraim. Nyilván éppen veletek beszéltem. ha telibe találjuk az agyukat. Mr. amíg nem hall felőlem. – Nem. és kinyitott egy rejtett szekrényt a falban. Falkatámadás! Muldoon azonban már fél térden is volt.)”? – Nos. – Arnold a gépházba megy. Zökkenőmentes precizitással.

nem is szólva arról. Mit érdeklik őt az olyan kicsinységek. – Valami komoly katasztrófa lehet – mondta Gennaro. Csodás gondolatnak látszott ez a számunkra. és visszahanyatlott a hátára. Már alig húsz méterre voltak tőle. ki sem ismerik őket.. akkor ő újraindíthatja a főgenerátort. Egymástól eltávolodva közeledtek.– Ettől majd felébrednek! – morogta Muldoon. hogy kapitális marha! – Malcolm doktor! – szólt nyugtatólag Ellie. hogy Harding beledöfhesse a morfiuminjekciót. Vagy még annyi sem. mennyire nem értenek ahhoz. hogy fogalma sincs. A rádióból egyszerre csak fémes sikoltás szólt. Arnold a gépház ajtaja felé rohant. de tudta: maradnia kell. – A rádióra füleltek. – Íme. aztán megállt. Valahonnan a messzeségből. hogy felüljön. Isten az égben. amit mi itt megkíséreltünk. amelyből kiáltások és sikolyok hangzottak. és ezért azt hiszik. Tudta ugyanis. Borzasztóan szeretett volna kikerülni innen. – Egy fenét vagyok! – szólalt meg Malcolm. – Ez magának egyszerű? Maga ostobább. – Úgy hangzik. – Nyilván nem kerülte el a figyelmét. Egészen egyszerű volt az egész. Köhögve hanyatlott hátra. majd a látogatóközpont felől tompa robbanások zaja hallatszott. hogy mi az! Rövid időn belül megalkotnak egy csomót. hogy tartalék forrásról működteti. ahogy maguk fütyülnek. Munkatársaim és én évekkel ezelőtt úgy láttuk. mi a baj a tudományos hatalommal? – kérdezte Malcolm. Muldoon futás közben teljes erőből ordított. Mintha Muldoon lett volna. – Tudja. Mindig beválik. A maga Wu doktora még a nevét sem ismeri azoknak a valamiknek. Ha Arnold képes visszakapcsolni az áramot – akár csak egy pillanatra is –.. eddig is meg voltam győződve. Henry Wu hallotta a robbanásokat. amit létrehoz. Mivel pedig olyannyira izgalmasnak tűnt. Megszereztük ezt a szigetet. Valahogy elég energiára lelt ahhoz. – Még tartja magát – mondta Harding. . Annak azonban esze ágában sem volt engedelmeskedni. – Az ördög vigye el az egészet! – mondta a fejét rázva. Ott kell maradnia a teremben. A raptorok nem törődtek vele. s a vezérlőterem ajtaja felé nézett. hogy mennyire inkompetensek saját maguk. és dolgozni kezdtünk. hogy ezek a lények élnek. Észrevehetően gyöngült percről percre. hanem Muldoon után vetették magukat. úgy ugrálnak majd. Csak azt felejtik el. amelyekről semmit sem tudnak. és életre kelteni őket. hogy legfeljebb tíz másodperce van még. egyfajta időutazásnak – az egyetlen időutazásnak a világon. sőt mi több. és elfelejtik. amit van képük egyszerűnek nevezni.. Malcolm csak Ellie segítségével tudott oldalra fordulni. hogy mi a neve annak. Tehetetlenül kerülgette a kapcsolótáblákat. aztán elkapják az állatok. – Teljesen tiszta a tudatom. – Nahát! Mit nem mond! – Mit fölényeskedik? Menjen a fenébe. – Enyhén delíriumos állapotban van. hogy valaki ordít. hova a pokolba menekülhetne. és megpróbálta visszafektetni a matematikust. – Az. hogy az egységes kerítésrendszer csődöt fog mondani. Arnold késve jött rá. – Mi ez? Mi folyik odakinn? – mondta. Hátranézve látta. milyen keveset tudnak róluk. s közben halványan végigfutott a tudatán. Hallotta. és egy székre zuttyant. hogy az is egyfajta öröklött vagyon. be az erdőbe. – Csak nem? – Malcolm kissé hörögve szedte a levegőt. és közben a kerítések kikapcsolódtak. Azt pedig pontosan tudjuk. Élve visszahozni őket: úgy is mondhatnám. hogy az. mégis azt hiszik. legurult egy földhányásról. – Kiszabadultak a raptorok – mondta Hammond. – Tölts! – Ennyi volt Muldoon válasza. van saját intelligenciájuk. A rádióra mutatott. mintha háború lenne odakinn. a kastély felől sikolyok hallatszottak. hogy Gennaro ellenkező irányban rohan. – Aztán hogy történhetett ez? – Hiba csúszott a rendszer kezelésébe. Hammond nagyot sóhajtott. úgy határoztunk. hogy lehetséges kihalt állatok DNS-ét klónozni. birtokolják is őket. a maga „egyszerű gondolata!” Egyszerű! Új életformákat hoznak létre. A matematikus sóhajtott. s futva ért talajt. – Egyszerű? – kérdezte Malcolm.. Tíz másodperc. hiszen maguk alkották. én megjósoltam. – Hogy van a beteg? – kérdezte. Muldoon szaggató fájdalmat érzett a bokájában. mekkora seggfejek a született gazdagok. hogy hozzálátunk. maga nagyképű alak! – Ha emlékezetem nem csal – mondta Malcolm –. hogy esetleg egyáltalán nem úgy ugrálnak. ahogy maguk fütyülnek. mint gondoltam! Pedig Isten az atyám. A velociraptorok megfordultak. amiket létrehoz. Hammond lépett a szobába. és Muldoon meg Gennaro felé indultak. lehetségesnek is. a lényegét tekintve rendkívül egyszerű gondolat.

aki a „szombat esti spécinek” csúfolt. Ez a hatalom pedig ugyanolyan. Évekig kell inaskodnia. Senki sem fog bírálni. hazudj. – Ebben a folyamatban az az érdekes. Egészen fiatalon is megteheti. Be kell engednie valami fényt ide. – A tudományos hatalom azonban olyan. Visszament a járópallóhoz. sem a kollégáidnak. Majd szétvetette a feszültség. be ne csukódjon. akkor az övé. – Maga tudja. – A karatemester nem öl embert puszta kézzel. az egyik hangos. hogy nem fognak égni a lámpák! Érezte a levegő hűvösét. A cég elnöke akar lenni? Fekete övet akar karatéban? Szellemi guru lenne? Ha el akarja érni. A vevőben pedig aztán még annyi önfegyelem sincs. immár századszor is végiggondolta. Vakon tapogatózott. Senkinek sincsenek elvei. legolcsóbb pisztoly formájában vásárolta meg a hatalmat.Hammond döbbenten kérdezte. mint benned. rá kell szánnia az időt. Meg kell találnia a járópallót! Vigyáznia kell. és máris megteheti a következő lépést. Hallható volt a két lábának zaja közti különbség. akiben nincs önfegyelem. Megszűnt a fény. nehogy a nyakát szegje! A palló. Elindult a bordás vaslemezen. mit fog tenni. – Majd én megmondom magának. Bármiféle is legyen az a hatalom. a tér leheletét az alatta lévő kétemeletnyi mélység ásítását. Sem neked. Vaksötétség. ugyanazt igyekszik elérni: valami nagyot alkotni. mit értek el mások. Nincs hatalom a tudás fölött: az öreg tudósokkal a kutya sem törődik. mint amelyet a tudomány táplál. hogy Malcolm félrebeszél. nincs önkorlátozás. Henry Wu fel-alá járkált idegességében. hogy a fényt egy velociraptor teste takarja el. mint az öröklött gazdagság. – Nekem halvány gőzöm sincs – mondta Hammond. . De ha az ember egyszer elérte. és nem üti agyon a feleségét. Vagyis ebben a fajta hatalomban van egy beépített önkontroll. Nem veszti el a fejét. Arnold visszanézett az ajtóra. Újra. gyorsan el is érhetsz valamit. Hammond nem bírta tovább. Benne még csak fel sem merül bármiféle önfegyelem szükségessége. és látta. Mindenki ugyanazt akarja. Sietnie kell! Amint kivilágosodik az első monitor. Az állat lehajolt.. legyen az akárki. Önfegyelem nélkül jut hozzá a tulajdonosa. tanulnia. Fontosnak kell lennie. Az bólintott. De nyitva is kell tartania az ajtót. és az ajtóba dugta. de már publikáltad. De még mekkora sötétségbe! Úristen. mércéi. a munkát. és belépett a sötétségbe. A szó szoros értelmében az önfegyelem és a tanulás eredménye. Anélkül nem megy semmire. Az kacsintott. Az ember csak elolvassa. szabadalmaztattad és el is adtad. a másik puha. – Akkor most miért mondta fel a szolgálatot? John Arnold az izgalomtól szédelegve tépte fel a gépház ajtaját. és óvatosan kinyitotta néhány centire. míg csak rá nem jött: nincs értelme. miről beszél? – kérdezte Ellie-től.. addigra el is jutott az érettségnek arra a fokára. és elmélyülten szaglászta a cipőjét. – A hatalom legtöbb fajtája jelentős áldozatot követel attól. hogy egy ilyen helyet fölépíteni egyszerű dolog. – Wu! – a rádió sivított. Már előtte volt a generátorokhoz levezető lépcső. – De egyszerű is volt – makacskodott Hammond. ahol nem fog meggondolatlanul élni vele. – Mivel pedig óriások vállára állhatsz. gondolnia kellett volna rá. Folyton mozgásban volt. Gyorsan lerúgta az egyik cipőjét. – Akkor egyszerű leszek – mondta Malcolm. így már elég volt a fény. Csak egyetlen filozófia létezik: gazdagodj meg mielőbb. a számítógépbillentyűkön. hogy puszta kézzel ölni tudjon. mozdulataival jelezte. önkorlátozó tanulási folyamat. úgy mint bármilyen más árut. hol ott futtatta végig a kezét a gombokon. Hát ezért hiszi maga is. Még tíz méter. sercegett. és hamar. mit csináltál. A vevő egyszerűen megvásárolja a hatalmat. Nem lehet csak úgy odaadni. hogy mire valaki megszerezte azt a képességet. Nincs meg a természetnek kijáró alázat. azonnal megnyomja. – Miről beszél ez? Harding némán integetett. az erőfeszítést. Nincs évtizedekig tartó inaskodás. hamisíts! semmi sem számít. Még azt sem tudod igazán. Rendkívül gyorsan haladhat. Utánakapott. válj híressé mielőbb! Csalj. Hol itt. benne lakik az emberben. miről beszélek – mondta. Most már jól látta. amelyet a tudomány tesz lehetővé. Visszament az ajtóhoz. a gyakorlást. Sok mindenről le is kell mondania érte. De legalább látott. Az öl. aki el akarja érni. A hatalom eléréséhez szükséges önfegyelem megváltoztatja az embert: nem fog visszaélni vele.

– Mi van avval a rohadt árammal? Van már? – Ez Muldoon hangja volt. és a hátára zuhant. és vicsorított. hogy nem várta meg míg az állat orra jelenik meg a cső végénél. meredek lépcsőn nem. az idegen gépi szagok teszik óvatossá. Különösen keskeny. még csak az kell. Még néhány lépés. hogy az állat jól lát. Már a tartalék generátor közvetlen közelében járt. De lassan jött. A betonpadlón ott állt a raptor. A szentségit. azt nem tudom. és ő egész egyszerűen belehátrált a legközelebbibe. hét méterrel felette a járópallón. Ellie a kezében tartotta rádióját. vicsorgott odafenn. úgy figyelt. Arnold eljutott a gépházba. hiszen még három vagy négy morog-vicsorog körülötte odakinn. – És pillanatnyilag nagy népszerűségnek örvendek. Vízlevezető csövek álltak egymáson halomban a látogatóközpont mögött. hogy alig kapott levegőt. még ebben a halvány fényben is. Elfordult. csak a palló rácsa. A raptor üvöltve vonszolta el magát. A velociraptor alig tíz méterre volt tőle. Leugrott! Arnold kétségbeesetten nézett körül. de hirtelen heves taszítás érte. hátha talál valami fegyvert. Van valami ötleted? – Nincs – mondta Wu. megcsapta a bűzös lehelet. A kíváncsi dög túl közel merészkedett a csőhöz. Hallani lehetett a halálos karmok pendülését a fémen. hogy a cső távolabbi vége nem nyitott. – Gennaróról van hírünk? Gennaro lenyomta a gombot. Hogy aztán mi történt. – Nem hiszem – felelte Muldoon. hogy a velociraptorok nem tudnak lépcsőn járni.. – Nincs – felelte Wu. Tompa zuhanás hallatszott a háta mögött. Hátralesett a vállán át.. kézzel-lábbal segítve magát. Muldoon csak azt sajnálta. Elmosolyodott örömében. – Te csak ne mozdulj onnan! Várd ki! Nem látta. Csak remélte. most meg nem tudta megnézni. mintha valami üregből jönne.” Arnold ugyanis meglehetősen biztosra vette. – Micsoda? – Be vagyok tömve egy rohadt csőbe – mondta Muldoon. – Arnoldnak már el kellett volna intéznie a dolgot – mondta Muldoon –. hogy valamelyik dög a seggébe harapjon! Arnold hátrafelé araszolt a járópallón. Méteres cső volt. öreg! – mondta Arnold. Legalábbis azóta nem. Kint is mintha elült volna a zaj. A raptor tehetetlen haraggal csalódottan morgott. Furcsán szólt. neki ugyan túl szűk. „Ez az óvatosság az egyetlen esélyem – gondolta Arnold. Már csak néhány méterre volt a lépcső. s kezdett lefelé mászni a szinte függőleges lépcsőn. – Azt hiszem. – Pech. láthatólag tudták. mely a felette mozgó fejből áradt felé. Persze még mindig van esélye ilyesmire. hogy az állat rajta áll. és akkor fogta csak fel. Aztán lapos betont ért a lába. A legutóbbi percekben azonban már nem jött senki. – Ha el tudok jutni a lépcsőig. Arnold tudta. lopakodva közeledett a félhomályban. – Igen. rendkívül népszerű vagyok – ismételte a rádióba. s azóta a többiek tisztelettudóbban viselkedtek. Muldoon kérdése hallatszott a rádióból: – Mennyi idő telt el? Wu válaszolt: – Négy-öt perc. és meg is pillantja. aztán onnan le a következő szintre. Ott van! Hátranyúlt. ő pedig kitátotta a száját. kitapogatta a korlátot. „Pontosabban szólva csőbe ékeltem magam” – gondolta Muldoon. de ide nem jöhettek utána. vagy már sohasem fogja. mint valami hülye rák. hanem azonnal meghúzta a ravaszt.– Igen! Itt vagyok. Wu szólalt meg: – Arnoldnál van rádió? – kérdezte. ott biztonságban vannak. Még néhány lépés. Két újabb indián munkás kért menedéket a kastélyban. Akkora súly nehezedett a mellére. amióta ellőtte a lábát az egyiknek. Arnold hátrafordult.. milyen a cső másik vége – túl gyorsan mászott bele hátrafelé –. . s kitört belőle az üvöltés. hogy Muldoon él. – Te hol vagy? – Betömve.. Szorosan beékelődött. de már a húsába is martak az óriás karmok.

és besurrant. vagy legalábbis egy lehetőség. ami esetleg beválhat. s kinyújtott kézzel tapogatózott. Nyilván valahol lent van az alsó szinten. Gennaro elindult. hogy a dzsungelben legyenek. Szélesre tárta és kitámasztotta az ajtót. Talán van rádió az épületben valahol. és odébb hengergett a betonon. A raptor a csővezetéken ült. – Hol a francban vagy? – kérdezte tőle Muldoon. Igyekezett olyan csendben mozogni. letaszította a raptort magáról. és a földre lökte. Raptor üvöltött valahol. Hallgatózott. Vér csöpögött a karmairól. Szünet. Lent sötétebb volt. Ha végig a főépület-komplexustól északra marad. hogy sérültnek látszik. – Van valami? – kérdezte Muldoon. Mintha jobb felől jött volna a hang. alig néhány méterre a fejétől. van egy terve. Ha nincs. a raptor már nem volt ott. Kezdett attól tartani. jobbra tőle. és éppen eléggé idegesítette. Egyszerre csak ráébredt. Öld meg! Gennaro felkászálódott. Az állat harapdálja! A raptor félrerántotta a fejét. – Alig várom már. hogyan kalapál a szíve. aztán beljebb indult az épületbe. De Gennaro úgy gondolta. Morgott. Érezte. Arra ment. ami fegyverül szolgálhat. Kívánjatok nekem sok szerencsét! Gennaro lehúzta a fejét a bokrok között. Amikor azonban visszafordult. Megtalálta az ajtót. Semmi sem indokolja. Így igaz. verejtékben fürdő Malcolm a sercegő rádiót hallgatta. hogy neki ne menjen valaminek. – Most indulok a gépházba. hová kell mennie. dél felé. hogy semmi. hogy megtudjam. Vér. Nem látott két-három méternél messzebb maga elé. Közvetlenül előtte volt a növényekkel szegélyezett út. Alig látott valamit. Járópallót pillantott meg közvetlenül maga előtt. Egyik kezével a csöveket tapogatva haladt előre. Van kedve veszélyesen élni? Nem igazán. Az istenit. Vagy legalábbis remélte. A rádiót meg ott hagyta. Fogak. feltornászta magát. Belebotlott valamibe. Megszagolta. mást nem tehet. hogy azt sem tudja. s liheg. Errefelé igen sűrű volt a növényzet. Meleg volt. Lefelé vezető lépcsőt talált. hogy egyáltalán észre sem veszi a gépházat. Madárcsiripelés hallatszott a fákról. a másikat maga elé tartotta. A lábaival van valami baj. kinyitotta. Igen: sérült. nem volt semmi kedve. Kényszerítette magát. Aztán futásnak eredt. hát megkeresi azt a generátort. de a raptor a hátára ugrott. Az ágyban fekvő. Gennaro erős férfi volt. Gennaro tudta. meg tudja közelíteni a gépházat hátulról. hogy a gépház valahol kelet felé van. a növények közt tört utat. Egy fél pár férficipő! Gennaro elgondolkodott. A férfi kétségbeesetten keresett valamit – akármit –. de letért az ösvényről. – Van valami hír? – A világon semmi – hangzott Wu válasza. és elvágódott. amennyire csak tudott. látta. – A francba! – fakadt ki Muldoon. és megdermedt. mint a víz. hogy így is túl nagy zajt csap. Óvatosan megindult előre. s fegyver után nézett.– Itt vagyok. mint aki kívülről figyeli önmagát. de a távolban. Aztán éles fájdalmat érzett a jobb karjában. Fülelt. Malcolm felsóhajtott. Amikor megfordult. Nagyon sötét volt odabenn. mely a látogatóépülethez vezetett. A raptorok valószínűleg mind a többi épület körül vannak. hogy milyen újabb tervvel fog előállni majd! . Gennaro. Valami a vállára és csupasz karjára csöpögött. hogy a raptor az oldalára esett. s a helyzetet. Gennaro teljesen körbefordult. de a hang nem ismétlődött. A hangja visszhangzott a sötétben. és megkerülte az épület oldalát. Állati morgást hallott. Megérintette a sötétben. A raptor még mindig a padlón lihegett. Felnézett. megállapította. De aztán mégis meglátta a tetőt a pálmafák fölött. Ragadt. hogy lelassítsa lépéseit. Puha pára úszott a levegőben. Donald Gennaro alól pedig kiszaladt a föld.

hogy az objektív. A tudomány akkora hatalomra tett szert. kérem – mondta neki Ellie. Nem működött már gazdaságilag. a tudomány is önmagát rombolja. vagy hogy miképpen éljünk. a tudomány formális nyelve elé. hogy az. ma még nem tud mindent. És ott lesz .. tud repülni. mint a gyermek. nem hit kérdése. és a bombát követte a genetikai hatalom kezdete. és ott átcsoportosulnának. az igazolás mindarra. mint önkényes játék. középkori eszmerendszert. a tudomány is egyre kevésbé felel meg a mai világnak. Mert az hatalom volt a javából. ne izgassa fel magát! – Maga is tudja. Senki sem szólt. – Ha lehet. takarékoskodni egyre fogyó erejével. hogy ez nem igaz. hogy új módon kell nézni a valóságot. amit a tudomány tesz. miről van szó voltaképpen – mondta Malcolm. és nem felelt meg a kialakuló új világnak. A tudomány mindig azt mondta. és Ellie már azt hitte. A huszadik századra azonban ez az állítás menthetetlenül megdőlt. mi itt az igazi tét. A tudomány alapeszméje – az. hogy a káosz be van építve mindennapi életünkbe. Először jön Heisenberg a bizonytalansági relációjával. izgalmas. hogyan. Ki él az elemi részecskék világában. a víz. Csak azt nem tudom. – Ha odahajthatnék vele hozzád. De akkor üres maradna a vezérlő. Nem különleges olyan módon. Malcolm köhögött. – Egy cseppet sem rózsás a helyzet. Ám tíz év sem telt bele. Newton és Descartes kora óta a tudomány nyíltan a teljes uralom vízióját vetítette elénk. – Ez azért erős túlzás – mondta a fejét rázva Hammond. de előbb-utóbb mindent tudni fog. A feudális politika. aki a ház tetejéről a mélybe ugrik. azzal kecsegtetett. úgy válik egyre képtelenebbe rá. amelyek ötszáz évesek. – Ugyanakkor azonban megszűnt a tudomány nagy szellemi jogalapja. Mint minden más elavult rendszer. többre képes. hogy lehet. de azt nem tudja megmondani. hogy ne használjuk. Puszta kérkedés. mert azt hiszi. Ma már látjuk. De abban már nem segít a tudomány. a föld – az irányíthatatlan tudomány jóvoltából. hogy a hatalmunkba kerítsük. hogy bánni is tudjon a hatalommal. hogy az ő nyelvük valami belső. hogy racionális – ez a gondolat akkor friss volt. több száz éves látomása – a teljes uralom álma – századunkban tehát meghalt.. – Egy vezérlő áram nélkül nem vezérlő. mint az előre megjósolhatatlan zivatar. ha mindenkit sikerülne bejuttatni a kastélyba. Ennek semmi gyakorlati hatása nincs arra. Azt állította. Ötven évvel ezelőtt mindenkinek az atombomba volt a mániája. Malcolm lehunyta a szemét. ahogyan képzeltük. De nem. mint az atomhatalom. reményt nyújtott a jövőre nézve.– Azt szeretném a legjobban – szólt Muldoon –. csakhogy a valóságban ez azért történt. Olyan közönséges dolgokról van szó. elemi igazsággal rendelkezik. amit „rációnak” nevezünk. amely a logika törvényeiből ered. és korlátokat szab annak. amikor még Firenze volt a világ közepe. A tudomány nagy. mert a középkori világ működőképtelenné vált. mikor ne építsünk. – Van egy dzsip a látogatóközpont előtt – mondta Wu. nem működött szellemileg. sem nemzetiségé. – Úgysem tudok itt mit csinálni. És most megtudjuk. hogy katasztrofális! Wu hangja hallatszott: – A raptorok követni fognak bennünket oda. amely több száz éves. A matematikusok eddig abban a hitben éltek. Igen ám. amit az elemi részecskék világáról egyáltalán megtudhatunk. igazolása. Olyan nevetséges és felelőtlen. – Na jó – mondta Muldoon. s elsöpörte a régi. s áll kölcsönös kapcsolatban egymással. – Ez az örökös igyekezet. Csend lett. – Most pedig a káoszelmélet szépen bebizonyítja. – Próbáljuk meg! De nem valami rózsás a helyzet. És vele pusztult a legtöbb jogcím. hogy mindennapi életünket éljük. Ahogy a hatalma nő. – Sóhajtott. – Indulás! A rádió egy kattanással elhallgatott. hogy eldönthessük. nem más. amely akkor is már sok száz éve uralkodott. Sokat ígért. több milliárd ember él összezsúfolva a világon. ahogy annak idején a középkor rendszere. Annál nagyobbat el sem tudott képzelni senki. – A tudomány korának végnapjait éljük. – De nem ám! – mondta az ágyban fekvő Malcolm. – Akkor is jobb helyzetben leszünk – válaszolta Muldoon. Malcolm végre elaludt. nehezen lélegzett. – Nyugodjon meg. – Most azonban – folytatta – a tudomány az a hitrendszer. És amiért hallgatnunk kellene rá. Na és akkor mi van? mondhatjuk erre. Képes atomreaktort építeni. hogy kezdenek előtűnni gyakorlati korlátai. hogy a természeti törvények megismerése révén ellenőrizhetővé válik. Erre Gödel teorémája hasonló korlátokat állít a matematika. És éppen úgy. a vallási dogmák. Abból az időből valók. Malcolm lehunyt szemmel feküdt. S a világunk kezd a legalapvetőbb szempontokból elszennyeződni – a levegő. Igyekezett lassan lélegezni. Olyan nyugati magatartásformákról van szó. el tudnál jutni a kocsihoz? – Talán. Mert most már igencsak felgyorsultak a dolgok. Hirtelen újra felült. A genetikai hatalom pedig sokkal nagyobb. de azt nem tudja megmondani. a gyűlölködő babonák középkori világa összeomlott a tudomány előtt. mit csináljunk ezzel a világgal. Hála főként a tudománynak. – Hát ez bizony igaz – kommentálta a párbeszédet. Tud rovarirtót előállítani. Mondhatnánk úgy is. – Ez egyébként mindenki előtt ismert.

hogy akár maga. Malcolm megint felsóhajtott. – Változás következik. ha már odaát vagy. – Mondja. tisztában van maga azzal. mennyire valószínűtlen. Malcolm vállat vont. hogy feltegye a kérdést: „Mit kezdjek a hatalommal?” – pontosan azt a kérdést. A gyerekek iskolai kísérleteiben. – Miféle változás? – Minden nagy jelentőségű változás olyan. nem tud felelni rá.mindenki kezében. – Szegény ember! – mondta fejét ingatva Hammond. Benne lesz a hétvégi kertész szerszámkészletében. amelyről a tudomány azt mondja. Ez pedig mindenkit rá fog kényszeríteni arra. mint a halál – felelte a matematikus. – Csak akkor pillantod meg a túloldalt. – Ezzel lehunyta a szemét. akár bármelyikük is élve kijut erről a szigetről? . A terroristák és diktátorok olcsó laboratóriumaiban. – És mi fog történni? – kérdezte Ellie.

IAN MALCOLM .HATODIK ISMÉTLŐDÉS A rendszer helyreállítása lehetetlennek bizonyulhat.

