You are on page 1of 240

MICHAEL CRICHTON

ŐSLÉNYPARK

MÆCENAS

A fordítás az alábbi kiadás alapján készült: Jurassic Park. A Novel by Michael Crichton Alfred A. Knopf, New York, 1990 © 1990 by Michael Crichton

Fordította BORIS JÁNOS A fedélen HELÉNYI TIBOR festménye Fedéltipográfia: GÁLÓCSI ÁGNES

ISBN 963 7425 91 8 Maecenas Könyvkiadó, Budapest Felelős kiadó: a Maecenas Kiadó igazgatója Szerkesztette: B. Háry Lenke Tipográfia és műszaki szerkesztés: Szakálos Mihály

Hungarian edition © by Maecenas Könyvkiadó, 1993 Hungarian translation © by Boris János, 1992

A. M.-nek és T.-nek

A hüllők visszataszítóak, mert testük hideg, színük halvány, a bőrük mocskos, csontvázuk porcos, hangjuk kellemetlen, lakóhelyük undorító, mérgük pedig iszonyú; mindezen okokból Alkotójuk nem vesztegette rá erejét, hogy túl sokat teremtsen belőlük. LINNÉ, 1797 Új életformákat nem lehet „felidézni”. ERWIN CHARGAFF, 1972

BEVEZETÉS
„Az InGen-ügy” A huszadik század vége felé hihetetlen méretű tudományos aranyláz kezdődött: eszeveszett versenyfutás indult a génsebészet kommercializálásáért. Ez az iparág oly gyorsan fejlődik – és oly kevés szó esik róla „civil” körökben –, hogy jószerivel senki sem tudja, mi folyik itt, micsoda méretekben, és milyen következményekkel kell számolnunk. A biotechnológia az emberiség történelmének eddigi legnagyobb forradalmával kecsegtet. Az évtized végére le fogja körözni az atomenergiát és a számítástechnikát, annyival nagyobb hatása lesz hétköznapi életünkre. Egy szakember így véli: „a biotechnológia az emberi élet minden oldalát át fogja formálni: orvosi ellátásunkat, étkezésünket, egészségünket, szórakozásainkat, magát a testünket. Semmi sem lesz többé olyan, mint volt. A szó legszorosabb értelmében más lesz az egész bolygó arca.” A biotechnológiai forradalom azonban három fontos szempontból különbözik a múlt tudományos átalakulásaitól. Először is igen széles körben folyik. Amerikát egyetlen tudományos intézmény, Los Alamos munkája vezette be az atomkorba. A számítógépkorszakba már egy tucat cég erőfeszítései révén jutott el. Biotechnológiai kutatásokkal viszont csak Amerikában több mint kétezer laboratórium foglalkozik. Ötszáz cég költ évi ötmilliárd dollárt ennek a technológiának a kimunkálására. Másodszor: e kutatások jó része felelőtlen, sőt egyenesen frivol. Halványabb színű pisztrángokat akarnak létrehozni, hogy jobban látszódjanak a vízben, szögletes fatörzseket, amelyeket könnyebb feldolgozni, vagy éppen injekcióba beadható parfümöt, hogy mindig kedvenc illatunkat árasszuk. Lehet, hogy ez mulatságosnak tűnik, de sajnos a legkevésbé sem az. Sőt, az új technológiával kapcsolatos aggodalmakat éppen hogy fokozza az a tény, hogy olyan iparágakban is alkalmazhatják, amelyek ki vannak téve a divat legszélsőségesebb változásainak. Harmadszor: ez a munka ellenőrizetlen. Senki sem felügyel rá. Nem vonatkoznak rá országos törvények. Nem foglalkoznak vele az állami politika szintjén. Nem is könnyű egyértelmű politikai álláspontot kialakítani vele kapcsolatban, mivel a biotechnológia termékeinek skálája a gyógyszerektől a mezőgazdaságon át a mesterséges hóig mindent magában foglal. Ami azonban a legijesztőbb: maguk a tudósok sem hoztak eddig létre semmiféle független ellenőrző csoportot. Feltűnő, hogy szinte minden kutató, aki géntechnikával foglalkozik, egyidejűleg a kereskedelmi célú biotechnológiában is érdekelt. Mindenki benne van a buliban. A molekuláris biológia elüzletiesedése erkölcsi szempontból a tudománytörténet eddigi legmegdöbbentőbb fordulata, ráadásul elképesztő gyorsasággal ment végbe. Négyszáz évig, Galilei óta, a tudomány mindig egyet jelentett a természet titkainak nyílt, szabad vizsgálatával. A tudósok soha nem vettek tudomást az országhatárokról. Úgy érezték, felette állnak a politika kérészéletű szempontjainak, sőt még a háborúknak is. Újra meg újra fellázadtak a kutatás bármiféle titkossága ellen, s még találmányaik szabadalmaztatása sem volt az ínyükre, mivel úgy vélték, munkájuknak az egész emberiség javát kell szolgálnia. És így is volt évszázadokon át: a tudósok felfedezéseiben volt valami sajátos önzetlenség. Amikor 1953-ban Angliában két fiatal kutató, James Watson és Francis Crick megfejtette a DNS-molekula szerkezetét, munkájukat úgy ünnepelték, mint az emberi szellem diadalát, azét az évszázados vágyét, hogy tudományos magyarázat szülessék a világegyetem egyik legnagyobb kérdésére. Mindenki meg volt győződve róla, hogy ezt a felfedezést is önzetlenül az emberiség javára fogják fordítani. De nem így történt. Harminc év sem telt bele, és Watson és Crick szinte minden tudós kollégája egy egészen másfajta törekvés részese lett. A molekuláris genetika kutatása hatalmas, multimilliárd dolláros üzleti vállalkozássá vált, amelynek eredete nem 1953-ra, hanem 1976-ra nyúlik vissza, egészen pontosan 1976 áprilisára. Ekkor került sor arra a ma már híresnek mondható találkozásra, amikor Robert Swanson, a nagyvállalkozó ajánlatot tett Herbert Boyernek, a kaliforniai egyetem biokémikusának. Megegyeztek, hogy kereskedelmi céget alapítanak a Boyer által kidolgozott génsebészeti technika kiaknázására. Új cégük, a Genentech szinte pillanatok alatt a géntechnikai vállalkozások legnagyobbika és a legsikeresebbje lett. Egyszerre csak úgy tűnt, mindenki meg akar gazdagodni. Szinte hetente jelentették be újabb és újabb cégek alapítását, s a kutatók seregestül jelentkeztek az új genetikai eljárások kiaknázására. 1986-ra már legalább 362 tudós – közülük 64 a Nemzeti Akadémia tagja – ült a biotechnológiai cégek elnökségeiben. Ennél is jóval többen voltak tőkéstársi vagy tanácsadói pozíciókban. Nem lehet eléggé hangsúlyozni ennek a magatartásváltozásnak a jelentőségét. A múltban a „tiszta” tudósok arisztokratikus módon lenézték az üzletet. A pénzhajhászást olyasvalaminek tekintették, amely szellemileg érdektelen, csak boltosoknak való. Ipari kutatásokat folytatni – még ha a nagy tekintélyű Bell cégről vagy az IBM-

mindig akadtak kívülálló tudósok. Az alapkutatók magatartása tehát kritikus volt az alkalmazott tudomány művelőivel szemben és az iparral szemben általában. ismeretlen maradt a közvélemény előtt. De most már titokban végzik. a Cowan. hogy beszéljenek róla. Nehogy bármiféle dokumentum fölöslegesen a nyilvánosság elé kerüljön. Az „InGen-ügynek” azonban számos olyan résztvevője is van. maga az eset KözépAmerika legfélreesőbb vidékén történt.laboratóriumokról is volt szó – azoknak való. hogy a legmagasabb szinten tárgyalják meg a problémát. A Costa Rica-i alkonzul meglehetősen szokatlan petíciójának meghallgatására zárt ajtók mögött került sor. olyan megállapodást írtak alá. Az sem meglepő. amikor a Genetic Technologies csődeljárást kért maga ellen a San Franciscó-i csődtörvényszéknél. hogy az a genetikai krízis. amelynek ne volnának kereskedelmi kapcsolatai. az InGen jogi tanácsadója képviselte. húsznál is kevesebb tanúja volt. s az InGen problémáit csendben. Ebben az elüzletiesedett légkörben alighanem elkerülhetetlen volt az olyan telhetetlen cégek létrejötte. mivel a hitelezők japán konzorciumok voltak. Nincs mit csodálkoznunk tehát. Ez a régi ellentét távol tartotta az egyetemi kutatókat attól. Ennek azonban vége. hogy egy hónap sem kellett hozzá. köztük a nagy tekintélyű tanácsadói testület. akik lemaradtak az egyetemi állásokról. Hol vannak már a régi. s ha bármiféle technológiai vita adódott. amelyet okozott. Ők nem zárkóznak el az elől. Costa Rica nyugati partjainál. Ma alig van molekuláris biológus vagy kutatóintézet. vita nélkül lezárták. az ügy alig keltette fel a sajtó figyelmét. Inc. és közülük is csak maroknyian maradtak életben. . a japán érdekeket is Daniel Ross. így a kör zárva maradt. A megállapodás résztvevői. aki nem tartozik az aláírók közé. mint a Palo Alto-i International Genetic Technologies. Az InGen kutatásait végül is titokban végezték. Még a végén is. mely szerint semmit sem hoznak nyilvánosságra. miféle különös események zajlottak le 1989 augusztusának utolsó napjaiban azon a távoli szigeten. a Hamaguri és a Densaka. amely csődöt jelentett. A bírósági iratok közül csak keveset hoztak nyilvánosságra. hogy „bepiszkolja” őket az ipar. Swain and Ross ügyvédi iroda társtulajdonosa. 1986 óta pedig a hetedik. sietve és a haszonért. boldog idők! A genetikai kutatás egyre vadabb tempóban folytatódik tovább. és senki sem nyilatkozik a történtekről. ők pedig hagyományosan kerülik a nyilvánosságot. Hiszen annyira hétköznapinak látszott: Az InGen abban az évben a harmadik kisebb biotechnológiai vállalkozás volt.

ŐSLÉNYPARK .

hogy a pilóta megkönnyebbülten fújja ki a visszatartott levegőt. Carter vagyok – mondta a lány. amely semmivel sem volt alábbvaló a chicagóinál. Leírt egy kört. majd megint vissza a parthoz. úgy figyelt. Manuel pedig gyengéden az ajtó felé kormányozta Bobbie-t. nem is szólva a ködbe burkolt óceánról. . Immár három hete volt Bahía Anascóban. és szinte feltépték a nagy. Figyeljen! Aztán ő is meghallotta. Orvost kerestek. ahol egymást érik az úszómedencék és a teniszpályák. míg egy fehér ember pattogó hangon parancsokat osztogatott. amely már több mint két éve folyt. izgatott spanyol nyelvű kiáltozás hallatszott. és kinézett az ablakon. Az utóbbi fehér esőkabátot viselt. Ahogy óvatosan felemelte vér áztatta ingét. rajta felirat: InGen Építészeti Vállalat. jól képzett szakember volt. amikor elvállalta. Manuel Aragón eszes. Bobbie látta. a rendelő bejárata felé. amely közeledett és erősödött. Lázas. miről lehet szó: a sok-sok tipikus. Egyenruhás férfiak ugrottak ki belőle. A sérült szinte gyerek volt még. A Costa Rica-i egészségügyi szervezet a világ húsz legjobbikának egyike. és tócsákba gyűlt a földön. – Dr. szanaszét fröcskölt. megállíthatatlan eső! A rendelő túlfelén Manuel egyszerre csak félrefordította a fejét. és most már a fejük fölött dübörgött. Egyébként minden a legnagyobb rendben lett volna. Óriási cseppekben zuhogott az eső. Sok-sok napsütést remélt. amint hintázva visszalendül a víz fölé a halászcsónakok közelében. aztán óvatosan oldalt siklik az ütött-kopott fadokk felé. Costa Rica nyugati partján. Lehetetlen – gondolta Bobbie. hogy a helikopter még ilyen időben is felszállt? Az orvosnő a szélvédőn át látta. Kalapácsütések verték a rendelő hullámbádog tetejét. valami mély berregés. csak úgy püfölte a fejét és a karját. Alig látott el a rendelőtől a tengerpartig. – Akkor talán jobb volna San Joséba vinniük – mondta Bobbie. – Ed Regis. doktornő. fémvége rozsdás a nyirkos levegőtől. – Vinnénk is. ebben a Bahía Anasco nevű halászfaluban. hogy két hónapig itt orvoskodjon vendégként. Helyet keres a leszálláshoz. A helybeliek közül sokan dolgoztak az építkezésen. Bobbie olyan színvonalon gyakorolhatta orvosi tudását. Két fekete bőrű férfi ernyedt testet hozott felé. De ez az eső! Ez a szüntelen. a főváros légiúton alig húszpercnyire volt innen. egy másik pedig a lábán. oldalsó ajtót. – Elesett. – Mit történt vele? – Üzemi baleset! – kiáltotta a zajban Ed. Átment rajta az exkavátor. – Hallom. Bobbie a sebesült mellett futott. a víz bőgve zúdult alá a fémcsatornákon. Bobbie-n térdben levágott farmer és atlétatrikó volt. – Nem azt. – Itt az orvos? – kérdezte az odasiető Bobbie-tól. és egy kis kikapcsolódást. Így hívták a céget. Elhiheti – mondta Bobbie. Új hang keveredett az eső zajába. – Ilyen időben képtelenség felszállni! De a zaj csak erősödött. Vajon mi lehet olyan sürgős azon a szigeten. Nagy hasú Sikorsky-típus volt. csak ebben az időben nem tudjuk átrepülni a hegyeket. amely új üdülőtelepet épített a part menti szigetek egyikén. Sztetoszkóp lógott a nyakában. Bobbie-nak tetszett Bahía Anasco elzártsága és barátságos népe. vörös haja kikandikált a „Mets” feliratú baseballsapka alól. San José. A fiú sápadt volt. Bobbie pontosan el tudta képzelni. Rázta a hideg. Mondták. a készülő üdülőhely valami egészen különösen nagyszabású és bonyolult. Felcserasszisztense. mély. A vörös hajú férfi kissé meglepetten nézett rá. miután két kemény évet lehúzott a chicagói Michael Reese Kórház baleseti osztályán. anélkül hogy bármiféle zavaró kapcsolatba kelljen kerülniük a helyi valósággal. legfeljebb ha tizennyolc éves. majd visszatért. amint a helikopter lassan letelepszik a nedves parti homokon. hatalmas amerikai üdülőkomplexus egyikéről. aztán az alacsonyan szálló helikopter áttörte az óceáni ködöt. hosszú hasított seb tűnt elő a vállán. Magának kell segítenie. Nem erre számított.PROLÓGUS A raptor harapása Sűrű függönyökben dőlt a trópusi eső. – Hallgassa csak! – mondta. kék csíkkal az oldalán. Csuromvíz volt minden. Azóta minden áldott nap esett. Súlyos betegünk van. hogy a vendégek nyugodtan játszhassanak és iszogathassák a koktéljukat. és eszméletlen. míg világossá nem vált. Roberta Carter nagyot sóhajtott. bőségesen ellátott rendelő működött. mi az: egy helikopter forgószárnyának ütemes pufogása. s még ebben az isten háta mögötti faluban is jól felszerelt.

– Ed beszéd közben az ajkát nyalogatta. hogy mechanikus balesettel van dolga. Másfelől viszont a test legnagyobb részén nem volt semmiféle sebhely. Ha földmunkagép ment volna rajta keresztül. nem spanyolul van. és fölé hajolt. hogy jobb legyen a megvilágítás. Kis automata Olympus gépéért nyúlt. Bobbie pedig a fiúra irányította a lámpát. Rossz a szag! – És keresztet vetett. de a nyelve alig forgott. Lo sa raptor. A kéz! Végigfutott a hideg a hátán. Két marcangolásos betege volt. Egy sor felvételt készített a sebről. Manuel a fejét rázta. – Összemarcangolták? – kérdezte Ed. ami pedig állati támadás esetén ritka. csak valami sikamlós. Bobbie Carter visszafordult a sebekhez. A fejet. mint egy építésvezető. Nyugtalan. nekem elhiheti. akit egy kutya harapdált össze. Valahogyan nem tudta elhinni. Mint a legtöbb traumatológus. hogy feltépték a fiú lábát. Majdnem biztos. magával vonszolta az exkavátor.. És láthatóan olyan helyzetben van. – Nem? – Az ő fülének pedig spanyolul hangzott. Bobbie újra végigvizsgálta. – Nem tudom. és hívogatva integetett. kilátszottak a sápadtfehér csontok. Ez valóban állati harapásnak. kérem.Manuel a rendelő élénkzöld ajtajánál állt. akinek ellentéte támadt egy bengáli tigrissel. Az orvosnőnek újra feltűnt. De földnek nyoma sem volt. igyekvő fajtának látszott. Ezzel szemben a fiú bőrét darabokra szaggatták. de valami nincs rendben! Manuel habozott. A fiú szája megmozdult. doktornő. Bobbie-nak az volt az első benyomása. hogyan történt a baleset! – mondta. Egészen más volt a kép. – Mennyi ideje történt? – Egy órája. mire félretette a fényképezőgépet. a kezet. Ekkor azonban a fiú felnyögött. Szörnyű. És egyáltalán nem úgy nézett ki. ragacsos habra nézett. Sok volt a hasonlóság a sérülések között. A seb szélein szinte összemorzsolódott a hús. – Ismételje el. Ha képzetlen helyi munkások dolgoznak az üdülőhelyi építkezésen. hogy a fiú állapota semmi jóval sem kecsegtet. E szavakra Manuel megdermedt. mint aki valami rosszat tett. – Várjon odakint! – Miért? – kérdezte riadtan Ed. A másik egy részeg cirkuszi őr. – Ez mint jelent? – kérdezte tőle Bobbie. Inkább.. a kart. megdörzsölte két ujja között. hasított karmolások mindkét tenyéren. Rövid. mi folyik itt. . még egy karcolás sem. hogy látszott alatta a combi ütőér lüktetése. – Akkor kérem. Mélyebbre hajolt. és becsukta az ajtót az orra előtt. mint valami tisztviselő. feltépték végig a vállán és ugyanúgy a combján. Rögtön látta. Manuel már készítette is az infúziót. mély. a seb mélye is csupa sár lenne. Semmi talaj fertőzés a sebterületen. – Tovább mossam? – Igen – mondta Bobbie. valami rothadó szag. – Azt mondják. Nem tetszett neki a dolog. annyira. mint akit összemarcangoltak – mondta Bobbie Carter. Bobbie épp elég ideig dolgozott Chicagóban ahhoz. Van valami jellegzetesség az állatok támadása okozta sebeknek. Az egyik egy kétéves gyerek. – De előbb adjon neki blokádot. ragacsos habszerűségnek. semmi zúzódásos elem. Bobbie még életében nem érzett ilyen szagot. Ideges volt. mint a gyári baleseteknek – szinte mindig lényeges összetevője a zúzódás vagy törés. amelyekkel évekkel ezelőtt találkozott. Manuel megszólalt: – Átmosdassam? – Igen – mondta Bobbie. – Lo sa raptor. milyen ideges Ed Regis. A férfiak bevitték a testet. – Én nem láttam – felelte Ed. – Ugyan. és ujja hegyével óvatosan megérintette a sebet. A mechanikus traumáknak – az autós sérüléseknek éppúgy. majd hátrálni kezdett. – Raptor – mondta. hogy meg fog halni. hogy tudja. jól emlékezett még azokra az esetekre is. hogy megvizsgálja sebeit. dehogy! Az exkavátor volt. Közepén a váll elmozdult a helyéről. mit jelent ez. – Na jó – mondta. „Vajon miért?” – kérdezte magától Bobbie. Nem tudta. úgy viselkedett. vágások a csuklókon és az alkarokon. tépett árok futott lefelé a vállától a mellkasáig. miközben a seb mélységét vizsgálta. Harapások! Minden arra mutat. gondolta. Megérintette. És a sebnek különös szaga volt. – Segíteni akar rajta vagy nem? – kérdezte a lány. mosdassa őt tovább! – Nem doktornő. a halál és a bomlás bűze. mindennaposak lehetnek a kisebbnagyobb balesetek. amire nem volt felkészülve. Kitolta a férfit a szobából. és lehajolt. A második hasadt seb átvágta a comb sűrű izomzatát. – Tudniillik úgy néz ki. marcangolásnak látszott. és letették a vizsgálószoba közepén álló asztalra. ahogy a tekintete a fiú kezére esett. még a lámpát is úgy irányította. Itt ennek nyoma sem volt. aki mindig mindennek igyekszik eleget tenni. Bobbie ismét a sebet borító sikamlós.

Manuel rémülten felordított. A Costa Rica-iak nem voltak különösebben babonás fajta. – Ez a szag. hogy maga mindent megtett. az ég szerelmére. hogy mindez reménytelen. hogy a fiú összeszorított fogai közé nyomja. és a kezével próbált védekezni a támadó ellen. legalább a képek megvannak. Meg is találta a szótárban. Éjszakai kísértetekről volt szó. és a szájára szorította a kezét. – Aztán már csak nézték Manuellel.. motyogott. Biztos. A hiedelem szerint a hupiák valaha Costa Rica hegyei közt éltek. Bobbie benyitott a rendelőbe. hogy a fényképezőgép eltűnt. Bobbie elkomorult. amelyet a fiú használt. amit csak lehetett. Nincs már esély rá. a helybeli bábaasszony volt mellette. hogy spanyolul van... Ismeri ezt a szót? . Ed nyitott be. Mindkettő csupa karmolás és horzsolás volt. A sebesült fiú ajkai ismét megmozdultak. s ő Manuel tiltakozása ellenére is gyanította. ahogy a mentők viszik a testet. arctalan vámpírokról. mint a nyál. – Hol az a sziget. Keze fejével a száját törölgette. Manuel egyre csak hátrált. – Maga ezt nem értheti. A sebesült nyöszörgött. Manuel. tágra nyílt szemmel bámult jobbrabalra. de a hupiáról már hallott a faluban. és maga a megtestesült józanság. a teste csak úgy vibrált. és kivitték a holttestet. – Remélem.. az éjszakában. Bobbie utánakapott. a fejét forgatta. azok sem valami kísértettől származtak. A babonában persze nem hitt.. Úgy százötven-kétszáz kilométerre a parttól. és visszarántotta. hanem valamiféle támadásnak esett áldozatul. Bobbie lenézett a padlón heverő testre. Az egyik falubéli asszony a szülés első stádiumában volt. határozott. A fiú a rángástól a betonpadlóra zuhant. „Raptor” – ez volt a szó. beteszik. majd vért hányt. vissza a helikopterhez. de egy ideje átköltöztek a szigetekre. az pedig mennydörögve a levegőbe emelkedik. hogy ez a fiú nem üzemi balesetnek. Manuel behívta a betegszállítókat. Manuel a helikoptert nézte. hogy hupia. És azok a sebek a fiú kezén. Bobbie maga előtt látta a fiú két kezét. – Jobb így – szólt Manuel. de aztán a vér láttán hátat fordított. „Nos. Ott. A szónak ez az értelme gyanúsan közel állt a hupia jelentéséhez. Vajon mit akarhatott mondani neki? A szomszéd szobából nyöszörgés hallatszott. amikor a sebesült fiú kinyitotta a szemét. – Ez a hupia! Bobbie éppen vissza akarta parancsolni a dolgára.. – Nem! – A férfi elszántan farkasszemet nézett vele. – Raptor – suttogta. és hirtelen meredten felült. – Üdülőhelynek nem éppen közel – mondta Bobbie. – A nyílt tengeren. hogy jöjjön ki egy pillanatra. ahonnan ezek jöttek? – kérdezte. Újra hányni kezdett. – Mi az a raptor? – Azt jelenti. „Erőszakkal elragadó”-t vagy „emberrabló”-t jelentett. amelyek elrabolják a kisbabákat. védekezésre utaló alakzatban. és hányta magára a kereszteket. mi az a raptor? Elena ősz volt. Azon az éjszakán végre elállt az eső. hogy szájon át való lélegeztetéssel próbálja éleszteni. Bobbie megdöbbent. Amikor azonban visszafordult az asztal felé. hogy szinte kirobbant belőle. A fiú teste utoljára még rándult egyet. és valami ilyesmit motyogott: – Tudom. A rendelő mögötti hálószobájának magányában Bobbie agyonhasznált spanyol zsebszótárát lapozgatta. Elena Morales. de úgy. hogy a fiút felélessze. soha többé nem jönnek vissza. látta. Mindent elöntött a vér. hatvan év körüli. és nem mozdult többé. Ed tűnt fel újra. Az orvos fölé hajolt. ez nem természetes – mondta.. doktornő? – Maga tudja. Bobbie felkapott egy fadarabot. de már későn. aztán elernyedt. – Raptor? – Igen. Azonnal rángógörcs fogta el. – Sí. – Átszáll magába a hupia! – Ugyan. és látta: úgy sincs semmi értelme.. de közben már látta. – Elena. a csillagok alatt elkomorodva kérdezte vissza. – Nem szabad! – mondta. de Manuel vadul a vállába markolt.” – gondolta az orvosnő. – Mi az ördög.? – kezdte. akik visszajöttek a rendelőbe.Majdnem. és intett Elenának. Manuel elborzadva mondta: – Megharapta! – Mi harapta meg? – A raptor.

olyan természetes volt. hogy a raptor spanyol szó volna.. Szinte elszégyellte magát. Fejével a rendelőben nyöszörgő. Még egy óra talán. Nem csinál az semmi olyat. aki újszülötteket rabol. ahogy a hullámok ki-kicsaptak a partra. – Ezt a szót ki ne ejtse. raptus) ragadozó madár. Visszament a szobájába. és elviszi a gyerekeket. Legfeljebb kettő. doktornő! – Miért ne? – Ne emlegesse most a hupiát! – mondta Elena határozottan. doktornő. raptor. és mindenáron be akarta fejezni.– Sí – bólintott Elena. Látta a parttól távolabb horgonyzó halászcsónakok árnyékát a sötétben. – Nem. A raptor ember. Merő kíváncsiságból fellapozta kis angol értelmező szótárát. .. amiért vámpírokról. és legnagyobb meglepetésére ott is megtalálta: raptor fn. – Nem okos dolog ilyenkor kimondani ezt a szót. fr. meg gyermekrabló kísértetekről kérdezősködött. szülő asszony felé intett. kirabló. ha itt az ideje. – Hívni fogom doktornő. aki éjjel jön. Bobbie felnézett a csillagokra. Újra eszébe jutott. és hallgatta a tenger békés morajlását. – Gyermekrabló? – Igen. Minden olyan nyugodalmas. – Egy hupia? Elenának még a tartása is megváltozott. mennyire tiltakozott Manuel az ellen. szóval azt. – Azt jelenti. – És a raptor? Össze szokta harapdálni meg karmolni az áldozatát? – Harapdálni és karmolni? – kérdezte csodálkozva Elena. – Láthatóan idegesítette az egész beszélgetés. (lat. El is indult a rendelő felé.

IAN MALCOLM . amelyből az alapvető matematikai szerkezetre következtethetnénk.ELSŐ ISMÉTLŐDÉS A fraktális görbe legkorábbi rajzain alig látható olyan nyom.

. Mint minden más. Az ötlet voltaképpen a feleségétől származott. ahol csak mi vagyunk – mondta Mike. megnézte magát a tükörben. nem tévedsz. hogy jó úton járunk? Órák óta nem láttunk egy teremtett lelket sem. A harminchat esztendős dallasi ingatlanfejlesztési vállalkozó két hétre üdülni jött Costa Ricába feleségével és kislányával. hogy micsoda gyönyörű természetvédelmi parkok vannak Costa Ricában. apu? – Az holtbiztos.és pókmajom. Három kilométernyi tökéletesen néptelen homokfélhold terült el előttük. – Igen. apu! Az út lefelé haladt. – Csodálatos. Valóságos paradicsom. és Tina felsikoltott. azt mondtad. és mennyi ott a fényűző magánklinika. és már vette is a ceruzát. Ellen heteken át telebeszélte a fejét. és sarat csapott fel. Ellen fürdőruhába bújt. és Mike Bowman a vezetésre összpontosított. A Land Rover zöttyent egyet. amint keresztülhajtott egy gödrön. Mike Bowman eddig életében nem hallott arról. amikor elérték a partot. Az óriási veszekedés persze nem maradt el. Costa Rica nyugati partján. mint a többi. és szép asszony. – Nem hinném. hogy selyemmajom volt – mondta. és megnyomkodta a szeme alját. Elfelejtetted? Tudod. – Biztos vagy benne. – Ebből a majomfajtából már nem egyet láttak útjuk közben. – Alig tizenöt perce találkoztunk egy másik kocsival. Mike Bowman kezdte úgy érezni. És úgy tűnt. fogunk látni háromujjú lajhárt. Csakhogy Ellen hajlott a kishitűségre meg az aggodalmaskodásra. A kislány nyolcéves volt. a felesége hazudott és becsapta. azzal a kékkel. hogy szépsége múlandó.VALÓSÁGOS PARADICSOM Mike Bowman vígan fütyörészve vezette a Land Rovert a Cabo Blanco-i biológiai rezervátum kanyargós útjain. csak bőgőmajom.. a háromujjú lajhár és a fehér orrú ormányosmedve. – Beszámíthatom? – kérdezte Tina. olyan strandot akarsz. – Amelyik az ellenkező irányba ment. – Tényleg? – Nézz csak a tükörbe! – Mindjárt hülyére röhögöm magam. – Egy percig némán vezetett. ha Tina láthatná az ottani csodákat. milyen olcsó egy plasztikai műtét Costa Ricában. az őserdőn át a tenger felé. Cabo Blanco maga volt a romlatlan természet. Nagyot sóhajtott. hogy ott a helyük. – Hát nem is tudom – mondta Mike bizonytalanul. rögtön kiderült. Ahogy elnézte. köztük a bőgő. Iskolai feladatul kapta. Amikor aztán megérkeztek. nem? Nézzétek ezt a kilátást! Gyönyörű! – Nem rossz – mondta Tina. – Majom? – Tán egy selyemmajom. s a látvány lenyűgöző: a sziklaszirteket körülölelő útról az őserdőre és a kék Csendes-óceánra nyílt a kilátás. hogy nem tévedsz – mondta hátul Christina. A partot szegélyező fák árnyékában állította le a Land Rovert. – Drágám. én is remélem. – Te Mike! – szólalt meg Ellen a mellette lévő ülésen. közben aggódva így szólt: – Esküszöm. – Bízzatok bennem! Én nem tévedek. Mike Bowman csatát nyert hősnek érezte magát. apu. ami igaz is volt. – Nézzétek! Nézzétek! – De az árnyék addigra el is tűnt az őserdőben. – Mi volt az? – kérdezte Ellen. Ezért aztán keményen megmakacsolta magát. hogy vezessen listát az utazás során látott állatokról. – Remélem. hát nem ő volt az Évfolyam Szépe végzős korában az egyetemen?! És ennek még tíz éve sincs. hogy a családi nyaralás ismét sínen van. Ellen púderesdobozt vett elő. és elővette az ennivalót.” Mit gondolsz. Plasztikai műtétről márpedig szó sem lesz! Marhaság az egész! Ellen csak harmincéves. hogy Ellent előre megbeszélt időpontra várja egy San José-i plasztikai sebész. Kezdett lejtősödni az út. és milyen jó volna. hogyan szabadulok meg ettől a súlyfeleslegtől! . mostanában leginkább amiatt aggódik. – Azt hiszem. elképzelésem sincs. Hirtelen kis fekete árnyék suhant át az úton. Gyönyörű júliusi reggel volt. Tina az útikönyvben lévő képeket vizsgálgatta. – Azt mondja a könyv: „Cabo Blanco partvidékét gyakorta látogatják a legkülönbözőbb állatfajok. Mike úgy érezte. – És én olyanra is viszlek! Ellen kétkedve ingatta a fejét. A fenébe is. aztán eltette a kompaktot. – Figyeljetek csak! – vidult fel a kislány.

Ott akart maradni. de már megtanulta: jobb. szívem! – mondta a férfi határozottan. nincs nála ennivaló. Azon a homokon legalább negyvenöt fok van. Ahogy így állt. Kedves játszópajtás lehetne belőle. Mint valami nagy szalamandra. Újabb állat. Észrevette. félrebillentette a fejét. édes! – A valóságban Mike inkább túl soványnak látta az asszonyát. – Szívem. adjon neki ennivalót. Az óceán meleg volt. amelyek libegtek a levegőben. – Csak ennyi. mint egy csirke. Felemelte a kezét. és meglepetten tapasztalta. Tina ült egy kicsit. és csiripelt. aztán visszanézett szülei felé. Tina futott. Alig volt nagyobb. de azért nem volt benne biztos.– Istenien nézel ki. Anyja most már kiáltozva hívta. Nem akart visszamenni. újra hallotta a susogást. milyen messzire került tőlük. A gyík megállt. amint hanyatt-homlok rohant a parton lefelé. mint a madarak. míg végül előtűnt a zajok forrása. – Biztos. Tina viszont megelégelte a napot. hogyan fogyhatna le. Apró mellső lábai piciny gyíkujjacskákban végződtek. – Ne hagyd itt a napellenzőt! – szólt utána Ellen. a partot. hogy lássa. hogy mennyi a madárnyom a homokban. hogy ennyire közel merészkedik. hogy nem bántják. vagy harminc centi lehetett. és elhatározta. és ha lehet. Lehet. ahol van. Néhány méternyire tőle egy gyík bújt elő a mangrovegyökerek közül. ha legalább látnám! – mondta Ellen Bowman a naptól hunyorogva. míg csak ki nem merült. Tina lassan és óvatosan előrenyújtotta nyitott tenyerét. hogy megmutassa. – Ide figyelj. Legalább látnám! . mintha nem értené. barna csíkokkal a hátán. Elindult felé. – Nézte a kislányát. és a feje is úgy ingott menet közben. Tina érezte. hogy nincs nála semmi. Hüllők. A homokot borító háromujjú madárlábnyomok némelyike kicsi volt és olyan halvány. Alaposan szemügyre vette a fákat. hogy az állatka nehéz. mint egy ártalmatlan Muppetshow-figura. hogy nem érheti baj? – kérdezte. mint a csirkéé. – Na és a kígyók? – Isten az égben! – mondta Mike Bowman. – Nincs nálam semmi! Ebben a pillanatban a gyík minden előzetes figyelmeztetés nélkül a tenyerére ugrott. hívta vissza. Alighanem valami tengeri madár lehet. hogy azt várja. – Hadd menjen! Hadd érezze jól magát! Átkarolta a felesége derekát. és ő is meglibegtette az ujjait. mint a gyík. alig hullámzott. hogy a gyík háromujjú lábnyomokat hagy maga után. vastag farkával egyensúlyozott. – A kígyók hideg vérűek. Tina ücsörgött a homokban. Aranyos volt. kilihegte magát. Feltűnt neki. hogy alig látszott. – Ne haragudj! – mondta Tina. hogy visszahúzódik a víztől a pálmafák árnyékába. Anyja integetett. lajhárt látni. percek alatt megfőne. mint az Egyesült Államokban és Kanadában együttvéve. Csodálkozott rajta. amint a pici lábujjak belekapaszkodnak a tenyerébe. – Majd később! – kiabált vissza a kislány. Tina tétlenül nézegette a lábnyomokat. Csicsereghet-e egy lajhár? Vagy cincog? Tina ezt nemigen hitte. Tina két nappal ezelőtt már látott lajhárt a San José-i állatkertben.. Ha előbújna egy kígyó. gondolta Tina. Mások viszont nagyok és mélyen a homokba nyomódtak. – Megyek lajhárt keresni. és boldogan hengergőzött a víz széle felé. és Tinára pislogott. ahogy a kislányra nézett. a súlya lefelé húzta a karját. Bánta is. hogy milyen lassú. aztán a homokra dobta magát. nem lehet. és rugdosta a mangroveleveleket. felegyenesedett a hátsó lábára. itt több kilométerre nincs egy lélek sem. amilyen még nincs a listán! A gyík hátsó lábaira állt. – Azért nem bánnám. ha erről nem szól. Nem akart napellenzőt felvenni. És akkor a gyík felkúszott a karján. Az állat nem félt. az arca felé. amikor egyszerre csiripelő vagy cincogó hang ütötte meg a fülét. Ezen a partszakaszon a pálmafák alatt göcsörtös mangrove-gyökerek kusza szövevénye zárta el a szárazföld belseje felé vezető utat. nem akarta az anyját hallgatni arról. hogy végtére is ez természetvédelmi terület. – A tengerparton nincsenek kígyók! – Miért. Csendben. Közelebb jött Tinához. ha hazavihetné. moccanás nélkül várt. Itt biztosan minden állat tudja. Különben is arról híres. Tina vidáman visszaintegetett. Tinának nagyon tetszett. hogy. nehogy elijessze az állatot. majd megzörrent a mangrovesűrű. A kislány a lélegzetét is visszafojtotta. sötétzöld volt a színe. Fejét egy kissé félrebillentette. Ellen Bowman körülnézett. Tina már szaladt is a partra. A gyík is nyilván szelíd. Az útikönyv szerint Costa Ricában háromszor annyi a madár. pontosan olyanokat. Tina biztosan gyorsabban futna nála. s már csak egy kis sötét folt a fehér homokon. Nem képesek ellenőrizni a testhőmérsékletüket.. és rábámult. de aztán eszébe jutott. A kislány igyekezett nem mozdulni. Úgy nézett ki.

– Azt hiszem. mint a parton. Miért hinném? – Annyira magunkban vagyunk itt – mondta Ellen. hogy semmi baja – szólt Mike. hogy másutt volna. ha látnám Tinát – mondta Ellen. Bánatos grillcsirkét talált benne.– Biztos. meg valami hússal töltött süteményfélét. ugye? – Dehogy szívem. Sikoltozott. – Akkor meg mi a baj? – Csak annyi. . – Azt azért te sem hiszed. Nem mintha Ellen bármiből is enne. Ekkor a kislányuk hangját sodorta feléjük a partról a szél. – Vágytam is. éppen erre vágysz – felelte Mike Bowman. aki a szálloda által összeállított ételcsomagban kotorászott. hogy nem bánnám.

délies amerikai tájszólásban szólalt meg. hogy egy körülbelül harminc centiméteres nagyságú. Bowman! – Örülök. mint a habos nyál. kézírásos jegyzeteket készített. akik feszülten várakoztak. – Aztán elmagyarázta. közel a kislányához. Sok idő eltelik még. Mike Bowman mégsem volt nyugodt. Mike Bowman az ágy mellett ült. Londonban és Baltimore-ban végzett. zöld gyík harapta meg. Egyet az itteni analízishez. Láthatják. most már megnyugodott – mondta hangját lehalkítva dr. Mr. hogy nem lesz kétségük dr. – Azt mondja. A rajzon a hátsó lábán áll. mire Mike Bowman elfelejti azt az eszeveszett robogást vissza a civilizációba a négykerék meghajtású Land Roveren. hátha szükség lesz még rá. s aztán Tina légzése is akadozni kezdett. Végigvitte a parton. és kutató sem dolgozott ott már jó ideje. Cruz összevonta a szemöldökét. – Én ehhez nem értek – mondta. Egy darabig még elnézegette a képet. – Adtam neki még egy adag szteroidot.PUNTARENAS – Azt hiszem.. Neves kutató. A kislány karja szinte azonnal vörösödni és dagadni kezdett. hogy a Yale Egyetem számára végez biológusként terepmunkát Costa Ricában. Dr. – Én magam még sosem láttam ilyen harapásokat.. hogy megismerhetem önöket. Óvatosan felemelte a karját. – Gondolom. A meglepetés abban állt. amelyet Tina a felvételi tisztviselőknek rajzolt. vissza a fákhoz. Guitierrez szaktudása felől. Az öböl túlpartján dolgozik. – Véleményem szerint Tina állapota teljesen megnyugtató. a puntarenasi kórház pedig makulátlanul tiszta volt és hipermodern. s bólintott magában. ceruzalámpával nézett meg közelről minden egyes harapást. Amikor Mike odaért Tinához. amerikai. körülbelül akkora.. és már sokkal könnyebben lélegzik. Tina szerint a hátsó lábain járt. amely alatt Tina aludt. pontosan. Ő talán képes lesz azonosítani nekünk ezt az állatot. mint aki megértett valamit. a karja meg csak egyre duzzadt és vörösebb lett. . amely felegyenesedve jött elő a partra a mangrovemocsárból? – Igen. – Mint valami madár vagy egér. igen – felelte dr. Dr. amikor a duzzadás már a nyakára is átterjedt. Cruz. amely ide-oda csúszkált az agyagos földúton. Az oxigénsátor átlátszó lapján át bámulta a gyereket. és szinte elborították az apró. – Cabo Blancónak nincs állandó személyzete. a kislány hisztérikusan sikítozott. hogy kiderült. hogy érti a mesterségét. – Szóval ez az állat harapta meg? – kérdezte a képet nézegetve dr. – Nem jöhetne valaki a Cabo Blancóból? – kérdezte Bowman.. – Még nem azonosítottuk őket! – vágott közbe az orvos. az ödéma is jóval lejjebb húzódott a karján. egyet pedig itt tartunk mélyhűtve. – Nos. Marty Guitierrez alaposan végigvizsgálta Tinát. – Tiszteletem. – Megkértem dr. amelyet – Cruz elmondta neki – még vizsgáltak a laboratóriumban. jöjjön ide. De láthatják. Ezután áttekintette a polaroidfelvételeket. Szerencsére lefényképeztem őket a további vizsgálatok érdekében. miközben a lánya üvöltött a félelemtől és a fájdalomtól. szakállas férfi volt. – kezdte Mike Bowman. olyan. – Igen – válaszolta Mike Bowman.. Bowman és Mrs. Máris alig látszanak. lágy. azok a harapások. Dr. egyet a San José-i laboratóriumba küldünk. Ezenkívül lemostam a karját. – Végül is ott érte Tinát a harapás. Cruzon látszott. – Közben precíz. és kérdéseket tett fel a nyállal kapcsolatban. Guitierrezt. Rendbe fog jönni. Még a park határától is távol voltak. Cruz. Végül Mike Bowmanhoz és feleségéhez fordult. – A kislányuk tehát azt mondta. Cruz. egyetlen lánya súlyos beteg. Véres volt az egész bal karja. Megvan még az a kép. amit a kislány rajzolt? – Persze – felelte Mike Bowman. Odaadta a vázlatot. dr. és több mintát is vettem abból a ragacsos nyálból. a Reserve Biologica de Cararában. trikós. zöld gyík volt. Akárhogyan is. mint egy csirke vagy varjú. Igen. Felemelte az oxigénsátor műanyag lapját. Mindössze tisztázni szeretnék néhány részletkérdést. – Nem ismerek ilyen gyíkot – mondta az orvos. Guitierrez sortos. már tűnőben vannak. ha jól értem? – Úgy van. Cruzból szinte sugárzott a szakértelem. Cruz. és nagyon távol vannak az otthonuktól. És itt-ott valami ragacsos habszerűség tapadt a karjához. igaz? – Tina szerint csiripelt vagy cincogott. De meggyőződésem. ujjnyom nagyságú harapások. – Sajnos nem – felelte dr. – Úgy van. Amikor bemutatták őt Bowmanéknak. tökéletesen beszélt angolul. Kis idő múlva hátralépett.. majd egy kis zsebvonalzó segítségével meg is mérte őket. – És a gyík valamiféle hangot is kiadott. – Most már rendben lesz? – kérdezte Ellen. és már öt éve itt van.

Higgyék el. Ezután Mike Bowman Guitierreznek is megmutatta a képet. Azt mondja. doktor bácsi – mondta Tina. Reggelre az égvilágon semmi baja sem lesz. Aztán megrázta a fejét. – Meg sem moccant? – ismételte Guitierrez elgondolkozva. hogy közönséges baziliszkusz harapta meg a kislányt. ahol maguk jártak. – Bizonyosan állíthatom. – De Tina kifejezetten állította. Már sokkal jobban vagyok. másik inget tetszett felvenni? Dr. – A hüllőnyál szerotonint tartalmaz. Guitierrez. és megfogta az orvos kezét. – Bizonyára – mosolygott Guitierrez. amely megmarta az amerikai kislányt. Ha éjszakás vagyok a kórházban. ami azt jelenti. – De nyakkendőt nem? – Nem. Mrs. Guitierrez bólintott. noha már a legelső eredmények több ismeretlen biológiai aktivitású. A betegség lefolyása gyógyszerezés mellett normálisan tizenkét óra. nehogy elijessze az állatot. nagyon fáj. – Menj szépen! Köszönd meg Cruz doktor úrnak. mi történt. Cruz egy pillanatig értetlenül nézett. A Clínica Santa Maria modern alagsori laboratóriumába befutott a hír. Tina. – Elmagyarázta. – Az irodalom szerint az emberek tizennégy százaléka erősen allergiás a gyíkokra. hogy dr. Csak inget. – És azt is. Az ügyeletes asszisztensnek azonban sok dolga volt aznap éjjel. azt nem. igen nagy molekulasúlyú protein jelenlétét mutatták ki. közönséges nevén a csíkos baziliszkuszgyík. – Cruzhoz fordult. – Hüllők nem hordozhatnak veszettséget. „BOWMAN. hogy hosszú nyaka volt – kötötte az ebet a karóhoz Ellen Bowman. – Leesett a vérnyomása az antihisztamin hatására? – Igen – felelte Cruz. – De egyáltalán.. A kislányuk is közéjük tartozik. hogy valaha is pontosan tudni fogjuk. – Köszönöm szépen. és ettől súlyos allergiás reakciót szenvedett. Közben így szólt: – Jé. hogy a világ mintegy hatezer gyíkfaja közül mindössze tán egy tucat jár felegyenesedve. amit Tina rajzolt. – No és az a ragacsos. – Az állatkerti ápolókat például rendszeresen megharapják a gyíkok. úgy száz kilométerre onnan. – Nem hiszem. Kivette a kémcsövet a szemétkosárból. A kutató bólintott. azonkívül a kislány három ujjat rajzolt a hátsó lábaira öt helyett. meg sem moccant. hogy meggyógyított – szólt Ellen Bowman. Minden egyéb szempontból azonban tökéletesen elmegy annak a gyíkfajtának. – Sikítozott. Ezek közül csak négy honos Latin-Amerikában. majd elmosolyodott. – Tina korához képest igen jó megfigyelő – tette hozzá Mike Bowman. ahogy mondod. CHRISTINA L. Egyébként alig néhány napja hallottam. A farok túl vastag és túl magasra emelkedik. miért volt a lányukon annyi harapás. Guitierrez közönséges baziliszkuszgyíkként azonosította az állatot. Costa Ricában és Hondurasban él. és előretolta Tinát. – Én azonban mégiscsak azt hiszem. A nyaka túl hosszú. reggel mindig inget váltok. – Szerotonin – ismételte Guitierrez. A lányuk allergiás rohamot kapott egy baziliszkuszgyík harapásai következtében. hogy Tina karjának feldagadása allergiás reakció volt.” – olvasta a kislány nevét az aznap távozó betegek között. Bowman. hogy az egyiken vörös címke van. egyre csak azt mondta. – Semmi kétség. hogy Tina jó megfigyelő. A nyál elemzését azonnal leállították. Ellen Bowman is megszólalt: – Mike mondta maguknak. a gyíkharapás nagyon gyakori – válaszolta Guitierrez. Szóval nem ritka dolog ez. hogy a San José-i egyetemi laboratóriumba továbbítandó. – Felnyúlt. – Azonnal. A vadállatok kiszámíthatatlanok. hogy az a gyík egy Basiliscus amoratus volt.Dr. Ellen Bowman valahogyan nem tudott megnyugodni. miért harapta meg az a gyík? – Asszonyom. akkor én ismerem ezt a gyíkot. . nem! – mondta dr. s a nyálmintát felrakta a hűtőszekrény tárolópolcára. Hátsó lábára állva a magassága elérheti a harminc centimétert. – Nem. hogy egy gyík a bölcsőjében harapott meg egy csecsemőt Amaloyában. nem mérgező. – Guitierrez elmondta. – Igen. nem komolyabb a dolog. – Akad persze egy-két hibás részlet. amely roppant fájdalmat válthat ki. amelyről szó volt. habos nyál a karján? – kérdezte Ellen. – Nos. – Folyton a veszettség jár az eszemben. Csak azt nem tudom. – Alighanem fájt is – mondta Guitierrez. Az utolsó pillanatban vette észre. hogy három lábujja volt. – Úgy van. Elfogadom baziliszkuszgyík rajzának – mondta. Mivel foglalatoskodott éppen? – Semmivel. mire kidobta a nyálmintákat. és útnak indította. Másnap reggel a nappali szolgálatot teljesítő asszisztensnő a távozó betegek listájával a kezében végigellenőrizte a tárolópolcon lévő mintákat.. – Mérgező a harapása? – Nem. amely itt.

az igaz. – Hát a lábára? – Aha. – De akkor mi lehetett? – Hát ez az! – mondta Guitierrez. barátom! . így! – tett néhány lépést. emlékszel még arra a gyíkra? – Aha. egyáltalán nem vagyok biztos. igen rejtélyes. – Meg úgy is ment. Nem. a parton minden madár ilyen nyomokat hagyott a homokban. – Azért érezd továbbra is jól magad Costa Ricában. és kezet rázott a kislánnyal. Bowmanék távozása után. más gyíkharapásról is hallottál a kórházban? – Nem. amit a kislány mond – hallotta Guitierrez hangját. Apropó. amikor dr. hogy megnéztem – mondta Tina. – Dr. – És a gyík lábnyomai is ilyesfélék voltak. Már nem vagyok biztos benne. majd komoly képet vágott. mint a madaraknak? – Aha – felelte Tina. mint egy madár. hogy felhívja Guitierrezt a biológiai állomáson. Cruz úgy határozott. – Magam is végeztem egy-két ellenőrzést. Cruz mosolygott. – Beismerem. Bowmanék már indulóban voltak. dr. bólogatva. – Három középső ujját szétterpesztve felemelte a kezét. míg itt vagytok. – Túl korai volna még erről spekulálni. Fel-le ingatta a fejét. – Különben is. Tina! – Majd igyekszem. Cruz utánuk szólt: – Tina.– Hát ami igaz. és elmondja amit hallott. hogy baziliszkusz harapta meg. – És hány lábujja volt? – Három – mondta a kislány. – Honnan vagy olyan biztos benne? – Onnan. – Olyan volt a lábnyoma a gyíknak. Miért? – Okvetlenül tudasd velem. ha hallanál.

Ám az örömteli izgalommal. De csak elvesztegetett egy napot. Egy másikat Puerta Soteróban. Nézte. barna csíkokkal”. Nem szaladt el még akkor sem. hogy megtalálja az új gyíkot. És Costa Rica pontosan az a hely volt. Volt valami a szájában. Ezek után felhívta az amaloyai tisztiorvost. Ez az új és jól körülhatárolható típusosság arra vezetette Marty Guitierrezt. rögtön együtt jár az új betegségek nyugtalanító lehetősége. atlanti-óceáni és még négy különböző hegylánc. barna alapon. Amikor visszament a carari állomásra. mielőtt a nagyanyjának sikerült elkergetnie. a Cabo Blancó-i tengerparton. röviden a CSE. mérsékelt övezetek. a gyíkharapás mindennapos dolog. Guitierrez felállt. kanyargós úton. Ez a bőgőmajom azonban. mit tegyen majd a leletével. végső . Costa Ricában háromszor annyi madárfaj él. míg végül kemény szikrákat vet az öböl vízén. – Különös – mondta Guitierrez. nedves mocsarak és száraz sivatagok. így írta le az asszony a gyíkot. Ezek közül a legveszedelmesebb az úgynevezett centrális szauruszi encephalitis. A majom sorsa egy cseppet sem izgatta. „Zöld színű gyík. és azzal folytatta. akkor alighanem több is lesz feljebb a fák között. Kicsit távolabb egy bőgőmajom sötét sziluettjét pillantotta meg. Többször is megharapta a gyereket. Marty végiglapozta az ottani kis könyvtár minden idevonatkozó kötetét. Nem akart sötétben vezetni azon a csúszós. meg-megállt. Így tehát teljességgel elképzelhető volt. amely a nagyanyja állítása szerint – ő volt az egyetlen személy. Az előzetes jelentést megírja ő maga. és ez az állatfajta gyakran levizeli a betolakodót. de baziliszkuszharapásról említést sem talált. egyedül van. ahol ez a leginkább elő is fordulhatott. – Nem. hogy egy eddig ismeretlen gyíkfaj jelenlétére kezdjen gyanakodni. A gyíkok vírusos fertőzések hordozói. Ha egy bőgőmajmot lát. felhőerdők. amely egyfajta álomkórt idéz elő az embernél és a lovaknál. Reggel jó korán megtöltötte légpisztolyát kábító nyilakkal. Lassan haladt. mint egész Észak-Amerikában együttvéve. hogy közönséges baziliszkuszgyíktól származzék. Több mint ezer orchideafajta. hogy bárkit is baziliszkuszgyík harapott volna meg. és felsóhajtott. Vásquezben. de az állatmaradványokat természetesen el kell küldenie az Államokba. és elindulhat visszafelé a dombon. hogy valaki gyíkharapás következtében kórházba került volna. egy cseppet sem – válaszolta a tisztiorvos. köztük négyezer méter magas csúcsok és aktív tűzhányók. Nézte. Ötezernél is több rovarfaj. és nagy reményekkel indult el a partra. Máris azon gondolkodott. aztán ételmaradékát elejtve a dzsungelbe menekült. a parthoz legközelebb fekvő faluban egy gyermeket álmában ért a harapás. hogy új faj kerüljön elő. ahol Guitierrez ült. legalábbis olyan közel ahhoz a helyhez. aki megerősítette. és előreindult. Amikor a második nyílvessző mélyen a combjába fúródott. A nyugtatóadag olyan csekély volt. Hamarosan volán mögé ülhet megint. Nagyjából ott volt. oda. Guitierrez arrébb lépett. Állandóan újabb és újabb fajokat fedeznek fel. hát azért. – hiába. úgy tűnt. Az áldozat mindig alvó gyerek vagy csecsemő volt. közelebb a vízhez. és sajnálatos okból: Costa Rica erdei fogyóban vannak. felsikoltott a dühtől és a meglepetéstől. hogy nem. nem hordoz-e betegséget. ahogy a délutáni nap egyre lejjebb ereszkedik az égen. hogy Tina Bowman tényleg úgy állatfajt látott. Noha Guitierrez nem hazudott. Lehet. Guitierrez úgy érezte. olyat azonban még életében nem hallott.A PART Marty Guitierrez a parti homokban ücsörgött. melyek közül több az emberre is átterjedhet. amikor Bowmanéknak azt mondta. s a sugarai a pálmafák alá is bekúsznak. méghozzá az utóbbi időben egyre gyorsuló tempóban. A legkeskenyebb részén mindössze százhúsz kilométer széles ország területe kisebb az egyesült államokbeli Maine államénál. hogy megvizsgálja. aki látta is az esetet – gyík volt. Ezen a viszonylag kis területen belül azonban a különböző fajta biológiai élőlények szinte elképesztően változatos sokasága található. van csendes-óceáni. hogy egy sor harapásos esetről hallott. Ezután egy amerikai nemzetközi számítógépes adatbázishoz fordult további információkért. Guitierrez még ebből a távolságból is kivette a zöld csíkokat. A biológus a földre vetette magát és célzott a pisztolyával. amit egy új faj felfedezése jelent. amikor az első lövedék célt tévesztve süvített el mellette. Emellett a Tina karján látott harapások átmérője kissé túl nagynak is látszott ahhoz. Talpra állt. Ez az ökológiai változatosság a legkülönfélébb növényi és állati életformák különösen széles skálájának nyújt otthont. fontos. és lekuporodott. kilencnapos csecsemőt megharapott egy állat. ahogy lejjebb és lejjebb száll a nap. s időnként ezzel együtt a viselkedésük is megváltozik. ahol két nappal előbb az amerikai kislány. a mangrovefák között. ha másért nem. esőerdők. Egy biztos: Guitierrez nem látott semmit. hogy egy bölcsőjében alvó. amennyire csak be tudta határolni. Az összes eset az elmúlt két hónapban történt. Olyat meg végképp nem. és elindult a part mentén. hogy legfeljebb néhány percnyi kábulatot okozhat. Az élőhelyüket vesztett őserdei fajok más területekre költöznek. lehet. A védettséghez szokott bőgőmajom csak kíváncsian bámult rá.