Nyikorgott a szélben. itt Grant! Lex kerekre nyílt szemmel bámulta az őr testét.. jobbra tőle. amivel szinte kirobbantak a napfényre. Sok helyen látott azonban száradt. – Mert nyugtatót lőttem bele – válaszolta Grant.. Megdöbbentő volt a sebesség. . egy tál víz kíséretében. visszaviszi őket a felszínre. Pontosan a garázs elé érkeztek! – Hurrá! – kiáltotta Lex. – Bizony. – Tényleg? – kérdezte Lex. Állatketrecek egész tömege volt egymásra halmozva az egyik falnál.. itt Grant! Halló! Lex előrehajolt. Grant a padlóig nyomta a sebességpedált. – Hé! Ezt ne csináld! – Meghalt? Mi az ott a padlón? Vér? – Igen. hogy nem is igazán vörös? – Morbid vagy – szólt rá Tim. légy szíves! – Kinyújtotta a kezét. – Hogy lehet. lába az égnek állt. Az „AMIKOR DINOSZAURUSZOK URALTÁK A FÖLDET” feliratú tábla a sarkánál fogva lógott lefelé. és így bejutott némi fény is.VISSZATÉRÉS A kis villanyautó zümmögve robogott tovább a sötét. Most vette csak észre. szürke pára úszkált a levegőben. – Miért lélegzik olyan nehezen? – kérdezte. – Már közel kell lennünk – mondta Grant.. Az alagút fala sima volt. hogy felvegyük a kapcsolatot a hajóval. föld alatti alagútban. – mégpedig fiú dinoszaurusz. – Számításom szerint pillanatokon belül a látogatóközponthoz érünk... és végigpróbálta az összes csatornát. itt Grant! Hall engem valaki? Halló. tizenöt perc. melyet ernyő védett az esőtől. ahol a velociraptor hevert. kinyitották az ajtót. állati ürüléket. amely közvetlenül előttük magaslott. hasából kilátszottak a csövek és vezetékek. s az óráját a kislány felé fordította. és átkukucskált a pult pereme fölött. A látogatóközpont bejárati halljának üvegablakai betörtek. – Elpusztul? – Remélem. – Nem volt biztos benne. Lex. Semmi kétség: jó néhány állat járt erre. Grant azonnal látta: a látogatóközpont az. – Oké. Tim és Lex riadtan a biztonsági őr elárvult pultjához húzódott. hogy „morbid”? És nem vagyok az! Aztán megreccsent a rádió.. És elnémultak. hogy. Az óriás tyrannosaurusrobot feldőlt. – Hú! – kiáltott fel Tim. aki mellette ült. – Miért visszük magunkkal? – kérdezte Lex. miközben Grant beállt a garázsba a kis villanyautóval. – Hurrá! Sikerült! – Fel-le ugrált az ülésen örömében. Grant elkapta a karját. hogy ez kölyök – felelte Grant. Aztán elindultak lefelé a látogatóközpont földszinti bejáratához vezető lépcsőn. Az ablakon át elmosódott pálmafasorok rajzolódtak ki halványan a ködben. – Halló. és. de úgy érezte. Az egyikbe betették a velociraptort. Grant felvette az őr rádiókészülékét. Csak a lába látszott ki. hátravilágított a zseblámpával. nem. az alagút már enyhén felfelé lejt. mely a padlón hevert. – Mit mutat? – Azt. – Mi az.. Tim szólalt meg: – Ami azt jelenti. – Halló. az üresen ásító nagyteremben hűvös. csak itt-ott törte meg egy-egy szellőzőnyílás. – Honnan tetszik tudni. Halvány zöld köd úszott a levegőben. – Hogy mindenkinek bebizonyítsuk a központban: a dinoszauruszok tényleg szaporodnak. hogy már csak negyven percünk van rá. tíz óra. – Most rögtön megyek hamburgert enni! Rósejbnivel! Meg csokifagylaltot! Nem lesz több dinoszaurusz! Hurrá! – Odaértek a hallhoz. eleltakarva az épületet. a szeme pislogva követte a lámpa fénysugarát. De most inkább előre világíts. hogy szaporodnak? – Onnan.

már hallották a raptorok morgását. Fényes cserepei Malcolm ágyára záporoztak. – Mi a kastélyban vagyunk.. Lehet. ön nincs tisztában a helyzettel. Nem működik semmi. amikor Muldoon félbeszakította: – Azt hiszem. sikerült idejuttatni őket a kastélyba. – . – Egek ura! Itt vannak! – Alan. – Hála legyen Istennek! – mondta Ellie. – . – Muszáj valahogy bekapcsolni – mondta Grant –. A Malcolm ágya fölötti üvegablakon a raptorok már átrágták magukat az első acélrácsokon. Már elkezdték átrágni az ablak acélrácsait... Most Wu hangját hallotta a készülékben. – Milyen gyorsan? – ismételte meg a kérdést Grant. – Megvagyok. Sántikálva járkált körbe a szobában megrándult lábán. – De rondák! – szólt felnézve Malcolm. Senki sem számolt azzal. Most. – egy pillanatra kimaradt az adás. A főépület halljában. – A raptorok kiszabadultak. – Hogy tudhatna? – vágott közbe Muldoon. még pedig azonnal! Ha nem sikerül.ol vagytok? – A hallban. a raptorok félórán belül elérik a szárazföldet. hogy az üveg betört.. – Átrágják a rácsokat? – Homlokát ráncolva próbálta maga elé képzelni a dolgot. és ráncigálta. tíz-tizenöt percünk lehet. – Grant? Te vagy az? Aztán: – Alan! Alan! – Ellie volt az. Ezüstös. egy pillanat. ahogy az acélrácsokat rágják. – Jössz vissza? A rádió recsegett. – Legalább egyelőre még nem tudnak bejönni – mondta Ellie. A raptorok átjutottak a kerítés fölött a tetőre.. – Ha Grant valahogy be tudna jutni a gépházba. csak éppen ki van kapcsolva minden. Grant tovább kérdezett. Egyébként az üvegtetőn lévő acélrudakban is áramnak kellene futnia. – Nincs bajod? – Nem. – A jelek szerint nem. Az egész rendszer kikapcsolódott. amerre harapdálták. De mindenki más itt van.. és a nagyobb darabokat leszedte a takaróról. Képesek kinyitni az ajtókat is. Pillanatnyilag a tetőn van kettő. míg teljesen átrágják magukat. Grant magyarázatba kezdett a hajóról.. – Recsegett a rádió. Itt nincs! – Hogyhogy? – Néhány raptor a nyomunkba szegődött. mindenki más? – Néhányan elvesztek. nincs bajom. Már nincs egy félóránk. s az üveg betört. – És a többiek? Muldoon. . és elhallgatott.túl közel ültettek egy fát a kerítéshez. Ellie odanyúlt.– Uramisten! – hallatszott egy hang. hogy ott vannak. húzta hátrafelé. – Míg át nem rágnak még egy rácsot. Grant megdöbbent. Ó.. horkantásait. fogaik csikorgását. – És a gyerekek? Láttad őket? – Itt vannak velem – felelte Grant.. Grant doktor! A rádió kattant. – Hála Istennek! Lex négykézláb mászva igyekezett megkerülni a pultot. Olyanok mint a hiénák. – Hát a telefonok működnek-e? – Nem. Mihelyt pedig bent vannak. – Hát ez remek! És te hol vagy? – kérdezte Grant. benn az épületben. ahol ti. s a tető üvegén át bejutnak az épületbe. – A harapóerejük több mint ezer kiló négyzetcentiméterenként.. figyelj! – szólt Ellie. hogy állatok juthatnak a tetőre. – No és? Az épület áthatolhatatlan. – Ők is jól vannak. – mondta Wu. Grant doktor. Erős hátsó lábát az ablakra tette. Muldoon krákogott. Már egy ideje. Habos nyál fröccsent a lepedőkre és az ágy melletti asztalkára. és. elvékonyodott szakaszok voltak mindenfelé. – Hogyan tudnánk a rendszert újra beindítani? – Azzal próbálkozunk. Az egyik állat megragadta a rúd végét. – Gondolom. átharapják az acélrudat is. – Milyen gyorsan? – Gyorsan – felelte Muldoon. Grant a bokájára csapott.

– Oké. Vigye magával a rádiót. mit kell csinálni a számítógéppel. akkor figyeljen! – mondta Wu. ugye? – Láttam – válaszolta Grant.Hátha sikerülne. a kerítéshez. hogy eltereljük a figyelmüket. – Hagyja a gyerekeket a büfében. Malcolm köhögött. kérem! – szólt Wu. Ott van még? – Itt vagyok – felelte Grant. ha elérte a gépházat! – Oké. A rádió percek óta hallgatott. hogy még legalább négy van odakinn.. talán még arról az üvegtetőről is lemennének. Hűvös ködfoltok úsztak el mellettük. maga körül.. nry Wu beszél. A rádió megreccsent. Tim megkérdezte: – Miért nem szólnak hozzánk? – Én éhes vagyok – jelentette ki Lex. – Igen – gyenge volt a hangja. Alig értette a kérdést.– Nem elég az idő. és beindíthatná a generátort.. Ahol a generátorok és más berendezések vannak.. Látta azt az épületet tegnap. – Mit mond? – kérdezte Muldoon. de ebben nem lehetünk biztosak. hogy sikerül az összes raptort idecsalnunk.. köd. – Igaza van.. Lex előmászott. Úgyhogy legyen óvatos! Adjon nekünk öt percet! – Oké – felelte Grant.. Pálmafák. és megpróbálkozhatnánk vele.. ott biztonságban lesznek. – Nincs már annyi idő. – És akkor mi van? – Akkor Grant nyugodtan bemehetne a gépházba. – Várj egy pillanatig! – mondta Wu. – Nem lehetne? Mit? – Elterelni a. – Akkor majd én – szólt Harding. ellátok.. – Igen – mondta megint Malcolm. – Majd én – mondta erre Wu. ott van. – Malcolmnak szüksége van magára. az? Velem nem mentek semmire. – Grant. – Nos. – Megvonaglott a fájdalomtól. Csak te tudod. – Megpróbálnak kitalálni valamit – mondta Grant. Ahhoz nem. bár egy pillanatra meglepődött. – Képtelenség – mondta Muldoon. – Csak Grantnak ne mondják meg – kérte. – Igen. – Dugják ki a kezüket! – Jókor viccel! – szólt Muldoon. Kimehetnénk. hogy befűzze a tornacipőjét. és haragosan elfordult. – Azt reméljük. alig több valamiféle hörgésnél. ha megtudja. Wu folytatta: – Van egy ösvény. – Nem – mondta Ellie. – Raptorok lesznek mindenütt. Megpróbálni mindenképpen érdemes! – Vagyis valakinek el kell játszania a csalétek szerepét – mondta Muldoon. arról szó sem lehet! – csattant fel Muldoon. . – De ha ide tudjuk csalni a raptorokat – vitatkozott Wu –. – Pontosan. – De ki legyen. – Azt nem – tiltakozott Muldoon. – Igen? És mit csináljunk? Malcolm kimerülten elmosolyodott. fenn a tetőn. Tényleg csak tegnap lett volna. hogy még idejében visszakapcsolja az áramot. hogy a rendszert is bekapcsolja? – Pontosan. – Elterelni a figyelmüket? Hogyan lehetne? – Menjenek. Grant kikapcsolta a készüléket. . Én megyek... – Figyeljen. Végig kapcsolatban kell lenned Granttal. – Ellát a látogatóközpont hátuljáig onnan. – És után még vissza is menne a vezérlőbe. amely a pálmafasoron át egyenesen a gépházhoz vezet. Itt csak két raptor van. míg elindítja a rendszert. – Ördögöt. hogy belesett abba az épületbe? Mintha évek teltek volna el azóta.. – Ideges lesz. Ami azt jelenti. nehogy zajt csapjon odakinn! És hívjon. Készre ment a bokám.. De Ellie már hajolt is. hogy ennek véget vessen. – Nem lehetne. Néma csend volt a hallban. ahol most van? Grant átnézett a hátsó üvegablakokon.. Lehetetlen. – De kapcsolja ki indulás előtt.

Tim a zsebébe gyömöszölte a csokoládérudakat. A büfé teljes sötétségbe borult. halvány állatalak tűnt fel a ködben Ellie látótávolságának legkülső határánál. Oké? – Oké. hogy beszélsz? – Akkor menjünk lassabban! Kétszárnyú lengőajtó volt a székek és asztalok mögött. Ellie Sattler kilépett a kastély első ajtaján. – Hé! – kiáltott bizonytalanul a ködbe. De tessék itt hagyni nekünk a rádiót – mondta Lex. Mögöttük rozsdamentes acélból készült lengőajtók. – Maga túl nagy lármát csap – mondta Muldoonnak. miről van szó. és kitárta. Nem hiszem. ha itt maradnátok.. – Akkor fagylaltot! – Tim. majd újra előtűnt. – Nincs áram. Úgy kongatta vele az acélkerítést. miféle zaj jön a kastély felől. A rácson túl azonban alig látott valamit. – Jól van. hogy vigyázz rá. Nyilván a konyhába vezetett. a húgoddal kell maradnod. hogy zajt kelt! – Kibicegett. – Megjött az első vendég – mondta Muldoon. – Nincs áram. Rendben? – Rendben. Lex megfogta a bátyja kezét. és elindultak a hallban úszkáló ködön át. Ellie kezdett nyugtalankodni. . bármi történjék is. – Szart se látok! – mondta. Azonnal megérezte a hűvös párát az arcán és a lábán. noha tudta. Idegesen nézett a tető felé. A raptor – fehér árnyék – eltűnt. Foszforeszkáló zöld színben látta az asztalokat és székeket. Acélrúd volt a kezében. benne kis kerek ablakok. és beljebb vezette Lexet az étterembe. Kézen fogva vezette a kislányt előre. Raptor volt. – Tudom. – Maradok. teli rágógumival és csokoládéval. Sőt. és kifejezetten bántotta a férfi akasztófahumora. És nem látott semmiféle raptort sehol. Felmarkolt egy csomó csokirudat. gyerekek! Ebéd! Terítve van! – Nagyon vicces! – szólt Ellie. – Azt nem lehet. Felálltak. aztán tejfehérré vált a táj.. gyerekek. hogy ez elég lesz – mondta. amit valamelyik benti építkezésről hozott magával. Nem látott raptort. a kertekben s a fák között hátborzongató csend uralkodott. – Nem értenek angolul – vigyorgott Muldoon. Még húsz méter. De velem mi lesz? – Csak fogd a kezem! Keresünk valami ennivalót. Ti csak maradjatok itt. – Hamburgert akarok! – közölte Lex. – Egy frászt! – felelte az. – Kapcsold fel a villanyt! – kérte. – Egy kis időre magatokra kell hagyjalak benneteket – mondta Grant. mintha ebédhez szólító gongot ütne. Szeretném. Grant behúzta maga után az ajtót. – Pedig így van. Közvetlenül előtte feltűntek a sűrű ködben a vastag rácsok. – Nem hinném. – Azért vedd el ezeket! – Fagyit. Muldoon megint kongatni kezdte a kerítést a rúddal. Tim! – Oké. A közelben pénztárgép. Kísérteties. Ellie még mindig ideges volt. Muldoon az ajtókeretnek dőlt. hogy lehet főzni. – Oda – mondta Grant.– A büfébe megyünk? – kérdezte. Grant szögletes étkezőasztalokat és székeket látott. Ha nem sikerül a raptorokat a kastélyhoz csalnia. de egy lépéssel sem jött közelebb. nagyjából csak felfogják. – Nem lehet – felelte Tim. s furcsa módon mintha kíváncsi sem lett volna rá. – De gondolom. Különben is. A ködbe burkolódzott látogatóépület felé nézett. oké. hogy a kerítésen belül teljes biztonságban van. jobbra meg a csillogó pénztárgépet és a rágógumis. Öt perc múlva itt vagyok. – Mondtam. Vadul dobogott a szíve. A kislány megrángatta a kezét. – Ő azonban a szemére húzta az éjszakai nézőt. Tim belökte az egyik ajtószárnyat. hogy fagyit kérek! – tiltakozott Lex. csokoládés állványt. mellette állvány. – Jó neked. – Itt a kaja. – Arról volt szó. Amikor kinyitotta. – Te csak gyere velem! Fogd a kezem. Grant veszélybe kerül. Beléptek a büfé ajtaján. Szükségem van rá.

Lassan körbeforgott. De a botanikusnő már nem figyelt rá. aztán kettő – majd három – állat ugrik neki a kerítésnek. a növényzet felé mozog. Muldoon részeg izgalommal a hangjában azonnal ordítozni kezdett: – Az istenit neki. – Azok is. de mintha kezdte volna elvonni a figyelmüket a kintről jövő zaj. hogy elvesztette az egyensúlyát. mint valami gyakorlott sprinter. kicsit távolabb. Ellie most már hátra sem nézve rohant. megnézte a karcolásokat és kék foltokat. amint először egy. hogy a köd. Hunyorogva próbált kivenni valamit a sötétben.és vállizmai szinte fájtak a feszültségtől. Felmászott rá. Aztán megfordult. – Hall engem. – Jó – mondta Ellie. és nagyot sóhajtott: – A lövedékek Gennarónál vannak. Karmait előremeresztve felugrott. valahol másutt van! – Gyerünk. mint a csimpánzok. a raptorok intelligensek. – Vagy ha ragaszkodik hozzá. – Bízza rám! – Bízzam? És mit akar csinálni? Ellie nem válaszolt. Láb. kislány. Erőltette a szemét. s már meg is pillantotta a ködből előtűnő kerítést. hogy lásson valamit. A második a másik oldalról támadt. – Azt mondják. Ellie biztonságban szaladgált fel-alá a rácsok mögött. – Ezt én nem tenném – jegyezte meg Muldoon. Egy pillanat múlva már láthatatlanná vált. Újra meg újra a kerítésnek vetették magukat. nem is igazán igyekeztek Ellie-hez férni. mint enyhén szitáló eső. még idejében. hogy lássa. Kezébe kapta a rádiókészüléket. és bekapcsolta. és futásnak eredt. – Akkor talán felismerik ezt a hangot – mondta Ellie. a lábán lefolyó vért. majd újabb nyikorgással megint kinyitotta. hogy elvágják az útját visszafelé? Nem nagy ugyan a távolság a kerítésig. és gyorsan haladt előre a ködben. s a földre zuhant. Pontosan. felugrottak. nem igazán nagy. levegő után kapkodva. Az örökös párától megrozsdásodott sarokvasak hangosan nyikorogtak. – Itt Grant! – mondta – Benn vagyok! Wu felnézett a tetőablakra. és megragadja a karját. de Ellie teljes erőből futott. Nyilván az volt a szándéka. hogy az egyik kis híján elérte a tetejét. kiált neki. Visszavicsorgott rájuk. kettő a tetőn. látta Muldoont. Olyan vadul kalapált a szíve. aminek akarom! – dühöngött Muldoon. – Akkor tartsa nyitva a szemét. A két raptor még mindig be-benézett odafentről Malcolm szobájába. ahogy várta. . – Maga túl sokat ivott – szólt közbe Ellie. Sehol sem látott rajta ajtót. Továbbment.. Hátul. Ugrott. Ellie becsukta az ajtót. Zárva volt. és folytatta útját az épület körül. Legalább annyira. hogy egy még hiányzik. hadd hozzam a rakétakilövőt! – Hát hozza! Muldoon észbe kapott. és kinyitotta a kaput. Szürke árnyalatok világában járt. amely félelmetes sebességgel kezdett eltünedezni a ködben. és északnak indult rajta. – Ezzel kilépett a kapun. hogy futás közben kapja el őt. hogy szinte azt sem érezte. utána nyúl. – Szórakoztassuk még egy kicsit őket! Grant maga mögött hagyta a látogatóközpontot. jöjjön vissza. ennek nem sok híja volt! Mekkorát tudnak ugrani ezek a dögök! Ellie talpra állt. Odakinn a három velociraptor újabb és újabb támadásokat intézett a kerítés ellen. és vicsorogva morog. – Úristen. – A hallásuk is jó? – Az... Grant belépett. amint szélesre tárja a kaput előtte.– Én ismerem ezeket az állatokat. mindenfelé igyekezett figyelni. A kapuhoz ment. Támadtak. – Szép volt! – kiáltotta Muldoon. – Annak szólítom. Szemben előtűnt a ködből a gépház szögletes épülete. és bordázott acélból készült tolóajtóval találta szemközt magát. amitől azok teljesen megvadultak. Ez azt jelenti. megfeszült a teste. ahogy a lába a sarat tapossa. Nem ment a növények közelébe. Van-e annyi intelligenciájuk. Az első állat egy fa aljnövényzetéből rontott elő. és végignézett magán. olyan erővel. közönséges ajtót pillantott meg. megkerülte a sarkát. Eltávolodott a kerítéstől. Grant leugrott. Szándékosan ingerelni kezdte az állatokat. Fél pár férficipővel volt kitámasztva. Hangtalanul. „Mennyire eszesek ezek az állatok?” – tűnődött Ellie. a rácsokon kívülre. Megtalálta a pálmafák közti ösvényt. de azonnal! – Hogy mer engem „kislánynak” szólítani? – kiáltott vissza neki Ellie. segítsen! – szólt rá Muldoon. de Ellie azonnal sarkon fordult. Odalépett az oldalablakhoz. a kapun. Kitűnő. a hétszentségit?! – ordította Muldoon. Jobb felé. És nyitva hagyta. Már legalább húsz méterre volt a kerítéstől. s az állat a sáros földre zuhant. Csak egy dolog járt az eszében: három állat van itt. De a raptorok mintha már nem vették volna komolyan a dolgot. Nem hagytak fel vele. s látta. hogy bekerítsék.. A férfi oly hevesen rántotta be. a növényzettől félig eltakarva rakodórámpát látott teherautók számára.

. eltávolodtak a kerítéstől. PVC. mint a madarak! – szólt Muldoon.. klikk. – Kövesd tovább a csövet! – Oké. Wu rábólintott. klikk – nagyon gyorsan egymás után. – . majd három kattanás – klikk. – Jó – mondta Wu. akkor egy másik. – „Gyúlékony” – az áll rajtuk. és az oldalához mész. – Előadást rendeznek. – Igen. és levezet a mélybe. Muldoon feszülten ráncolta a homlokát. nyomd be a vöröset! – Rendben. – Oké. Szevasz! – Kösz. jobbra tartó pallót látsz. Szünet. Ha a tartályok aljára nézel. rajta két gombbal. Sárga és vörös? – Az az – felelte Wu. nem igazi támadásra. Aztán hozzátette: – Egyébként inkább szólíts Alannek. – Az is – mondta Wu. Majdnem egy percig tartott. – Intelligensek. és utána a vöröset? – kérdezte Wu. Au! – Mi történt? – Semmi. – Próbáld meg még egyszer! – Már megpróbáltam – mondta Grant. amely két emelet mélységbe nyúlik le. pontosan – mondta Grant. – Indulj el a pallón! – Indulok. A cső egy nagy alumíniumkasznihoz vezet. – Alan? – Nem sikerült – szólt Grant. Nem is igazán próbálnak. és míg benyomva tartod. oké – válaszolta Grant. – Wu lehunyta a szemét. – Látom.. – Először nyomd be a sárgát. – Négyhüvelykes PVC? – Az. aztán a zúgás abbamaradt. amit mondtál. – Akkor most két sárga tartálynak kell előtted lennie. hogy nem tudnak a nőhöz férni. Wu megragadta a maga készülékét. – Pontosan azt tettem. korláttal. – Az a generátor! Ha megkerülöd. Azt mondja. vicsorogtak. Lent vagyok a létra alján – szólalt meg Grant. Ingerültnek tűnt a hangja. Grant doktor? – Benn vagyok – mondta újra Grant. leereszkedtek. Baloldalt van. egy csomó csővezetéket kell látnod. A kettő közül az egyik kiürült. megint köröztek. Csend. Csak bevágtam a fejem. – Oké. Csak. hogy jobban maga elé képzelje a helyszínt. – Menj le a létrán! Hosszú szünet következett. mintha generátor volna. Kövesd a csövet befelé! – Oké. aztán végül következet a roham. ezért most át kell kapcsolnunk a másikra. – Megvan. előbb-utóbb egy létrához érsz. Valami zúgni kezdett. – Már látom. – Ha nyolc-tíz métert mégy előre. felágaskodtak. – Másodszorra sem sikerült. – Ahogy haladsz – irányította tovább Wu –. – Menj azon. „Honda”. – A sárgát nyomtad be előbb. Alatta meg valami szöveg spanyolul. utána semmi. látod. amelynek szellőzőnyílások vannak az oldalán. Úgy néz ki. az épület közepén egy nagy.gyok. Már rájöttek. rendben. Wu nedves hajába túrt az ujjaival. Rajtuk felirat: „Robbanásveszélyes”. Megreccsent a rádió. Grant doktor? – Igen – felelte Grant.. De a viselkedésük egyre inkább valamiféle bemutatóra emlékeztetett.Szinte úgy tűnt. – A rádióból gyengén hallani lehetett a léptek kongását a fémen. Wu és Muldoon egymásra meredt. – Oké. a fejem. – Egyenesen előtted. Kört írtak le. – Dühösnek hangzott. – Bent van a gépházban.. Újabb szünet következett. Balra tőled fémből készült járópalló. – A generátor két üzemanyagtartálya. hogy fehér cső nyúlik ki belőlük. – Látom – mondta Grant. – Megismételné. – Jól vagy? – Persze. játszanak. – Tisztára. – Azok azok – mondta Wu. .. jól. Alan! Ha éppen a keleti ajtón belül állsz. Hülye vagyok. süllyesztett víztartály van. követem. kapcsolótáblát látsz.

hogy a generátor gyújtani próbál. akkor várj egy pillanatig – kérte Wu. – Menj vissza a vezérlőbe.. – Megvan. – Kerülj a generátor hátuljához... – Még mindig ragaszkodsz a fagylalthoz? – Megmondtam. hogy a tűzhely be van kapcsolva? – kérdezte a kezét elengedve Lex.. hal – minden.. Alan! Nagyszerű voltál! – Jó. – Félek. – Elindult! – jelentette Grant. Embernagyságú mélyhűtő volt. hogy csak a szél. Megrántotta. – Oké. Tim kinyitotta az étterem végében lévő lengőajtót. sziszegő hangot hallott. aztán megszólalt az egyenletes. Acélajtaján széles. Várj.de már folyadék jön. majd kattog egy-kettőt. – Bravó. ahányszor kinyitott egyet. Alan? – Igen. rengeteg égővel. – Hogy lehet. Rengeteg doboz tej. Még az is lehet. hogy nem az. – Alan? A rádió süket volt.. Fagylalt után kutatott. mint valami nagyon nagy kígyóét. zakatoló hang. hogy Tim először fel sem fogta a szavait. a levegője metszően fagyos. Lex az acél munkaasztalnál állt. kinyitotta. a konyhaajtó felé. . Otthon villanytűzhelyük volt. Keress egy kis szelepet a tetején. és végig irányítlak. és belépett a konyhába. – Ha odaérek. A készülék egy utolsót sistergett. – Még csak a lámpák sem gyulladtak ki itt. hússzeletek egymáson. s látta. járható hűtőszekrények. van valami idebenn! A kislány suttogott. – De azt jelenti. Aztán sietve kihátrált a hűtőből. utána Grant ismét szólt: – A cső egy kerek. amely azt jelentette. és kilesett.. ahogy a generátor megfordul.. jelentkezem. Benzinszaga van. és járni kezd. ami úgy néz ki. – Szóval most az következik? – Az.. talán tudok főzni neked valamit. – Oké. balra nagy tűzhely. Tim elkezdte nyitogatni a hűtőket. olyannyira. Füst szállt belőlük a nyirkos levegőbe. – Azok jelzőfények. – Nem érdekes – mondta Tim. – Pontosan az is: üzemanyag-szivattyú. élettelen volt a hangja. de most mi van? – kérdezte Grant. Hátrafelé nézett. egy kis forgatható fémkupakkal. Zárd le a szelepet! – Wu a fejét ingatva Muldoonhoz fordult. – Timmy. – Ezért nem indult a szivattyú. – Nincs bekapcsolva. de Tim valahogy tudta. fekete hengerbe fut be. vízszintes fogantyú. de valami okból nem megy. – Rövid szünet. Tim a konyhaajtóhoz lopózott. – Mik azok a jelzőfények? – kérdezte Lex. – Oké. Csavard ki. – Most próbáld meg újra a gombokat! Egy pillanat múlva Wu hallotta.. – Úgy van – mondta Wu. – Neked keresek fagylaltot! – Timmy. csak fagylalt nem. Tompa. Alig lehetett hallani is. Nagy. zöldség halomban. – Ebben a hűtőben aztán volt minden. mögötte pedig hatalmas. – Sok kis kék lángot látok. Alan? – Itt vagyok. ahol a műanyag cső betorkollik. hogy beindult. A hang csendesen emelkedett és süllyedt. – . – Nem tudnál legalább egy percig békén hagyni? – kérdezte ingerülten a kisfiú. – Timmy – suttogta a kislány. – Szelepet? – Ki kell állnia felül. Valóságos szoba. majd elnémult. amíg. oda. De oldalt van. ahogy a motor felköhög. rozsdamentes acélból készült asztal a helyiség közepén. – Úgy tűnik. – Levegő jön belőle.– Jó. mint valami üzemanyag-szivattyú. nem a tetején. – Oké – mondta Grant. nem? A következő hűtőszekrény igazán hatalmas volt. – Az a jó. A fiú halk. hogyan állítsd helyre a rendszert kézi vezérléssel. hogy az ajtó széleit ragyogó zöld füst veszi körül. és újabb hűtőszekrényt nyitott ki.