. gondolta Marty.azonosításra. idős úr volt a gyíktaxonómia legnagyobb szaktekintélye az egész világon. Igen. Simpson. címzetes professzora New Yorkban. valószínűleg neki fogom elküldeni ezt a gyíkot. Ez az ezüstös hajú. Kinek küldje? A legelismertebb szakember Edward H. a Columbia Egyetem nyugalmazott. elegáns.

hogy intézményük neve hallatán mindenki valami sokkal grandiózusabb dologra gondol. látta. japán B-encephalitisszel. – Látszik bizony – mondta Stone. terepmunkán. Ez magának való. csináljon róla egy röntgenfelvételt meg egy pár polaroidképet az irattárunknak. és mivel ennél a gyíknál felmerült. Stone visszatette a cipzáras zacskót. No. A gyíkvér nem mutatott szignifikáns reaktivitást semmilyen vírusos vagy bakteriális antigénre. Langat-vírussal és Mayaróval fertőzött mintákat azonosított. Kőkeményre fagyott húsdarab hullott ki tompa puffanással. – Oké – mondta Stone. és fehér gőz szállt fel. dér lepte el. – A fajt nyilván nem tudjuk azonosítani – mondta. amikor az intézet még az Orvosbiológiai Kutató épületének egész negyedik emeletét elfoglalta. hogy őrizze addig a gyíktöredéket a TBI. A laboratórium kényelmes. „A gyík helybéli gyermekeket harap meg. míg dr. és a titkárnő arra kérte Stone-t.NEW YORK Dr. A pecsétek érintetlenek voltak. A fehér műanyag henger körülbelül akkora volt. itt egy pozitív találata akadt: a vér enyhén reagált az indiai kristálykobra mérgére. Műanyag kesztyűt és maszkot öltött. hogy megszabadítsák a világot a sárgaláz. Sziszegve távozó gáz zaja hallatszott. – A betegségeket viszont könnyen ellenőrizhetjük.” Utálkozva húzta fel az orrát. a Trópusi Betegségek Intézetének vezetője a Columbia Egyetem Orvostudományi Központjában gyakran mondogatta. ezért dr. Stone doktor. Stone egy cipzáras műanyag zacskót talált benne. Fémzárakkal volt leszorítva. Az asszisztensnő a mellékelt iratokat tanulmányozta. hogy a figyelmeztetés hatott. Stone a képre pillantott. futtassa végig az antitestvizsgálatokat. De a hüllőfajok közti kölcsönös reaktivitás igen gyakori. nem továbbít-e valamilyen betegséget a harapás. A henger jéghideggé vált. Végül is a laboratórium nem olyan régen még venezuelai lólázzal. és teli volt ragasztva különféle felszólításokkal és figyelmeztetésekkel vagy négy nyelven. úgy is várni kell. – Csak azt nem értem. Mihelyt lesz vér. és felmerült. mint amilyen az a valóságban. A laboratóriumi válasz már ebéd előtt készen állt. Richard Stone odajött a laboratórium végéből. asszisztensnő is csak kettő dolgozott benne teljes munkaidőben. nincs-e valamilyen átadható megbetegedése. három lábujjú genetikai anomáliával – olvasta az asszisztensnő. . Stone ezt nem tartotta olyan fontosnak. ha problémája van. hátha összeáll valami. Stone bekapcsolta a légtisztítókat. hogy meggusztálja a küldeményt. nehogy felnyissák. Aztán lecsavarta a kupakot. hogy immár Nairobiban és Sao Paolóban is kiváló intézmények működtek – TBI egykori fontosságának java részét elvesztette. Sebészlepedőt terített az asztalra. „Nemzetközi biológiai mintatartó” – ez állt a címkéjén. minket kért meg. Ahogy Stone a hengerre irányította a lámpát. – Ed Simpson laboratóriumából jött? – Onnan – felelte az asszisztensnő. mint egy másfél literes tejesüveg. – Simpson Borneóban tölti a nyarat. és bedugta a hűtőszekrénybe. De az orvostudomány sikerei következtében – valamint annak eredményeként. A század elején. hogy megették. – Ezen látszik. a kupakja pedig csavaros volt. Richard Stone. miért küldenek ők egy gyíkot nekünk.” Kiemelt a papírok közül egy gyíkot ábrázoló gyermekrajzot. Kyanaszaur-vírussal. mit kaptunk. amit az asszisztensnője aznap este küldött Marty Guitierreznek. A gyík azonosításának kérdése fel sem merült: azzal így is. – Fuj! – szólt az asszisztensnő. amelynek TINA állt a tetején. „Azonosítatlan fajú Costa Rica-i gyík részlegesen megrágott töredéke. lássuk. megszokott munkamenetébe sehogy sem illett bele a reggel befutott küldemény. Kérdéses a faj azonosítása. Simpson hazatér. – Telefonált a titkárnője – mondta Stone. A figyelmeztetések a mindig gyanakvó vámhivatalnokoknak szóltak. mihelyt sikerült némi vért kinyernünk ebből a töredékből. – Na. Míg kiolvad. ez aztán gyönyörű! – kiáltott fel a Trópusi Betegségek Intézetének asszisztensnője a vámcímke olvastán. amelyben valami zöld volt. Toxicitás-vizsgálatokat is végeztek. Nem is voltak felkészülve az ilyesmire. Nagysága csupán a töredéke volt az egykorinak. a malária és kolera átkától. – Az egyik gyerek le is rajzolta a gyíkot. mit írnak? – Basiliscus amoratus. – Kezdjünk hozzá. hogy a telefaxba is belefoglalja. csapatostul sürögtek-forogtak itt a tudósok és asszisztenseik. Mi is ez az állat. Addig azonban még hetek voltak hátra. és kirázta a zacskó tartalmát. akiket elsősorban külföldön járt New York-iak betegségeinek megállapítása kötött le. Szóljon. hogy megvizsgáljuk.

Gyorsan borogatást tett az anya homlokára. Kalapácsütések verték a rendelő hullámbádog tetejét Bahía Anascóban. Simpson hivatalától ANYAGOK: hátsó szegmentum. hogy megnézze az újszülöttet. ismét hallotta a csiripelést. eredeti nézetei beigazolódtak: újabb gyíkfajta kényszerült új élőhelyre a dzsungelből.” A szöveg rövid volt: TÁRGY: Basiliscus amoratus genetikai anomáliával Érkezett: dr. cincogó. mivé lett a gyermek arca. Csuromvíz volt minden. EREDMÉNYEK: Emberre átruházható betegség jelen basiliscus amoratus példánynál sem hisztológiailag. Trópusi Betegségek Intézete. Costa Ricában úgy vélték. (?) részben megevett állat VÉGZETT VIZSGÁLATOK: röntgen. halott. hogy a fertőző betegségek hiánya azt jelenti. és a szomszéd helyiségbe sietett. Amint megérintette az ajtó gombját. A kosár peremén három gyík ült körben. De már jóval azelőtt. mint vízköpők a kút szélén. ha egy újszülöttet madár látogat meg. bakteriális vagy parazitológiai betegségek szempontjából. és most kapcsolatba került a falusi lakossággal. D. az szerencsét hoz. Közeledett az éjfél. Nyilván madár repült be az ablakon az eső elől.Marty Guitierrez elolvasta a faxot. hogy odaért volna a mózeskosárhoz. úgy tűnt.. Az egyik az volt. s Elena. sivító hangot. és gyors fejmozdulattal húscafatot szakított ki a csecsemőből. a bábaasszony zseblámpafénynél dolgozott. és a harapásos esetek megszűnnek. s nem maradt utánuk. Az egyik gyík lágyan csiripelve lehajolt. a bábaasszony már látta. (aláírás) Dr. mikroszkópos. csak egy csomó véres. Ellenkezőleg. A vihar miatt kimaradt az áram. ciripelő. Elena sikítva rohant arrafelé. Guitierrez biztosra vette. amikor egyszerre csak meghallotta a különös. és tudta. immunológiai reakciótesztek vírusos. Sűrű függönyökben dőlt a trópusi eső. hogy a Columbia Egyetem kutatói helybenhagyták a faj azonosítását mint baziliszkuszgyíkot. hogy a gyíkok néhány héten belül letelepszenek. Elena benyitott. Richard Stone. háromujjú lábnyom. A fonott mózeskosárban fekvő könnyű takaróba bugyolált babának csak az orra volt szabadon. igazgató Guitierrez két feltevésre jutott a feljegyzés alapján. Zseblámpája fényében az asszony látta: pofájuk vértől csöpög. . de nem menekültek el. s a gyíkok a sötétbe menekültek. A gyíkok csiripelve-sivítozva szaladtak szét az esős éjszakában. mint a madarak után. sem immunológiailag nem kimutatható. Elena patkányra gyanakodott. A másik. Elenát megpillantva kíváncsian félrefordították a fejüket. az elszórtan jelentkező harapásos esetek nem jelentenek komolyabb egészségügyi kockázatot Costa Rica számára. Feladó: „Columbia Egyetem Orvostudományi Központja. M. és megnyugodott.

Ott rajzolta le egy kislány. és beazonosítja. az asszisztensek úgy vélték. de a kobraméreggel rokon. – Mondok valamit. – Stone visszatette a zacskót a mélyhűtőbe. Éppen ezért nem is tűnt fel a jelentés senkinek. nem tesz jelentést a gyíkok rohamáról. bár szerkezetében primitívebb neurotoxikus méregnek látszott. Ott van a hűtőben. hová – mondta Alice Levin. a hátsó lábán áll. ez egy gyík. Alice képzetlen. Biológiai aktivitását ugyan még vizsgálták. én csak tudom. így is maradt volna minden. A laboratórium emellett kimutatható mennyiségű gamma-amino-metionin-hidrolázt talált. hogy a gyermek megfulladt. Simpson megjön Borneóból. A legkisebb dinoszaurusz nem érte el a harminc centit sem. Maga a gyíktöredék a Columbia Egyetemen pihent a mélyhűtőben. és kirázta belőle. kivette a csomagot. és senki sem tett fel kérdéseket. Richard – folytatta Alice Levin. – Na és? Annak idején voltak kis dinoszauruszok is! – vitatkozott Alice. Elena Morales úgy döntött. dr. A rémlátomásszerű jelenet ellenére nyugtalanság fogta el: baja eshet. Ez egy dinoszaurusz. Hozzá nem nyúlt. tiniszaurusznak hívták. Gondolom. vagy mit tudom én. – Ez egy jelenkori állat rajza. – Ha ez itt mégis dinoszaurusz. Stone azonban továbbra is csak a fejét rázta. és nem jelentették. – A dinoszauruszt. molekulasúlya l 980 000. Mint várható volt. míg dr. állandóan a nyomában van az egyik műtősfiú. – Szóval semmit nem akar csinálni? – A világon semmit. az illetékes puntarenasi orvost. nagy mennyiségű szerotonin volt jelen. és becsapta az ajtót. és vállat vont. tán nem az? Az én srácaim is folyton ilyeneket rajzolnak. nem! – rázta a fejét Alice Levin.AZ ADATOK TANÚSÁGA Amikor visszanyerte a nyugalmát. – Nem akarom. Stone. és a San Joséba küldött halálozási nyomtatványt így töltötte ki: indokolatlan csecsemőhalál-szindróma. az marha nagy dolog volna! – Az lehet. ami még egy jó hónapig nem volt esedékes. És bármi legyen is.. amiért nem vigyázott jobban a gyermekre. vagy ilyesminek. Még egy töredékét is ideküldték. ha egy Alice Levin nevű asszisztensnő be nem tér a laboratóriumba. és nem kérdi meg: Nahát! Kinek a gyereke rajzolta ezt a dinoszauruszt? – Micsodát? – fordult feléje lassan dr. Alice! Ez a gyík nem megy innen sehová! . Miért. – Higgye el. Ott várta. A vitát lezártam. Stone-nak eszébe jutott. Simpson hazaérkezését. Micsoda képtelen nevek! Tízéves életkor fölött már nem lehetett megjegyezni őket. így hát azt mondta az anyának. A San José-i egyetemi laboratórium kielemezte a Tina Bowman karjáról vett nyálmintát. amikor egyszer azt állította. – Nem. Alice Levin megnézte a láb és farok fagyott maradványait. – Stone odament. – Ez egy gyík – mondta Stone doktor. Lévén ez az enzim a génsebészeti beavatkozás egyik jele. Csakhogy a nyálban lévő proteinek között egy igazi rém is akadt: az egyik legnagyobb ismert protein. Nagy fej. – Értse már meg. És élénk a fantáziája. vastag farok. – Elvigyem én maga helyett? Akarja? – Nem – mondta Richard Stone. – Ezt komolyan mondom! – Szégyellném magam – felelte Stone. – Costa Ricából. amikor felhívták Cruz doktort. így írják le a néhány napos csecsemők között nemritkán előforduló megmagyarázhatatlan haláleseteket. de sajnos nem az. meg nem látja Tina Bowman rajzát. hosszú nyak. Több figyelemre méltó felfedezést tettek. – Ez nem dinoszaurusz. – Ellenőrizte valaki? – Nem – mondta Stone. amit mondok! – szólt Richard Stone. – Akkor vigye el a Természettudományi Múzeumba. amely vadon élő állatokban nem fordul elő. – Nézze csak meg! Teljesen világos. – Az lehetetlen! Csak harminccentis. – Én sem tudom – mondta. Egyszerű asszisztensnő a folyosó végi bakteriológiai laboratóriumból. csak laboratóriumon belül keletkezett fertőzésről lehet szó.. – De nekem ez dinoszaurusznak látszik. Szakértő vagyok. ráér.

MÁSODIK ISMÉTLŐDÉS A fraktális görbe későbbi rajzain váratlan változások jelenhetnek meg. IAN MALCOLM .

mit akarhat Alan Granttól a Környezetvédelmi Hivatal ügyvédje. s a földből épphogy csak kinőtt Sziklás-hegységtől egészen az Appaleche-hegység éles. – Hé. Lelki szemeivel Grant maga előtt látta a hatalmas beltenger ingoványos partvidékét. Óvatosan. Montana legkietlenebb vidékén. Holdbéli táj vette körül. Keskeny felhősávok borították akkoriban az eget. az ingoványos tóparton. Ez a terméketlen vidék volt csak. Ez a sűrű növényzettel övezett sziget jól védett menedékül szolgált: itt rakták le tojásaikat közös fészkeikben a kacsacsőrű. Csak meddő kő. Egy kis szerencsével Grant a csontváz többi részét is megtalálhatja. savas tó egyre sekélyebb lett. csak kagylók és csigák. ahová tojásaikat rakták. lepattant egy-két csontdarab. két hektárnál. és ott volt az olyannyira jellegzetes mediális hajlás. s itt nevelték sipítozó kölykeiket. A talaj összetöredezett és megvetemedett a hőségben. hogy Ellie neki integet. Sehol egy fa vagy akár egy bokor. Alig három centi volt a hossza. Néhány húsevő dinoszaurusz portyázott itt-ott a pálmafák között. aki erre járt. rossz vidék – így hívták ezt a kietlen vidéket. A puha térdvédők ellenére is fájt a térde. Pterosaurusok csaptak le a levegőből. a területe nem nagyobb. – Hé. Alan! Alan Grant felnézett. míg csak ki nem száradt. Alan! A negyven év körüli. körülbelül két hónapos korában. amely csak elkeserítette. Sok-sok kilométernyi távolságban más sem volt az ég kék kupolája alatt. amint a következő domb vastag köveibe vág. a tábori laboratórium árnyékából. az autó felé. amelyeket a paleontológusok ismernek. Semmi kétség. a kihalt életformák tudománya hirtelen fontos lett a modern világ számára. Az állat hetvenkilencmillió évvel ezelőtt pusztult el. csak lekopott dombtetők és porladó mészkőkupacok. Minden figyelmét lekötötte az előtte elterülő húszcentis földdarab. Ez lenne az első húsevő dinoszauruszbébi-csontváz. széndioxiddal telített volt a légkör. egy húsevő dinoszaurusz kölykének állkapcsa került a napvilágra. – Bob Morris vagyok a KH-tól – mondta. amelyet elsötétített a közeli tűzhányók füstje. Grant abba is hagyta egy pillanatra. Elindult lefelé a dombon. Az ezt követő évmilliók során a sötétzöld. Hal nem élt ezekben a vizekben. Több mint negyvenöt fok meleg volt. és sokat találgatták. a domb alján látta táboruk hat indiánsátrát. A srácok a másik dombon kíváncsian bámultak. – A San Franciscó-i kirendeltségen dolgozom. mielőtt folytatta volna a feltárást. Ritkán jött hozzájuk vendég Snakewaterbe. türelmesen dolgozott – az egyik kezében fogorvosi véső. amely teljes egészében. Hunyorgott a napfényben. A homlokáról a földre csöpögött a verejték. szakállas férfi felállt. és bekente gumiragasztóval a csontot. „Badlands”. és algákat gyűjtöttek a víz felszínéről. meg lehet magyarázni bizonyos múltból származó információk segítségével. és keze fejével megtörölte a homlokát. amely tábori laboratóriumul szolgált. Grant azonban fel sem vette ezeket a kellemetlenségeket. Alan viszont tisztában volt vele. Másfélezer kilométer széles volt ez a beltenger. míg teljes egészében fel nem tárult az apró. Olyan információk segítségével. növényevő dinoszauruszcsapatok. A fogak egy sor apró pontocska. Hallotta a hordozható áramfejlesztő zakatolását és a légkalapács csattanásait. Lepusztult domboldalon térdelt. L alakú állkapocscsont. legalábbis részben. A part mentén gyorsan nőttek a növények. a földgolyó felmelegedésével vagy az ózonlyukkal kapcsolatos kérdéseket – úgy tűnt – esetenként. Ahogy ásott.. hordómellű. Snakewater közelében. savas portól. amely már nyolcvanmillió éve nem létezett. ahol sok tízmillió évvel ezelőtt a dinoszauruszok fészkeltek. A látogató a fehér portól köhögve becsapta az ajtót. Ez a modern világ ugyanis gyorsan változott. abból lett mára az a szélfúvásos lepusztult domboldal. Aztán látta. Grantot az elmúlt néhány évben kétszer is felkérték..A BELTENGER PARTJA Alan Grant mélyen előrehajolva térdepelt. szaggatott ormáig terjedt. Amikor azonban Grant körülnézett ezen a tájon. az orra majd a földet érte. És a kis szigetből. Odalent. Sűrű. ahol most Alan Grant folytatta ásatásait. . a másikban puha festőecset –. és kelet felé mutatott. Víz alatt volt az egész mai amerikai Nyugat. Az órájára pillantott: holtpontos az ürge. – Látogató! – kiabálta Ellie. ami megmaradt abból az egészen másfajta világból. hogy a paleontológia. ő valami egészen mást látott. perzselő nap és sivító szél. Lehúzta napszemüvegét. Grant látta a porfelhőt és az egyenetlen úton feléjük bukdácsoló kék Ford szedánt. s az időjárással. a vastagsága legfeljebb kisujjnyi. hogy adjon szaktanácsot. A parttól nem messze pedig volt egy kis sziget. és kezet nyújtott. a csapkodó szárnyú étkezősátrat és a lakókocsit. A tüdeje égett a szúrós.

ahol egy szakadt heverő. az egyik legismertebb ember a maga szakterületén. Morris csak nézett. Odébb porcelántálak és korsók. és egy doboz sört nyomott a kezébe. nyolcoldalú sátrakat hozták magukkal.. melege van. Végül kezdtek indiánsátrakat. Amíg hozzá nem kezdtünk ehhez a munkához. – Egészen pontosan hatvanhárommal – szólalt meg Ellie Sattler. – Dehogy – mondta Grant. miért vagyok itt. A lakókocsi légkondicionálója legfeljebb csak harmincfokosra hűtötte le a levegőt. kézzel kell elvégezni. – Mint a csirkecsontok – mondta a porcelánedényekbe nézve Morris. – Ellie tartja bennünk a lelket – mondta Grant. amelyek belül nagyobbak. Morris értetlenül meredt rá. – Azt hittem.Grant is bemutatkozott. – Azok is voltak – felelte Ellie. Kinyitotta az aktatáskáját. – No és azok? – mutatott a férfi a lakókocsi ablakán át a kint álló. és felhajtotta a magáét. ezért gondoltuk. az egyetemi világot. – És mi a dolga? – kérdezte Morris. amikor Morrisnak tátva maradt a szája. ezért Grant megmagyarázta: – Idekint sörben mérjük az időt. de még mennyire! – Morris húszas évei vége felé járhatott. Még az egyetemi előadásait is farmerben és tornacipőben tartotta. Többfajta sátorral is megpróbálkoztak ezután. a bőre bronzbarnára sült. – Nyilván kíváncsi. – De mindaz. – Mióta vannak itt? – Körülbelül hatvan ládányi ideje – felelte Grant. Aktatáska volt nála. foglalja el a karosszéket. mivel közben odaértek a lakókocsihoz. – Olyan csontok. és a szélben is szilárdan állnak. – Egyszerűen csak ezek a legmegfelelőbbek errefelé. ahogy bemutatta a lányt. – Használhatatlan darabok – válaszolta Ellie. – Genetikai vizsgálatra? – visszhangozta Morris. amint Morris pedánsan lesöpri a széket. Grant a denveri egyetem paleontológia-professzora volt. – Ezek négy cölöpön álló. és ügyet sem vetett rájuk. a legmodernebb típusú. – Elmesélte. de az eredmény ugyanaz maradt. a dinoszauruszok nagyok voltak – mondta. és megrázta a fejét. de manapság genetikai vizsgálatra kell küldenünk. Grant a heverőre dobta magát. De hát ez valaha a „feketelábúak” földje volt. Összehúzott szemmel körülnézett a kietlen tájon. szőke haját hátrakötötte. – Parancsoljon – mondta Grant. és tudta. amely arra szolgált. Grant nézte. Csak a szabadban érezte otthon magát. – És én készítem el a szokásos helyszíni preparátumokat is. Rosszul tűrte az akadémikusokat. – Helyezze magát kényelembe! – mondta. de a társasági jópofáskodás sosem volt a műfaja. a tudomány alig ismert dinoszauruszkölyköket. ingben. és egy jókora porfelhőt bocsátott ki magából. hogy a modora. Grant a kocsi végébe kísérte. Meg is tett mindent. Míg Grant a hűtőszekrényhez ment. amelyek túl töredékesen kerültek elő. „feketelábú” sátrak – mondta Grant. . vastag műanyaggal befedett. tipiket állítani. mindegyiken pedánsán elrendezett. Erős ecetszag érződött. kényelmesebbek. felrakta az asztalra a lábát. – Nagyon madárszerűek. – Aha – mondta Morrison. Grant bólintott. amely megnyikordult. de a déli nap forrósága után ez is kifejezetten hűvösnek érződik. Snakewatert éppen a dinoszauruszok fészkelőhelyeinek nagy száma teszi fontossá. és belépett. Mi viszont egy tucat különböző hadrosaurusfészket fedeztünk fel. amit itt lát. nagyobb csonthalmokra. s intett Morrisnak. majd megkérdezte: – Látom. s azokat. amint a lakókocsi felé indult. a Góbi sivatagban. – Nagyon érti a dolgát. keresgélt a papírok között. mielőtt ráül. de még az öltözködése is más legyen. Morris a csontokra pillantott. felszalagozott felcímkézett apró csontminták. Egyetlenegy fészket találtak csak. azt hittem. aki a lakókocsi túlvégében fogóval szedegette ki a csontokat a savfürdőből. akiket tömören „irodai dinoszauruszvadászoknak” hívott. A lány hátradöntötte hosszú nyakát. Ellie térdnél levágott farmert és a köldöke fölött összekötött trikót viselt. – Amikor lefelé jöttem a dombról. – A sziú tipik három cölöpre épülnek. mind tele kicsinyek csontjaival és tojásokkal. megsüllyedt fotel és egy ütöttkopott fali asztal állt. hogy ami a paleontológiában fontos. Régen egyszerűen kidobtuk az ilyet. Eddig mint egy hatvannal végeztünk. Grant jót mulatott magában. nyakkendőben és öltönynadrágban volt. – Bejön az irodámba? – Hogyne – felelte Morris. hogy leoldja a mészkövet a finom kis csontokról. Csakhogy állandóan felborította őket a szél. bébiktől származik. Egy sor hosszú faasztal állt a kocsiban. s közben hátrapillantott Ellie-re. Hegyes orrú cipője csikorgott a kavicson. Huszonnégy éves volt. mint az „irodai dinoszauruszvadászoké”. – A paleobotanika – felelte Ellie. Kér egy sört? – Te jó ég. Egy másikat Ellie-nek adott. Száz ládával kezdtük júniusban.. sóhajtott. – Igen – mondta a lány. – Nem sokat adunk az etikettre errefelé – szólt Grant. hogy amikor 1978ban hozzákezdett a munkájához ezen a vidéken. Ellie megmutatta Morrisnak az ecetsavas fürdőt. – Kinyitotta az ajtót. – Nagyon ideillők. Hátradőlt. azt a szabadban. a múzeumi kurátorokat. indián rezervátumot látok – mutatott a hegyes tipikre Morris.

– Erre emlékszem. – De nem ez az egyetlen rejtély – folytatta Morris. mire kellhet az nekik – mondta Grant. – Ezeket az ásatásokat finanszírozta az Alapítvány a múlt évben. Nem vágyott másra. tizenkétezer dollár. – Tudja.. A gondolat..– Hosszú volt az út idáig. amelyről szólt. márciusában. – Az utolsó öt évben. a 80-as . Nem vesz észre valami különöset? Montana. hogy bárki is borostyánt halmozzon. mert a dokumentumok szerint maga tanácsadói díjat vett fel ezzel a szigettel kapcsolatban. terméketlen. – Egyszer-kétszer. sem katonai értéke nincs. Önök is kapnak tőlük némi anyagi támogatást. ahol szinte állandó a köd. mely szerint egy nagyjából tízezres kacsacsőrű dinoszauruszhorda élt egy hatalmas beltenger partjain. – Nos – mondta Morris –. tartson előadásokat. évről évre. És semmiféle szigethez nem volt köze. mint a gazdagok közül oly sokan. Rá jellemző módon mindent visszautasított. amelyeken aranyos bébik dugták ki a csőrüket a tojásból –. Tudja. egyik napról a másikra híressé tette Grantot. amin vörös pontok voltak bejelölve. és csapatosan nevelte kicsinyeit. amelyet az InGen Inc. Alaszka. mi az a borostyán! – vágott közbe Grant. Ha igaz. – Hát hogyne tudnám! – felelte Grant. – Mert az öreg John Hammond dinoszauruszbolond. miért fordít az alapítvány ennyit a dinoszauruszkutatásra? – kérdezte Morris. – Ön mit tud az alapítványról? Grant vállat vont. – De miért kérdi? – Azért – felelte Morris –. – Százötven kilométerre van a nyugati parttól. az. Fene fura egy dolog volt. elég idős már. A Hammond Alapítvány kizárólag a hideg éghajlati kutatásokat támogatja. adott neki 1984. Az összeg. Világszerte segíti anyagilag a kutatómunkát. Grantot szinte ostromolták. a száraz fagyanta kemény. írjon könyveket... – Évi harmincezer dollárt – bólintott Grant. A Hivatalnak aggályai vannak a Hammond Alapítvány tevékenységét illetően. és olyan részén fekszik az óceánnak. – Borostyánt – ingatta a fejét Grant. Tudni szeretnénk. az egésznek egyszerűen semmi értelme. Svédország. már évek óta.. Tizenhét millió dollárt költött borostyánra az Alapítvány. hogy a gigászi dinoszauruszoknak volt anyai ösztöne – meg a rajzok. California. A tanulmány. közte számos dinoszauruszkutatót is. – Hogy mit csináltam én? Morris papírlapot nyújtott át Grantnak. aztán még sok-sokra. még muzeális ékszereket is. valahogy megragadták az olvasókat világszerte. Sem kereskedelmi. A déli dinoszauruszkutatások – Utahban. de csak 1983-ban jutott el odáig. amely közös fészkeket épített sárból. Grant gyorsan átlapozta a térképeket. Kanada. – Másnak sincs – felelte Morris. Viszont mindig lelkes. hogy bárkinek kellhet. Sziklás. Európában és Ázsiában. Rövid látogatásokra jön csak ide. – Morris további térképeket szedett elő. Semmi ok. Palo Alto. Morris. miért. és. A kibocsátó címe: Farallon Road. – Maga szerint például mi lehet az összefüggés a dinoszauruszok és a borostyán között? – Borostyán? – Igen. – A Hammond Alapítvány a tudományok elismert támogatója. és odanyújtotta Grantnak. hogy publikálja is a felfedezését. – Ezt tulajdonképpen csak azért kérdem. de emlékszem rá. Jelenleg az egész világon ők rendelkeznek a legnagyobb magánkézben lévő készlettel ebből az anyagból. De ekkor. – Mindig ugyanaz. Tudja. Nyilván másokat is. Vajon miért? – Hát – mondta Morris –. Alan Grant 1979-ben akadt az első dinoszaurusztojásokra Montanában. Mr. – Morris az aktatáskájában kutatott. Egy csekk másolata volt. – Amennyit mi értünk hozzá. a Hammond Alapítvány voltaképpen eléggé rejtélyes egy szervezet. Coloradóban vagy Mexikóban – soha nem kapnak egy fillért sem. Isla Nublar. – Elővett egy fénymásolt világtérképet. – És a Costa Rica-i szigete? – folytatta Morris. csak hogy folytathassa ásatásait. Hammond pedig pontosan azt teszi. A negyvenötödik szélességi kör alatt semmi. az biztos. Valaha Felhő-szigetnek is hívták. mert az elmúlt öt év során Hammond óriási mennyiségben vásárolt borostyánt Amerikában. hogy az Alapítvány csak a hideg égövi kutatásokat támogatja. – Hát persze! – kiáltott fel Alan Grant. Tudomásom szerint ők támogatják Bob Kerryt az albertai Tyrrellből és John Wellert Alaszkában. Csupa északi lelőhely. Kiállítva Alan Grant nevére. – Elképzelésem sincs. És különc. – Tudom. A csekk alsó sarkán ez a megjelölés szerepelt: TANÁCSADÓI MEGBÍZÁS (COSTA RICA) FIATALKORI HIPERTÉR. sárga. – Személyesen is találkozott már vele? Grant megint vállat vont. hogy adjon interjúkat. Tudomásunk szerint a Costa Rica-iakat erősen meglepte. minthogy a legjobb dinoszauruszkutatók közül sokan forró égövi tájakon dolgoznak. Borostyánt mesterségesen is könnyű előállítani. akkor térjünk rögtön a tárgyra. az tényleg elég különös..

Hogy értse: ha valaki. Az újszülöttek meg a kölykök. Aztán mi történt? – Hát nézze! – mondta Grant. Fészekrakási szokások. De Gennaro azt mondta. – Igen. mire kell neki ez az információ? – Igen – mondta Grant. Voltak köztük paleontológusok. ha a Környezetvédelmi Hivatalt ennyire érdekli John Hammond – az északi dinoszaurusz-lelőhelyek. – Hogyan léptek kapcsolatba magával? – Telefonon.évek derekán. – És mikor kezdte a Hammond Alapítvány finanszírozni a kutatásait? – Ennek utána kell néznem – felelte Grant. . mint én. akkor miért nem kérdezik meg tőle mindezt? – Sajnos a jelen pillanatban ezt nem tehetjük. Néha még az éjszaka kellős közepén is. Ez úgy nyolcvanöt közepe táján lehetett. Ötvenezer dollárt. Hatvanöt millió évvel ezelőtt kihaltak. Ennének-e a dinoszauruszok ezt vagy azt? Hát amazt? Legyen-e ez vagy az a kiállításon? Soha fel nem tudtam fogni. – Arról. Megegyeztünk tizenkettőben. hogy nem publikáltunk mindent. – Mondja – kérdezte Grant –. bármi legyen is. meg egypár ökológus. ő tudja. az a sziget Costa Ricában –. – És az ötvenezer dollár? Grant megrázta a fejét. a borostyánfelvásárlás. ha írásos anyagot készítek róla. csak telefonon beszéltünk. tőlem mindenesetre a dinoszauruszok táplálkozási szokásai felől érdeklődött. Gondolom. hogy egy egész sor köztiszteletben álló tudós tanácsadót alkalmaz. hogy elküldöm neki munkánk összefoglalását. – Tehát beleegyezett. Rengeteg csontvázleletünk van. Mindent. – Az InGen jogtanácsosa. És nagyon magas honoráriumot ajánlott. és a fali asztalra tette. mitől olyan izgatott. Ötvenezer dollár két teljes nyári ásatási munkánkat fedezi. És pénzt ajánlott. – Jogász vagy nem. – De nagyjából ugyanakkor lehetett. hogy az InGen cég megkereste. hogy jelentést ír neki. Egy rendszerelemző is. nem igazán. hogy megteszem. neki pedig minden kell. Morris bólogatva jegyzetelt. Elmondta. Jó csapat. – Gennarót különösen a fiatal dinoszauruszok érdekelték. Morris leírt valamit. ezekben a zűrzavaros napokban történt. A nyolcvanas évek közepén. – Találkoztak is Gennaróval? – Nem. – A fiatal dinoszauruszok táplálkozási szokásairól. amit tudok. reggelig várhatott volna az a telefon. – Láthatja. Ehhez képest. – Értem – mondta Morris. Morris magnetofont vett elő. hogy ők mit ettek. nem tudja? – Nem. – Gennaro hogyan reagált? – Folyton hívogatott. – Szóval Gennaro 1984-ben felhívta magát. – Nem zavarja? – Engem? Dehogy. de annyira azért nem fontosak. mindazt. mondjuk. – Szóval elfogadta a tanácsadói megbízást? – Elfogadtam. Név szerint is felsorolta őket. – Nem én. hát én fontosnak tartom a dinoszauruszokat. s a padlóra állította az üres konzervdobozt. Morris ezt is leírta. és dinoszauruszbébiket akart bemutatni. amit az általunk talált kacsacsőrű hadrosaurusok szokásairól tudunk. – Donald Gennaro – mondta. egy Ian Malcolm nevű matematikus Texasból. elvállalna-e egy tanácsadói megbízást. Vagyis azt feleltem. azt hitte. – Azt is megmondta Gennaro. területiség. táplálkozási viselkedés. – Ráuntam Gennaróra. – Múzeumot tervezett gyermekeknek. Morris bólintott. én tudom. de a táplálkozással kapcsolatban szinte semmi adat. – De miért nem? – erősködött Grant. mivel foglalkozunk mi itt. – Grant kiitta sörét. – Azelőtt is hallott már az InGenről? – kérdezte Morris. – És miféle információkat küldött neki? – Mindenfélét. És ezt meg is mondtam neki. – És az InGen? Azóta nem volt kapcsolata velük? – 1985 óta nem. Megígértem. Valami Gennaro vagy Gennino nevű pasas. – Miért. együttes magatartás. csak nyugodtan. és lemondtam az egészet.

És azt hiszem. hogy tudták volna. Felháborító. – Én magam viszont meg vagyok győződve róla. Egyes paleontológusok úgy jellemzik az állat viselkedését. Vajon minek? – Szabad a gazda. Ha vesszük egy állat minden viselkedésformáját – táplálkozását. – Nem tudom adni. a génsebészet ugyanolyan. hogy figyelemmel kísérje az olyan amerikai technológiai exportot. itt már végeztem is. Normális esetben az ember nem kaphat veszettséget. magyarán egyszerű belégzéssel is fertőzést okozhatott. A chilei kormányt lekötötte az országos gazdasági válság. sem az érintett parasztokat. Ez a vakcina élő veszettségi vírusból állt. Ebben az esetben a „fiatalkori hipertér” nem más. De nyilvánvalóvá vált. Felhívtak. – Három Cray – mondta Grant. mi az ördögnek kellhet valakinek ekkora teljesítmény Costa Ricában. Volt már ilyen a történelemben. Csak összehasonlításképpen: három Cray együtt nagyobb számítástechnikai kapacitást jelent. Lewis Dodgson.– Mert semmi bizonyítékunk nincs. – Az meg mi? Valami számítógép? Morris biccentett. mi történik. hogy fiatal dinoszauruszokról van szó. ha van rá félmillió dollárja. felelőtlen disznóság volt. – Apropó. Ám a Biosyn ellen mégsem indult eljárás. – Szóval ezért kezdtünk nyomozni az InGen ügyében – mondta Morris. hogy „fiatalkori hipertér”? – Ó. hogy az InGen a világ egyik legnagyobb teljesítményű génsebészeti laboratóriumát állítja fel egy obskurus közép-amerikai államban. Bűnös hanyagság. mint a lehető legnagyképűbb megjelölése annak. olyan gépek. és így tovább –. ahol nincsenek előírások. Mint a háromdimenziós kirakósdi. – Nos. nem exportra – mondta tovább Morris. – Amikor visszamegyek San Franciscóba. amelyek maguk dolgozzák ki a génkódot. De bármelyik géntechnológiai labornak lehet ilyenje. anélkül hogy tisztában volnának vele. s így örömmel fogadják. Ők hivatalosan nem foglalkozhatnak a felhasználással. ahol fennáll az illegális technológiaexport eshetősége. A chilei gazdák. aki az egész kísérletért felelős volt. – Úgy három hete. A gép minden utasa megfertőződött volna veszettséggel. hogy még rá sem kerültek a tiltólistára. nem fertőzővé tettek. hogy nincs viszonteladási szándékuk. Volt már rá eset. S ami még ennél is rosszabb: a vírust módosították. A lakókocsi túlsó végében megszólalt a telefon. kockára tették az életüket. A Biosyn így nem tudta. élő veszettségi vírust menetrendszerű légi járattal vitték Chilébe a kézipoggyászukban. – A TH dolga. mint minden más új csúcstechnológiai fejlemény. mit jelent az. Egy országban. – Kezdte összecsomagolni az aktatáskáját. Az első: az InGen három Cray XMP-t szállított Costa Ricába. hogy bizonyos amerikai biotechnológiai cégek más országokba helyezték át a működési területüket. a tüdő-léghólyagocskán. De a virulenciát nem ellenőrizték le. a biogenetikus. micsoda veszélyeket hordoz. tudatlan parasztok voltak. Nem tájékoztatták sem a chilei kormányt. Ennyi az egész. Ezek közül a Biosyn veszettségi esete volt a legszemérmetlenebb. az amerikai hatóságoknak pedig nem volt semmiféle illetékessége. hogy közöljék: két olyan területre is akadtak az InGennél. ahol azt hiszik. amelyek tájékozatlanok a génkutatások terén. És a Hoodok még ennél is aggasztóbbak – folytatta Morris. bizonyítékaink szerint az InGen huszonnégy Hood szekvencert szállított arra a Costa Rica-i szigetre! – Megint azt állították. akik anélkül. amelynek esetleg katonai jelentősége lehet. hogy a vakcina végülis okozhat-e veszettséget így is. hogy Hammond görbe úton jár. a mai napig a Biosynnél dolgozik. éppen tárgyal. Annyira újak. Visszahívhatja önt? . alvását. Az ügyletet a cég különböző részlegei közti áthelyezésként írták le. hogy az egyik részlegükből a másikba vitték. Az amerikai biotechnológiai cégek pedig hanyatt-homlok rohannak olyan országokba. – A TH nem sokat tehetett. mint azelőtt. mozgását. – Hipertér: ez multidimenzionális teret jelent. – Hatalmas teljesítményű szuperkomputerek. hacsak meg nem harapja egy állat. amelyet génsebészeti manipulációval non-virulenssé. 1986-ban a cupertinói Genetic Biosyn Corporation biológiailag manipulált veszettségi vakcinával kísérletezett egy chilei farmon. hogy ne zavarják őket az előírások és a szabályok. ha útközben a kapszula eltörik vagy kinyílik. A Biosyn cég alkalmazottai a fertőző. – Belelapozott a jegyzeteibe. Ellie felvette. Minek? – Azt senki sem tudja. Olyan országokba. – Ezek automata génszekvencerek. – Először a Technológiaátadási Hivatal keresett meg – magyarázta Morris. – És konkrétan mit találtak? – Nem sokat – ismerte be Morris. az csak egy nagyképű cím a jelentésemhez – felelte Grant. De a Biosyn úgy módosította a veszettségi vírust. megalkothatjuk az állat sokdimenziós térben elhelyezett képmását. mint amennyivel bármely más amerikai magáncég rendelkezik. hogy az átjuthatott az alveolus pulmonárison. Morris nemegyszer eljátszott a gondolattal. Egyszerűen kibocsátották a vakcinát. és kijelentették. És a Biosyn ma semmivel sem megfontoltabb. hogy bármi rosszat cselekedne – felelte Morris. De a TH egyszerűen nem tudta elképzelni. És az InGen Costa Ricába küldte ezeket a gépeket. alighanem le kell zárnunk a vizsgálatot. hogy az ökológiai hipertérben történik. vagy nem.

Tudnak hadrosaurusbébit etetni. tizenöt-húsz centisre nyitva az ujjait. – Nincs annak a laboratóriumnak valami köze az InGenhez? – Én nem tudok róla – válaszolta Grant. – Mennyi idő alatt érte el a teljes nagyságát? – Három év alatt – mondta Grant. és érezte. – Mit szólsz John Hammondhoz a főgonosz intrikus szerepében? – nevetett Grant. – Sattler doktornő említette. Vehették más hasznát is a magától kapott információknak? Grant felnevetett. Odaértek a lakókocsi ajtajához. amely megőrli őket. Alice Levinnek hívják. hogy az InGen a valóságban mégsem múzeumi anyagot készített elő. és az eredményt jelentik nekünk. – Az Orvosbiológiai Szolgálat Salt Lake Cityben. – Tételezzük fel. és felállt. Grant elindult Morrisszal a kocsi túlsó vége. – Hadrosaurusbébit. Morris a kezét nyújtotta. Nagyon kért. és megpróbál proteineket kivonni belőlük a számunkra. tojást vagy bármi ilyesmit? – kérdezte közben Morris. Különben ki telefonált? – Ja? – szólt Ellie. az ajtó felé. hogy feltegye a napszemüvegét. – Mit gondolsz? – kérdezte Ellie-től. – Ez így nem pontos – mondta Grant. Grant kinyitotta. – Mint egy mókus. mihelyt tudod. – Naiv figura. . A lány vállat vont. hogy bizonyos genetikai munkát is végeznek itt. elküldjük a csontokat egy laboratóriumba. amelyek töröttek vagy valamilyen más okból nem megfelelőek arra. mint Walt Disney. – Melyik laboratórium végzi ezt? – kérdezte Morris. – Egy utolsó kérdés – szólalt meg Morris még egyszer.Morris bekattantotta aktatáskáját. – Szerintem John Hammond nagyjából olyan sötét üzelmeket folytat.. – Miért éppen ők? – Versenytárgyalás. – Szívesen. majd becsukta a lakókocsiajtót. Nem is rossz! Azt magam is megnézném. – Kért magától Hammond bármiféle fizikai anyagot a lelőhelyről valaha is? Csontot. Morris vele nevetett. – Köszönöm a segítségét és a sört – mondta. – Hát hogyne. – Amikor olyan kövületeket találunk. A Columbia Egyetem Orvostudományi Központjában dolgozik. hogy múzeumba kerüljenek. – Óvatosan vezessen a visszaúton! – mondta Grant. – Egy nő. – Nem én. Ezután a proteineket azonosítják. hogy azonnal hívd vissza. ahogyan Morris a kocsijához indult. Ismered? Grant a fejét rázta. – Nem – felelte Grant. – Valamiféle maradványok azonosításáról van szó. Egy pillanatig utánanézett. Ők tették a legjobb ajánlatot. Mekkora volt egy olyan? – Úgy ekkora – mutatta Grant. Morris megállt. – Pár hónap ide-oda. ahogy szinte bezúdul odakintről a forróság. – Még egyszer köszönöm a segítségét..

majd a savfürdőkre összpontosította figyelmét. jól megoldott csalás. és a fejét ingatta. a piltdowni ember körüli csalásra csak negyven évvel később jöttek rá. De hol vannak a kis ragadozók? Snakewaterben több tucat fészekrakó hely volt. A lelőhely is teljesen érintetlennek látszik. hogy tanulmányozhassa.. hát akkor megnézem. Ezt a földet kétszázmillió éve nem taposta három lábujjú gyík. – És biztos. Már rég bebizonyosodott. Nem. – Grant letette a kagylót. Grant vállán át Ellie is megnézte a röntgenfelvételt. Fél füllel hallotta Grant hangját. ez fantasztikus! – mondta Ellie. Ellie csodálta. mint a dromaeosaurus. – Ó. Rajta kellett tartani a szemét. A növényevőket már vizsgálta ebből a szempontból. – Mellesleg van egy új leletem a számodra. – Nem gyík.. 5-től 30 százalékos koncentrációig.. Lassan fújta ki a levegőt. Az elmúlt két év ásatásai során a csoport csak kacsacsőrű hadrosaurusokat talált. egytől három méter magasságig. hogy a csalás lehetősége bármikor fennáll. Annyira könnyű a csontváz. Az afrikai és indiai vadrezervátumokban végzett vizsgálatok. persze. és az elkövető a . teljes fogazat. És kölyök! Ellie tudta: Grant egyik nagy álma. valami álszenzáció az. de szinte előre is garantálom. Déli domb. – Faxon ideküldi a röntgenképét. Talán ez a velociraptor-csontváz azt jelenti. – Átment a telefaxhoz. Ám eddig egyet sem találtak.. az erősebb oldatok nehogy elmarják a mészkövet. Még előfordulhat. milyen izgalomba jöttél! – mondta Ellie. hogy a teljes csontvázra is ráakadunk. igazán nincs időm. Velociraptorkölyök. Állkapocs. Szakszerű. Minden biológus tudja. – Csak nem hiszed. hogy egy tízezer kacsacsőrűből álló csorda mindössze huszonöt tyrannosaurus „ellátására” volt elegendő. – Milyen korú? – Fiatal – felelte Grant. – Tényleg? Grant bólintott. hogy ezek a legelésző dinoszauruszok hatalmas. – Mondom. Rendben.. azt nagyon kétlem. – Miss Levin? Itt Alan Grant beszél. csupa ragadozó. Ez azt jelenti.. hogy nagy ragadozó maradványaira akadjanak. A leghíresebbre. de mégiscsak az. hogy baziliszkuszgyík lesz. A dinoszauruszbébik csontjai pedig ugyancsak törékenyek voltak. A röntgenképre meredt. – Nem – mondta Grant. Miss Levin. legfeljebb négy hónapos. Egyes területeket a szó szoros értelmében elborított a dinoszaurusztojások héja. hogy megjött a szerencséjük.. és várta. Miféle maradványok. miként nevelték kicsinyeiket a húsevő dinoszauruszok. – Te jóságos Úristen! – mondta halkan Grant. az oviraptor. Ellie először arra gondolt. Grant nem válaszolt. – Éppen azelőtt találtam. és sok kis dinoszaurusz tojásokat evett. hogy velociraptor? – Holtbiztos – mondta Grant. Rögtön is küldheti.A CSONTVÁZ Ellie Sattler kisimította elszabadult szőke fürtjeit az arcából. azt mutatják. Eléggé valószínűtlen volt tehát. sajnálom. hogy meginduljon. hogy valami rendkívül ügyes trükk. tíz-húszezres csordákban vándoroltak a krétakori síkságokon. hogy az a srác jött. De ahogy nőtt a bizonyosság. biztos izgalomba jöttél – ismételte Ellie. – De nem gyík. Nem is akármilyen. hogy ritkák lehettek. – Te. ami előttük fekszik. – Két. így az azonosítás tökéletesen biztos. Ez pedig akár az első lépés is lehet az álom megvalósítása felé. De. – Micsoda emberek vannak! Ellie megkérdezte: – Mi ez az egész? – Valami gyíkot szeretne azonosítani – mondta Grant. hogy ez egy amassicus? – De igen – felelte Grant. Jó. hogyan maradhattak fenn egyáltalán nyolcvanmillió évig. négyes horizont.. semmi akadálya. Tömegével kellett itt olyan állatoknak élniük. és kikezdjék a csontokat. mint később majd a bivalyok. – Vagy triassicus. semmi mást. egyre élesebben vetődött fel a kérdés: hol voltak a ragadozók? Természetesen számítottak rá. Hat sorakozott előtte. amelyek a ragadozók és prédáik népességarányaira vonatkoznak. – Képzelem. – Talán végre fordul a szerencse. hogy nagyjából egy ragadozó esik minden négyszáz növényevőre. Hogy micsoda? Mi van magánál? – Nevetésben tört ki. a velociraptor és a coelurus.

az Archaeopteryx hamisítvány. Igen. kiásott gyümölcspatkányt Új-Guineából. azóta kiderült. De más példák is vannak. magánál senki sem járt ott kint? – Az az igazság – felelte Grant –. Én is örülök. Ellie a csatolt feljegyzést olvasta. hogy feltételeztük. Még olyanok sem hallottak róla. – Ez megint Alice Levin lesz – mondta Grant. Ez volt az a környezet. Akadt köztük egy-két millió éves is. Fiatal procompsognathus röntgenképe volt. Grant bólintott. – A példányt a Cabo Blanco-i tengerparton szerezték július 16-án. Túl szépnek. még ennél is sokkal régebbi állatfajhoz tartozott. hogy már volt nálam valaki. Virágkorukat. de gyereket nem. Mi más lehetne? Megszólalt a telefon. – Körülbelül húsz centi a csípőig. Tehát történt már ilyesmi.. Mr.mai napig sem ismert. De az a példány. mint a femur. Megőrült. míg 1938-ban ki nem fogtak egy élő példányt az óceánból. mivel a középső karom a legkisebb. – Hammond? Mit akarhat? – kérdezte Ellie. – Ellie-re nézett.) A sikeres csalás lényege abban áll. amely az Északitól a Délisarkig húzódott.. Természetesen várok. – Gyorsan megmérte. úgy mondta: – Ezt a különcöt! Mint mindig! Ezt neked is hallanod kell! Grant lenyomta a kihangosító billentyűt. hogy nincs rá más magyarázat. – Tényleg? Hogy ön? Ez igaz? Rászorította kezét a membránra. hogy a British Museumban kiállított. A procompsognathus pedig alig ismert állat. – Nos – mondta Ellie –. amelyben a procompsognathus élt. amelyet ők vizsgáltak. és néhány nagy sivatag.. míg elő nem került egy élő példány Melbourne-ben egy szeméttartályból. A procompsognathus a triászkor elején élt. Működő vulkánok százai voltak mindenütt.. mire nemsokára kapott egy élő példányt postán. Még egy gyerek is elég félelmetesnek tűnhetett a szemében. mint a bolygó uralkodó állatfajtája a jurakorban élték. azt tudjuk. várok. A negyedik és ötödik lábujj csontos csökevénye fent volt. majd beleszólt a telefonba: – Igen. Az ausztráliai hegyi törpe oposszumot csak fossziliákból ismerték. Gondolom. csak döglött állatokat evett. – A helyzet az – mondta –.. Ellie összeráncolt homlokkal nézte a röntgenfelvételt. Ja. Vagy hamisítvány – amit kétlek –.. a krétakorban már ki is haltak. – Igen. nagyjából 220 millió éve.. hogy vannak a régmúltból itt maradt. ami azt jelenti. Nem is olyan régen pedig a nagynevű csillagász. hogy az egész állat úgy harminccentis lehetett. Mindenféle esztelen kérdésekkel zaklat mindenkit.. A háromujjú láb egyensúlya jó. A tibia erős és jóval hosszabb. A krokodilok lényegében ma is élő triászkori állatok. elküldi-e nekünk magát a példányt is. – De röntgenképet hamisítani szinte lehetetlen. akkor újrafelfedezés. hogy valódi. – A coelacanthus egy két méter hosszú halfaj volt. amint gyorsan beszél: – . csak úgy. mint a mai. – És a kora? Grant bólintott. vagy amit várnak. Egy zoológus pedig leírt egy tízezer éves. hogy azt tárja a tudósok szeme elé. Fred Hoyle azt állította. ha pedig nem az. – Felvette a kagylót. Sűrűbb volt a levegő. Tisztára önállósította magát. és azt mondja. közel a metatarsális ízülethez. Mindössze ennyit sikerült megmenteni belőle. Hammond. Eszerint az állatot éppen ette egy bőgőmajom. Hammondot. ásatásból származó szárnyas dinoszaurusz. mindenfelé beszél összevissza. hogy valóságos leletről van szó? Élő állatról? Mint a coelacanthus? – Lehet – mondta Grant. ezt kétlem – mondta Grant. amikor bolygónk egész arculata más volt. A csípőnél az acetabulum hiánytalan. Talán egy csecsemőt megharaphatott. hatvanötmillió éve kihalt. hogy hallom a hangját. Először pedig a triászkorban jelentek meg. A föld melegebb. Az Atlanti-óceán keskeny tó volt a majdani Afrika és Florida között. Kapcsolja csak Mr. A mostani földrészek még egyetlen összefüggő szárazföldtömeget alkottak – Pangeának nevezik –. amelyről úgy tudták. a gyík megtámadott egy kislányt. és meglepetten pillantott Ellie-re. lassan már az egész országot bejárja. – Te el tudod hinni. a coelacanthus esetében hatvanötmillió éves. amit látni szeretnének.de újabban az agyamra megy valami környezetvédelmi fickó. tíz-húszezer évesek lehettek. Triászkoriak a cápák is. A nagysága pedig megállapítható. mint egy csirke. . A legtöbb újrafelfedezett állat viszonylag új keletűként szerepelt a fosszilis őslények listáján. – No. A hatalmas kontinenst erdők és páfrányosok borították. – Lássuk. – De tényleg valódi lehet? – makacskodott a botanikusnő. Grant csak a fejét rázta. A farkon negyvenöt csigolya látszott. – Bár ki tudja? A procompsognathus olyan kicsi és könnyű volt. Körülbelül. Ellie számára pedig a gyík röntgenképe szinte hihetetlenül tökéletesnek látszott. – Lehet hamisítvány ez a röntgenkép? – Nem tudom – felelte Grant. túlélő állatok. A dinoszauruszok hatvanötmillió éve. és Ellie reszelős öregemberhangot hallott.. akik különben egészen jól ismerik a dinoszauruszokat. – A kor az tényleg probléma. 190 millió évvel ezelőtt.. (Igaz.

Csodás hely! Trópusi őserdő. hogy folytassa.. százötven kilométerre lehet a parttól. – Ugyanis törvényes úton próbálnám leállítani. – Nem jól értettem. – Hol Közép-Amerikában? Közelebbről is tudja? – Valami Cabo Blanco nevű tengerpart. Értem. Igen. Idegesnek hangzik.. – De hát a kellős közepén vagyok egy. dr. ez teljesen lehetetlen. – Ne mondja! Élő állaté? Ez aztán különös! – Így igaz.. Nem tudom pontosan.. Biológiai rezervátum lesz belőle. Isla Nublar a neve. de szerintem mégis le kell jönnie – mondta Hammond. A mi költségünkre. – Hammond a torkát köszörülte. Hatalmas park! Jövő szeptemberben nyitjuk. a hét végére levitetek egypár embert azok közül. hogy itt hagyjam a.. Morrisnak hívják. az az oka mindennek. amely élő procompsognathidának látszik. Grant Ellie-re nézett. – A múltkor Ian Malcolmnál járt – ismeri a matematikusunkat Texasból? Akkor hallottam róla először. Grant. Szóval ma.. Remek lenne. nem? – Igen. – Nem. semmi vád. A hivatal vezetője erre azt állítja. Eszemben sincs. itt van-e még Morris! – mozgott Grant szája. Már harminc hónapja építkezünk ott. hogy van egy szigetünk odalenn? – Nem én – mondta Grant. A fene egye meg. Zavarta magát? Feltartotta a munkájában? – Nem. és ott kezdtünk dolgozni. mintha éppen most ötlött volna az eszébe a gondolat. ha megtudnánk a véleményét. – Az az igazság – mondta Hammond –. Elképzelheti. Mindenesetre már telefonáltattam az ügyvédeinkkel a Környezetvédelmi Hivatalhoz. – Csak ennyit kérek. s közben Ellie-re nézett.Hammond felhorkant. félek. egy Közép-Amerikában gyűjtött állat részleges töredéke. – Éppen most találtam egy új csontvázat.. Ez természetes. . Nézd meg. nem zavart. Jöjjön le maga is egypár napra. víg erőszakosságával a hangjában.. Ha valaki. példányt? – Éppen ma.. – Küldtem is róla egy kis anyagot magának. Grant! Meg fogja látni. higgye el. az a kölyök le akar menni Costa Ricába. A hangszóróban Hammond köhécselt. Semmi panasz. – Hogy mit? – Hammond beszéde hirtelen lelassult. mint aki oda sem figyel igazán. és.. ha zavarta volna. ebben biztos vagyok. – Éppen most. – De hiszen csak egy hétvégéről volna szó – mondta Hammond az öregek idegesítő. hogy a saját szakterületéről van szó. – Nem is hallottam róla. Némán mozgó szája szavakat formált: Mi folyik itt? Ellie csak a fejét rázta. Megvettük. hogy erőszakos leszek magával. hogy éppen ma kapja meg. Hogy eljusson a szigetünkre. egyszerűen csak zaklatni kezdi az embert egy minden felügyelet nélkül dolgozó kölyök.. – Tudja.. – Igen? Remek. és kinézett. – Ma. – Figyeljen csak! Mondok valamit – szólt Hammond. dr.. és nézzen körül. és hétfőre már vissza is érne. négy éve? Öt éve? Már elfelejtettem. már majdnem kész – mondta Hammond. Élő állaté. de Morris autója már eltűnt. nagy sziget. mi a fene a bajuk. Izgalmasnak fogja találni. Visszafordult. Tényleg el kellene mennie. Szóval amint látja. hogy feltartsam a munkájában. Grant! – Érdekesnek hangzik – felelte Grant –. hogy ott szaglásszon.. – Ezenkívül ugyancsak most kaptunk kézhez egy igen rejtélyes és egészen rendkívüli leletet. Komoly gond megfogni az ilyesmit. hogy megnézze! – Ragyogóan hangzik.. Nézze meg jól! A sziget egyszerűen csodás.. bármilyen furán hangzik – mondta Hammond. akik tanácsadóként dolgoztak nekünk. Megkapta? – Nem. valami Morris. – Lehet. Ellie az ablakhoz ment. – És mikor vette kézhez ezt a. hogy megtudjuk. én tudom... ahogy ez a kormány dolgozik... de itt elég távol vagyunk a. aki csak vesztegeti az adófizetők pénzét. Tudja. Látnia kéne. – Pedig van. ő semmiféle vizsgálatról nem tud! Most ezt rakja össze! Az az istenverte bürokrácia.. – Minden tanácsadónkat felkeresi – mondta Hammond. Egy okoskodó kölyök. hogy az hol. Értem. – Közép-Amerikát mondott? – Igen.. Mi is annak tartjuk. – Sajnos. ez nem éppen a legalkalmasabb időpont arra. A munkát sosem szabad félbeszakítani! De leugorhatna ide ezen a hétvégén. Jellemző arra. de hát. nem mehetek – mondta Grant. – Biológiai példány. Élő procompsognathidát mondott volna? – Úgy van – mondta Grant. El kell mennie. – Hát az elég baj. hm. de hát tulajdonképpen. – Értem. – Ettől féltem. milyen fontos dolga van. dr. – Hammond megint a torkát köszörülte.

. A Környezetvédelmi Hivatal szimatolgatása a lehető legrosszabb pillanatban jött. A holnapi viszontlátásra! – Ezzel Hammond letette a telefont. Útlevél sem kell. ahol maguk táboroznak. Choteau-ban fogjuk felvenni magukat. ő is megkapná ugyanezt. Grant doktor. és szeretném. – Ezt hogy érti? – kérdezte Grant. – Helyes. – Nézze. nem tagadom. Nagyon helyes. A legmagasabbat. Előre is örülök. remek! – mondta Hammond nyájasan... meg késéseink.. hogy van egy kis probléma ezzel a szigettel kapcsolatban. Botanikusra is szükségünk van. – Helyes. Oda tudnak érni addigra Sattler doktornővel? – Azt hiszem. Legyen elég annyi. hogy minél simábban menjen minden. igen. Mit szól? Ellie Grantot nézte. Kevés holmit csomagoljanak. hogy ennyi pénzből két nyáron át finanszírozhatnánk a következő expedícióinkat.. Most kissé szórakozottan szólt a hangja.– Izé. – Remek. Igen. azon a magánreptéren. Hammond. Legyenek ott holnap délután ötkor! Várni fogom magukat. Mondjon véleményt! Megfizetem a szokásos hétvégi tanácsadói díjat. hogy némileg szorult helyzetbe kerültem itt. mintha másutt járnának a gondolatai. . hogy találkozni fogunk. ha a kedvemért megtekintené ezt a szigetet.. És ha Sattler doktornő is nélkülözhető az ásatáson. Az hatvanezer három napra. Ismeri. – Azt szeretném. Onnan aztán egyenesen lerepülünk. Szóval nézze. – Hát különböző problémáink voltak. ugye? Mindössze két órányi autóútra van onnan. az az igazság. magukért jövünk a cég sugárhajtású gépével. amint válaszol. Mr. Ide figyeljen. tudja. Grant doktor! Beszélt már erről valakinek? – Nem.

az mit jelent? – kérdezte Ross. – És Grant beleegyezett. okosan járunk el – mondta Gennaro. – Nem lett volna szabad. Vizsgálatot folytat ellene a Környezetvédelmi Hivatal. Hogy annyi a biztonsági és elővigyázatossági intézkedés. hogy semmi baj azon a szigeten. Borotvaélen táncolt az egész. – De ezek szerint megcsinálta – mondta Ross. Számítógépes rendszerelemző. és Rosshoz fordult.COWAN. amely szöges ellentétben állt azzal. – A fenébe is. – Általános vagy korlátolt felelősséggel? – Általánossal. – No és mit mond Hammond? – Állítja. – De az egyik legfőbb befektetőnk a Hamachi. egyikük pedig – Ian Malcolm a matematikus – nyíltan szembehelyezkedett az egész tervvel. Senki sem hitte komolyan. – Gennaro listát dobott Ross asztalára. hogy meg tudja csinálni. – Újfajta gyík? – Igen – mondta Gennaro. már nyolc éve! A résztulajdont honorárium fejében fogadtuk el. Megkértem Hammondot.. S ha még emlékszel. Daniel Rosst nézte. és Gennaro segített felhajtani a pénzt. igen. Semelyiküknek sem volt különösebb köze a szigethez. a befektetők meg kezdenek nyugtalankodni. Mi az anyagi pozíciónk ott? – Cégünk tulajdonrészesedése öt százalék – felelte Gennaro. – Te szervezed? . Az ügyvédi iroda csúcstechnológiában utazó ügyfeleinek gyakran volt szüksége tőkére. – Nem lett volna szabad ebbe a dologba belekeverednünk. Azonnal körül kell néznünk azon a szigeten. hogy semmit – válaszolta Gennaro. hogy nagyon is ideje utánanézni. hogy nem sikerülhet. a Costa Rica-i üdülőtelepnek csúszik a határideje. kitűnő. – Az első csoport egy paleontológusból.. Túl sok munkás halt meg. Túl sok a kósza hír. Gratulálok. hogy szegődjön a már akkor közel hetvenéves John Hammond mellé. – Miért. hogy eljöjjön.. – Helyes – szólt Ross. – Akkoriban úgy látszott. SWAIN ÉS ROSS A San Francisco-i Cowan. hogy miféle bajok vannak odalenn. Ezen a hétvégén utaznak. Mi a helyzet a helyszíni szakértőiddel? – Olyan szakemberekkel kezdem. – És ki van még? – Egy technikai ember. – Ez már nem játék. – Nem bízhatunk Hammondban többé. mint valami szédületes vágtára. – Méghozzá potenciálisan veszélyes álmodozó – tette hozzá Ross. Swain és Rosshoz. – Meg fogják mondani neked az igazat? – Azt hiszem. Kitűnő. Telefonált s közben főnökét. – Lehet. – De te nem hiszel neki – mondta Ross. még valamikor 1982-ben.. Nem hülyéskedhetünk vele. – Nem hiszek. az volt. – Hammond álmodozó – mondta Gennaro. Ross pislogott. egy paleobotanikusból és egy matematikusból fog állni. Mindjárt az egyik legelső megbízatása. hogy a következő három hét mindegyikén legyen egy-egy független. míg sikerül elegendő pénzt összeszedni az InGen Társaság alapításához. És akkor mindennek a tetejében jön ez az ügy. Swain és Ross ügyvédi irodát elöntötte a déli napfény. A múlt héten pedig éppen a Hamachi San José-i képviselőjétől kaptam egy értesítést. John. igen. mint egy temetkezési vállalkozó. Hammond terve nagyon spekulatívnak tűnt. John – mondta Hammond. Ross a fejét ingatta. aki sötét. – Értem. Állította. Donald Gennaro a befektetési bankok világából érkezett a Cowan. ahogy Donald Gennaro érezte magát. és helyreigazít egy-két kisebb hibát. helyszíni ellenőrzés. Felülvizsgálja a park komputereit. hogy képtelenség. – Letette a kagylót. Túl nagy rajta a nyomás. – Azzal mindenesetre egyetértek. – Nem – felelte Gennaro. Ő már péntek reggelre ott lesz. Gennaro úgy emlékezett vissza az egészre. akiket Hammond még a terv kezdeti szakaszában alkalmazott tanácsadóként. Eszerint valami újfajta gyík gyerekeket harapdál a tengerparton. Velük megyek én is. részemről rendben. A végén majdnem egymilliárd dollárt hoztak össze. olyan vidámságot kölcsönözve a szobának. csíkos öltönyében olyan hűvös volt. hogy a szárazföldön találtak egy ilyen élő procompso-micsodát.

amit tudott. hogy szeretném megköszönni. Üdvözletem Sattler doktornőnek. dr. Jó néhány éve már. ez a pro. – Itt Grant. Fel akar vágni a szigetével.. amíg önök ott tartózkodnak. – Nos. éppen most beszéltem telefonon John Hammonddal. – Akkor jó – mondta Gennaro. csak afféle társasági meghívásról volna szó.. majd egy hangot. – Halló. önt is. hogy meg is történjék. hogy holnap látni fogom őt is. amelyet találtak. dr. csak annyi az egész.. hogy ott lesz – mondta Grant. Azt hiszem.. . – Állítólag már holnap indulunk. – Csak egy röntgenképet láttam. mintha nem volna semmi baj. – Lenne olyan szíves. Grant elmondta. – Nos.. – Ezzel Gennaro letette a kagylót. Gennaro tárcsázott. – Így esetleg megszerezhetném azt a példányt John Hammond számára. A Columbia Egyetemről hívott fel miatta egy nő.. itt Donald Gennaro! Az InGen általános jogi tanácsadója vagyok. az.procom. hogy jöjjön ő is. – Az. – De gondoskodj róla. aminek történnie kell! Légy ura a helyzetednek! Egy hetet adok rá. aki egészen lázba jött a hallatára. amiért ilyen gyorsan elvállalta. és kivonult a szobából. Talán el tudom intézni.. Előbb csak a rádiótelefon sziszegő zúgását hallotta. – Úgy van – szakította félbe Grant. Nyilván szeretné látni a saját szemével is. Grant? Mármint a valóságos példány maga? – Nincs – mondta Grant. megpróbál úgy tenni. Nagy örömömre azt hallottam tőle. akárcsak ön. Ismeri? A Texasi Egyetem tanszékén van Austinban. egyáltalán emlékszik-e. Örülök.– Hammond maga akarta lebonyolítani a telefonokat. ez a bizonyos példány. – John Hammond említette. – Hát jó – mondta Ross. hogy leküldjék a szigetre. – Nos – mondta Gennaro –. és elmondaná a részleteket is? – kérdezte Gennaro. hogy nem voltunk kapcsolatban. – Emlékszem – szólt Grant. Felkértük Ian Malcolmot is. Apropó. hogy maga is eljön a Costa Rica-i szigetünkre. hogy ez a Costa Rica-i probléma megoldódjék! – Ross felállt. Nem tudom. Maga az állat New Yorkban van. aki szintén az első tanácsadóink közé tartozott. ez kitűnő.. Grant – mondta Gennaro. Magánál van ez a példány. Grant doktor. vagy micsoda? – Procompsognathus – mondta Grant. – Egyébként magam is ott leszek.

Kedves Alan és Ellie! Amint látják. – A legfelső oldalra lapozott vissza. hogy magukkal is megbeszélhessem. MŰSZAKI MUNKÁLATOK: LÁTVÁNYTERVEZÉS: ELEKTROMOS MUNKÁLATOK: COMPUTER C/C Grant magukat a terveket kezdte nézegetni. Misikawa. Főtanácsadó: A. De valami képet ez is ad az Isla Nublar-i munkálatok céljáról. a mutatós propagandaanyagok terén még nem állunk valami fényesen.” . NEM TERJESZTHETŐ. Grantnak feltűnt a kék-fehér InGen-embléma. Palo Alto. és mindegyiken ez állt legfelül: „Ezek a tervrajzok az InGen bizalmas. Kicsinyítve voltak. Hammond a feladó. Üdvözlettel John – Nem értem – mondta Grant. Cambridge. Bélyegző volt rajtuk: IPARI TITKOK. V. Végigpörgette a lapokat. Tokió. Makasawa Integrated Computer Systems. velünk tudnak jönni. New York. Kobayashi. Boston (szerkezeti). LÁTOGATÓKÖZPONT KASTÉLY MEGBÍZÓ ÉPÍTÉSZEK ISLA NUBLAR ÜDÜLŐKÖZPONT InGen Inc. vastag könyvecskévé összefűzve. Remélem. T. Kísérőlevél nem volt benne. nagyon izgalmas! Alig várom.. MÁSOLÁS TILOS. Calif. Inc. Ashikiga. Dunning. Amikor kihúzta. Tervezési társtulajdonos: Richard Murphy. dokumentumot.TERVEK – Most jött – szólt másnap Ellie. A. Ieyasu. Amint felcsapta a könyvet. Murphy és Tsai. Szerintem. – Ezek építési tervrajzok. Kanazawa N. A. meg BIZALMAS. – Az egyik srác hozta a városból. Az oldalak be voltak számozva. MUNKAPÉLDÁNY. London. belső célra készült jogvédett alkotásai. H. kihullott belőle egy papírlap. ahogy felszakította a borítékot. hogy csupa tervrajz. akkor bűnvádilag felelősségre vonható. Whitney Fields. Főtervező: Theodore Chen. kiderült. Osaka (mechanikai) Shepperton Rogers. Projektfőfelügyelő: Dennis Nedry. R. A borítón ez állt: AZ ISLA NUBLAR ÜDÜLŐTELEP VENDÉGLÉTESÍTMÉNYEI (TELJES DOKUMENTÁCIÓ: SZAFARIKASTÉLY) – Ez meg mi az ördög? – kérdezte. és egy vastag barna borítékkal a kezében a lakókocsi végébe ment. Adminisztratív társtervező: Sheldon James Harlow. Mass. Ha ön nem írta alá a 112/4A sz.

amelyeket vizesárkok és elektromos kerítések választanak el az úttól. Többnyire pedig mellettük fut az út is. Az oldalnézet vázlatokon látványosnak látszott: hosszú. És az utak a talajszint fölé voltak emelve. hogy ez a kietlen táj soha sem változik semmit. Hunyorgott a napfénytől. – Mondom – ismételte Grant. Ebben a pillanatban tompa robaj hallatszott. de a valóságban szüntelenül . ha be is fejezi. Grant félretette a papírokat. kis ablakokkal. – Most mi történt? – Elveszett a bemenő integrátor – mondta az egyik fiú. hajlott területrészekre nézett. pontosan keresztül a sziget központi dombjain. Ezek az építmények mind betonból készültek. jobb. – Hát tudod – mondta Ellie –. mesterségesnek tűnő tó. – Utálom a komputereket! – mondta Grant. hogy megvan rá az oka – így Ellie. amelyeken szinte semmi építmény nem volt.” és „Szafarikastély”. Amennyire Grant látta. hogy minden területrészen akad egy-két építmény.– Kissé paranoidnak látszik – mondta Grant. betongátakkal. gondoskodni akarok a lelet biztonságáról. általában félreeső sarkokban. Semmi kétség: kis velociraptor volt. hosszú nyaka hátrahajolva. A monitorról eltűnt a kép. mintha szántszándékkal nagy. Grant lehuppant a domboldalra. – Elektromos kerítések egy üdülőtelepen? – Méghozzá kilométerszám – tette hozzá Grant. hogy elvész. Az oldalnézeti domborrajzokon úgy néztek ki. /D/TRIC/L/5 (4A + 1). – Elektromos kerítések és vizesárkok. És mindet betonból készült vizesárok határolta el az úttól. ezen belül pedig az épületek ilyen elnevezéseket viseltek: „Látogatók érkezése”. „Látogatóközpont/Adminisztráció”. Mint a régi háborús filmek náci géppuskafészkei. A sziget többi része még rejtélyesebb volt. Az egyik srác hallotta. hogy mit jelent: a kerítésekben áram van. Ezután következtek magának a Szafarikastélynak részletes rajzai. A főútvonal északról délre tartott. „Hammond Réz. Az utakat különösen helyezték el. Aztán Ellie-hez szólt: – Akkor ezt az ősrégi módszerrel fogjuk megcsinálni. mint valamiféle betonbunkerek. A gépet a négyes számú domb tetején egy sörösládára állították. de semmit sem talált. hogy át lehessen látni a kerítés fölött. ezek a méretek helyenként döbbenetesek! Nézd meg ezt! Ez a betonárok legalább tíz méter széles. Mindegyik ilyen területet kódok jelöltek. Az árkokon kívül kerítés volt. nagy részét szabad terület töltötte ki.. meg egy-egy külső épület itt-ott. Grant jól látta egy úszómedence körvonalait. A bontás ezúttal hibátlanul sikerült. nem messze attól a szerkezettől. aki közben felfedezte. és tökéletesnek látszott. – Tán kivették – mondta a lány. alacsony épület. Grant gyorsan átforgatta a lapokat. Egyre inkább kezdett úgy látszani. – Van megfejtés a kódhoz? – kérdezte Ellie. és vizsgálgatni kezdte az elemmel működő. És mielőtt elmegyek. zárt területeket hoztak volna létre. – Mint valami állatkert – mondta Ellie. – Lehet. Hat ilyen részterület volt az egész szigeten. amelyet mintha a szó szoros értelmében belevájtak volna egy szikla oldalába. keskeny. míg rá nem jöttek. egy folyó fölött. a teniszpályák négyszögeit és a növényeket és sövényeket jelölő kerek rajzjeleket. – Üdülőtelepnek látszik. és az órájára nézett. – Kész paranoia. De a sziget legnagyobb része nagy. – A nagy.. aztán a számítógép képernyőjén tisztán megjelentek a sárga körvonalak. Utak és alagutak hálózata borította. – Hát ez furcsa – szólalt meg Ellie. amelyeket elválasztott egymástól az úthálózat. s volt egy olyan útszakasz. Alan! – Nézzétek! – mondta Grant. az biztos – szólt Ellie. – Egy pillanat! – Lehajolt. Mint egy katonai erődítmény! – Akárcsak ezek az építmények – mondta Grant.. /LN/OTHN/C/4 (3A + 1). LÁTOGATÓTERÜLET – ez volt az északi szekció megjelölése. és alaposabban szemügyre vették a körvonalakat. amelyet Döngetőnek neveztek el. vastag falakkal. Ha az ember egyszer hozzákezd egy őslelet feltárásához. és Alan Grant előtt ott volt a csontváz gyönyörűen meghatározott képe. – Ugyan.. Ezen eltűnődtek egy darabig. egy sor piramisszerű formával a tetején. és /VV/HADR/X/11 (6A + 3 + 3DB). „Energia (Sólepárlás) Tartalék”. és így szólt: – Vissza a munkához! – Tűz! Egy kicsit reszketett még a kép. A látogatók mindig azt hitték. /P/PROC/V/2A. – Nem késhetem le a repülőgépet. hajlatokat formáló területekre oszlott. hordozható számítógép hátuljába befutó dróttömkeleget. aztán egy hosszú. Újra elővették a topográfiai térképet. mert különben kockáztatja. De a látogatóterületen belüli többi épületen nem volt semmi különös. mentén kis fényjelzés.

Előadóként az egyetemen Grant más hasonlatokkal igyekezett érzékeltetni a dolgot. felnőtt velociraptor azonban valami egészen más volt. miután a nagyok kielégítették az étvágyukat. aki egyszer s mindenkorra megcáfolta ezt az elméletet. A kitekert nyak eszerint a haláltusáját vívó dinoszaurusz végső agóniájának jele. A srácok viszont állították. Egy ilyen finom ősleletet még egy kisebb zápor is elmoshat. Ezek az emberi élmények aligha készíthetnek fel bárkit is. – Meddig várjak még? – kérdezte Grant. – De nem hinném. mint a piramisok életkora. hogy a víz irányított módon folyjék le. hogy egyes tudósok elméletet alkottak a magyarázatára. Azokból a hullákból táplálkozott. Egész nap hallani lehetett a morzsolódó domboldalról leguruló kavicsok zaját. hogy így hatékonyabban ássanak. méghozzá szó szerint az ember szeme előtt. hogy igen sok madár. Ennyi telt el azóta. Grant látta. A Döngető most úgy hét méterre lehetett tőlük. Grant visszament. Látszani is alig látszott a képernyőn. hogy a számítógép az oka. – Ez a bébi alighanem dögevő volt. Ennek semmi köze a halál okához. a hátsótest felé. amelyekkel a felnőttek végeztek. Valószínűleg a legfalánkabb dinoszaurusz. hogy felhasítsa vele az áldozat testét – ennél a kicsinél nem volt nagyobb egy rózsatövisnél. A gyermek egy évtized alatt felnő. abból következik. hogy felfogja. – Nem is volt az – felelte Grant. csak a fej és a nyak hajlik hátra. A kérdés csak az volt. míg vissza nem tér. a terepen gyalázatosan érzékenynek és megbízhatatlannak bizonyult. amelyet a legképtelenebb helyen állítottak le. a velociraptor gyors volt. Feltehetőleg az intelligenciája is hasonló lehetett. tizennyolc centis. és apró harapásokkal tépkedték a dögöket. Ez esetben a nyolcvanmillió év még mindig 3542 évet jelentene. A velociraptor egyébként is könnyű felépítésű dinoszaurusz volt. ami több. A kicsik csicseregve átmásztak az alvó nagyok testén. hogy a Döngető puha ólomlövedéket lő bele a talajba. Szóval a velociraptor nagyon-nagyon régen elpusztult már. – Valahogy torznak látszik – mondta a srác. hogy ponyvával fedik le a területet. A berendezés ugyanis. – Nem is – mondta Grant. Ez az új eljárás abban állt. amelyeket a számítógép leolvas. Aranyos kis cicák lehettek! Egy kifejlett. háromdimenziós kép nyerhető a csontokról. mit jelent nyolcvanmillió év. . Éppen a következő puha ólomlövedéket töltötték bele.és gyíkfaj egy olyan nyaki ligamentum-összehúzódáson megy keresztül a halála után. éles fegyverré fejlődött. Aztán mindig fennállt egy váratlan zivatar lehetősége is. Alan. mekkora árkot igényel a velociraptor csontváza. és ennek alapján egyfajta röntgenképet állít össze a domboldalról. s a monitorra nézett. Bár a termete viszonylag kicsi volt – nagyjából mint egy párducé –. Az ezüstnek néhány nap elég a megfeketedéshez. aztán ott felejtettek. Gondoskodni kellett a védelméről. Egyformán jól támadott éles fogaival. hogy maga az ásás fölöslegessé válik. Nem volt komoly. kerekes ezüstdoboz.folyt az erózió. Eljön az ásatás nélküli felfedezések kora. mint a madáré. Próbáljuk meg képzeletben az átlagos emberi életet – hatvan évet – egyetlen napba sűríteni. s amelyek ott száradtak a napon. Azt pedzették. hogy meghatározták vele a leletek kiterjedését. – Már megvan. a körzetet pedig körülárkolják. Leginkább egy mozgó fagylaltárus tolókocsijára emlékeztetett. Nagy. A leletvédelem rendesen annyit jelent. amely a felnőtt állatnál hajlott. Grant részben feltárt csontváza tehát veszélyben volt. Az a sok-sok idő. Valóban fiatal példány volt. esernyővel a tetején. amikor bebizonyította. hogy ez a csontváz oldalirányban is elcsavarodott. A CAST-programnak eddig csak annyi hasznát vették. Megint előtte volt az élénksárga vonalakkal kirajzolódó csontváz. Egész nyáron ezt az eljárást alkalmazták. Ennek meghatározására a számítógépes hangtomográfiát alkalmazták (rövidítése az angol szavak alapján CAST). amelynek következtében a nyak jellegzetes módon hátrahajlik. amely valaha csak élt. Ez a nyakhajlat annyira gyakori volt a fossziliáknál. úgy. intelligens és könyörtelen. – Csak az idő. Ez azonban még a jövő zenéje volt. karmos mellső lábával és leggyilkosabb fegyverével: a hátsó lábán lévő egyetlen. s ez forradalmasítani fogja a régészetet. Grant tisztában volt vele. Két ifjú legény kezelte. hogy az emberek nem tudják felfogni a földtörténeti időt. Tökéletes. hogy ez a kis állat elpusztult. hogy egy-két éven belül olyan pontos képet tudnak majd létrehozni a képernyőn ezzel az eljárással. változó sikerrel. Itt – úgy látszott – a csontváz tökéletes rendben van. A velociraptor legfőbb jellegzetessége – az egy lábujjú karom. hatalmas karommal. A húsevők akár a saját súlyuk 25 százalékát is el tudták fogyasztani egyetlen étkezés alkalmával. mert megmérgezték őket a növényekben kialakuló alkaloidák. csontjai finomak. – Nem tűnik valami félelmetesnek – mondta az egyik srác. hogy a bal láb és lábfej a gerinc fölé emelkedik. Az alma percek alatt megbarnul. Az emberi élet egészen más időskálán folyik. ezzel rezgéshullámokat kelt. amely tökéletesen működött a laboratóriumban. hogy a tetem kiszárad a napon. Egy rakás komposzt egyetlen évszak során lebomlik. hogy a dinoszauruszok azért haltak ki. s alkalmas volt arra. erős. Grant volt. után pedig elálmosodtak.

Mindannyian tanultak etológiát. bordáikat.. ahogy maga elé képzelte. A diákok bólogattak. viselkedéstant. A kölykök leölésével az összes nőstény tüzelni kezd. náluk sokkal hatalmasabb dinoszauruszokra. Oly kevéssé ismerik a dinoszauruszok életét – gondolta Grant. Betegség. és tudták. Elég egy kétméteres négyzetet lefedniük. Még az is. torkukat szaggatják. a hátukra ugranak. hogy a nőstények más hím leszármazottainak felnevelésére pocsékolják az idejüket. milyen legyen a vizesárok. az első dolga. – A vadonban magas a gyermekhalandóság. Azt ugyanis tudjuk. akármi. s így megtermékenyítheti őket. Grant segített leverni az utolsó póznákat. muszáj! . hogy egy felnőtt támadta meg. Az oka egyértelműen genetikai: a hím célja – hiszen így fejlődött –. amint egy tucat ilyen vadállat teljes sebességgel ráront a békésen legelésző. amely lefedte a domboldalt.. hogy például amikor új hím veszi át az oroszlánfalka vezérségét.” – Mennünk kell! – mondta Ellie. amilyenben csak tudja. Bármi lehet az oka. és mindezek ellenére alig van elképzelésük arról. – Fogy az időnk! – hozta őt vissza a való világba Ellie. lemaradás a csoporttól. Ellie közben kibontotta a ponyvát. Egy csapásra azt is megakadályozza.„A velociraptorok falkában vadásztak. hogy az együtt vadászó velociraptorfalkát is egyetlen hím uralta. hogy valaha is megtudjuk – felelte Grant. hogy az összes kölyökkel végezzen.. Grant utasításokat adott. Micsoda látvány lehetett!” – gondolta Grant. – Hogyan pusztult el a bébi? – kérdezte az egyik fiú. hogy a csontváz viszonylag kis területen helyezkedik el. „Ki tudja? Lehet. A számítógépes képből tudták. – Kétlem. Az afrikai vadasparkban egyes húsevőknél a hetven százalékot is eléri. milyenek lehetnek a dinoszauruszok a valóságban. de fogalmunk sincs a csoport társas viselkedéséről. – 150 éve ásnak és kutatnak szerte a világon. – Ha ötig el akarjuk érni Choteau-t. hasukat. hogy ezek az állatok falkában vadásznak. hogy olyan tág körben terjessze el a génjeit..

hogy a miniatürizáció folyamatában az elefánt magatartása lényeges változásokon ment át. Lógázta. a Sziklás-hegység irányába repültek. a lába nem ért le a szőnyeggel borított padlóra. mint .. hormonális beavatkozások segítségével. Volt valami gyermeki a pasasban. viszont az elefánt nem genetikai eljárással készült.. khakiszínű sortok meg trikók és borotvakészlet. ami kiviszi a repülőtérre. valahányszor elfelejt becsomagolni. Donald. Dan. mint az alvó papagáj kalitkáját. A titkárnő kiment. valamint Hókuszpókusz bácsit. 1983-ban. kelet felé. – Nem lehetek ott a kislányom születésnapján. Aztán az elefánt nagyon hajlamos volt a megfázásra. Mr. Hogy élvezné az új parkunkat Costa Ricában! Gennaro már el is felejtette. Atherton. reszelős hang. jól. Gennaro – jegyezte meg –. hogy Gennaro elutazik. mint ahogy Gennaro emlékezetében élt. ám inkább olyan volt.. – Én megtettem. A felesége nem fogadta kitörő örömmel. többnyire Gennaro vitte be a terembe. A ketrecet. Ne is gondolkodj! Csak csináld! Érted. az apró élőlény szabályos elefántnak látszik. mindjárt magának is szeretett volna egyet. Hammond minden pénzszerző összejövetelre magával vitte. Ráadásul Athertonnak sosem sikerült másodpéldányt előállítani a minielefántjából. Annak idején. – Van benne tornacipő a maga méretében. köszönöm. – Tudja. amely alig volt nagyobb egy macskáénál. Donald. amelyet takaró borított. Még az árcédula is rajta volt. – Értem – mondta. – Manapság már soha fel sem hív – mondta szemrehányóan Hammond. Az elefánt huszonöt centi magas volt. mielőtt Atherton gondoskodik az utánpótlásról. De ha komoly. tapsvihar tört ki a láttán. majd egy drámai pillanatban lerántotta a takarót. – Hiányoltam magát. – Hát ez nagyszerű! A gyermek igazi áldás. Kicsiny teste. nem szívesen utazik el. és harminc centi hosszú. Óriási befektetésről van szó! – Akkor sem habozhatsz. Például azt. és előtűnt az elefánt.HAMMOND Gennarro titkárnője vadonatúj bőrönddel a kezében sietett be a szobába. csak az agyara volt csökött. Amint elhaladt a csupa üveg tanácsterem előtt. amit Hammond sejtetni engedett. és mesterséges anyaméhben keltette életre. nehogy az elefántja kimúljék. – Jó utat! – mondta Ross. és kijött hozzá. mekkora a baj odalenn. pedig Hammond ma már. Hammond azt is elhallgatta befektetőjelöltjei elől. Az is előfordult. ha hűvös lenne. hogy Norman Atherton laboratóriumából ismeretlen csodák egész sora fog majd kikerülni. Lent várja a kocsi. Már egy kislányunk is van. Amanda sem. Dan Ross felállt az asztaltól. Elizabeth remekül érzi magát. Hogy van a bűbájos felesége? – Nagyon jól. kedves fiam! – mondta a jól ismert. Hammond leadta szokásos beszédét a „fogyasztócentrikus biológiai technológiáról” – ő nevezte el így –. – De hát Hammond. mert aki csak látta a kis állatot. az az érzésem. mennyi is lehet? Hetvenöt? Hetvenhat? Ott valahol. Az alakja hibátlan. nehogy félreértés legyen. amit ennyi idő alatt lehetett – mondta a titkárnő. Öregebbnek látszott. Jó is lesz. uram – felelte Gennaro. Az elefántnak mindig óriási sikere volt.. s ilyenkor mérgesen horkantott. amit mondok? Gennaro bólintott. sok mindent elhallgatott. fiam? – Köszönöm. Ahányszor csak prüszkölt egyet kicsiny agyarán át. miközben beszélt. Hátradőlt a Gulfstream-11-es típusú sugárhajtású gép párnázott ülésén. Hammond imádta a feltűnést. különösen télvíz idején. Menet közben tépte le az árcédulát a bőröndről.. hogy genetikai céget akar alapítani. nehogy lekésse a járatot. Ahogy az ülésen ült. amelynek most jött el az ideje. – De tisztázzunk valamit. hogy agyaracskája a ketrec rúdjai közé szorult. máskor meg fertőzéseket kapott az agyara szegélyénél. Ez sem volt akármilyen teljesítmény. de hát már vagy öt éve nem látta. hogy pénzre van szükségük. – Amanda születésnapja szombaton lesz. ha indul. miközben szabadulni próbált. – Hammond le van szarva! – mondta Ross. a Stanford Egyetem egykori genetikusa Hammond üzlettársa volt az új vállalkozásban. Hammond reszketett.. akkor a földig égeted az egészet. Farmer és pulóver. Atherton egyszerűen fogott egy törpeelefántembriót. Hammondot rettegés töltötte el. Elisabeth sivalkodó négyéveseket hívott meg a zsúrra. Már csak azért is. hogy igaza van – mondta Gennaro. Én sem tudom. Gennaro elindult a folyosón. Világos? – Úristen. – Hát hogy van mostanában. mennyire alacsony ember Hammond. Mutatványosnak született. Ekkor Hammond közölte. pedig igazán mindent megtett. Csakhogy amikor Hammond az elefántról beszélt. állandóan egy elefántot hurcolt magával egy kicsi ketrecben. – Fiam. – Lehet. a híres-nevezetes varázslót. Meglehet. azzal kecsegtetett. de semmi köze sem volt ahhoz.

gyógyíthatatlan rákban szenvedett. Gennaro vállat vont. Az öreg most éppen tudomásul sem veszi. Donald. – Fantasztikus! Na és a többi. Gennaro megjegyezte. Mind a helyén van. Donald.. – Mennyi? Kétszázharmincnyolc? Az öregúr kuncogott. éppen a hivatalos nyitás előtt. amit tervezett? A létesítmények? A számítógépek? – Minden megvan. – És egyáltalán. néven bejegyzett társaságot. Mindennek ellenére Gennaro segítségével Hammond összeszedte a pénzt. olyan érthetetlen ez az. Csak a japán befektetőkben volt ennyi türelem.. – Már hogyne tudnám – mondta Hammond. társasági kirándulásról volna szó. – Dehogy jelent – válaszolta Hammond. – És mindenből a legkorszerűbb. – De természetesen a Costa Rica-i terv végső céljáról sem feledkezhetünk meg: pénzt akarunk keresni – fűzte hozzá Hammond. Könnyen leharapott ujj lehetett volna a vége. Gennaro akarata ellenére elmosolyodott. Hammond igyekezett visszatartani az embereket. Coney Islanden is. mint a csík. A repülőgépen ülve Gennarónak az járt a fejében. Ez sok befektetőt elijesztett. hol vagyunk már attól! Kétszázharmincnyolc állatunk van. aggályoskodás. Kísértetkastély. – Nos. – Azt maga el sem tudja képzelni! Egész csordáink vannak! – Kettőszázharmincnyolc. amire fel lehet ülni. – Most van a kislányom születésnapja. Donald – mondta. – És az állatok? – Az állatok természetesen már ott vannak. Nagyralátásban és lelkesedésben nem volt hiány. kalózbarlang. 1983 szeptembere és 1985 novembere között John Alfred Hammond és az ő „Vastagbőrű Vállalkozása” 870 millió dollárnyi befektetési tőkét gyűjtött össze.. hogy megindítsa tervezett cégét. vadnyugat. hogy az egész világ képzeletét megragadják. legmodernebb szórakoztató parkjáról – vurstlijáról – van szó. amelyet Hammond annak idején a befektetőknek adott el újra meg újra. hogy Norma Atherton – ő volt az agy az üzleti tervek mögött – halálos beteg volt. Mindennel le kell állnunk. az International Genetic Technologies. Úgy viselkedik. hogy életképes-e az egész elképzelés. Donald. hogy a családját nem hozta magával. Már elhalasztották a nyitást. minden – felelte Hammond. – De a szálló már kész. földrengés – mindezt megtalálhatja akárhol. – Az várható volt. Donald – mondta Hammond. Nincs a világon semmi gond azzal a szigettel. – Ez hihetetlen – mondta Gennaro. hogy bekövetkezik. Ez volt az utolsó apróság.... – Nézze. mozgó dolgok – az is van mindenütt manapság. A világ legfejlettebb. mintha pusztán valamiféle vidám. Nem hullámvasútról meg mindenféle más herkentyűkről. hogy az! – Hammond meghúzgálta a sportzakója mellső zsebéből kikandikáló díszzsebkendőt. csak éppen az volt teljesen bizonytalan.. hivatalosan még nem – felelte Hammond. meg egy bűvészt. És hány faj? – Tizenöt különböző faj. Az van mindenütt. Láthatóan élvezte Gennaro megdöbbenését. Inc. – Rengeteg pénzt! – Emlékszem – mondta Gennaro. harapós. az eredeti elképzelés szerint azt remélte. hogy voltaképpen az egész utat Gennaro ügyvédi irodája kényszerítette rá. másfelől legalább öt évig nem ígért osztalékot a tőke után. – Ja. hogy tizenkét. Várható. És még több is összejött volna. – Emlékszem. és kibámult a gép ablakán.. Már meghívtunk húsz gyereket. nehogy simogassák.egy gonosz kis rágcsáló: gyors. így végül többnyire japán konzorciumok maradtak mellette.. hogy van az ilyesmi. amelyet Hammond elfelejtett megemlíteni... elektronizált. amire szüksége volt. Tudja. de hát Hammond egyfelől ragaszkodott a tökéletes titkossághoz. mennyire kerüli Hammond.. – Ó. „Animatronikus” környezet. Majdnem ugyanazt a beszédet hallotta szóról szóra. amely összekapcsolja a legfrissebb elektronikus és biológiai technikákat. a terve mélységesen spekulatív volt. így mi biológiai látnivalókban gondolkodtunk. – Igazán kár. Élő látványosságokban. igaz? – kérdezte Gennaro. – Akkor egy ellenőrző vizsgálat sem jelent problémát. örökké mérges. Valami csodás az egész! Ezért olyan. Maga is meggyőződhet majd róla. – Csak éppen lelassítja a dolgokat. Amelyek olyan döbbenetesek. – Miért? – kérdezte Gennaro. – A gyerekek mindig előre beleélik magukat a dolgokba. Különös tekintettel arra. – Hogy ezt megértse. . egy kicsit vissza kell térnünk az üdülőtelep eredeti elképzeléséhez. készen áll már a park a látogatók fogadására? – kérdezte Gennaro. így van hol lakni. – Amúgy is több késésük volt. hogy szembenézzen a valósággal. És bár Hammond magabiztosan kilencmilliárd dolláros évi bevételt ígért 1993-ra.

hogy egy ilyen parkkal igazán nagy pénzt lehessen keresni – folytatta Hammond –.. Egy harmadik pedig exkavátorbaleset következtében. De most már hónapok óta nem volt semmiféle balesetünk. – Emlékszem. a karbantartókét. Csökkenteni kell a személyzet létszámát. – És összesen három volt halálos kimenetelű. – Azt hallottam.. Maga tán hallott már komolyabb számítógéprendszerről. Olyan park kell. amit csak lehetett.. az állatokat. normális. – Szóval csak a szokásos. – Munkások haltak meg. amely minimális személyzettel működik. több baleset is előfordult – válaszolta Hammond. – Kérem. Az étkeztetőkét. történt egy-két baleset az építkezés során – mondta Gennaro. az indítással kapcsolatos késésekről volt szó? – Úgy van – szólt Hammond.. óhatatlanul adódnak bizonyos problémák. hogy amikor az ember összehozza az egészet. a takarítókét. amely időre elkészült. – Kezét a fiatalabb férfi karjára tette. – Csakhogy a leplezetlen igazság az – mondta Hammond –. amikor azt mondom. és be is indult? Mert én még nem. Hát ezért fektettünk annyit az egész számítógépes rendszerbe. a szigeten minden a terv szerint halad! Azon a szigeten minden a legtökéletesebb rendben van! A hangszóró életre kelt. Mindent automatizáltunk. januárban. . Donald – mondta –. – Igen. kérem! Rögtön leszállunk Choteau-ban. higgyen nekem. a jegyszedőkét. Két munkás a sziklaút építésekor halt meg. a számítógéprendszereket. Megszólalt a pilóta hangja: – Csatolják be a biztonsági öveket.– Annak pedig. egyetlenegy a titka. – Csak a szokásos késésről.

Hammond Gennaróhoz fordult. nem tagadhatja meg tőle. hogy négy óra lesz az út Dallasig. Donald úgy véli. Engedjék meg. fontos. milyen szűk a hely odabenn. A patrónus az patrónus. Dinoszauruszokat ásnak elő. amíg a karcsú testű Grumman-gép leír egy kört. . ahol csúcsos dombok meredeztek. kérem! – szólt a stewardess.. A gép megállt. – Tisztába kell tenni egy-két dolgot. Mindig is ez volt. hogy ha John Hammond a segítségét kéri. Gyorsan kezet fogtak. és hozzákezd a leszálláshoz. – Rühellek a pénzeszsákok kedvében járni! – morogta Grant. Össze kellett görnyednie. Ez a dolgok rendje. Függetlenül attól. Ragyogóan szabott Armani-öltönyt és drótkeretes szemüveget viselt. Ellie vállat vont. – Foglalják el a helyüket. majd továbbindulnak Costa Ricába. miközben bezárta az ajtót. – A munkánkhoz tartozik ez is.. Grant tudta jól. Harmincas évei közepén járhatott. és gyorsan gurult feléjük. – Nyilván tisztában van vele. a közönség legnagyobb meglepetésére és gyönyörűségére. Sattler – mondta Hammond. Ellie a vállára kapta a táskáját. hogy senki se tudjon semmit egészen addig a napig. Míg számos tudományterület – mint például a fizika és a kémia – növekvő állami támogatásban részesült. – Ez a bizonyos sziget. s egy kék ruhás stewardess kinyitotta az ajtaját. – Nem leszünk odalenn negyvennyolc óránál tovább.CHOTEAU A forró. Tán valami titkos dolog folyik ott? – Bizonyos értelemben igen – felelte Hammond. de egy kissé sietős az utunk. ahová megyünk. száraz sivatag a messzeségbe nyúlt. Másnap reggel érnek oda. hogy maga nő! – Pedig előfordul az ilyesmi – mondta Ellie. – Higgyenek nekem! – mondta Hammond Grant felé fordulva. míg hivatalosan meg nem nyitjuk a szigetet. Port fújt és száradt ágakat görgetett ide-oda a szél a repedezett betonon. mintha valami vicceset mondott volna. – Hát az attól függ – szólt Gennaro. Gennaro meglepetten megszólalt: – Nahát! Nem is sejtettem. neki sem tetszik a pasas. és Grant tudta. Gennaro zömök. A gép azonnal meg is indult. korábban még csak nem is hallottam róla. izmos férfi volt. ahogy Hammondhoz lépett. Paleontológusok. hogy bemutassam munkatársamat. mi dr. Grant becsatolta az övét. Grant és Ellie a dzsip mellett állva várták. a paleontológia még mindig nagy mértékben függött bizonyos gazdag magánemberek adakozó hajlandóságától. – Aztán elnevette magát. A pilóta bejelentette. bármilyen fényűző is a berendezés. Grant első látásra ellenszenvesnek találta. – Dr. hogy mielőbb odaérjünk. – Nagyon vigyáztunk rá. Grant meglepetten tapasztalta. hogy kezet rázzon vele. Örülök. hogy maga is kíváncsi volt arra a Costa Rica-i szigetre. Grant és dr. A kis sugárhajtású gép leszállt. Sattler foglalkozása. – Elnézést kell kérjek – mondta Hammond –. ahol feltöltik a gépet. Donald Gennarót. Amikor Ellie is a kezét nyújtotta. – És meddig leszünk Costa Ricában? – kérdezte Grant. hogy velünk tartanak. Grant és dr.

Ezt a halat könnyebb volt észrevenni a patakokban. Lew – mondta. A szokásos adományokról a világ legkülönbözőbb állatkertjeinek. – Azért jöttünk ma este össze. akik a múlt iránt érdeklődtek: paleobiológusokat. és ő irányította azt a bizonyos hírhedt chilei kísérletet a veszettség elleni vakcinával.és Vadvédelmi Hivatalhoz érkező panaszoknak. DNS-filogenetikusokat és így tovább. A következő évtől kezdve aztán az InGen a gyár teljes milliporus plasztiktermését a maga céljaira fordította.és Vadvédelmi Hivatalánál kötöttek. a sport. génsebészeti úton új.. Papírjaikat rendezgették. belépett Ron Meyer. Még a repülőtérről idevezető utat és a forgalmat figyelembe véve is itt kellene már lennie! – Miért. Kizárólag a szórakoztatás. hogy fontos döntés előtt állnak. Posztgraduális tanulmányai kellős közepén kirúgták a John Hopkins Egyetemről. Most a termékfejlesztési részleg vezetője volt a Biosynnál. az azt jelenti. Világosnak látszott. Tojásalakúvá lehetett formálni és csirkeembriókat növeszteni benne. A Biosynnál kapott állást. De még mennyire! Ha Dodgsonon múlik. Mind az InGen. hogy vizsgálódás tárgyává tegyünk egy önmagától adódó célpontot: az InGent. A Biosyn már fel tudott mutatni bizonyos sikereket. Az InGen indulásáról 1983-ban. – Uraim! – kezdte. Az elmúlt tíz percben egymás között beszélgettek. kopaszodó. japán tőkével. A tíz igazgató bosszúsan. – A karórájára nézett. kitől kérdi az ember. Attól függött. minősített többség kell? – Úgy van – mondta Dodgson. Ez egy mezőgazdasági érdekeltségű cég volt. A Biosyn különben is tovább dolgozott rajta. sekély mesterséges tó kialakítása a sziget . Dodgsonnak immár megvolt a minősített többsége. hogy a kaliforniai Cupertinóban székelő Biosyn Részvénytársaság rendkívüli konferenciára hívta volna össze igazgatótanácsát. amely nagyrészt az InGen ellen irányult. És ez így is volt. Egy szerződés alapján például. mint a madártojás. Ez egy pillanatra elhallgattatta őket. miszerint nincs pisztráng a patakokban. halvány színű pisztrángfajtát hoztak létre. és. azután létrehozták a saját változatukat.EGY ÖNMAGÁTÓL ADÓDÓ CÉLPONT Soha eddig még nem fordult elő. Az 1980-as években néhány géntechnológiai cégben felmerült a kérdés: „Vajon mi lehet a Sony Walkman biológiai megfelelője?” Ezeket a cégeket a legkevésbé sem érdekelték a gyógyszerek vagy az egészség. Egyre feltűnőbben pillantgattak az órájukra. Ron Meyer irodájában azt mondták. közöttük egy több mint három kilométer hosszú. és gyorsan belehuppant az egyik székbe. Ha minősített többségről van szó. a hatórás géppel jön San Siegóból. Steingarten. forradalmasította a horgászsportot. héjaarcú. hogyan működik. szétszedték. Harmincnégy éves volt. Este nyolc óra volt.. tanácskozásra sem kerül sor.. idegesen ült a tanácsteremben. mire készül az InGen. – Aztán 1987-ben az InGen felvásárolt egy jelentéktelen kis céget Nashville-ben. – Eggyel többre van szükségünk. A három Cray XMP szuperkomputerről. – Az kell. a Biosyn feje azonban ragaszkodott hozzá. a szabadidő-tevékenységek. kifürkészték. A Costa Rica-i Isla Nublar megvásárlásáról. amely olyan tulajdonságokkal rendelkezett. hogy ez a pisztrángfajta néha belehalt a napégésbe. A borostyán felhalmozásáról. Tennessee államban. hogy végett vetettek a Hal. – Ehhez meg kell szerezned a beleegyezésüket. Arra számítottak. Nyílt az ajtó. mire várunk? – kérdezte az egyik. amelyet Milliporus Plasztikgyárnak hívtak. Nagyszabású földmunkák indultak.) Az a tény. hogy az 1990-es évekre igencsak megnő az igény a „fogyasztócentrikus biológiai termékek” iránt. a húsa pedig vizenyős és ízetlen volt. emellett olyan kutatókat foglalkoztattak. Egyesek szerint Lewis Dodgson volt nemzedékének legmerészebb genetikusa. amely leginkább – így mondták – „fordított génsebészet”-tel foglalkozott. Nem sokkal korábban egy új plasztikfajtát szabadalmaztatott. amelyet Idaho állam Hal. Dodgson gyorsan áttekintést adott a dolgok hátteréről. semmi másról.. mert embereken akart génterápiai kísérleteket folytatni a Szövetségi Gyógyintézeti Hivatal jóváhagyása nélkül. Fogták a konkurencia egy-egy termékét. – Még valaki hiányzik – mondta Lewis Dodgson. de most lassanként mindenki elcsendesedett. A gyakorlatban ipari kémkedésről volt szó. mind a Biosyn ezen a területen működött. mások szerint a legmeggondolatlanabb. s mint mondták. – Mindeme jelek ellenére – mondta Dodgson – még mindig fogalmunk sem volt. nem képezte vita tárgyát. – Mégis. a kozmetika és a kedvtelésből tartott állatok iránt érdeklődtek. (De annyi bizonyos. de. hogy a cég figyelme állatokra összpontosul. Azonnal felállt. merre tart. – Ezzel egyidejűleg – folytatta a magáét Dodgson – megkezdődött az építkezés az Isla Nublaron. – Dodgson doktor! Ez mind rendkívül érdekes. a New York-i Zoológiái Társaságtól az indiai Ranthapur Természetvédelmi Parkig.

igen. ez lesz az első példa rá. Napi kétezer dollárt? Vagy tízezret? . A japánok meg egyenesen imádják az állatkertet. játékbabák. – Mi az akadálya.. A trikók. hogy a fosszilizáció minden DNS-t megsemmisít. akkor visszafordított génsebészettel elkészíthetnénk a magunkét. Befektetik a pénzüket az adott területen. Éppen annyit változtatnánk a DNS-összetételén. az a világ legnagyobb egyedi idegenforgalmi látványossága. Pillanatnyi szünetet tartott. ha egy kicsi. de fogalmuk sincs. A század végéig szinte lehetetlen utolérni őket. egy élő állat klónozása is lehetségessé válik. Ez az állatkert egyedülálló az egész világon. Ha elegendő DNS-töredéket sikerül kivonni. aki megpróbálja. Jelenleg ötven van belőlük Japánban.. A génsebészeti úton létrehozott állatok immár szabadalmi védelemben részesülnek. Az InGen abszolút tulajdonosa lesz a maga dinoszauruszainak. – Pontosan – mondta Dodgson. Egy ilyen állatkertért az InGen annyit kérhet látogatási díjul. hogy egy kihalt élőlény pusztán DNS-ének rekonstrukciója után feltámadjon. a Harvard javára. hogy sikerül DNS-töredékekhez jutni. Már sikerült genetikai anyagot nyerni egyiptomi múmiákból és a kvagga.. – Micsodák? Állatkák? – Még szép! Ha az InGen képes életnagyságú dinoszauruszokat létrehozni. sapkák. ha állatkertben tartják őket. – Semmi. A DNS manipulációja évről évre könnyebb és könnyebb lett. Úgy látszik. hogy nem tartanak lépést a fejleményekkel.közepén. Az elmúlt évben több amerikai járt állatkertben. azt hiszem. csak legyen.. Ha pedig ez lehetséges. hogy üdülőlétesítmények épülnek. és továbbiak állnak építés alatt. mi minden lehetséges. mint az összes baseball. – Atyaúristen! – suttogta valaki. Lehetségesnek azonban lehetséges volt. Van gyerek. élő dinoszauruszt kapna játszótársul? A saját kis szabadalmazott állatkáját? Az InGen milliószám fog eladni belőlük. képregények és a szelíd háziállatkák. Dodgson véleménye szerint teljesen indokolatlan és értelmetlen volt. az állatkertek igen népszerűek. – Amit ők felépítettek – mondta Dodgson –. – Az állatkert egy hihetetlen méretű üzleti vállalkozás központi része. – Miféle állatok azok? – Dinoszauruszok – mondta Dodgson. Elméletben azonban nem volt akadálya. amennyit csak akar. Az InGen. aki ne örülne. hadd legyen afféle öleb belőle.. az állat újbóli kitenyésztése. Nagy mennyiségű dinoszauruszcsont porrá őrlésével azonban elképzelhető.és futballmérkőzésekre együttvéve. Azt hogy lehet? – Lehet. A pénzemberekkel mindig az a baj. akkor törpe dinoszauruszok előállítására is képes. A videojátékok. Korábban úgy hitték. hogy ez nem így van. hogy a dinoszauruszokat szabadalmaztatni fogják. S ha ez meg is történik. hogy csak az InGen dinoszauruszeledelével táplálkozhatnak majd. zebraszerű állat bőréből. Sikerült a múltból való. és amelyek igen nagy helyet igényelnek. – Miféle állatokat? – Olyan állatokat. a jelek azonban arra mutatnak. 1985-re már lehetségesnek tűnt a kvaggaDNS rekonstruálása. és senki más nem hozhat létre ilyet törvényesen. – Dinoszauruszokat klónoznak. Mindössze bonyolult volt. mi jöhet még? A masztodon? A kardfogú tigris? A mamut? Vagy éppen a dinoszaurusz? Természetesen senkinek sem volt tudomása róla. hogy mi is megcsináljuk a magunk dinoszauruszát? – kérdezte valaki. És az InGen génsebészeti módszerekkel úgy fogja alakítani őket. – Azt mondta. hogy nekik öt év előnyük van.. hogy dinoszaurusz-DNS léteznék bárhol is a világon. Most kiderült. Mint tudják. hogy az InGen egy hatalmas kiterjedésű magánállatkertet hozott létre a szigeten. A jelek szerint az InGen valami egészen rendkívülit alkotott. Bizalmasan kiszivárogtatták. – Ugyebár semmiféle törvénytelenségről. Az ezt követő megdöbbenés és pánik dr. . – És hozzá tudnánk jutni ilyen példányhoz? Dodgson ismét hallgatott egy kicsit. egy az 1880-as években kihalt. Az egyik igazgató előrehajolt. Valaki a torkát köszörülte. hogy kicselezzük a szabadalmat. És még csak ekkor jönnek a fogyasztási cikkek! A képeskönyvek. – Nos. amelyek tojásból fejlődnek. és megszólalt: – De Dodgson doktor! Na és? – Ez nem közönséges állatkert – mondta Dodgson. A valóságban a szakirodalomban már 1982-ben felmerült a dinoszauruszok klónozásának lehetősége. 1982-ben a dolgok technikai akadályai szinte leküzdhetetlennek látszottak. Annak idején. drága. kivéve. kihalt állatokat klónozniuk. – Persze ha hozzájuthatnánk az ő dinoszauruszuk egy példányához. volt. A Legfelsőbb Bíróság 1987-ben döntött így. a siker pedig valószínűtlen.

rendelkezem – mondta Dodgson.. Csak egy elégedetlen alkalmazott kell hozzá vagy némi helytelenül kezelt hulladék vagy ilyesmi.. hogy ide fáradtak. igen hamar döntenünk kell. dehogy! – vágott közben gyorsan Dodgson. . Senki sem szólt. – Nem látom okát. Semmiféle törvénytelenségről nincs szó. Elegendő látnom a teremben uralkodó hangulatot. hogy formális határozatot kelljen hoznunk ebben a kérdésben. Az értekezlet résztvevői a jegyzetelő titkárnőt és az asztalon álló magnetofont nézték. Csak bólogattak némán. – Csak attól tartok. Dodgson? – Igen. Senkinek a véleménye nem került a jegyzőkönyvbe.– Ugyan. amennyiben megteszem a szükséges lépéseket. hogy egyetértéssel találkozik-e. dr. Törvényesen juthatunk az ő DNS-ükhöz. Hosszas csend szállt a teremre. mivel jelenleg az InGennél kisebb válság történt. s az én forrásomnak a következő huszonnégy órán belül lépnie kell. – A többi már az én dolgom. uraim – mondta Dodgson. – Köszönöm. A fejek lassan igent intettek. – Ön rendelkezik ilyen forrással.

– Hát ez meg mi? – nevetett. Tizenöt faj. hogyan működik. Ez a tény egy új. De hogyan szállítsam őket? Dodgson egy nagyméretű Gillette borotvahabos tartályt nyújtott át neki. Rendben. A férfi mintegy mellékesen lenézett. – Nyomja meg a tetejét! A férfi megnyomta és fehér borotvahab fúvódott a kezére. – Egy frászt akarom. – És ha ellenőrzik a csomagomat? Dodgson vállat vont. ugye. Bár az illetőnek nem volt dolga genetikai anyagokkal. – A pénzt akarom látni. eljött a pillanat. – Tíz percem van a gép indulásáig. Dodgson tartotta vele a kapcsolatot. mélyhűtött embriók. – Dodgson technikusai éjt nappallá téve dolgoztak két napon át. – Ez az egész? – Nem az egész. Dodgson gyorsan becsukta az aktatáskát. hogy otthagyja a Cetust a Biosyn kedvéért. – Gondoskodni fogok – mondta Dodgson. szabad szemmel nem is látható. és néhány hüvelyknyi bepillantást engedett. – Akarja. – Ezt mind a tizenöt fajért kapja. – Fussunk csak át még egyszer az árfolyamon! . Elfojtotta a mérgét. és kisétált az ajtón. Dodgsonnak ehhez nem volt elég a bakteriális DNS. Az év vége felé Dodgson végre ráakadt egy olyan InGen-alkalmazottra. amelyre Dodgson várt – ugyanis ez azt jelentette. 1987-ben rávett egy elégedetlen genetikusnőt. Hétszázötvenezer dollár. hogy a pasas most hozzá tud férni az embriókhoz. A genetikusnő egyszerűen az egyik keze öt körmére pöttyentett egy-egy cseppet mind az öt törzsből. és gyorsan körülnézett. – Azért gondoskodjék róla. – Egy kicsit nehezebb a megszokottnál. – Álruha? – Sosem lehet tudni – felelte Dodgson. Az InGenen kifogni azonban jóval nehezebb feladat volt ennél. Hat hónapja viselte el türelemmel ezt a pasast. A génsebészetileg előállított DNS – súlyra mérve is a világ legeslegdrágább anyaga. Most pedig. A fele.REPÜLŐTÉR Lewis Dodgson belépett a San Franciscó-i repülőtér indulási csarnokának kávézójába. – Nem rossz. Gyorsan megmutatta a férfinak. hogy az InGen a legkörültekintőbb biztonsági rendszabályok segítségével őrzi embrióit. Ilyen embert viszont nem volt könnyű találni. A pultnál várakozott. mikroszkopikus baktérium. hogy legyen hordozható hűtő a fedélzeten. hogy az InGen alvállalkozókat és tanácsadókat hívott meg a szigetre. és hol ebben segített neki egy kicsit. akár ötmilliárd dollárt is érhet. és hozzon magával öt génsebészetileg kialakított baktériumtörzset. nem felejtette el? – Nem hát. Dodgson azonban tehetetlen volt vele szemben. mind a ketten pontosan tudták. Dodgson leült mellé. – Oké. Egyetlen. bizarr ipari kémvilágot eredményezett. és észrevette a szalmakalapot a fején. aki megközelíthetőnek látszott. hogy még egyszer végigmenjünk a tennivalókon? – kérdezte Dodgson. – Jól van. – Késett. Addigra az embrióknak már San Joséban kell lenniük. hol abban. és képes kijátszani a biztonsági intézkedéseket. és a padlóra tette aktatáskáját kettejük között. hogy összeállítsák. – Ez az? – Ez az. aki hozzá tud férni az embriókhoz. amely a szívinfarktus enziméhez. Nem rossz. – Az már a maga emberén múlik. mi a tét. Csak úgy juthat hozzájuk. – Térjünk a tárgyra! – mondta a férfi. annyi az egész. Mélyhűtött embriókra volt szüksége. csak meg kell találni hozzá a megfelelő vevőt. Dodgson doktor! – mondta az. öregem – mondta a férfi. – Mennyi hűtőgáz van benne? – Harminchat órára elegendő. havonta találkoztak Carlos és Charlie vendéglőjében a Szilikon-völgyben. Dodgson doktor. amely megakadályozza a növény kárt. – A férfi elfordult. de most már igazán! Dodgson felkattantotta az aktatáska csatját. Dodgson pedig ehhez értett igazán. Az viszont minden találkozással egyre pimaszabb lett. ha talál egy olyan alkalmazottat a cégnél. a sztreptokinázhoz való gént tartalmazza. aki a hajóban lesz – mondta a férfi. vagy az úgynevezett „jég-plusz” génjét. Az embere már ott volt. Ránézett Dodgsonra. – Tányérja szélén letörölte a habot. és jól tudta. hajlandó lopni belőlük. és kiitta a kávéját.

hogyan kell működtetni a. Nem az északinál. – Nyugodjon meg. – Remek! Aztán gondoskodjon róla. hogy a hajó ott legyen péntek éjjel a sziget keleti dokkjánál. hogy a sziget legalábbis tudomásunk szerint. hogy tudja.. – A férfi ellökte magát a bárpulttól. A keletinél. Kis pótkikötő.. ha életképes. tudom. – Minden leszállított embrió ötvenezer dollár. Ott legyen nekem vasárnap reggel a San José-i reptéren! És készpénzben! – Ott fogom várni magát – mondta Dodgson. Rendben? – Rendben – mondta Dodgson. A feltételek maradnak – mondta Dodgson. ahová a nagy teherszállítók érkeznek. – Nézze. Dodgson nyugtalanul kérdezte: – Biztos. – Bízza rám! Nyugi! Maga csak hozza a pénzt. – Maga mikorra ér vissza San Joséba? – Valószínűleg vasárnap. További ötvenezer. tehát. – Ne féljen! . – Gondoljon arra is..– Ahogy megállapodtunk. ezt a részét már elrendeztem – mondta a férfi. – Biztosan – felelte a férfi. állandó rádiókapcsolatban áll az InGen kaliforniai központjával..