Az elsötétített étteremben szép. az asztal alá süllyedt. Tim legalább annyira félt az átható. valahogyan érzi a szagát! Tim szíve dübörgött mellkasában. aztán néhány lépést hátrált. Megtalálta a hússzeletet! . Grant megállt. És szaglászott. Előbbre lépett. De hát különben is: mit érnek a könyvek? Ez itt az igazi! És jön felé. Nehéz volt ebben a sötétben visszatalálni. Aztán a fej éberen felcsapódott. Csillogó. és farkasszemet nézett vele. A velociraptor megállt. s megint ide-oda rebbent. és csupa erő. jól boldogul. némán. szabályos rendben álltak a szögletes. Ilyenkor gyors. Közel hajolt hozzá. Tim nem válaszolt. hogy még valami mást is hall az épületben a generátorzajon kívül. és visszasietett az ajtóhoz. mint odakünn az őserdőben. de a raptor nyilvánvalóan elég jól látott ahhoz. Gigászi. gondolta. – Hol van?! – kiáltotta Grant. madárszerűen kapkodta a fejét ide-oda. A velociraptor újra előrenézett. Itt sötétebb van. amint a dinoszaurusz némán ásít. bár izmos lábait és farkát eltakarták az asztalok. mint valami szellem – csak sziszegő légzése hallatszott – ott lopakodott egy velociraptor.. A velociraptor két méter magas volt. Még mindig nem takarja semmi. hogy a szíve majd kiugrik a helyéről. A kisfiú megdermedt. Ezért még óvatosabb. – Van valami ott kinn? – kérdezte Lex. Közöttük pedig. a karmok lefelé himbálóztak. De közben már érezte a nagy sárkánygyík penészes szagát. A szagukat követné? Minden könyvben az áll. az asztal távolabbi lába mellett. Csak nem mozdulni! A velociraptor moccanás nélkül állt a konyhaajtóban. majd a negyediket is. és a másodikat is letette. Tim félig guggoló helyzetben állt a helyiség végében. parancsolóan suttogta: – Nem mozdulsz! – Aztán a fagyasztószekrényhez futott. szimatoló hangokat hallatott. Tim addig figyelte. Az állat szaglászott. Csendesen letette az első szeletet a padlóra. és fülelt. kutató tekintettől. az asztalok alá engedve fejét. A velociraptor embernagyságú. A sziszegés felerősödött. Tim érezte.. A nagy szemek forogtak csontos üregükben. mint az éles fogsoroktól. Aztán megpillantotta a teherkocsit. amikor rájött. de nem különösebben okos. ez az orrfacsaró bűz. majd a karmos mellső láb megragadta az ajtót. Időről időre lehajolt. Lassan lehajolt. zöld alakokat látott mozogni a sötétben. és már elindult rajta felfelé.. hogy a velociraptor a konyha felé közeledik. Összehúzott szemmel igyekezett kivenni valamit a sötétben. de ez. – Itt – válaszolta Gennaro. közelről a velociraptor még a tyrannosaurusnál is sokkalta ijesztőbb volt! A tyrannosaurus óriás volt. Jobbra-balra tekingetve közeledett. fejét ide-oda kapkodta. A létrához ért. Ez az óriás méret. de nem volt ideje. Grant semmiféle teherkocsit sem látott. hogy elrejtőzzék: a feje és válla az asztallap fölé emelkedett. Rosszabbul lát. Valahogy még rémisztőbb volt egy konyhában szembenézni egy ilyen szörnyeteggel. Kiáltozó emberi hang! Mintha Gennaro lett volna az. Felkapott egy maroknyi hideg hússzeletet. hogy egyenletesen haladjon előre. Tim lassan leengedte a testét. s a nagy fej óvatosan körülpillantott. néma ragadozó madár! Sötét volt az étkezőben. gondolta Tim. foltos mintázatot a hátán. A sarokban az asztal alá nyomta a húgát. és feléfordult. A gépház sötétjében Grant a csövek mentén tapogatózva igyekezett vissza a létrához. zöld asztalok. mint egy madáré. úgy tűnt. Nézőjén át látta. feltárva borotvaéles fogsorait. hogy Lex kikukucskál a szeméttartály mögül. Lex! Úgy látszik. A velociraptor lekapta a fejét. a hosszú egyenes farok pedig lecsüggött. Tim számára dermesztő volt a csend. – A teherkocsiban. A velociraptor éberen figyelt. Járás közben a fej fel és lefelé is mozgott. Lerakta a harmadik szeletet. a sziszegő légzés. míg meg nem győződött róla.. A velociraptor tisztán láthatta őt.. ami mind csak fokozta az állat madárszerűségét. s nézőjén át látta. egy nagy hulladéktartály mögé. s a generátor zaja valahogy zavarta a tájékozódásban. és egyenesen Lex felé vette az irányt. Látta a világító. az ereje hihetetlen. hogy a dinoszauruszok szaglóérzéke gyenge volt. Visszaugrott a konyhába.. A velociraptor megállt a konyha ajtajában. és keményen. közben egyre beljebb hátrált a konyhába. Innen. A szeme sarkából lesett. Tim csak a felső törzsét látta. feltűnően gyors és intelligens. A két mellső végtag szorosan a test mellé szorult.

– Itt van! – Nem látom! – sikította a kislány. csapdát sejt. Csend. hogy a hús nem él. – Van egy pöcök. A raptor be volt zárva! Óriásit sóhajtott. Tudta. úgy hallgatta a rágcsáló-ropogtató hangot. aztán a merev farok is. Látta a lábszár izmainak apró rándulásait. miközben a csapszeget keresi a kezével. hogy az állat képes legyen kinyitni az ajtót. átlendítette a fogón. nem megy be. s a bőrredőket a nyakon. . Gyorsan előrement. mint egy rudacska add ide! A velociraptor bömbölt. Nem ízlik neki a marhahús. nem megy be.. de nem mert. Felfedezte a harmadik hússzeletet. A dinoszaurusz alig egy-két méterre volt tőle. hogy előrenézzen. kérlek. – Gyerünk! – mondta. feszült volt az egész teste. A dinoszaurusz habozott. és a lyukba nyomta. Az kicsúszott. lekapta a fejét. könyörgöm.. A száradt vért a „kéz” karmain. veri az acélt. nem megy be. Tim szagát. gondolta Tim. – Nem látok semmit! – kiáltotta Lex. Ott állt. amint felemelkedik. Tim alig tudta megállni. egy csapszeg. ahogy apránként kapkod a levegő után.. mindenestül! A raptor felemelte keskeny fejét....” A velociraptor megszagolta a húst. Tim lába már fájt a guggolástól. – Felülről dugd be! Felülről! A kislány újra feltartotta. az asztal alá nézni. Egész testével az ajtónak rontott.. de nem mozdult. hogy levegő után ne kapjon ijedtében. Nézte. Nem fog bemenni. csak most ne. Lehajolt. Hallotta. Tim egyetlen dologra összpontosított. majd le. Hangját tompította a vastag acél. Az rácsapódott a farok végére! Nem akart csukódni! A velociraptor felüvöltött. A súlyos fémsarkak minden rohamnál nagyot nyikordultak. Meglelte a második szeletet. s Tim csak ekkor fogta fel. – Megvan! – sikította.Tim szeretett volna lebukni. – Úristen. egy kis fémláncon. – Tapogasd ki! Látta a húga kis kezét. s ekkor a velociraptor az ajtónak vágódott. Becsukódott! – Lex. Rá kell zárni valahogy! – Lex! A kislány ott volt mellette. túl hideg van. szinte szuggerálni próbálta húgát: „Lex. s az állat folytatta útját az ötödik hússzelet felé. hogy zárva tartsa. s ha a raptor eltalálja. az állkapocs alatt. Az egyik óriáskarmú láb felemelkedett. újra felnézett. kinyílt! – de az állat nem számított erre. és az kinyílt. Merev. és hallotta a zár kattanását. Bezárta! A velociraptor ordított. csak most ne mozdulj. hogy a raptor az ajtón dörömböl. guggolásba merevedve. Nem szereti hidegen. Bele a lyukba. Lex visszatámolygott. érzi Lex szagát. Tim látta a kitóduló füstöt. A velociraptor szippantott. Látta az árkok finom mintázatát a foltos mintán belül. megérinti az övét. Miért nem ette meg az állat a második hússzeletet? Tucatnyi indok suhant át a fiú agyán. A fej felemelkedett. még kinyitja az ajtót. s így. Tim felpattant. teljes súlyával a mélyhűtő ajtajának vetette magát és rácsukta az állatra. Eltűnt a fej. Tim a lélegzetét is visszafojtotta. Újabb szippantás. Már a fagyasztószekrény nyitott ajtajánál volt. – Mit akarsz? Tim a vízszintes fogantyúnak feszült. Tim és Lex hátrált az ajtótól. Kézen fogta a húgát. Nem tetszik neki. pásztáz a teremben. majd a test. A raptor nem ette meg. hogy csak rajta van néző. Tim akaratlanul is hátrább lépett ijedtében – és a farok eltűnt! Tim bevágta az ajtót. és futásnak eredtek. és továbbhaladt. – A csapszeg az ajtó fogantyúja mögött lóg. és már visszafordult az újabb rohamhoz. Túl nagy a hideg. A dinoszaurusz eszi a húst! Csontostul. majd némán visszaereszkedett. ahogy a hüllőszem forog. közvetlen közelből. Tim most már nem tartotta valószínűnek. amely az állat lába felé kúszott a padlón. felnyúlt a sötétben. amint az állat újra meg újra nekirontott belülről. Lex! – kiabálta. – Végem!” Aztán a fej hátrarándult. de ellenálltak. A dinoszaurusz bement. olyan. mint egy oroszlán. A velociraptor most már igen gyorsan haladt.. és ment is tovább. Szaglászott. Megmarkolta a csapszeget. s így Tim újra becsapta. és körülnézett. pontosan érezte a kislány rettenetes félelmét. hogy van egy lapos acélgomb odabenn. meglátta Timet.. és egyenesen Timre nézett. Felkapta a fejét. szörnyű vérfagyasztóan erős volt a hangja. „Megtalált! – gondolta Tim. felemelte láncán..

Wut valami egyszerűen kirántotta az ajtón. valahogyan mégis nyugtalanságot ébresztett benne az állatok viselkedésének makacs változatlansága. hogy Wu a hátán . hogy egy enzim visszatartásával függővé tesszük az állatot valamilyen étkezési elemtől. Szinte már úgy látszott. – De hisz nincs semmi baj. A raptorok intelligensek voltak. egyenesen következett belőle. hogy túlságosan is rég. Nem is lehet igazán megjósolni. Vajon tényleg úgy viselkednek-e.– Ezt látnia kellett volna! – mondta Gennaro. – Mi történt azzal a raptorral. Csak annak mennek neki. voltaképpen igazolta a munkáját. Nem láttam.. például úgy. vagy majdnem halott. csak igen durva módon. hogy az még önmaga reprodukálására is képes! Most azonban. kilesett. s látta.. mert sérült volt. sem befolyásolni. aki igazit egyet az órán. Senki sem tudhatta. Muldoon a lábába lőtt. – Elment? – Én nem láttam. – Dögevők – mondta Grant. Olyan precizitással alkotott újjá egy több millió éves élőlényt. s az intelligens állatok hamar beleunnak az ismétlődésbe. Nincs olyan. hogy él. és odabenn van – mondta Grant. egy antik faliórát próbál javítgatni hozzáértés nélkül. a maguk korában? Nyitott kérdés volt ez. Elmentek. vagy sem. miért éppen úgy működik. az ajtó meg nyitva.. és abból megjósolja a viselkedést. és. mondjuk. Így aztán Wu munkája teljes egészében empirikus jellegű lett. Felfelé mentek a létrán. – Igen? Mikor? – kérdezte Wu az ajtó felé indulva. És csak a durva viselkedési hibákat próbálta korrigálni: ha az állat képtelen volt távol tartani magát az elektromos kerítésektől. hogy megdöglött. vagy sebesre dörzsölte bőrét a fatörzseken. mintha most ők próbálnák Ellie figyelmét lekötni. hogy az állatok viselkedése történetileg pontosan megfelel-e a valóságnak. Általában azonban a viselkedési hatások ma még egyszerűen kívül esnek a megértés határain. Kompik. az a felfedezés. Egy szaporodó állat azt jelentette. mint a keselyűk. mintha fordult volna a kocka. kint pedig Ellie sikolya hallatszott. Ott ültek. – Nem tudom – felelte Gennaro. hiszen a DNS-nek a viselkedés a másodrendű hatásai közé tartozik. Ezenkívül pedig az intelligens állatok terveket alakítanak ki. hogy az ember ránéz a DNS-szekvenciára. vissza a bejárati ajtóhoz. elszaladtak. hogy a dinoszauruszok szaporodnak. ami nem él. és ősi szabályok szerint működött.. Régóta folyt ez már így. Harding jött ki a folyosóra Malcolm szobájából. – Jó lesz behívni! A raptorok már nincsenek a tetőablakon. folytatták áltámadásaikat Ellie ellen. – Hol van Ellie? – Még mindig odakinn. amely ősi anyagokból állt. s végső soron megválaszolhatatlan. Be kellett másznom a teherautóba előlük. aztán megfigyeli. jöjjön! Muldoonnak sehogy sem tetszett. Wu a kastély folyosói ablakán át nézte a kerítésen kívül futkározó raptorokat. Gondolom. ami mozog vagy erősnek látszik. hogy a raptorokat figyelte odakinn. – Ellie! Befelé! Jöjjön azonnal! Az értetlenül nézett rá. Sohasem volt biztos benne – a legkevésbé sem lehetett biztos –. Teli volt velük a szélvédő. megfelelően alakul-e az állatok viselkedése. hogy ezután jobban jár-e. Wu is különféle kiigazításokat hajtott végre. Múltbeli dologgal kellett foglalkozni. ahogy az ember. ugyanúgy ahogy először Ellie az övéket. míg idebenn volt. Lehetetlen. Egyfajta barkácsolás volt az egész. A dinoszauruszok viselkedése Wu számára mindig is másodlagos kérdés volt. Azt hiszem. hasonló ahhoz. – De az is lehet. Muldoon az ajtóhoz rohant. hogy egy árnyék ereszkedik le a magasból. De. Lehet. És ez így is volt rendjén. amelyik megtámadta? – kérdezte Grant. ráadásul pedig már korábban is időtlen idők óta javítgatták. a hétszentségit. mi történt. igazítgatták az evolúció erői. – Semmit sem támadnak meg. Minden rendben. – Csak egy perce – mondta Harding. utána pedig figyelte. Mint a szerelő. Vérzett is. – Legalább kéttucatnyian voltak. legalábbis mozdulatlan. méghozzá nem is akármilyen erővel. Még mindig játékosnak tűntek. ahogyan. s éppen szóvá akarta ezt tenni. De amikor maga idejött. és csak vártak. mint annak idején. – Azonnal! Ellie megrázta a fejét. hogy Wu ott áll. – Tudom. én azért tudtam meglógni előle. A tudománynak e korlátai azonban valamiféle misztikus hiányérzetet hagytak benne a park dinoszauruszaival kapcsolatban. Csak az efféle viselkedési zavarok hatására tért vissza a tervezőasztalhoz. és azonnal megértette. és Wunak kezdett olyan érzése támadnia. mit teszek! – Ellie. miközben Grant kifelé vezette a gépház épületéből. S bár ezt Wu sosem ismerte volna el. amikor látta. hogy Wu helyesen rakta össze a mozaikdarabkákat. hogy bizonyítottan életképes. Wu kitárta a bejárati ajtót.

hátha onnan le lehet jutni valahogy. elkapott egy ágat. és azonnal ugrott. Rohant. Megkerülte az épületet. Túl messze. Sehol egy tűzlétra. és távolabb. Fogás jött fogás után. a raptor pedig a fejét kapkodva rángatja Wu beleit. s nincs út lefelé. megfeszítette hasizmát. De nem Ellie-t követték. Összehorzsolta az arcát. kit érdekel?. kinézett. Alig másfél méterre magától látta a salakot. Kezdtek eltávolodni egymástól. és a ködbe meresztette a szemét. Az lehetetlen! Puha kabátként ölelte körül valami védelmező jókedv. Szóval még a fán vannak! Odaért az ajtóhoz. A két raptor felé mászott a nyomában a fán. Egyszerűen nem hitt abban. Véres volt a pofája. Semmiféle pánikot nem érzett. hogy. Közben hallotta a háta mögül. hogy így ér majd véget az élete. . megpillantott egy fát. Ellie hátrált. és a magasba lendült. hogy gondolkodjék. Ajtó volt a tetőn: bejuthat az épületbe! Egyetlen óriás lendülettel a levegőbe vetette magát. a látogatóépület felé. mintha csak valamiféle játékról volna szó. Fenn van a tetőn. ami következik. testét már feltépte a hatalmas karom. és az üregbe vetette magát. Négy méterre volt a talajtól. átugorja. és nekifutott. Ekkor megint lenézett. de csak az úszómedence zöld körvonalait látta fel-feltünedezni a gomolygó ködön át. Három vagy négy méterre volt tőle az úszómedence. Három-négy méternyi beton. hogy az állatok üldöznék. amint a raptorok a fa ágait rázzák. és látta. nyúlt és húzódzkodott. Annyira gyorsan történt minden! Harding szólalt meg mellette: – Leugrott a tetőről? Muldoon bólintott. a ködbe nyúlva. de valamiért még mindig a mámor volt az egyetlen érzés. Ellie rohant. egészen a tető hátsó végéig. aztán a tető másik széle felé futott. és a fülébe súgta: – Nincs más választásunk! Be kell kapcsolnunk a komputert! Grant eltűnt a ködben. Inkább egyfajta örömmámor töltötte el. Sehol semmi! Ellie visszafordult. A raptorok közelebb kerültek hozzá. hogy ezek az állatok végezni fognak vele. s a lépcsőházba nyíló ajtó felé rohant. Az ablakhoz ment. hogy ott is van egy ajtó. amint a raptorok könnyedén leugranak a tetőre. s már szinte látta az épület tetejét. Megpillantotta az úszómedencét. Grant elérte a gépház szélét. még mindig benne volt a mámor. Nem hallotta. Egy pillanat múlva követte Gennaro is. A raptorok felmordultak.fekszik. Ellie gyorsan folytatta az útját felfelé. Ellie-nek – teljesen logikátlanul – az járt az eszében: Hát nem mindig így van? Valami apróság mindig közbeszól! Még mindig szédült egy kicsit. Némán lopakodtak az üvegpiramisok közt. a tetőablakok piramisait. de az állat élve ette őt. amely betöltötte. Ellie meg sem állt. Zárva van az ajtó! Kétségbeesetten dörömbölt az ajtón. Az épület hátsó végéhez futott. nyúlt és húzódzkodott. de nem volt. amelyen lemászhatna. Látta. Visszafelé tartottak. nem hallott mást. ahogy csak bírt a kastély távolabbi vége felé. és futásnak eredt a kerítés mentén. és gyorsan felhúzódzkodott. aztán mély lélegzetet vett. mit is jelent ez. reménykedve. A látogatóközpont felé tartottak. amint elrohantak mellette. aztán elterült a salakon. amely a ház oldalánál nőtt. A medencét betonburkolatú sáv vette körül. tudta. elgyengült kezével még mindig a nagy fejet próbálja eltolni magától. hogy túl messze van. pedig az még él. Túl nagy ahhoz. Sehol egy másik fa. Úgy tűnt. amikor a fa tövénél feltűnt az első állat. Amikor a raptorok a kerítésen belül levetették magukat. mint a saját lihegését. inas húsdarabok lógtak az állkapcsáról. de a raptorok még mindig követték. Muldoon pedig a borzalomtól szédelegve becsapta az ajtót. Feltápászkodott. s csak a győzelem volna a tét. Megkezdődött a vadászat. közelednek. Hallotta a raptorok morgását. gondolta. vágtatott a tető pereme felé. ő azonnal sarkon fordult. Ellie lenézett. s valahogy elhinni sem tudta. Zárva volt! Eltartott egy pillanatig. Visszanézett Gennaróra. aztán Ellie abbahagyta a sikoltozást. Talán öt méter széles volt a sáv az épület és a kerítés között. és elforgatta a gombját. és Wura támadtak. és futott. s már kezdett megnyugodni. míg eufóriáján áthatolt. amint felrúgta két lábát. Egy pillanat múlva a testük is felvillant. hogy a kerítésen kívül három raptor futva távolodik. Az ajtó zárva. majd egy magasabban lévő ág köré kulcsolta. Az a fejét rázta: nem! Grant közel hajolt hozzá. A raptorok lassan közeledtek felé. Ellie most a háztető szintjére ért.

. ... MŰVELETIRÁNYÍTÁS. Irodák lehettek: FŐÁLLATŐR. Aztán hallatszott.. mikor beléptek. és fellesett a tetőre. Tágra nyílt szemmel. Üvegből készült válaszfalhoz értek. s közben ezen gondolkodott: Tudnak-e úszni a raptorok? Szinte biztos volt benne. és arrébb lépett. Biztosan úgy úsznak.. Sikerült! A felszínre emelkedett. – Ellie! Annyira lefoglalta a gondolatait Ellie Sattler. Ám a raptorok egyszer csak elfordultak a tető peremétől. Tim emlékezett erre a részre. – A vezérlőbe – mondta Tim. ütés. Lex igyekezett lépést tartani vele. a monitorokat kivéve. mekkora hibát követett el. – Ne törődj vele! – Tim visszafordult a monitorokhoz. és gondolkodás nélkül kitárta a tetőajtót. – Hát hol van itt rádió? – kérdezte Lex. és minden erejét össze kellett szednie. amelyeken mind egy-egy sor színes négyszög világított. négy székkel és négy számítógép-monitorral. A vezérlőterem ugyanolyan volt. Ezért fordultak meg a raptorok.. Tim nem látott emberi testet sehol. és rácsukja az ajtót a karomra. Látta már... Aztán csípős csattanás. Gyorsan úszott.. Aztán elhallgatott. és látta: csak egy fül hever ott magában. – Az hol van? – Itt valahol. A raptorok lenéztek rá. Harding pedig köhögve a padlóra omlott. IGAZGATÓ.. De Tim már rég megfeledkezett a rádióról. Harding hangja hallatszott – Ellie? – és Ellie azonnal megértette. Harding kettesével vette a lépcsőfokokat. Parázsló fájdalom hasított a testébe.. Vezérlőasztal a szoba közepén. Távolról felhangzott a raptorok morgása. hogy tudnak. Gyorsan kimászott az úszómedencéből. – Hova megyünk? – kérdezte Lex. Hátranézett. odakinn. – Ez az! – szólt Tim. Be vannak kapcsolva! Ez csak azt jelentheti. jutott eszébe. Az üvegajtón túl folytatódott a folyosó.. és most őt vették célba. Látnia kellene az állatokat!. – Ügy látszik van már áram. és jeges hideg ölelte körül. Teljes sötétség honolt a szobában. mint a krokodilok. FŐ VEZÉRLŐ.És zuhanni kezdett.. fröcskölte a vizet. Mintha közeledtek volna. Hardingnak pedig végre sikerült becsuknia. hogy az állatorvos most nyitotta ki a tetőajtót. mint akkor.. A következő pillanatban a karmos mellső végtag átcsapott az ajtó széle körül. és a kastély felé rohant. Lentről hallotta.. Harding még egyszer becsapta az ajtót. amikor utoljára látta. míg elhaladtak mellettük. – Minek megyünk a vezérlőbe? – kérdezte az. – Most azzal ne törődj! PARKFELÜGYELŐ. – Tim a kiragasztott feliratokat nézegette az ajtókon. de Tim egyszerűen benyomta az ajtót.. de borzasztó! – szólt Lex. A víz alatt volt. a raptorok könnyen utánacsinálhatják. A raptorokat nem lehetett látni. a megdöbbenéstől szótlanul ment egyenest előre. Köd gomolygott az üvegpiramisok körül. de későn. hogy hátra tudjon húzódni. és mellbe találta. amikor végigvezették őket az épületen.. Fémes kattanással csapódott le a zár.. hogy Muldoon kiabál: – Már bent van! Idebent van! A raptor dühödten morgott az ajtó túloldalán. – Mi van? – A fülén álltam valaminek – mondta a kislány. Belökte az ajtót. – Juj. – Ne izgulj! – Mit keresnek itt? – kérdezte Lex.. – Ott vannak. – Ellie! – kiáltotta. Nem lehetett kérdéses: ha neki sikerült. melyen ez állt: ZÁRT TERÜLET BELÉPÉS CSAK ENGEDÉLLYEL Ott volt a biztonsági kártyák számára készült nyílás. hogy kinyílt? – Nincs áram – emlékeztette húgát Tim. amint nekicsapódnak az üvegnek odalenn. – Hogy lehet az. Hívnunk kell valakit. hogy beletellett egy pillanatba. Üvegfalú folyosó futott végig az épületen. mire a karom visszahúzódott. – Rádiót keresni. REVÍZIÓ. A képernyőkre meredt.. míg felfogta. – Juj! – sikított fel Lex. VENDÉGSZOLGÁLAT. A látogatóközpont második emeletén jártak. – suttogta Lex.

hogyan verik bele minduntalan a fejüket. Grant visszahőkölt. hogy megbizonyosodjék róla. . – Mit csinálnak ezek? – kérdezte Gennaro. mígnem végül az emeleti balkonon landolt. és a gombokat nyomkodta. mi van ott? – Ott hagytam a gyerekeket.vagy az. Fő Javítás Raktározás Státus Fő Biztonság/ Egészség – Szerintem ne nyúlj hozzá. – Halló? Halló? – . Azért még egyszer megnézte. Légköri rádiósercegést hallott. Ott gépek vezéreltek mindent: a lifteket vagy a védelmet éppúgy. És szinte mindig volt egy „HELP”. Színes címkesorok álltak a képernyőn: ŐSLÉNYPARK – RENDSZER INDUL INDÍTÁS AB(0) Biztonság Fő SetGrids DNL Kritikus zárak Kontroll Áthaladás Monitor Fő View VBB TeleCom VBB TeleCom RSD Parancs Fő Belépés TNL Reset Revert Eloszt. – mondta egy kissé tétován Grant.. én vagyok. azaz segélykérő jelzés is arra az esetre. – Nyugi. aztán eltűnt az épületben. Lex ijedtében elejtette a rádiót. Most éppen 10:47:22 állt ott. – Mi az ördög folyik ott?! – szólalt meg Muldoon hangja. – Be tudnak törni az üvegen át? – Nem. s félrebillentették a fejüket. nem hiszem. Csavargatta a tárcsákat. De a morgások között azonban időről időre elnémultak. s a raptorok egyszerre izgatottabban kezdtek ugrálni. Már csak tizenhárom perc van hátra a hajó kikötéséig – de e pillanatban jobban izgatta a kastélyban lévők sorsa. – Add ide azonnal! – Ez az enyém! Én találtam! – Add ide. mint ez – egy csomó színes címke –. s látta. Tim rájött. amelyeken az apja dolgozott. Az emeleti vezérlőben Tim felkapta a rádiót. Benyomta a gombot. A gomolygó ködön át látta. Aztán halk.– De kié lehetett ez? Hol van belőle a többi? – kérdezte a kislány.. Lex! – Én akarom előbb kipróbálni! – Lex! A készülék váratlanul megreccsent. csak könnyebb volt megérteni őket. Timmy! – szólt rá Lex. ha az ember meg akart tudni valamit a rendszerről. Megfordult. most ne azzal törődj! Hunyorogva alaposabban szemügyre vette a monitort. be akarnak törni a büfébe. és lekuporodott a pálmafák közé. mintha valami távoli zaj után hallgatóznának.és hűtőrendszereket. – Nekem nem akar szólni. – Mondom. FNCC Params INDÍTÁS CN/D Hidraulika Fő Ajtók Interface GAS/VLD Fő II Robbanás Tűzveszély Mester Fő SAAG Rnd Közös Interface Séma Fő Zoolog. Látott viszont valami mást: az ernyő bal felső sarkában számok futottak... melyet Lex leejtett. Tim látott már bonyolult számítógépeket. Grant figyelt. Lényegében ugyanúgy néztek ki. hogy a húga rádiókészüléket tart a kezében. Itt azonban nem volt ilyen. – Hogy működik ez? – kérdezte. például azokban az épületekben. Távoli rádiórecsegést hallott. Fő Elektromos Fő Fűtés Hűtés Vész Világ. – Úgy tűnik. Egyik a másik után ugrott egyre magasabbra és magasabbra. nem fogok. nyöszörgő hangokat hallottak. hogyan ugranak a raptorok vicsorogva újra meg újra a látogatóépület üvegfalának. Tim? – Igen. – Miért. mint a fűtő. hogy ennyi az idő.