Le kell állítania az egészet. tetőtől talpig feketében. – Méghogy leállítani! – Hammond felpattant mérgében. nagyon örvendek. De ettől függetlenül is. Rémes világban élünk. – De nem unalmas. a világ meg még fizet is. Először is szinte állandóan számítógépekkel dolgoztak. kopaszodó. Én hiszek abban. – Grantnak az az érzése támadt. én csak két színt hordok: feketét és szürkét. amit a fekete testek sugárzási tulajdonságairól tanult valaha. – Az első perctől kezdve megjósoltam! – benyúlt puha bőr aktatáskájába. Való igaz: néha már-már úgy viselkedtek. Végül pedig mintha csak hangsúlyozni akarnák az akadémikusi világból való kilépésüket. – Malcolm doktor! – kiáltott fel erőltetett kellemkedéssel a hangjában Hammond. De nem. adott. Malcolm sorra kezet fogott mindenkivel. hogy olyasmivel foglalkozzam. – Mondja. hogy tapsolhasson nekik. Matekos vagyok. itt vagyok. Hammond Gennaro felé fordult. – Nevetséges! Malcolm vállat vont. egy cseppet sem. ha netán tévedésből szürke zoknit vennék a fekete nadrághoz. – Maga hívta meg! – mondta. mit vegyek fel holnap reggel. Ezek a tudósok több szempontból is szakítottak a hagyományos matematika elefántcsonttorony-világával. és széttárta a karját. mi lesz a végkimenetele mindennek. Malcolm leült az egyik párnázott ülésre. nincsen egy kicsit túl meleg ahhoz. – Csak felrázva. – Dr. de a valóságban a gondolkodást száműztük. – De ha jobban belegondol. mindent összevetve. Ha visszaemlékszik arra. és senki sem gondolkodik. Azt hittük. hogy a matematika valami olyasmit írjon le. mindannyian tudjuk. az meg nem. ezek nem is olyan triviális ügyek. Őszintén. akik nyíltan hirdették: őket az érdekli. Sattler doktornő – mondta erre Malcolm. úgy beszéltek és öltözködtek. – Maga nagyon csinos. John! Igen. iszik-e valamit. – Semmi problémánk! – vágta rá gyorsan Hammond. Hát nem döbbenetes? Eljött az információ társadalmának kora. és így mutatkozott be. – Ian Malcolm. A stewardess megkérdezte.MALCOLM Dallasban magas. mint a popsztárok. hogy feketében járjon? – kérdezte tőle Ellie. harmincötéves férfi szállt a gépre. úgy bámulta a matematikust. azt hiszem. – Ez a két szín minden alkalomra megfelelő – folytatta Malcolm –. Amikor felnőtt férfiak ütőkkel kis labdákat csapkodnak. a zoknija. a nadrágja. Nem fogom arra vesztegetni. s ezt a módszert a hagyományos matematikusok mélyen megvetik. – Egy álló napon át képes volnék gyönyörködni a lábában. A maga régi nemezise megérkezett. hogy ez a sziget nem fog működni – folytatta Malcolm. De azért. – És merem remélni. – És milyen okosan tette! – mondta erre Malcolm. hogy csak két színben jár? – Nem. Adott. ami a valós világban ténylegesen létezik. Igen hatékony. hogy az ember így vagy úgy fog viselkedni. hogy az – egy idősebb kolléga szavaival – „felháborító módon előtérbe helyezte a személyiséget”. ahol minden adott. – Egy Diet Coke-ot kérek – mondta. maga el tud képzelni unalmasabb dolgot a divatnál? Jó. hogy ez érdekelni fogja. a valóságban a fekete szín tökéletesen megfelelő a melegben. – Nem vagyok hajlandó azon törni a fejem. hogy Malcolmot mindenekfölött szórakoztatja ez az egész kirándulás. Ellie-nek a szája is tátva maradt. vagy nagyobbakat hajigálnak ide meg oda. „hogyan működik a való világ”. Malcolm volt a leghíresebb az új matematikus nemzedék azon tagjai között. – És természetesen teljesen őrült – tette hozzá Malcolm maga. a divat még a sportnál is érdektelenebb. Malcolmnak nagyon határozott véleménye van mindenről – szólt közbe magyarázólag Hammond. talán a profi sport még unalmasabb. Kifejezetten felszabadító érzés. Fekete volt az inge. amelyet maguk „káoszelmélet”-nek neveztek el. mint az öltözködés! – mondta Malcolm. Hidegen hagyta Hammond haragja. hogy száműzni fogjuk a papírt. – A jelek szerint ugyanis maguknak komoly problémájuk van. és egymáshoz is jól illenek. hogy az életem értékes. hogy a fekete egyenesen a legjobb a forróságban. – Hello. – Én mindig mondtam. Másodszor szinte kizárólag nonlineáris egyenleteket alkalmaztak kialakulóban lévő tudományterületükön. . el fogja hinni nekem. még a vászoncipője is. Harmadszor minden jel szerint arra törekedtek. Malcolm elvigyorodott. A neve természetesen nagyon is ismerős volt Grant számára. de nehogy megkavarja! A nyitott ajtón át bekúszott a gépbe a nedves dallasi levegő.

Turbulens dolgokat nonlineáris egyenletekkel lehet leírni. – Idáig értem – mondta Gennaro. hogy még ha meg is értenénk. Ez a nonlineáris dinamika. sebessége és szöge. – Erről van szó? – Nem – felelte Malcolm. – Ha mást nem. – A fizika nagy eredményeket ért el bizonyos viselkedésfajták leírása terén. hogy minden véletlen és kiszámíthatatlan? – kérdezte Gennaro. A káoszelmélet eredetileg azokból a kísérletekből nőtt ki. hogy Hammond szigetének csődöt kell mondania? – Pontosan. Ennek a hatalmas.– Elhoztam az eredeti tanulmányom másolatát maguknak – mondta. Évszázadok óta rendre meg is oldjuk őket. a második rendszer nem fog nagyjából ugyanúgy viselkedni. A repülőgép szárnya fölött áthaladó levegő. – Nem tudná ezt esetleg emberi nyelven is elmagyarázni? – Dehogynem – mondta Malcolm. – Azt hiszem. az az volt. Az időjárás egyetlen hatalmas. hogy Malcolmnak bőven van ellensége. kezdem érteni – mondta Gennaro. Nem volt nehéz elképzelni. mint a kerengő bolygók. – Úgy van – mondta Malcolm. amely leírja őket. – Akkor menjünk vissza a legelejére. Ha fogok egy ágyút és kilövök belőle egy bizonyos súlyú lövedéket. Lehet. Az időjárás előrejelzése teljességgel lehetetlen. rövid kifejezés minderre a „pillangóeffektus”. aztán pedig megismétlem majdnem ugyanazzal a hőmérséklettel. Az az új elmélet. Grant tisztában volt vele. Ezeket le lehet írni úgynevezett lineáris egyenletekkel. Ezért a fizika sosem értette meg az eseményeknek ezt az egész csoportját. – Hát az idegen attraktorok? – Azt sem. – Rendben. Ezeket nehéz megoldani – sőt általában nem is tudjuk megoldani őket. hogy a rendszer viselkedése igen érzékenyen függ a kezdeti feltételektől. Amit azonban az első kutatók mégiscsak megtanultak a számítógépes modellekből. – Na jó! – sóhajtott Malcolm. Az időjárás. de ott segítek. örvényléssel kapcsolatos. és a szomszéd kabinba ment. – De hol is kezdjük? Tudja. – A káoszelmélet miatt? – Pontosan. A gép szárnyalt az éjszakai égen. Körülbelül tíz évvel ezelőttig. amelyet annak idején készítettem az InGen-nek. aztán kilövök egy másik lövedéket. a holdra tartó űrhajók. a káoszelmélete pedig sekélyes. amellyel a fizika nehezen boldogul. – Csakhogy van másfajta viselkedés is. széllel és nedvességgel. például az időjárás. A rendszer kényesen érzékeny a kezdeti feltételekre: az egészen apró különbségek felerősödnek. az ingák. Gennaro szólalt meg: – A tanulmányának tehát az a végkövetkeztetése. Ezért válhatott a káosz olyan tágabb elméletté. A vér folyása a szíven át. amelynek a segítségével oly sok . mi az a nonlineáris egyenlet? – Nem. – Vagyis a káosz abban áll. – Jó. Olyasmikre gondolok. Egy pillangó meglebegteti a szárnyát Pekingben. – Annak a tanácsadói véleménynek a másolatát. amelyet egy bizonyos hőmérséklettel. mint az első. ami turbulenciával. bonyolult rendszernek a működése mindig is érthetetlen maradt a számunkra. Elkezd eltérni tőle. – Szünetet tartott. akkor sem tudnánk megjósolni. Például bármi. nevezetesen a Föld atmoszférájának kölcsönhatása a földfelszínnel és a nappal. de az egyenletekre éppen hogy csak rápillantott. a dolgozatom legalább addig is ad egy kis munkát maguknak. Illetve még pontosabban a rendszernek a fázistérben való viselkedése miatt. – Ez a lineáris dinamika. egy bizonyos sebességgel és egy bizonyos hajlásszögben. Most meg hová megy? – Telefonálnom kell! – morogta Hammond. Ennek pedig az az oka. hogy sokak számára a modora bántó. és igen hamar nagyon más lesz! Zivatarok lesznek napsütés helyett. és New Yorkban megváltozik az időjárás. amelyek során az 1960-as években számítógépekkel próbálták meg modellezni az időjárást. A tárgyak szabályszerű mozgására. Könnyen megoldhatók. hogy a matematikai rész egy kicsit bonyolult. amelynek majdnem azonos a súlya. gördülő golyók és a többi. – Már nem tudom követni – szólt közbe Gennaro. akkor mi fog történni? – A két lövedék nagyjából ugyanazon a helyen fog célba érni. az úgynevezett káoszelmélet. – A leggyakrabban használt. Ezért hát nem is tudtuk megjósolni az időjárást. A vízköpőből kiömlő víz. és felnézett a mennyezetre. amelyek semmiféle nehézségeket nem jelentenek a matematikusok számára. – Ha azonban van egy másfajta rendszerem. Átlapozta a tanulmányt. Gennaro félrelökte a tanulmányt. – Valójában a rendszer viselkedésének komplex változatosságán belül rejtett szabályszerűségeket találunk. – Végül is hosszú az út – szólt Malcolm a többiekhez. egy bizonyos szélsebességgel és egy bizonyos nedvességgel indítok. bonyolult rendszer.

– És most jön Hammond terve – folytatta Malcolm. Elméletben az egészen távoli jövőig ki tudjuk számítani a golyó viselkedését. már megint? – kiáltott fel Gennaro. Hátradőlt az ülésen. – Rendben – bólintott Gennaro. – Halálbiztos. Egyfajta rendet találunk a mélyén. Sőt voltaképpen tökéletesen fölösleges.. hogy a sziget igen rövid idő múlva előre nem látható módon kezd el viselkedni. látná is a szigetet. – Baj van azzal a szigettel! Egyetlen katasztrófa az egész. mint az időjárás – van egy alapvető rend. – És maga biztos az elméletében. továbbá ki tudjuk számítani a szögeket. Vagyis minden olyan rendszer. Meglökünk egy biliárdgolyót. – Ó. . és az elkezd visszapattogni az asztal oldalairól. – Jézus Mária. – De mi ez az alapvető rend? – Lényegében a rendszer fázistérben való mozgása jellemzi – felelte Malcolm. mondjuk. meg tudjuk jósolni a golyó jövőbeni viselkedését. hogy minden komplex rendszerben – az olyanokban. hogy hol lesz három óra múlva. azt. – Az is egy látszólag egyszerű rendszer – állatok.minden tanulmányozható a tőzsdétől a tömegzavargásig vagy az epilepsziás roham alatti agyhullámokig. hogyne! – mondta Malcolm. – Értem. ha mielőtt ítéletet mond. miért olyan biztos abban. állatkerti környezetben –. hogy mit is hozott létre Hammond valójában? – Nem. Meg lehet jósolni. amelyben zűrzavar és kiszámíthatatlanság uralkodik. Elméletben. de eljutunk oda is. – Csakhogy a valóságban – folytatta Malcolm – kiderül. hogy ez a nagyon egyszerű rendszer – az asztal meg a biliárdgolyó – kiszámíthatatlanul viselkedik. azazhogy az egyszerű rendszerek is viselkedhetnek komplex módon. Az elméletből egyenesen következik. – Nézze. – Megértem magát – mondta Malcolm –. ahogy az egyik oldalról a másikig pattog. Az első. engem csak az érdekel. A káoszelmélet két dolgot állít. Vegyük például a biliárdgolyót. A második ennek épp a fordítottja. A részleteknek nincs jelentősége. Mivel ismerjük a labdának átadott erőt és a labda tömegét. hogy Hammond szigete csődöt mond. Elméletileg ez igen egyszerű rendszer. – És maga mindezt azért tudja. – De nem volna mégis jobb. az elméletből – mondta Malcolm. Tudniillik szinte azonnal elkezdik éreztetni hatásukat az egészen kicsiny tényezők: a labda felszínének apró egyenetlenségei. hogy legfeljebb egy-két másodpercre tudjuk előre meghatározni a jövőt. amely hamarosan kiszámíthatatlan módon kezd majd működni. mert. – Igen. Érti? – Értem – mondta Gennaro. amelyekben a falakhoz ütődik. És a lehető legrövidebb időn belül felborítják az ember gondos számításait. majdhogynem newtoni. Vagyis kiderül. hogy bekövetkezzék. amely csak arra vár. egy-két pici mélyedés az asztalban és így tovább..

vulkanikus sziklatömb. hat-hétszáz méterrel magasodtak a tenger fölé. amint lába alatt eltávolodik a talaj. Kapaszkodjanak. és legszélesebb pontjánál öt kilométer széles. aztán a felhők szaggatott foltjain át kijutottak a napfényre. A hegytetőket köd borította. Aztán egyszerre csak halványan kirajzolódtak a fenyőfák zöld ágai. – Nem örülök neki. mégis nagymérvű a defolsztáció.ISLA NUBLAR A motor felbőgött. – Bahía Anasco – mondta a pilóta. és meglátjuk Isla Nublart. a hegyek felé tartottak. – Persze sokkal nagyobb – jegyezte meg Hammond. – Úgy negyven perc lesz az út – hallatszott Hammond hangja valamelyik hátsó ülésből. a fenyőerdőre nézett. San Joséban felvettek még egy utast. amely meredeken emelkedett ki előttük az óceánból. majd mélykékké. Hegyes-völgyes sziklás volt alattuk a táj. A legnagyobb magánállatkert Észak. aztán jobbra. Az alacsony dombok felmagasodtak Grant szeme előtt. A víz zölddé vált alattuk. – Hogy a jó istenben csinálja ezt? – kérdezte Malcolm. hogy lásson valamit a sűrű ködön át. – Jézus! – nyögte Malcolm.. amely kiemelkedik az óceánból. Gyönyörű partszakaszok vannak arrafelé. hogy maga is nyugtalan. de a világon semmit sem látott. Ennek a legnagyobb része az elmúlt tíz évben ment végbe. hektárszám. Amint odaérünk. Motyogott valamit. a szárnyak forogni kezdtek odafönn. tovább a part mentén. és átrepült a hegyek fölött. hogy. Némelyik ág egészen közel volt. Az erdő borította hegyoldalakat zöld köd koszorúzta. az ingére alufóliadarabkák tapadtak. majd meglátják. Grant a szemét meregette. – Costa Ricában jobban működik a népességszabályozás.. – Halászfalu. mert megzavarja az állatokat. Grant hallotta a recsegést a fülhallgatójában. Nyugatnak. de jól látszottak a csipkés szirtfokok és a csapkodó tenger hullámai. A sziget látványa szinte misztikus volt. A hegyek a sziget csúcsánál emelkedtek a legmagasabbra.. Elhúztak egy kis part menti falucska fölött. hölgyeim és uraim! – A helikopter gyorsan ereszkedett. de már itt is vagyunk! Robogott velük a helikopter. Reggel tíz óra lehetett. – A vulkáni eredet nyomai az egész szigeten megtalálhatók – mondta. Grant sziklás.. ahogy. – Már csak egypár perc – mondta Hammond –. – A pilóta egyenesen a nyílt óceánnak vette az irányt. hogy találkozzék velük.és KözépAmerikában. Még mindig közel voltak a fák. de a hangján hallatszott. egyiket a másik után. ott láthatják a Cabo Blancó-i természetvédelmi területet. egy Dennis Nedry nevű férfit. Elmagyarázta. inkább tengeri hegy. mint Közép-Amerika többi országában – magyarázta Hammond –. de nem kapott választ. . hogy Isla Nublar ködös területen fekszik. Kövér volt. és senkinek sem nyújtott kezet. Ez és az uralkodó áramlatok az oka annak. Grant a plexiüveg buborékon át nézte. A pilóta hangja félbeszakította: – Megkezdjük a leszállást. – Úristen! Tiszta Alcatraz! – szólt Malcolm. zord. folyton csokoládét rágcsált. és Grant megpillantotta a nyugati part szegélyét. Grantot meglepte az erdőpusztulás nagysága. csipkézett szigetet pillantott meg. – Több helyen gőzjáratok is vannak. amint a pilóta a toronnyal beszél. – Arra fenn. hogy Isla Nublar voltaképpen nem is igazi sziget. és forró a talaj az ember lába alatt. Egyre alacsonyabban szálltak a víz fölött. Grant ismétlődő elektronikus sípjelet hallott a fülhallgatóban. aki odarepült. A hegyek túloldalán ismét átlépték a felhőréteget. szélkoptatta dombokat látott mindenütt. – Tizenhárom kilométer hosszú. – Sajnos magán a szigeten kell leszállnunk – mondta Hammond. és lompos. és máris sűrű köd vette körül őket. s a helikopter robogó árnyát figyelte. – Általában nem ilyen sűrű – nyugtatta Hammond. a keze ragacsos volt tőle. A helikopter gyorsan süllyedt. ezúttal lefelé ereszkedve. – Észak felé mutatott. az erdőpusztítás. A gép emelkedett. Lecsupaszított. Néha viszont nagyon izgalmas. A pilóta tekintete bal felé pásztázott. amint ki-kinyúlnak a ködből. A napfény visszatükröződött a víz felszínéről. Összterülete közel hatvan négyzetkilométer. A helikopter emelkedni kezdett. pörgő árnyakat vetve a San José-i repülőtér betonjára. hogy a szigeten lévő számítógépekkel van dolga. és a sziget északi vége felé vette az útját.

a „szélborotva” miatt. Ez néha nagyon veszélyes ezen a csúcson. fehér épületek tetejét látták odalenn. az északi dombok lejtőin. – Ed Regis a nevem! Isten hozta önöket Isla Nublaron. Ez azonban csak mikroklíma. Az erősen koncentrált. Grant felsóhajtott. aztán a gép egy huppanással máris a leszállóhelyen ült. hogy megérkeztünk! Biztos talaj van a lábunk alatt. Egy kicsit olyan volt. Ahogyan lefelé haladtak. Az építkezés bonyolultabb volt. amely alól kikandikáltak vörös hajfürtjei. Nagy kiterjedésű. mintegy megbúva a növényzet sűrűjében.. majd elhalt. fluoreszkáló keresztet pillantott meg a lába alatt a plexiüvegen át.A sípjel hangosodott. Grant a pilótát nézte. amely inkább klasszikus esőerdő. és kicsatolta a biztonsági övet. Hűvös és nyirkos volt a levegő. amely déli irányban messzire nyúlt. – Az elsődleges ökológiai környezet itt a lombhullató esőerdő. és így már egész kiterjedésében láthatták a szigetet. Grant meglepődött.. kérem! Keskeny. Baseballsapkát viselt. A kereszt sarkainál erős lámpák villogtak. mindenkit! Csak óvatosan. A sziget legnagyobb része trópusi. és Grant most már jobban látta a tájat. – Helyesen látja – mondta Ed Regis. Óriás. A pilóta egy kicsit igazított az irányon. Kitárta az ajtót. – Hello! – mondta vígan. no de az a lényeg. és. gyorsan kell leszállni az egymás fölötti ellentétes irányból mozgó széláramlatok. amely a magaslatokon ilyen. Meglehetősen eltér a szárazföldi vegetációtól. . Lejjebb érve teljesen kikerültek a ködből. Grant lenézett. mint az Olympic-félsziget. mint gondolta. kanyargós ösvény vezetett le a dombról. egyre vékonyodott a köd körülöttük. – Ha így jövünk. Egy férfi szaladt a helikopter felé. A rotorok zaja halkult. mint a Csendes-óceán északnyugati partvidéke Észak-Amerikában.

túlpörgetett. Gennarónak a szava is elakadt. hogy bejárhassák az összes létesítményt. Még mindig nevetett. Semmi esetlenség vagy bizonytalanság nem volt a viselkedésében. És gyors. élő dinoszauruszok! Valódibbak már nem is lehetnének! Gennarónak ez járt a fejében: „Egy vagyont fogunk keresni ezzel a szigettel. D. hogy választ adjon a tudományterületét régóta foglalkoztató kérdésekre.. Hagyományos vélemény szerint a brontosaurus idejének nagy részét sekély vízben töltötte. aki a legközelebbi épületek felé indult. válaszolok rá. Montanában. ívelt. Cope. amiről elképzelni sem tudta. és csak nevetett tovább. hogy be is következik mindez. – Valami baj van? Grant a fejét rázta. és akkor ha van még kérdésük. mintha csak túl meredeken futna lefelé a lába alatt az út. hogy mi olyan vicces: az. Fejük és nyakuk igen aktívan vándorolt ide-oda a pálmafák fölött – meglepően aktívan. közepes nagyságú ősgyíkfajta tagjai. az. hogyan tovább – szólalt meg Hammond. szürke nyakakat. Mindannyian a fák fölé magasló állatot bámulták. A könyvek túl nagyra nőtt. Istenhez imádkozott. késő jurakori szint. aztán a többiek is beszálltak a kórusba. – Igen életszerűek. – Úgy szerveztük. kövessék Mr. úgy hallgatta egy percig.. A csoport Ed Regis nyomába szegődött. de máris kezdi elfogadni – és azonnal arra használja friss megfigyeléseit. – Ha jól feltételezem. Túlméretezett zsiráfokra emlékeztették Grantot. csúf. dinoszauruszt nézni. kövér és esetlen lényekként ábrázolták őket. Alig kapott levegőt. Ezek az állatok azonban – bár nem voltak vízben.A FOGADTATÁS – Te jóságos Úristen! – szólalt meg halkan Ellie. nem? Újra hallották a trombitáló hangot a távolból. – Üdvözölnek bennünket a szigeten. – Uramisten! „A dinoszaurusz szép!” – ez volt az első gondolata. Első felfedezés: E. és elindult lefelé a lejtőn. ahogy az emberek megérkeznek. – Nyilván szeretnék tudni. mint reklám. Közhasználatú nevükön „brontosaurusok”. Ő mindvégig tudta. Döbbent agyában szinte önmaguktól megindultak a tudományos asszociációk: észak-amerikai növényevők. amiről korábban azt tartotta: nem más. hogy a saját szemével látta. Ugyanolyan jóindulatú. 1876-ban. Grant csak állt a domboldali ösvényen. Végül is nem magyarázhatta meg.. hogy a sziget biztonságos legyen. de valahogy a lelke mélyén mégsem hitte. Abban a pillanatban újabb fej emelkedett a növényzet fölé. majd harmadik. Szédült. Nemrégiben Berman és McIntosh a koponya külső jegyei alapján új osztályba sorolta őket. Atyavilág. Ennek a hosszú nyakú állatnak azonban szinte légiesen kecses és egyben méltóságteljes volt minden mozdulata. És most mégis itt van! A ködben mozgó állatok tökéletes apatosaurusok voltak. Az őshüllő éber érdeklődéssel pislantott le rájuk. Hiszen olyasvalamit látott. – Ez a hívó szavuk – szólt Ed Regis. A Morrison-féle formációs rétegekhez kapcsolódó példányok kerültek elő Utahban. Coloradóban és Oklahomában. – Azok bizony – mondta Hammond. most pedig. amikor az ötödik és hatodik nyak is a pálmafák fölé nyúlt. mire számítson – évek óta erre várt –. Grant szinte bénultan állt. később délután pedig a parkba visszük magukat. ezek nem animatronikus modellek – mondta Malcolm. mekkorák ezek az állatok! Óriásiak! Mint egy ház! És annyi van! Valódi. kérem. szólni sem tudott a megdöbbenéstől. Az őshüllők nézték. és mély trombitáló hangot hallatott. aztán egy negyedik. és tágra nyílt szemmel bámulta a pálmafák fölé magasló. majdnem mint egy elefánt. kissé bugyuta volt a tekintetük. – De hát életszerűnek is kell lenniük. Az ösvény fölött kézzel írt ákombákomokkal a következő felirat állt: „Isten hozta! Üdvözöljük önt a Juraparkban!” .. – Uramisten! – mondta megint Ellie. Egy vagyont!” Őszintén reménykedett. Grant felnevetett. hogy valaha is látni fogja életében. És most. Először csak egy állat hallatta. – Mi az? – kérdezte Hammond nyugtalanul. mint diplodocusokat. Regist. az arca csupa pára. A vacsoránál találkozunk újra. amely segített nagy testtömegének fenntartásában. Az új genetikai technológia elképesztő hatalma. hogy alig néhány másodperce látja az állatot. lelkesítő szöveg. ez jól látszott – túlontúl is gyorsan mozogtak. ez a hatalom most vált teljesen világossá a számára.

IAN MALCOLM .HARMADIK ISMÉTLŐDÉS Ahogy a fraktális görbét újra rajzoljuk. egyre tisztábban jelennek meg a részletek.

De az tény. – Igen – mondta Grant. Tizenöt éven át dúlt a vita a melegvérűség fölött. – Íme. Azok voltak a legjobb paleontológusok. amennyiben a dinoszauruszok klónozhatók – nos. fosszilis lábnyomokat. a kutatási tanulmányok. – De szeretném közelről is látni őket. hogy egy-két másodpercnél tovább a hátsó lábukon maradjanak. Vége a dinoszauruszok paleontológiái vizsgálatának. A paleontológián belül minden nagy vita ezen a módon folyt. azazhogy a dinoszauruszok gyors mozgású. Addig nem lehetek egészen biztos a dolgomban. egyszerűen nem vág össze az ásatási eredményekkel. amely a megkövült csontokban és a rég kihalt óriások nyomdokaiban kereste a támpontokat.A JURAPARK Beléptek a pálmák magasban összeboruló. hogy a fogaikat is lássam. meleg vérűek voltak-e a dinoszauruszok. Malcolm felnevetett. Az emlős az anyagcsere révén képes testhőmérsékletté alakítani az elfogyasztott ételt. amióta csak az első óriás állatcsontokat felfedezték Európában. míg végül általánosan elfogadták az új látásmódot. A klasszikus dedukció logikai módszerével több bizonyítékból vonták le új következtetéseiket. Ez a mozgékonyság megint csak meleg vérre utal. de a hangjuk még hallatszott. Kikalkulálták a nyomást. – Nem látszik elkeseredettnek – jegyezte meg Malcolm. Most azonban. a tudományos folyóiratok –. hogy a dinoszauruszok összetett társadalmi életet éltek. előbb-utóbb bekövetkezik. Az első a testtartás volt. és sok közülük felegyenesedve a hátsó lábán járt. hajlott lábú csúszómászók. A tudósok mindaddig a hüllők osztályába sorolták be a dinoszauruszokat. – Nem is vagyok. mindez nincs többé. Vizsgálták a járást is. hogy jól néznek ki. Amerre csak a szem ellátott. Grant a fejét ingatta. amelyben a hüllők fennmaradása elképzelhetetlen. Ezzel szemben a dinoszauruszok egyenes lábon álltak. Grant megrázta a fejét. Ráadásul az északi sarkkörön túl is találtak dinoszauruszmaradványokat. A teknősök elhagyják a tojásaikat. amelyek a talaj közvetlen közelében kúsznak. amelyekből arra a véleményre jutottak. élénk állatok voltak. megvizsgálni a karmukat. Százötven éve. amelyek legnagyobbrészt éppen Grant munkáján alapultak. – Ez mindent megváltoztat. az emberi faj története dióhéjban: „Sokan úgy gondolták. amely szerint a dinoszauruszok lassú mozgású. a dinoszauruszokkal kapcsolatos tudományos vizsgálatok főként következtetésekből álltak. A gyíkok és hüllők rövid. megtapintani a bőrüket. kinyitni a szájukat. – Gondolom. Szeretném felemelni a lábujjuk begyét. akár az ember. és – szemben a csúszómászókkal – felnevelték kicsinyeiket. meleg vérű szív lehetett képes. s amely a körül zajlott. Csak nem ilyen hamar. amely ahhoz volt szükséges. köztük az a haragos összecsapás is. a hideg vérű állatokéba. Egy idő után azonban néhány kutató – főként John Ostrommal és Robert Bakkerrel. hideg vérű hüllők voltak. Ezután az anyagcsere vizsgálata következett. mely a látogatói főépülethez vezetett. a hüllő nem. hogy fölnyomja a vért a brachiosaurus hat méter hosszú nyakán át a fejéig. Már nem látták a dinoszauruszokat. A kongresszusokon még mindig akadtak kollégák. hogy erre csak egy négykamrás. Oda az egész – a múzeumi termek az óriás csontvázakkal és a köréjük sereglő iskolás gyerekekkel. amelyben Grant kulcsszerepet játszott. A dinoszauruszok azonban valószínűleg nem ezt tették. A gyíkoknak nincs elég energiájuk. olyan hideg környezetben. akkor Grant kutatási területe egyszeriben átalakul. A jelenleg élő állatfajok között felegyenesedett testtartás csak a meleg vérű emlősöknél és a madaraknál fordul elő.” Továbbmentek az ösvényen. A paleontológia lényegében egyfajta detektívmunka volt. . akik a legügyesebben tudtak következtetni. hogy az a felfogás. előbb-utóbb bekövetkezik. az egyetemi laboratóriumok a csonttálakkal. a földben hagyott. arra utaltak. Csak nem ilyen hamar. hogy melegen maradjanak. akik nem álltak szóba egymással. a gondosan kialakított növényi környezet mindenütt azt sugallta. – Egész jól néznek ki – szólt Ellie Granthoz. Sokan úgy gondolták. amiből az a következtetés adódott. hogy most a valóságot maguk mögött hagyva egy új világba lépnek be. a Yale Egyetem tanáraival az élen – gyanítani kezdte. hogy a dinoszauruszok olyan gyorsan futottak. melyek az élethez szükséges hőmennyiséget a környezettől vonják el. az őskori trópusok világába. Vagyis a dinoszauruszok testtartása melegvérűségre utal. zöld alagútjába. de a gyűlölködés nehezen múlt el. Már egy ideje folynak a viták erről. Végül a csoportos élettel kapcsolatos tanulmányok. ez egy kissé megváltoztatja a maga tudományterületét.

amelyekkel a növények megmérgezik a talajt maguk körül. – Hát nem csodás? – ismételte Ed Regis. hogy a Jurapark tervezői korántsem voltak olyan gondosak. hogy valaki halált okozó páfrányokat telepített az úszómedence köré. Ugyanis valódi jurakori páfrányokat látnak! Ellie megállt. amitől ehetetlenné lesz – és ugyanezt teszi minden duglászfenyő az erdőben. különösen párás napokon. Igen gyakori a több mint kétszáz millió éves kövületekben. A klónozás tehát lehetetlen volt. alacsony épületet látott. másokat mérgekkel. olyan vegyi anyagot termel ki. amelyet Ellie mindig roppant izgalmasnak látott. a fosszilizáció pedig nagyrészt elpusztította és szervetlen anyagokkal helyettesítette be a DNS-t. harcolnak a fényért. Soha eszükbe sem jut. A sarokban televíziókészülék állt. – Nézzenek előre! Ott a mi Szafarikastélyunk! – Ellie látványos. A növények nőnek. A probléma az volt. szinte biztos. annak nyilvánvalóan sejtelme sem volt róla. hogy közelebbről is megvizsgálja a páfrányokat. és buzgón végzik az összes életfunkciót: lélegeznek. – Ezek a növények. – Hacsak nincs valami olyan módja. Csakhogy az aki úgy döntött. hogy ezzel a páfrányfajtával díszíti a fürdőmedencét. Grant lakosztályában a világosbarna szín uralkodott. Regis igazat mondott. hogy a növények voltaképpen élőlények. Ez reakcióként megy végbe. dinamikus folyamat ez. Persze ha fagyott vagy tőzegmocsárban fennmaradt dinoszauruszt találtak volna. hogy minden ismert dinoszaurusz kövület volt. a fürdőszobában villanydróttekercs hevert a földön. Londonban és Tokióban afelől. már önmagában is arra utalt. A Serenna veriformans mérge csupán egyetlen kisebb példája annak a sokoldalúan kimunkált vegyi fegyvertárnak. mint amilyennek képzelték magukat. mint a képeket a falra. hogy a legtöbb embernek fogalma sincs minderről. a nádfonatú bútorokat zöld őserdői mintás huzat díszítette. de csak azért. Egy kerítésen túl fürdőmedencéhez értek. Ha egy duglászfenyőt bogarak támadnak meg. Vannak terpének. amely vízesésként csordult túl. megint másokat táplálnak. hajlanak és tekerednek. széthordják magvaikat és virágporukat. hogy a természet abból áll. csatorna: Hypsilophodont-felföld 3. és leömölve kisebb sziklamedencéket alkotott. hogy komoly spekuláció folyik Berkeley-ben. alkaloidák. sőt bizonyos szempontokból még gyilkosabb harcban. Ellie szólalt meg: – Igazi dinoszauruszokat nem lehet reprodukálni. nagyban hozzájárulnak ahhoz. mozognak. – Ott fognak lakni. szaporodnak – és védekeznek. Nem volt miből klónozni. és állandó kölcsönhatásban vannak az állatokkal: egyeseket kérgekkel és tüskékkel tartanak távol maguktól. csatorna: Húsevők földje . amelyet mumifikált a sivatagi környezet. amelyekkel kommunikálnak. Aki azt hiszi. hogy esetleg lehetségessé válhat egy-egy régen kihalt állatfaj – mint például a dinoszaurusz – újraklónozása. hogy az állatok valamiféle zöld háttér előtt mozognak. Az ember a vonzó zöld levelek puszta érintésétől is rosszul lehet. nehogy versenytársaik kinőhessenek. A növény Serenna veriformans volt. Fagyott vagy mumifikálódott DNS-t azonban mindeddig senki sem talált. válaszul arra az alleokemikáliára. amelyet a megrohamozott fa választ ki magából. amelynek tetejéből egy sor üvegpiramis magasodott ki. De tudta. vagy olyat. és vannak feromonok. amire eddig nem gondoltunk – mondta erre Grant. Összetett. csak éppen nincs mit lemásolni vele. amelyet a növények kifejlesztettek. hogy a földtörténet során a növények éppoly kemény versengésben fejlődtek ki. A puszta tény azonban. hogy a veriformans spórái egy halálosan mérgező béta-karbolin alkaloidát tartalmaznak. akkor annak a DNS-éhez hozzájuthattak volna. még annak legtávolabbi részén is. Hatalmas páfrányokkal volt beültetve az egész terület. ha növényekről van szó! – gondolta magában Ellie – Puszta küllemük alapján választják ki őket. hogy belehal. A toxin ötvenszer mérgezőbb az oleandernél. csatorna: Sauropodák ingoványa 5. rettenetesen téved. ha pedig egy gyerek egy keveset a szájába töm. Grant tudott róla. mint az állatok. mert ezek segítik a szaporodásukat. ma azonban közönségesen csak Brazília és Kolumbia nedves árterületein fordul elő.” Ellie azonban jól tudta. honnan szedték a DNS-t? – kérdezte Grant. Az a zöld háttér csupa élet. míg itt vannak nálunk a Juraparkban. táplálkoznak. Mint amikor van egy fénymásolónk. „Milyen naivak az emberek. – Hát nem csodás? – kérdezte Ed Regis. mert nem tudunk igazi dinoszaurusz-DNS-hez jutni. A szoba még nem volt teljesen kész: a szekrényben egymásra rakott lécek tornyosultak. hogy igazi őskori atmoszféra alakuljon ki. ürítenek. – Fogalmam sincs – felelte Grant. már amennyiben hozzá lehet jutni a szükséges dinoszaurusz-DNS-hez. ragadozók (és a gyermekek) számára. a tetején kártya. melyen ez volt olvasható: 2. – Például mi? – kérdezte Ellie.– Az egyetlen kérdésem csak az. Használhatatlan volt az egész modern génsebészeti technológia. Igen. amelyek ehetetlenné teszik őket a rovarok. csatorna: Triceratops-terep 4.

ahhoz voltak hegesztve a rácsok. Grant az órájára pillantott. bement a hálószobába. így árnyékcsíkok hullottak az ágyra. Ellie lépett a szobába. Látta a kastély tervrajzait. de az csak sistergett. ez a kerítés sem szerepelt a terven – szólt Ellie. Alan? Már ami a szobákat illeti. Mutatósra tervezték és feketére festették. Grant megállt egy pillanatra. – A lány körüljárta a szobát. és az ágyra hajította táskáját. hogy utólag kerültek a helyükre. de semmiféle szépítő igyekezet nem tudta eltakarni a fém vastagságát és háromméteres magasságát. Bekapcsolta a készüléket. csatorna: Stegosaurusok délvidéke 7. képet nem adott. – Csak úgy mellesleg: azok a páfrányok mérgezőek. Az egész kastélyt hüvelyknyi vastag acélrácsokból készült kerítés vette körül. Az ablakok az úszómedencére néztek. és acélkeretbe helyezték. Sajnos azonban az üveget erős rácsok védték. – De meg ám! Szerintem is. oda nem illő kidolgozásukon. . Sátorszerű érzést keltett. „Rejtély!” – gondolta Grant. – Kicsik az ablakok – mondta. Hát a kerítést megfigyelted-e. amikor bejöttünk? Grant bólintott. csatorna: Velociraptorok völgye 8. csatorna: Pterosaurusok hegye Kellemkedően mesterkéltnek érezte ezeket a neveket. Átment a hálószobából a nappaliba. piramis formájú üvegtető volt. hogy kovácsoltvasszerű legyen.6. hogy rácsok lettek volna az üvegtetőn. Pontosan az ágy felett nagy. – Megváltoztatták a tervet. Egyébként nem tűnt fel neked semmi. Az ajtók is acélborításúak. mintha a csillagos ég alatt aludna az ember. – Hát ennek az okát biztosan megkérdezzük majd – mondta. de nem emlékezett rá. Fekete acélkeretet szerkesztettek az üvegfalon kívülre. – Mintha csak erődöt csináltak volna ebből az épületből. Ennek nem kellene okvetlenül így lennie. Kikapcsolta. Látszott is nyers. – Az üveg edzett. – Úgy emlékszem. – Húsz perc múlva indul a szigetnéző túra.

ha óhajtja. a keze összefonva a mellén. miért is vagyunk itt. amint azt bizonyára már mindannyian felismerték. hogy a lehető legjobb benyomást keltsék. Ellie-hez és Malcolmhoz. – Egy: a csecsemőhalandóság január és február hónapokban alacsony. Grant felfedezése. hogy a dinoszauruszok nem juthatnak ki innen? Gennaro leoltotta a lámpákat a teremben. hogy magát a valóságos töredéket. szeretném összefoglalni. miután állítólag megharapott egy amerikai kislányt a parton. Mielőtt azonban nekiindulnánk. a kérdésem egyszerű. hogy Mr. Ez emeletes volt. Ismaloyától Puntarenasig. és mindenfajta adatot pontosan számon tart. Márciustól kezdve olyan jelentéseket kaptak. akik mélyen aludtak. csupa üveg. amely szintén bizonyíték lehet. majd áprilisban ismét alacsony. légi úton ideszállítsák. márciusban kiugrik. aki dinoszauruszként azonosított egy korábban ismeretlen állatot. Ez év júliusában találták. – Hamarosan bejárjuk a létesítményeket – mondta Gennaro. mindenütt drótok és kábelek borították a padlót. később bővebb részleteket is előadhat. Kis előadóterem volt benne. de egy éven belül megnyílik. Májustól kezdve azonban szinte mindvégig magas. és onnan szólt Granthoz. Biztonságos-e a sziget? Biztonságos-e a látogatók számára. Az első dr. Intézkedtem. amelyet a Közegészségügyi Szolgálat készített a csecsemőhalandóság alakulásáról a part menti településeken az év folyamán: – Hadd hívjam fel a figyelmüket e grafikon két jellegzetességére – mondta Gennaro. egészen júliusig.AMIKOR DINOSZAURUSZOK URALTÁK A FÖLDET A látogatóépületben jöttek össze. ahol génsebészeti úton előállított dinoszauruszok természetes parkszerű környezetben mozoghatnak. idegenforgalmi látványosságot nyújtva. Március múltán már nem érkezett jelentés gyíkharapásról. high-tech építészeti stílus” – állapította meg magában Grant. amellyel foglalkoznunk kell. Ezt a dinoszauruszt csak egy töredékből ismerjük. Gennaro felmászott a színpadra. és kellő biztosítást nyújt-e a tekintetben. – Biztos vagyok benne. – Costa Ricában kitűnő a közegészségügyi szolgálat. látható vasbeton szerkezettel és fémgerendákkal. – Nos. mielőtt távozunk. A hangja enyhén visszhangzott a teremben. Rendelkezésemre bocsátották viszont a következő grafikont. „A legutolsó. Kissé távolabb más kiállítóvitrinek álltak: MI AZ A DINOSZAURUSZ? és A MEZOZOIKUM VILÁGA. Közben egy második tény is a tudomásunkra jutott. Grant doktor. Ezek a gyíkharapások szórványosan jelentkeztek a part menti falvakban. Hammond és munkatársai úgy fognak bemutatni mindent. De a kiállítás még nem volt készen. amit el kell döntenünk. amelyet egy Tyrannosaurus rex-robot uralt. öregeket is. Hammond hátul ült. Ez fenyegető tartásban helyezkedett egy kiállítási terület bejáratánál. Ebben a hónapban szenvedte el a harapást az amerikai kislány . így önök közvetlenül is megvizsgálhatják majd. Ez a látványosság még nem nyílt meg a turisták előtt. ez egy olyan sziget. mely a Costa Rica-i parton került elő. és mi az. szabadon. amelyen ez állt: AMIKOR DINOSZAURUSZOK URALTÁK A FÖLDET. melyek szerint egyes csecsemőket gyíkok haraptak meg a bölcsőjükben – sőt. amely egy New York-i laboratóriumban van. hozzáteszem. – Két olyan tény van. Lényegét tekintve. amit meg kell tudnom.

Újra kigyulladtak a fények. például egy új influenzavírus okozza a grafikonon megjelenő fluktuációt. de maga nem tudja. A Közegészségügyi Szolgálat gyanakszik rá.. A turbulencia váltakozást hoz létre. És ilyen típusú... hogy nem okozhatják a szökött dinoszauruszok? – Mert ez nonlineáris jel – felelte Malcolm. mondjuk. amely valójában sokkal kifinomultabb és érzékenyebb. Sohasem szökhetnek ki innen. hogy izolálható. Azt pedig nem hiszem. amely arra utal. hogy ők okozzák. – Miért? – Amiatt.. – Nem is szöktek soha! – morogta Hammond. – Sok száz dinoszaurusz kellene ahhoz. – Valószínű. máris – felelte Malcolm. Próbálják ki maguk is. Se be. vagy abban reménykedni. A másik dolog. Valamire. mit beszél. hogy valami rendszeresen váltakozó jelenség hatásáról van szó. hogy ellenőrizze. izolált világot alkossanak. amire felhívnám a figyelmüket. se ki nem mehet semmi. – Máris?! – kérdezte meglepetten Gennaro. – Kutya legyek. Ez valami sokkal nagyobbra törekszik. – Igen. amit maguk itt létre akarnak hozni. Az állatkertek fogják a már létező természetet. hogy valami más jelenség. egy olyan komplex rendszer. – Egyszerűen megvalósíthatatlan. – De miért nem? Tán nincsenek állatkertek. – Megtakaríthatunk magunknak egy csomó időt – szólt közbe Malcolm. csepp. váltakozó grafikont fognak kapni. Grant szólalt meg: – És ezt honnan tudja? – Figyeljék meg: a grafikon magas és alacsony pontok között ugrál – mondta Malcolm. sem ökológus. A szándék szerint ezen a szigeten a levegő kivételével – amely szabadon folyik – minden tökéletesen izolált. az én szempontjaim szerint ez lehetetlen vállalkozás. Felállt és elhagyta a termet. Én nem vagyok sem környezetvédő. De ennek a parknak nem az állatkert a mintája. Valahogy így. ahol szabadon kóborolnak a rég kihalt élőlények. Az állatok rendszeresen megszöknek. csepp-csepp. hogy adóval tartozik. és azt is elszúrjuk. Még ezek a minimális módosítások is nemegyszer csődöt mondanak. – Az állatkertek nem reprodukálják a természetet – mondta Malcolm. – Maga pimasz kis nyavalyás! – sziszegte Hammond. Az. Uraim! – mondta Gennaro. de tudniuk kell. hogy vannak szökött dinoszauruszok? – Ez Gennaro kérdése volt. hogy állatok jutottak a szárazföldre a szigetről. ha értem! – Pedig roppant egyszerű. ez a jele. – Ilyen fokú izoláció egyszerűen nem lehetséges – mondta szárazon Malcolm. Én pedig ehhez hasonló módon. Csepp-csepp. amelyekre magyarázatot keresek. ha bármiféle új betegség kezd elterjedni egy közösségben. A természetről alkotott képünk roppant módon leegyszerűsített. – Hülyeség! – fakadt ki Hammond a háttérben. mint amilyennek hajlandók vagyunk elfogadni. így van? – Így. – Beszéljünk nyíltan.. Gennaro csak a fejét ingatta. Mintha azt kérdezném magától. – De ugyanakkor az a véleménye. akkor váltakozva kapnak nagy és kis cseppeket. hogy egy kis örvénylés is jelentkezik. hogy nincs is mit számolni rajta. – Én máris megmagyarázom magának az egészet. – Jó – mondta Gennaro. Elő sem kellene vennie a zsebszámológépet. az a rejtélyes. de ezt nem jelentik a parti falvakban működő egészségügyi dolgozók. csepp. amit „természetnek” nevezünk. Úgyis tudná. Van valamelyiküknek bármiféle.is. Ha csak egy kicsit elcsavarják a csapot. Folyamatosan ezt tesszük! – Már elnézést – mondta erre Malcolm –. – Roppant sajnálom – vonta meg a vállát Malcolm –. Annyira önmagáért beszél matematikailag. hogy tereket képezzenek az állatok tartására. – Ez sok összetett rendszerre jellemző. de a tény az tény marad. és igen csekély mértékben módosítják. Például a csapból csepegő vízre. Az itt tartott állatok sohasem keveredhetnek a Föld nagyobb ökoszisztémájával. – Uraim.. De ha jobban megnyitják. úgy. – De akkor miért állítja.. ez a sziget kísérlet egy múltbeli természeti környezet újjáteremtésére. – Kettő: a Közegészségügyi Szolgálat grafikonjának szinte bizonyosan semmi köze a szökött állatokhoz. – De megvalósítható. Hogy egy olyan. hogy valamilyen tényező hatással van a csecsemőhalandóság alakulására. Nézze. mennyire nem értik az egészet! Hát mennyit . ahol. hogy nem lehet így sikeresen lemásolni a természetet. kéthetenkénti kiugrás. biztosan tudom. Igen. folyamatosan kezd csepegni: csepp. A következtetésem ezért az. – Egy: igen valószínű. – Nos.. – Szóval ezek azok a tények. ami inkább valamiféle földi űrállomással rokon. hogy több száz szabadult volna el. hogy kell-e adót fizetni egymilliárd dollárnyi jövedelem után.

.. Donald! – De igen. Attól tartunk. a vállán baseballkesztyű lógott zsinóron. – Az Isten verje meg! – mondta Gennaro. – Hát nem veszi észre.. ha tudomásul vesz valamit.. ha el kell hallgattatnom. hogy rakja őket vissza a helikopterre! – kiáltotta Gennaro. A kislány kissé félszegen integetett. Építünk egy.. a másik egy valamivel fiatalabb kislány. – És be fogom bizonyítani.kell még bizonygatni? Hányszor kell rámutatni a tényekre? Megépítjük az asszuáni gátat. – A maga szigete e pillanatban komoly vizsgálat tárgya. – Ez a hely tökéletesen biztonságos – mondta Hammond. hogy kockára teszi az. de úgy hallom. Gennaro halkan felnyögött. Alighanem a példányt hozza Grant doktornak. parazitikus fertőzöttséget okoz. – Jó lesz. – Valóban. A két gyerek ügyesen sietett lefelé a helikopter leszállóhelye felől az úton. – Ugyan. mert a befektetőiknek súlyos aggályaik vannak. – A gép már el is ment. – Nem fog elhallgattatni. hogy megvizsgálhassa.. ugyan – nyugtatta Hammond.. Nem szeretnék ráijeszteni a gyerekekre. Két gyerek jött lefelé a domboldalon Ed Regis vezetésével. Ehelyett elpusztítja a termékeny Nílus-deltát. Nyakán kiduzzadtak az erek.. és szinte suttogva mondta: – Uramisten! – Nyugodjon meg. – Elindult kifelé a teremből. hogy szörnyű veszedelmes hely. – Nem igaz. Jogomban áll.. nem vesztették-e el fölötte az uralmat. jó? – szólt Hammond. és kihúzta magát. és tönkreteszi az egyiptomi gazdaságot. és állítjuk. és. A hegy lábánál álltak. – Maga vesz tudomásul valamit! Ez itt nem piknik! Nem társasági kirándulás. Grant megfordult.. jön a helikopter. – Ez az én szigetem – mondta Hammond –.. és azt hívok ide. akit csak akarok.. – Válnak a szüleik. majd kis távolságra Gennarótól és Hammondtól megálltak. Gennaro üvöltött: – Agyalágyult vénember! Elment a maradék esze is? – Most aztán elég! Ide figyeljen! – mondta Hammond.. mennyire az! – Én pedig ragaszkodom hozzá. a rotorok hangja halkult. – Hogy mit csinált?! Kit hívott meg?! – Nyugodjon már meg! – szólt Hammond. – Megjöttünk! . nagypapa! – mondta. – Szia. Mindannyian követték. – Nem lehet – mondta Hammond. – Nem! – kiáltotta Gennaro. Tizenegy év körüli.vagy nyolcéves. – Elnézést – vágott közbe Gennaro –. csak egy vidám hétvégét akartam szerezni nekik. talán hét. „Mets” feliratú baseballsapka alá gyűrte szőke haját. Gennaro túlordította a helikopter zaját. hogy a segítségével felélesztjük a vidéket. – Bármit hablatyol is az a bolond matematikus. szemüveges kisfiú volt az egyik.. – Majd később megbeszéljük.

– Mi volt az a könyv. hogy a dinoszauruszok meleg vérű állatok voltak. Tim elszégyellte magát. Alexis is megérezte a feszültséget. – Naná! Most ismerkedtél meg vele. hogy valami nincs rendben. dehogy – mondta Tim. – Menjünk be mindannyian a látogató központba. Alexis gonoszkodott. A nagyapja javában veszekedett a vele szemben álló. – A bácsit ismerem – mondta Tim. tetőtől talpig feketében. Ki kell mennem. – És mióta érdekelnek a dinoszauruszok? – kérdezte Grant. Aztán egy kövér. a keze a csípőjén. Felöltötte az anyja legidegesítőbb tartását. feszengve álldogált mögöttük. Alan Grant az egyik vezére azoknak. meg egy szakállas férfi farmerben és mintás hawaii ingben. – Nekem ki kell mennem – mondta Lex. – Előbb bemutatlak titeket – szólt rá Ed Regis. mert sok dinoszaurusztojást találtak ott. Tim megpróbálta rendbe szedni a benyomásait. – Mindenki elindult. hogy Grant doktor szegődött melléje. aki még csak kezet sem nyújtott. De Timmy alig hallotta a húgát. amikor hirtelen ráébredt: tudja. és észrevette. ha valakinek dinoszauruszokon jár az esze – mondta Lex. ki a szakállas! – Nyitva felejtetted a szád! – szólt Lex. De Ed Regis már hozzá is kezdett a bemutatáshoz. – Apu szerint hülyeség. mert hátramaradt. – Mondok valamit! – szólt Ed Regis. A többi felnőtt meg zavarodottan. Lex mérgesen villantotta rá a szemét. és elmesélte a család utolsó kirándulásának történetét a Természettudományi Múzeumban. amint Gennaro odasúgja a nagyapjának: „Ezért meg tudnám ölni!” – aztán a kisfiú felnézett. – Azt mondtad. – Néha elmegyünk a múzeumba. ki kell menned – szólt a húgára. Grant professzor több dinoszaurusztojást talált. – A papádat nem különösebben érdekli? Tim bólintott. és így szólt: . vörös képű. – Azt én tudom. akik azt hirdetik. Granttal kell beszélgetnie. hogy nekem is ez a bajom. És jó illusztrátor is. és sportoljon. – Agyadra mentek a dinoszauruszok? – kérdezte a szakállas férfi. – Mindjárt megyek is – válaszolta Lex. aztán az a férfi következett. vagy tévedek. amit Alan Grantról tudott. Az apja ránézett az egyik csontvázra. – Az előbb még sürgős volt. Alex! – Indulj te. hogy Timmy inkább menjen a levegőre. csak a fejével biccentett. Zavarban volt. egyetemista kinézetű pofa következett. Ő rajzolta a képeket a saját könyvéhez. Ez izmos ember volt. Timmy? – Tizenegy. – Hány éves vagy. Tim hallotta. Mindjárt hozzá is kezdhetünk a bejáráshoz. de Ed Regis vidám hangon mondta: – Mindenkinek bemutatlak benneteket. – Nem. Timmy? – kérdezte a szakállas. – Nem. Volt ott egy szőke nő sortban. Előbb nagypapához vitte őket. végül pedig egy sovány férfi. fiatalabb férfival. Timmy! – Ne légy undok! – mondta a kisfiú. – Már egy ideje – felelte. és Gennarónak hívták. aztán kezdődhet is a kirándulás. és a magasba dobta baseball-labdáját. hogy dr. – Apu szerint Timmynek agyára mentek a dinoszauruszok. aki mindkettejüket megpuszilta. ha rá tudom venni a családunkat. Az járt az eszében. Rengeteg ásatást végzett egy Tojásdomb nevű helyen Montanában. Ez olyan természetjáró fajtának látszott. akinek a számítógépekkel volt valami dolga. nem te. – Őszintén szólva félek. Tim nagyot nyelt. – A dinoszauruszok letűnt világa – felelte Tim. – Olvastam a könyvét. A többiek valahogy összemosódtak Tim szemében. akivel az előbb vitatkozott. Neki kellett meglódítania: – Indulj már. amit azért hívtak így. A papámat. mint bárki más a világon. és éppen a szőke nő lábát nézte. Timothy? – kérdezte a kislány. – Azt mondja.A KIRÁNDULÁS Tim Murphy egyből látta.

és el akarja kapni a meccset a tévén. Egy camposaurus. hogy a Mets játszik. – De apu. és Lex is ezt akarta. Aztán mentek tovább a következő látnivalóhoz. hogy az anyjának pasasa van. a leghatalmasabb ragadozó. De hát az ő családjában általában mindig így mennek a dolgok. Aztán az apja azt mondta. A vállára tette a kezét. – Én is tudom. és hátrább lépett. Nem értette. Ennek több van. amiért az apjuk elment. Állt még egy kicsit mellette. és megszorította egy kicsit. ha egy idő után nem vitatkozik az apjával. hogy a dinoszaurusz hibás. hogy az apja válik az anyjától. Most. Mármint így mentek annak idején. – És én ezt higgyem el neked? – Pedig az. hogy a tyrannosaurusnak túl sok csigolyája van a farokrészén. aztán megkérdezte: – Na és mért számolod őket? – Azt hiszem. hol vannak a csigolyák – mondta bosszúsan az apja. Az apja szó nélkül nagy lépésekkel a sarokban álló teremőr felé vette az útját. De most már lehet. ez csak közepes nagyságú. Nem az 5072-es számú volt? – De igen – felelte Tim. – A csigolyáit? – Igen. – A te nagyapád szigetén. és Lexnek persze nem is említette. – Hát ez döbbenetes. hány csigolyának kell lennie a farkon! Esküszöm. – Az 5072-es volt? – kérdezte Grant. – És a kréta a legrégibb? – Dehogy. – Mondd. hogy az már. tenisz meg ilyesmi. pedig pontosan ezért jöttek. – Te tudod. A kislánynak a szíve is majd megszakadt. uszoda.. Fura kifejezés ült az arcán. javította ki magát Timmy gondolatban. de nem volt biztos benne. nekem elég nagynak látszik. ez még csak nem is felnőtt! Az apja összehúzott szemmel méregette a csontvázat. – Semmit – felelte a kisfiú. apu. – Kréta? No és mi a különbség aközött. hogy erre sosem kerül sor. semmiség. – A mamám szerint ez csak valami üdülőhely. – Hát nem tudom! Nekem elég nagynak látszik. így hát a család távozott a múzeumból. – Majd séta közben elmesélem neked. A gerincén. a jura a régibb. miről beszél Grant. a tyrannosaurus ott a múzeumban. – Egy biztos. mindegy – mondta az apja. Tudja. Téves. – Évek óta ígérik. hogy kijavítják. Tim voltaképpen nem bánta. Aztán az apja visszajött. – Hát nem éppen – mondta Grant. ellenkezik-e. és az elmúlt néhány hét során olyan undok lett. Ennyi az egész. Egy tyrannosaurusnak csak harminchét csigolyája lehet a farkán. Az egyik csontváz előtt – Tyrannosaurus rex volt. . – És mi ez? Jura? – Jézus! Dehogy. – Mit csináltál megint? – kérdezte Timtől az anyja. kréta. hogy jobb. ezt honnan tudtad? – kérdezte. amely valaha élt a földön – Tim hosszasan álldogált. – Timhez fordult. – Na. ami itt folyik – mondta Grant. – Honnan tudja? Grant elmosolyodott. Az őr ugyanis természetesen megerősítette. A kisfiú viszont már megtanulta. hogy jura meg kréta? – Ó. az életben nem láttam ilyet! Te tényleg teljesen belebolondultál a dinoszauruszokba. Tim pedig nem látott több dinoszauruszt. – Tudod. Az apja már el is költözött.– Ez aztán jó nagy! Tim erre azt felelte: – Nem. biztosan minden másképp lesz majd. s bár kezdetben ez egy kicsit furcsa volt. hogy lássa. Végül megszólalt az apja: – Mit nézel annyira? – Számolom a csigolyáit – mondta Tim. – Miért nem? – Amiatt. hibás. – Tessék? – kapott észbe Tim. – Én csak azt mondtam. így csak morgott valamit. Az volt az érzése. – Hát olvastam – felelte Tim. apu.. kisfiam – mondta az apja. hogy a Természettudományi Múzeumban lévő csontváznak téves a csigolyaszáma? – kérdezte az apja. Csak úgy százmillió év – mondta Tim. – Azt akarod mondani. Tim a fejét rázta.

amikor megszólalt Ed Regis: . De hát éppen ez a baj az egész reklám. Senki sem tekinti szakembernek. mi lesz az üdülőtelep igazi látványossága. amint távolabb hátul Sattler doktornő is kilép a fürdőszobából. barátaim. Hátrafordult. Hát mit ért ő ahhoz. Tim a többiekkel együtt haladt Ed Regis nyomában felfelé az emeletre vezető függő lépcsősoron. ha beteg lesz valami munkás? Most meg szaros idegenvezető és óvó bácsi.és propagandafőnöke. miközben várakozva toporgott a látogatóközpontban. – Maga felel értük az egész hétvégén! Ed Regisnek ez a legkevésbé sem tetszett. – Sasszemmel figyelje az unokáimat. még csak nem is idegenvezető. még ha fontos személyiségekről van is szó. – Rendben. Az Harding dolga lett volna. Aztán látta. Elhaladtak egy felirat mellett. És ami azt illeti. Nem vesztegetheti az idejét arra. amelyeket finom köd vett körül. és még ezer dolgot kell elintéznie a nyitásig hátralévő év alatt. Erkélyre nézett. A kreatív embereket dédelgetni kell. Az egyik fal üvegből volt. A másik falon ajtók. hogy jól végezzék a dolgukat. Mint azt az ügyet múlt januárban. és csalódást érzett. de még mindig a legkülönbözőbb feladatokat varrták a nyakába. Regis már hét hónapja tartózkodott nagyrészt a szigeten – hol jött. hol ment –.és propagandaszakmával. ha valaki ezt választja foglalkozásul. Hardingé vagy Owensé. most meg egy vacak óvó bácsit csinál belőlem!” – dohogott magában elkeseredetten Ed Regis. úgy vigyázzon rájuk! – parancsolt rá az öreg. VENDÉGSZOLGÁL ALIGAZGATÓ. A folyosón félúton üveg válaszfalhoz értek. hogy tudósokat kalauzol a látnivalók között. hogy mit kell csinálni. és pálmákra. amelyen újabb jelzés állt: B BIOLÓGIAI VESZÉLY VIGYÁZAT! BIOLÓGIAI VESZÉLY Ez a laboratórium megfelel az USG P4/EK3 sz. akkor kezdjük a kirándulásunkat a második emeleten. az általános vállalkozóé. Ehelyett Ed Regis nyakába zúdult. amin ez állt: ZÁRT TERÜLET BELÉPÉS CSAK ENGEDÉLLYEL Tim a felirat láttán izgalomba jött. Bátorítani.. mindenféle nyomtatott felirattal: FŐÁLLATŐR. Megalázónak érezte.„Tessék.. Ő nem óvó bácsi. Végigmentek a második emeleti folyosón. Csupán a San Franciscó-i és londoni PR cégekkel és a New York-i és tokiói ügynökségekkel való kapcsolattartás egész embert követel – különösen mivel az ügynökségek előtt még mindig el kell titkolni. és ettől idegesek voltak. A cégek csak figyelemfelkeltő hadjáratot folytathattak.. és megszámlálta a fejeket. genetikai előírásoknak Alatta további jelzések: VIGYÁZAT! Teratogenikus anyagok Terhes nők számára e terület tiltott! VESZÉLY! Itt radioaktív izotópokat használnak Potenciális rákkeltő hatás! Tim egyre izgatottabb lett. Egy még hiányzott. Teratogenikus anyagok! Amikből szörnyetegeket hoznak létre! Borsódzott a háta.. Ő a Jurapark reklám. minden konkrétum nélkül.

. hogy be is jön! – mondta Wu. Wu. Mindössze húsz ember működteti az egész telepet.. – A fagyanta – magyarázta Wu –. A videomonitoron nézték. hogy akár ötven nanogrammnyi anyag is elég a sikerhez. Megálltak az ablakoknál. A szoba tele volt sárga kövekkel. Ed Regis becsúsztatta a kártyát a nyílásba. – Ez tényleg nagyon ügyes – mondta Malcolm. A borostyánban mindenféle rovar megtalálható – köztük csípős rovarok is. Természetesen ezt nem tudhatjuk biztosan. – Felemelte az egyik sárga követ. amíg ki nem vonjuk. – Én viszont még mindig nem értem – ismerte be Grant. Biztosíthatom magukat. Ilyenkor a kövület teljes épségben megőrzi őket. és paleo-DNS-t nyerünk. majd visszafordult a számítógép-monitorokhoz. amely egy legyet zárt magába. – A genetika kicsit bonyolult dolog. aki legombolt gallérú. Itt a központi vezérlőterem. Szerencsés esetben igen. John Arnold – mutatott Regis egy sovány férfira. Ed Regis a csoporthoz fordult. Sőt. Grant Ellie-re nézett. de őskori emberi maradványokból is nyert vérsejteket így. Négy laboratóriumi köpenyes asszisztens volt benn. Innen ellenőrizzük az egész parkot. valójában két lehetséges forrásunk van. – Biztosan szeretnék megtekinteni ezt a termet – mondta Ed Regis –. kurtán biccentett. – Ha ebben a légyben van idegen vérsejt. aki a harmincas éveinek közepén járó. kartondobozokban és a nagy. a híres fehér vadász Nairobiból. és cigarettázott. Felpillantott a csoportra. de előbb nézzük meg. – Nyilván feltűnt önöknek. – Nos – mondta Wu –. amelyek nagyobb állatok vérét szívták. őskori fagyanta. Ingzsebére akasztva hordta napszemüvegét. ha jönni kezdenek a vendégek. a főgenetikusunk. Tim zöld fényben úszó kis szobát látott odabenn. – Aki baloldalt áll. és meg nem vizsgáljuk. és bepillantottak az elsötétített helyiségbe. honnan szerezzük a dinoszaurusz-DNS-t. és elismerően bólintott. Némelyik képernyőn adatok látszottak. Egy asszisztens borostyánt helyezett alá. Ez egy gramm ötvenmilliárdnyi része. Álltak és beszélgettek. A Loy-féle antitesteken alapuló kivonási technika alkalmazásával néha közvetlenül is nyerhetünk DNS-t a dinoszauruszcsontokból. amely olyan volt. Az eljárása olyannyira kifinomult. – És aztán maguk a rovarok pedig megőrződtek a borostyánban. – Mellette pedig a parkőrünk. hogy húsz százalék nem elegendő a mi munkánkhoz. – Ó. – Csak kiegészítésképpen – felelte Wu. – Vért szívtak – ismételte Grant. mint egy űrhajós irányítóközpont kicsinyített mása. de eredményes! – Dinoszaurusz-DNS-t voltaképpen könnyebb ezzel a módszerrel kivenni. hogy klónozhassuk. amint hosszú tűt szúr a borostyánba. de húsz százalék még mindig kinyerhető. aztán Malcolmra. rövid ujjú ingben.. Regis bemutatta Henry Wut. honnan vesszük a dinoszaurusz-DNS-t. Sárga kövek voltak az üvegpolcokon. – Gondolom. Maga dr. lassú folyamat volt. a többség azonban videoképet közvetített a park különböző részeiről. hogy itt a szigeten a személyzet létszáma minimális. Nekünk a teljes dinoszaurusz-DNS-típus kell. Odalépett az egyik mikroszkóphoz. mint az emlősökét. – És maguk az ő technikáját alkalmazzák? – kérdezte Grant.– Ne törődjenek a jelzésekkel. biztosítom. ez is biztonsági kártyával nyílott. ki fogjuk tudni vonni belőle. – Csak nem azt akarja mondani.. – Grant csak ingatta a fejét. mit is csinálunk mi itt. Loy arra használta.. egyenesen az őskori légy légcsövébe. Ezt csináljuk immár öt éve. – Dr. s így a vörös vérsejtjeikben nincs DNS. Hosszú. Ő fogja elmagyarázni. karcsú testű férfi volt. a fény felvillant. nyakkendőben volt. Az ajtón ez a felirat állt: EXTRAKCIÓ. és csapdába ejti őket. aztán Loy eljárását alkalmazzuk. – Legalábbis megpróbálom – mosolygott Henry Wu. – Hát az oldódó proteinek legnagyobb része kiázik a fosszilizáció folyamatában. az a főmérnökünk. minden teljesen veszélytelen. az ön számára is nyilvánvaló. Egy függőleges üveglapon ott állt az egész park átlátszó térképe. ha megőröljük a csontokat. de egyelőre csak ennyien vannak. ami ott van nem reprodukáljuk. – Ördögi! És be is jöhet. Mindegyik kő fekete tintával volt felcímkézve. A túloldalon őr állt. hogy dinoszauruszok vérét szívták? – De. mint megkövült. vagy nagy felbontású videoképernyők képeit nézték. De önöket valószínűleg az izgatja. kihúzható tálcákon. igen. Robert Muldoon. akik kétcsövű sztereomikroszkópba bámultak. Egy emlős . hogy proteint vonjon ki kihalt ausztráliai erszényesekből. hogy az emlősök vörös vérsejtjeinek nincs sejtmagva. s az ajtó kinyílt. Csak két ember volt odabenn. Villogó számítógép-monitorok sora nézett szembe vele. És innen szerezzük meg. Ami nem más. Ennek az az oka. Csak a törvényelőírások miatt vannak ott. – Milyen az arány? – kérdezte Grant. Mr. – Muldoon jól megtermett. – Felmerült bennem a kérdés – mondta Grant. gyakorta ráfolyik a rovarokra. Természetesen a számuk nőni fog. széles vállú férfi volt khakiruhában. – Átvezette őket az ajtón. valamilyen kihalt lény DNS-ét. és akárcsak a laboratóriumi terület többi ajtaja. Tátva maradt a szája. – Borostyánból.

és megállította az egyik képet. a falak mentén pedig csípőmagasságig érő. mint aki már rég tisztában van az egésszel. hogy a DNS hibás.klónozásához fehér vérsejtet kell találnunk. a Cray XMP szuperkomputerek működtetik. Ha napi nyolc órán át minden másodpercben megnéznénk egy-egy ilyen ernyőt. thymin. guanin és cytozin. A számítógép kiválaszt egy sor enzimet. Tim látta. Türelmetlenül pislantgatott a következő ajtó felé. rozsdamentes acéldobozok sorakoztak. hogy a szekvencia négy alapvető vegyületből áll. egyenként kétméteres. Wu. mint a mai madaraknak. Az első dolgunk ezért az. l 61 121 181 241 301 361 421 481 541 601 661 721 781 841 901 961 1021 1081 1141 1201 1281 GCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGC GGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCG Nsp04 TGTTCCGACCCTOCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGC TGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTG □ BrontIV CCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAA AGTAGGACAGGTGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAG 434 [nxT] AoliBn ATCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACT CCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCTGGGCT GGCGTTCGCGACOCGAGGCTGGATGGCCTTCCCCATTATGATTCTTCTCGCTTCCGGCGG CCCGCGTTGCAGGCCATGCTGTCCAGGCAGGTAGATGACGACCATCAGGGACAGCTTCAA CGGCTCTTACCAGCCTAACTTCGATCACTGGACCGCTGATCGTCACGGCGATTTATGCCG Nsp04 CACATGGACGCGTTGCTGCCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAA CAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAA 924 Caol11 DinoLdn GCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGG CTTTCTCAATGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTG ACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCA ACACGACTTAACGGGTTGGCATGGATTGTAGGCGCCGCCCTATACCTTGTCTGCCTCCCC GCGGTGCATGGAGCCGGGCCACCTCGACCTGAATGGAAGCCGGCGGCACCTCGCTAACGG CCAAGAATTGGAGCCAATCAATTCTTGCGGAGAACTGTGAATGCGCAAACCAACCCTTGG CCATCGCGTCCGCCATCTCCAGCAGCCGCACGCGGCGCATCTCGGGCAGCGTTGGGTCCT 1416 DnxT1 SSpd4 GCGCATGATCGTGCTACCCTGTCGTTGAGGACCCGGCTAGGCTGGCGGGGTTGCCTTACT ATGAATCACCGATACGCGAGCGAACGTGAAGCGACTGCTGCTGCAAAACGTCTGCGACCT – Itt egy kis töredéknyi dinoszaurusz-DNS tényleges szerkezetét látják – mondta Wu. hogy Grantot még mindig nem sikerült meggyőzni. hogy követni sem lehetett őket. zümmögő zajt hallottak. – Arra. Tolóajtókon át egy hűtött terembe léptek. amely elvégzi a feladatot. Több monitor volt a teremben. Hangos. míg végignéznénk a teljes DNS-sort. hogy kijavítsuk pontosabban a számítógépnek kell ezt tennie. amelyeken olyan gyorsan futottak az adatok. 1 61 121 181 241 301 361 421 481 541 601 661 721 781 841 901 961 1021 1081 1141 1201 1281 1341 GCGTTGCTGG GGTGGCGAAA TGTTCCGACC TGCTCACGCT CCGTTCAGCC AGTAGGACAG ATCGGCCTGT CCAAACGTTT GGCGTTCGCG CCCGCGTTGC CGGCTCTTAC CACATGGACG CAAGTCAGAG GCGCTCTCCT CTTTCTCAAT ACGAACCCCC ACACGACTTA GCGGTGCATG CCAAGAATTG CCATCGCGTC GCGCATGATC AGAATGAATC AACATGAATG CGTTTTTCCA CCCGACAGGA CTGCCGCTTA GTAGGTATCT CGACCGCTGC GTGCCGGCAG CGCTTGCGGT CGGCGAGAAG ACGCGAGGCT AGGCCATGCT CAGCCTAACT CGTTGCTGGC GTGGCGAAAC GTTCCGACCC GCTCACGCTG CGTTCAGCCC ACGGGTTGGC GAGCCGGGCC GAGCCAATCA CGCCATCTCC GTGCT AG ACCGATACGC GTCTTCGGTT TAGGCTCCGC CTATAAAGAT CCGGATACCT CAGTTCGGTG GCCTTATCCG CGCTCTGGGT ATTCGGAATC CAGGCCATTA GGATGGCCTT GTCCAGGCAG TCGATCACTG GTTTTTCCAT CCGACAGGAC TGCCGCTTAC TAGGTATCTC GACCGCTGCG ATGGATTGTA ACCTCGACCT ATTCTTGCGG AGCAGCCGCA CCTGTCGTTG GAGCGAACGT TCCGTGTTTC CCCCCTGACG ACCAGGCGTT GTCCGCCTTT TAGGTCGTTC GTAACTATCG CATTTTCGGC TTGCACGCCC TCGCCGGCAT CCCCATTATG GTAGATGACG GACCGCTGAT AGGCTCCGCC TATAAAGATA CGGATACCTG AGTTCGGTGT CCTTATCCGG GGCGCCGCCC GAATGGAAGC AGAACTGTGA CGCGGCGCAT AGGACCCGGC GAAGCGACTG GTAAAGTCTG AGCATCACAA TCCCCCTGGA CTCCCTTCGG GCTCCAAGCT TCTTGAGTCC GAGGACCGCT TCGCTCAAGC GGCGGCCGAC ATTCTTCTCG ACCATCAGGG CGTCACGGCG CCCCTGACGA CCAGGCGTTT TCCGCCTTTC AGGTCGTTCG TAACTATCGT TATACCTTGT CGGCGGCACC ATGCGCAAAC CTCGGGCAGC TAGGCTGGCG CTGCTGCAAA GAAACGCGGA AAATCGACGC AGCTCCCTCG GAAGCGTGGC GGGCTGTGTG AACCCGGTAA TTCGCTGGAG CTTCGTCACT GCGCTGGGCT CTTCCGGCGG ACAOCTTCAA ATTTATGCCG GCATCACAAA CCCCCTGGAA TCCCTTCGGG CTCCAAGCTG CTTGAGTCCA CTGCCTCCCC TCGCTAACGG CAACCCTTGG GTTGGGTCCT GGGTTGCCTT ACGTCTGCGA AGTCAGCGCC . még mindig több. Nos. teljesen közönyösnek tűnt. – Íme a mi csúcstechnológiás automata mosodánk – mondta dr. – Látom. amely sok más mellett arra utal. – Megfigyelhető. Ennyi DNS-ben valószínűleg van valami utasítás is arra nézve. ami sokkal ritkább. igen nagy sebességgel. Ezeket. Mr. Nedry már a következő munkafázisunkra kíváncsi – szólt Wu. Igen. azok a tornyok ott a terem közepén. A képre mutatott. mint két évig tartana. Ez is olyan jel. kerek torony állt a terem közepén. hogy mi módon azonosítjuk a kinyert DNS-t. Wu lenyomott egy billentyűt. ott lenn az 1201-es sorban. Az általunk kivont DNS legnagyobb része töredékes vagy hiányos. ugyanis láthatják. Úgynevezett restrikciós enzimek segítségével kimetszi a DNS-t. a bőrük pedig pergamenszerű. hogy a dinoszauruszok egyáltalán nem hüllők voltak. hogy miként állítható elő egyetlen protein – mondjuk egy hormon vagy egy enzim. Adenin. A teljes DNS-molekula hárommilliárdnyit tartalmaz ezekből az alapokból. Önök lényegében e pillanatban egy hihetetlen képességű genetikai gyár kellős közepén állnak. Dennis Nedry. A dinoszauruszoknak azonban magvas vörös vérsejtjeik voltak. – Azok a dobozok a fal mentén Hamachi-Hood típusú automatikus génszekvencerek. a kövér ürge pedig. – Ez tipikus példa. Akkora. e célra nagy kapacitású számítógépeket használunk. Inkább hatalmas madarak. mint a vörös. Két.

két enzim metsz be a sérült pont mindkét oldalán. majd analizált. – Az lehetetlen volna. szerinted miféle adatbázisnak lehet szüksége hárommilliárdos tárolásra? – kérdezte. Ehhez hozzászokott. az egyik tervparaméter úgy szólt. amikor a cég megbízást adott neki. mint a kirakós játék.. Egy kicsit olyan ez. és még ez is éppen elég nagy munka. Hárommilliárd mező! Nedry már azelőtt is dolgozott nagy rendszereken. Az összképnek csak azokat a szekcióit vizsgáljuk. amelynek tanúi voltak. amikor egy laboratóriumnak négy évébe került volna. Néhány éve. Dennis Nedry ásított. és megtudjuk. hogy csak valami tévedésről lehet szó. milyen bázispárokat kell bevinnünk. A komputer most újra kombinálja őket. – Barney. E célból különböző metszettöredékeket kell összerendeznünk. – Ó. hogy helyrehozzuk a sérülést. hogy tévedésről szó sincs.I. Nedry nem értette a dolgot. hogy tervezze meg a park vezérlőrendszerét. az M. hogy egy ilyen képet dekódoljon. Ezek nemegyszer több milliónyi adattal dolgoztak. – Vagyis a teljes DNS-sorral dolgoznak? – kérdezte Grant. illetve mások. Mint az 1201-es sorban látják. melyiket használja. amelyet a komputer állított helyre. amelyek állatról állatra különbözőek. Ott azonban közölték. például így: – Most olyan DNS-töredéket találunk. De azt is tudnunk kell.. De a DNS-molekula még így is túl nagy. csak ki vannak jelölve rajta a restrikció. hogy világméretű telekommunikációs rendszereket hozott létre multinacionális cégek számára.T. úgy. . A művelet. ezért felkereste Barney Fellowst a Symbolicsnál. A paraméter pontos. hogy megkeresi az átfedő kódszekciókat.-intézet közelében. Csak a számítógép nagyon gyorsan végzi el. Amint látják. Mi másodpercek alatt elvégezzük. egy közönséges laboratóriumban hónapokat vett volna igénybe. Nedry rögtön arra gondolt.– Ez ugyanaz a DNS-szekció. és elvégezhetjük a helyreállítást. De az InGen valami sokkal nagyobbat akart. a massachusettsi Cambridge-ben. dehogy! – felelte Wu. Ezt elemezzük. hogy a számítógép döntse el. és azonnal felhívta Palo Altót. Azzal szerzett hírnevet magának. kis dinoszaurusz-DNS-szekciók. A nukleotidáknak csak kis százaléka változik fajról fajra. 1 61 121 181 241 301 361 421 481 541 601 661 721 781 841 901 961 1021 1081 1141 1201 1281 1341 GCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGC GGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCG TGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGC TGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCBAGCTGGGCTGTGTG CCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAA AGTAGGACAGGTGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAG ATCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACT CCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCTGGGCT GGCGTTCGCGACGCGAGGCTGGATGGCCTTCCCCATTATGATTCTTCTCGCTTCCGGCGG CCCGCGTTGCAGGCCATGCTGTCCAGGCAGGTAGATGACGACCATCAGGGACAGCTTCAA CGGCTCTTACCAGCCTAACTTCGATCACTGGACCGCTGATCGTCACGGCGATTTATGCCG CACATGGACGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAA CAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGOAA GCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGG CTTTCTCAATGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTG ACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCA ACACGACTTAACGGGTTGGCATGGATTGTAGGCGCCGCCCTATACCTTGTCTGCCTCCCC GCGGTGCATGGAGCCGGGCCACCTCGACCTGAATGGAAGCCGGCGGCACCTGGCTAACGG CCAAGAATTGGAGCCAATCAATTCTTGCGGAGAACTGTGAATGCGCAAACCAACCCTTGG CCATCGCGTCCGCCATCTCCAGCAGCCGCACGCGGCGCATCTCGGGCAGCGTTGGGTCCT GCGCATGATCGTGCTAGCCTGTCGTTGAGGFCCCGGCTAGGCTGGCGGGGTTGCCTTACT ATGAATCACCGATACGCGAGCGAACGTGAAGCGACTGCTGCTGCAAAACGTCTGCGACCT ATGAATGGTCTTCGGTTTCCGTGTTTCGTAAAGTCTGGAAACGCGGAAGTCAGCGCCCTG – És íme a felülvizsgált DNS-képlet. hogy 3xl09 mezőnyi adattárolóra van szükség. A sötét csíkok a képen restrikciós töredékek: enzimek által lebontott. Nagy utat tettünk meg a hatvanas évek óta. a szűrés pontjai. hogy az InGen valami ilyesmiben mesterkedik. mi hiányzik. amely átfedi a sérülési területet. mint ez. Már régesrég eljutott arra a következtetésre. Ma a számítógépeink néhány óra alatt elvégzik. Hétköznapi esetben hagyjuk. meg is tudjuk találni. mint a mai DNS.

hogyan csináljuk. hanem több Cray? Azt a mindenit! – Barney a homlokát ráncolta. – Van. aki a DNS-molekula analízisével foglalkozna. – Igen – mondta Nedry. hogy vannak gondok.– Ez csak tévedés lehet – mondta nevetve Barney. Vagy hetekig. amit elmondhatsz? – Ne haragudj – felelte Nedry –. . Sötétben tapogatózva kellett dolgoznia. – Ez a cég igen titokzatos. Ezért a világ legveszedelmesebb mérgei közül tartanak itt néhányat. éppen úgy fejlődik. hol illik bele az evolúciós sorba. – Megnövesztjük. A DNS éppúgy átmegy egy időbeli evolúciós folyamaton. amelyre ez volt írva: FERTILIZÁCIÓ. Dr. béta-alkaloidák – mutatott az ultraibolyafény alatt sorakozó injekciós fecskendőkre. Mindjárt bemutatom maguknak. – Kivihetetlen. Ez már logikusabban hangzott. Szerencsére nem az a feladatom. amelyet teljes egészében kék ultraibolyafény világított meg. De ehhez tíz év összehangolt munkájára volna szükség. így tehát fogjuk az ismeretlen DNS-t. – Hárommilliárd rögzített adattal – mondta erre Barney. – No és a másik? Wu megvonta a vállát. és beléptek. Valóban ezt akarják. Az utasítás csak ennyi volt: „Tervezzen egy nyilvántartási modult!”... ki készítette az algoritmusaikat? – Nem én – felelte Nedry. – Ezt én is tudom. szinte kétségbeesetten. – Ugyan ne hülyéskedj! – mondta Nedry. mire kellenek az alrendszerek. hogy javítsa ki „az általa nem rendezett problémákat”. optimisták – mondta Nedry. De mégis. – De hát ez őrület! – mondta Barney. ha meg akarnak találni valamit. de ez már nem kötötte le a figyelmét. a kéz vagy más fizikai jellemző. Csak arra kértek fel. kinyitotta az ajtót. hogy tárolókapacitást és memóriát hozzak létre az egész rendszer számára. és villámsebes algoritmusokat. – Bármely élő állattal másodpercek alatt végeznek. Időigényes eljárás. – Nincs. mint bármi más egy szervezetben. Bizonyos adatbázis-kereső eljárások rengeteg memóriát zabálnak fel. hogy egyes biológusok egy humángenetikai projektum létrehozását tervezgetik. hogy a sejtmitózist. amelyben laboratóriumok sora venne részt szerte a világon. A tervparamétereket megkapta. mire kellhet egy ilyen adatbázis? Barney elkomorult. – Micsoda? Multi-XMP? Szóval nem is egy. hogy a rendszer felépült és beindult. vagy: „Tervezzen egy modult vizuális megjelenítésre!”. – Nem tudom elképzelni. de a felhasználásról egy szót sem közöltek. – Tudta. Tim újabb termet látott. és megtervezte az ellenőrzőrendszereket. mi lesz belőle – mondta. Lehet. – És ez egy magáncég – tette hozzá Nedry. Grant éppen ezt kérdezte: – És amikor a számítógép kielemezte a DNS-t. mint valaha a Manhattan Terv. – Az első a filogenetikai feltérképezés. hogy a DNS-sel csinálnak valamit – mondta Barney. legalább akkora. – Hát én továbbra is arra tippelek. Elérték a következő ajtót. Szerette a technikai dolgokat. Óriási vállalkozás volna. az osztódást pontosan megadott pillanatokban megszakítsák. aztán meglátjuk. de nincs. – Véletlenül egy nullával többet írtak. – Mi a rendszer? – Multi-XMP. de megoldható. – Igen-igen. – Van még. – Tudod. Amikor visszafordult a többiekhez. Wu becsúsztatta az ellenőrzőkártyát.. a láb. mi lehet a. azaz génsebészet – tűnődött Barney.. milyen állatot takar a kód? – Két eljárásunk van erre – válaszolta Wu. Szinte minden munkájánál megkívánták a titoktartást. ahol megint csak fehér ruhás laboránsok ültek mikroszkópoknál. amit azért elmondhatsz? – Biotechnológiai cégről van szó. hogy a megrendelő soha nem volt hajlandó elárulni. akkor honnan tudják meg. Még ha a leggyorsabb processzorokat használod is. hogy a DNS-munka megkívánja. és ismét elgondolkodott. „Dühítő!” – gondolta Nedry. Dr. hogy optimisták. és a számítógép segítségével nagyjából meghatározzuk. míg elkészültek. – Helotoxinok. Ahogy az út folytatódott. – Biotechnológia. a keresés így is napokig fog tartani. már ami a rendszertervüket illeti. viszont RAM-érzékeny algoritmusaik vannak. Hátul volt egy rész. – Aztán hozzálátott. – Vagy esetleg csak DNS-töredékeket elemeznek. – Nem tévedés. colchinoidák. melynek során kielemeznék a teljes emberi genetikai fonalat. Még csodálkoznak? Teljes pánikban parancsolták ide. – Írtál alá titoktartási megegyezést? – Hát persze – felelte Nedry. – No és mi? – DNS-molekula. hogy algoritmusokat keressek. Leellenőriztem. Vagy kettővel. a legkevésbé sem lepte meg. – Többnyire ezt tesszük. Wu elmagyarázta. Több mint egy évbe került neki és programozóinak. – Akkor nyilvánvaló. Most pedig. Tim türelme egyre inkább fogyott. mi máshoz kellene ez. A dolgot különösen megnehezítette. az atombomba elkészítése volt.

de egy csepp vizet sem. míg felnőnek? – A dinoszauruszok gyorsan érnek. amely elborította az asztalokat. Kinyitotta a keltető belső ajtaját. pittyent egyet. A fajokat betűkkel és számokkal jelzik az egyes asztalokon: STEG-458/2 vagy TRIC/390/4. – Jurakori atmoszféra – jegyezte meg Grant. és mindegyik más-más DNS-kivonatfajtát képvisel. kérem. Azt mindannyian látták. Wu tovább duruzsolt arról. Az életben maradási arányunk körülbelül nulla egész négy százalék. – Mink van ma idebenn. hogy megkönnyítsük a személyzet dolgát. de dr. – Ez egy új DNS-fajta – mondta Wu. a relatív légnedvesség pedig száz százalék. – Egy kicsit meleg és nedves a levegő odabenn – mondta Wu doktor. amelyet keltetünk. A következő terem felirata ez volt: KELTETŐ. e pillanatban nincs. Képzelheti. és a külső ajtó egyetlen szisszenéssel elhúzódott. Lépcsőzetesen próbáljuk időzíteni. mi fog kinőni belőle. halvány körvonalaikat el-elmosta a sziszegő. és hőérzékelőkkel vizsgálják a hőmérsékletüket. Tim hatalmas. Wu. – Ebben a keltetőben több mint egy tucat kivonat termékét állítottuk elő. Nehéz fejben tartani ezt a rengeteg nevet.Tim szívesen hallott volna többet is a mérgekről. sosem tudjuk még biztosan. Az inkubációs periódus állatonként különböző. Wu doktor elmondta. Még Sattler doktornő is kezdte elveszteni az érdeklődését. Az embriókat mechanikus módon helyezzük be. milyen állat lesz. tehát valószínűleg Coelosaurus lesz. mindegyik ezüstfóliába csomagolva. Kathy? – kérdezte dr. A terem egyik oldalán nagy tartályok voltak. . Amikor először készítünk kivonatot. – Csak egy raptorbébi. A tojások maguk plasztikból vannak. Ebből százhúsz környezeti. Lágyan himbálóztak. – És ez az asztal itt? – kérdezte Grant. Van még kérdésük? Nincs? Akkor menjünk az óvodába. azonnal jelezze! Wu becsúsztatta ellenőrzőkártyáját a nyílásba. így tehát máris jó néhány felnőtt példányunk van a parkban. Lex unatkozott. Grant elmosolyodott. Kerek szoba volt. és beléptek. amikor néhány napon belül egyszerre százötven állat jön a világra – bár a legnagyobb részük természetesen nem marad meg. további kétszáz tojáson belüli és a többi magából a genetikai anyagból származik. fehér köpenyes nő ült a földön. Aláfirkantva ez állt: „Feltételezett Coelu”. A dinoszauruszokat szerette volna látni. a polcok teli fagyasztott embriókkal. mint a kórházakban. A tojások némelyike átereszti a bőrolajokat. óránként megfordítják a tojásokat. Ezért a pára. Volt benne néhány olyasfajta inkubátor. – Pontosan. Amint látja „Feltételezett Coelu” van odaírva. amely egy rugalmas karral lenyúlva sorra minden tojást megérint. de pillanatnyilag mind üres. A kód így szólt: XXXX-0001/1. rajtuk felirat: FOLYÉKONY N 2 Aztán hatalmas. – A hüllőtojások nagy mennyiségű fehérjét tartalmaznak. Wu. hogy megtermékenyítetlen krokodilpetesejteket használnak. nyitott termet látott maga előtt. embernagyságú hűtőszekrények következtek. hogy minden asztalon 150 tojást tartanak. Ha bármelyikük rosszul érzi magát. majd megkérdezte: – Van valami éppen kikelőben? – Nem. – Háromszáznegyvénhétről – szólt közbe Tim. aztán Grant professzor tett fel újabb bonyolult kérdéseket. Rongydarabok és játékok hevertek szanaszét a padlón. – Mit jelentenek a számok? – Azok a kódok a különböző DNS-fajtakivonatokat azonosítják – mondta dr. – Az első négy betű jelöli az állatfajt. bedugják a kezüket a ködbe. Kettőtől négy éven belül elérik a teljes nagyságukat. és behelyettesítik a DNS-t. ha jól emlékszem. Nedry ásítozott. A szenzorok állandóan mozognak. Kis növényevő. De számítógépes elemzéssel mintegy ötszáz változóval dolgozunk. Ott például a TRIC azt jelenti. Háttal nekik fiatal. – Harminchét Celsius-fok körül tartjuk a hőmérsékletet – mondta –. amely infravörös fényben fürdött. és így tovább. milyen. A termet fölülről TV-kamerák és mozgásérzékelők ellenőrzik. – Nem tudjuk pontosan. hogy triceratops. alacsonyan mozgó pára. – Nem sok – felelte a nő. Hosszú asztalokon ültek a tojások. Timnek pedig elege volt ezekből a komplikált laboratóriumokból. ahol az újszülöttek vannak. majd megy tovább. És vigyázzanak a fejükre. majd itt kikeltetjük. A harminchárom százalékot is eléri. Magasabb O 2-koncentrációval is dolgozunk. Egyébként azok az X-esek ott már bármelyik nap kikelhetnek. hogy ugyancsak fent halad egy automata hőérzékelő. – És meddig tart. de általában mintegy két hónap. A tojások mind mozogtak. A STEG pedig stegosaurust jelent. és hófehér. tojástól tojásig. A keltető munkásai derékig párában jártak. amin természetesen javítani szeretnénk. és összesen kétszázharmincnyolc élő állatot nyertünk. Az embrióknak az őket körülvevő környezetből kell kinyerniük a vizet. Úgy háromszáz dinoszaurusznemről tudunk eddig. Legalábbis úgy feltételezzük. – Hadd figyelmeztessem önöket még egyszer: semmit se érintsenek meg ebben a teremben.

úgy leste az őt bámuló vendégeket. Félrebillentette a fejét. felemeli a dinoszauruszok szoknyáját.. Gyíkfeje volt. – Nos. mert – a szó szoros értelmében úgy készítjük el őket. hogy miért nem képesek szaporodni ezek az állatok. és teljesen száraz. – Éppen most ástam ki egy raptort – mondta Grant. Az állatkának alig volt súlya. aztán a személyzet segíti ki őket. A padlón lévő állat hossza úgy ötven centi lehetett. – Velociraptor – mondta halkan Grant. – Ó. Csak ennek a segítségével tudjuk pótolni a Jurapark állományát. hogy közelebbről is lássa. De hogy válaszoljak a kérdésére... Ezért van a neveldénk. és fészket raknak. Egyébként a felnőttek is. Biotechnológiai szempontból nézve nőstényeket könnyebb tenyészteni. amikor kritikus kérdéssel kerültünk szembe. – Egyik állatunk sem képes a szaporodásra. . legfeljebb ha egy kiló. Barátságos. Tim kacarászott. – Nem bánt? – Nem. azt hogyan ellenőrzik? Valaki végigjárja őket. Amikor vadon tenyésznek. vadon. Hegyes orrukkal lyukat ütnek a tojáson. kis nyelve ki-be járt. nyilván az ön számára is nyilvánvaló. – Legalábbis míg meg nem nő egy kicsit. Ellenőrzésünk alatt tartjuk a kromoszómáikat. – A legtöbb dinoszaurusz tojásfogakkal születik. – Azt akarja. Téves lehet a sugárzási dózis vagy esetleg nem arra az anatómiai területre irányul az állatnál. Ilyen egyszerű – mondta Wu elégedett mosollyal. Mélysárga volt. milyen lényeges.– Hadd lássuk! A nő felkelt és félreállt. Valamilyen pótlólagos hatás – például a fejlődés egy megfelelő pillanatában beadagolt hormon – kell ahhoz. A fejecske centiméterekre volt Tim arcától. hogy ne is szaporodhassanak – felelte Wu. Ez itt csak hathetes. mint egy tigris. – Tojás fog? – kérdezte Nedry. mert besugarazzuk őket röntgensugarakkal. hogy mind nőstény. A kis velociraptor megszaglászta Timet. mint egy gyík – hallotta Nedry hangját Tim. – De mi teljesen meg vagyunk győződve róla. Még tojásfoga sem. az embrió természetszerűen nősténnyé fejlődik. – Már a bébik is tudnak. – És a második ok? – A Juraparkban csak nőstény állatok vannak. Malcolm szólalt meg. teljesen biztos – felelte Wu. miközben lehajolt. De éppen most evett.. aztán a nyakához dörgölte a fejét. másokat bonyolultabb. A sötét. – Ez olyan. hogy minden gerinces embrió alapvetően nőstény jellegű. Ez esetben két egymástól független ok is van rá. hogy a növekvő embrió hímmé alakuljon. ha ezt egy kicsit bővebben is kifejtené – mondta. – Szóval ki kell őket segíteni – mondta a fejét ingatva Grant. Bőre meleg volt. – Ez mind igaz! – vágott közbe Wu. és hogy is mondjam?. és hosszú orra. és alánéz? – A nemi szervek fajonként különbözőek – mondta Wu. de egyenesen állt erős hátsó lábain. mint az orrszarvúé. ami azt illeti. – Egyeseket könnyű felismerni. És higgyék el: nem képesek szaporodni. Mindannyian nőstényként kezdjük életünket. többszörös biztosítási rendszert terveztünk. Nyilván tudják. ezek kis szarvacskák az orrhegyen. úgyhogy most egy darabig nem adunk neki. hogy mind nőstény – mondta Malcolm –. hogy enni adjon neki – mondta Wu. Először is sterilek. – Hé! – Tudnak ugrani – mondta Wu. egyenes farok. Tim megfogta a velociraptort. Azaz mindig legalább két kontrolleljárásról gondoskodtunk. – Ragadozó. – Biztos maga ebben? – kérdezte Gennaro. – No és. és ellenőrizzük a tojáson belüli fejlődési környezetünket. Azért tudjuk. Kétágú. és magához ölelte. dülledt szemek rámeredtek. amelyikre kellene. – Nem bánnám. barna csíkokkal. mint egy kis majomé. – De hát arra nem képesek – mondta Wu. A kis gyík abban a pillanatban felugrott. – Velociraptor mongoliensis – bólintott Wu. – Szerintem ugyanis a besugárzás mint eljárás csupa bizonytalanság. – De miért nem tudnak szaporodni? – kérdezte Grant. – De mi történik az őserdőben? – Az őserdőben? – Úgy értem. – Mit eszik? – Egeret. terméketlenek. De ha magában hagyjuk. és Grant feje fölött egyenesen Tim karjába repült. Egyébként a bébiknek egyáltalán nincs is foga. Némelyiket mi magunk megszokásból hímként kezeljük – például a Tyrannosaurus rexet gyakran „nagy fiúnak” nevezzük – de a valóságban mindegyik nőstény. testét kiegyensúlyozta a vastag. hogy a gonádszövetet pusztítjuk el. – És minden esetben. A segítségükkel törnek ki a tojásból. némi aggodalommal a tekintetében.

Grant közelebb lépett. – Elképesztő – mondta Grant. fontos. – Nem maradhatnék itt. Van. – Most inkább ne – felelte Ed Regis. – De kicsiny korukban ezek az állatok rendkívül érzékenyek. amely Tim karjaiban pihent. de Grant oda sem figyelt. – Megengeded? – kérdezte Timtől. hogy bejárjuk magát a parkot. Újra közelebb ment.A kis raptor hátradőlt. – Kérem. Az állat erre élesen felsivított. ha elveszti a testi kontaktust. – Úgy véljük. – Grant doktor! Tegye le! -mondta Ed Regis. és kritikusan szemügyre vette a kis élőlényt. – Ígérem. kitapogatta a csontokat. és hirtelen vad haraggal sziszegett Grantra. kicsi – mondta. Grant azonban egyszerűen képtelen volt távol tartani magát az állattól. A kis velociraptor kitátotta a száját. és pici karmaival huzigálni kezdte a másik végét. Grant – mondta Regis. hogy minden lehetősége meglesz rá. A raptor tovább visítozott. Többet is elvesztettünk posztnatális stressz-szindróma következtében. Az tüstént abbahagyta a visítást. – Három óra van. Timre bámult. Regis újra megszólalt: – Grant doktor! Kérem szépen! – Nem lesz semmi baja. a szájába vette. Az órájára pillantott. amikor még nem találkozhattak emberi lényekkel.. Egy olyan korból származnak. amely átszaladt a szobán.. dr. – Nem szereti. – De hát. – Azonnal! – Regis kezdett feldühödni. – A gyík szívverése még mindig gyors volt.. bocsásson meg. és megvizsgálta. akik piszkálják és bökdösik őket. – Most már semmi baj. hogy később alaposan megvizsgálja őket. hogy megnézze az arcélét. Megtekinthetik az összes dinoszauruszt az élőhelyükön. miközben a gyík izgett-mozgott és tekergett. Grant a hátára fordította az állatot. hogy öt perc alatt elpusztulnak. elkapott egy rongydarabot. Tim megsimogatta a kis raptort. hogy itt a lehető leghumánusabb módon bánjunk az állatokkal – folytatta Regis.. Most megszorította a farkát. és. amelyet mi terveztünk nekik. – De kérem. Tim látta a kis karmokat mindkét „kéz” három-három ujján. . hogy játszam vele egy kicsit? – kérdezte Tim... amely – úgy gondoljuk – adrenokortikálisan közvetítődik. – Ezt nem szereti – mondta Regis. és itt az idő. Az átengedte a raptort a tudósnak. Aztán a raptor visszabújt a nyakába. – Grant doktor! Ezek a lények nem a mi világunkból valók. Aztán magasra emelte. és újra meghimbálta mellső lábait a levegőben. Tim a mellkasán érezte kicsi szívének gyors dobogását. én nem bökdösöm. Grant visszanyújtotta az állatot Timnek. – Minden rendben. Tim elengedte a velociraptort. és ránézett.

Bizonyára tudják. Tizenöt. de állíthatom. Egy kiváltó gén nem működik. hogy miként oldjuk meg. amennyire csak lehetséges. – A második probléma viszont a hulladék eltávolítása. A procompsognathusok pedig valódi jurakori dögevők. – Ez tényleg probléma – mondta Malcolm. de azt hiszem. amelynek a testsúlya meghaladja a harminc tonnát. – Éspedig? – Nézze! – mondta Wu. Wu doktor. hogy a legnagyobb őshüllőket ne tenyésszük ki. hogy ezt megtehessük. Szóval ami a lényeg: kiderült. mármint ha vannak tetemek. hát azt szerettük volna. míg el nem értük a számot. tervezői kifejezéssel élve. – Újra elmosolyodott. Vagyis ha elegendő kompink van. „vissza a rajzasztalhoz”. – Pontosan azért épült a vezérlőterem. Ed? – Annyi. Az ő ürüléküket viszont könnyedén lebontják a mai baktériumok. Ilyenkor aztán.A VEZÉRLŐ Útban vissza a vezérlőterem felé megszólalt Malcolm: – Még egy kérdésem volna. . amely tízszer annyi. amikor azt hittem. Hat hónaponként előállítottunk egy-egy csoportot. egy-egy állatot tökéletesen megcsináltunk mármint DNS-s szempontból. – És van a tizenöt között. És a legnagyobb állatok nem emésztik meg az élelmüket valami nagyon jól. Egy hormon nem választódik ki. Hány különböző fajt állítottak eddig elő? – Nem tudom egészen pontosan – felelte Wu –. mint amilyeneket itt tartunk. amit elpotyogtat. amelyek megeszik a tőlük származó trágyát. De most csak tizenöt van. Körülbelül futball-labda nagyságú minden darab. – Ezen a szigeten van néhány igen nagy növényevő. – Volt. Legalábbis az őshüllőfécesz nem bomlik le egykönnyen. De mivel az összállatállomány mindössze kétszázharminc-valahány. Én nem tudom. hogyne! – vágta rá Wu. Kifejezetten törekedtünk arra. hogy ilyen kis sziget bármilyen ideig ellássa ezeket az állatokat. – A kompik nagyon jellegzetes állatok. hogy az – mondta Wu mosolytalanul. hogy néha azt hisszük. és még több az öt és tíz tonna közötti. – Biztosíthatom. – Maga nem tudja pontosan? – kérdezte mímelt megdöbbenéssel Malcolm. Elölről kezdjük a munkát ezzel az állattal.. amelyek az ürülékük lebontására specializálódtak. amely kifejezetten elefántürüléket eszik. – Malcolm Granthoz fordult – hogyan is hívták? – Procompsognathus – mondta Grant. – Ezt úgy érti. Wu mosolygott. láttak-e már elefántürüléket – mondta Wu –. Sok hasonló. Akkor képzeljék el egy brontosaurus ürülékét.. És ezt el is értük vagy legalábbis nagyon megközelítettük. Nagyjából mint ma a sakálok. Lehetetlen. de még így is több olyan állatunk járkál odakünn. Így aztán takarítási célokra sok kompira volt szükségünk. Egyfelől táplálnunk kell őket. nagy testű állatfajhoz tartoznak társult lények. hogyan csináljuk. Te tudod. nem sok a tetem – mondta Wu. hogy Afrikában van egy olyan ganajtúróbogár-fajta. mi maradhat egy csordányi olyan állat után. a problémát megoldottuk. Vagy valami más probléma lép fel a genetikai sorban. és újraemésztik. A kompik voltaképpen egy egész másfajta hulladékfeldolgozáshoz kellenek. hogy a Jurapark környezete annyira hiteles legyen. Utána pedig próbálják elképzelni. Belőlük éppenhogy szokatlanul sokat állítottunk elő. már túl vagyunk a húsz fajon. Látni fogják. hogy tetemes méretű. – Az első tucat után abbahagytam a számolást. és az az igazság. így aztán sokat ürítenek. – Azaz nem ez volt a fő cél. Tizenöt fajnál. hogy a tetemek eltakarítására? – Arra is. Három csoportban. hogy a kompik megeszik a nagyobb növényevők ürülékét. A tetejébe pedig a dinoszauruszok kihalása óta eltelt hatvanmillió év alatt a jelek szerint azok a baktériumok is eltűntek. – Ötven állat – mondta Malcolm – egy kicsit sok ahhoz. – És miért? – Nos. hogy kéthetenként élelmiszert kell a szigetre hozatnunk. aztán egyszerre csak közbejön valami váratlan hiba. de emlékezetem szerint a megcélzott populáció ötven állat volt. Aztán meg – folytatta – meg kell értenie. hogy folyton szemmel tartsák. ami az alapvető dolgunk –. e pillanatban tizenötnél tartunk. – Szóval hoztak már létre procompsognathusokat vagy mifenéket? – Ó. – Pokoli sok időt fordítottunk rá. – Hány kompit tenyésztettek ki? – A pontos számot már elfelejtettem. Ez óriási feladatot jelent a számunkra.

hogyan készülnek az állatok. Hacsak nem jutnak exogén lizinben gazdag étkezési forráshoz – ezt mi adjuk nekik tabletta formájában –. amíg nem látjuk a valóságban. – Az az állat jár a fejében. bonyolult hálózatáé. hogy magam gondoskodtam róla. bizonyára látni szeretnék azt a termet is. – A velociraptorokat még nem sikerült teljesen integrálnunk a park egészébe. maga azt mondta. hogy tökéletesen alakul? Ezeket az állatokat még soha senki nem látta eddig. a velociraptor. Kizárt... a Juraparkban. – Nem tudom. Wu Regisre nézett. Azt hiszem. ami a szigetről hiányzik. Beültettem egy gént. Ezeket az állatokat génsebészeti úton olyanná tettük. mi sem vagyunk bolondok. de a bennlévő férfiak oda sem figyeltek. – Nézzék. Grant is megszólalt: – De honnan tudják. hogy ezek őskori állatok. Például az. hogy már tudják. – Érdekes – szólt Grant. Wu mosolygott. Falkában vadásznak. amely sok millió éve kihalt. amikor erősen hullámzik a tenger. A mi állataink pedig a külvilágban tizenkét órán belül elpusztulnának. – Arról beszélt az előbb. – Félbehagyta a mondatot. amit az előbb láttunk – mondta Ellie –. hogy így legyen – jelentette ki Wu. A monitorokat mind kikapcsolták. hogy egy állat tökéletesen alakul. – Nem hiszem. hogy van! – mondta Grant.. akár el is mehet megnézni őket. Elég kényes ügy behozni a hajót. – A borostyánlelőhely után – mondta Wu. – Amelyik megharapta az amerikai kislányt? – Igen. amelyiket a parton találtak? – kérdezte Wu a szemöldökét felhúzva. Lehet. amely létrehoz egy – és egyetlen – hibás enzimet a proteinanyagcserében.. mint ön. – Kínából való. egy jó kikötő vagy akár egy jó dokk. Ennek eredményeképpen az állatok nem képesek a lizin nevű aminosav termelésére. hogy összehasonlítsák a mi állatainkat az ásatási maradványokkal és kövületekkel. – Megnézhetném őket ott? – kérdezte Grant. – De az állat. – Tudom. Csak itt élnek meg. Semmi sem tartaná korlátok között őket. – És ezt honnan tudja? – Onnan. Tudjuk. mi annak az állatnak a magyarázata – mondta Wu. és nem tudjuk. aki egyszerre csak zavartnak látszott. – Íme a vezérlőterem – szólt Ed Regis. hogy vadon életképesek legyenek. hogy csak egynek sikerül. hogy ezt bármi módon meg lehetne úszni. Tudjuk másolni a DNS-t. akin most először látszott némi bosszúság. ha van kedve. – És a másik ok? – A szárazföld több mint százötven kilométerre van innen. Wu. és egy nagy hajó képét. A vastag üvegablak mögött sötét volt a terem. – Nyolc felnőtt nőstény. Végül is remélem. mielőtt magunk is. Ezért lizindependenssé tettem őket. de mégis tételezzük fel. hogy mongoliensis. módjuk lesz rá. természetesen. – Hát hogyne. – Most. Ha csak egy is hiányozna. – Éppen egy kis antirrhopust ástam ki. – Ja. kiderül róla. amely minden jel szerint tökéletes. így zárt karámban tartjuk őket. hogy képtelenek legyenek megállni a külvilágban. várnunk kell egy kicsit. azonnal észrevennénk. Eltarthat egypár percig. – Egy sem szökhet meg. – Megkopogtatta az ablakot. és elpusztulnak. Sőt. egy rég letűnt ökológia részei. hogy néha létrehoznak egy állatot. – Egy darabig még nem – mondta vidáman Regis. Kényelmetlen csend támadt.. – De egyet biztosan tudok: semmiképpen sem lehetett a miénk. amelyek rohanó számokat mutattak. A nőstények igazi vadászok. némileg paradox a dolog. de ahogy növekszik. de a fejlődés során sok az időzítési kérdés. – De ha ezek közül a kompik közül csak egy megszökne a szigetről. Először is ott vannak az ellenőrzési eljárások: az állatainkat minden néhány percben megszámolja a komputer. hogy a mai világban nem volna ragadozójuk. – Hát akkor azt hiszem. és ily módon igazolják a fejlődési sort. Kivétel nélkül – mondta Wu. – Magam is sokat gondolkoztam ezen. éppen dokkolnak. három kivételével.. .. tudja? – Látni fogjuk őket a kirándulás során? – Nem – mondta Wu. Az egyik fontos dolog.. Hajóval is közel egy napig tart az út. hogy hibádzik valahol. Nem akarjuk. – Mi történik ott? – kérdezte Ed Regis. Van felnőtt raptor is itt? – Igen! – vágta rá Ed Regis... – Igen – mondta dr. Kívülről kell azt a szervezetükbe juttatni. Ellie Wu doktorhoz fordult. – De még mennyire. mégpedig két okból. hogy előbbutóbb a paleontológusoknak. Az életformák egy olyan. akkor tizenkét órán belül kómába esnek. ó nem! Lényegében a mi foglyaink. és kijutna. amíg itt várakozunk – az órájára pillantott –. ahonnan magát a parkot ellenőrizzük és vezéreljük. mondok valamit.– Biztosan – mondta Malcolm. hogy minden helyesen működik-e. Az ördög vigye el! – Dokkolnak! – Kéthetenként jön az ellátóhajó a szárazföldről. Nem szabadok.

de dinoszaurusznak kicsi – a súlya hetven és százötven kiló között volt. mint a szüleik. ami falkatámadásra utal. kivel beszél – mondta Grant. Grant horkantó hangot hallott. hogy ők az urak. te meg én. – Ha megkerülik a házat. sokan közülünk kezdik azt hinni. A kerítéseken belül sűrű csoportokban elhelyezkedő nagy páfrányokat láttak. – Mit tudsz a velociraptorról? – kérdezte Grant Timtől. – Tudod mit. Előre mutatott. Legyek zümmögtek a levegőben. – Valószínűleg a dinoszauruszokat etetik velük – mondta Malcolm. – Halvány fogalmam sincs. – Vagyis mennyire intelligensek? – kérdezte Malcolm. – Helyes a válasz – mondta Grant –. hogy még a kis gyerekek is megtanulják a dinoszauruszok neveit. A gyerek a nyomukban kullogott. . – Nem játszana velem egy kicsit? Dobhatnánk egyet-kettőt. Villanylámpák éles fénye világította meg. – Azt attól függ. hogy kimondják ezeket a nehezen kiejthető neveket. Gyors számolás alapján ötven-hatvanra becsülte a számukat. ahogy tátott szájjal bámulják a föléjük magasló. – Miért ne? – felelte Regis. mintegy felmérve a férfit. mert ezek a titokzatos óriások valamiképpen a föléjük tornyosuló. hogy vajon mi az. Az erőmű kétemeletnyi mélységbe nyúlt lefelé a talajszint alatt. Alig néhány métert kellett megtennie. Elhaladtak egy pálmafasor mellett. Ellie veregette meg a vállát. acéltetejű betonkunyhót pillantottak meg. ahogy a paleontológusok végül is megbékéltek azzal a gondolattal. – De ne menjenek túl közel a kerítéshez! Te is mennél? – kérdezte a kislánytól. A társaság egy földúton haladt tovább. És persze a raptoroknak az agyuk is nagy volt. és enyhe benzinszagot éreztek. – Hát ez meg minek? – kérdezte Ellie. és elhaladnak a gépház mellett. Intelligensebbek a legtöbb dinoszaurusznál. Még mindig semmit sem látott. Túloldalt kétrétegű. már láthatják is a karámot – mondta Regis. és nagy. Majd csikorgó léptek közeledő zaját. néma csend. amíg beengednek a vezérlőbe. Bekukucskáltak. Grant Ellie-vel és Malcolmmal együtt megkerülte az épületet. mert csak így győzhették le a nagyobb prédát. mint ahogy a szüleiket is szeretik. aki benézett. Újra és újra elcsodálkozott. akik ennyire nyíltan rajonganak a dinoszauruszokért? Grant szívesen elnézegette a gyerekeket a múzeumokban. Mintha onnan jött volna a zúgás. El is tűnődött nemegyszer. – Méghozzá nagy – felelte Grant. és egy kis állatkarámhoz ért. hogy a gyerekek azért szeretik a dinoszauruszokat. Rejtélyesek. Gyors volt és erős. ellenőrizhetetlen tekintélyt testesítik meg. Arra pedig. Grant mekegést hallott. Ezenkívül több olyan fosszilis lelet került elő. alacsony. furcsák és ijesztőek. Másfél méteresek is megvoltak. Süvítő turbinák és csővezetékek hatalmas rendszere futott le a földbe. – Egy puszta üdülőhelynek nem lehet szüksége minderre – jegyezte meg Malcolm. bár ma már a Deinonychust is a velociraptorok egyikének tekintik. Maguk mögött hagyták a látogatóterületet. négy méter magas kerítéshez értek. hogy falkában vadászott.– Nekem is – csatlakozott hozzá Ellie. amikor egy-egy hároméves azt rikoltotta: – Stegosaurus! – Azzal. Végül arra a következtetésre jutott. Grant gyanította: ez lehet az oka. amit olyan izgalmasnak találnak. hatalmas csontvázakat. – Én nem – mondta Lex. – Nem látok semmit – súgta egy idő után Tim. Aztán hosszú. menjünk le. ahol egyetlen nagyobb prédaállatot több raptorcsontvázzal együtt találtak meg. mint a Deinonychus – felelte Tim. amely falkában vadászott. Felnézett Regisre. egyfajta hatalmat gyakorolnak az óriások fölött. – Egy kisváros ellátásához is elég az az energia. csakhogy beszélgessenek valamiről. és nemsokára már hallották a generátorok mély zümmögését. amelyben kecskék voltak. láncszemekből készült. A külső kerítés mentén elektromos zúgás hallatszott. és játsszunk egyet. és északnak indult. Valamiféle jelképes szülők. – Biztosan generátor – mondta Ellie. A gyerekek pedig szeretik őket. csak közvetett bizonyítékaink vannak. – Kis termetű húsevő. Feltételezhető. További másodpercek teltek el. amit itt fejlesztenek. kimutatják. hogy a dinoszauruszok alighanem meleg vérűek voltak. – Ssssss! Grant várt. De ezt senki sem tudja biztosan. – Ugyanúgy. valamiféle szaglászást. Grant szerette a gyerekeket – hogyan is lehetett volna nem szeretni olyan emberkéket. hogy némelyikük meglehetősen intelligens volt. hogy a velociraptoroknak csoportosan kellett vadászniuk. A tetején szögesdrót. – Talán a komputerekhez kell? – Lehet. Az egyik maga az állat külső megjelenése. – Én is mennék – lelkesedett Tim. és áthaladt egy sűrű bambuszsövényen.

s lényegében azonos színű a nemrég látott bébivel: sárgásbarna.. Hárman. hogy elkapjanak egy embert. . Lassan több fej is előbukkant. hogy észrevették. hogy szinte a mozgásukat sem látta. Az egész támadás. a tempó – minden annyira más. ötöt. Az állatok figyelték őket. mint például a másfél méteres indonéziai Komodo-sárkány. mint amilyen az ember is. „Ez vadászik ránk!” gondolta. – Gepárdsebesség – mondta Malcolm.. – Megszólaltak a vészjelzők – mondta a benyomott.. Az állatok vicsorogva morogtak. a merev. mindegyik hajlott karomban végződött. savanyú. Grant még mindig azon igyekezett. amint röpködtek körülötte a szikrák. – Egyiküknek sem esett baja?! – Semmi bajunk – felelte Grant. a hajlott karmú végtagokról és a hegyes. Grant hármat számolt meg. De mintha nem is bánnák. Az állatok vicsorogtak. A szemek nem pislogtak. Egy emlős számára. – Ez aztán gyorsaság! – mondta Ellie. – De valahogy úgy tűnt. amelyek számára ösztön az orvtámadás.. señor? Örüljön. – Magukra támadtak? – Igen. – Tudja mit. A rohamozó raptorok döbbenetes sebességgel tették meg a majdnem tízméteres távolságot a kerítésig. A kéz finoman. van valami leírhatatlan idegenség abban. hogy hű de intelligensek – jegyezte meg Malcolm. Három fogóujj volt a kézen. Alligátorok vagy más nagy csúszómászók között lenni mindig is egyet jelentett azzal. Akár a madarak. kettesével repkedtek a forró szikrák. A sebesség valóban döbbenetes volt – az állatok olyan gyorsan törtek elő.. fekete bőrű férfi futott feléjük. A fej 70-80 centi hosszú lehetett. Vannak óriásgyíkok.. éles fogakkal teli tátott szájakról. egy más világra. itt-ott megszenesedett kerítésre nézve a férfi. – Állandóan ezt csinálják. Ahogy Grant figyelte. Ropogva. amely már eltűnt a föld színéről.A páfrányok között Grant megpillantotta egy állat fejét. amelyek stopperral mérve óránként ötven kilométeres sebességgel futnak. mi? – kérdezte Malcolm. elég gyorsan ahhoz. A két nagy sötét szem hidegen meredt rájuk. hogy az ember egy másfajta életre kell emlékezzen. A némaság. Hideg tekintettel meredtek rájuk. és áramütést kapnak.. az állat nem mozdult. egyensúlyozó farkokról. A néger férfi bólogatott.. aztán egész testükkel a levegőbe lendültek. két méter magas testekről. részben eltakarták a levelek. Mozdulatlan volt. látta. A harmadik állat csak ekkor támadt. Nem is csoda. lassan és óvatosan félretolta a páfrányokat. mintha hirtelen rontanának előre. égett bűzfelhő maradt utánuk. az elejétől a végéig. Ugrott. hogy az emberek irtóznak a csúszómászóktól. hogy ott az a kerítés – mondta. esetleg krokodilra emlékeztette Grantot. éles karmú hátsó lábuk felemelve. A kerítésnek rohannak. mély. – Te jó isten! – szólalt meg Tim. – Pontosan. – Falkában vadászó állatok. hüllőszerű hangot adtak ki magukból. ahogyan a hüllők vadásznak áldozataikra. Aztán nekirepültek az előttük feszülő kerítésnek. A néger elhallgatott. Hihetetlen. hogy. és mellmagasságban vágódott neki a kerítésnek. mint a tigris csíkjai. hogy egyetlen mellső végtag nyúlik fel lassan. Ez az állat persze nyilván nem fogta fel. – Az – mondta Grant. négyet. A fej nagy gyíkra. a csapdába ejtés. A látogatók döbbenetükben mind előreléptek. Grant csak valamiféle elmosódott képet észlelt az erős. mint bármelyik élő csúszómászó. – Sokkal gyorsabbak. – Falkában vadászó állatok – mondta fejét ingatva Grant. és hátat fordított. sötétebb. – Azt azért nem mondanám. A velociraptorok sziszegve zuhantak vissza a földre. sziszegő. hogy elválassza egymástól a páfrányokat az állat arca előtt. Csak enyhén rothadó szag és lassan elillanó. De azok az állatok ott a kerítés mögött becslésem szerint legalább kétszer olyan gyorsak. Malcolm is megjegyezte: – Figyelemre méltó a gyorsaságuk. A hegyes orr-részről hosszú fogsor haladt hátrafelé egészen a hallójárat nyílásáig. A támadás hirtelen jött. Amint visszafelé sétáltak. – Nem valami okosak. nem tarthatott tovább hat másodpercnél. a hidegség.. Hunyorogva pillantott Malcolmra a délutáni napsütésben.. majd visszaugrottak a páfrányok közé és eltűntek. balról és jobbról egyszerre. de csak rövid távon egy-két méteren. vöröses sávokkal. ahogy előretörtek. Pergamenszerű volt a bőre. Horkantások hallatszottak a kerítés túloldalán a növények mögül. amely fülként szolgált. – Száz-százhúsz kilométer óránként. Egyes alligátorok ugyan elég gyorsan mozognak. hogy rendbe szedje benyomásait. Overállos. Tim rémülten felsikított. Grantnak megborsózott a háta. Öldösik az embereket rendesen.