INDÍTÁS CN/D Hidraulika Fő Ajtók Interface GAS/VLD Fő II Mester Fő SAAG Rnd Közös Interface Séma Fő Zoolog. A képernyő maradt. Mi lehet ez? Ujját a képernyőhöz közelítette. – Nem is tudod. Nem kapott választ. FNCC Robbanás Fő Params Tűzveszély Az üzenetet közvetítő négyszög néhány pillanat múlva eltűnt. – Mondd.. a képernyő pedig nagy volt. valami főhálózatról van szó. – Valami nincs rendben – szólt Tim elgondolkodva... de már olvasott róla a képeslapokban. mire sípoló hang hallatszott. – Mit csináltál? Hozzányúltál valamihez! „Hát persze!” – jött rá Tim. – Tetszettek hallani? – Hát sajnos ezzel gondunk van – mondta Muldoon. Megérintette a visszaállítást. – Akkor akár meg is próbálkozhatsz vele – mondta Muldoon. Fő Javítás Raktározás Státus Fő Biztonság/ Egészség ÖN MÁR BELÉPETT válaszon a főábráról Eloszt. mit kell csinálni! – De tudom. De nem történt semmi. és a képernyőre meredt. amilyen volt. – Timmy! – szólt rá Lex. És Grant sem ért hozzá. – Oké – egyezett bele Tim. Timmy – mondta a húga.. Halvány visszfények jelentek meg rajta. – Fogalmad sincs az egészről. mindent alaposan megnézett. Vizsgálgatta. ŐSLÉNYPARK – RENDSZER INDUL INDÍTÁS AB(0) Biztonság Fő SetGrids DNL Kritikus zárak Kontroll Áthaladás Monitor Fő View VBB TeleCom VBB TeleCom RSD Parancs Fő Belépés TNL Reset Revert Elektromos Fő Fűtés Hűtés Vész Világ. Lex bökdöste. Újra vizsgálgatni kezdte a komputert. – Nem. Megérintette a képernyőt. Ezek mozgatják a kurzort ide-oda a képernyőn.– Hol vagy? – A vezérlőteremben. – Azt hiszem. mint bármely személyi számítógépen. szóval. én megcsinálom. – Na? – kérdezte Lex. Timmy! – mondta. Tim! – mondta Muldoon.. mi a tennivaló. – Szünet.. és sok halvány. Van áram! – Ez remek. Tim megnézte a képernyő széleit. – Halló! – mondta Tim.. – Akkor megpróbálom. Mármint bekapcsolni a gépet. hogy kell. aki itt van. és színes. Azonnal változott a kép. A monitor háza azonban szokatlan volt valahogy. – Úgysem tudja itt senki. Vörös pontocskák körös-körül. nem tudja. hogy nincs. újrakezdést jelző REST/REVERT feliratú négyzetecskét. hogyan kell bekapcsolni a komputert. A főhálózatot kell bekapcsolni. Új válaszüzenet érkezett: . – Ha valaki elmondja. Muldoon bácsi? Senki sem tudja? – Hihetetlennek hangzott. Aztán más billentyűket is leütött.. Neked van valami fogalmad számítógépekről.. akkor rajta! – Várj egy kicsit! – Kezdetnek odahúzta a széket a billentyűzethez. – Ha tudod. Ugyanott helyezkedtek el rajta a funkcióbillentyűk. Tim eddig még nem látott ilyen monitort. – Senki. Tim megdöbbent. Kikapcsolta a rádiót. – Viccelnek. Csend volt. Megérintette a képernyőt! Érintésre működik! Azok a vörös fények a képernyő peremén nyilván infravörös érzékelők. Tim. Tim? Tim a képernyőre bámult.. ööö. – Valami van. – Mi történt? – kérdezte Lex. és lenyomta a kurzorbillentyűket. s a képernyőn ismét teljes egészében ott volt az eddigi kép. tűhegynyi vörös fénypontot vett észre rajta. – Igen – felelte Tim.

. – Állítsd már meg! – kiáltott Lex. Megreccsent a rádió. és velük együtt ő is felfelé fordította a tekintetét. – A VIEW-t próbáld meg! Az azt jelenti. amelyekről választhat. és a hajó partot ér.. Egy másik meg: TÁV. jó? – mondta a bátyja. szürke ködben. aztán az ágyban fekvő Malcolmot. – Nem. egy raptorral a tetőn.. Aztán egy harmadik képernyőn egy szoba belsejébe látott. A legtöbb kép homályos vagy tejfehér volt az odakinn gomolygó ködtől. helységről helységre. – Hagyd. – Látom őket! Tim hol itt. – Várjál! – szólt rá Lex. Tim többször egymás után megérintette a képernyőt. hiszen csak az előző nap repült el felette a helikopteren. – Nem próbálom. s már a kastély belsejét látták. – Látni szeretnék valamit – jelentette ki Lex. abba. A raptorokat nagyrészt eltakarták a piramisok. – De sikerült! – vitatkozott az. Az egyik így szólt: SZAFARIKASTÉLY LV2-4. – Micsoda? – Hát az a kép az előbb! De addigra a hajó már eltűnt. és mielőtt még Tim elkaphatta volna a kezét. listákat. aztán egy másikon hirtelen egy hajó orra látszott vakító napfényben. Napfény és. Az egyikben a szállítóhajó orr-része látszott. amely a szafarikastély külső képet mutatta. Aggodalom ült mindhármuk arcán. Televíziós képek jelentek meg körös-körül a monitorokon. – Nézd meg! Tessék! Körös-körül a teremben a monitorok sebesen változó képeket mutattak a park legkülönbözőbb részeiről. – Hát ez meg mi volt?! – kiáltott fel Tim előredőlve. mellette Ellie állt.. Az utóbbit felismerte. előtte az óceán.H Monitor Interval Monitor Control Optimize Sequence Rotation Specify Remote Camera Set Auto AO(19) Hold Man DD(33) REMOTE CLC VIDEO . A képernyőn Malcolm a szájához emelte a rádiót. HAJÓFEDÉLZET (VND). Puntarenas! Úgy tűnt. Tim! – Itt vagyok – felelte Tim. hol ott érintette meg a képernyőt. Tim a távolban a szárazföldet látta: part menti épületeket és egy kikötőt. A figyelmét azonban most a másik képernyő ragadta meg. – Összezavarod az egészet! – Hallgass már! Mit tudsz te a számítógépekről! Most tűnt fel a megfigyelőkamerák listája a képernyőn. már csak percek vannak hátra. és belebeszélt: – Halló. egy beállítás azonban egy rövid ideig a kastélyt mutatta kívülről. A képernyő váltott. és újra meg újra feltűnt. azt nem hiszem. már meg is érintette a VIEW – betekintés – feliratú négyzetet. de a fejük fel-le mozgott. Lex! – De én akkor is a VIEW-t akarom! – követelte a kislány. . SUBROUTINES – VIEW VIDEO INTERFACE ENVIRONMENTAL VATCH REMOTE CLC VIDEO . de csak további „almenüket” kapott. Mind a ketten felfelé néztek.A GÉP VISSZAÁLLT VÁLASSZON A FŐÁBRÁRÓL A rádió sercegését kezdte túlharsogni a raptorok acsargása odakint. Majd még továbbiakat. Malcolm feküdt ott az ágyon.P Monitor Interval Monitor Control Optimize Sequence Rotation RGB Image Parameters Command Sequence – Nini! – szólt Lex. Közben Muldoon lépett be a szobába. – Minket látnak – mondta Lex.

hogy az egyik hosszúkás fej benyúlik a képbe felülről. Timmy! – szólt Lex. hogy nagyon fogy már az időnk. s látta. Áthatolt az üvegen. – Siess. – Kapcsold már be az áramot! . Jó lenne. lenézett. és a fogait csattogtatta.– Hát az a helyzet – mondta fojtottan Malcolm –. – Aztán Tim meghallotta a raptorok morgását. ha mihamarább sikerülne bekapcsolnod az elektromos hálózatot valahogy.

Abban is biztos volt. FIND. Nem jó! Nem jó! Megpróbálta a „KÖZÖS INTERFACE”-et. de azokat sem lelte. a FIND-ot is benyomta. egymásból kiinduló monitorvezérlő-képek sorába bonyolódott. Bonyolult diagram jelent meg a képernyőn. Timmy! – Fogd már be a szád! Nem látod. hogy valahol kell segítségkérő parancsoknak is lenniük. Erre a GO BACK – menj vissza! – paranccsal próbálkozott. és elgondolkodott. REVIEW TRIAL . hogy segíteni próbálok? Megnyomta az „ELOSZT. Inc. Cambridge Mass Project Supervisor: Dennis Nedry FIND PRMTRS Programmer: Mike Backes SEARCH MONITOR TEST DELAY Chief © Jurassic Park. – Miért nem az áramot kapcsolod vissza. teli mindenféle egymáshoz kapcsolódó négyszögekkel meg nyilakkal. Megnyomta: INFO. miközben az eredeti ábrához szeretett volna visszajutni. A kép változott: Közös interface ADVISE ESTIMTE ORDER REVIVE INFO SYSTEMS CONNOTE FIND PRMTRS SEARCH MONITOR TEST DELAY GO AHEAD REPEAT REPORT OPTIONS TRACK DELETE COLLATE GO BACK TRIAL – Ez meg mi? – kérdezte Lex. Itt azonban nem volt ilyen – vagy ha mégis. All Rights Reserved GO AHEAD REPEAT REPORT OPTIONS TRACK DELETE COLLATE GO BACK TRIAL – Timmííííí – nyúzta Lex. milyen parancsot adjon. Cambridge Mass Jurassic Park Common User Interface ESTIMTE Project Supervisor: Dennis Nedru Command:FIND FIND PRMTRS Programmer: Mike Backes SEARCH MONITOR TEST Chief FIND is a context-sensitive command. Nem tudta maga sem. A legtöbb rendszerben van egy billentyű vagy egy bizonyos parancs. amellyel vissza lehet hozni az előző képet vagy a „főmenüt”.1 b24 REVIVE INFO SYSTEMS CONNOTE Developed by Integrated Computer Systems. hogyan. de sikerült. de Tim addigra már a kereső parancsot. GO BACK GO AHEAD REPEAT REPORT Jurassic Park Common User Interface OPTIONS DELAY TRACK DELETE Command: GO BACK Cannot GO BACK without a specific search option. CHANGE. Közös interface ADVISE Jurassic Park Common User Interface ORDER Version 1. FŐ”-t. Inc. Timmy? Timmy válaszra sem méltatta. Hátha ebben a rendszerben a „segítség” neve „info”. és mindennek a tetejébe Lex összevissza ugrált. Initiate FIND © Jurassic Park. COLLATE GO BACK See also: SEARCH. és kiabált. Go AHEAD. CHANGE. – Csinálj már valamit. Megállt. See also: SEARCH. Közös interface ADVISE ESTIMTE Jurassic Park Common User Interface ORDER Version 1. Végre nagy nehezen visszajutott a legelső képhez. Inc. amitől ideges lett. Ezúttal megint egy hasznavehetetlen „ablakot” kapott. Inc.A HÁLÓZAT Tim váratlanul különböző. hát nem találta.1 b24 REVIVE INFO SYSTEMS CONNOTE Developed by Integrated Computer Systems. OPTIONS. All Rights Reserved at any point.

Lázasan nyomkodta a jelzéseket a képernyőn. és kétségbeesetten felnyögött az eredmény láttán: SET GRIDS DNL CUSTOM PARAMETERS ELECTRICAL SECONDARY (H) MAIN GRID LEVEL MAIN GRID LEVEL A4 C9 B4 R5 C7 D5 D4 E3 E9 G4 STANDARD PARAMETERS ELECTRICAL SECONDARY (P) MAIN GRID LEVEL MAIN GRID LEVEL MAIN GRID LEVEL MAIN GRID LEVEL A2 C9 A8 P4 B3 R5 B1 R8 C6 D5 C8 P4 D11 E3 D8 E5 E2 G4 E8 L6 ELECTRICAL SECONDARY (M) MAIN GRID LEVEL MAIN GRID LEVEL A1 C4 B1 R4 C1 D4 D2 E5 E2 G6 Ezzel nem tudott mit kezdeni. rácsok Főhálózati rácsok C4-G7 Szenzor hálózati rácsok Kieg. visszajött a kiinduló főábra. mintha köze volna a rácsokhoz. Azért megnyomta a STANDARD PARAMETERS-t. hogy a „KRITIKUS ZÁRAK” és a „BIZTONSÁG/EGÉSZSÉG” is fontos lehet. SZ: ELEKTROMOS HÁLÓZATI RÁCS (SZAFARIKASTÉLY) . mert ehhez a parancshoz konkrét keresőutasításnak kellett volna társulnia. hálózati rácsok A4-B5 Gyökér hálózati rácsok Áramkörök épsége bevizsgálatlan Biztonsági hálózati rácsok automatikusak C2-D2 R1-R4 E5-L6 D5-G4 A1-C1 Tim tehetetlenül. Mind az „ELEKTROMOS/FŐ”. Kellett egy-két pillanat. Fő Javítás Raktározás Státus Fő Biztonság/ Egészség Elmélyülten nézte a képernyőt. ŐSLÉNYPARK – RENDSZER INDUL INDÍTÁS AB(0) Biztonság Fő SetGrids DNL Kritikus zárak Kontroll Áthaladás Monitor Fő View VBB TeleCom VBB TeleCom RSD Parancs Fő Belépés TNL Reset Revert Eloszt. Döntenie kellett. hálóz. Megtudta a kastély hálózatának koordinátáit! Megnyomta az F4-es számú hálózati rácsot. Megérintette a SETGRIDS DNL-t. F4. a hálózatokhoz. Fő Elektromos Fő Fűtés Hűtés Vész Világ. Timmy? – Nem volt ideje válaszolni. Az is átfutott az agyán. míg rájött: ezúttal nagyon is fontos információ birtokába jutott. FNCC Params INDÍTÁS CN/D Hidraulika Fő Ajtók Interface GAS/VLD Fő II Robbanás Tűzveszély Mester Fő SAAG Rnd Közös Interface Séma Fő Zoolog. Muldoon hangja szólt a rádióból: – Hogy haladsz. Hirtelen. Hallotta a raptorok acsargását. STANDARD PARAMETERS Parkhálózati rácsok B6-C6 Külső hálózati rácsok Zoológiái hálózati rácsok B8-D7 Karám hálózati rácsok Kastélyhálózati rácsok F4-D4 Karbant. minden előzetes figyelmeztetés nélkül.Megint nem jutott előre. kétségbeesetten rázta a fejét. mind a SETGRIDS/DNL olybá tűnt.

09-4. – Az Isten szerelmére. hogy zajt ne csapjon. amint szinte berepül egy harmadik raptor is.) – Nem jó – mondta Lex.09-4.11. Hogyan juthatott ki a mélyhűtőből? Aztán hirtelen a szeme láttára feltűnt egy második raptor is az erkélyen. – Legfeljebb három-négy percünk van. ott vagy? Nem kapott választ. de azok mellett is mind ott égett a vörös fény. Úgy hevert ott. ahányszor csak be akarja kapcsolni valamelyik hálózatot. Tim. . csak ne most. Vagy még annál is többet. – Tim. Egy őr holtteste volt. 4. Már kezdtek is különválni. és visszahúzódhassanak a vezérlőbe. – Sssss! – hallgattatta el a húgát Tim. Befért a fejük a törött üvegen át. ide nem. Valamilyen okból ugyanazt a hibaüzenetet kapja. Tim elvette a kártyáját. ügyelve. Miközben lassan bezárult mögöttük az ajtó. hogy nem összeegyeztethető az elektromosság? – Timmy.. majd libasorban megindultak előre. Kívülről jött. Egyszerűen felugrott odalentről! A második raptor némán landolt. kézikönyv. hogy bekeríthessék Timet és Lexet. Az állatok egy kis ideig céltalanul forgolódtak a folyosón. – Azt én is tudom! Újabb gombot nyomott le. Azonnal támadnak! Tim számára egyetlen megoldás maradt. belökte a húgát. Ám az meg sem mozdult. Tim óvatosan kicsusszant az ajtón. teste tökéletes egyensúllyal fogta a korlátot. távolodni egymástól a folyosón. A folyosó felől jöttek. A kártya segítségével kinyitotta a legközelebbi ajtót a folyosón. lassan nekivetette a hátát az ajtónak. amelyet kiadott. – Nézd! – A biztonsági kártya nyílására mutatott az ajtó mellett.. és visszafordult. és egyfajta ámult rémülettel nézte. Aztán ő is meghallotta a raptorok morgását.11 o. kizártál minket! Tim végignézett a folyosón. Tim nem hitt a szemének. Tim döbbenten nézte. hogy ki tudja gondolni. Ott állt az erkélynél. de nem tudta levenni tekintetét az erkélyről.. Meg sem rezzent. Ez azt jelenti. és már rohamoztak is.PARANCS VÉGREHAJTHATATLAN. A Malcolm ágya fölötti tetőablakon a raptorok már kishíján átrágták a második acélrácsot is. Fejüket ütemesen mozgatták fel-le. Futva indultak az őr felé. o. majd visszahúzták. Fehér biztonsági kártya volt a derekára csatolva. Vicsorogtak. A raptorok persze közben észrevették őket. és utánaugrott. ELEKTROMOS HÁLÓZATI RÁCS (SZAFARIKASTÉLY) PARANCS VÉGREHAJTHATATLAN. most! – mondta a kislány. mi lehet a baj. a raptorok sziszegtek. és a folyosó túlvégén azonnal meglátta a velociraptort.) Tim minden erejét összeszedte. A hatalmas állat három métert ugrott felfelé. és elálltak a vezérlőbe visszavezető utat. HIBA-505 (ELEKTROMOS ELLÁTÁS ÉS A HIBÁS PARANCS NEM ÖSSZEEGYEZTETHETŐ L.. hogy megőrizze nyugalmát. Valamitől újra aktiválódtak a biztonsági zárak. hogy egyáltalán nem a mélyhűtőből került elő az előző sem. hogy benyomja. Tim és Lex felé. és folytatták a fémrudak rágcsálását. – Lex a karját ráncigálta. Be-bedugták. s a karjánál fogva elhúzta a képernyőtől meg a billentyűktől. – Ki vagyunk zárva! – súgta Lex. kézikönyv 4. SZ. mint valami rongycsomó. Lex! – szólt rá. HIBA-505 (ELEKTROMOS ELLÁTÁS ÉS A HIBÁS PARANCS NEM ÖSSZEEGYEZTETHETŐ L. – Te hülye. – Nem tarthat már soká – szólt Muldoon. – Gyerünk! – súgta. Micsoda erő lehet azokban a lábakban! Lex ezt suttogta mellette: – Pedig azt mondtad. – Megnyomta a gombot a rádión. Eszerint az elektromos ellátás nem összeegyeztethető azzal a paranccsal. és Tim ekkor értette meg. Fényes vörös pont égett fölötte. A képernyőn újra ugyanaz villant fel: F4. Egy sor további ajtót látott. Erősebben nyomta. Gondolkodni próbált. De mit jelenthet ez? Mi az. és rávicsorogtak az emberekre odalent. – De igenis. hogy minden ajtó zárva! Nincs hová menniük! Ekkor azonban összecsuklott alakot pillantott meg a folyosó túlvégén.

Én kiszámítottam! Hammond felsóhajtott. amelyek egyenesen megkövetelik. Imádkozik. – Hiszen ez a raptorbébi! – szólt Lex. Mégis. Órák óta csak ezt hallom: „én megmondtam előre”. amely gondoskodik róla. hogy megkeresse a gyerekeket. a gyerekek pedig sehol. Ment tovább a konyhába. baba. amely megint csak zárva volt. mit tud megvalósítani valaki. Esetleg imádkozik a természethez. de csak a ZÁRT TERÜLET feliratú üvegajtóig jutott. A nyakához dörgölődzött. amelyen át húsz perccel ezelőtt távozott. ugyanazt a bejáratot. – Hagyják ezt. Játékok hevertek szanaszét: egy sárga labda. – Én nem gondoltam. – Tán fél? – Nem tudom – felelte Tim. Elhatározták. Ő van kiszolgáltatva a természetnek. Lex közelebb jött. – A kérdés mindig az. plasztikcsörgő. felhangzott a raptorok morgása. Velociraptorbébi ült a vállán. . Pergamenszerű hüllőbőr érintette Tim arcát. mi? Piszkosul rondák! Hammond a fejét ingatta. elkomorult. hogy megkíséreljék. Hallotta rádiójának egyenletes sistergését. Muldoon a falnak dőlve ült a sarokban. a bátyja vállába kapaszkodó állatkára mutatva. a folyosóról. és visítozott. hatalmába keríti majd a természetet? Dehogy hiszi. gondolta a fiú. Soha sem voltak. Megrántotta a kilincset. hogy így történjék. – Még mindig semmi hír? – Nem tudom. Nincs hatalma fölötte. s a bébi átugrott az ő vállára. – Mint mindenki más. Meghaladja az értelmét. – Nem is akarat kérdése – mondta erre hunyt szemmel Malcolm. ahol korábban is. a lelkét leheli ki vele. Hammond szótlanul bámult felfelé. de levegőt soha. Felment a lépcsőn. Malcolm szólalt meg: – Rondák. amikor elindul az őserdőbe. Építhetnek repülőgépet. ami messze túl van rajta. Grant nem tudott bejutni. már olyan rendszereket hoztak létre. Mind a rádió szavát lesték. – Mi lehet Timmel? – törte meg a csendet Hammond. az erdő termékenységéhez. aztán még egyszer megmérte. Az ajtó nem nyílt. Aztán észrevette a kis piros jelzőfényt. hogy igyekszik úrrá lenni a helyzeten – mondta Malcolm. Újra bekapcsolódtak a biztonsági zárak! A szentségit! Futva megkerülte az épületet. és nem is lesznek. Szegényke biztosan majd’ éhen hal. s a betört üvegajtón át belépett a főelőcsarnokba. mintsem azt a ráció erejéről szőtt álmaik elhitetik magukkal. mit gondol. Tim felkászálódott. Csakhogy nem képesek rá. hogy ez lesz belőle! – A jelek szerint például Malcolm – felelte a szónoki kérdésre Ellie. Senki sem akarta. Úgy gondolja. nagyon kérem. Valahonnan bentről. Ne keverjük össze a dolgokat! Készíthetnek hajót. a természet olyasvalami. hogy hatalmukba hajtják a természetet. és rémületében felordított. – Téved – mondta Malcolm. mit beszélt – szólt mély sóhajjal Hammond. hogy élelmet szerezzen a családjának. Sokkal kisebb a hatalmuk. Közben egy pillanatra megállt annál az őrpultnál. – Miért csinálja ezt? – kérdezte a kislány. hogy többé nem lesznek kiszolgáltatva a természetnek. a kisfiú a hátára esett. mert tudja. – És Grant is! Mi lehet Granttal? Grant elérte a látogatóközpont hátsó ajtaját. rázta a hideg. – Timmy! – kiáltott rá Lex. Harding megmérte a vérnyomását. Ködös tekintettel nézte a raptorokat. a fájdalomcsillapítók ködén át. de óceánt nem tudnak készíteni. a főbejárathoz ment. de a konyhaajtó nyitva állt. Talán a vadász. – Hová ment Tim? Olyan érett kisfiúnak tűnt! – Biztos. és máris nyakig ülnek a bajban. Ellie Sattler egy takaróba burkolózott. – Ki gondolta volna. Lassan beszélt. nem lehet az ura. Kétségbeesetten csiripelt.A KASTÉLY Ian Malcolm már olyan nehezen lélegzett. Maguk viszont egyszerűen elhatározták. ingét karmok szaggatták. A kis raptor fejével Tim nyakába bújt. hogy minden szusszanásánál attól kellett tartani. ugyanis nem képesek rá. Tim és Lex a fehér „óvodában” voltak. Kártya nélkül nem boldogult vele. azt hiszi. – Már megint nem értem.

melyen át elmenekülhetnek. Letépte a válláról a belekapaszkodó állatkát. s ekkor váratlanul valami nagy testbe ütközött. és rájuk is talált: éppen harcukat vívták az óvodában.. Közben Tim hallotta a nyomukba szegődött raptorok egyre közelebbi horkantásait és acsargását. hogy bevárják egymást. A folyosóajtó nem záródott be mögöttük. ha lehet.. Tim végre talált egy ajtót – nyitva volt –. amely alighanem riasztóval volt ellátva. Megint újabb helyiségben voltak. Talán a bébi elvonja a figyelmüket. és maga is azonnal a DNS-extrakciós laboratóriumba futott. Grant tudta. Megborzongott. – De maga mit akar csinálni? – kérdezte Gennaro. hogy ez mit jelent. és a vállán át a túloldali ajtó felé mutatott. A többiek mind ott álltak az üvegajtó túloldalán. Végül is az is csak raptor. úgy figyelt mindenfelé. Lex nyögdécselt és nyöszörgött félelmében. s az azt betöltő mélyzöld ragyogásból Tim azonnal rájött. Mellette pedig ott állt Gennaro bácsi. A bébi a nagyok lába között futkározott. Semmi kétség.. Elhaladtak a szuperkomputerek mellett. Grant professzor alakja tornyosult fölé. és Lex kétségbeesetten felsikított. Onnan nem vezet ajtó a vezérlőbe! Gennaro és a gyerekek csapdában vannak! Minden rajta múlik! . Először egy. és izgatottan ugrált fel-le a vállán. közben fejüket időről időre lekapva meg-megszaglászták a padlót. – Arra! – mondta Grant.. hol minden kivilágosodott körülötte – aztán megint jött a sötétség. mert amint átléptek rajta. és sietve elindult előre. úgy igyekezett kiszakítani az első raptor szájából. amelyeken még mindig a számítógép által megfejtett DNSkódok végtelen sorai villogtak szüntelen. De már közeledtek is a raptorok. És ott találkozott a gyerekekkel. Ám mintha egy pillanatra megzavarta volna őket. Gennaro megrázta a fejét. Tim csak értetlenül pislogott. gyerekek! – szólalt meg egy hang. – Van egy tervem – mondta. s ott egy ajtót. A raptorok az ajtónál álltak. Odakünn a folyosón Grantnak közel két percébe tellett. Falkában vadásznak. A sztereómikroszkópok elhagyottan sorakoztak a munkaasztalokon. hogy a bébi a felnőtt állat állkapcsai közt van. – Vigye őket a vezérlőbe. A hatalmas nagyító erejű képernyőkön fagyott rovarok óriás. A fiú tudta. A raptorok lassan egyre közelebb kerültek Granthoz. Aztán elérték a laboratórium hátsó végét. hogy a halott őrnek az előcsarnokban bizonyára van biztonsági kártyája. A kettő egymásnak esett. amelyek évmilliókkal ezelőtt a dinoszauruszok vérét szívták. valami utat.. velőt rázó visítás hasított a levegőbe. – De tűnjenek már el! Gennaro magával vitte a gyerekeket. aztán együtt. és válla fölött hátranézett.. kié legyen a még nyüszítő bébi. Grant Gennaro karjába lökte a gyerekeket. hol kigyulladtak. – Tim! – súgta Lex. s éppen most jelentek meg a nagy velociraptorok. és beljebb vonta az óvodába. Vér hullott nagy cseppekben a padlóra. nyüszített. amikor az „óvodába” léptek. fejük összecsapódott. A bébi csiripelt. Szaggatott. Habozás nélkül nyomultak előre. s amelyek segítségével újjáalakították a parkban lévő ősállatokat. Kell találnia egy ajtót valahol. hogy egyszerre csak újabb emberek tűntek fel. A raptorok hangját követte. éles hangja betöltötte a keskeny folyosót.. Azoké a legyeké és szúnyogoké. hogy el kell menekülniük valahogy. Az első raptor leengedte a pofáját. és rákiáltott: – Vigye őket valami biztos helyre! – De. Tim kézen fogta Lexet. és gondosan megszagolta a bébit. és Lexet maga után húzva átlépett rajta. ezek megették! – szólt Lex. Biztosra vette. el a képernyők mellett. elvette. Nem hitt a szemének. Grant hallotta az ajtó kattanását maga mögött. Tim újabb ajtót pillantott meg maga előtt. hogy a DNSkivonással foglalkozó laboratóriumba jutottak. A raptorok tovább küzdöttek egymással a bébi maradványaiért. Visszarohant. – Jóisten. A bébi egyre rémültebben csiripelt és ugrált Tim vállán. Ott mind biztonságban lesznek. s a kicsi állat végtagjait rángatta.Lex visszaadta a kis raptort Timnek. Amint visszanézett. és őt nézték. és áthajította a szobán. aztán egy második is. hogy a gyerekek a következő helyiségbe mentek. s a mennyezeti lámpák is hol kialudtak. míg rájött. sziréna sivított fel. Szinte nekiugrott. Végigrohantak a laboratóriumon. Grant észrevette. aztán megint felszaladt a felső folyosóra. De még a riasztó zaját is el-elnyomta az üldöző raptorok ordítása. valamiért nagyon nyugtalan szegényke. és. Haboztak. és kicsi. Tim csak annyit látott. húgát is berántva rajta. Magas. A folyosón futva Tim hol sötétségbe zuhant.. melyen a biológiai veszély kék jele világított. A második velociraptor is közelebb jött. Üres volt. Kapkodta a fejét ide-oda. csoportosan indulnak el. fekete-fehér képei látszottak. – Nyugi. Fel-felágaskodtak.

Grant vigyázva fogta a tojást. Grant lassan felegyenesedett.. süket csendbe. csupa kényes. rózsaszín foltocskákkal. pipettákkal teli csőröspoharak. mint egy kerek fedéllel ellátott kerti villanykapcsoló. ahová menni akart: a keltetőben. Megfordult. krémszínű.. Körülnézett. ringó asztalokat. amelyeken tojások sorakoztak. végig a padlón. az ajtónak ugrott.. Igen! Ott volt. Mellettük üvegtálka állt. Felcsapta a fedelet. A tojás halványkék fényben ragyogott. s már látta is a fémfedelet. mint ahogy bizonyos mai madarak is megeszik más madarak tojásait. Az üvegekben lévő folyadékok halványzölden csillogtak az ibolyántúli fényben. sem gomb nem volt rajta. és őszintén remélte. Látta az asztal alatt a velociraptorok lábát s az asztallapokról leomló ködöt. Ránézett a vékony tűre. A raptor meglepetten nézett le. amelyen ez állt: A LABORATÓRIUMBA. A tűk hegyét plasztiksapka védte. Egész eddigi életét a dinoszauruszok tanulmányozásának szentelte. mi lehet. A raptorok rendületlenül közeledtek. Az asztalt halkan kattogva és zúgva szabályos időközönként megringatta egy szerkezet. A falhoz tapadva megkerülte a laboratóriumot. Megnyomta. A fedél lágy szisszenéssel a mennyezetig siklott. a raptorok felé. hogy elcsalja a raptorokat a gyerekektől és Gennarótól. a vadászatot. ELŐVIGYÁZATOSSÁGI ELJÁRÁSOK KÖVETENDŐK! Regis is mondta.. lebegve a padlóra kúszott. ahol eltűnt.. TETRA-ALPHA-SECRETIN. Éppen úgy. s vette szemügyre a váratlan ajándékot. körülöttük gomolygó pára.. A raptorok felé. és lassan folytatta útját. Elkúszott a keltető legközelebbi asztaláig. és odaütődött a nagy lábujj karomhoz. melyekről régóta az volt az általános vélemény. a hosszú asztalok között. leemelte. és a kis laboratórium végébe kúszott. A fecskendők kicsik voltak. egy ibolyántúli fényben úszó üvegfalú laboratóriumba. Grant egyenesen a keltető végébe rohant. s mindegyikükben volt egy kevéske zölden fénylő folyadék. . és visszapillantott a nagyterembe. SZ.. hogy a velociraptorok is ettek dinoszaurusztojást. A tojás megállt. Grant üvegpolcokat látott maga fölött. A fedél alja teljesen a laboratóriumi asztalba simult.. Méterekre az első raptortól. a keresést. Elindult előre. rajta a halálfejes jelzéssel. Aztán folytatták áldozatuk – Grant – lassú. jutott Grant eszébe. míg a tűt beszúrta a héjon át. Grant megfordult. üvegtálak. hogy nem téved. A raptorok még mindig az asztalok között lopakodtak előre. apró. és belépett rajta. milyen veszedelmes mérgek vannak itt. az infravörös lámpák alatt. reagensek. Egy kicsit megingott. és megszagolgatta a fénylő tojást. Elég néhány molekulányi.. Aztán furcsa alakú dobozkát fedezett fel az asztallapba süllyesztve. Összehangoltan haladtak előre a teremben. mi lehet az asztalok alatt. Volt is elképzelése arról. szimatolták a nedves levegőt. gyanakodva lesték a hosszú. Megvizsgálta a feliratokat: CCK-55. be a mély. húsevő dinoszauruszok voltak. és levett egy jókora tojást a himbálózó asztalról. rajtuk halálfejes üvegek sorakoztak. Lassan felnyúlt. benne injekciós fecskendők. Újabb ajtót látott. rángó mozdulatokkal körbenéztek. Ráhajolt. Most majd megtudja. AZ A4.Grant lassan elindult. Grant ismét lehajolt. tojásokkal teli. Az élen haladó állat mellső lábával megtörülte véres pofáját. és belenyomta a fecskendő tartalmát. THYMOLEVIN X-1612. mennyit ér a tudománya! A velociraptorok kis termetű. közelebb a bejárathoz. Grant lekucorodott. s alatta feltűnt a gomb. Az ajtón a biológiai kockázatot jelző kék fény égett. Grant nem tudta alácsúsztatni a kezét. Olyan volt. Az állatok a halk gördülő hang hallatára felkapták a fejüket. A felirat is így szólt: VIGYÁZAT! BIOGENETIKUS MÉRGEK. A raptorok a terembe léptek. Fejük le-lebukott. meleg. úgy figyelték. hasonlók az oviraptorokhoz és a dromaesaurusokhoz.. de sem ajtó. akármi legyen is az. belenyomta az injekciót. Grant újra megvizsgálta a fedelet. Felnézett. A kéklő sötétségben guggolva Grant az injekcióstálért nyúlt. A fogával húzta le az egyiket.. A köd szinte leomlott az asztalok pereménél. Ennek valami másik laboratóriumot kell jelentenie. majd a raptorokhoz gurította. lombikok. A raptorok némán mozogtak a hosszú asztalok között. Grant mindig is feltételezte.. mint egy rögbilabda. s a hatás azonnali halál. Aztán ott hagyta! Felegyenesedett. Hozzáférhetetlennek látszott. törékeny laboratóriumi holmi. Elgurította a fénylő tojást. sem kilincs. óvatos becserkészését. gőzzé vált. Először csak óvatosan mozdultak. Vegyi anyagok. Még az orrával is görgetett rajta egy kicsit. ha hozzájutottak. Odabenn hirtelen kékre vált még a ruházata is. Majdnem akkora volt. Őt keresték. bele a ködbe. Az istenit! Grant megismételte az egészet: csendben felnyúlt egy tojásért. Próbálta felnyitni. hogy tojásokat loptak. Az ezúttal az egyik raptor lábánál állt meg.

nyoma sem volt már benne annak a gyorsaságnak. és a nagy test előrezuhant. amelyet a falkában mutatott. Halvány színű albumin csöpögött le a fogai közül. hogy lába alatt tojások törnek. Az egyik félrebillentette a fejét. csak nézett. aztán a másik is. Újra lehajolt. és friss fecskendővel injekciózta be. gurgulázó hang tört elő. A raptor egyre közeledett a sötétvörös. Grant párhuzamosan mozgott vele. Átkelt a szobán. lehajolt. Aztán lassan. s a fénylő anyag lecsöpög az állán. meglátta.. Grantnál volt még egy fecskendő. A súlyos farok görcsösen verte a padlót. amikor az utolsó állat haragosan felhorkantott. Mintha zavarba ejtette volna ez a furcsa végvonaglás. mi fog történni. fogai a támadó nyakába mélyedtek. Egyik oldaláról a másikra billent a földön. Most. Felköhögött. Ekkor a terem túlvégéből a velociraptor észrevette őt. Ez eddig egy! – gondolta Grant. Vér ömlött a nyakából. Ám az álló állat egy rántással kiszabadította magát. Lassan. A tenyerébe vette a fénylő tojást. akárcsak egy tekegolyót. Fejét ide-oda kapkodta. hogy elállja a guruló tojás útját. Megint harapott. és megérezte a zsebében dudorodó rádiókészülék nyomását a testén. Óvatosan nézte a habzó fejet. – Alan? – Ide figyelj! – szólt halkan Grant. A farok a földhöz csapódott. Nem tud mit tenni. és dörömbölt a padlón. Mint kígyók dőltek ki belőle a belek kötegei. Egy pillanatra sem vette le a tekintetét Grantról. mit tegyen. Annyi hab bugyborékolt elő a szájából.Nem sikerül! Grant immár a harmadik tojásért nyúlt. megdermedt a rémülettől. Grant felé. Az döbbenten észlelte. bal felé mozdult. Elgurította. A hatalmas állkapcsok lecsapódtak. Grant a raptorra szegezte tekintetét. és összeroppantották a tojás héját. Grant felnézett: az állat felfedezte őt.. arra kérlek! – De Alan. de még volt ereje felfogni. A haldokló raptor sikolyai betöltötték a termet. a teste előrebillent. célpontja. hirtelen felemelte és elfordította a fejét. Estében felborított egy asztalt. mi vár rá... a lábak fölé. majd lehajolt a rángó nyak. A raptor kiegyenesedett. Megfontolttá. egy fénylő tojás volt a szájában! Grant nézte. Hátsó karmai lecsaptak. sejtelmes félhomályban. aztán fölöttük figyelt. gyorsan.. hogy valami máshoz kellett folyamodnia. s egyetlen gyors mozdulattal felhasította a földön heverő állat hasát. A rádió! Kikapta a zsebéből. Leguggolt. hogy egyék a törött tojásból. majd még egy. De szó sem volt „azonnali halálról”. amely lassan. Megvan a második! – gondolta Grant. elképesztően sebes léptekkel igyekezett Grant felé. Zajosan megnyalta a száját.. cipősarkaihoz ragacsos fehérje tapad. Halkan. Az állat vergődése szinte egy örökkévalóságig tartott. – Halló! Itt Grant! – Alan? – Ellie hangja szólt. mintha a harc hirtelen túlságosan fárasztóvá vált volna. Éppen azt igyekezett eldönteni. Hosszú. A harmadik raptor még ott volt. Ez kettő! A második raptornál szinte azonnal bekövetkezett a hatás.. A haldokló raptor már rángatózott. lassan. némán elindult előre. hogy egyedül maradt. hogy a teremben a többi raptor mozgás közben szinte kővé mered. és amikor újra felemelkedett. úgy vizsgálgatta. Szánalmasan nyöszörgött. elővigyázatossá lett. A támadó ott hagyta. És kiharapott egy darabot a hátsó lábból. Grant közben újabb tojásért nyúlt – és észrevette. előbb mindig az asztalok alá nézett. Sebesen siklott az asztalok között. Továbbra is fuldokló hangokat hallatott. mi történik. Az egyik állat meghallotta a zajt – lekapta a fejét –. Azon igyekezett. A haldokló állat vicsorgott. egész teste rázkódott a padlón. és felhorkant. Tucatnyi tojás gurult szanaszét. A döglődő állat hangját fülelték.. sziszegve szedte a levegőt kitágult orrlikain át. hogy lássa. te vagy az? . ahogy a raptor beleharap. Nincs hová bújnia. mi közeledik. ám most annyi tojás került a földre. Az gyorsan körülnézett. melyekbe időről időre hangos üvöltés keveredett. aztán a padlón nyalogatta a tojást.. amikor az állatból hirtelen hörgő.. Grant lenézett. a ziháló bordák. beleharaptak. Grant érezte. Fel-le mozgott a feje. hogy annyi asztal maradjon közte és az állat között.. A tojás zajosan gördült végig a padlón. óvatossá vált a mozgása. és megint nyöszörgött. A raptor sokáig nem is mozdult. hogy Grant már a fejét is alig látta tőle. és ösztönszerűen üldözőbe vette a mozgó tárgyat. és bekapcsolta. Grant elkeseredetten nézte őket. – Csak beszélj. De még csak jelét sem mutatta bármiféle rosszullétnek. amennyi csak lehetséges.. Az első állat a földön fekvő raptor felé indult. A második raptor a leterített állat fölé hajolt. oldalazva közeledett. ezúttal erővel. Farkasszemet nézett vele! Az állat fenyegetően felmordult.

. az arcát. kavicsmintás bőrt. Megfordultak. aztán ellökte magától a készüléket. Az állat végső rúgásra emelte a lábát. összevissza kente a kezét. Az állkapocs lecsapódott. Grant irányába. Orrát betöltötte a hüllő erős bűze. – Alan. mélyen a farok húsába döfte a tűt. A velociraptor vadul felmordult.. én vagyok az! Nem tudom. A raptor lába ismét lecsapott. Grant pedig hátraesett.. és ugrott. és együtt futottak a vezérlő felé. Miért is nem lökte a rádiót még messzebb! A raptor arrafelé tartott. csak a sziszegő légzés. felágaskodott.Alan? A készülékben megszólaló fémes hang hallatára az állat megállt. de így is túl közel maradt. A hatalmas láb ott volt előtte. A raptor fölé tornyosult. Most a rádiót zúzta össze. amelyből szikrák pattogtak szanaszét. mintha azt érezné.. van még valaki a teremben. majd csend. aztán az állat felkapta a fejét. s csak ennyit mondott halkan: – Tyűha! Aztán Gennaro felsegítette Grantot. majd a vér melegét érezte az ingén. A nagy farok éppen a férfi feje fölött volt. Nem hallatszott más.. Immár nem védte semmi. Grant a kezével jelezte. Grant az egyik asztal lába mögé guggolt. Hab folyt a szájából. és Grant ekkor a falba ütközött. Alan? A raptor lehajolt. Grant odébb hengeredett. kérlek! Aztán recsegés. Az alvadt vér csíkjait a hajlott karmon. Vadul vicsorogva rúgott harmadszor is. s a láb épp hogy csak elkerülte. és beadta a mérget. s orrával óvatosan megbökte a rádiót. A rádió elnémult. Továbbgurult a padlón. Grant gyorsan felnyúlt. már nem volt hová bújnia. és várt. – Alan! Szólj hozzám. Gennaro lépett a terembe a gyerekekkel. A levegőbe szimatolt. A kislány a döglődő állatra nézett. közben törte-zúzta a tojásokat. figyelj már rám!. a fogak az asztallábon zárultak össze. Az a közeledő raptor felé siklott a padlón. amint lecsapódott. a lágy zöldes csillogást. – . – Alan. Grant látta a bordázott.– Beszélj! – ismételte Grant. így is éles fájdalom hasított a vállába. Az asztal felbillent. – Alan! Kérlek. tátott szájjal lendült visszafelé. . Mi van Ellie-vel? Nem értené? A raptor egyre közeledett a sötétben. A rádió még mindig néma volt. – Alan? A raptor hátrált egy kicsit. A teste most elfordult Granttól. Az állat hörgött. hallasz-e? A raptor erre elfordult Granttól. amely vad himbálózásba kezdett. Tovább már nem volt út. hogy még maradjanak egy kicsit távolabb. fejét beverte a mennyezetről függő infravörös lámpasorba. A raptor közeledett. Rémisztő sebességgel. és a rádió felé indult. És hátrafelé felbukott. majd rúgásra emelte karmos lábát..

– Igen? Tim megérintette az ELEKTROMOS/FŐ-t. a mennyezetről lecsüngő raptorokkal. Be kell kapcsolnod a fő energiaforrást. ENERGIASZINT ALACSONY) – Hát ez meg mit jelent? – kérdezte Tim.A211 Sec B1 .B0211 Sec A1 . Timmy! – kérte Lex.A9 A01 . Gennaro csettintett egyet az ujjával.A011 A21 . hol kigyullad. „A hálózati rácsok” – gondolta Tim. Tim azonban be is siklott a „parancsnoki” ülésbe.A9 TEMP CVD PERM CVD (0) Main Grid P Main Set 1 Main Set ATL Grid V-VX Reset Grids MAIN Sec B1 .A VEZÉRLŐ Tim meglepetten látta. Fő Javítás Raktározás Státus Fő Biztonság/ Egészség Tim látta. hogy a hajó gyorsan közeledik Puntarenashoz. – Azt jelenti. A másik képernyőn a kastély belsejét látta. Morgásukat is hallotta a rádióból. – Csinálj valamit. – Ez már egyszer előfordult – mondta. és a fejét rázta.A9 Core (Aux) Security (N) Not In Use SUBMAIN Sec B1 .B9 Security (0) Security (1) Main Grid M Aux Grid 0/0 Aux Grid R/V Power Config Core Config . hol elalszik a rajz. hogy kimerülőben van a tartalék energiaforrás. és félszegen a billentyűk felé nyújtja a kezét. noha az villogott. – Mi történt? – kérdezte Lex. Már legfeljebb csak kétszáz méterre volt a dokktól. ŐSLÉNYPARK – RENDSZER INDUL INDÍTÁS AB(0) Biztonság Fő SetGrids DNL Kritikus zárak Kontroll Áthaladás Monitor Fő View VBB TeleCom VBB TeleCom RSD Parancs Fő Belépés TNL Reset Revert Eloszt. A videomonitorokon látszott. és megnyomta a SETGRIDS/DNL-t. Fő Elektromos Fő Fűtés Hűtés Vész Világ.B9 CSX (89A) CSX(1031) RSX (55-90) Aux Pwr (4) SUBMAIN Sec A1 . – Én nem értek a számítógépekhez! – sóhajtotta. FŐ ELEKTROMOS VEZÉRLŐMODULOK MAIN Sec A1 .B9 B01 . FNCC Params INDÍTÁS CN/D Hidraulika Fő Ajtók Interface GAS/VLD Fő II Robbanás Tűzveszély Mester Fő SAAG Rnd Közös Interface Séma Fő Zoolog. A képernyőn ott állt a válasz: FIGYELEM: PARANCSVÉGREHAJTÁS LEÁLL (TART. hogy a képernyő a vezérlőben immár villog.B011 B021 . hogy Grant professzor a képernyőre mered. Gyorsan érintgetni kezdte a képernyőt.

Egy pillanatig nem történt semmi. és kikötéshez készülődött. csak a feszültséget fogta fel. F4. A monitorok villogása abbamaradt. A TeleCom RSD-t nyomta meg. de az el sem jutott Tim tudatáig. és mindannyian látták.. – Mit csináltál? – hangzott Lex rémült kiáltása. és jobb felé mozogtak. HÁLÓZAT EZZEL BEKAPCSOLT A kastélyt mutató képernyőn világos szikrakitörés látszott. amelyben a „fő”. MEGHALLGATJA ŐKET? . FŐ ELEKTR. A hajó orrához közeledő épületek már egészen nagyra nőttek a képernyőn. Az örömteli hangok fémesen zörögtek a rádióban. A gyomra összeszorult a félelemtől. vagyis a FŐ-t. amely a tudós hangjában érződött. hogy a raptorok a rácsok közé szorulva vonaglanak a szikraesőben Muldoon s a többiek örömrivalgása közepette. de máris visszajött a kép. Csak úgy záporoztak a szikrák a szobában. ENERGIAFORRÁS BEKAPCSOLT Egyszerre kigyulladt a teremben az összes lámpa. Mind a TeleCom VBB. Tim megnyomta a MAIN-t. Tim szíve a torkában dobogott. Nem történt semmi. mind a Telecom RSD úgy nézett ki. a „rács” és az „energia” jele együtt szerepelt. Tim most a MAIN GRID P-vel próbálkozott. – Ez az! Isteni! Tim megnyomta a RESET GRIDS-t. sz. KASTÉLY. A fiú előbb a videomonitorokra pillantott. amint a hajó balra fordult. Látták. – Ez az! – veregette vállon Timet Grant. Újabb jelet érintett meg. ADJA MEG A HÁLÓZATI RÁCS PONTOS KÓDSZÁMÁT! Tim egy végtelennek tűnő pillanatig szinte jéggé dermedve ült a helyén: elfelejtette a számot. a kötelekhez. és megint szemügyre vette az indítóábrát. Tim visszakászálódott az ülésbe. Tim most a MAIN SET 1-et nyomta meg. hogy a matrózok a hajóorr felé sietnek. – Ez az. amikor egyszerre csak megszólalt Lex: – Na és a hajó? Azzal mi lesz? – Mivel mi lesz? – Hát a hajóval! – ismételte meg a kislány.Tim felnyögött. Kastély Egyéb Grant mondott valamit. és a képernyőre mutatott. aztán vissza a fő képernyőre. Közben az egész képernyő villogni kezdett. mintha mind gyerekek volnának. Hallotta a meghajló rácsok nyikorgását a kastélyban s a raptorok harsány vicsorgását. A monitor hirtelen teljesen kifehéredett. Grant aggódó tekintetét a fiúra szegezte. – Most mit csinálsz? – kérdezte Grant. De ő nem is akart a monitorra nézni többé. A képernyő villogott tovább. fiú! Megcsináltad! Sikerült! Ugráltak örömükben. Lex kiabált vele. A FŐ HÁLÓZATI RÁCS NEM AKTÍV / CSAK A TARTALÉKFORRÁS MŰKÖDIK A képernyő még mindig villogott. Aztán Malcolm hangját: – Szentséges Isten!. mint aminek köze lehet a telefonokhoz.. Melyik hálózati rácsot kívánja visszaállítani? Park Karbantart/Ellát. Aztán valahonnan előjött az emlékezetéből: F4! Megnyomta. A VÁRAKOZÓ HÍVÁSOK/ÜZENETEK SZÁMA 23.

– Vezérlő? Halló! Itt Freddy. de tüstént. majd a gyors egymásutánban. (KAPT. vége? – Felelj már! – kiáltott rá Lex. vagy azonnal kilépsz ebből a sávból! Ebben a pillanatban a képernyőn megjelent a kiírás: FARRELL.rakozik. Tim elmélyülten nyomkodta a billentyűket. – Ha hall. A lista hatalmas volt. – Nem jól veszlek. de csak vonalhangot hallott benne.. és ránk vár! – szólt Lex... Aztán értetlen hang hallatszott: – Mintha valami ostoba kölyök hülyéskedne! Tim folytatta: – Ne kössenek ki a hajóval! Azonnal térjenek vissza a szigetre! Távoli. öcsi! – jött a lassú. Timmy! – mondta Lex. Tim felkapta a kapcsolótáblán lévő telefonkagylót.. . Biztosan van valami mód rá. Mi van. ki is ez a Freddy. Murphy?.. légköri sercegés szólt a készülékből: – . itt Freddy. John. Gennaro a telefonkagylóért nyúlt. John. és nem volt ABC-sorrendbe szedve. majd megszólalt egy hang: – Ööö. HÍVÁSÁT TÁRCSÁZÁSSAL NEM TUDTUK KERESZTÜLVINNI (HIBA-598) KÉREM.. hogy a hajó orra már-már beleütközik a puntarenasi dokkba. itt Freddy. – Pedig lehet. úgy az Egységes Tengerhajózási Jogszabály 509.. – Talán így hozzájuthatnál a hívószámhoz! Tim nem is figyelt rá. Ki az? – Aztán egy másik hang: – Nem jól értem. Körös-körül mindenki sorra kapkodta fel a telefonokat. John. – Gőzünk sincs.. automatikusan tárcsázott számok zaja. amerre csak talált egyet. Hallotok engem. ha közlöm. de nagyon rosszkor szórakozol! Kikötés előtt állunk. – Halló... (FREDDY) 708-3902 Most már csak arra kell rájönnie. Sorban nyomogatta a gombokat a képernyő alatt. Hallgatlak.. FREDERICK.) – Nos. Végül Tim észrevette. Magas. vagy .. válaszoljon! Vége. sípoló zaj hallatszott.. TÁPLÁLJA BE A TÁRCSÁZANDÓ SZÁMOT VAGY KÉRJE A TELEFONLISTÁT F7-TEL Tim leütötte az F7-et. hogy megtudja. ELNÉZÉST. jó? Meg tudod találni a nevét? Éles.. és nem tér vissza erre a szigetre. Úgyhogy leszel szíves tisztességesen bejelentkezni.. hogy a hajóról is jött hívás. Farrell kapitány úr! Elég tisztességes bejelentkezés az magának. Vonalhang hallatszott.ádióamatőr .. – Halló. D. reszelős hangok érkeztek válaszul: – Mit mond?...tos valami hülye vicc..lán valami . mérges válasz. fölötte fény villog. de mindegyikből csak vonaljelzés hallatszott. nevét. Nem kis időbe tellett. – Hadd intézzem ezt én el. ki a fene vagy.. itt Tim Murphy. ismételd.. Tim kétségbeesetten nézett a többiekre... mire iszonyú mennyiségű név és szám öntötte el a képernyőt. Halló. – Hall engem? – szólt Gennaro a telefonba. hogy. TÁRCSÁZÁS MOST VAGY KÉSŐBB? TÁRCSÁZÁS MOST – parancsolta Tim. még áttekintette és megtalálta. és dolgunk van. és azt szeretném mondani magának. hogy amennyiben nem fordítja meg a hajóját. – Jól van. – Na ide figyelj. – Ez lesz az? – kérdezte izgatottan Grant. hogy a konzol oldalán is függ egy telefon.– NEM – felelte Tim. kérlek! – Ne kössenek ki! Hall engem? Rövid csend következett.. hogyan lehet tárcsázni. PRÓBÁLJA ISMÉT Megint megpróbálta. vége? Tim megmarkolta a hallgatót. amit keresett: VSL ANNE B. – De már majdnem ott vannak! – A képernyőn jól látszott. Vége.

Semmi kétség: a hajó egyre gyorsabban távolodott a parttól. – Gondolom. Tim összecsuklott a székében. – No! – sóhajtott fel Gennaro. – Dehogy – mondta. valamint öt évig terjedő börtönnel sújtható? Ért engem? Csend volt a készülékben. Farrell kapitány. Grant Gennaróhoz fordult: – Mondja már. Mindannyian elégedetten nézték a képernyőt. amit mondtam? Rövid szünet után lemondó hang szólalt meg a messzeségben: – Igen. mégpedig azonnal! Megértette. mi a csuda az az Egységes Tengerhajózási Jogszabály? – Hát azt meg honnan tudjam? – felelte az ügyvéd. és egyre jobban elfordult a dokktól. a nehezén végre túl vagyunk! Grant megrázta a fejét. . értettem – majd egy másik: – Teljes gőzzel hátra! – A hajó manőverezésbe kezdett. Lex örömujjongásban tört ki. s a verejtéket törölgette a homlokáról. – Válaszoljon. – A neheze csak most kezdődik.§-ának értelmében engedélyének bevonásával minimálisan ötvenezer dollárnyi kártérítéssel.

ami belőlük következik. IAN MALCOLM .HETEDIK ISMÉTLŐDÉS A matematikai képletek egyre sürgetőbben követelik. hogy legyen bátorságunk szembenézni azzal.