– Én azt mondanám. amit a paleontológusok valaha hittek. az az. ezek után most már roppant kíváncsi vagyok arra a vezérlőteremre! . úgy mentek tovább. Csak az elmúlt években kezdtek egyes kutatók. Csak a szemükkel kommunikálnak. hogy több dinoszauruszfajta felegyenesedve járt. de milyen állatokéi? 1942-ben Richard Owen. Azonkívül pedig a jelek arra mutattak. ez így van? Ezeknek az állatoknak valahol a fejlődésük során rá kell jönniük. hogy az emberi lényeket könnyű megölni. Mondjuk az afrikai kígyászsasnak vagy a kazuárnak. hogy az Úr nem engedheti az Ő teremtményeit kipusztulni. – Valójában nagyon is közel van ahhoz. – Hogy csinálják így. Ehhez összehangoltság kellett. hogy a dinoszauruszokban keveredni látszanak a gyíkok. – És ezek a dinoszauruszok tényleg minket akartak megtámadni? – Igen. ugyanolyan villámgyorsan és halálosan veszedelmesnek látta. amikor meglátnak bennünket. Később tisztázódott. – Sőt. nyelv nélkül? – Ó. Jó. – Azért kérdem – mondta Malcolm –. hogy eltérő sajátosságok keverékét mutatják. Csak ez után válnak emberölővé. Egy csimpánzcsoport becserkész egy majmot. mint valami modern faj túlméretezett változatát. Szóval azon gondolkodom: vajon ők is csakúgy tanulták – valahol. Isten tudja. de a mozgásuk inkább olyan. amely maga is olyan sebes volt. a tudósok kezdték ostoba. A jelenkori világban csak néhány igen kis emlősnek ilyen gyorsak a reflexei. az akkori tudósok kötelességüknek tartották úgy magyarázni őket. mint a madaraké. Most azonban be kellett látnia. és hasonló a gyorsaságuk és a ragadozóösztönük is. mint a kazuárt. hogy a nagyragadozók. de amikor napvilágra kerültek az első igazán gigászi leletek – olyan – állatok maradványai.. élénk lények voltak. mint egy mai ló. nem gyíkszerű. struccszerű új-guineai madarat. mint az oroszlán vagy a tigris. a krokodilok és a madarak jellegzetességei. hihetetlenül gyors vadászok valóságos látványához képest. azon egyszerű oknál fogva. Azért volt ez így. amelyek életükben száz tonnát is nyomhattak –. hogy a dinoszauruszok csípője madárszerű. Owen elképzelése szerint a dinoszauruszok gyors mozgású. hogy embert ölni könnyű? Mindannyian elnémultak. – Bárhogy is legyen – mondta Malcolm –. – Várható volt – felelte Grant. no és persze madaraknak.. ez a karmos. – Az ásatások tanúbizonysága szerint a velociraptorfalkák képesek voltak rá. de még nagyobb emlősök sem léteztek. és ez is volt az uralkodó nézet vagy negyven évig. hogy az elképzelései messze elmaradtak e nagy. a velociraptor voltaképpen pontosan ugyanolyan benyomást tett Grantra. mint Grant. A bágyadt hüllő képe fokozatosan győzött a gyors. nem született emberevők. Például a kobraölő mongúznak. mint a Tenontosaurust. hogy ötszázkilós állatokat is leküzdjenek. a kor legnevesebb brit anatómusa a Dinosauria – „rettenetes gyíkok” – latin elnevezést adta nekik. – Igen. Amikor az 1820-as és 30-as években az első óriási csontok napvilágra kerültek. – Szóval ezek a velociraptorok hüllőnek látszanak. Szerintem az. lassú mozgású. Különösen feltűnő volt. ha tehetnék? – Azt hiszem. amire én voltaképpen rá akartam térni – mondta Malcolm –. mikor –. amikor nemhogy emberek. mert a közvélekedés szerint semmilyen faj nem halhatott ki. élénk madár fölött. – És ez az összehangolt harcmodor. – Úgy van – mondta Grant. hogy ez az istenfelfogás téves. – Nos. mert úgy hallottam. Owen felismerte. hogy így van. Magát Grantot kollégái kifejezetten radikálisnak tartották a dinoszauruszviselkedésről vallott nézetei miatt. – A csimpánzok is mindig anélkül támadnak. hogy meggyőző állat-e ez a maga számára? Tényleg dinoszaurusz? – Igen. Ugye. Végül is olyan korból valók.– Úgy van. – Megölnének és megennének bennünket. visszatérni az élénkebb dinoszauruszképhez. minek vélnek. én is úgy tudom. igen. Kis emlősöknek. és a csontok kihalt állatokéi. kihalásra ítélt óriásoknak látni a dinoszauruszokat. – Márpedig akkor ezeknek a dinoszauruszoknak még felkészületlenebbnek kell lenniük. olyan a bőrűk és általában az egész külső megjelenésük. Igen ám. és végez vele. a nyelv egy cseppet sem szükséges az összehangolt vadászathoz – mondta Ellie. – Meglepi ez magát? – Nem igazán – felelte Grant.

4-es verziót. Henry! Megint elvont eszmefuttatásokkal akar szórakoztatni? Tudja. Nem tettünk mást.A 4. – Csakhogy. – Nézze – kezdett bele mégis –. Hammond szolgálatában áll. – Jobbat a valódinál? . – Az emberek nincsenek hozzászokva ahhoz. Vagy fél tucat tévémonitorral szerelték fel.. nem teljesen – mondta Wu. Tekintheti esztétikai kérdésnek is az egészet. és közben a szobában lévő képernyőkre mutatott –. – Inkább ne csapjuk be önmagunkat! Mi itt nem teremtettük újjá a múltat. Nem meggyőzőek. milyenek voltak az életben. – És meg is kaptam! – Tudom – mondta Wu. és kényelmes. – Kérem. – Nem – felelte Henry Wu. és? – A jelenleg meglévő dinoszauruszaink igaziak – mondta ismét Wu. Mint a film. – Maga mondta. és. Jobbat is elő tudok állítani. hogy azt akarják – mondta Wu. hogy valahogy fel vannak gyorsítva. És az a helyzet. Ezt akarom. háziasítottabb dinoszauruszokat is. vagyis ebben a pillanatban. amelyek ilyen gyorsak. Hammond elegáns bungalójának nappalijában álltak. Hammond a maga szokásos türelmes. – elhallgatott.. – De miért? Mi a baj velük? – Voltaképpen semmi – felelte Wu –. a pálmafák sűrűjében. most. nagy vonalakban. És én éppen ezekről a részletekről szerettem volna ma beszélni önnel. hogy fontolóra kellene vennie a második fázissal kapcsolatos javaslataimat. amit szeretne megértetni vele. hogy hatalmas állatokat lássanak. – Fel-alá járt a nappaliban. nagyon sajátos. hogy én az egyszerű beszédet szeretem. amelyet Wu magával hozott. hogy ezek igazi dinoszauruszok. A szórakoztatás a valóság antitézise.4-ES VERZIÓ – Volt valami gondja a társasággal? – kérdezte Hammond. Hogy fogja ezt megmagyarázni Hammondnak? Hogyan lehetne? Hiszen Hammond alig-alig fordult meg a szigeten. – Rendben van. – A szórakoztatásnak pedig semmi köze a valósághoz. Hammond a homlokát ráncolta. Ez állt rajta: ÁLLATFEJLESZTÉS: A 4. – Esztétikai? – kérdezte csodálkozva. El kellene indítanunk a 4. Én pedig azt mondom. – Semmi a világon. amelyek mindegyikén a parkban mozgó állattok látszottak. Azt nem is lehet újjáteremteni. Henry! – mosolygott Hammond. atyai módján nézett a tudósra. a világon szinte senki sem látott még valódi dinoszauruszt. Senki sem tudja. kivéve azt. Ami múlt. Hammond egyenesen az egyetemről – posztgraduális tanulmányai kellős közepéből – emelte ki. John Hammond úgy ráncolta össze az orrát. hogy amióta csak dolgozik. hogy jobbat is tudunk ennél. az múlt. A kávézóasztalon ott hevert a dosszié. – De hát Henry! Ezek igazi dinoszauruszok! Hisz épp maga mondta! – Tudom – mondta Wu. és igaz.4-ES VERZIÓ. – Úgy van.. amikor itt állunk. John. mint aki kellemetlen szagot érez.. A mostani dinoszauruszaink igaziak. – Maga le akarja cserélni az egész jelenlegi állatállományt? – kérdezte Hammond. Baj csak a részletek körül van. Hammond nagyot sóhajtott.. – Micsoda? Háziasított dinoszauruszokat?! – horkant fel Hammond. mint rekonstruáltuk a múltat vagy annak egy verzióját. és adott neki állást. hogy ez a park a szórakoztatást szolgálja – folytatta Wu. és az valami egészen más. – Azt akarják látni. A ház a park északi szektorában bújt meg. – Elfogadták a magyarázatát? – Miért ne fogadták volna el? Végül is őszinte beszéd volt. – Jobbat? Milyen szempontból? – Hogy csak egy dolgot mondjak: túl gyorsak – mondta Henry Wu. hogy a látogatók azt fogják hinni. A monitorokra mutatott. Attól félek. – De hiszen azt kértem magától.. ami a várakozásaiknak megfelel. A nappali levegős volt. – Természetesen vannak bizonyos gyakorlati következmények is – mondta Wu. – Kinek kellenek háziasított dinoszauruszok? Az emberek az igazit akarják látni! – De hiszen épp erről van szó! Én nem hiszem. de bizonyos tekintetben nem kielégítőek. – Komolyan az a véleményem. A harmincnégy éves Wu nagyon is tudatában volt annak. – Hát szóval. – De könnyen kitenyészthetnénk lassabb.

mint a régi fénykép. – Miért? – Miért? Nézzünk szembe a tényekkel! – felelte Hammond. aminek eredményeként. amikor Hammond nagyon is odafigyelt arra. gépkocsira szerelt. Sőt. És azért is megtettünk mindent. óriás villanycsősz-szerkezeteket. Ez itt nem a valóság! – Reményvesztetten vállat vont. amilyet szeretnénk? Amely elfogadhatóbb a látogatók számára. mi a valós helyzet a DNS-kiesésekkel. fantasztikusat! – és most eljött az idő. Nem akartunk várni. Akkor még egyetlen teljesen felnőtt egyedünk sem volt. a komputertomográfia. békésebb verziót az állatkertünk számára? Hammond ismét elkomorodott. Huszonnyolc éves volt akkor. azaz a mágnesrezonanciás diagnosztikai képalkotás. De Hammond olyan célratörő. – Az elkerülhetetlen volt. Henry! – Beszéd közben finoman kifelé kormányozta Wut a szobából. Henry! Megszólalt a telefon. mi volt 87-ben. Ne nézzen olyan meglepetten! Nem mondok semmi olyat. és sorolhatnám a végtelenségig. a mikroprocesszor. honnan lesz majd pénz. akár a genetika területén. Olyan géneket vittünk be. A legkülönfélébb eszközök egész tára áll a rendelkezésünkre – és most mind túl lassú! Muszáj igazodnunk a helyzethez. Hammond pedig elindult. a MRI. én azt hiszem. Az egyetemeken megállt az idő. meg lizindependenssé. Csupa bizonytalanság volt minden. és a vállára tette a kezét. hogy felvegye. – De akkor a dinoszauruszok nem volnának valódiak. mi lesz a doktori programokkal. Ha komoly eredményt akar elérni akár a számítógépek. amelyek villanyárammal töltött dróthálókat lőnek ki. ha tartja valamire a saját tehetségét. Hogyan magyarázza most el neki. hogyan értethetné meg főnökével az elképzelését. így azt sem tudtuk. amikor Henry Wu posztgraduális diákként Norman Atherton laboratóriumában készült a doktorátusára Stanfordban. egyenes módon közelítette meg Wut. jó? – mondta Hammond. Hammond megvonta a vállát. a szekvenciában előforduló hiányokkal. A fontos dolog ma már nem az egyetemeken történik. hogy minden erejét összeszedve kitalált valamit – szerinte a legjobbat –. A kutatóintézetben mindenki tudta. de a részleteket nem ismerte senki. Maga nagyon keményen dolgozik régóta. Lemaradtak. és az ő érveinek lényege pedig technikai természetű volt. ágyúkat. eszébe ne jussanak az egyetemek! Te jó Isten! . hogy el sem jut Hammond tudatáig amit mond. Wu még mindig azon törte a fejét. De hiába. Atherton halálakor a gyász mellett teljes zavarodottság lett úrrá az intézetben. Hammondot sosem érdekelték a technikai részletek. Senki sem tudta. – Én nem aggódom. hogy néhány ember lássa. Két héttel a temetés után John Hammond felkereste Wut. hogy maga kezd begyulladni. Mert öt hosszú év után a Jurapark a befejezéséhez közeledett.. a hologram. Nevetséges még a gondolat is. A második világháború óta minden igazán fontos felfedezés. már negyven éve nem. hogy maga a legjobb genetikus az intézetben – mondta. és mindenki nyugtalankodott a pályája miatt. mit mond Wu. – Rosszul teszi – mondta nyersen Hammond. – Legalábbis. Hogy mielőbb elérjék a felnőttkort. mire lesz szükségünk.– Miért ne? – kérdezte Wu. Látta. hogy gyorsítsuk a növekedésüket. amit ne tudna maga is. a gyermekbénulás elleni vakcina. – Mik a tervei ezután? – Nem tudom. John Hammond pedig többé már nem is figyelt rá. és állítsunk elő pontosan olyan dinoszauruszt. Volt idő. a lyukakkal. amelyeket Wunak úgy kellett kitöltenie. Wu megdöbbenten pislogott. amikor munkatársául választotta. találmány magánintézetekben született. De én azt mondom: miért kellene itt megállnunk? Miért ne folytassuk a munkát. hogy a világ a legteljesebb mértékben elégedett lesz. de mégis csak kitalálta. Mindet a mi kívánságaink szerint állították elő. a tranzisztor. Különösen a kezdet kezdetén. de itt-ott kijavítva és tisztázva. hogy azt nem lehetett elfelejteni. Mi sem természetesebb. Én azonban meg vagyok győződve róla. Lényegében azonos az eredetivel. a személyi számítógép. amit elért. minthogy lámpalázas és ideges egy kicsit. – Figyeljen rám. Gondolnunk kellett a befektetőinkre. Kutatás. – Valamilyen egyetemi állásra vágyik? – Igen. – Az egyetemek ma már nem az ország szellemi központjai. – Norman mindig azt mondta. A lézer. Hatalmas áramütőket gyártottunk. amikor kezdtünk felkészülni az állatok majdani fékentartására. Henry! – mondta Hammond. A dinoszauruszok DNS-e olyan volt. – Végül is ezek az állatok már amúgy is módosítottak. a régi szép időkben. hogy Atherton valamiféle kapcsolatban volt Hammonddal. – Természetesen. – Emlékezzék vissza. és fantasztikus munkát végzett – komolyan mondom.. amelyek szabadalmaztathatóvá tették őket. – De hisz most sem azok! – mondta Wu. – De John – próbálkozott még Wu. – Ha nem haragszik meg az őszinteségemért. és amelyet mi magunk is könnyebben kezelhetünk? Egy lassabb. – Ezt próbálom megértetni magával. A legteljesebb mértékben. Hogy kételyei támadtak. Ez csak egy állatkert. amelyet retusáltak. Tudja. hogy Muldoon katonai felszereléseket akar? LAW-rakétákat és lézervezérlésű fegyvereket? – Muldoont hagyjuk ki ebből.

. de sokkal nehezebb. – Publikálható lenne a munkám? – Előbb-utóbb igen. hogy a dinoszauruszok a madarakhoz álltak közelebb. – Ne aggódjon! Ha sikerül. hogy ki kellene javítanunk a valóságot pusztán azért. Ám végül mégis sikerült. Én ötéves szerződést ajánlok magának. az egész világ tudni fogja. jogi vagy más okokból. azt muszáj volt. – Hogy próbáljon megvalósítani valamit. John Hammondnak pedig többé már nem volt szüksége Henry Wura. Helyes. Honnan szerez több asszisztenst. hogy a befolyása napról napra csökken. mit tett.. De azt nem hiszem. Az adminisztráció pedig nem állt közel a szívéhez. Henry? – A második fázisnál – mondta Wu. De maga a munka is irányt változtatott: már nem is hüllőklónozásról volt szó. legalábbis ilyen rövid idő alatt. hogy mit csinál. nem érti. aki beleszóljon. Mindenki más egyszerűen félreáll az útjából! Túl szépen hangzott ahhoz. Ötvenmillió dollárt. A tanszékvezetőség. Maga dönt. igazi teljesítményről. – Hol is tartottunk. ami egészen más. csak hogy egyáltalán belekezdhessen valamibe! Hány ösztöndíj. Ezt megígérhetem. Beszéltünk mi már azelőtt is erről. hány hozzájárulás kell hozzá! Az ügyvezető bizottság.. mint az emlősökkel. hogy igaz legyen. Sokkal. Jól van. – De a későbbiekben publikálható? – makacskodott Wu. amit az emberek látni szeretnének. hogy mihamarabb elismerést szerezzen magának. – Nem. amiről senkinek sem tartozik számadással. de nagy általánosságban hüllők klónozásáról van szó. – De nem azonnal. Öt évi hajsza után már csak egy év van hátra a park nyitásáig. Feltéve. hogy én semmi okot sem látok rá. – És rengeteg pénzem annak. úgy jobb. – Tudom. Ehelyett azt kellett tapasztalnia. gondolta Wu. Így tisztességes. a DNS meg túl hosszú! Elismerést szeretne. Hammond akkor nevetett. hogy tapasztalata és munkája révén neki is azok közt kell lennie. igenis értem! És azt is őszintén meg kell mondjam magának. Az egyetemi pénzügyi bizottság. barátom! És Hammond mosolyogva kinyitotta előtte az ajtót. nem több. amit látniuk kell! Ez a kötelességünk. – Te jó Isten! – ismételte a szavát Hammond. mihelyt rájöttek. hány kérdőív. ez már csak ad neki jogot a beleszólásra. . igaz? Ha elismerésre vágyik. de félek. A klónozáshoz még tíz-tizenöt év kell. Persze az elmúlt évek azért nem egészen úgy zajlottak. – Ne is haragudjon. – Ja persze. Henry.. Ez az. hogy lehetséges. Madárklónozást végeztek. És ez az. hogy bekövetkezik néhány alapvető fejlemény. Henry – mondta Hammond enyhe éllel a hangjában –. Hallgatta egy kicsit. – Én munkáról beszélek – folytatta Hammond –. Henry. hogy az már szinte rutinszerűnek volt mondható. Amit változtatnunk kellett a genomon. hogy a jövőben is kell még változtatásokat végrehajtanunk. mire költse. ami valószínűleg megvalósíthatatlan. és évi tízmillió dolláros költségvetést. Az élet túl rövid. mi mindenen kell keresztülmennie. – Gondolja csak végig. például az ellenálló képesség fokozatára vagy más célból. de nemegyszer félelmetes nyomás nehezedett rá. Mi kell a tudósnak a munkához? Idő és pénz. Elérte. Most igazi dinoszauruszaink vannak odakinn. Senki sem szól bele. Lehet. aki kutatócsoportokat és számítógép-vezérlésű génszekvencerek egész ütegeit irányította. de én meg azt hiszem. ha szükséges? Nagyobb helyiséget a kutatásaihoz? Mennyi idejét veszi el mindez? Egy nagy tehetségű ember nem vesztegetheti az idejét bizottságokra meg beadványokra. – Nekem öt évem van – mondta Hammond. mert azt képzeljük. És nem is azért vállalta az egészet. És Henry Wu úgy vélte. akik eldöntik. Az utolsó két évben pedig Wu már elsősorban adminisztrátor volt.Wunak a szava is elakadt. – Jól van. hogy az lehetetlen volna – mondta Wu. hogyan tovább. – Én nem hinném. A technológiák megértek. És most minden valószínűség szerint a világ hamarosan tényleg tudni fogja. Végül ezt kérdezte: – És mit kér cserébe mindezért? – Hogy kísérelje meg a lehetetlent – felelte Hammond. Henry. – Rendben lesz – mondta Hammond a telefonba. amit a vonal másik végén mondanak. közben Wura mosolygott. – A hüllőkkel könnyebb a dolog. hadd menjen. a közelébe se menjen az egyetemeknek! Akkoriban Wu bizony nagyon is vágyott rá. amiről senki sem hitte. Már itta John Hammond szavait. – Miről van szó? – Részleteket nem mondhatok. ahogyan azt Hammond ígérte. A dinoszauruszok már léteztek. Volt. Az előállításukra létrehozott technikát olyan pontosan kidolgozták. hogy megszépítsük a valóságot.és támogatási kérelem. – Letette a kagylót. Wu hosszan hallgatott. aki már most hajlandó megpróbálkozni vele.

És ellenőrzi. és a nagy függőleges üvegtérképen csipkés. szimatoló hangokat hallatott. mint a karácsonyfa.9 3. Azt viszont azonnal észrevette. Tudta. s közben székestül feléjük fordult. – Ott van. – Mennyire pontos a helyzetmegjelölés? – Másfél méteren belül van. ni! – És a kis rex? – A fenébe is. – Az meg mi? – A számítógép minden tizenötödik percben megszámlálja az állatokat kategóriánként is – mondta Arnold. akik a teremben voltak. Halk. ahol a térkép szerint vannak. ha nyomon van. amelyből semmit sem értett. – Ez a mi fiatal T-rexünk. csupaideg. és egyetlen világító. Arnold újabb billentyűt nyomott le.1 3. olyan kicsi a képük. – Ez igen – mondta elismerően Gennaro. – A legtöbbjük merevkábeles. látható. negyvenöt év körüli férfi volt. – Még fiatal. A bébik szinte mindig a nagyok csordájának közepében maradnak. A vonalak a térképen sűrűn rajzolódtak egymásra. De amiatt nem aggódunk nagyon. Az ő összes mozgása a parkon belül az elmúlt huszonnégy órában. zavarba ejtő szerkezeteknek érezte a számítógépeket. de a videóról közvetlenül megkapjuk a képazonosítást. – Nekünk hihetetlen ellenőrzőrendszereink vannak! – mondta. a számítógép figyeli őket.9 .1 3. – Arnold pöfékelt. Azokat néha összekeveri. – Arnold leütött egy billentyűt a gépén. kódszámmal ellátott folt jelent meg a lagúnától északnyugatra fekvő mezőn. – Szóval az ellenőrzőrendszereinkre kíváncsi? – kérdezte Gennarótól Arnold. Nem szerette a számítógépeket. és megint új cigarettára gyújtott. – Megint lenyomta. Még az operációs rendszer és a felhasználói program közti alapvető különbséget sem fogta fel igazán. – Meg az előzőben. – Például vegyük az állatkövetést. némelyiknek egészen különleges érzéke volt a komputerekhez. hol van mindenki. – Csak időben tudjuk érzékelni. A térkép kitisztult. – Például? – kérdezte Gennaro. Egyik cigarettáról a másikra gyújtott. – Újra lenyomta a billentyűt. Ezért aztán zavarodottan és elkedvetlenedve állt – a szó szoros értelmében elveszetten – egy idegen földrajzi terepen. – Fogalmazzunk úgy: ha most kihajt kocsival. Ha kivetíti az ember a nagy és a kis rexet. A srácok közül. mint a véreb. az összes állatot pontosan ott fogja találni. de nem bánta. egyfajta intuíció. akikkel dolgozott. – Követ el hibát a számítógép valaha is? – Csak a bébiknél. néhány pedig rádió-teleméteres. Annyi fénypont gyúlt ki sorra a gépen. Még ha nem is nézzük a videomonitorokat. – Így: Állatok összesen Faj Tyrannosaurus Maiasaurus Stegosaurus Triceratops Procompsognathida 238 Várt 2 21 4 8 49 Talált 2 21 4 8 49 Ver 4. hol van. És igyekszik távol tartani magát a nagy. avult szemléletű kutatónak nézik. mint egy kisgyerek firkálása. hogy Gennaro tökéletesen otthon érzi magát. Fölpislantott a többiekre. Idegen. – Az előző huszonnégyben. és mekkora a mozgásterülete – mondta Arnold. Csupa pötty. és rögtön ideges lett. – Ez jelen pillanatban kettőszázharmincnyolc állat. hogy ezért régimódi.A VEZÉRLŐ A lesötétített teremben Grant végignézett a számítógép-monitorok villódzó során. hogy olyan lett. Aztán ott a kategória szerinti számlálás. – Hol van a nagy rex most? – kérdezte Gennaro. kék vonalak gyulladtak ki. megmutatom én magának a park összes állatát! – morogta Arnold.3 3. felnőtt rextől. Persze a mozgásérzékelők nem jelzik az állat faját. ezért közel marad a vízhez. hogy sosem találkozik az útjuk. – Hogy csinálják? – Mindenütt ott vannak a mozgásérzékelőink az egész parkban – válaszolta Arnold. A „kis rex”. Grant soha nem érzett ilyesmit. De az irkafirka egyetlen területen belül helyezkedett el: közel a lagúna délkeleti partjához. – Milyen időközönként mérik be őket újra? – Minden harminc másodpercben. Malcolm pedig egyenesen elemében van. A főmérnök sovány. mellettük kódszám. semmit sem ismert.

és figyeli. Grant szólalt meg: – És mi az ott a jobb szélső oszlopban? – Az állatok kibocsátási verziószáma. az egy teljesen különálló számlálóeljárás. Fontos. mert a víz mozgása és a felszínen keletkező légáramlás megzavarja a szenzorokat. a dzsungelben. – Értem – mondta Malcolm. és megfulladt. hogy senki se feledje: úgy állították őket elő.3. a számlálás leállt.1 3. leadja nekünk a figyelmeztetést. Az egyik othnieliánk belegabalyodott egy fa ágaiba. Az ember teremtményei. és kitörte a nyakát. – És ezek a szenzorok mindenütt ott vannak a parkban? – A földterület kilencvenkét százalékát lefedik – mondta Arnold. – A másik a közvetlen kép – folytatta a mérnök.. Ha netán valamelyik állat érzékelő nélküli területre lép. Arnold alighanem észrevette az arckifejezést. a számítógép megjegyzi. mert két különböző adatgyűjtőmódot hasonlít össze. Tegyük fel. És ha baj van. Mégiscsak élőlényekről van szó.1 vagy 4. – Volt egy-két állatpusztulásunk. Wu doktor laboratóriumainak új verziót kell készítenie. A kompik társaslények. dr. – Igen. – De térjünk vissza a számlálás kérdésére! Ha jól értem. Ellenőrizhetem az állatokat vizuálisan is. Például a folyón. A legfrissebb verziónk a 4. – Kijuthatnak a körülzárt . és a számítógép vészjelzést adott. Most foglalkozunk a gondolattal. – Jól van – mondta Malcolm. – Vagyis az összes állatot láthatja. A gondolat. – Természetes. Az egésznek az a lényege.. hogy én azt gyanítom.0 3.9 4.1 3. Wu laboratóriumainak muszáj új verziót készítenie. mikor jön ki onnan. amelyik mindet el-elkapja. Hogyan bizonyítják be. Vagyis az egyednek vagy az A csoportban. – Először is követni tudom az egyedek mozgását a többi kompihoz képest. mire az egyik monitoron gyorsan peregni kezdtek a kompik képei egytől negyvenkilencig számozva. igen – felelte Arnold. Egy hypsilophodonta leesett. hogy követniük kell! – vágta rá türelmetlenül Malcolm. – Tehát negyvenkilenc procompsognathidát jeleznek. csoportban mozognak. mint a szoftvert..3 4.1 4. Nekünk pedig figyelemmel kell követnünk az éppen kinn lévő verziót. amikor csak akarom. mert így szólt: – Nézze.. Két kompicsoportunk van a parkban. – Öt percen belül? – Úgy van. mozgásérzékelők segítségével történik. Amint felfedezünk a DNS-ben valami zűrt. valahogy taszította Grantot. Ha pedig nem jön. Nem tudta volna megmagyarázni. tökéletesítik és modernizálják. minden számlálás szenzorok. Az elmúlt öt percben belüliek. ha akarja? – Igen.Othnielia Velociraptor Apatosaurus Hadrosaurus Dilophosaurus Pterosaurus Hypsilophodontida Euplocephalida Styracosaurus Microceratops Összesen 16 8 17 11 7 6 33 16 18 22 238 16 8 17 11 7 6 33 16 18 22 238 3. Ha egy állat hiányozna.. hogy az ember beleszeressen ezekbe az állatokba. hogy a számítógép nem hibázhat.9 4. Egy stegó belepusztult abba a bélbetegségbe. vagy a B csoportban kell lennie. – Csak egy-két hely van. hogy áttérünk a 4. hogy némelyikük nem a helyes faj. ahol nem tudjuk használni őket. – Bizonyos szempontból valóban hasonló dolog a szoftverhez. Néha akad velük valami baj. – Verziószámuk van? Mint a szoftvernek? Új kibocsátás? – Nos. Nem az állatkövető-adatokon alapszik. hogy tévedek? – Két módon – felelte Arnold. Gombokat nyomott meg.1 – Amit itt látnak – mondta Arnold –. a fékentartással? – kérdezte Gennaro. Mindegyik esetben mihelyt az állat megszűnt mozogni. miért – túlontúl is új volt az egész –. Teljesen új szemmel néz körül. igaz? – Igaz. – Ezek a képek. – Pillanatnyi azonosítási képek. De szinte mindenütt másutt ott vannak. nem szabad. hogy élőlényeket úgy sorozatszámoznak. de ösztönösen viszolygott tőle.3 2. – És mi a helyzet a fizikai elszigeteléssel. öt percen belül tudnánk. – És ki is próbálták már ezt a valóságban? – Hát ha úgy vesszük – mondta Arnold. Grant doktor. de.4-es verzióra..0 3.

hogy ne menjenek a közelükbe. Egyik sem halálos. Mi törékenynek. Arnold újabb cigarettával pöfékelt. elektromosan töltött hálók. . Az állatok hamar megtanulják. vagy más állatokat fertőznek meg. modem segítségével. – Megbolygathatja-e valaki? Arnold a fejét rázta. de még egyik sem működőképes. tizenkét hónappal azután kerül sorra. – Ezek az árkok mindenütt legkevesebb négy méter mélyek. mint amelyek magukat aggasztják. tehát nem befolyásolható távolról. beleértve azt a harmincöt kilométert is. amikor az állatok belepusztulnak a saját betegségeikbe. Más sincs. és független a pótellátása is. Sehogy sem tetszett a gondolat. Bennünket ez a kérdés nem is foglalkoztat. Ezért sokat tudunk arról. hogy megtörténik. – A rendszer „meg van keményítve” – így mondják. s a táblán narancsszínű vonalhálózat tűnt fel. – Félelmetes egy rendszer! – mondta. ahol a csónakok víz alatti síneken haladnak. és van egy „Madárházvasutunk”. – Ezek igen drága állatok. Lézer sokkfegyverek. Ezek új állatok. A számítógéprendszer teljesen biztonságos. A kerítésekben tízezer voltos áram fut. hogy az állatok kiszabadulhatnak. amit maguk is megtesznek majd. négy méter magas kerítésrendszerünk van. – De ha mégis kiszabadulna egy? – kérdezte Gennaro. A park az alapvető „Dinoszauruszvilággal” nyit. – Betegségek? – kérdezte hirtelen riadalommal Gennaro. – Azt kell megérteniük – folytatta Arnold –. – Azt most inkább ne – szólt közbe Gennaro. A többi vasút pedig csak hat. amelyek ezeknél az állatoknál előfordulnak. – No és a mechanikus rendszereik? – A vasutakra gondol? – kérdezte Arnold. hogy az ember már több száz éve tart emlősöket és hüllőket állatkertekben. – Rengeteg eszközünk van hozzá. azzal az úttal. – Hullámvasútjaik lesznek? Mint egy vurstliban? Arnold megnyugtató hangon válaszolt: – Ez itt egy állatkert. A nagyobb állatoknál a vizesárok akár tíz méter mély is lehet. – No és ha megszökik egy a szigetről? – Az kevesebb. ahogy az állatorvosok kikefélik azokat a hatalmas fogakat. hogy nemigen van problémájuk. Ennyi az egész. – Élénkvörös vonalak ragyogtak fel a hatalmas képernyőn. A rendszer nem kommunikál a külvilággal. Ezek génsebészeti úton előállított állatok. Hatvanötmillió év után hozták vissza őket egy olyan világba. – Lenyomott egy billentyűt. – Van „Dzsungelfolyó” nevű járatunk. Mr. nem értünk hozzájuk. Megint elfogta a bosszúság. És egyszerűen nem tudjuk. az az. – Tegyük fel. – Félelmetes! – Ezek szerint – mondta Malcolm –. olyan jól működik a rendszerük. – Dehogy. Muldoon megköszörülte a torkát. gondolom. Nem képesek szabadon megélni. Ha jól látom. – Mi a helyzet magával az ellenőrzőrendszerrel? – folytatta a kérdezősködést Gennaro.. Csakhogy a dinoszauruszokról eddig még soha senki sem próbált meg gondoskodni. hogyan kell a gondját viselni egy krokodilnak vagy egy elefántnak. amely magának a szigetnek a védő körzetét veszi körül. amelyikhez alkalmazkodtak. és megszólalt: – Akkor kimegyünk és szépen visszahozzuk – mondta. Gennaro. Akarják látni a nagy rex egészségügyi anyagát? Az oltásait? A fogászati kartonját? Nem semmi! Látniuk kellene. – Csak nem olyasfélék. – Miért. Túráink vannak a különböző területek bejárására. mert ahogy Mr. Többszörös elkerítéssel dolgozunk. Utána az elektromos feszültség alatt tartott kerítések következnek. – Megeshet. Mr. Grant elkomorult. amely teljesen más. Nagyon vigyázunk rájuk. Arnold mondta. – Nyolcvan kilométernyi. ebből valami hatalmas balhé lesz a szárazföldön.. Gennaro bólintott. Ami viszont kifejezetten izgat. Gennaro? Ez egyetlen állatkertet sem izgat. a maguk fő aggálya az. Először is ott vannak a vizesárkok. De ennek figyelésére is vannak programjaink. hogyan óvjuk meg őket. Az a legfőbb gondunk. Bennünket sem. maga kapott már náthát állatkerti alligátortól. Grant hirtelen felkapta a fejét: vasutak? – Még egyik sem működik – mondta Arnold. A legnagyobb gondunkat a betegségek jelentik. nehogy megszuvasodjanak. csak az egyszerűség kedvéért hívjuk őket „vasutaknak”. érzékenynek látjuk ezeket az állatokat. Arnold erre csak horkantott egyet. – Várjon egy pillanatra! – szólt közbe Grant. mint problémánk – húzta fel a szemöldökét Arnold. bennük víz van. és elnyomta a cigarettáját. Csend lett. mint huszonnégy órán belül elpusztul. A számítógép minden szempontból független. hogy valamelyik látogató megkapja? Arnold ismét csak horkantott. nyugtatólövedékek. hogy dinoszauruszok egy vurstli célját szolgálják. ezek drága állatok. mint amelyikből valók.területekről? – Az teljességgel lehetetlen – felelte Arnold. – A puszta feltételezés kedvéért – makacskodott tovább Gennaro. Önálló az energiaellátása.

indul a kirándulás. – Ha kell. melyik pillanatban hol vannak. szóval. amit a végén mutattak nekünk. új biológiai világot létrehozni. és a billentyűkkel dolgozott. Pedig ha bárki csak egy kicsit is belegondol. amit Wu doktor mondott nekünk. A lényeg. Tudom. – Nos – mondta Arnold –. Kifelé menet Gennaro megjegyezte: – Nekem ez igen jó rendszernek tűnik. van még kérdés? – Nincs – felelte Malcolm. normális megoszlás ezen a szigeten éppenséggel szörnyen aggasztó! – Aggasztó? – De még mennyire! Abból kiindulva. – Feltételezések? – ráncolta a homlokát Gennaro. Nedry tervezett? – kérdezte Malcolm. Ezek vannak a görbe elején és végén. Gennaro megdöbbent. ilyen görbét sosem volna szabad látni itt.Malcolm viszont tovább kérdezősködött: – Az egész parkot ebből a vezérlőteremből tudják irányítani? – Igen – felelte Arnold. – A számítógép a videoképek leolvasása közben mértéket vesz. Minden egészséges biológiai populáció ezt a fajta megoszlást mutatja. hogy kijutottak innen állatok? – Nem hiszem. – Csak alapfeltételezések kérdése az egész. – Várjon már! – mondta meglepetten Gennaro. és negyvennyolc órára feltölteni a vízvályúikat. – Csoportonként is tudnak vizsgálatokat végezni? Megmérni őket vagy akármit? Arnold gombokat nyomogatott. . Annyi automatika van beleépítve. mindezt akár felügyelet nélkül. Mindet meg tudják nézni. hogy az állatpopuláció normális Poisson-féle megoszlást mutat. Fel sem nézett a billentyűzetről. – Amit tudok. hogy az a szép. – Fantasztikus rendszer – mondta büszkén Arnold. hogy az állatok többsége egy átlagos központi érték körül összpontosul. – Az teljesen nyilvánvaló – felelte. egymagam is elboldogulok. – Nem? – kérdezte Malcolm. Azt látjuk. már elég. én terveztem – mondta Nedry. – Csak egy van – szólt közbe Malcolm. – Én meg azt hittem. – Ez az a rendszer. hogy egy természetes világot kell látniuk. így azonnal lefordítható. – Így van. – Ezt mind meg tudjuk csinálni. Hogy szökhetne meg akár csak egy is? Malcolm csak mosolygott. Tudják. – Nézze! A Jurapark lényege. Nos hát – kérdezte újra Arnold –.. amit Mr. Nem látom. ha nincs több kérdésük. rá kellene jönnie. – Igen. mint azon a grafikonon. A vezérlőben ülő szakemberek pedig abból indulnak ki. – Csak egy-két kisebb hibát kell kiigazítanom. vagy kisebb a többinél. Csokoládérudat majszolt. etetni őket. Maga azt hiszi. hogyan juthatott volna akár egyetlen állat is ki a szigetről. – De hát hogyan? Hiszen maga is látta! Minden állatot figyelnek. néhány pedig vagy nagyobb. ez teljesen nyilvánvaló. – Az – szólt szórakozottan Nedry.. amire számít az ember – mondta Malcolm. sőt igen gyorsan – mondta Arnold. A számítógép önállóan képes követni az állatokat. hogy a tudósok és műszakiak megpróbáltak egy teljes. – Úgy van – válaszolta Malcolm. Olyat. – És ez éppen az a fajta görbe. Új kép jelent meg az ernyőn. úgy látom. Dennis Nedry a szoba túlsó sarkában ült egy terminálnál.

manipulált természet. A Jurapark nem a való világ. És a Jurapark minden. – Nem baj. – Mert az egy normális biológiai populáció görbéje.– De hát miért nem? – kérdezte Gennaro. Ha tetszik. amelyet azért manipuláltak. hogy még természetesebbnek hasson. hogy a kirándulás mindent világossá tesz majd – mondta erre Malcolm. Egy bizonyos értelemben igazi park. csak nem az. Biztos. megint nem tudom követni – szólt Gennaro. – Félek. talán leginkább a hagyományos japán kertekhez hasonló. .

A dinoszauruszok világában akadtak maibb növények is. Az előttük haladó kocsiban a három kutató és Gennaro látható izgalommal beszélgetett és mutogatott.. A Land Cruiser lassan gördült előre a növényzeten át. Tim örült. és a belső képernyőkön felirat jelent meg: ISTEN HOZTA ÖNÖKET A JURAPARKBAN! Ünnepélyesen zengő. – Egy kis szünetet tartott. mit képzel. Richard Kiley folytatta: – Mindenekelőtt figyeljék meg az önöket körülvevő. és tanácsot adjon. – Nem takarékoskodtunk semmilyen téren. hogy fokozzák az igazi őserdei hatást.. – Én tisztában vagyok vele. és. – Végig nyílt rádiókapcsolat lesz a kocsik között. Gennaróval együtt beszáll az első Land Cruiserbe. minden kocsiba kettőtől négy. és élvezzék ezt az automatikus irányítású társastúrát. – Ezek elektromos kocsik – jegyezte meg. – Nem tudom. – A fene egye meg! – szólt Gennaro. – Technikai dolgok. Tim észrevette. – Tíz éven aluli gyermekek csak felnőtt kísérettel utazhatnak.. A fák önöktől jobbra és balra úgynevezett cikászok. és megszólalt: – Ezeket a könnyű súlyú. hogy. – De engem érdekelnek a technikai dolgok – erősködött Tim. Egy sor Toyota Land Cruiser gördült fel a látogatóközpont alatti mélygarázsból. aki öklével bele-belecsapott a kesztyűjébe. mindenki. amelyek átrágják magukat a krétakor és a jurakor százmillió évvel ezelőtti mocsaras erdein. mint egy CDROM. amint Grant. Látnak még benettitidákat és ginkókat is. – Ez Richard Kiley. A két fekete bőrű férfi rájuk csukta az ajtót. jellegzetes növényzetet. Ed Regis pedig utánuk. A Land Cruiser alacsony. erre! – kiáltotta Ed Regis. mint az afrikai vadrezervátumokon. a nagy színész – mondta Ed Regis. – Azért van itt.. hogy az első ülésre ülhet. és amelyet önök immár a maga valójában láthatnak. egy olyan világba. elektromos Land Cruisereket a Jurapark természetvédelmi politikájával összhangban a mi külön megrendelésünkre gyártotta az osakai Toyota cég. Reményeink szerint idővel majd szabadon hajtunk az állatok között. De a legtöbb . Ezeket is látni fogják még. mi a fenének van maga itt?! – hallatszott Gennaro dühös hangja a hangszóróból. Kérjük. – Kérjük. mint vegetáriánus óriásokat. hogy meggyőződjek. miről beszélnek olyan nagyon – szólalt meg Ed Regis. egy számítógép-vezérlésű lézerlemezjátszó. szalagjukon „Jurapark” felirattal meg egy kis dinoszauruszforma emblémával. A dzsipek némán. meg valamiféle rádióadó. – Egyébként közlöm. ami leginkább úgy nézett ki. miről beszélnek – mondta erre Regis. kellő felelősséggel végezte-e a munkáját Hammond.. Ed Regis kifejezéstelen mosollyal arcán lenyomta a gombot. mert a műszerfalba két számítógép-monitor volt beépítve. Nem én hívtam ezeket az istenverte kölyköket. Tim Lexre pillantott. és több fura. miért vagyok itt – mondta Malcolm. hogy szellemi társasjátékot űzzön velem! Enyém ennek a cégnek öt százaléka. mindörökké letűnt világába. És akkor – az Isten verje meg! – jön maga. hogy kerítések és a tartófalak zöld növényekkel vannak befuttatva. a pálmafák történelem előtti ősei. – Szeretnék velük menni! – Úgyis hallani fogod. Rámutatott az első kocsira. Két szafari-egyenruhás néger férfi nyitogatta az ajtókat a beszálló utasok előtt. Bekapcsolta a kocsik közti rádiórendszert. Ed Regis lenyomta a rádiótelefon gombját. kérjük. és megkérdezte: – Én nem mehetnék velük? – Nekik fontos megbeszélnivalóik vannak – mondta Ed Regis. nem azért. A Land Cruiser elektromos zümmögéssel elindult. Volt ott még egy hordozható walkie-talkie. – Akkor kezdjük a műsort. hogy felvilágosítson engem. tömzsi pálmafákból álló fasoron haladt át. amelyet gigászi élőlények uraltak – egyikük sincs ma már a föld színén –. Jött a második kocsi. Ellie Sattler és Malcolm az ügyvéddel. Két antenna ringott a tetőn. – Az útba ágyazott kábel vezeti őket. mély férfihang szólalt meg: – Kedves vendégeink! Üdvözöljük önöket a Juraparkban! Önök most belépnek a történelem előtti kor ősi. rendben? Harsonaszó hangzott fel. halljuk. mint a különféle fenyők és a mocsári ciprusok. minden kocsiba kettőtől négy utas szálljon. vezető nélkül álltak elő. – No. de egyelőre helyezkedjenek el kényelmesen. és enyém a feladat. Tim nézte. – Általában úgy szoktuk elképzelni a dinoszauruszokat – mondta Richard Kiley –.A KIRÁNDULÁS – Erre. – Nekem muszáj nyíltan beszélnem. Tim és Lex beszállt. kvarc szemüvegféle kukucskált ki a térképből. minden kocsiba kettőtől négy utas szálljon! – ismételgette egy magnóra vett hang. meg egy doboz. A cikászok a dinoszauruszok kedvenc eledelei közé tartoztak.. hogy mi is halljuk magukat itt. A mellette álló nő parafasisakot osztogatott.

– Egyszerű párzási hívóhanggal előcsalogathatók. – Hol vannak? – kérdezte Lex. – Elég unalmas – mondta Lex. – A csorda törzse az önök alatt lévő füves síkságon tanyázik – mondta a hang.dinoszaurusz nem volt akkora. – Kis termetű. a formája meg egy hátsó lábán álló gyíké. Maga a név: „hypsilophodonta” is „magasélű fogat” jelent. Az egyik felnyúlt. sötétbarna és fekete pöttyökkel. mellettük pedig a velük kapcsolatos számadatok. és a CD-ROM felzümmögött. és az átlagdinoszaurusz akkora volt. A hangszóró megismételte a hangot. amely sárgás fűvel borított mezőre nyílott. – A neves múlt századbeli dinoszauruszvadász. hogy a Land Cruiser képernyőit ugyanazok a mozgásérzékelők irányítják. mire a fejek megint előbukkantak. – Jobbra! – mondta. Ott rés nyílt a növények között. a Juraparkon át. – A fákon? – kérdezte döbbenten Lex. mint egy őzike. amelyen keresztül kelet felé be lehetett látni a terepet. Úgy véljük. pontosan ugyanúgy. majd fogaskerék-csikorgás hallatszott. Tim még két állatot vett észre feljebb. – A nagy zöld fatörzs közepe táján. de talán a fákon az ágak között is. A fej nagyságából ítélve egy méter-egy méter húsz centisek lehettek. hosszú farkával egyensúlyozott. a mai Angliától Közép-Ázsián át Észak-Amerikáig. ugyanabban a sorrendben. – A hypsilophodonták a dinoszauruszvilág gazellái – mondta a hang. Hypsilophodontáknak hívják őket. talán meg is látnak belőlük egyet-kettőt. mint ahogy azt az emberek hiszik. A fű egy méter magas lehetett. olyan mint a libagágogás. hogy gombáról vagy valami allergiáról lehet szó.. A fa foltos árnyékában mozdulatlan. Úgy röpködtek a levegőben. mint egy kis majom. Nyilván valamilyen automatikus rendszer keresett valamit a lemezen. erős hátsó lábuk és hosszú farkuk mind láthatóvá vált a délutáni napfényben. Őket láthatják maguk előtt a sík területeken. – A kis állatok. A fejek eltűntek. amelyek az állatokat követik nyomon. A kocsi villanymotora beindult. – A hypsilophodonták nem valami okos állatok – magyarázta a hang. Mind nagyjából egyforma nagyok voltak. – Ezek nem csinálnak semmit. és el is tűntek. nagyjából akkorák. Lelógó. Tim úgy gondolta. Marsh a Yale Egyetem professzora volt. mint egy póniló. sikerük titka abban rejlett. és ezeknek az állatoknak az önélesítő fogaira utal. – Az egy othnielia – jegyezte meg Tim. zöld állatka ült egy ágon. hogy erősebb állkapcsuk és fogazatuk segítségével jobban el tudták rágni a növényeket kortársaiknál. annak az az oka. A fejek színe tompazöld volt. . Az adólámpák villogtak. s közben egész testük. De hát a történelemben ezek az első olyan dinoszauruszok. De lehet. ugyanannak a fának magasabb ágain. Ha balra néznek. náthás hang szólalt meg. méla jelleget kölcsönzött az állatnak. úgynevezett othnieliák – szólt a hang. mozgott az állkapcsa. Némelyik hypsilophodonta rágcsált. amelyek egykor mindenütt a világon jelen voltak. A Land Cruiser egy kis magaslaton megállt. de ez nem biztos. Othniel Marsh tiszteletére kapták a nevüket. amelyeket élve lehet vizsgálni. Akkora lehetett. és ötujjú kezével megvakarta a fejét. Erdős lankát láttak maguk előtt. – Az egyik hangszóróból a kerítésnél elnyújtott. A legkisebbek nem voltak nagyobbak a közönséges házimacskánál. Tim is elnevette magát. amelyek lefelé haladtak a karcsú nyakon. A monitorokon most hypsilophodonták képei jelentek meg. Tim a műszerfalra nézett. mint az előbb. mint az ugráló kenguruk. Állatorvosaink itt a Juraparkban arra gondolnak. továbbhaladunk a kicsivel nagyobb dinoszauruszok felé. – Dinoszauruszok a fákon? Tim látcsővel pásztázta végig a vidéket. – Ha vakarózni látják őket. – Most. Meglátják! A Land Cruiserek folytatták útjukat dél felé. Mind balra néztek. hogy talán nem is csak olyan kicsivel lesznek nagyobbak. Abban a pillanatban egymás után hat gyíkfej bukkant elő a tőlük közvetlenül balra elterülő füves réten. gyors állatok.. A hatás komikus volt. A mozdulat valamiféle elgondolkodó. hogy bőrpanaszaik vannak. Néhány ugrás. A váratlan zajra az egész hypsilophodontanyáj hirtelen magasra ugrott. Mi is ilyen átlagos nagyságú állatokat keresünk fel először. – Az intelligenciájuk nagyjából megegyezik a közönséges tehénével. amelyeket látnak. Egyetlen dinoszaurusz sem volt sehol. miután láttuk ezeket az érdekes növényevőket. Egyik sem mozdult.