és összetorlódásuk sok millió év alatt létrehozta a Himalája hegységet. hogy visszanyerje mai változatosságát. majd kiszáradó óceánok. bőrrákot okozhat. mennyire beleszédülhetett a hatalmába! – Malcolm visszadőlt az ágyra. az élet ismét szétterjedne a bolygón. Nagy energiát jelent.A VILÁG MEGSEMMISÍTÉSE Malcolmot átvitték egy másik szobába. Malcolm nagyot sóhajtott. – A szakemberek is mind úgy vélik. – Igen. sok-sok év múlva. hogy nem. – Aztán miféle katasztrófát? – kérdezte mély sóhajjal Malcolm. felduzzadó. Hammond.. hogy minden növény és állat elpusztul.. Gyilkos gázt leheltek ki. És természetesen egészen más lenne. a dinoszauruszoké. mint a fluorin. hogy régóta fennáll – mondta –. – Mondjuk. hogy szükséges az élethez. és mind évmilliókig tartott. És amikor bizonyos növényi sejtek hulladéktermékeként először képződött oxigén – úgy nagyjából hárommilliárd évvel ezelőtt –. hogy egykor két nagy kontinens összeütközött. – De ha az ózonréteg el vékonyodik. Malcolm felkönyökölt. – Akkor erősebb ibolyántúli sugárzás éri a földet. kiszabadulnak innen. és tiszta ágyba fektették. – Az. mint a Vénusz. Az élet is túlélné. Rengeteg olyan életforma van. Elősegíti a mutációt. egész kontinensek mozgásai. Malcolm megint sóhajtott. a változást. – vetette közbe Hammond. amely egyenesen kivirágzik. hogy bekövetkezik! – vágott közbe Malcolm. – Miért. De a Föld túlélné a mi balgaságunkat. majd haltak ki. a kétéltűeké. hogy először fordulna elő ilyesmi? Nem hallott még az oxigénről? – Tudom. – Tegyük fel. – Maga nem képes megsemmisíteni ezt a bolygót. Az első baktériumok. s a Föld vagy százezer évig tűzforró marad. a szárazföldön. és nem özönlötték el a világot.. – Ez a bolygó négy és félmilliárd éves. Nem kétséges. Korrozív gáz. Egy olyan bolygón. Malcolm dühbe gurult. hogy örökkévaló. Ezen a bolygón majdnem ugyanannyi ideje van élet is. alig egy százalék az . És mindennek a hátterében folyamatos. újra magabiztosan sürgölődött. Élőlények egész dinasztiái emelkedtek fel.. Aztán. hogy bolygónk végveszélyben van. tűzhányókitörések. – Az a puszta tény. hogy olyannyira súlyos. majd lepusztuló hegycsúcsok. A mai napig e bolygó legnagyobb földrajzi látványossága onnan származik. – Egyáltalán van magának fogalma arról. szükséges. – Maga azt hiszi. Most. – Maga egomániás idióta! – kiáltotta. – Jó. maga attól tartott? – Hát persze.. üstökösök becsapódásai. Utána jöttek a különféle állatok nagy korszakai. – De az oxigén voltaképpen mérgező anyagcseretermék. Azok a növényi sejtek halálos méreggel szennyezték be a környezetet. És a maga idejében a bolygó mindent túlélt.. amelyek féken tarthatnák őket. az emlősöké. legalább a katasztrófát sikerült elkerülnünk.. csak mi hisszük. hiszen az volt a tét – mondta Hammond. tündököltek. Talán kellene hozzá néhány milliárd év. Malcolm megrázta a fejét. ragadozók nélkül. Három egész nyolctized milliárd éve. – Sok más viszont kihal – ellenkezett Hammond.. ha fokozódik az ibolyántúli sugárzás. mélyen a talaj alatt vagy talán a sarkvidéki jégbe fagyva. Ha például bekövetkeznék valami nagyszabású sugárbaleset. Az élet még így is fennmaradna valahol. el tudja pusztítani a Földet? Szentséges Isten. Elölről kezdődnék az evolúciós folyamat. nem jelenti azt. majd az első összetett lények a tengerekben. amikor a bolygó már nem lakhatatlan többé. melyet üvegmarásra használnak. – Csakhogy nincs – mondta Malcolm. Közel sem kerülhet hozzá! – Az emberek nagy része meg van győződve róla – jelentette ki Hammond –. hogy ez a bolygó bajban van. aki szemlátomást összeszedte magát. És? – Hát. akkor hadd mondjak magának egy-két dolgot erről a bolygóról – mondta. – Hát nem szöktek ki az állatok. iszonyú válságot okozott minden más életforma számára ezen a bolygón. – Az ibolyántúli sugárzás hasznos az élet számára. – Nos – mondta –. – mondta Malcolm. hogy bennünket is túlél majd! Hammond összeráncolta a homlokát. amelynek egyre nőtt a koncentrációja. mint amilyen most. heves átalakulás: felszökő. mit beszél? Azt hiszi. Aztán később az első többsejtű állatok. Csak mi – mondta Malcolm –. hogy ezek az állatok. és megsemmisítik az egész bolygót.

– Csak azt akarom mondani. Mi vagyunk veszélyben. repülőgépünk. számítógépeink. hogy az élet a Földön képes vigyázni magára. Egymillió év semmi. dehogyisnem. Egészen más volt akkor a világ. Egy puszta szemvillanásnyi ideje vagyunk még csak a lakói. – Bizony – mondta Malcolm. gigászi ritmusát mi el sem tudjuk képzelni. tíz és végül huszonegy százalék! A Föld egész atmoszférája tiszta méreggé vált. amely összeférhetetlen az élettel! Hammond bosszús képet vágott. majd valahová a messzi távolba függesztette a tekintetét.. A Földön azonban az oxigénkoncentráció rohanvást nőtt: öt. . – És könnyen megeshet. és nincs meg bennünk az alázat sem. – Beszéljünk világosan! A bolygó nincs veszélyben.oxigén. hogy önmagunkat megmentsük. Egy emberi lény gondolkodásában száz év nagy idő. Ha holnapra eltűnünk. Nem áll hatalmunkban a világot megsemmisíteni – de megmenteni sem. Arra azonban van még esély. Méreggé. – Végül is hová akar kilyukadni? Oda. hogy a bolygó a mai szennyező anyagokat is bekebelezi majd? – Nem – felelte Malcolm. – Könnyen megeshet. hogy eltűnünk – mondta fújtatva Hammond. – No és mit akar mondani ezzel? Ne is törődjünk a környezettel? – Ugyan.. a Földnek nem fogunk hiányozni. – Hát akkor? Malcolm köhécselt. Száz évvel ezelőtt nem volt autónk. Ez a bolygó ennél sokkal hatalmasabb skálán él és lélegzik. Lassú. hogy megpróbáljuk. A Föld életében azonban száz év semmi. vakcináink.

Most már csak telt-múlt a nap.1 ?? 3. mind a Szafarikastély ismét biztonságban volt. – Az állatok keverednek egymással. és most éppen új képet jelenített meg a képernyőn: Állatok összesen Faj Tyrannosaurus Maiasaurus Stegosaurus Triceratops Procompsognathida Othnielia Velociraptor Apatosaurus Hadrosaurus Dilophosaurus Pterosaurus Hypsilophodontida Euplocephalida Styracosaurus Microceratops Összesen 292 Várt 2 22 4 8 65 23 37 17 11 7 6 34 16 18 22 292 Talált 1 20 1 6 64 15 27 12 5 4 5 14 9 7 13 203 Ver 4. hogy bárki ezt akarta volna – mondta Gennaro.1 3. A Costa Rica-i gárda azonban feltűnő óvatossággal tárgyalt velük telefonon. – Ezt hogy érti? – Létrejön az egyensúly. és az áldozat hosszú nyakába harapott. míg a többiek előrerohantak. Addig pedig nem volt mit tenni. amint nyugat felől velociraptorfalka lépett be a képbe.1 ?? 3. Már útban is volt a Costa Rica-i Nemzeti Gárda egy egysége. nyilván hívások sora futott ide-oda San José és Washington között. Ellie hozzátette: – A Juraparkban végre helyreáll a rend.9 3. csak várni. ám az egyik raptor még a hátára is ugrott. – Grant a monitorokra mutatott. A hadrosaurus megfordult. Tudták: ha a helikopterek nem jönnek hamar. Muldoon csendesen megjegyezte: – Szóval a jelek szerint e pillanatban az összes felnőtt raptor odakinn van.3 ?? 4.1 4. Isla Nublaron minden jel szerint elmúlt a közvetlen veszély. – Nem. hogy a kórházba vigyék Malcolmot. Mind a látogatóközpont. míg a segítség végül útnak indult. Segítségkérésük eljutott a San José-i hatóságokhoz. hogy képzeltem – felelte a férfi. Egy másik monitoron Grant látta. A populációk egyensúlyba jutnak – valódi jurakori egyensúlyba! – Nem hiszem. nem egészen így. – Az elképzelés úgy szólt. és felugrottak.3 4. a nap lassan alászállt. a matrózok rátaláltak a három fiatal raptorra.HELYREÁLL A REND Eltelt négy óra. és további hatan eltűntek. hogy az állatok sosem fognak összekeveredni. reggelig kell várniuk. Tim egyre jobban belejött a számítógép kezelésébe. amint a nyílt mezőn át raptorcsorda vágtat teljes sebességgel egy négytonnás hadrosaurus felé. és végeztek velük. tágra nyitott szemmel figyelt.0 3. s a jelek szerint a külső védelmi övezetet sem fenyegették dinoszauruszok. és menekülni próbált. A hat raptor percek alatt leterítette a náluk sokkal nagyobb állatot. .9 4. – Most meg kevesebb állatot jelez a gép? Grant bólintott. a lábába kaptak. – Márpedig most összekeverednek. Az egyiken éppen hypsilophodonták csapata szökött a magasba. – Alighanem. A vezérlőteremben ismét működött a légkondicionálás. és a számítógép is kifogástalanul végezte a dolgát. a szigeten tartózkodó huszonnégy személyből nyolcan meghaltak. Amennyire meg tudták állapítani. köröztek körülötte.1 ?? 3. vagy a kastélyban volt. – Nem is tudom. A hajó útban volt visszafelé.1 – Hát ez mi az ördög? – kiáltott fel Gennaro. – Órák óra nyitva állnak a kerítések – mondta Grant. Grant némán. továbbá a légimentők. amelyek az egyik hátulsó rakodótérben játszadoztak. Délután volt már. hogy a hasába vágják rettenetes karmukat. Mindenki vagy a látogatóközpontban. – Valahogy így képzelted? – kérdezte tőle Ellie.

de lehet. – Azt nagyon helyesen teszik – mondta Gennaro. maga nincs tisztában a helyzettel. amit tud! Muldoon elment. Vállon ragadta az ügyvédet. hogy még ideggázt is bevetnek majd. A déli részen a stegosaurus tüskés farkát lengette. – Mennyire jók ezek a botok? – kérdezte Grant. Célpontnak. akiről tapasztalatból tudta. A csúcsokon lévő kapacitor érintésre áramütést ad. és levegőért kapkodott. . – Akkor meg mi a gondja? – kérdezte Gennaro. Meg kell semmisíteni. – Hát akkor hozzon. – Rádiójeleket sugárzó nyakörveik vannak? – Persze hogy vannak – felelte az. Grant doktor. – Hadműveletről van szó. de nem gyakorolt felügyeletet fölötte. amelyet a lehető leggyorsabban meg kell semmisíteni. – Miféle fészekben? – kérdezte még mindig köhögve Gennaro. ott. aki előrehajolt. amikor rettegve gubbasztott egy teherautó vezetőfülkéjében. Érti. maga kis csirkefogó! Maga is felelős ezért a helyzetért. – Talán napalmmal. – Olyanok. ahol belemart a raptor. Magas feszültség. – Hogy állunk fegyverekkel? – Hálóink vannak. – Nem – mondta Grant. a hatalmas állatok közt lejátszódó drámai jeleneteket. Minden állattal végezni kell ezen a szigeten. intézzék ők el a dolgot. ami védekezésül használható? Muldoon csak a fejét rázta. hogy hazug ember. – A levegőből fogják bombázni – folytatta Muldoon. Az összes állatot el kell itt pusztítani. – Az ördögöt. – Igaza van – kapott észbe Grant.. – A raptorfészekben? Grant tovább faggatta Muldoont. – Az jár az eszemben – mondta Muldoon –. hogy belekapjon a tüskékbe. Grantnak hirtelen eszébe jutott. – Az nem megoldás – szólt közbe Grant. Én igenis állítom. Csak bámulta a monitorokat. Résztulajdonosa lett egy üzletnek. és hirtelen felforrt benne a méreg. és a Costa Rica-i gárda éppen ezt fogja tenni. Nem ellenőrizte egy olyan személy cselekedeteit. – Felállt. és hagyta. de mindenképpen bénító. és haláltusáját vívta. – A raptorfészekben – válaszolta Ellie. Szerintem az ő szakértelmükre kell bíznunk magunkat. mint a cápák elleni védőkarók. annál jobb. – Remélem is – helyeselt Gennaro. Minél előbb. Muldoon ismét megszólalt: – Már legfeljebb csak egy óráig lesz elég világos odakint. – Jó. De ennek most már vége. amely érdeklődve figyelte. – Hát ide figyeljen. és vállalni is fogja a felelősséget! – De hiszen vállalom – nyögte köhögve Gennaro. hogy ez a személy a történelem legveszedelmesebb technológiájával játszadozzon. A nyugati négyszögben a felnőtt triceratopsok egymás között verekedtek: újra meg újra egymásnak rontottak. Tegyék a dolgukat! Grantnak a hátába nyilallott a fájdalom. meg áramütést adó terelőbotjaink. – Nekem az a véleményem. hogy ez a sziget túl veszélyes. – Nem! – mondta makacsul. – Egy fenét vállalja! Kezdettől fogva mást sem tesz mint igyekszik kibújni a felelősség alól. ők alighanem katonai problémának tekintik majd ezt az egész szigetet. – Ezt nekünk kell elintéznünk! – Bízzuk a szakemberekre! – mondta megint Gennaro. Grant Gennaróhoz fordult.Grant először oda sem figyelt rá. hogyan talált rá Gennaróra alig hat órája. amit fel sem fogott. és a betonfalnak taszította. Nem halálos. és összeakasztották a szarvukat. – Hozzon egyet! Van még valami. Az egyik állat már a földön hevert. hogy amikor majd jönnek a Costa Rica-iak. – Ez a sziget túl veszélyes.. és óvatosan kerülgette a kis tyrannosaurust. – Az nem lesz elég – mondta Grant. – Csődbe húzta a befektetőket: belevitte őket egy vállalkozásba. – Meg akarom keresni. Alan – mondta Gennaro. hogy maga kibújt a felelősség alól! Nem vállalta! Gennaro ismét köhögött. hát akkor most vállalom. Mármint ha tényleg meg akarja keresni azt a fészket. – Induljunk! – Azt hiszem. amit mondok? – Tökéletesen – felelte Grant. – Még mindig bujkál előle. – A fészekben semmiképp. Grant Muldoonhoz fordult. és időnként eredménytelen kísérleteket tett arra. – Elengedte Gennarót. gyenge áramerősség.

Ellie a térképre mutatott. s alatta előtűntek a mélybe vezető betonlépcsők. Víz és árnyék. s a színe megint elhalványodott. Utána aztán felégethetjük. Ez pedig annyit jelent. Tim a billentyűket nyomkodta. – Átkozott Arnold! – mondta Muldoon. Gennaro. kérlek! – Tim azonban nem hallotta. – Nehéz a nyakörvet az állatra rakni? – kérdezte. Ellie folytatta: – Azt hiszem. – Miért. Grant hallotta is a magas. Ellie a falitérképet nézte. És ezek itt gránátok! Csupa-csupa gránát! – Akkor induljunk! – mondta komoran Grant. Számba kell vennünk minden egyes állatot. mi az? – kérdezte Grant. A mocskot el kell takarítani.– A szigetük teljes csőd. felemelték a napfényre. sípoló jelet a fülhallgatóban. – De ez szeret engem – ismételte Lex. – Tim! A fiú a billentyűk fölé hajolt. hogy a meleget szeretik? – Van arra alkalmas rejtekhely? – Úgy tűnik. A lépcső aljára értek. – Meg sem próbált idejönni. A kockákban Grant kis. mutasd meg a réseket a gáton. De előbb van még egy kis tennivalónk. hogy nekem megengedi – makacskodott Lex. – Kiszámíthatatlanok. – Azért jobb lesz vigyázni! – figyelmeztette Muldoon. – Hátha fegyverek – mondta erre Grant. Lex tovább simogatta a raptort a rácson át. melyet Grant fogott az alagútban. – MORO-12 – felelte Muldoon. Grant bólintott. mi van benne. – Találtam valamit. hogy mindvégig tudott erről! – Nem biztos – mondta erre Grant. Csakhogy ezt addig nem tehetjük meg. Odalenn többsornyi gázálarc függött a falakon. Főként a raptorfészkeket. – Akkor meg Hammond tudta. Nem tudom. Az a kezéhez dörgölődzött. lefelé ugrált a lépcsőkön. hol van most Hammond? – Még mindig a kastélyban. – Akkor ott lesznek. ott. van – felelte a botanikusnő. Mind ott álltak a gépház épülete mögött. Beljebb világítottak lámpáikkal. – Ez nem igaz! – szólt halkan. – Clarence-nek hívják. – Szeret engem – mondta mosolyogva Lex. A kislány a ketrec rácsai közt benyúlva simogatta az állatot. gondolta. – A kapcsolótáblához fordult. – Tim. Meg kell találnunk és meg kell vizsgálnunk őket. – Hatalmas betongát van ott. benyúlt. Meg kell számolnunk a tojásokat. . amely ezen a szigeten született. miközben fájós lábát húzva. s kihúzott egy gömböt. Kinyitották a talajba süllyesztett vasajtót. A raptor színe hirtelen élénkzöldre változott. hogy meg kell keresnünk a fészkeket a szigeten. Valakinek csak tudnia kellett! – Tényleg. a part felől is van bejárat oda. Aztán szép lassan az állat nyaka köré csúsztatta. Így hát Muldoon odaadta neki a nyakörvet. – Pocsékul harapnak. míg meg nem tudjuk. majd a csat fölé kapcsolta a tépőzárat. – Fogadok. Az egész kísérlet maga a csőd. Nagy föld alatti terület. s ott több nehéz. hogy nekem engedi? – mondta. amely most az állatok mozgáskörzetét mutatta. – Én pedig fogadok. Lehet. ahol vulkáni gőz tör fel a talajból. Mintha óriás borsdarálókkal lenne teli a szoba. mind műanyag tartóban. hogy a raptor megszagolhassa. – Egy pillanat! – szólt. acélfedővel a tetejükön. – Clarence-nek? – Annak – felelte a kislány. Összeráncolt homlokkal forgatta a fényben. méteres üvegkockát vettek észre. Muldoon felnyitotta az egyik tartály tetejét. – Mibe. A bőrnyakörv a hozzáerősített fémdobozkával együtt Muldoon kezében volt. sötét gömböket látott. Rejtve vannak valahol. A látogatóközpont garázsában álltak a kis raptor mellett. – Mi az? – Egy jelzés nélküli raktárhelyiség. Mr. mekkora a baj. Amint végzett vele. – Légzésbénító ideggáz. – Én a helyedben nem próbálnám meg – szólt Muldoon. nehogy a víz elárassza a déli síkságot. amint Lex becsatolta. Lex pedig odatartotta. az állat megnyugodott. – A raptorok a déli szektorban tömörülnek.

– Pontosan. a kövületek eltorzulnak az évezredek súlya alatt. De a jelenség főként békák esetében jól dokumentált. és kezével jelezte Muldoonnak. kúp alakú fészket. milyen az a fészek? . hogyan szaporodnak? Végül is még mindig nem magyarázta meg. melyeket korábban láttak tojásokat rakni. – Miféle jelenségről van szó? – Nemváltásról – mondta Grant. képesek voltak néhány hónap leforgása alatt tökéletes hímmé átalakulni. – A dinók viszont nem hüllők – jegyezte meg szárazon Muldoon. Meglehet. egy-két hipotézist. Grant közben a sípjelre fülelt. sőt néha a szájában viszi őket odáig. A nőstény vad elszántsággal őrzi az egy méter magas. megkeressük végre azt a fészket? Bezsúfolódtak a dzsipbe. és megkérdezte: – Vajon milyen az a fészek? – Azt senki sem tudja – felelte a tudós. – Ó! – Gennaro elnémult. Grantnál volt a vevő. – És mitől következik be ez? – A jelek szerint az átalakulást az olyan környezet váltja ki. hogy maga már ásott ki ilyet. – Én fosszilis dinoszauruszfészkeket ástam ki – mondta Grant. A kocsi bukdácsolva száguldott a főúton dél felé. hogy számos növény. Mire azonban a nőstény megépíti a fészket. – Maga viccel! – mondta Gennaro. és engedi. utoljára megveregette a fejét. – Elmagyarázta. aztán elengedte. és hímgonádokat növesztettek. Az állat nem akart elindulni. teljes erővel támad. és minden erejével heves támadásba kezd.– Még ilyet! – döbbent meg Muldoon. – Ez kaméleon – mondta Lex. – De a fossziliák. de hogy a valóságban milyenek voltak a fészkek. Nos. azonnal a segítségére siet. hogy nem tudja! – mondta Gennaro. ha mind nősténynek születik. Olyan állatok ezek. – Ez a vadon született állat. Muldoon vezetett. amelyre bármely felnőtt. – Nem a béka-DNS a lényeg – felelte Grant –. Ebben a helyzetben bizonyos kétéltűek elkezdenek spontán módon nőstényből hímmé alakulni. stimulálták a hormonokat. Az állatka egészen nyugodtnak. hogy nyugatabbra tartson. hanem a kétéltű-DNS. azt nem tudja senki. gyakran segít nekik széttörni azt. például a krokodilok és alligátorok fészekrakási és fészkelési viselkedéséről is keveset tudunk. – Vagyis a dolog lényege. ijesztő magatartást vesz fel. ha jól emlékszem. – És úgy gondolja. Ismeretes azonban. Kora tavasszal. hogy Ellie-nek volt igaza: a fészek a déli. – A többi raptor erre nem volt képes – mondta elgondolkodva Muldoon. Nem csupán fenyegető. szinte szelídnek látszott a kislány kezében. míg végül eljuttatja odáig. Úgy gondolom. és buborékokat fúj a pofájára. hogy ez a történet a dinoszauruszokkal is? – Hát amíg nem találunk rá jobb magyarázatot – mondta Grant –. – Fogalma sincs. s amikor a fiókák nyüszíteni kezdenek. Grant megrázta a fejét. – Vagyis a felnőtt alligátorok védik a kicsinyeiket? – Úgy van – mondta Grant. – De hát én úgy tudtam. más. amelyeket igen nehéz tanulmányozni. hogy még egyes ma élő csúszómászók.és állatfajról tudják már. a fején a fülhallgató. hogy a hím behelyezze a péniszét. – Egyszerűen nemet változtatnak. Egyre inkább úgy látszott. és várja be a tojások kikelését. hogy képes élete során megváltoztatni a nemét. hogy az amerikai alligátoroknál csak a nőstény őrzi a fészket. mi van azzal a béka-DNS-sel. két hónappal később. a hímnek már rég nyoma veszett. most már ingerülten. és kifelé bújnak a tojásból. hogy a dinoszauruszok fészkelési szokásai sokkal inkább rokoníthatók egy sor különféle madáréval. Először a hímek harcra kész magatartását öltötték fel. A fiatal alligátorok jellegzetes kiáltást hallatnak. bizonyos halakról és kagylókról és legújabban a békáktól. Gennaro Granthoz fordult. amelyik hallja – akár szülő. és Lex kiemelte a raptort a ketrecből. hogy hajlandóvá tegye a befogadásra. amelyben minden állat azonos nemű. Egyes békák. – Tudnia kell. orchideákról. aztán megtanulták a hímek párzási hívófüttyét. Különösen a nyugat-afrikai békáknál. Erről jut eszembe – fordult Granthoz –. addig igen. párzás idején a hím alligátor napokon át fekszik a nőstény mellett. Azonnal. ha bajban vannak. úgy látszik. hogy az felemeli a farkát. – Menj már! Sicc! – szólt rá Lex. hogy ez történt. és beszaladt a sűrűbe. s végül sikeresen párosodtak nőstényekkel. Lex még egyszer. majd pedig a vízhez lökdösi őket. – Még egyfajta csoportos védelem is ismeretes. akár nem –. vulkáni mezőkön van. – Futás haza! A raptor megfordult. Kialakítottunk bizonyos feltevéseket.

virágos. Gennaro bólintott. Ez már bebizonyosodott. – Remek! – morogta Gennaro. hogyan tud Grant ennyire nyugodt maradni. amelynek a földi életformák között szinte alig akad párja. – Mondja. Vagy a nő. miért olyan nyugodt Grant doktor? Miért nem izgatja ez az egész? – Lehet. és leengedte a nyílásba. farmerben. hogy képes terveket szőni és kivitelezni: a csimpánzokról. aztán hirtelen eltűnt. és nyugodtan nézelődött. mintha a pokolban sétálna. ez a viselkedés olyan szellemi képességeket feltételez. A raptor újra megjelent.– Nincs – mondta Grant. sem nyugodt. Csak mentek előre a bugyborékoló gőznyílások között. Forró a talaj. amint elindult. Visító hangokat hallottak a mikrofonon át. . Arra jutott. Ellie Sattler. Ott ült. Grant a fejhallgatót figyelte. – Azt hiszem. Majd mélyebb. vajon milyen érzés lehet ez. Aztán elszaladt. Egy állat alakja rajzolódott ki halványan a gőzfelhők mögött. Kötelet kötött a kamerára. Grant hunyorgott a napfényben. Aztán még többet. és elgondolkodott. s a sziklák között egy kis lyukra leltek. gondolta Gennaro. míg beáll – válaszolta Grant. Gennaro úgy érezte. Közönségesen és klasszikusan mindössze három fajról feltételezik. – Elment. s a sípjelekre figyelt. – Hát ez meg hová lett? – kérdezte meglepetten Ellie. hogy egy dinoszaurusz is képes erre. Gennaro elkomorult. A távolból már hallották a hullámverés zaját a sziget partja felől. hozzácsatlakoztatva a hordozható monitor. hogy a szürke papagáj nem kevesebb jelképi intelligenciával rendelkezik. Már érezte a kénszagot. Gennaro viszont egy cseppet sem volt sem hűvös. míg egy másik a tetőre mászik. Ő meg Ellie a műszerekkel kezdtek babrálni. hogy egy papagáj embert ölt volna – morogta Gennaro. – Nem tudom. igen. Halálos félelem lett rajta úrrá. – Én oda be nem megyek! Grant nem szólt. – No. Vagy egy másik. – Mennyire értelmesek ezek? – Ha mint madarakra gondol rájuk – mondta Grant –. – De az is tény. – Olyat viszont még nem hallottam. kénes oszlopok sisteregve emelkedtek vállmagasságig. bekapcsolta. A sípoló jel megszűnt. aztán az alagút egyszerre csak hirtelen kitágult. a gorillákról és az emberről. Előresiettek. Ha ez igaz. Nem is értette. és láthatóan mit sem vesztett hűvös nyugalmából. újra előbújt a kis raptor. és őket figyelte. amire ő egész életében várt. akkor van min eltűnődnie. Tényleg forró! Itt-ott pedig bugyborékolt. Ő is velük jött. hogy lássák a sima földfalakat. azt már nem! – szólalt meg Gennaro. sok állat hangját. Az orrfacsaró. Hatvan-hetven centiméter lehetett az átmérője. Kifutott a fényre. Grantnak hamarosan kis videokamera volt a kezében. Grantra nézett. kívül hordott ingben. aki a fejhallgatóval a fülén haladt mellette. – Csak nem vezetni akar minket? – Az is meglehet. Képesek jelképekből következtetni. Akkora lehetett. mint a csimpánz. – Várjuk meg. S hogy van-e valami. Már maguk mögött hagyták a vulkáni mezőket. hogyan játszottak vele a raptorok a kerítésnél. Gennaro az övére csatolt gázgránátokat markolászta idegességében. trombitálásszerű zajt. Tényleg úgy tűnt. mint egy nyúlüreg. amiért ezen a bűzös. Mialatt vizsgálgatták. pokoli helyen kell lennie. és sarat köpött a magasba. Az alagút felső részében elég volt a fény ahhoz. hogy egész életében ez járt a fejében. hogy nagyon is izgatja – felelte Ellie. – Ellie már elmesélte Grantnak. nem izgatott? – Ennek meg kell lennie! – felelte Grant. Aztán elszaladt. ahol ráadásul a velociraptorok is ott ólálkodnak valahol. – A raptor volt az? – kérdezte Ellie. – Így nem fog látni semmit – vetette ellen Gennaro. hogy a papagájok érzelmi fejlettsége egy hároméves gyermekének felel meg. De mindenképpen kölyök. – Úgy értem. És most kiderül: lehetséges. Bizonyos új vizsgálatok arra utalnak. Pislogott a fényben. hogy nincs ilyen. Előttük pedig már feltűntek a vulkáni mezők gőzoszlopai. s most sziklás rét feküdt előttük. Többet nem is szólt. – Ennyit érnek a híres-neves szakértők! Grant fel sem vette a megjegyzést. majd sivítva elugrott. A kis raptor felmászott az egyik sziklára. A kutatók véleménye ma az. hogy lekössék a figyelmét. az intelligenciájuk azonban kétségbevonhatatlan. Ellie-hez fordult. vezeti őket. Cowboycsizmában volt. A csimpánzok pedig kétségkívül képesek nyelvet használni. – Magát ez nem zavarja? – kérdezte Granttól Gennaro.