Hogy a legveszedelmesebb. a sorbaállók ellenőrzése. Egyébként ők is jobbára a vezérlőből nézték a parkot. – Hagyjuk már a velociraptorokat! – vágott közbe Hammond. hogy a Jurapark eredendően veszedelmes hely. – Mindet el kellene pusztítani! – Rádiójeleket sugárzó nyakörvekkel akarta ellátni őket – mondta erre Hammond. A triceratops-nőstények ölik egymást az uralomért. Ennek okát sem ismerjük. és nagy „tematikus” parkokat tervezett Amerika szerte: a kaliforniai Varázshegyet. amelyeket valaha is hordott a föld a hátán. kinek az oldalán áll maga? – E pillanatban tizenöt kihalt állatfajunk van. Mr. Ujjain kezdte számolni a szempontokat. azért annyira talán mégsem rossz a helyzet! – mondta Hammond. Végül pedig itt az a példátlan feladat. hogy Arnold maga ritkán ment ki a parkba. pedig kettő már bele is pusztult. No és a velociraptorok. De még ha a raptorok nem is szabadulnak ki soha – mondta Arnold –.. A hypsilophodonták bőrkiütésben szenvednek. hogy ma először járják be a parkot igazi látogatók. Arnold – válaszolt egy hang a rádiótelefon hangszórójában.. mint róluk. Nem tudjuk. Az igazság az volt. élelmiszer-kezelés. hogy néha évekbe telik. Tapasztalatból tudta. nemhogy egy egész park tökéletes működését megszervezni. – Pedig azok – mondta csendesen Muldoon. Mérnök létére hozzászokott az elnyúló határidőkhöz – sokszor emlegette a „szeptemberi nyitás”-t. – Maga nyilván nem így látja. – Betege vagyok. aki éppen belépett a terembe. Az. az alkalmazottak pedig elég modortalanok. Arnold ezer kisebb részlet felett nyugtalankodott. hogy látogatók jártak a terepen. véleményem szerint akkor is el kell fogadnunk. Arnold rendszerszervező mérnök volt. a virginiai Óvilágot és a houstoni Csillagvilágot. Csak félig szánta viccnek. hogy állítsa fel és hozza működőképes állapotba a Juraparkot. bár kissé túl drága. és sok embert csábítottak át a repülőgépgyártás és az űrhajózás területéről. És azonnal le is rágták a nyakörveket. – Nem hiszem – felelte Arnold. – Dehogynem. Közben a Disney cég szórakoztató parkjai egyre fejlettebb és bonyolultabb elektronikusan vezérelt hullámvasutakat és más „járművek”-et kezdtek alkalmazni. míg meg nem született első gyermeke. zárórendszerek fenntartása és a többi. leggyilkosabb lények. – Maga örökösen aggodalmaskodik – mondta Hammond. hogy állandóan ilyen parkokon dolgozott. és nem tudja – felelte Arnold. Most. Mr. – Jelentéktelen apróság – jegyezte meg Hammond. és hasmenést kapnak. Az 1960-as évek végéig a tengeralattjáróról kilőhető Polaris rakétákon dolgozott. úgy lett egyre elégedetlenebb az elért haladással. .” Az utóbbi két évben Arnold feladata az volt. de műszaki szempontból a Jurapark a történelem legnagyralátóbb tematikus parkja. és ez el nem vette a kedvét a fegyver készítéstől. szállítás. biztonság. védelem a rovarok és más kártevők. – Egy lószart! – mondta Hammond. a végén már a valóságot is egy kissé sajátos nézetből láttatta vele.A VEZÉRLŐ – Csikorognak a fogaskerekek az áttételváltásnál! – szólt John Arnold a vezérlőterem félhomályában. – A tyrannosaurusok isszák a lagúna vizét. Muldoon némán figyelt a sarokból. s ahogy közelgett a szeptember. Hammond! – mondta. Kettő: ehhez jönnek egy nagy állatkert problémái. – Egy: a Juraparkban megvan egy szórakoztató park minden problémája. és „Pteratopskastély”-t a madárházban. ha visszajönnek! – Igen. A mindig feszült Arnold most különösen ideges volt. – Szóljanak a karbantartásnak. míg sikerül a hibákat kiküszöbölni egyetlen parki berendezésből is. Állatgondozás és ellátás. Nagyon is érezte súlyát annak. és hatnál kisebb csoportokba kell szétválasztani őket. még láthatta a két Land Cruisert dél felé haladni a parkon át. még ha szakemberek is. hogy olyan állatpopulációról kell gondoskodnunk. – Különben is. a betegségek és allergiák ellen. Járműkarbantartás. Arnold részt vett az orlandói Disney World építésében. Arnold hátratolta a székét a vezérlőpanel központi konzoljától. – Igen. de én igen. amikor azt állította. „Párizs egy nagy tematikus park – mondta egyszer egy nyaralás után –. ami mindig a jövő év szeptemberét jelentette –. és új cigarettára gyújtott. hogy másról sem hallok. – Én pedig hozzájárultam. A látogatók soha nem fognak erre gondolni. Az állatápolók csak az egyes etetőházakhoz jártak. hogy lassanként az egész világot le lehet írni a „tematikus park” metaforájával. hulladékeltávolítás. Amint kinézett. szálláshely-biztosítás. miért. a főállatorvos néha járt odakint. miért. az állatok egészsége és általános jóléte. – Nincsenek jelentéktelen apróságok. – Ó. amelyről eddig soha senki sem próbált. a többségük veszélyes – mondta tovább a magáét Arnold. Csak éppen maga sosincs itt. A stegosaurusoknak gyakran kisebesedik a nyelve. – El kellett halasztanunk az „Út a dzsungelfolyón”-t a dilophosaurusok miatt. etetés és tisztaság. és néha megbetegszenek tőle – csak azt nem tudjuk pontosan. hogy nézzék át a BB4-es és BB5-ös kocsikat. Harding.

ott vannak! – mondta a hang. Éppen most kerülték meg a madárházat. minden egyes példánynál makacsul kimutatta a Phagostum venulosum nevű parazita jelenlétét. hogy vannak problémák. és ivott a vízből. De Timnek leginkább a fej keltette fel az érdeklődését. Az állat halk huhogó hangot hallatott. mint bármilyen más állatkerti állat a világon. Beletanulnak ellátásuk rendszeres ismétlődéseibe. Ezek nem technikai kérdések. A taréjon papagájra vagy tukánra emlékeztető. Míg Nedry dolgozott. Kezdettől fogva ez volt a tervezők megingathatatlan meggyőződése. nincsenek-e paraziták az állatok székletében. Az egész biztonsági rendszer tehát csak a fő energiarendszerrel működött. Csak szerette tudni. Bármit is mondott a magnó. hajlott taréj haladt végig a fejtetőn a szemektől az orrig. úgy hogy a kocsik belsejében lévő CD-ROM-okat megfelelően irányítsák a mozgásérzékelők. A kocsi szakadék felett húzódó. Valójában a hibák listája immár százharminc tételre rúgott. madárszerű fejet mutatott. – Tim alumíniumlemezeken csillanó napfényt látott a távolban. Arnold tudta. Két széles. hogy minden telefonvonalra szüksége lesz. minden áramkimaradásnál kikapcsolt. Nem mintha nem bízott volna Nedryben. erre az elektromos sebváltók kezdenek el vacakolni! A sebváltók! – Az ég szerelmére. Tim csak egyetlen állatot látott. hogy hétfőig túlórázhassanak. – Ha tisztességesen megcsinálta volna már kezdetben – kezdte Hammond. amely az elektromos Land Cruiserek mozgását követte. Arnold egy billentyűnyomással újabb ablakot nyitott a saját monitorán. ahol ha szerencséjük van – megpillanthatnak egy igen ritka húsevőt. A folyó mentén haladtak észak felé. Mind kell ahhoz. magas úton haladt. A program erre automatikusan beadagolta a szükséges gyógyszert az állatok eledelébe. A biztonsági rendszer. hogy rendben működjenek. hogy programadatokat továbbítsanak ide-oda közte és programozói között. a mélyben robogó vizű folyó. végső soron úgy fognak viselkedni. mint valami bagoly.mert a pterodactylusok olyannyira kiszámíthatatlanok. láthatják a Jurapark madárházának kupoláját. Nedryre pillantott. és nem kapcsolt vissza. – Éppen elég műszaki késésük volt – jegyezte meg Hammond. hogy semmi haszna Nedryt felbosszantani. John Arnolddal viszont azt közölte. így bepillanthatott abba. – Ez az átkozott komputer örökösen csak gondot okozott! – Meglesz az oka – mondta Nedry. oldalszám. mit csinál Nedry a sarokban lévő klaviatúrán. Bármennyire különösek vagy egzotikusak is ezek az állatok. Hiszen szoktathatók. Megnézte a grafikus kijelzést a jobb oldali monitoron. Következésképpen a személyzet nem tudta pontosan felmérni. Amikor a teljes listát megpillantotta. és az állatok megtalálják majd a helyüket. V-alakot alkotva a dinoszaurusz fején. próbáljuk meg azért az arányérzékünket megtartani! – mondta Hammond. Timék kocsijában azonban mindenki kifelé meresztette a szemét. – Szükségszerű. . amely az Isla Nublart a szárazfölddel összeköti. elképzeléseik gyökere. fekete-vörös csíkok voltak. mint a leopárdot. A vízmedret sűrű növényzet fogta közre mindkét oldalról. – Nagy ez a rendszer – mondta Arnold. volt. aki a szoba sarkában dolgozott egy terminálnál. míg éppen dolgozik. a vasárnapi etetéseket viszont nem volt hajlandó rögzíteni. Három méternél is hosszabb testét sárga és barna foltok borították. és nem lehetett kikapcsolni. Felépítése megfelelt a húsevők alapvető formájának: súlyos farka volt. megszólalt a vészjelzés. A takarékossági program. de Arnold csillapítóan érintette meg a karját. Mr. Az automata fekáliaanalízis (közkedvelt nevén „autókaka”). amelynek tíz óra után minden nap le kellett volna tompítania a lámpákat. – Közvetlenül alattunk pedig a mezozoikumi dzsungelfolyónk látható. Tényleg csak a főattrakciót. Hammond! Nem műszaki okokból történtek! Gondok vannak az állatokkal. hogy egymaga el fogja végezni az összes javítanivalót a hétvége alatt. és rájuk parancsolt: mondják le minden hétvégi programjukat. amikor a rendszer a tartalék energiaforrásra állt át. erős hátsó végtagjai és hosszú nyaka. Azonnal hívta munkatársait Cambridge-ben. – Maga csak tartsa rendben a műszaki részt. és akadt közöttük néhány ilyen furcsa is. Középütt összefutottak. nem pedig huszonnégy óránként. hogy van a számítógép? – szólt Hammond. amelyeket most látnak: Dilophosaurus. mi történik. – Ha balra néznek – szólt a hang –. Tartsák nyitva hát a szemüket. csak minden második nap működött. Ha viszont az ápolók kiöntötték a tartókból. hogy ne kerüljön az ételbe. Denys Nedry abban a tévképzetben érkezett ide. mennyit ettek az állatok. – Íme. hiba hiba után. És így tovább. hogy ellenőrizze. A dilophosaurus hátsó lábára kuporodott a folyónál. – Ne fogja az állatokra! – Igen. Heteken át igazítgattuk. a parkon végigvivő „Dinoszauruszvilágot” sikerült működőképes állapotba hoznunk. noha az a valóságban egyiknél sem fordult elő. elsápadt. amelynek az volt a feladata. például: Az állatetető program tizenkét óránként állt vissza a kiindulópontra. amely az összes kártyával nyitható ajtót vezérelte. amely még nem nyílt meg a látogatók előtt. – Azoknak az állatoknak a neve. és reagálni fognak rájuk. de jól! Benn a Land Cruiserben a monitor lángvörös taréjú. – Addig is.

ismert nevén Tyrannosaurus rex. és igen erős. – Az még egy kicsit odébb van – szólalt meg Ed Regis. Lex. Ismerik ápolóikat. ha nem automatikus az egész. Szállodai szobájukból telefonon foglalhatnak asztalt. – Remélem. mint egy elefánt. – Hé! Hülye dinoszaurusz! Mozogj már! – Ne zargasd az állatokat. A Land Cruiser lassan továbbhaladt. ha olyan közel volnánk. és hagyják magukat simogatni. Orruk közelében egy harmadik.– De jól néz ki! – szólalt meg Lex. mint a világ történetének leghíresebb ragadozója. mint a fordított elefántagyarak. kedves utasaink! Itt biztonságban vagyunk. – Ezek tényleg mérgesek. Lecsavarta az ablakot. Alain Richard. háromcsillagos éttermünk. A szemük fölötti szarvak másfél méter magasra íveltek. rinocéroszszerű szarv. Harcias külsejük ellenére a valóságban egészen szelídek. Ma már azonban tudjuk. és úgy vélték. . Regis bácsi? – Te csak ne félj! – mondta Ed Regis. a világhírű francia Le Beaumaniére-ből jött hozzánk. Rövidlátó. – A triceratopsoknak legyező alakú taraj van a fejük mögött. Akkorák voltak. a hatalmas zsarnokgyík. Ezek is megrohannák a kocsinkat. A hang közben folytatta: – . Tim két állatot látott mozdulatlanul állni egy nagy fa árnyékában. Ezek az állatok egyenként hét tonnát nyomnak.. – Remek! A Tyrannosaurus rex! – kiáltott fel Tim. – Ha felnéznek a jobb oldalon lévő szirtfokra. Lex kényelmetlenül mocorgott az ülésén. Ha jobbra néznek. – De miért ne? Ezek hülyék.. – A tudósok azt hitték. a Les Gigantes épületét. mint egy képeskönyvben – mondta Lex. hogy az állkapocsizomzatuk túl gyenge volt ahhoz. ha a hátsó felüket vakarják. mint ezek a bambák – mondta Lex. hogy még egy utolsó pillantást vethet a dilophosaurusra. Különösen kedvelik. az jobb lesz. Lex! – szólt Ed Regis. A dinoszaurusz ezután kedvére elbánhat vele. – A vendéglőt még építeni sem kezdik novemberig. – Miért nem mozdulnak már? – kérdezte Lex. hogy Grant professzor is legszívesebben ezt tenné.ezek a jó kedélyű szörnyek egy letűnt világból éles ellentétben állnak azzal. és hajlamos rá. elsősorban dögevők lehettek. és maga mögött hagyta a folyót. Tim felnézett a szirtre. Ez aztán a meglepetés! Mérges dinoszauruszok! Szívesen megállíttatta volna a kocsit. de nem látott semmit. hogy mérgezők. Csak ülnek ott. Triceratopsok – gondolta. Ez tömör csontból van. amit következőként látunk majd. A chef. Fogadni mert volna. remélve. Tim hátranézett. – Más dinoszauruszokkal ellentétben – mondta a hang – a Triceratops serratus nem jól lát. – Ez már igen! A dilophosaurus jellegzetes huhogó hangja ismét feléjük úszott a délutáni. – A mai arizonai óriásgyíkhoz vagy a csörgőkígyóhoz hasonlóan a dilophosaurus is hemotoxint választ ki a szájában elhelyezkedő mirigyekből. ami támadást vált ki belőle. mint a rinocéroszoké. – De igazán azok? – Nos hát igen. ott látják remek. A harapás után perceken belül eszméletlenség lép fel. – Micsoda? – Tim elvigyorodott. – A dilophosaurus az egyik legkorábbi húsevő dinoszaurusz – mondta a magnetofonhang. valószínűleg már látják is őket. hogy áldozatokra vadásszanak. és elfordult a triceratopsoktól. s a színük is hasonló. mint a mai rinocéroszok. Olyan formájú volt az orruk is. Tartásukban azonban ott volt a rinocéroszok vadsága is. A Land Cruiser befordult egy sarkon. és elfogyaszthatja prédáját. – Őskori szafariutunkat folytatva most elérkezünk az ornithischia csoportba tartozó növényevőkhöz. hogy látnának bennünket! De aggodalomra semmi ok. ám annál veszedelmesebb tagja a Jurapark állatállományának. hogy mozgó tárgyak láttán meglepődjék. Ez pedig nem más. meleg levegőn át. A dilophosaurus szép.

hal is van benne. A ketrec rácsai lesiklottak. Robert Muldoon jól megtermett. Hangja fémesen szólt a hangszóróban. és csak mozgatja a korcs mellső végtagjait tehetetlen haragjában.A NAGY REX – Az óriás tyrannosaurus viszonylag későn jelent meg az őstörténet színpadán. mint a vadállatok életének szakértője. és könnyen leég a naptól. hogy odalenn vadászik az apatosaurusokra – mondta Grant. rex? – Jó kérdés. amitől félek – szólalt meg Muldoon. – Lehet. meghatározta az oroszlánok. s az árnyak egyre hosszabbra nyúltak. könnyen beleélhette magát. A másik teljesen kifejlett. Mint a madarak. – Kihajolnak az ablakon. Nemzetközi hírnévre tett szert. a londoni Sunday Times-ben ezt írta róla egy cikk: „Ami Robert Trent Jones a golfpályán. és Muldoon osztotta Arnold minden félelmét. rex. – Ez bejött. – Már csak percek kérdése – szólt Regis. elefántok. a kis T. – Vadászna is. És csak ücsörögni. feszülten figyelte a Land Cruisereket. Csend volt. különösen nappal. hogy csalódni fognak – mondta Regis. de nyugodtak lehetnek. hogy „élőben” járták be látogatók a Juraparkot. hogyan csinálja. Grant azonban nem volt meghatva. Távolabb. Két és fél méter magas. hogy végre lássák. Malcolm elnevette magát. mert érzékeny a bőre. Fiatal még. Nyugatra a nap már lefelé szállt. védtelenül. s a kecske riadtan mekegve ott maradt. fokozatosan merült a párás horizont alá. – A Tyrannosaurus rex félénk? – Nos. a szeme mélykék. A lagúna élő víz. – De miért nem? – Úgy gondoljuk. Érdekes nézni. amely magán-vadrezervátumot épített Észak-Amerikában. az igaz. A Land Cruiser egy dombtetőn állt. Ez már-már szabály. ugyanaz Robert Muldoon az állatkertek területén: felülmúlhatatlan tudású és szakértelmű tervező. Kulcsait az ujja körül pörgetve. Majd kiesnek. Kenyában nőtt fel. Aki elnézte ezt a tájat. felnőtt tyrannosaurus. hanem az egész fejét a vízbe dugja. a bajsza acélszürke. hogy valóban évmilliókat utazott visszafelé. a súlya másfél tonna. úgy figyelnek. lehajló nyakát látták. – De akkor hol van? – Rejtőzik – felelte Regis. csak a cikászok halk zizegése hallatszott. – Várjanak csak egy kicsit! Halk. Muldoon jelölte ki a különböző állatok körleteit. Erdővel borított területre tekintettek le. De most nem látom. A veszély kedvéért jöttek! – Pontosan ez az. ha tehetné. nézi azokat az állatokat. Ezek nem látszanak. aki a vezérlőterem monitorát figyelte. ötvenéves férfi volt. – Illúziórombolásból jeles! – Mégsem hiszem. egy letűnt világba. rex területét teljesen körülzártuk árkokkal és kerítésekkel. – Félénk?– döbbent meg Malcolm. amelyek ott ittak. – Egy kicsit félénk. bégető hangot hallottak. – A kicsi? – Igen. Néha órákig áll a lagúnánál. majdnem mindig elbújik. A kicsit gyakran látni lenn a lagúnában. A mező közepén kis ketrec emelkedett a magasba. – Hol van a T. és akárcsak apja. a vízparton az apatosaurusok kecses. nem mehet sehová. azért. – Nézzék őket! – mondta Hammond. Alig győzik türelemmel. De a T. Szinte sosem látni kinn a szabad terepen. igaz? – hallották Ed Regis hangját a kocsik közti rádiótelefon hangszórójából. elhiheti. délebbre. a termete kétharmada a kifejlett példánynak. nagyvadak nyomában járó vadászok kalauzaként töltötte élete legnagyobb részét. Százhúszmillió éven át uralták dinoszauruszok a földet. zebrák és vízilovak területi . amely a lagúna széle felé lejtett. – Szeretek néha idejönni este. 1980 óta azonban főként természetvédelmi csoportok és állatkerttervezők tanácsadójaként dolgozott. Nem a kezét használja. de ebből csak az utóbbi tizenötmillió évben éltek tyrannosaurusok.” 1986-ban egy San Franciscó-i cégnél vállalt munkát. Kibámultak az ablakon. A lagúna felszínén rózsaszín félholdak himbálództak. Ez volt az első eset. kétéves. A kicsi megtanult halat fogni. egy kötél végén a mező közepén. Grant sóhajtott. Hidraulikus szerkezet emelte ki a föld alól. Regis nevetett. Puha fényben fürdött a Jurapark egész tája.

amitől Muldoon félt. A raptorok karámját is átépítették. hogy egyet is megöljenek. és orrukkal emelik fel az ajtózárat. Kimondott tehetségük van hozzá. mint például a majmok és az elefántok. Könnyedén meg tudnak szökni. jó? Grant a kocsiban várakozott. Az ajánlat egybeesett azzal a vágyával. hogy a dilophosaurusok mérgesek lehetnek. és az ablaküvegeket is acélráccsal erősítették meg. míg meg nem figyelték őket. csakhogy a vezetés nem engedte. a rothadás és bomlás már-már hulladéktelepi bűzét. Az eset után a vendégkastélyt átépítették: súlyos. hogy bizonyos állatok különösen hajlamosak rá. hogy némelyik dinoszaurusz túl veszedelmes ahhoz. – Amíg még idefent van. Muldoon puskákat is akart. lézervezérlésű rakétakilövőt. s ez gyakran szembeállította őt a Jurapark kaliforniai vezetőivel. és mintha csak arra születtek volna. Ráadásul erős tépőfogaik voltak. Némán figyelt. a fizetés pedig kitűnő volt. amelyeket most az ujja körül pörgetett. mint a csimpánzok. és sosem hagyták futni az áldozatot. egyes dinoszauruszok súlya pedig ennek a négyszerese volt. amelyik ki tudja nyitni a ketrecajtót. Aztán egyszerre csak megérezték a szagot. magas védőkerítéssel vették körül. oda-vissza rohangált. Azt is megjelölte. Ezek voltak a kulcsok. dobjon meg egy kólával. míg elpusztulnak. Muldoon meg volt győződve róla. de sikertelenül. erős futók és elképesztő ugrók. hogy dinoszauruszokat klónozni a laboratóriumban. Mások. Ezek után Hammond végre beleegyezett. az alagsorban. hol választódik ki a méreg. hogy megjelenjen a T. és különböző tárgyakat manipulálni. egy Tigrisvilág nevű indiai park Kasmírban. amelyet feléjük hozott a szellő a domboldalon. A munka persze érdekes volt. amelyről kiderült. Felfedezték azt is. amikor kisült. A jávorszarvasok állandóan megszöknek. A vezetés elszörnyülködött. hogy a dilophosaurus tizenöt-tizenhat méternyire is el tud köpni. és valóban kiszabadult egy. hogy még mindig túl keveset tudtak az állatokról. hogy kitörjenek a ketrecből. két különböző állatnál. – Hé! – kiáltott Dennis Nedry a sarokban lévő billentyűzet mellől. milyen állatokat lehet egymás mellett tartani. Ellie lehalkította a rádiót. hogy hét különböző toxikus enzimet tartalmaz. ha nemis voltak éhesek. És nem is fogja tudni. És a raptorok legalább olyan intelligensek. a vezetőség úgy döntött. ott várták. .igényeit és életkörülményeit. és kitálal a sajtó előtt. amelyeket egy zárt helyiségben tartottak. Öltek akkor is. már érdekesebb volt. amint a szigeten őshonos patkányokra vadásznak – megharapják a rágcsálókat. Minden állatkerti szakember tudja. Ugyancsak megdöbbent. És vállról indítható LAW-rakétákat. Miután ez felvetette a lehetőségét. Sokkal intelligensebbek voltak a többi dinoszaurusznál. egy harmadik pedig egy életre megnyomorodott. A két Land Cruiser a dombtetőn állt. Lázasan rángatta a kötelet. hogy köpni is képesek a mérget. környörgőbbre vált. Minden vadász tudta. Mellső lábuk egyetlen lendülete elég volt ahhoz. nekik is ügyes kezük van. különösen azzal a vakmerő kis diktátorral. mint az elefánt az ormányával. Az öles öröméért öltek. A veszély részben abból adódott. bólintott. aztán félreállnak. kompromisszumot kötöttek. igen – felelte neki valaki. hogy parki körülmények között tartsák. hogy kivizsgálják a dilophosaurus-mérget. Muldoon egy évre elvállalta a dolgot. és türelmesen kivárják. – Lemegyek – mondta. ösztönös vadászok voltak. Van. A rádiótelefonon át Grant Lex ijedt hangját hallotta: – Mi lesz a kecskével? Meg fogja enni a kecskét? – Gondolom. amelyek szakították a húst. A következő munkája. Aztán úgy egy éve ajánlatot kapott. hogy az örvös tatu notórius szökevény? Vagy a jávorszarvas? Pedig a jávorszarvas legalább olyan ügyesen nyitja ki a ketrecajtót az orrával. Ragaszkodtak hozzá. Amikor aztán bekövetkezett. És még akkor sem gondolt rá senki. Muldoonnak az volt a véleménye. hogy a park valójában génsebészeti úton előállított ősállatok gyűjteménye. rendkívül intelligens. Akkoriban ez már szinte rutinfeladat volt. az kétségtelen. Ezek született. Halálos karmok voltak mind a négy végtagjukon. hogy milyen nehéz egy négytonnás elefántot elejteni. míg az egyik ápoló kis híján meg nem vakult belé. De ki feltételezné. Gondjukat viselni a vadonban. hogy kiszabadítsák magukat. az egy dolog. hogy legyen a Jurapark fővadőre. Példának okáért még csak nem is gyanította senki. hogy otthagyja Afrikát. Miután Muldoon kijelentette. és melyeket kell elválasztani egymástól. hogy eltávolítják a méregzacskót. mint például a vaddisznó. Csakhogy afrikai évei alatt Muldoon megtanulta sajátos módon. amíg fel nem boncolnak egy dilophosaurust. Az állatorvosok kétszer is megpróbálták. két építőmunkás halt bele. hogy semmiféle fegyver nem lehet a szigeten. Végül is beszereztek két. az valami egészen más. Arnold. Villámgyorsak voltak. Senki sem tudta. rácsos kapukat szereltek fel. romantikátlanul nézni az állatokat. külön e célra készült. ahelyett hogy harapták volna. hogy szabályosan kibelezzen egy embert. A szobához csak Muldoonnak volt kulcsa. A kecske mekegése hangosabbra. Akár a velociraptoroknak. amelyek figyelmeztettek egy esetleges újabb szökésre. aki le nem vette a szemét a megfigyelő képernyőkről. Muldoon ennél is jobban aggódott a velociraptorok miatt. amellyel ajtókat tudnak nyitni. hogy akkor felmond. hogy némelyik látogató akár meg is vakulhat. és elektromos érzékelőkkel szerelték fel. aki most mellette állt a vezérlőteremben. Mint a csimpánzoknak. rex.

és megszaglászta a kecske tetemét. – No nézzük. nem közeledik-e egy másik ragadozó. az iszonyatosan nagy állkapcsokra és fogakra. hogy túl alacsonyan pásztáz a tekintete: az állat feje hat és fél méterrel volt a talaj fölött. A Land Cruiserre bámult. majdnem harminc méterre a fáktól. Malcolm hátradőlt az ülésen.Grant odasúgta: – Már itt a fiú! – A lány – javította ki Malcolm. – Vajon meddig fog még várni? – suttogta Malcolm. hogy bűntudatuk van. A Land Cruiserek elindultak. – Kitűnő! A tyrannosaurus ismét felemelte fejét. gyakran hirtelen óvatosak lesznek. óvatosan figyel. Hatalmas teste teljes egészében előtűnt.. – Itt marad – mondta Regis. Tévedés azt hinni. tépett húscafatok lógtak ki a szájából. – Hölgyeim és uraim: íme a Tyrannosaurus rex! – mondta a magnószalag. hogy megtámadja. mintha végül mégiscsak győzött volna az óvatosság. de Grant egy pillanatig semmit sem látott. Gennaro a homlokát törülte. – Valószínűleg egy másik tyrannosaurustól – súgta válaszul Grant. és átharapta torkát. – Mitől tart? – kérdezte Malcolm. és a balsiker gyakoriságát. mindenfelé figyelt. vagy elhurcolja a zsákmányát? A tyrannosaurus lehajolt. Aztán rádöbbent. A mai tudósok azonban a sikeres vadászattal járó erőfeszítést hozzák fel indokul – néha órákig kell türelmesen ólálkodni a végső támadás előtt –.. Talán. Az óriás állat azonban még mindig nem bújt elő a fák közül. Az óriás állat újból a kecske fölé hajolt. A tyrannosaurus állkapcsa csak egyet mozdult. A tyrannosaurus hirtelen tétovázni kezdett áldozatának teteme fölött. mint az oroszlán vagy a tigris. És a tyrannosaurus még mindig várt. Nagy lendületes lépéssel megtette az utat a kecskéig. A tyrannosaurus némán kiugrott a fák közül. Ez a tyrannosaurus is valószínűleg egy másik tyrannosaurus megjelenésétől tartott. – Hát persze – mondta a rádión át Regis. lehajolt. Hallották a csontok visszataszító roppanásait. előttünk fog-e enni. mihelyt elejtették áldozatukat. Csend lett. A tizenkilencedik századi zoológusok azt képzelték. hogy a nagyobb vadak kedvük szerint bánnak el a kisebbekkel. Súlyos. Aztán meredten nézte a Land Cruisereket odafenn a dombtetőn. és elvegye a zsákmányát. rángó mozdulatokkal forgatva a fejét. Malcolm csak suttogni tudott: – Jóságos Atyaúristen! Ez akkora. a préda legtöbbször elmenekül. – Öööu! – hallatszott Lex hangja a hangszóróban. és némán továbbhaladtak a növényzeten át. Nagy. mint egy ház! Grant a hatalmas. majd összerándult. Amikor aztán a húsevőnek sikerül leterítenie egy állatot. – Lát bennünket? – kérdezte suttogva Malcolm. és hangtalanul visszavitte a fák közé. nagy feje ide-oda forgott izmos nyakán. apró. – Mint egy madár – szólt Ellie. Ide-oda nézett. a tyrannosaurus fogai közé kapta a kecske maradványait. . A kecske a mező közepén volt kikötve. Sápadtnak látszott. Félig eltakarták a pálmafák felső ágai. A mekegés elhallgatott. négyszögletes fejre meredt. A nagyobb húsevők. – Talán két-három percig. másfél méter hosszú. Az egyik hatalmas hátsó végtag leszorította a tetemet. míg a fogak tépni kezdték a húst. – Hát ez fantasztikus! – mondta. amiért öltek. – De gusztustalan! Aztán. Aztán rágni kezdett. kinyílt.

Jóval kisebbnek látszottak a másik fajtához képest. hogy egyetlen ilyen állat súlya nagyobb. hogy mindenki a sötétben ül. Ezek voltak az elektromos kocsik. mi lesz a vége – mondta. Úgy terveztük és állítottuk elő az állatokat..A VEZÉRLŐ Henry Wu arra lépett be a vezérlőterembe. amely konkrét rendellenességet okozott a fenotípusban: egy enzim nem indult be vagy egy protein nem nyílt ki. mint ahogy a parkot magát is megterveztük.. és lement a lépcsőn. ezúttal az őshüllő-ingovány közelében. Nincsenek ellenőrzési hiányosságok. Muldoon kiszállt a liftből.. Nagy apatosaurus-csorda legelészett a lagúna partján.. Amint maga mögött hagyta a garázst. – Lóg az eső lába – mondta az égre pillantva Ed Regis. hogy nekimenjenek a kocsiknak. A sarokban állt egy vörös sávos dzsip. Van egy elmélete. – Miért. hogy a park lényegében tökéletes. – . hogy képesnek tartsák rá: segédkezet nyújt egy olyan rendszer kiépítéséhez. és rádión át érkező hangokat hallgatja. Bármilyen probléma jelentkezett is a DNS-nél. a dzsip hátsó ülésére tette a fegyvert. Az ég szerelmére. hogy az bezárassa a parkot. – Nincs az az isten. – Ez a Malcolm – mondta keserűen Hammond.. hogy a Jurapark problémái sem alapvető problémák. De ő inkább beledöglik. a két benzinnel működő autó egyike – a másikat az állatorvos. – Uramatyám. hogyan sül el ez az egész. egyszerűen nem fordulhat elő. mindig sikerült megoldani viszonylag kis módosítással a következő verziónál. majd visszatértek a látogatóközpontba. Csak az apatosaurusok sokkal nagyobbak. Bent fegyverállványok sorakoztak. Miután becsukta az ajtót maga mögött. ha belegondolok. mintha pléhdobozban beszélne. A Land Cruiserek újra megálltak. Hammond szólalt meg a vezérlőteremben: – A fene egye meg! Miért ilyen negatívok mindannyian? – Még mindig arról beszélnek. ahol ilyesmi egyáltalán megeshet. Okozhat gondot. brontosaurus – mondta a felvett hang –. hát ez itt csak egy állatkert. – Ez az oka mindennek! Kezdettől fogva ellenünk volt. hogy a természetet nem lehet utánozni.. de a tudományban apatosaurus az elnevezésük. Vagy botrányt csinál a San José-i kormánynál. hogy vonják vissza a pénzüket. amelyek végtelen láncot alkotva bejárták a parkot. mi a baja. Malcolm kiemelt egy Randler gyártmányú..Jézusom. mert az valamilyen ismeretlen okból visszariasztotta a triceratopsokat attól. ugyanúgy.. Talán látják. – Hatalmas. Várjuk meg. vállra emelhető rakétakilövőt és egy doboz gáztartályt. Másik hóna alá két szürke rakétát dugott. ha egy állat kiszabadulna? – kérdezte Wu. A fegyverterem ajtaján nem volt semmiféle jelzés. Muldoon elment a dzsip mellett. Ugyanígy tudta azt is. amelyek bárhová eljuthattak a parkban. – Mi hiszünk a parkban. – De megkísérelheti. odabólintott a földszinti őrnek. csak bebizonyíthassa az elméletét. hogy a komplex rendszerek nem működhetnek rendben. a hátsó fal felé. – Várjuk ki. ami megállítsa! – Nincs bizony. hogy a hadrosaurusok a valóságban egy cseppet sem kicsik. – Vállat vont. Wu lelke mélyéig meg volt győződve afelől. nem? Tele van velük a világ. mint egy egész csordányi mai elefánté együttvéve.. Ami azt jelenti. Több kacsacsőrű hadrosaurus is volt ugyanazon a részen. Arnold elnyomta a cigarettáját. Csak azt remélem. Hosszú nyakukon ülő kicsiny fejük tizenöt méternél is magasabbra nyúlt. hogy mindent kézben tartunk. és természetes ellenfelei sincsenek. hogy egy állat megszökjék. nem sikerül úgy ráijesztenie Gennaróra. Nem tudom. hallotta a mennydörgés távoli moraját. Látniuk kellett. – Nem értem. ahogy az ő paleoDNS-e is az. megteheti? – kérdezte meglepetten Wu. Olyan súlyos dolog. – Dehogy – felelte Hammond. amelyeket most látnak. Vagy két tucat Land Cruiser töltötte meg az alagsort. és rávenni őket. Wu egyenesen sértőnek találta. – Azoknak a nagy állatoknak a közismert neve. Megpróbálhat ráijeszteni a japán befektetőkre. Több mint harminc tonna a súlyuk. Harding vitte el még reggel –. A pálmafák felső ágainak leveleit rágcsálták. és szélesre tárta a súlyos ajtót. Azért festették rájuk az átlós vörös sávot. Bármi volt is a nehézség. tudják jól. Úgy szólt a hangja a hangszóróból. Kulcsával kinyitotta. Tim persze tudta. ha egy ilyen állat egyszer kiszabadul! – mondta Gennaro. hogy az általuk . az alapjában véve mind a kód megjelölhető problémája volt. és mind jól működik.. még az állatok közé is. mi lenne.

amit a könyvekben állítanak. Észre sem veszik a csodát. ahányszor csak felmásztak a fákra. amelyeket most látnak. Arnold bólintott. – De én láttam! Állítsák meg ezt a kocsit! A rádiótelefonban hangzavar hallatszott. – Én csak egyetlen dolgot kérdeznék tőled ezzel a raptorral kapcsolatban. már kikelt állapotban helyezték a többi közé néhány hónappal ezelőtt. itt Malcolm professzor – vágott közbe egy hang a rádiótelefonon át. mint az a bébi. – Lehetetlen. – Azonnal állítsák meg a kocsit! – Mi az? – kérdezte Ed Regis. és úgy vizsgálják végig. Tim pedig visszanézett a hadrosaurusokra. Hirtelen az egyik szélen halványsárga állatot látott felvillanni. – Ebből a jellegzetes növényevőből több példány is él itt a Juraparkban. – A fiatal állatokat. – De fiatalabb.frekventált terület a lagúna mentén nem mocsaras. A nagyok szájából kihulló levelek után kapkodtak. – Szerinted mit láthatott a gyerek? – Szerintem is csak oti lehetett. Roppant gyorsan mozgott. Nagy méretükhöz képest kecsesen mozogtak. amint a hír elindult Granthoz és Malcolmhoz. – Csak előre tudunk menni. mint a felnőttek a karámban. – Tim azt mondja. Mit mondanál. A vezérlőben Arnold Wuhoz fordult. – Kattant a rádiótelefon. Ez körülbelül feleakkora. mennyi bajunk van velük! – Én pedig tudom. lóg az eső lába – ismételte Ed Regis. mekkora lehetett? – Idősebb. Egyesek szerint pedig az ultrasaurus és a seismosaurus még a brachiosaurusnál is nagyobb. mint a könyvelők! Eleve csak hibákat keresnek. annyi időt töltenek a fákon. hogy ők is hozzájussanak a levelekhez. – Nem – felelte Regis. Tim nem is vette a fáradtságot. az az. a stegosaurust – mondta a magnóról a hang. Azok kétméteresek voltak. – Az nem lehetett raptor. hogy kijavítsa. A számítógép folyton el-elvesztette őket. hogy raptor volt – mondta makacsul Tim. Az ég sötétebb lett. hogy felépítjük ezt a csodálatos parkot. Barnás csíkok voltak a hátán. majd újra lejöttek. – Éhes vagyok – szólalt meg Lex. – Nem lehet visszamenni? – kérdezte döbbenten Grant. – Nem tudjuk rákényszeríteni. – Amit egyszerűen képtelen vagyok felfogni – szólt Hammond –. és Arnold lassú beszédet hallott: . – Gyorsan! Állítsák meg a kocsit! – Most pedig tovább haladunk. amely mintegy százhetvenmillió éve fejlődött ki – mondta a hang. – Hé! – kiáltotta. aztán megjönnek a legelső látogatóink. – Sajnálom. nem úgy. A száraz földet kedvelik. én nem hiszem – mondta Ed Regis. – Biztos vagyok benne. Biztos valamelyik oti volt. – Hol? – Az előbb a mezőn. – Nehézségeink vannak az otik követésével. A kocsik programozva vannak. Mennydörgés zaja morajlott fel. lejjebb ereszkedett és fenyegetőbbnek tűnt. Azok rendszeresen átugranak a kerítésen. Tim. raptort látott. Lex – mondta Ed Regis. ez egy olyan szellemvasútféle. a brontosaurusok kerülik a mocsarakat. A seismosaurus súlya akár száz tonna is lehetett! Az apatosaurusok mellett a hadrosaurusok a hátsó lábaikra állva ágaskodtak. – Menjünk vissza. Egyszerűen nem lehetett az.. – Az az ő bajuk – mondta Arnold. – Mondtam. Sírdogálni kezdett. Ha tudnák. – Csak egy másodpercig láttam – mentegetőzött Tim. és nézzük meg! – Azt nem lehet – mondta Ed Regis. – Láttam! Ott a mező közepén! – Mit? – Egy raptort! Ott a mezőn! – A stegosaurus közép-jurakori állat. A felnőtt állatok körül több kis hadrosaurus ugrált. – Ugyan. A kocsi megindult. Ellentétben ugyanis azzal. – A brontosaurus a legnagyobb a dinoszauruszok között. hogy nem raptor volt – mondta Ed Regis. – Remek – mondta Malcolm. – A Jurapark dinoszauruszai nem szaporodnak – magyarázta a hang. – Tim.. A felnőttek azonban ennek ellenére gondozzák őket. mint a többi állat. hogy át is éljék a csodát. Azonnal felismerte. hogy megtekintsük az utolsó történelem előtti állatot. A valóságban a brachiosaurus háromszor akkora volt. amit ma láttunk – válaszolta Tim. meg újakat talált. – Az otik kivételt jelentettek a percről percre való megfigyelés alól. ezt a fantasztikus látványosságot.

– Küldje őket el innen! – Megadjuk az engedélyt a távozásra. Valami berendezés. ha eloldozhatnánk a köteleket.. addig meg hajó sem köthet ki. a hullámzás odacsapdossa a hajót a dokkhoz. Biztosan megállnak. Lenyomta az adógombot. mielőtt túlságosan megnő a hullámzás. de gondolom. – A sziget déli csücskén nagyobb volt a vulkánikus tevékenység. – Viszlát két hét múlva! – mondta a hang. John. a dokkban horgonyzó hajó látszott. – Most hol vannak? – kérdezte Hammond. Anne B – szólt bele a rádióba Arnold. hogy újra használható legyen. amelyen a sziget keleti oldalán. . Szeretnék lelépni. plusz a kikötő megtisztítása. John. Akkor aztán a többi költség is a maga nyakába szakad. – Az lehet – mondta Arnold. Még nem fejeztük be a kirakodást. – Úgy látom. Arnold visszafordult a fő konzolsorhoz. A hajó pótlása. mint az északin.. jobb lenne. hogy mindjárt a stegóknál lesznek. A videomonitoron látták. Tudod. Magam is láttam. a déli mezőkön – felelte Arnold.. Hammond lemondóan legyintett. – Engedélyt kérsz a távozásra? – Igen. még várhat két hétig. amint a legénység a fedélzeten eloldozza a köteleket. mit csinál Harding. – Ami azt jelenti. hogy nem horgonyzunk biztonságban. itt az Anne B a dokkban. és szükségem van rájuk. Volt már rá eset. – Nekem kell az a berendezés – szólalt meg Hammond. Arnold bekapcsolta a videomonitort. A Land Cruiserek éppen gőzt pöfögő mezőkön haladtak át. hogy lássák. Jim? – Már csak a három utolsó konténer. – Arra viszont sajnálta a pénzt. hogy egy hajó így süllyedt el. Nem ellenőriztem a listát. de ahogy tőlünk délre ezt a viharzónát elnézem. Ha nő a vihar. – Laboratóriumi dolgokról van szó.. és százötven kilométerre vagyunk a parttól.– Ööö. – Mennyi van még hátra. Így aztán nincs jó kikötőnk. hogy vihargátat építsenek a móló védelmére.

Tiszta folyadék ömlött ki a felszakadt hólyagokból. – Érzéstelenítette a stegót. – Megengedi? – kérdezte Ellie. Hátranézett. Megkaparta körmével a nyelvet. méteres tüskék álltak ki a farkából. ahol Grant és az állatorvos a földön térdeltek. az orvos lenyugtatózta. – Igen. – Döbbenetes! – mondta. Beteg. mint egy igen buta lóé. és a két gyerek kiugrott belőle. – Ellie már előbb megérezte a stegosaurus különös szagát.A STEGOSAURUS Amint a Land Cruiser megállt. Az el-elkeskenyedő nyak végén azonban képtelenül apró fej ült. Harding. – És ez farmakológiai hatás. – Egyensúlyzavarok. Az biztos. Elvette a zseblámpát az állatorvostól. amit ismert. – Csakhogy ez a pupilla ki van tágulva – mondta a biológusnő. – Ellie. Harding is megnézte. a hátán vízszintes páncéllemezek. mert beteg? – kérdezte Lex. Állandóan legelésznek. hogy stegosaurust még soha nem szagolt. Ellie a gőzoszlopokon át szemügyre vette a stegosaurust. Ellie is kiszállt. dezorientáció. de sehogyan sem jutott eszébe. – Körülbelül hathetenként előveszi őket. meg sem mozdult. A legtöbb növényevőnek nincs erős szaga. Nyugodtan állt. mi az. Rothadó halra emlékeztette. ez tényleg nagyon különös állat – mondta Malcolm. A stegosaurus hét méter hosszú volt. Grant már kinn is volt a kocsiból. Veszedelmesnek látszó. A nagy. hogy egyáltalán létezni tudjon. – Pontosan – mondta erre az állatorvos. A pupilla összeszűkül. – A nyugtatónak van hatása a pupillára? – kérdezte. nehéz légzés és súlyos hasmenés – mondta Harding. a tekintete üres. De afelől kételyei voltak. Vörös csíkos dzsip parkolt mellette. – Folyamatosan táplálkoznak? – Hát persze – felelte Harding. azért nem mozog. – Örökösen betegek. – Nem tudják biztosan – mondta Ellie. És ne feledd. – Lehet. – Akkor nem valószínű. . Miotikus hatása van. dagadt. Lex felhúzta az orrát. Egy férfi jött elő az állat mögül. ha mérgező növényt enne. – Ez tényleg jó nagy – mondta. Nemcsak hathetenként betegedne meg. – És mik a szimptómák? – kérdezte Ellie. az állatorvosunk – szólalt meg Ed Regis a rádióban. amint a második Land Cruiser is megállt. – Egy ekkora állatnak napi két-háromszáz kilónyi anyagot kell elfogyasztania. – És hogy szaglik! – Tényleg szaglik. – Egy állandóan legelésző állat folyamatosan beteg lenne. Igazi bűzzel csak húsevők büszkélkedhetnek. Semmi kétség: a stegosaurus pupillája kitágult. Meg valami másra. pergamenszerű lemezek a hátán enyhén lefelé lógtak. – Fuj! – mondta Lex. nehézkesen lélegzett. és a stegosaurus szájába bámultak. – Nem fertőző? – kérdezte Lex. A bordó színű nyelv bágyadtan lógott ki az állat szájából. Az ürüléknek sem. nézd meg a nyelvét! – szólt Grant. Az állatorvos ráirányította lámpáját. s a mozdulatlan stegosaurus felé igyekezett. Talán ez a jellemző szaga. a teste hatalmas. – Ez dr. ezüstös hólyagokat. Lassan. – Az bizony – mondta Ellie. – Mekkora területen mozog az állat? – Úgy tizenkét négyzetkilométeren. – Apró vízhólyag – mondta Ellie. – Azért büdös. és a rávetődő fényre sem húzódott össze. – Érdekes. s minden lélegzetvétellel valami nedves hangot adott ki magából. – Rengeteg bajunk van ezekkel a stegókkal – mondta az állatorvos. – Mi a baja? – kérdezte Tim. Előrementek az állat apró fejéhez. hogy Ellie is jól láthassa a finom. hogy növényi mérgezésről volna szó – mondta Ellie. – El kell ismernem.

– De nem jut semmire – mondta Ellie. Amitől megbetegszenek. Ellie a földet vizsgálta. A Melia azederach. közben legelnek. s ezeket az emésztő csatornába lévő kis. – Találsz valamit? – kérdezte Grant. A kislány olyan erővel dobta vissza. hogy közelebbről is megvizsgálja a növényeket. hogy elrágták volna az ételt. és Gennaro odadobta neki a labdát. és időnként gőzoszlopok emelkedtek a magasba a földből. Sok madár és krokodil kis köveket nyel. valahonnan a távolból. „Érdekes rejtély!” – gondolta Ellie. De ezt soha nem sikerült bizonyítani. hogy igazad van. – Ha ezt nem tudnám. – Csak köveket – mondta. Állandóan figyeljük őket a kamerákkal. – Igaza van – mondta. – Elindult a mezőn. hogy a dinoszauruszfogak túl kicsik voltak. pupillatágulás. Teste a talaj fölé hajlott. Semmi jele. Ezek a kövek kis halmokban álltak. Kisebb kőhalmok voltak rajta szanaszét. hogy ettek volna belőlük. – Milyen gyakran jönnek ide a stegosaurusok? – Körülbelül egyszer egy héten – mondta a férfi. – Tudjuk. De az állatok nem eszik. hogy az állatok egyben nyelték le az ételüket. s ezzel a könnyebb emésztést segítik. Semmi a világon. hogy az állatok csak a bogyókat eszik. – Igen. ilyen kis halmokban hagyják. – Nem dobálna velem valaki egy kicsit? – hallotta Lex hangját a háta mögött. és távolabb ment a réten. Lehet. Erre utalt. állítanám. mert mind simák. – „Mi magyarázhatja a szabályos időközönkénti mérgezést?” – Látja azokat az alacsony. törékenynek tűnő bokrokat? – Nyugat-indiai orgona – bólintott Harding.. Ezeket a köveket lenyelik. – Igen. hogy mérgező. – De unalmas! – szólalt meg Lex. A nyugat-indiai orgona bogyója éktelenül keserű. kövekkel. amit zúzának hívnak. Aztán hirtelen abbahagyta. ezért felkérődzik őket. és túl kevéssé kopottak. már tudta is. A kövek közt bogyókat látott. – Az állatok nem eszik – ismételte az állatorvos. Zúzakőhalmok. mi az. És velük együtt lenyelnek bogyókat is. de ennek semmi köze sincs az óceánhoz. – Fura kis halmokat? – kérdezte Grant. – A növények épek. – A stegók lassú hurkot írnak le a lakóhelyük táján. azaz a nyugat-indiai orgona több mérgező alkaloidát is tartalmaz. hogy az állat a Melia-mérgezés összes klasszikus szimptómáját együtt mutatja: eszméletvesztés. – Biztos? – Igen. többnyire mindig éppen ezen a területen vannak. de mintha csak úgy lehajigálták volna őket oda. Balról. és a zúzakövek bontották le a növényi rostokat. – Viszont csak hathetenként betegszenek meg. Mintegy követte paleontológusi ösztönét. – Közel lehetünk a parthoz.. Mindenütt. hullámverés hallatszott. – Zúzakövek – morogta Grant. de a biztonság kedvéért többször leellenőriztem az ürüléküket is. – Nézd csak ezt! – Ide. Megnézte a kőhalmot. A kövek valóban lecsiszolódtak. Nehéz elképzelni. – Sattler doktornő gondolkodik. – És még ott a hathetes szünet – emlékeztette az állatorvos. Mihelyt rámutatott. aki csatlakozott hozzá. – Legalábbis észak és kelet felé mozognak innen – mondta Harding. végigsimította a köveket a kezével. A zúza izmainak mozgása révén a kövek összezúzzák a kemény növényi élelmet. És fura kis halmokat alkotnak. mielőtt az elérné a gyomrot. A stegók sosem esznek az orgonabokrokból. Egyes csontvázakkal együtt találtak is kis kőhalmokat az abdominális rész közelében. – De ahányszor megbetegednek. Ezért feltételezték. nyálkahártyák hólyagosodása. – Csuda! – mondta Grant. – Úgy van – mondta Harding. A kínaiak halméregként használták a növényt. A rét itt-ott köves volt. öregem! Ne kímélje a kesztyűt! – kiáltotta Lex. és új köveket nyelnek. Ott is van egy halom – mutatott rá az egyikre Ellie. izmos zacskóba gyűjti.– Nagyjából ezen a környéken? – kérdezte Ellie. Ez viszont értelmetlennek tűnik. Késő délután volt. – Érdekes – mondta Ellie. azt hiszem. – Biztos vagyok benne. és. aztán néhány hét múlva kisimul a felületük. – Ellie – szólt. hogy megcsípte Gennaro kezét. – Ssss! – szólt rá Tim. az ég rózsaszín az egyre lejjebb szálló szürke felhők alatt. Ellie sóhajtott. Egy hét alatt járják be. Egyes tudósok szerint a dinoszauruszoknak is volt zúzájuk. Nyílt réten álltak. .

Fájdalmasan. Ez volt a tudósok dédelgetett álma Newton óta. mindent kiszámíthatsz. Hammond bólintott: – Tudtam. Az időjárást sosem lehet egy-két napnál hosszabb távra megjósolni. Ha eleget tudsz. De úgy látszik. hogy egyáltalán alapozni kezdtek itt. Új területekre terjed át. Az élet kiszabadul a korlátok közül. amelyek lényegüknél fogva kiszámíthatatlanok. más a napsugárzás. Nem alkalmazkodott a mi világunkhoz. hogy előbb-utóbb megfejtjük ezt is mondta. úgy látszik. hogy lássa. és hallotta. Ez a stegosaurus százmillió éves. – Én minden információt jóval azelőtt megadtam Hammondnak. Ma jót nevetünk azon. Megkíséreltük a lehetetlent – és jó sok pénzt is pocsékoltunk rá. de az élet mindig utat keres és talál a maga számára.. mivel próbálkoztak valaha az alkimisták. Csak nem fog terv szerint menni. – Miről van szó? – kérdezte Muldoon. Egyenesen a monitorhoz ment.. – Rajtam nincs kesztyű! – Anyámasszony katonája! – mondta megvetően a kislány. Harding hangját hallotta a rádión át. Minden más. Ez a szerencsétlen állat olyan állapotban van. megvan az oka. – Egyáltalán van. – Ehhez az én személyemnek semmi köze. Mert a jelenségnek egész osztályai vannak hatalmas kategóriák. Csakhogy azok meglehetősen akadémikus elméletek. hogy ha van egy komputerünk. Muldoon válaszra sem méltatta. – Ezért olyan rossz a vétel. Gennaro ingerülten rázta a fejét.– Hé. Lényegénél fogva kiszámíthatatlan. – Maga ezt mondta neki? – csodálkozott Gennaro. hogy a park nem lehet képes az életformák kordában tartására. – Malcolm megrázta a fejét. Mindjárt átváltok egy másik csatornára. – Igen. Valami bogyót esznek. ne olyan vadul! – mondta. Ősállatot akar létrehozni. és egy szigeten akarja elhelyezni őket? Szép álom! Bűbájos. Azt mondja. mert egyes matematikusok – mint például Neumann János – úgy gondolták. Gennaro mérgében visszavágta a labdát. amiről mindenki annyit fecseg összevissza. – Előre látható volt ez is – mondta Malcolm. Ez a káoszelmélet.. Filozófiai jellegűek. Gennaro a dinoszaurusz mellett állva tovább folytatta a labdahajigálást. mintha ólmot akarnánk arannyá változtatni. – Nem akartam filozofálni. hol jelentkeznek majd az eltérések. Nyilvánvaló. nagy vonalakban. hogy az állatok egészsége az egyik ilyen terület. akkor képesek leszünk előre meghatározni az időjárást. amint Muldoon visszatért a vezérlőbe. semmilyen körülmények között nem lehet előre kiszámítani. egy olyan gép. más a föld. hogy milyen kevesen hajlandók odafigyelni rá – mondta Malcolm. Mint az időjárás. – Ez már valamivel jobb – mondta Lex. Más a levegő. – Hozott kólát? – kérdezte Nedry. hogy bizonyos jelenségeket soha.. Hallgassa csak. hogy zihál! – És a többi terület? – A dolog lényege.. Már észrevettem. hogy rajtunk ugyanígy fog nevetni a jövő nemzedéke. Az egész evolúció lényegében arról szól. Tudja. – . talán veszedelmesen is. amint belecsapódik a kesztyűbe. hogy senki sem hajlandó végighallgatni a matematikai következtetéseket. mi történik. miért építették eredetileg a számítógépeket? – Nem én – felelte Gennaro. Ellie és Grant a mező túloldalán kiabált és integetett. az előrejelzés csupán a dolgok követésének funkciója. ami nem látható előre a maga elmélete alapján? – Nézze – mondta Malcolm. – Szóval ez a káoszelmélet? – Igen. A káoszelmélet viszont a mindennapi életre vonatkozik.. mások a rovarok. Merő bolondság az egész! Ugyanolyan értelmetlen. És miért nem? Mert rendkívüli a jelentőségük az emberi élet szempontjából. amely egyszerre sok változóval képes dolgozni. – Odalenn vannak a déli csücsökben – mondta Arnold. és hihetetlen. Az oxigéntartalom csökkent. más a növényzet.a stegó. mint egy ember háromezer méter magasság fölött. Sokkal nagyobb. és most tessék! Gennaro hátrafordult a hangra. mint a Heisenberg-féle bizonytalansági relációé vagy Gödel teorémájáé. . de közben Malcolmhoz beszélt: – No és ez a beteg dinoszaurusz hogy illik az elméletébe? – kérdezte. végre. és meg sem fordul a fejünkben. – És? – A káoszelmélet ezt az egészet kihajítja az ablakon. hogy az élet minden akadályt leküzdve tör előre. Sőt azt is megmondtam. rájöttek. Az emberi elme végre megfejti az időjárás rejtélyét! Azt hitték. Azt a rengeteg pénzt. ez. amit a hosszú távú időjárás-előrejelzésre költöttek – vagy félmilliárd dollárt csak az elmúlt néhány évtizedben – egyszerűen elbocsátották. – Gyerünk már! – sürgette Lex. mi a baj a stegókkal. – Azért hozták létre a számítógépeket az 1940-es évek végén.