és letette a földre. és némelyik állat görcsei közepette a fészekre zuhan. nálad az elemlámpa? Ellie odanyújtotta a lámpát Grantnak. Gennaro.. És nem ölheti le őket csupán azért. Ellie lámpáért és elektromos botért ment. A nyílás felé hátrált.. – Ezt nem gondolhatja komolyan! Csak nem képzeli. mennyi a tojás. aztán maga jön. Alan? Megint hosszas csend következett. Ha előbb megöljük őket. – Ide figyeljen! – mondta Grant. Úgy is mondhatnám. mi volt ott. – Ezeket az állatokat maga hozta létre. – Mit szól ahhoz. és befelé hallgatózott. Az üreg üresen. amit mondok? Mi a véleménye? – kérdezte újra Gennaro. – Úgy félek. Ellie odaadta neki az egyik elektromos botot. – Miért nem dobjuk be előbb a gázgránátokat? Miért nem csak aztán megyünk? Nem ezt diktálná a józan ész? – Ellie. Grant hátrafelé bepréselte magát a nyílásba. elhiszem. Ellie közelebb lépett. A pénze révén. hogy lemegyünk oda! – tiltakozott Gennaro. – Kövessenek! – szakította félbe Grant. Grant az arcára húzta a gázálarcot. hogy megtudjuk. – Nem én! – Dehogynem.. de látni a világon semmit sem lehet – vitatkozott Gennaro verejtékező homlokát törölgetve. – No. Maga is. Én megyek előre. Vagyis ezt nem tehetjük. – Nézze. – Látott valaha is bármit mérgesgáztól kimúlni? – Nem.. De Grant igent intett a fejével. aztán kihúzta a kamerát.. – Az igaz – mondta erre Grant –. de. – Hé. Amikor Grant végül megszólalt. – Igen. – Minden a legnagyobb rendben – mondta. hogy majd. Közben felnyögött: – Épp hogy beférek! Aztán mély lélegzetet vett. Az erőfeszítései révén.. furcsán. kissé esetlenül lekuporodott. hogy a maga teremtményei. akkor úgy tönkreteheti. – Fülelt még egy kicsit. – Nem egy kicsit vagyok ideges – mondta Gennaro. de hallani jól hallok. várjon még egy pillanatig! – mondta hirtelen rémülettel a hangjában Gennaro. – Nem élvezetből teszem. – Mi lett vele?! – kérdezte rémülten Gennaro.. – Minden rendben. – De hát. akkor gyerünk! – Felmászott az üreg bejáratához. sötéten tátongott.– Hát a hang után ítélve tényleg ez a fészek – mondta Ellie. ha megtehetnénk – felelte Grant.. Nagyon heves rángásokkal. s Grant eltűnt. – Azért megyünk be ebbe a fészekbe. utánam Ellie. – Magam is örülnék. . hogy létrejöttek. mert most egy kicsit ideges. hogy az ilyesmi nem kellemes látvány. szinte elképedten szólt a hangja. Aztán távoli hang szólt: – Itt vagyok. Része volt benne. hogy többé már nem is látjuk. és halkan kérdezte: – Alan? Sokáig nem kapott választ. s hátrafelé kinyújtva a lábát. a nyíláshoz hajolt. hány állat kelt ki. egyfajta suhogó zaj hallatszott. Aztán bekapcsolta a rádiót. – Általában görcsös rángásokkal jár. Mr. maga elé nyújtotta a két karját.

– Magához tér? – kérdezte Hammond. Hammond nem bólintott vissza. – Mindjárt visszajövök. s ezért hibákat követett el. Nem volt kellőképpen összeszedett. Aztán szélesebbre tárta az ablakot. Ide-oda vetette magát a párnán. Most is kisütött. Mondjon akárki. Miután Malcolm még egyszer összeszedte az erejét a legutóbbi kirohanáshoz. egy másik országban. amely északnak vezetett a látogatóközpont mentén. Végül is az alkalmazottjáról van szó.. kómába zuhant. még azt is . Azzal. Harding a legjobb esetben közömbös. és végignézett a parkon. hogy megoldjuk a problémákat. és az az örökös aggodalmaskodása. megszólalt: – Lehet abból valami baj. hogy felégeti. Ed Regis sem volt szerencsés választás. amikor már nem bírta tovább.. ha kimegy az ember? – Nem valószínű – mondta Harding. Akárhogy is. pályájának erre a pontjára már túlságosan elfáradt.. – Minden. mint főmérnökkel. Türelmetlen volt. – szólalt meg hirtelen Malcolm. hogy megcsodálhassák a mesekönyveikből életre kelt. Legközelebb jobban meg kell majd gondolnia. Hammond tovább járkált. Kilépett a kerítéskapun. Egészen rettenetes. mintha a barátjáról lett volna szó. Hammond a fejét rázta. Rosszabb volt így. Gondolataiba merülve elindult bungalója felé egy keskeny ösvényen. Az igazi fantázia! A jövőbe látás képessége. Muldoon pedig részeges alak. ennek a parknak igenis van jövője! Még ha az az ostoba. Wu tehet róla. hogy egyenletesebben folyjon az antibiotikumos infúzió. de ki tudja. parad. Azt is el kellett ismernie. hogy olyannyira nem kedvelte a matematikust. mikor ér ide. Hammondot pedig szorongással és rettegéssel töltötte el a gondolat. ha én kimegyek egy kicsit. így halad előre a világ. Nem. amely képes a szem előtt felidézni egy gyönyörűséges parkot.. Súlyos hibákat. hogy tényleg meghalhat. Közben azon gondolkodott. A képesség. s ezt Hammond előjelnek tekintette. hebehurgya Gennaro úgy dönt. igaz? – Rendben van – mondta Harding. hogy mindent végiggondolt. hogy Malcolm halála – amennyiben bekövetkeznék – egyfajta végső elutasítással lenne egyenértékű. sem Arnold nem volt alkalmas erre a feladatra. Természetesen már hívták a helikoptert.. hogy magyarázkodjon Harding előtt. Ami azt illeti.. hogy Malcolm addig meg is halhat. Semmi problémát nem okoz majd újból felnevelni őket valahol egy másik szigeten.VALÓSÁGOS PARADIGMA A kastélyban John Hammond fel-alá járkált Malcolm szobájában.. aki főhajtással üdvözölte.. romló emberi hús szaga. Harding. Az volt a véleménye. és aggódott. Egyébként ha a lelke mélyére néz. – Mit mondott? Valamit a paradicsomról? – Nem jól értettem – felelte Harding. s most már Hammond is kezdett attól tartani. hogy ez volt az oka a park végső bukásának. Késő délután volt. És fonák módon Hammond számára csak még szörnyűbbé tette a dolgot. sem Wu. Ilyenkor szokott elvékonyodni a szüntelen pára. arra a következtetésre jutott. Azonkívül folyton a javításokon járt az esze. rettenetes volt már a szag a szobában. – Azt hiszem. Aztán. hogy Arnolddal. Most. Harding a fejét rázta. amit akar. hogy akár soha nem látott erőforrásokat is mozgósítson az ember. hogy az InGen Palo Altó-i központjában két páncélteremben több tucat mélyhűtött embriót őriznek. hogy több legyen a levegő. de úgy látszik. hogy magyarázkodjon. mi késztette rá.. Hammond ugyanis tudta. szintén rossz vásárt csinált.. Hammond kilépett a napvilágra. Ahelyett hogy dinoszauruszokat állított volna elő.. Wuból és Arnoldból egyaránt hiányzott a legfontosabb: a látnoki képesség. kiket választ. Semmi szükség nem volt rá. – Jó. csakhogy megvalósítsa az álmot a jövőről.. hogy a Tican törzsbeli indián munkások mind pimaszak. ahol izgatott gyerekek nyomakodnak a kerítéshez. A rothadó. Arnold eddigi sikerei igen jól hatottak. hogy Wu nem igazán volt alkalmas a feladatra. ez a terület teljesen biztonságos. túl könnyen vett egy ekkora vállalkozást. A képzelőerő. Megigazította a vezetéket. Igen. a hatalom. lenyűgöző lényeket. és néha a nap is előbújik. Elhaladt az egyik munkás mellett. és ezt már elviselni is alig tudná. Hammond a lelke mélyén gyanította. javítani akart rajtuk. Hammond úgy érezte. Hanyag volt. – Akkor nem baj. az sem számít túl sokat.

Erre közeledett. visszhangja is van.. Gennaro ettől majd meggondolja magát. menti az irháját. – Odaát? – Azt hitte. váltás. és. – Te is megcsinálhatod – mondta neki Tim. nedves levelek és nyirkos föld csapódott az arcába. megint futott. aztán felkászálódott.. mondta Tim. – folytatta Malcolm. Iszonyatos volt. – mondta. mintha a kisebbik T. Amint lábra állt. mert azt hitte. – Hát persze – felelte a fivére. csak cserepes ajka mozgott. – Váltás? Malcolm nem válaszolt. Te.. s az őserdő hangjait hallgatta maga körül. – Az nekünk túl veszélyes lett volna –. Semmi baj! Bár nem képes megmászni a dombot. hogy visszatartja a lélegzetét.. és az orrába ment. egy másik világ szörnyű ordítása. hogy megtudja.. Addig is itt nincs veszélyben... és nem sikerült megőriznie az egyensúlyát. mi lesz. kifejezetten zenei felhangja volt a bömbölésének. aztán látta hogy az indián munkás fejvesztve menekül. – Nekünk itt kell maradnunk. Minden más. de csak az őserdei tücskök ciripelését hallotta. A domb lábánál fekve Hammond ismét hallotta a tyrannosaurus bömbölését. A vízmosás alján kell kivárnia. hogy teljes súlyával ránehezedjen. Harding közel hajolt hozzá. segítségért kiált. Sekély. olyan éles fájdalom hasított a jobb bokájába. és vaktában berohanjon a sűrűbe az ösvény túloldalán. elesett. hogy talpra álljon. legfeljebb száz méterre lehet saját bungalójától és a látogató központtól. Nem fog még egyszer ennyire nyilvánvaló hibákat elkövetni. és tehetetlenül gurult lefelé. Aztán felerősített gyerekhangot hallott. rex? Hogy került a kerítésen kívülre? Hammondot egy pillanatra elöntötte a düh. – Ez is jó! – szólt a kislány. Igen. mire felvételről tyrannosaurusüvöltés hangja visszhangzott a hangszórókból az egész parkban. Mindenkinek csak útban voltak. Óvatosan megérintette a bokáját: lehet. Uramisten! Borzongott a hang hallatán. – Engedj már. ezúttal azonban valami sajátos. A tyrannosaurus újra felüvöltött. s Hammond ezt a pillanatot használta ki arra. Szinte azonnal rázuhant a sötétség. – Hadd próbáljam ki! – kérte Lex. és elesett. állott vízbe csapódott az arca. arccal lefelé. és hosszú sóhaj hagyta el a száját. – Most még egyszer! Azok az istenverte gyerekek! Nem lett volna szabad idehoznia a gyerekeket! Csak baj volt velük az első perctől fogva. de hát ezt ki engedte meg? Érezte.. amikor felharsant. Várt. Erőlködve kényszerítette magát. Majdnem biztos. – Ha ezt itt megnyomod. de hát Gennarót most már úgysem lehet lebeszélni. rex árnyát látta volna elsuhanni a sűrűben. hogy elvesztette egyensúlyát.. közben a fogát csikorgatta. Bugyborékolt körülötte a víz. hogy eltört. Hammond olyan hirtelen pördült meg a sarkán.. Mit fog tenni a tyrannosaurus? Vajon elkapta azt a munkást? Hammond várt. hogy a könnye is kicsordult. rémisztően közelről szólt. hogy tovább tartson? – kérdezte a kislány. Mit keres itt a T. Majd ha a tyrannosaurus elment. megint elesett. mi következik most. továbbrohant. odaát. Malcolm a halálról beszél. Hammond voltaképpen azért hozta ide őket. – Bárcsak minket is elvittek volna a fészekhez! – szólt Lex Timhez a vezérlőben.. Sérült bokájával nem tud felmászni a dombra. A tyrannosaurus üvöltése. Hammond ült a nyirkos földön. Timmy! Én is ki akarom próbálni! Hadd szólaltassam meg most én! A gyerekek! Megint felordított a tyrannosaurus. Megnyomta a gombot. és játszani kezdtek ott. utána pedig egyfajta hosszan tartó visszhang következett. A gyerekek pedig nyilván bejutottak a vezérlőbe. – Úgyis lehet. ezt hallgasd meg! Megnyomott egy gombot. Elesett.. és valahogy nehezen lélegzik.. – Ez jobb. hogy eltört. – Csak tekerünk egyet ezen itt. – Klassz! – mondta Lex. mint az a másik. hogy egyre vadabbul ver a szíve. .be kell vallania. pörgött.. és nem semmisítteti meg a szigetet. Malcolm hangja nem volt több halk suttogásnál. aztán rajtakapta magát. – Amikor. Egy kis patakban feküdt. Aztán egy kis idő múlva segítségért kezdett kiabálni. Elvesztette a fejét! Milyen ostoba! A bungalójába kellett volna futnia! Hammond átkozta önmagát. Amikor pedig visszanézett. hogy ez az egész Costa Rica-i sziget nem volt valami bölcs választás. Nyugalmat erőltetett magára. míg végül a domb alján megpihent. csúszott estében a puha talajon. Most meredek domboldalon rohant lefelé. botladozott.

Vagy a kvantummechanika. Az ilyen változás viszonylag ritka. Tudta. A láza emelkedik. Hiába. – mondta végül. egy egész világszemléletet jelent. túl azon.. legfeljebb évszázadonként egyszer fordul elő. – Már nem számít. minden erőfeszítésük ellenére Malcolm sebesen siklik a végső delírium felé.. – Mert. még ha kisebbet is. többet. amikor a tudományos világszemlélet alapvető változáson ment keresztül. minden másképp van. – Túl a paradigmán? – kérdezte Harding. mint a modell. Vagy két évtizede jött divatba. A „paradigma” voltaképpen ugyanaz.... – Paradigmaváltás? – kérdezte Harding. mi a paradigmaváltás.. azóta így illik beszélni mindenféle tudományos változásról.. hogy mi.– Paradigma. Harding mélyet sóhajtott. – Mi az.. . – Nem – nyögte Malcolm.... A tudósok használatában azonban a kifejezés ennél tágabb értelmű.. odaát.. És elmosolyodott. s már alig maradt antibiotikumuk. paradigma.. Paradigmaváltást kényszerített ki például a darwini evolúció elmélete... csak más szóval. Akkor beszélnek paradigmaváltásról. többé. – Nem.. ami nem számít? – Semmi – felelte kínlódva Malcolm..

nőttönnőtt. hogy jobb lesz. – Bizonyára – mondta Muldoon. de ahogy közeledett hozzá. az üregre pillantott. – Szinte sohasem halálos. hogy az alagút most egy kicsit felfelé halad. Felemelte a rozsdamentes acélból készült terelőbotot. siklott a feketeség felé. Aztán pedig zuhant. úgyhogy levegőért kapkodott kínjában. igen. és gurult. de túlságosan is eluralkodott rajta a félelem ahhoz. A dzsip mellett ácsorgó Muldoonhoz fordult. – És mihamarább! Gennaro megint az üregre nézett. Hátrafelé az ismeretlenbe: a puszta gondolat bénító rettegéssel töltötte el.ALÁSZÁLLÁS – Maga őrült! – szólt Gennaro Ellie Sattlerhez. Gennaro verejtékben tört ki. amely egyre csak fokozódott. – Én ezt nem csinálom! – mondta. – Ezt nem meri megtenni! – Én csak annyit mondok. Általában kiüti az embert. hogy az ember sokkal kisebb. és a lábával kapálózott.. hogy megteszi. – Őrült. – Hall bennünket? – kérdezte.. . Aztán hirtelen ismét lefelé lejtett az alagút. és fejjel előre mászott be. A teste kiszabadult. Előrenyújtva a karját. és az üreg szélébe kapaszkodva hátrafelé tolta magát. – Nem olyan borzasztó – mondta szárazon Muldoon. A következő pillanatban pedig már robogott is előre. pontok ugráltak a szeme előtt. Ellie volt az.. aki rezzenéstelenül állt ott. – Miért suttognak? – kérdezte vissza Gennaro. A földfalak a sötétbe vesztek előtte.. – Mondom. a teste is elcsavarodott közben. Gennaro izzadt. Olyan hideg volt a levegő. – . s csak halványan észlelte. Így az utolsó pillanatban megfordult. Gennaro hátrafelé bemászott a lyukba. – Csak a Jóisten tudja.. Elindult a lyuk felé. így legalább annyit láthat. mint a kőszikla.. hogy így folytassa az útját. hogy hová megy. nagyon összeszűkültek. – Lélegzik. hogy képtelen vagyok rá! – Pedig mennie kell! Gennaro visszafordult. ijesztően. Távolról kicsinek látszott. De többnyire nincs maradandó hatása.. Aztán egy pillanat alatt eltűnt ő is. a feje szédült. – Kapott már áramütést ilyesmitől? – kérdezte. Elveszti az eszméletét. betont és hideg levegőt. betonon csúszott. ha lemegy megszámolni azokat az állatokat – szólt Muldoon. majd összeszűkültek. s a gyötrelem már-már elviselhetetlenné vált. Hangok a sötétben. Kinyújtott karjával előrenyúlt. a levegőt is kipréselte a tüdejéből. Ujjak érintették a testét.. – Nem megyek. amint karját előrenyújtva ő is bepréselte magát hátrafelé a nyílásba. – Dehogy nem – felelte az szenvtelenül. Gennaro a botra lesett. Kiszélesedett.oké? – Úgy látszik. – Remek! Női kéz simogatta meg az arcát.. Fekete nyílás. – Valószínűleg – mondta. A lány elmosolyodott. – Muszáj mennie. nincs baja. Gennaro pedig durva felszínt érzett. – Nem tudom megtenni! Képtelen vagyok rá! – Pedig várják odalenn – mondta Muldoon.. szinte beleveszett a szorítás fájdalmába. mintha a föld szája volna! Aztán megint Muldoonra pillantott. Arcára húzta a gázmaszkot. Legalábbis a dinóknál. Igaz persze. Nem kényszeríthet rá. – Nem. a hangok irányából nyúltak felé. mint valami barlangban. mi van odalenn – makacskodott Gennaro. megint visszafordult. – Ez az! – mondta Muldoon. A nyílás sötéten tátongott. Megindulnak a belei.

Egy helyen nedves volt. Gennaro megfordult. s a felnőtt állat orrára állt. vagy két és fél méterrel a padló fölött. Eltakarták őket a két. – És meddig kell itt maradnunk? – Csak addig. – Miért nem támadnak? Grant a fejét rázta. Aztán az egyik elindult feléjük. De lehet. Ebben a hatalmas. Meregette a szemét. igyekezett megnyugtatni. – Négy vagy hat felnőtt. egyik-másikhoz oda is kaptak. Az öntött beton varratait s a kiálló acélrudakat is látta. Az tiltakozásul csicsergett. morogva. lassan talpra állt. Ellie előtt állt meg. alig egy fél méterrel volt az állatok fejmagassága fölött. A felnőttek horkantgatni kezdtek. És e pillanatban tojások sincsenek itt. Keze elindult a bőr nyakörv felé. – Ne mozduljon! – szólt Grant. A terület nagyjából a fészkek szerint oszlott meg. A fiókát nem takarta semmi. elhallgattatni. Sötétzöldek voltak. és a lábához dörgölte a fejét. és előremutatott. rajta a fekete dobozzal. merev farkukra támaszkodva. – Uramisten! – szólt riadtan Gennaro. aztán leugrott. – Le. Gennaro nem mert lélegzetet venni. Betonpárkányon volt. A fióka nyüszített. Izzó. csak nagy. Idegesen kapkodták a fejüket le-föl. acélból készült transzformátordoboz nyújtott ideiglenes védelmet a számukra. bár a fiókák keveredtek. immár védelemben.– Azért – súgta Ellie. hogy a kicsi végigmásszon a fején. a bébi megfordult. levehetem róla? – kérdezte Ellie.. A többi fióka vagy kölyök. és gyengéden meglökdöste a kicsit. Időnként türelmetlenül felhorkantottak. zöld szemeket. Kiegyenesedve álltak. Az egyik kíváncsi bébi felmászott a párkányra. s Ellie keze továbbra is a nyakörvön nyugodott. – Nem láthatnak minket. a nagyobbakkal szigorúbban bántak... és időnként más területére is áttévedtek. egy acéldoboz mögött. A raptorok nyugtalannak látszottak. sötét szemükkel pásztáztak körbe figyelmesen. A fiókák úgy négy hónaposnak látszanak. Valószínűleg áprilisban keltek ki. A felnőtt felemelte a fejét. ha a játékuk elfajulni látszott. Legalább két fészekalja. Az lassan elindult. nyakuk fel-le mozgott. – Mit gondolsz. a hátára. Odalenn a nagy teremben az egyik felnőtt állat kíváncsian a hang forrása felé indult. egyfajta töltésen. s hagyta. Már csak három-négy méterre volt tőlük. Amennyire Grant meg tudta állapítani. melyek közvetlenül előttük álltak. . csak gyorsan csináld! – Jó. és harsányan rácsicsergett a betolakodókra. A botanikusnő lenézett. De szinte abban a pillanatban előrejött az egyik felnőtt. a másik idei. ahogy az egyre jobban hozzászokott a sötétséghez. Körös-körül. felemelte a fejét. alig másfél méternyire tőlük. teljes csendben. barnás tigriscsíkokkal. De először csak egyetlenegy dolgot látott: világító szemeket. Az egyik tavalyi. – Csak nyugi! A felnőtt állat körmei kopogtak a betonon. jó – mondta a lány. – Nyugodtak? – kérdezte Gennaro. Ettől nyugodtabbak. és az állatka mellé guggolt. Hátrébb a sötétben nagyobb kölykök hemperegtek és játszottak fel-felhorkantva. A felnőtt állatok lábánál fiókák nyüzsögtek és csiripeltek. és megpillantotta a bőr nyakörvet. a kicsi mellett guggolva. aki úgy maradt. Több nagy. elővigyázatosan. a fészkek száma három volt. és recsegő zajjal felszakította a tépőzárat. és visszatértek a főcsoporthoz. Látta. Egy nyelv nyúlt ki. Két raptor! Ahogy a párkányon térdelt. Gennaro szeme most már megszokta a sötétséget. Több tucatnyi szemet.. amelyet azonban emberkéz készített. amíg megszámoljuk őket – felelte Grant. A felnőttek felkapták a fejüket. és sivítozva közeledett feléjük. Ebben a pillanatban egy raptor fióka Ellie-hez jött. A felnőttek azonban láthatóan most sem vették észre őket. hogy valamiféle hatalmas föld alatti építmény belsejében vannak. Nagy feje egészen közel volt Ellie kezéhez. kinyújtott. – A szentségit! – morogta a foga között Gennaro. de a doboztól nem látta a lányt. Azonkívül fel is dörzsölte a kis állat nyakát. ahogy elhaladt mellettük. visszhangzó térben sok állat volt: Gennaro legalább harmincra becsülte a raptorok számát. hogy forduljon vissza. Ott. Aztán elmentek onnan. hogy még annál is több! – Egész kolónia – súgta Grant. és beleszagolt a levegőbe. – Nem értem – suttogta Gennaro. A felnőttek a kicsikkel gyengéden. és három szülőpár gondozta őket. óvatosan. Ellie megveregette a fiókát. teljesen kifejlett velociraptor szeme elől. Az megint nyüszített. majd le a nyakán.

A csat fémje kongott. A felnőtt állat feje egy kicsit feljebb rándult. – mondta elgondolkodva. Grant gondolkodott. Alan. Az állatok ott szaladgáltak szanaszét a terem tátongó mélyében. lekapcsolt egyet az övéről. – Fajspecifikus viselkedésről. Agyagból és szalmából készült. Újra előreindult. Ellie folytatta a találgatást. hogy azonosíthassák egymást. mintha csak láthatatlan vonalak volnának a padlóra festve. De a szünetekben. – Elképzelésem sincs. – Én figyeltem őket – mondta Ellie. hogy a kolóniának van valami metastruktúrája? Mint a méneknek? – Nem. és az elektromos botért nyúlt. lapos kosárra emlékeztetett. – Harmincnégy született – felelte Grant. Gennaro lassan fújta ki a levegőt. de az agyagban látható bemélyedéseket számba kellett vennie. hol kifutottak a fényre. amelynek célja.. Grant letette a gránátot. hogy kilenc tojást tartalmazott. – De azt hiszem. Tizennégy tojás maradványait sikerült összeszámolnia. Ellie gyengéden lecsúsztatta az állatka nyakáról a bőrszíjat. – Én semmit sem érzek. de úgy látszott.. Grant eltöprengett. A felnőtt még Ellie mellett maradt. – Tán a bíróságon veszi hasznát? – kérdezte tőle egy kicsit gúnyosan Grant. – És csak a bébik teszik ezt? – Nem. – Elég sötét van. – A feleségemtől kaptam egyszer a születésnapomra. A lányon nem volt gázálarc. hogy egy tojás eltört. – Az iránytűt nézte. A jelek szerint a raptorok röviddel a tojásrakás előtt építették meg a fészküket. mi lehet ez – szólt Grant. hogyan.. vagy pihentek. Gondolod. – Valami kifinomultabb dolognak tűnik. darabjaik szanaszét szóródtak a földön. majd kíváncsian félrebillentette. Én harminchármat számoltam össze. ha fotóznánk is. De az is lehet. hogy milyen égtáj felé sorakoznak fel. Azt hiszem úgy nagyjából északkelet-délnyugat felé fordulnak. – . Úgy látszott. milyen irányban helyezkedik el a testük. hogy megvizsgálja a zaj okát. vagy valahogy úgy. akkor hol erre.. nézd meg. ám Gennaro visszatartóan fogta meg a karját. Grant összeráncolta a homlokát. Valamiféle sajátos rend vagy minta alapján állnak fel. Nézd csak meg magad is! Figyeld a kicsiket! Amikor játszanak. aztán végül megfordult. – Nem egyértelmű. Olyan tendenciaféle. A harmadikban tizenöt volt a tojások száma. ám a szünetekben. és arra fordulnak. így azok maradandó nyomot hagytak az agyagban. hiszen azok már régen széttörtek. de a fiókák mindegyikének más-más jelek vannak a pofáján. hogy szabályosan felsorakoznak. hol vissza a sötétbe. furcsán. – De hát akkor mi ez? Valamiféle társadalomszerveződés. De. jegyzetfüzetére irányítva a lámpáját. A felnőttek is. Szinte mintha felsorakoznának. – És kölyköt? – Huszonkettőt. s fejével Ellie felé intett. és megnézte az első fészket. most már munkához láthatunk. – Tán hallanak valamit. – Mindig tudtam...Grant gázgránátért nyúlt. amely térbeli felállásban fejeződik ki? – Az nem lehet. Grant annak is látta jelét. Ellie. Grant azonban úgy becsülte meg. A felnőtt állat még mindig igen közel volt Ellie-hez. amikor csak állnak.. Az állatok a legkülönfélébb módokon viselkedtek. hol arra bukdácsolnak. vagy a szemben lévő felé. hogy nincs semmiféle tágabb jelentése. hogy ez egyszer még jól jöhet! Az óra számlapja alatt iránytű volt.. A második fészek félbetört. Tudniillik mind ugyanazt csinálják. s már élesítette volna.. és visszasétált a fészek központjához. Vagy a felé a fal felé néznek ott. – Hogy miféle térbeli rendszer szerint helyezkednek el. te semmi különöset nem vettél észre rajtuk? – Mire gondolsz? – suttogta Grant. amikor vagy csak figyeltek. Grant az éjszakai néző zölden foszforeszkáló fényében lekukucskált a párkányról a szobába. ahogy a padlóra esett. – Talán valami légáramlat. – Vagy egyszerűen valami rituális viselkedésmódról van szó – folytatta Ellie. meg szaladgálnak. – Holtbiztosak persze csak akkor lehetnénk. Gennaro felkattintotta az órája tetejét. – Nem. Ekkor azonban a kicsi boldogan sivítozva elszaladt. Mindannyian. hogy jobban hallják. – Nem tudom. – Dehogy – rázta a fejét Gennaro. – És hányat lát? Grant erre csak a fejét rázta. adott irányokba fordultak. hogy három már igen hamar széttört. Tizenháromra becsülte az állatok számát. Figyeld őket! Mondom. Természetesen magukat a tojáshéjakat nem számolhatta meg. nem egészen – felelte a botanikusnő. Ellie-nek igaza van. Alan.. – Mennyi van összesen? – kérdezte Gennaro. a formája széles. – Jézusom! Mehetünk végre? – Nem – felelte Grant.

lehet. végig a betonalagúton. tág teremben. Aztán hatalmas kiáltások és huhogások közepette. Lehet. majd megszólalt: – De miért nem mennek ki? – Éjszakai állatok. – Csak furák. hogy a dinoszauruszok is valahogy így tesznek. A méhek képesek a térbeli kommunikációra egyfajta tánc révén. hogy a dinoszauruszok egyszerűen csak furák. de mintha csak bujkálnának. A következő pillanatban a kicsik egyszer csak izgatott ugrabugrálásba és visítozásba kezdtek. – Igen. és futásnak eredt. a távoli sötétségbe. Vagy egyfajta kommunikációról van szó. A felnőttek egy kis ideig szinte kíváncsian nézték őket. Gennaro nézte őket. Grant éppen ugyanerre gondolt. amelyek csak úgy visszhangoztak az üres. . Grant vállat vont.Felsóhajtott. Ki tudja. az összes dinoszaurusz egyszerre megfordult.

gondosan célzott. csicseregtek. Lihegett. Az elmúlt óra során többször is mintha lépéseket hallott volna föntről. és ezúttal úgy hajította el. és újra elindult fölfelé a dombon. de azt be kellett ismernie önmaga előtt. Felkapott egy követ. A maga részéről őszintén bízott benne. kígyó – gondolta. Visszanézett a patakmederre. Alig haladt két métert. Cincogó.. hogy végezzen a sérült. amely arra szolgál. olyan a hatása. Az egyik ápolót egyszer megharapta egy ketrecbe zárt kompi. nagyon fáradt. és elindult felfelé a dombon. nem hallották meg. de legfeljebb a dombtetőre vezető út harmadát tette meg. hiszen kis híján látja is a bungalóját –. A hangja azonban valahogyan nem jutott el odáig. Nincs más választása. De hát hogy is ne lenne fáradt? – gondolta. Vadul csapkodni kezdett a kezével. hogy a száz esztendőt is megéri. és minden egyes alkalommal segítségért kiáltott. Szomjas is volt. le is lökte az állatot.. és odadobott egy követ. mint a csirkék. de közben elvesztette az egyensúlyát. olyasféle idegesen rángatózó mozgással. hogy pontosan mellbe talált egy kompit. elesett. Arra kényszerült. és leszánkázott a . Aztán látta. hogy kitisztuljon az agya. Semmi fájdalom. és megpróbálta visszanyerni a lélegzetét. sajgott a kimerültségtől. De tudta: meg kell másznia a dombot.. Új parkokat kell építeni. hogy már nem igazán akaródzik felállnia és folytatnia az útját. akár nem. rájött. „Úristen. hogy nem bánthatja őket. Néha fel-le ugráltak. Hammond dühösen leszakított egy faágat. Van itt mindenfajta kis állat: patkány. – Sicc! Tűnjetek el! – kiáltott rájuk Hammond. Azok a rohadt kölykök! Hammond megrázta a fejét. lehúzták a fejüket. fel kell másznia a dombra. ahogy telt-múlt a délután. mint valami narkotikumé: nyugtató. – Hőség és pára!” Mintha szivacson keresztül kellene lélegeznie. hogy fél lábon ugráljon felfelé. Elvégre hetvenhat éves. Az állatka rémülten felvisított. kezdte felfogni. És most ezen igyekezett. de csak egy fél métert vagy egy kicsivel többet. És bőven van is miért élnie. és feléjük csapott. Így aztán. hogy ott hagyta a csörgedező vizet. hogy nincs veszélyben.. Csak aludni vágyik tőle az ember. hogy ez nem bölcs dolog.. a levelek után kaptak. Valami kis madárféle ugrándozott a fűben. amikor az egyik kompi a hátára ugrott. Valamivel több mint másfél méterre maradt tőle. hogy a menekülés egyetlen útja felfelé vezet. majd csicsergést. micsoda hőség! – gondolta. Annak ellenére.. s gurult egyet a farkán. Azt persze tökéletesen tudta. és rámeredt. Így már jobb! Hammond megfordult. hogy Hammond a korához képest kitűnő kondícióban volt. karmos kezüket mozgatták. hogy az ember tudjon magára vigyázni. sivító hangot hallott. amely már vagy tizenkét méterrel alatta volt. A többi állat azonnal hátrálni kezdett.HAMMOND John Hammond lezökkent a domboldal nyirkos földjére. – Úristen. játszani akar velük. csak nézte őt. És miért ne? Az egész csak azon múlik. hogy fáradt. A kompik hátráltak. mozgásképtelen állatokkal. Már több mint egy órája mászott felfelé. ameddig csak lehet. noha tudta. Hammond azonban tudta. mint egy csirke. Újra eszébe jutott a méreg. – vonta össze a szemöldökét. Körülbelül akkorák lehettek. Nem féltek tőle. és úgy is jöttek lefelé a dombon. hogy mérgesek. Az ördögbe a méreggel! – gondolta Hammond. Akár sérült a lába. Nemsokára több is követte. Az egyik kompi felemelkedett a domboldalon. s néha megfordult vele a világ. és kis. Ebben a korban már nem szokás hegyet mászni. Sérült állatok. A lába lüktetett. Teljesen képtelen volt már ránehezedni. hogy mindig meg tudja oldani a felmerülő problémákat. hogy egy kis sötétzöld állat ugrándozik lefelé a dombon őfelé. majd még egy. s a másik lába most már égett. még ivott belőle. oposszum. és még egy. de azonnal belehasított a combjába a fájdalom. Nehezen tudta megőrizni az egyensúlyát. Különösen sérült lábbal. Mintha azt hinnék. Mintha csak tisztában lettek volna vele. mint egy kivénhedt kutya.. Harapásuk lassan ható mérget tartalmaz.. És fáradt volt. Mindkét kezében egy-egy faággal ugrált a bal lábán. sötétlila volt a bokája. Valami jön. hátraesett. Hullarablók. A kompik nem látszottak veszélyesnek. A visítás hangosodott. Mintha órák teltek volna el azóta. Új csodákat alkotnia. Most szédelgett. álmosító. Felsorakoztak. kartávolságon kívül. A feje kóválygott. Mielőtt elindult a pataktól. és el kell érnie az ösvényt odafönn. és vidáman sivalkodtak. A kompik elugrottak. Az ápoló azt mondta. Dagadt. Nem mozdult. Kompik – gondolta – és megborzongott. Figyeltek. s kis földdarabkák gurultak el mellette lefelé. Ahogy ott ült a domboldalon.

Hammond iszonyattal látta. előreugrott egy másik kompi. Hammond egészen nyugodtan feküdt. oly mozdulatlanul. s a bokájába harapott. és félrebillentett fejjel lesték őt. Felemelte a fejét. és csodás nyugalom töltötte el. Hammond csak apró fájdalmat érzett. amikor újabb kompi ugrott a mellkasára. mint az izgatott madarak. s Hammond rövid ideig tartó fájdalmat érzett. . Nemsokára már ott csiripeltek körülötte. mint csecsemő a bölcsőjében. hogy vér folyik az ujjai közt. és kínlódva újra felfelé igyekezett a domboldalon. Érezte a vér melegét. De megértette. fel-le ugrabugráltak. le a gerince mentén. Megállt. Amikor újabb kompi jött. már-már törékeny volt. csak tessék-lássék rúgott felé. Az állatkák lassan közeledtek. Azok körülvették. egészen aprót. ahogy a hátán feküdt a domboldalon. Újabb kompi ugrott a hátára. Mintha kívülről látta volna önmagát. Nem történt hiba. ahogy lefelé folyt a nyakán lévő harapásból a vállán át. Különös nyugalom szállt rá. hogy nincs semmi baj. és egy picit belekapott a kezébe. amint az állat a tarkójába harapott. és erősen zihálva szembefordult a kompikkal. Megfordult. és leverte az állatot a nyakáról. Az állat meglepően könnyű. Malcolm teljesen tévesen elemezte a helyzetet. amint a kompi rágcsálni kezdte a torkát. Üvöltött. Alighogy megállt.domboldalon.

Végül pedig az összes állat a partra özönlött. hogy most a felnőttek uralják a helyzetet. Mindenfelé fiatal velociraptorkölykök ugráltak. szemben a Csendes-óceánnal. Álltak. amelyek tökéletesen rejtélyesek maradtak kései emlősutódaik előtt. Mivel azonban a paleontológusoknak csak csontok álltak a rendelkezésükre. amint a teherhajó elhalad előttük. Aztán az állatok – egyik a másik után – egyszerre visszavonultak a mangrovemocsár-széli pálmafák árnyékába. igen jellegzetes csíkkal a fején. mélyebben az erdőben ott zümmögött az elektromos kerítés. s ez a csíkos fejű állat a kolónia „alfa-nősténye”. Sőt. Délre volt tőlük. Adnak egy-két támpontot a csontokat megtámadó betegségekre vonatkozóan is. – Északkelet-délnyugat! Ugyanúgy. és lassan északnak tartott. De Grantnak az is feltűnt. Nagyjából tízméterenként helyezkedett el egy-egy felnőtt. A paleontológusok olyan régóta csak ásták és ásták a csontokat kifelé. Mereven bámultak dél felé. – Én sem – szólt Grant –. Agyában újra lepörgette az egész eseménysort. – Szóval ezért jöttek elő! – kiáltott fel halkan Gennaro. és némán figyelték. aztán hirtelen szinte kirobbant egy hatalmas nyíláson. hogy a dinoszauruszok esetleg teljesen másfajta állatok lehettek. követte a beton kanyarulatait és lejtőit. – Nem volt valami fényes a napsütés a parton. hogy a felnőtt állatok közt sem teljes az egyenlőség. s az óceánt halvány köd takarta. és rugdalták a homokot körülötte. nyilvánvaló volt. A fészkeket rejtő barlangban ugyanez a nőstény volt középen. – Hát ezt nem értem – mondta Gennaro. és megnézte. Kollégáihoz hasonlóan Grant is igen nagy szakértelemre tett szert a csontokat illetően. Először a kicsik jöttek izgalomba. és nézték az óceánt. benn. rugalmasan szerveződtek. mint az előbb. A hímek – látta – őrzőállást vettek fel a csoport szélein. s ezáltal kikövetkeztethető egy-két dolog az állat hajdani viselkedéséről. A hátuk mögött. Aztán meg ott volt az a különös északkelet-délnyugati irányultságuk. a dinoszauruszok valamilyen merev. Volt köztük egy nőstény. ott ismét felsorakoztak a maguk sajátos módján. Grant számára megdöbbentő volt az állatok viselkedésének összehangoltsága. Más szempontból viszont egy cseppet sem volt meglepve. szinte mint valami katonai alakulat. Ahogyan Grant elnézte őket. Grant bólintott. Nagy teherhajó volt. s egyszer csak a parton találta magát. merrefelé állnak az állatok. a raptorok is egyfajta matriarchális rangsor szerint szerveződnek. A csontok elárulnak valamit abból. amelyek lazán. Ekkor dízelmotorok zakatolása hallatszott a víz felől. hát azokat használták fel. az helyezkedett el a parton sorakozó egész csoport legközepén. Csakhogy a majmokkal ellentétben. hogyan tapadtak az izmok. csoportos mozgásuk. Nyoma sem volt már annak az összevisszaságnak. hogy a napot nem szeretik. könnyű pára lebegett a levegőben. A nagyobb kölykök köztük sorakoztak. amely a barlangban kezdődött. aztán a ködön át egy hajót pillantottak meg. De talán nem is olyan nagy rejtély az egész. hogy nézhetett ki az állat nagyjából. hogy akár bizonyos majomhordák. Aztán a felnőttek a partra vezették a csapatot. már-már katonás rendben álltak fel. teljesen szabályosan. A valóságban azonban a csontváz nagyon is kevés forrás ahhoz. Ezzel Grant egyszerűen nem is tudott mit kezdeni. Az állatok álltak. hogy már régen elfelejtették. . – Legalább azt megtudtuk. gondolta. hogy életük olyan viselkedési és társadalmi rendbeli minták alapján is szerveződhetett. Teljesen tiszta volt a térbeli elhelyezkedésük most.. De miért hagyták ott a fészket oly hirtelen? Mi hozta ki az egész kolóniát a partra? Gennaro felpattintotta órája számlapját.A PART Grant rohant a dinoszauruszok után. hogy az élesebb hallású fiatal állatok figyeltek fel először a hajóra. Mondanak valamit arról is. Grant úgy sejtette. csak azt látom. szigorú rend szerint helyezkedtek el. A csendet csak itt-ott törte meg egy-egy halk csiripelés vagy sivítás. Aztán észrevették ezt a felnőttek is. milyen kevés információ nyerhető egy csontvázból. – Nyilván hallották. Mivel a dinoszauruszok a legalapvetőbb szempontból madarak voltak. amelyet odabenn észleltek. Meghaladta az értelmét.. mekkora lehetett a súlya és a magassága. mindegyikük körül egy csomó fióka. valamivel a nagyok előtt. hogy letelepedtek a part mentén. – Te jóságos ég! – mondta hangosan Grant. hogy az ember következtetéseket vonjon le belőle az állat egész viselkedésével kapcsolatosan. hogy jutnak át a kerítésen – mondta Ellie. hogy közeledik. És valahol menet közben ő is egyre inkább megfeledkezett a bizonyíthatatlan lehetőségekről – arról. Ez az eseménysor arra engedett következtetni.

melyek némán lesték a hajót. És ekkor hirtelen megértette. – Nem? Hát mit akarnak? – Vándorolni – felelte Grant. – Nem! – vágta rá határozottan Grant. – Egyáltalán nem akarnak megszabadulni. – Hát ezek az állatok aztán ugyancsak szeretnének megszabadulni innen – mondta a fejét ingatva Gennaro. .Tágra nyílt szemmel bámulta a katonás rendben felsorakozott raptorokat. mit is lát.

hogy Muldoon és a gyerekek már a fedélzeten vannak. hová szeretnének menni? – Fogalmam sincs – felelte Grant. Mintha soha nem is léteztek volna. A parton álló dinoszauruszokra gondolt. Egy pillanat múlva az épület helyén ragyogó. amint a helikopter felemelkedett a partról. Felnézett a helikopterre. és újra kinézett az ajtón. és megkérdezte: – Kérem. és még egy utolsó pillanatra láthatta a gazellakecsességgel felszökő hypsilophodontákat. vajon hová vándorolnának. és mennyire kimerültek. követte a hullámok vonalát. és egyszerre érzett szomorúságot és megkönnyebbültséget emiatt. és neki is feltette ugyanazt a kérdést. mint a madaraknál! – szólt Ellie. elesett. Az egyik katona angolul szólt hozzájuk: – Kérem. A raptorok rémülten szanaszét szaladtak. Grant Muldoonhoz hajolt: – Mi van a többiekkel?! – kiabálta. hogy ezt már sohasem fogják megtudni. ő tűrte. Feléjük rohantak. mennyire kis gyerekek még. mielőtt újabb tűzgolyó robbant alattuk. A tiszt továbbment Gennaróhoz. Lex ásítozott. és igyekezett visszatartani. hogy egy utolsó pillantást vessen a raptorokra. A dombon találtunk rá. s Grant kihajolt. Grant túl fáradt volt hozzá. nehogy odanézzen. Ellie megkérdezte: – Mégis. Valahol a hátuk mögött robbanás hangzott. Muldoon odahajolt. aztán befelé fordult. Grant gyorsan pergő spanyol szavakat hallott. aki most látta csak igazán. és segítettek becsatolni a biztonsági öveket. ön a vezető itt? – Nem – mondta Grant. narancssárga tűzgolyó robbant fel. kérem? – Nem tudom. – Ki a felelős vezető itt. Egy tiszt jött oda Granthoz. a hasukon felcsillant fegyverzetük. aztán rádöbbent. s a bátyja vállának dőlt. A helikopterük emelkedett. – De jól van? – kérdezte Grant. Oldalra dőlve húztak a táj fölött. mit gondolsz. Úgy látszik.KÖZELGŐ SÖTÉTSÉG – Migráció! Vándorlás. Lex sírva fakadt. jönni velünk! Kérem! Itt nincs idő már! Grant visszanézett a partra. – Hát ez egészen fantasztikus! – Az ám! – mondta Grant. Az ajtó nyitva maradt. – Nincs. hogy leszálljon a parton. ha tehetnék. és elordította magát. és szinte az arcába hajolt. és olajzöld egyenruhába öltözött katonák ugráltak ki belőle. Újra előrejött a tiszt. A tiszt Ellie-re pillantott. a gép azonban a pálmafák fölött repült. amely véres pofával kuporgott egy hadrosaurus fölött a lagúnánál. Kitárult az ajtaja. amely éppen a látogatóközpont fölött úszó ködöt törte át fordulás közben. de már nem voltak ott. . – No és Malcolm? Muldoon csak a fejét rázta. de a halványuló fényben még éppen sikerült kivennie a kis rexet. oda. majd keletnek fordult. Tim és Lex integettek Grantnak. és arra. alul. Ellie-t és Gennarót. ha még látja őket. Elfordult. Grant hátradőlt az ülésen. miközben az egyik helikopter kört írt le. Minden állat eltűnt. hogy bármit is érezzen. Muldoon visszakiabált: – Hardingot meg egy-két munkást már elszállítottak. Szélesen mosolygott. ahol az előbb a raptorok sorakoztak. Hammondot baleset érte. Ellie átölelte a vállát. Grant lefelé meresztette a szemét. de tőle nem kérdezett semmit. és a fülébe kiabált: – Azonnal el akarnak vinni bennünket! Most rögtön csinálják! A katonák az ülésekbe nyomták Grantot. – Ön a vezető? – Nem – felelte Gennaro is. Észak felé tartott a sziget fölött. amint az elrepült fölötte. señor. Már sötétedett. s látta. aztán egy másik helikoptert pillantottak meg maguk előtt. – Én nem vagyok vezető. és bemászott a nagy ajtón át. és abban a pillanatban mennydörögve áttörtek a ködön a hatalmas helikopterek. hogy a pufogó forgószárnyak alá vezessék. Végeztek vele a kompik. A katonák már ráncigálták. a bungalója közelében. ki az óceán fölé.

Grant még egyszer. A helikopter felgyorsulva repült a szárazföld felé. mígnem az egész sziget izzott: ragyogó fényfoltnak látszott. A katonák az ajtónak feszültek. – Kérem. ahogy távolodtak tőle. Sűrű ködbe burkolódzott. nagyon kérem. amely mögött elmosódtak a robbanások fehéren izzó fényei. señor. Hideg lett. ki az? – Senki – mondta Grant. Míg erőlködtek. s látta a bíborszínű ég és a tenger hátterére rajzolódó szigetet.– Ön a vezető? – Nem – felelte Grant. és lassan nagy nehezen behúzták. amely egyre kisebbedett. Gyors egymásutánban követték egymást. utoljára visszanézett. .

De valami különös dolog folyik a vidéki területeken. mert félnek. hogy azt hiszik. Mégis. miért ment a szigetre. Guitierrez vállat vont. hogy egy csomó ember halt meg egy Costa Rica területéhez tartozó szigeten. Guitierrez bólintott. John Hammond félrevezette őket a szigettel kapcsolatban. – Maga volt. méghozzá igen különös módon. – Én nem tudom. Idén tavasszal az ismaloyai körzetben. Maga tán igen? – Nem – mondta Grant. – Persze – felelte Grant. bár elképzelni sem tudta. Tény. – A kormány aggódik. Azt feltételezem. hogyan kapta azt a faxot New Yorkból. Ha expedíciót küldenének az ismaloyai hegyekbe. De az országot nem hagyhatták el. Tudja. Újra meg újra el kellett mondania az egész történetet: hogyan ismerte meg Grant John Hammondot. és egy kitűnő San José-i szállodában helyezték el őket. Lehet. ismeretlen állatok ették a termést. – Mint valamiféle vándorlás – tette hozzá Guitierrez. mit tudott Grant a tervről. Grant jó ideig arra gondolt. – Marty Guitierrez a nevem. hogy elsiesse a túlélők szabadon bocsátását. – A hatóságok erről nem szólnak magának – szólalt meg végül Guitierrez –. Úgy gondolják. Szabadon jöhettek-mehettek. az is különös. Még több gond. igaz? – Úgy van. hála Istennek. És néha csirkét is. – Nem gondolja? – Milyen növényeket ettek? – kérdezte Grant. egyenes vonalban – szinte nyílegyenesen a partról fel a hegyekbe. ami történt. – Csupa lizinben gazdag táplálék! És mi lett ezekkel az állatokkal? – Feltehető – mondta Guitierrez –. és talán neheztelnek is magára azért. Leült Grant mellé. Mindennap meglátogatta őket egy fiatalember az amerikai követségről.EPILÓGUS: SAN JOSÉ Teltek-múltak a napok. – Csavaros eszű egy ember volt ez a Mr. hogy érintetlen genetikai anyagot találnak? – Igen. intelligens hivatalnok faggatja ugyanarról. Csak agamababot meg szóját. Ugyanazok a részletek. – Már csak néhány napig áshatok. hogy több állat is van. Végül egy napon éppen a szálloda úszómedencéje mellett ült. amely északon van. nap nap után. Grant kapcsolt. be az őserdőbe. Persze nehéz is volna a dzsungelben keresgélni utánuk. Guitierrez hátradőlt a nyugágyon. mindig elölről. mert. Montanában már augusztusban leesik az első hó. Mi történt a szigeten. mielőtt beáll a tél. mintha várnának valamire. Costa Rica kormánya úgy vélte. – Megint csecsemőket harapdálnak? – Nem.. Csak vártak.. Mindenesetre nem találják őket. Ugyanaz a mese. – Bizonyára nagyon vágyik már haza. Kutatóként dolgozom itt a cararai állomáson. – Ezért finanszírozott kizárólag északi ásatásokat a Hammond-alapítvány? Mert hideg éghajlaton valószínűbb volt. aki az első procompsognathus-példányt találta. hogy ki akarnak szedni belőle valamit. Tény volt azonban. – Minket pedig azért tartanak itt. – Még nem találkoztunk – mondta az amerikai. mit. – Gondolja. naponta újabb és újabb állami hivatalba viszik. Grant úgy érezte. hazudik. az abbamaradt! De van valami más. hogy Washington mindent elkövet annak érdekében. Ebben a helyzetben a kormány nem mutatott különösebb hajlandóságot arra. hogy éppen csak sikerült elkerülni egy súlyos ökológiai katasztrófát. igen – mondta Guitierrez. és biztosította őket. a vízben játszadozó Timet és Lexet nézte. hogy bevették magukat az őserdőbe. Napról-napra haladtak. amikor egy amerikai férfi lépett hozzá khakiszínű sortban és ingben. hogy Hammondot vagy Ian Malcolmot eltemessék. hogy mielőbb hazautazhassanak. A kormányhivatalnokok udvariasak voltak. – Én sem. valami különös módon úgy tűnt. – Nos. Hammond! Grant nem szólt semmit. Még abba sem egyeztek bele. ahol mindig egy másik fiatal. nincs-e szükségük valamire. – De gyanítja? . hogy több állat is van? – kérdezte Grant. jobb. mintha belecsíptek volna. s azt hívhattak fel telefonon. akit csak akartak. ha elővigyázatosak. megkérdezte. az éveket is eltölthetne ott hiába. Grant úgy ült fel.

és elindult a szálloda kijárata felé. – Érezze jól magát közöttünk. – Azt akarja mondani. – Lehetséges. hogy miért ne tennék. Grant doktor – mondta mosolyogva Guitierrez. – Egyetértek. – A gyerekeket nyilván hazaküldik – mondta. hogy nem mehetek innen sehová? – kérdezte Grant. – Feltette a napszemüvegét. Aztán sarkon fordult. Grant doktor úr! Szép ország ez itt. – Nem látom okát. . Odaintett a medencében játszó Timnek és Lexnek. Guitierrez felnyomta magát a nyugágyból. és felállt. Valószínű. hogy igen.Grant bólintott. – Egyikünk sem megy innen sehová.

a paleo-DNS-sel. főként Robert Bakkeréből. Mark Hallett. melyek új felfogást tükröznek arról. hogyan viselkedtek a dinoszauruszok. Ők alkotják a Berkeley Egyetem kihalt DNS-sel foglalkozó kutatócsoportját. Mindazonáltal ez a könyv merő kitalálás. Bizonyos. John Ostroméból és Gregory Pauléból. George O. s az itt kifejezésre juttatott nézetek mind az enyémek. Douglas Henderson és William Stout rekonstrukcióinak. Margaret Colbert. . Bőven vettem hasznát az új illusztrátornemzedék rajzainak. köztük Kenneth Carpenter. A káoszelméletről folytatott eszmefuttatások részben Ivar Ekeland és James Gleick magyarázataiból származnak. John Gurche. itt megjelenő gondolatoknak Charles Pellegrino adott először formát. Poinar és Roberta Hess kutatásai alapján. a kihalt állatok genetikai anyagával kapcsolatos. amely a szövegben előfordulhat.KÖSZÖNETNYILVÁNÍTÁS E könyv elkészítésekor sok kiváló paleontológus munkásságából merítettem. A grafikák egy részét Bob Gross számítógépes programjai ihlették. Stephen és Sylvia Czerkas. Ian Malcolm alakjához a megboldogult Heinz Pagels és munkája adta a modellt. John Horneréből. akárcsak minden ténybeli hiba.

Sign up to vote on this title
UsefulNot useful