– De hát nem szaporodhatnak! Lehetetlen! – makacskodott Harding. Hacsak nincsenek struccok is itt a szigeten. hogy ez dinoszaurusztojás – felelte Grant. felfelé hajló vonalmintázatot lát rajta. melyik fajé? – Igen – mondta Grant. a belső hajlás. – Több tucatnyi madárfaj él itt a szigeten! Grant a fejét ingatta. Alan? – Száz százalékig – felelte Grant. – Ez egy velociraptortojás. Mintha háromszögformákból állna. – Látom. hogy igen nagy tojásról van szó. . – Nézze meg a hajlatát! A héj már-már lapos. Malcolm is megszólalt: – Azt is meg tudja állapítani. – Nos. – De a dinoszauruszok nem képesek szaporodni! – A jelek szerint mégis képesek – mondta Gennaro.– Nem túl meggyőző – jegyezte meg Gennaro. Ujjhegyén a halványuló fény felé tartotta a posta bélyegnél nem nagyobb. halvány. Ami azt jelenti. – Biztos benne. – Minden állat nőstény! – Én csak annyit mondtam. Teljes bizonyossággal. ez bizony dinoszaurusztojás. ez dinoszaurusztojás héja? – Igen. – Ez biztos csak egy madártojás – mondta erre Harding. Ha megfordítja. Harding megrázta a fejét. – Szóval azt mondja. – Elárulja a belső felület mintázata. nemrég ástam ki két ilyen mintázatú tojást a montanai lelőhelyemen. fehér töredéket.

1 3. mint mindig! – Hammond alig tudta titkolni megelégedettségét.3 3. Összeráncolta a homlokát.A VEZÉRLŐ – Teljes képtelenség! – fakadt ki Hammond a vezérlőteremben. – Helyes – mondta Malcolm.0 3.1 ?? 3.3 4. – Egy pillanat – mondta Arnold.0 3.9 4. Ha jól értem. – Jól látszik a maguk monitorán is? – Látjuk – mondta Malcolm.9 3. ha lehet. Tegye meg. Egyszerűen nem lehet más! A rádió reccsent.0 3.9 4. – Akkor azt is látják.9 3. Arnoldot.1 Hammond kiegyenesedett ültében.1 3. hogy minden állat megvan. .1 3.3 4. rá tudja adni a Harding doktor kocsijában lévő monitorra is. – Akkor tudna keresni a gép más állatszámot is? – Mennyire gondol? – Legyen mondjuk eggyel több.1 3.9 4.3 2. Egy pillanat múlva a vezérlő képernyőjén megjelent a kiírás: Állatok összesen Faj Tyrannosaurus Maiasaurus Stegosaurus Triceratops Procompsognathida Othnielia Velociraptor Apatosaurus Hadrosaurus Dilophosaurus Pterosaurus Hypsilophodontida Euplocephalida Styracosaurus Microceratops Összesen 238 Várt 2 21 4 8 49 16 8 17 11 7 6 33 16 18 22 238 Talált 2 21 4 8 49 16 8 17 11 7 6 33 16 18 22 238 Ver 4. Egy pillanat múlva a gép kiírta: Állatok összesen Faj Tyrannosaurus Maiasaurus Stegosaurus Triceratops Procompsognathida Othnielia Velociraptor Apatosaurus Hadrosaurus Dilophosaurus Pterosaurus Hypsilophodontida Euplocephalida Styracosaurus Microceratops Összesen 239 Várt 2 21 4 8 49 16 8 17 11 7 6 33 16 18 22 238 Talált 2 21 4 8 50 16 8 17 11 7 6 33 16 18 22 239 Ver 4.1 3. – Az csak madártojás lehet. Malcolm hangja szólalt meg: – Tegyünk egy kis próbát.0 3.9 4.9 3.1 4. miután hallotta a jelentést a rádión.1 3.3 3.1 4. jó? Kérjük meg Mr.3 2.1 – Remélem.1 3. futtassa le az állatszámlálást. Kétszázharminckilenc. most azonnal. elégedett – szólt Hammond. kérem! – Semmi akadálya – mondta Arnold. – Most? – Igen.

HIBA: Keresett param. hogy nem is lehet több. – Kutya legyek. Állatok összesen 244 – Kettőszáznegyvennégy? – kérdezte döbbenten Hammond. – De honnan? – Fogalmam sincs. hogy keressen nekünk. háromszáz állatot? – Mit beszél ez? – kérdezte Hammond. hogy az operátor adott számú állatot tápláljon be és csak annyit keres. Mit beszél? – Egy pillanat – mondta Arnold. hová akar kilyukadni ez! – mondta idegesen Hammond. – Igazat beszél – mondta Arnold. igaz? – Igaz – felelte Wu. – Mi folyik itt? – A gép számolja az állatokat a parkban – mondta Wu. hogy meggyorsítsuk a számlálást. mennyi lesz még? Aztán a kislány hangja hallatszott: – Éhes vagyok! Mikor megyünk már haza? – Nemsokára. mondjuk. – A gép engedi. A hangja emelkedett. hogy hibának kell lennie valahol. – Gombokat nyomott a monitoron. De úgyis hamarosan megtudjuk. Az ernyőt figyelte. mit. vagy mit tudom én. Arnold. Egy pillanat múlva azonban a gép írni kezdte: . – Nedry! Már megint elszúrt valamit? – Én ugyan nem – mondta billentyűi mellől Nedry. Állatok összesen 239 – Nem értem. ha tudom – felelte Wu. – Háromszáz állatot. – Ehhez kell egy-két perc. – Ezek az állatok nem képesek szaporodni. – Nos. én igen – szólt Arnold. – Mi egyszerűen csak azért használtuk mindig a kétszázharmincnyolcas alapszámot. – Majdnem biztos. Állatok összesen 262 – Várjanak már! – szólt Hammond. Mr.– Hát ez meg mi az ördög? – Előkerült még egy kompi. Lex. hogy mindig is azt tette! – Hirtelen megpördült a székével. De ez puszta kényelmi lehetőség. Nézték ahogy a szám tovább emelkedik. – Az összes állatot. 300 állat nincs – Hiba! – bólogatott Hammond. – Nem képesek szaporodni. – Gondoltam! Én mindvégig éreztem. Állatok összesen 283 Gennaro hangját hallották a rádióból: – Atyaúristen. hogy valami hiba van a vizuális követéssel. – Én úgy tudtam. Hibajelzés villogott a képernyőn. A gép biztosan mezei egereket számol. – Félek. Aztán megjelent az első össz-szám. A rádió recsegett. Hammond Wuhoz fordult. mert abból indultunk ki. A számok az első sorban futni kezdtek. akkor megkérné mélyen tisztelt számítógépét. nem hiba. Állatok összesen 270 – De hát honnan jönnek ezek?! – kérdezte Arnold. – Én is ilyesmire gondolok – mondta Arnold.

hányat bocsátottunk ki. Henry – mondta Malcolm. ha a vártnál kisebb a szám.0 3. Arnold majd lehívja magának. a saját adataik is ezt igazolják. A probléma az.3 ?? 4. Attól tartottak. amennyit vártak.1 Reccsent a rádió: – Íme a hiba az eljárásukban! – hallatszott Malcolm hangja.1 ?? ?? ?? 3.9 3. Annál pedig nem lehet több. amennyinek a jelenlétére számítottak.3 4. ezért úgy tervezték az eljárást. Csakhogy a probléma nem ez.1 3.1 4.. – Önök csak annyi dinoszauruszt követtek. – Abszolút normális. hogy azonnal tudomást szerezhessenek róla. – Tudjuk. hogy több van. – Sajnos mégis több van. – Ilyet: . hogy három „tételben” vittek be a három különböző időpontban kikelt állatokat? Hat hónapos időközönként? – De. amely három csúcsot mutat a három különböző generációjú csoportnál. – De nem lehet több! – szólt közbe Wu.9 4.. – Nem! – Még ha nem is fogadja el Grant doktor tojáshéját bizonyítékul. – Úristen! – nyögte Arnold. – Nem vesz észre rajta semmi különöset? – Poisson-féle megoszlás – mondta Wu.Állatok összesen Faj Tyrannosaurus Maiasaurus Stegosaurus Triceratops Procompsognathida Othnielia Velociraptor Apatosaurus Hadrosaurus Dilophosaurus Pterosaurus Hypsilophodontida Euplocephalida Styracosaurus Microceratops Összesen 292 Várt 2 21 4 8 49 16 8 17 11 7 6 33 16 18 22 238 Talált 2 22 4 8 65 23 37 17 11 7 6 34 16 18 22 292 Ver 4. hogy elveszíthetnek állatokat. Nézze csak meg a kompik magassági grafikonját. amely kikerült – mondta Malcolm a billentyűket ütögetve. – Szaporodnak. mint amit vártak. – Hát ez az! Nem maga mondta.1 ?? 3. – Akkor olyan görbét kellett volna kapniuk.

Wu szinte ráförmedt: – Mit beszél? Tisztában van azzal. a hipszik – és a velociraptorok! – Úristen! – kiáltott fel Muldoon. Itt valami tévedésnek kell lennie. Henry! Ez a maga műve! – De hát ha egyszer mind nőstény! – mondta Wu. hogy a szigeten szaporodnak az állatok. – Pedig szaporodnak.– Csakhogy maguk nem ilyen görbét kaptak – folytatta Malcolm. Henry – felelte Hammond. azért ez még nem a világ vége – mondta Hammond.. – Ezek a számok szerintem is alátámasztják. És nagy növekedés a kisebb állatok számában. – Nem értem. A kompik szaporodnak! Wu a fejét ingatta. öt kategóriában. – Azt jelenti. a maiasaurusoknál és a hipsziknél. Kattant a rádió. akárcsak az othnieliák. jó. Ennek így egyszerűen nincs értelme. – Csak három kategóriában van növekedés. a maiasaurusok. hogy jól elszúrta az egészet! – Az kizárt! – Szaporodó dinoszauruszok vannak odakint. – Velociraptorok szabadon a parkban! – Ugyan. mit jelent ez? – Persze. – Lehetetlen. És nézze meg a számokat! Kis növekedés a nagy állatoknál. Méghozzá hét különböző helyen! . hogyan.. hogy tisztában vagyok. Azok közül is kettőben igen kicsi. – Nincs tévedés – szólalt meg Grant hangja. – A maguk görbéje szaporodó populációt mutat.

– Figyeli valaki a parkot éjszaka? Csend volt a válasz. azt nem fogjuk – ismerte el Grant. A raptoroknak is kettő.. – Akkor hadd találjam ki. – Nem. – Hát egyszerűen csak feltételeztük.. megvizsgálnunk őket. Mi a helyzet az egerekkel és patkányokkal? Ismét nem érkezett válasz.A SZAPORODÓHELYEK Az ég egyre sötétedett. – Gondoltam – mondta Grant. – Akkor hogyan fogjuk megtudni? – Nekem csak egy ötletem van – mondta Grant. – Szaporodóhelyek? – kérdezte Wu a rádión át. Azok alapján talán meg tudjuk határozni. Utána kell néznem. – Meg kell lelnünk az egyes dinoszauruszfészkeket. Aztán ahogy múlt az idő. – De ez legalább kezdetnek valami. Esetleg kisebb rágcsálókat. hogy madár-DNS-t vittünk be. – De ez még mindig nem világos – mondta Wu. a gond fokozatosan megszűnt. – És azt hiszem. Grant és társai behajoltak a dzsip ajtói fölött. töredékes darabokkal dolgozott. – Akkor nézzen! – mondta Grant. hogy az adja meg a választ a kérdésre. – De miért olyan kevés a nagy állat? – kérdezte Wu. – Lehetséges. – Fészkekről van szó – mondta Grant. sőt talán a tojásból kibújt újszülötteket is. – Ha feltételezzük. – Ezt az adatok alapján nem tudjuk eldönteni. de azért ne feledkezzünk meg a főkérdésről: jutottak-e állatok a szigetről a szárazföldre? Grant válaszolt neki. Nem csak egy lenne. – Előfordult. és megszámolnunk a megmaradt tojástöredékeket. És a hipsziknek és a maiáknak szintén egy-egy. Az otiknak egy. – És eszükbe sem jutott.. úgy lesték a műszerfalba épített képernyőt. hány állat kelt ki eredetileg. – Az első időben. Sokan voltak. – Ötven létszám fölötti állat táplálkozásához nem lehet elég néhány fészekalja tojás. hogy valami mást is esznek. – Csakhogy a parkban szabadon járkáló kompik és raptorok alighanem eszik a nagyobb állatok tojásait. Volt. hogy az átlagos fészekalja mintegy nyolc-tizenkét tojás. – Ez igaz – mondta Grant. hogy a teljes egész összeállításához más fajoktól vett DNS-töredéket kellett használnia? – Esetenként igen – mondta Wu. hogy a hiányzó állatokat megölték-e. amikor maguk a szigetre jöttek. . akkor nyolctól tizenkettőig kellene terjednie az újabb maiák számának is. Nemrégiben értesült egy elgondolkodtató német vizsgálatról. Nem szaporodhatnak. – Amikor a dinoszaurusz-DNS-t készítette. további információkat kaphatunk. akkor ezek az adatok arra utalnak. jó? – mondta Grant. hogy a kompiknak két fészkük van. különféle madaraktól. Pontosan így volt. vagy pedig tényleg elhagyták-e a szigetet. – Béka-DNS? Miért éppen béka-DNS? Ekkor türelmetlenül közbeszólt Gennaro: – Nézzék. Malcolm ellenkezett. – Feltételezem. És azt hiszem. – És kétéltű-DNS-t? Konkrétan béka-DNS-re gondolok. természetes okokból múltak-e ki. Ezen már Grant is törte a fejét. – Nézze! – mondta Wu. Gyanította. – A raptorok éjszakai állatok – felelte a paleontológus. – Arnold elhallgatott. Mennydörgés morajlott a távolban. – A dinoszauruszok félreeső helyeken raknak fészket. meg fogja találni a választ is. – Ha a maiák fészkében a tojások száma nyolctól tizenkettőig terjed.. – De hol vannak ezek a fészkek? – Meg kell találnunk őket! – mondta Grant. megvizsgálni az okát. igaz? – Igen – felelte Wu. hány hiányzik. – Csak így lehet véghezvinni a feladatot. Malcolm megkérdezte. gondjuk volt a patkányokkal. És kezdhetjük felbecsülni. ha alaposabban megvizsgáljuk a népességi grafikonokat. – Attól mindig marad a tény. hogy az összes állat nőstény. néha pedig hüllő-DNS-t. – Nem is elég – mondta Grant. – De azt akkor sem fogjuk tudni. – De hát sosem láttunk ilyet – szólt Arnold a rádióban. ez mind roppant izgalmas. – Igen.

amelyek a természet világában léteznek. hogy különböző nagyságrendekben a dolgok szinte azonosnak látszanak. és a nagy hegy egy kisebb csúcsát nézed. Tim? – szólt közbe Ed Regis. Mi ülünk az első kocsiban. és használhatod az éjszakai nézőt. Sattler doktornő lehet az indíték. megszólalt Tim: – Most szeretnék az első kocsiban ülni Grant professzor bácsival. ígérem – mondta Tim. Aztán beszállt. Meg sem szólalok. hogy különböző nagyságrendekben? – Például egy nagy hegynek – mondta Malcolm –. amit minden iskolában tanítanak – tudod. amely egy Mandelbrot nevű ember nevéhez fűződik. – Én is – tette hozzá Malcolm. hogy az a sort ilyen hatással van rá? – Mással is megesett már – mondta Grant. Úgy érzem. – Miért? – Megérzés. – Visszamehetünk már? – kérdezte Lex. hogy a számítógép segíthet ebben. – Az az igazság. Tim? Rendkívül érzékeny infravörös szűrő van a lencséjében. – Készítek egy-két fotót a stegóról Harding doktor gépével. – Tényleg? – Malcolm áttért a tegezésre. van egy bizonyos csipkézett hegyformája. van egy kis sikerélményed. hogy inkább rettegés fogott el. – Te tudsz valamit a fraktálokról? Grant megrázta a fejét: – Nem. – Hadd üljenek ők ketten a hátulsó kocsiban. – A fraktálok egyfajta geometriát alkotnak – fraktális geometriának hívják –. Malcolm szólalt meg: – Vajon mi lehet a közelebbi oka. – Nem ér a nevem! Nem ér a nevem! Mindent csak neked lehet. gömbök. Intuíció. – Te! – mondta Lex. elektromos zúgással megindultak. – Tudod mit. Amikor odaértek a Land Cruiserekhez. – Klassz! – vágta rá Tim. – Én is akarok nézni vele. – Hisznek a matematikusok az intuícióban? – Teljes mértékben. – Nem – közölte Tim. Hiszen beigazolódott. Egyébként a fraktálok jártak az eszemben – mondta Malcolm. – Mi az. hogy a mi kitűnő jogászunk maradni akar? Grant vállat vont. veszélyes ponthoz érkeztünk. – Viszlát a táborban! – mondta. Próbáltál már ilyennel nézni éjszaka.– És hogyan fogjuk megtalálni ezeket a fészkeket? – Azt hiszem – mondta Grant –. milyen lesz a visszaút! Grant és Malcolm beszállt a második kocsiba. és odaszólt Grantnak: – Már előre látom. – Igazán türelmes voltál. – Az az érzésem. és rámosolygott. – Induljunk! – szólt Ed Regis. és majd Harding dzsipjével megyek vissza én is. Valami módon. Az intuíció roppant fontos dolog. – Jó. Malcolm furcsán hallgatagnak tűnt. Ahogy visszafelé haladtak a halványuló fényben. – Én még maradok egy kicsit – mondta Ellie. fiúk? Hogy hangzik egy daiquiri? – Megpaskolta a kocsi fémvázát. Grant megjegyezte: – Gondolom. Nem is szólva arról. Malcolm válaszolt: – Sajnos Grant professzornak és nekem megbeszélnivalónk van. Azok a vízhólyagok a nyelvén holnapra már feltisztulnak. – Én viszont sietek vissza – mondta Grant. kockák. és már futott is az első kocsihoz. – Bizalmas beszélgetésről van szó – mondta erre Malcolm. Nem igazán. – Gondolod. – Én azt hiszem. ha távolról nézzük. Felfedezte. Timmy! Ed Regis elnézte őket. akkor menjünk! Elindultak. amivel látni lehet a sötétben. Szóval a fraktálok alighanem a valósághoz kapcsolódnak. – Körülbelül húsz perc múlva ehetnek is – mondta Ed Regis. – A gyerekkel megyek. – Én csak ott szeretnék ülni. Ha közelebb mégy. Már ami az elméletedet illeti. – Én éhes vagyok! – Jó. Néhány esőcsepp csapódott a szélvédőre. ilyesmi –. és futva ment az első kocsihoz. Sattler doktornővel együtt. maradok – mondta Gennaro –. és elindult a két Land Cruiser irányába. A hegyek és a felhők fraktális formák. A közönséges euklideszi geometriával szemben. – Szóval Mandelbrot valami sajátos dologra jött rá a maga geometrikus eszközeivel. Vörös fény villant fel a műszerfalon. A Land Cruiserek finom. milyen jólesne egy finom kis banános daiquiri! Mit szólnak hozzá. a fraktális geometria minden jel szerint valós tárgyakat ír le. menjünk – mondta Grant. – Magam is kezdtem már várni azt a vacsorát. négyszögek. annak is ugyanolyan formája van. És voltaképpen .

mesterséges világlátás. Ásított. amely a dolgok normális rendjén kívül esik. – És a káoszelmélet arra tanít bennünket. Vagy túl van azon. ami egyet jelent azzal. amely Puntarenas felé vette az irányt. – Jó. Grant bekapcsolta a rádiótelefont. hogy elintézed ezt vagy azt. – Lát valamit? – kérdezte Ed Regis. amelyik viszont nagyjából ugyanolyan. látjuk. hogy egy nap áringadozásainak görbéje alapvetően ugyanolyan. – Keresse mélyen lent! Grant lejjebb billentette a látcsövet. – A hajóról beszélnek? – Úgy tűnik. lát valamit a hajón. Pedig beépül – szögezte le Malcolm.ahogyan lefelé haladsz a skálán. De már egészen besötétedett. radikális. hogy éppen ez most miért aggaszt téged – mondta Grant. Hogy a dolgok hirtelen megváltozhatnak. eltervezed. Valójában az élet olyan találkozások. de el sem jutsz oda. Nem úgy fogjuk fel a hirtelen. És minden így van. – Ez tulajdonképpen egyfajta világlátás – mondta Malcolm. – Csak így lehet felfogni! Legalábbis ez az egyetlen olyan felfogás.. de a végén azon kapod magad. – A gyapotárak több mint száz évre visszamenőleg kitűnően dokumentáltak. – Nem – mondta Malcolm. – Nem látok semmit. mint amikor két autó összeütközik. – Történéseknél? – Vegyük a gyapotárakat – mondta Malcolm. és a kislány izgatott hangját hallotta: – Oda nézz. mint ami beépül magába a lét szövedékébe. és futva közelítette meg az ő kocsijuk ablakát. mintha nem volna igaz! E pillanatban a kocsik hirtelen zökkenve megálltak. hogy egész mást csinálsz. – Elnézést – mondta –. hogy az a fajta egyszerű linearitás. – Malcolm hátradőlt az ülésen. de.. hogy szinte csak egy sziluettet látott. amit adottnak fogadtunk el mindenütt – a fizikától a szépirodalomig – egyszerűen nem létezik. érintkezések sora. Kissé távolabb a parttól. Ed Regis kiszállt az első kocsiból. – Mélységes igazság ez. és a néhány méterrel előttük haladó. mint a halálos betegség. Az egész életed formája ugyanaz. A való élet nem egymással belsőleg összefüggő események sora. és könyökével megtámaszkodott a Land Cruiser ablakának peremén. Csak úgy ragyogtak a sötétbíbor kora estében. mint egy hét görbéje. Grant felkapta a távcsövet. másik Land Cruisert nézte. Egy nap olyan. – Nem – felelte Grant. – Miért álltunk meg? – kérdezte Malcolm. A dolgok valahogyan visszafordulnak önmagukba. A végénél! Tessék a végénél figyelni! – De hát hogyan láthatnak bármit is ebben a fényben? – kérdezte értetlenül Malcolm. mint egy egész élet. – Van maguknál távcső? – Minek? – A kislány azt állítja. visszatérésre utal. Látták. kiszámíthatatlanul. . sőt akár pusztító módon is. Ha megvizsgáljuk a gyapotárak ingadozását. minden előzetes figyelmeztetés nélkül. Valamiféle állatot – mondta Regis. mint egy évé vagy tíz évé. Az azonosságról alkotott fraktális elképzelésnek ugyanis van egy olyan aspektusa is. hogy feljebb. amelyben minden esemény teljes mértékben egy csapásra megváltoztathatja mindazt. Most értek a partvonalhoz. hogy az egész létezésednek ugyanaz a véletlenszerűség a jellemzője. – Mi történt? – kérdezte Grant. így is fel lehet fogni a dolgokat – mondta Grant. mindvégig felfedezhető ugyanaz a fraktális forma. kigyulladtak a hajó utazólámpái.. mint a gyöngyök a nyakláncon. amely a partra és az óceánra nézett. Timmy! Látod? Ott van! Malcolm összehúzott szemmel a hajót kezdte nézni. irracionális változást.. mint a nagy hegynél. amely egész világegyetemünk szerkezetét érinti. amit ellenőrizni tudunk. És ez a nagyságrendi azonosság történéseknél is jelentkezik. Olyan sötét volt már. – Hát gondolom. mint egyetlen napodé. amely közel áll a valósághoz. – Mi azonban beleringattuk magunkat abba az elképzelésbe. ami utána következik. de a gyerekek teljesen izgalomba jöttek – mondta. Amint nézte. az előttük levő kocsiban a gyerekek az óceán felé mutogatnak. amely ismétlődésre. Baleset. egészen az icipici szikladarabokig. – Mélyen lent vannak – mondta Lex a rádión át. amelyek úgy követik egymást. amit csak mikroszkóppal látsz. De valamilyen okból továbbra is makacsul úgy teszünk. Most közvetlenül a merülővonal fölött pásztázta a hajótestet. A linearitás csinált. Belekezdesz valamibe. hogy a hirtelen változás valami olyasmi. Megcsapta az orrát a vulkáni gőz kénszaga. hogy a történések kiszámíthatatlanok. – De én látom – vágott közbe türelmetlenül Lex. – Nem egészen értem. és alig tudta kivenni a részleteket. És életed végén rájössz.. – Mandelbrot egy bizonyos azonosságot fedezett fel a legkisebbtől a legnagyobbig.. Végigpásztázta a szállítóhajó hosszú testét. az egyre lejjebb ereszkedő felhők alatt Grant észrevette a szállítóhajó sötét körvonalait.

– Ne nyúljanak a konzolomhoz. amilyenre mi már nem is emlékszünk. és a testüket merev farok tartja egyensúlyban. és egyenletes. Légköri zaj sistergését hallotta a rádióban. amint legörnyed. Éjszaka az egész utat bevilágították a hatalmas fényszórók. – Hazafelé tartanak. Nagy esőcseppek folytak szét a szélvédőn. – Mindkét rádióval baj van! – kiáltotta. – Jézus Mária! – nyögte Ed Regis. Grantnak olyan érzése támadt. – Pedig úgy látszik. amely dél felé nyúlt. – Az Isten szerelmére. hogy kikapcsolta a készüléket. Grant elkomorult. nem egész egy méter magasak. ahogyan sorra váltotta a csatornákat. Grant beleszólt a rádióba: – Mennyi idő alatt éri el a hajó a szárazföldet? – Tizennyolc óra alatt – válaszolta Ed Regis. Sistergő légköri zörejeket hallottak. – Ásított. – Legalább kettő. Muldoonnak mindennap ez volt a legkedvesebb pillanata. – Az a hajó a szárazföld felé tart! Malcolm megvonta vállát.– A gyerekek látnak – válaszolta Grant. Aztán kiegyenesedett. Az út mentén a vulkáni gőz felhői szivárványt szőttek a ragyogó kvarcfények köré. – Mik ezek? – Raptorok – mondta Grant. hogy a vihar az oka – mondta Muldoon. A hajó tatja irányába mozgatta a távcsövet. – Úgy látom. Csak egy kis ideig voltak a szeme előtt. fokozatosan. – És miért nem tudunk beszélni velük? – Nem tudom – felelte Arnold. és visszanézett rájuk. Már próbáltam. Lehet. – A vihartól származó interferencia. de még a halványuló fényben is megállapíthatta. – Ne izguljon! Inkább hívja a vezérlőt. hogy hívják vissza a hajót. . – Akkor bocsánat! – mondta Nedry. – Még mindig nincs kapcsolata a vezérlőteremmel? – Eddig nincs. – Jézus. A vezérlőben Muldoon a parkra néző nagy ablakok előtt állt. – Állandóan próbálok elérni valakit – mondta Ed Regis. úgy tizenöt perc múlva. – Nagyjából. monoton sistergést hallott benne. érti a dolgát. Hét órakor az egész szigeten kigyúltak a kvarc reflektorfények. – Nem működik. – És Hardinggal? Őt el tudja érni? – Nem. semmi mást. hogy azok az állatok a szárazföldre kerüljenek! – Mennyi idő alatt érünk vissza a bázisra? – Innen még tizenhat-tizenhét perc – felelte Ed Regis. – Látom. Látták. Kölykök. Ide-oda cikáztak a tatnál lévő felépítmények körvonalai között. amit nem szeretnénk. pedig valaha magunk is így láttunk. – De miért álltak meg? – kérdezte Muldoon. Ed Regis benyúlt. – Nem tudom hívni a vezérlőtermet! – Akkor induljunk. de azonnal! – kiáltott rá Nedry. ha van. – De azt hiszem. mintha ragyogó zöld levélalagúton haladna át. – Olyan éles a látásuk. lassan. és szóljon nekik. Azt hiszem. És ekkor ő is meglátta az állatokat. – A Land Cruiserek újra elindultak – szólt Arnold. – Micsoda lompos alak! – szólt Hammond. és az ajtó felé indult. – Egypárat megnyitok a következő adás végén. és lekapta a rádióadót a műszerfalról. – Ez mi? – kérdezte. Arnold felvette a telefont. de máris! – mondta Grant. – Valószínűbb. – Szóval egyedül mi tudunk a hajón lévő állatokról. oké? Az ajtó becsukódott. Elrohant az első Land Cruiserhez. s az egész tájat hatalmas ékszerré varázsolták. hosszú hétvégém lesz. mintha mind bedugult volna. De elég megbízható. – Talán kikapcsolták a rádiókat a kocsikban. tegye vissza. – Holnap délelőtt tizenegy körül kell odaérnie. hogy két lábon járó állatok. – Az – mondta Arnold. Játszottak. – Az órájára pillantott. akkor az. meg a kattanásokat. – Tetszik már látni? – kérdezte Lex. Malcolm a fejét ingatta. – Felkapta a válltáskáját. – Ezzel valami baj van! – mondta Regis. – Megszakítja az adatfolyamatot! – Az összes telefonvonalat elfoglalta? Még a belsőket is? – A külső kommunikációra szolgáló vonalakat valóban mind igénybe vettem – mondta Nedry. most tényleg hozok magamnak egy kólát. – De a belső vonalaiknak működniük kellene.

Kinyitotta. Apatosaurus. és elővette a Gillette borotvahab tartót. majd megáll. s látta. „Itt járt Zorro!” Harmadsorban azonban Nedry ezzel biztosította be magát a jövőre. Hadrosaurus. Azzal. Tudniillik szántszándékkal így programozta be az egészet. amely körül folyékony nitrogén fehér felhője gomolygott. Egy lélek sem volt a laboratóriumban: ahogy előre sejtette. hogy a Land Cruiser lelassul. és helyrehozd a zűrt. Később azonban. Az InGen nagymérvű módosításokat követelt az egész rendszerben. Nedry elhagyta a hűtőt. ahol a megtermékenyítés zajlott. amelyet csak biztonsági kártyával lehetett kinyitni. hogy ő maga programozta így. a telefonvonalak mind bedugaszolva. és fordított egyet a tetején. az egész személyzet vacsorázni ment. de csak odakint. a védőövezet területén mindenütt megszűnt az áramszolgáltatás. Hallotta a kiszabaduló gáz szisszenését odabenn. És még csak sejteni sem fogja senki. mint egy gardróbszekrény. leveleket írtak Nedry más ügyfeleinek. Arra hivatkoztak. hogy bejuss.Egyszer csak érezte. Belépett a fertilizációs terembe. poliénnel ledugaszolva. elképzelte. hogy ez az eredeti szerződésben is benne van. de nem volt hajlandó fizetni is érte. – Mi van a két Land Cruiserrel? – Valahol a Tyrannosaurus-domb közelében állnak. Rengeteg kellemetlensége volt a Jurapark tervei miatt. – Hát akkor hívd a karbantartókat. Részben a józan ész is ezt diktálja: ha a felhasználó ügyetlenségből lezárja a rendszert – aztán téged hív segítségül –. Ahogy visszalépett a folyosóra. de csak sziszegést hallott: Nedry komputerei beszélgettek egymással. szándékosan. hogy hozzák rendbe! Arnold felkapta az egyik telefont. a védőövezeten belül. sem a TV-kamerák. mi történt. mint hogy lenyelte a külön költségeket. FENNTARTANDÓ MINIMÁLIS HŐFOK -10°. A biztonsági kódok teljes összevisszaságban. A polcok nagyrészt műanyag zacskókban lévő reagenseket és folyadékokat tartalmaztak. Tyrannosaurus. – Mi történt? – kérdezte Malcolm. Visszaejtette a tartályt a táskájába és behúzta a zárat. amelyen ez állt: TARTALMA: BIOLÓGIAILAG ÉLETKÉPES ANYAG. Semmi sem működik. hogy ő bizony ki tudja játszani a Jurapark biztonsági rendszerét. Mert hogy sosem lehet tudni. A biztonsági rendszer hiányosságai az élen álltak a Jurapark hibalistáján. amint kezdik felfogni. Nedry pedig nem tehetett mást. ahová ne tudna bejutni. – Ez meg mi az ördög! – kiáltott fel Arnold a monitorokra meredve. A nagy számítógépek tervezői csak ritkán tudnak ellenállni a kísértésnek. hogy ne hagyjanak a maguk számára egy titkos bejáratot. Az ő segítsége nélkül órák alatt sem tudják megszüntetni a zűrzavart – de néhány perc múlva már Nedry is ott lesz. Két percig sem tartott az egész lopás. . Nedrynek megfordult a fejében. mi történt. Bőven kitart míg visszaér San Joséba. Az embriók fajok szerint voltak elrendezve: Stegosaurus. és becsúsztatta őket a borotvahabtartályba. – Biztos pillanatokon belül újra kigyullad a fény. az összes olyan ajtó zárja kioldódott. Másfelől ez afféle titkos aláírás vagy jeladás. felhívták a figyelmüket. benne polcok a padlótól a mennyezetig. Perrel fenyegetőztek. Szabályosan megzsarolták. hogy a periméter. és kis csőállvány siklott ki belőle. és visszatért a főlaboratóriumba. és pillanatok alatt mindent rendbehoz. Dodgson azt mondta. az épületben minden teljesen rendben. mindig van rá mód. nem juthat-e valakinek eszébe. – Kiment az áram? – Igen. Nedry hajlandó volt végighallgatni a mondókáját. Sem a fények. és kinyitotta a „járható” hűtőszekrényt. harminchat órára elég a benne lévő hűtőanyag. amikor tapogatózni kezdett volna Lewis Dodgson a Biosyntől. Nincs olyan helyiség. És nem tagadta. és végrehajtotta a Hammond által kívánt változtatásokat. semmi. Ezután visszacsavarta a tartály alját. hogy itt szó sincs hibáról. nitrogénes hűtődobozt látott. Nedry gyorsan mindegyikből kikapott kettőt. nincs olyan rendszer a parkban. hogy Nedry nem megbízható. Az az átkozott Nedry! Nedry! Ez meg hová a fenébe tűnt el? Dennis Nedry óvatosan kinyitotta a FERTILIZÁCIÓ feliratú ajtót. A hűtő akkora volt. Lecsavarta az alját. az ajtaja vastag kerámia. hogy a tartály belseje csupa henger alakú üreg. alufóliába csomagolva. Az egyik oldalon kisebb. mekkora lehet a riadalom a vezérlőben. Nedry elhúzta a villámzárat a válltáskáján. Klasszikus rejtekajtót épített magának. Itt. Mindkét kezére vastagon szigetelt kesztyűt húzott. Kinn a parkban viszont nincs áram. Mindegyik embrió üvegtartóban volt. s a tartály deres lett a kezében. – Most mi van? Lex szólalt meg: – Nem akarok megállni! Miért álltunk meg? – Ez csak valami áramkimaradás vagy ilyesmi lehet – mondta Ed Regis. – A külső ellenőrzőmonitorok elsötétedtek.

– Az a hülye Nedry kikapcsolta a biztonsági rendszereket – mondta Arnold.. hogy puszta előrelátásból betette a rakétakilövőt. – Én mindenesetre kocsiba ülök. Majdnem. ha kiszállnak. és percek alatt ki. akár nem. Gyerekjáték! – Az istenfáját! – dühöngött Arnold. A motor felberregett. és tudta. mit lehet tudni. ami biztos! Muldoon lesietett a lépcsőn az alagsorba. Alig két-három stimulációs esemény elég egy kísérleti galamb betanítására. – Igen. szürke csőszerűséget vett észre az utasülésen. Nem valószínű. Muldoon az ablakoknál állt. – De igen – mondta Arnold. gondolta. Valószínűtlen volt hát. akár bennük ülnek az utasok. mit fognak tenni az emberek a kocsikban. – Most van igazán baj! – Mi van? – kérdezte Muldoon. s így éppen nem látta. de mégis. ahol fényesen ragyogtak a lámpák. befelé a parkba.. Leért a garázsba. És onnan ismét három perc vissza a vezérlőterembe. hogy a dzsip kigördül a föld alatti garázsból. hogy a személyzetből néhányan futva igyekeznek fedél alá az eső elől. Muldoont jobban nyugtalanította. de mintha senki sem vett volna észre semmit. és behozom az utasokat a Land Cruiserekből – mondta. Az. Milyen szerencse. a kocsik újra elindulnak. Így azonnal indulhat. „Nincs itt! Mi az Isten?!” – Muldoon döbbenten bámulta az üres parkolóhelyet. – Az egész épületben minden tárvanyitva áll. – Értesítem az őrséget – mondta erre Muldoon. Egyetlen ajtó sincs már zárva. Látta.. – Biztos. Muldoon átnézett a vendégkastélyra. A dinoszauruszok többsége már kilenc vagy annál is több hónapja van a helyén. Muldoon az ajtó felé indult. mint egy rakétakilövő.. – A kerítések?! – kérdezte döbbenten Muldoon.. Három perc az egész. miközben elfordította az indítókulcsot. és folytatta az útját az alagsorba. – Cigarettára gyújtott. – Az igazi az. persze. és már jó néhányszor súrolta a kerítést mindegyik. hogy a sokkhatást el kell kerülni. – Teljesen össze van kavarva minden! – Hiába nyomkodta a gombokat a konzolon. Nem szerette volna.. – Csak nem azt akarod. „Mi az ördög folyik itt?!” . Az elektromos Land Cruiserek szabályos sora mellett elhaladva a fal mellett parkoló. és a karbantartóúton keletnek tart. és a dzsip felé indult. valami fura. Innen a parkba. – De ez a legkisebb baj – folytatta Arnold. Az egész szigeten kialudtak a fények. nem nyugtalanította olyan nagyon. hogy a dinoszauruszok most megközelítsék a kerítést..Dennis Nedry vigyorogva lesétált a földszintre. A dzsip nem volt a helyén. hogy a kerítések áramtalanul maradtak. benzinmotoros dzsiphez ment. mert mihelyt visszakapcsolódik az áram. Lemaradhatnak. – Ajaj! – mondta Arnold. Az eredményt megérezték. Amikor beszállt. hogy a biztonsági rendszer kikapcsolásával az összes elektromos védőkerítés is kikapcsolódik. és a partot nézte. – Kiszabadulhatnak az állatok. – Egy sincs áram alatt az egész szigeten. kivéve a főépület közvetlen körzetét. Muldoon ismerte az állatokat. ódabólintott az őrnek... de az ördög nem alszik. Elfordult az ablaktól. Nedry az órájára pillantott.. és egyenesen a keleti dokkhoz. az elektromos kerítések – felelte Arnold. milyen hamar megtanulják. hogy ebben az esőben elhagynák a kocsikat. gondolta magában. – Valószínűleg nem fog történni semmi.

NEGYEDIK ISMÉTLŐDÉS Elkerülhetetlenül kezdenek megjelenni a belső kiegyensúlyozatlanságok. IAN MALCOLM .

Tim jóformán ki sem látott. ami az utakba épített kábelekben fut. Csak az eső dübörgött a kocsi tetején. végképp nem. Lex – mondta Ed Regis –. – Mióta ülünk itt? – kérdezte Malcolm. – Tim! Ott vagytok?! . és az utat szegélyező növényzetet vette szemügyre. s most idegesen nyomkodta bőrkesztyűjét. de nem látott semmit. Az eső zaját hallgatva Tim érezte. aztán elektronikus zöld és fekete árnyalatokban tisztán kivehetővé vált a hátulsó Land Cruiser. mögötte a drótkerítés zöld szerkezetének egy-egy darabja látszott. Klassz! Grant az első szélvédőn át éppen feléje bámult.A FŐÚT A Land Cruiser tetején hangosan dobolt az eső. – Látjuk. Az volt az érzése. Feszültség volt a hangjában. ugye? – Mindig félt a villámtól. Mit számíthat egy tyrannosaurusnak a napszak? Az eső csak zuhogott tovább. de hát itt ragadtunk. A Land Cruiserek egy domb lefelé tartó lejtőjén álltak. akkora. Azon kezdett gondolkodni. – Nem tudom. Egy pillanatra éles. Akkorát. – Csak a húgom beszél összevissza. Tim megfordult. – Maradjatok a kocsiban! – Maradunk. kicsikém. s az időjárás is mindegy neki.. – De nem villámlik. Hátrakapta a fejét. – De még alig esett. és fokozta az erősséget. Ne tessék félni! – Kikapcsolta az adógombot. – Micsoda eső! – szólalt meg Ed Regis. Grant bácsi. Az éjszakai nézőkészülék súlyosan nehezedett Tim homlokára. Izgis lenne ezzel a nézővel tyrannosaurust látni! Micsoda szám! Hátha a tyrannosaurus a kerítéshez jön. amely a füle táján helyezkedett el. Tim látta. Tim megint végigpásztázta a levélsövényt. Ásított egyet. hogy valahol a tyrannosaurus-rész közelében vannak. Erre megint csend következett. Még a föld is megremegett. Ed Regis felhorkant: – Ömlik az eső.. – Mennyi időre ragadtunk itt? – Amíg helyre nem állítják az áramot. Az ablakokon patakokban folyt le a víz. Lex szólalt meg. hogy a tyrannosaurus éjjeli-nappali állat. – Aha. aztán fel is hagyott a próbálkozással. majd az út bal oldalát szegélyező pálmafák felé fordult – és abban a pillanatban akkora dobbanást hallott. hogy megnézze őket! Vajon csillogna-e a szeme a sötétben? Az volna csak az igazi! De semmit sem látott. hogy olvasott-e erről. Négy vagy öt perce. ami azt jelentette. A nézőn át a levelek színe fényes. hogy maradunk! – morogta. – Vajon mi lehet a probléma? – Talán rövidzárlat keletkezett az eső miatt. Mindenki elhallgatott. amint leakasztja a rádióadót a műszerfalról. A hangszóróból egy pillanatig csak légköri recsegés hallatszott. aztán megszólalt Grant hangja: – Láttok minket magatok mögött? Tim elvette a rádiót Ed Registől. mint egy tyrannosaurus. – Igazi felhőszakadás! Aztán Lex szólt: – Éhes vagyok! – Tudom. elektronikus zöld volt. amikor történt. hogy ijedtében összerezzent. hogy a tyrannosaurusok előjönnek-e éjjel. Éjjeli állatok volnának? Tim nem emlékezett biztosan. még a nézővel is alig. de már csak egy szemvillanásnyi ideig látta a sötét alakot. amely sebesen átkelt az úton a két kocsi között. – Ezt nem jól vettük. – Minden rendben? – Semmi bajunk. Még szép. – Mi az? – kérdezte Grant doktor. mint a kocsi. – Jézus Mária! – Mi volt az? – Hatalmas. A kocsik villanyárammal mennek. benne Grant doktor és Malcolm doktor. foszforeszkáló fény villant fel. Kezével megkereste az igazítógombot. hogy elálmosodik.

a kerítésen túl valami vaskosat látott. és számolni kezdett: egy.. Mintha egy másik világból jött volna az üvöltés. az iszonyú volt. vagy akármi is volt az. magasabbra. – Én nem sokat látok innen. mint a fa kérge.. Timnek végigfutott a hátán a hideg. mi van ott? – Igen. Az óriás állat a fejét forgatta. Az csak állt ott. De azt tudta.. Tim feljebb nézett. ne. Tim nézője vakító zöldet villant. mi történhet az emberrel. aki éppen kinézett az ablakon.. kitörölhetetlenül. Bevizelt. Tim. Tim tekintete a nézővel tovább haladt felfelé. Látott raptor marcangolta testet. egyedül Ed Regisnek volt fogalma arról. De ugyanakkor érezte. de sokkal nagyobb! A leghatalmasabb húsevő. keményen zuhogott. Iszonyú rettegés fogta el. – De nem láttad? – faggatta Ed Regis. Grant professzor. három. Tim egy kicsit szégyellte magát.. Aztán hirtelen nagy csattanással fehér villámfény hasított végig az égen. – A tyrannosaurus volt az? – kérdezte Ed Regis. amely valaha is a földet taposta.. – Oké.. – Jézus Mária! – kiáltott fel Ed Regis. csak az eső dübörgött tovább. Lex sírva fakadt.. kicsikém – nyugtatta Ed Regis. és nem látta az állatot. A kisfiú lehunyta szemét. rázták a leveleket. ahogy a tekintete lefelé haladt az óriási fejtől és állkapcsoktól a test felé. Ő tudta. És ekkor megpillantotta a tyrannosaurus hatalmas fejét. Az úton volt valami.. aztán még feljebb kúszott. hogy egyre jobban reszket a térde. Lex szipogva sírdogált tovább. Ed Regis érezte.. Aztán vissza. Timnek az volt az érzése. hogy Grant doktor igyekszik úgy beszélni. Aztán sötétség és újra csend. és bömbölt egyet a vakító fényben. akik a kocsiban ültek.. amely valaha a földön járt! – Atyaúristen! Amikor a tyrannosaurus elbődült.. de aztán.. . – Jaj. – Történik most valami? – Semmi – mondta Tim. – Rajtad van az éjszakai nézőkészülék. Mozgásba jött minden. Himbálózott a levegőben. – Csak áll a kerítésnél... Olyan volt a felszíne.. Mekkora a feje! Egyik kocsiról a másikra nézett. vagy szemcsés. Mintha pontosan Timet bámulta volna. Tim nézte a tyrannosaurust. – Mi a fene volt az? – kérdezte Malcolm. hogy melegség terjed végig belül a nadrágjában.! – Semmi baj. – Azt nem hiszem..Felkapta a rádiót. A legnagyobb ragadozó. majd figyelem – mondta Tim. és nagyon közeli. cseppjei verték. Tim tovább pásztázta a sövényt. Grant bácsi? – Látod. aztán megragadta a kerítést. Tim? – Igen. – Éppen elmulasztottam. – Igen. látom. minden idők legszörnyűségesebb támadója. hogy rá ne ijesszen a húgára. milyen a dinoszaurusztámadás. Nem ülhet itt tétlenül.. Csak úgy libegett a nadrágszára.. A mennydörgés csattanása fülsüketítő volt. A nézőkészülékben úgy látszott. hogy a szeme élénkzölden ragyog. – Én jól látom. hanem maga a rex! Sokkal. – Ez csak villám. Egyszerre szégyellte magát és rettegett. itt vagyunk! – Láttad. A levelek mögött. Nem volna szabad itt lennie! Mindannyiuk közül. megpillantotta a kisebb. Mintha életre kelt volna maga a táj is. amiért nem figyelt eléggé. Állj! Valami van a levelek között. újságíróagya valamelyik zugában Ed Regis még mindig reklámszöveget írt. Újabb szünet következett. mintha kavicsokkal lenne kirakva. A kép ott maradt az agyában. És ez nem is raptor. Nézte a tyrannosaurust a készülékkel. De ez nem fa volt. Csak áll. várva a véget! Tennie kell valamit! Valamit! Reszkető keze a műszerfalnak ütődött. Az eső sűrűn. hogy muszáj tennie valamit. négy. A tájat ismét bevilágította a villám. – Nem.. Tim az út szegélyét pásztázta. – Tim? – Igen. izmos mellső végtagot. s nem tud úrrá lenni a remegés felett. Tim? – Nem – felelte Tim. – valahol. kettő. s a kerítésen át nézte a két Land Cruisert.

és futni kezdett. Tim már nem látta Grant doktorék kocsiját. mint az előbb. mint kell. Végre Lex is meglátta az állatot. és behúzza a nyakát az esőben. Most a két kocsi között állt. hogy az állat a kerítésbe kapaszkodik! Nincs áram a kerítésben! – Lex. – Zárd be az ajtókat! Húzódj a kocsi közepére! És fogd be a szád! Odakünn a tyrannosaurus a fejét forgatta. de már csak annyit látott. – Hová megy. – Tim lekapcsolta a rádiót. Kattant a rádió. és becsapta az ajtót. – Tim? – Igen. – Zárd már be az ajtót! – kiáltott rá a bátyja. a kerítésben nincs áram – mondta Tim. – Itt hagyott minket! – Mi történt. Az állat fejét nem is látta. Megint a rádió: – Tim! Ott vagy?! A kisfiú megragadta a készüléket. Grant professzor. És azt hiszem. – Itt hagyott! Itt hagyott! Tim hunyorgott. – Timmy! Visszaugrott. s egy pillanatra a fehéren világító mennyboltra rajzolódott a hatalmas alak árnyképe. A mellső lába a kerítést markolta. Ed bácsi?! Ed Regis egyszerűen sarkon fordult. – Tim! – Tessék. olyan magasan tornyosult a kocsi teteje fölé. és becsukni az ajtót helyette. mint valami monoton sirámot. – Hé! – kiáltott fel Lex. és mennydörgés robaja töltötte be a levegőt. – Hogy mit csinált? – Elszaladt. nem is moccant. majd eltűnt az erdőben. Az eső patakokban folyt lefelé a csupa izom hátsó láb kavicsmintázatú bőrén. és egy ugrást tesz előre. nincs áram a kerítésben! – Lex! – ismételte Tim –. amint a tyrannosaurus gigászi hátsó lábának egyetlen csapásával leszakítja a drótkerítést. Az bömbölt. – Oké. mert az óriás eltakarta. ki az ömlő esőbe. de a hátsó ülésről nem érte el a kilincset. mi van veletek? – kérdezte ismét Grant. – Maradjatok a kocsiban! Húzzátok össze magatokat! Ne mozduljatok. – Mi van veletek? – Regis bácsi elszaladt – mondta Tim. Nem maradt más hátra: Timnek ki kellett szállnia a hátsó ajtón. Tim előrehajolt. Tim fölnézett. Tim ebben a pillanatban fogta csak fel. Le sem vette a tekintetét a dinoszauruszról. – Oké.– Jézus Mária! – mondta megint. Visszanézett a tyrannosaurusra. amint kiszabadítja lábát a kerítésből. Tim? – szólalt meg Grant doktor hangja a rádióban.. – Itt hagyott! Itt hagyott! – ismételgette. hogy Ed Regis kilép az ajtón. – Hallottad ezt. Hátsó lába karma beleakadt a földre tiport kerítés hálójába. Tim hallotta. Grant bácsi. – Nincs áram a kerítésben? – hallotta Malcolm kérdését a rádión át. és látta. hogy nyílik az ajtó. A zajt elnyomta a mennydörgés hangja. nem képes kinyitni a kocsit. Azt hiszem. hogy nyugton maradjatok. – A kisfiú azt mondja. a belső borítás egyre vizesebben csillogott. éppen amikor ismét villám ragyogta be az eget. és elnémult. és megpróbálta becsukni az ajtót. – Tim. Grant bácsi. . hogy visszanyerje látását. és esetlen mozgással egy lépést tett előre. Újabb villám hasított keresztül az égen. – Nem esik bajotok. – Nem szabad jézusozni! – szólt rá Lex. Tágra nyílt szemmel bámulta. Nem férhet hozzátok. a tyrannosaurus pontosan ugyanúgy állt ott. csukd be az ajtót! Reccsent a rádió. Hirtelen elfordította a fejét a tyrannosaurustól – a szemüveg oldalt csíkot húzott –. csukd be az ajtót! – De Lex csak sikítozott. Amikor újra odanézett. de a kislány sikoltozni kezdett: – Itt hagyott! Itt hagyott! – Elment! – nyöszörögte Lex. – Itt vagyok! – Lexhez fordult. Lex? A kishúga némán bólintott.. és ne üssetek semmi zajt! – Jó. és intően mozgatta az ujját. el a dinoszaurusztól. Állkapcsáról csöpögött az esővíz. mozdulatlan óriásként. A Land Cruiser ajtaja nyitva himbálózott. – Az a lényeg. és ne hívjátok fel magatokra a figyelmét jobban. A villám fényénél látták.

ami vele történt. Visszanézett Grant doktorék felé. A kislány valahol az első ülés alatt feküdt a padlón. és Grant és Malcolm kocsijára nézett.. A tyrannosaurus kinn állt az esőben az első lökhárítónál. hogy felüljön az első utasülésen. A tyrannosaurus a kocsinak támaszkodott. Gyorsan újra felült.. A kocsi hátsó része egy pillanatra a magasba emelkedett. és Tim a villám fényénél látta. az első ülésre. a mellkasa süllyedt és emelkedett. Eszméletlennek látszott. sikálták a fémet. amely minden lélegzetvételére előre-hátra himbálózott. mellső lábai a semmit karmolászták. Tim szédült. ő maga pedig pontosan mellé esett. Lenéz. Tim hátrafordult. s látta: az első szélvédő kitörött. Fogak csikorogtak. Igyekezett kikerülni a tető hajlását. Eltűnt. Az ablakok a sárba mélyedtek. – Timmy. – Semmi baj – súgta vissza Tim. oldalt fordult. Éles. és összevegyült az esővízzel. ahogy a Land Cruiser hintázott a kerekén.. Feszült arckifejezéssel meredtek előre az ablakon át. és megint eltűnt a szem elől. kapkodva szedte a levegőt rémületében. Csak csipkés üvegszilánkok maradtak a keretben. hogy a kislány fejének egyik oldalát teljesen elborítja a vér. Ahol Ed Regis is kiszállt. A tyrannosaurus a Land Cruiser elejénél állt. Fogait a Land Cruiser hátuljára erősített pótkerékbe mélyesztette. egyenesen a sebességváltó dombjára. A hatalmas fej lassan ismét felemelkedett a kocsi oldala mentén. . hogy az egész kocsi meglódult. s a szélvédőn repedés pókhálója futott szét. Lex mellett találta magát. A rugók hangosan nyikorogtak. hogy az egyik hátsó láb felemelkedik. vastag nyelv siklott a kocsiba a nyitott szélvédőn át. Pontosan odament.A tyrannosaurus most körüljárta az ő kocsijukat. A tyrannosaurus állkapcsai ekkor rácsapódtak az ablakkeretre. remélve. Vér csöpögött a Land Cruiser benyomott tetejére. Hátul. ahogy a levegőt szedte. A tyrannosaurus feje a motorházfedőnek csapódott. és döbbenten látta. hogy csendben marad. A fej végül felemelkedett. Jobboldalt nem látott mást az ablakon át. majd a tyrannosaurus felüvöltött. Úgy tűnt. amint a fej rohanvást közeledett hozzá. – Tim! – szólt Grant doktor. és az ablak mellett megállt. megvagytok? Tim megragadta a rádiót. és bepislantott. idegtépő fémcsikorgás hallatszott. Üvegcserepek záporoztak Tim körül mindenfelé. Ekkor olyan ütés érte a Land Cruisert. a kocsi mögött az állat felhorkant. az állkapcsok tárva. amint gödrében forog. A fém begörbült. – Lex? Sehol sem látta a húgát. A fej hirtelen elhúzódott. – suttogta Lex. őrá! Tim torkát jeges rémület szorította el. felemelt farok teljesen eltakarta az oldalablakokat. amint Lex tehetetlenül az oldalablakra zuhan. gondolta.. Ott megállt. aztán sarat fröcskölve visszahuppant. A tyrannosaurus még kétszer lecsapott. és egyetlen fejmozdulattal leszakította azt a kocsiról. iszonyú zaj töltötte be a kocsi belsejét. Hunyorgott a sötétben. A tyrannosaurus bömbölt. A tyrannosaurus Timre nézett. hogy látott minket. Az egész világ félrebillent. – Lex! – suttogta Tim. – Tim. Benézett a kocsiba! Húga szaggatottan. „Nem fér hozzám – gondolta Tim. Tim letette a rádiót. Most oldalról ismét megkerülte a kocsit. ahol az előbb Tim kiszállt a kocsiból. Nedvesen csapkodott körben a kocsiban – Tim érezte a dinoszaurusznyál forró habját –. Újabb csapás rázta meg a kocsit. – Túl nagy!” Aztán a fej a magasba lendült. és a padlóra gurult. hogy fél szemmel meredjen rá. Látta őket. Tim szíve vadul kalapált. amely egybeolvadt a mennydörgéssel. és bevágta a fejét. Tim nehézkesen felkapaszkodott. és teljesen eltakarta az összevissza repedt szélvédőt. a pofája nyitva. Az éjszakai nézőszemüveg lecsúszott a homlokáról. amint a karmok a kocsi tetejét szántották. Ekkor az óriás fej ismét lezuhant. s a vér melegét érezte a szájában. Tim látta. Lex ismét felnyögött. kifejezéstelen hüllőszemet. Az óriás fej lebukott a sáros talaj felé. és az egész Land Cruiser a levegőbe emelkedett. majd hatalmas. félrebiccentve hatalmas fejét. és kezdett előrekúszni.. Felnézett. Tim érezte az állat forró. ahogy a kocsi az oldalára zuhant. mintázott. bűzös leheletét. és a fémtető benyomódott. csak repedezett. Volt még annyi hely. Talán az állat nem is látja őket. Csörgött a vér a pofájáról.. A fej közeledett a kocsihoz. Mély. dörgő morgást hallatott. Aztán nyöszörgést hallott. – Nem hiszem. és mögöttük ott a dinoszaurusz óriás feje. Tim a lökéstől elterült az ülésen. – Semmi bajunk – mondta. és megszorította a karját. bőr fedte húst. A tyrannosaurus megint a kocsi orrához verte a fejét. Tim a villámfénynél látta a dülledt. Tim kinyúlt. Tim az ülést markolta. A hatalmas. megzavarodott attól. Az állat ide-oda rázta. Tim heves fájdalmat érzett a fején.

Csak állt. hogy dörömböl a szíve. Arcát és testét csak úgy hasogatta a jéghideg eső. majd az óriás hátsó láb felemelkedett. – De tényleg ő volt? – Nem tudom – válaszolta Grant. aki még mindig mozdulatlanul állt. a tyrannosaurus túl közel van. Neked nincs ilyen érzésed most? – Dehogy nincs – mondta Grant.. majd hatalmas feje lebillent. de már nem hallotta. Olyan hatalmas a dinoszaurusz teste. hogy szűnjön a remegés. A másik kocsiban Malcolm rémülten kapott levegő után.. Malcolm erre elfordította a kilincset. talán csak eltakarja. és futásnak eredt. vannak pillanatok. Félrebillentette a fejét. Grant megmeredt. és a kislány kizuhan a kocsiból a sárba. Addigra már Grant is kint volt a kocsiból. amikor az embernek határozottan az az érzése támad. Érezte. a húga meg ráesett. A tyrannosaurus ismét elbődült. Aztán a kocsi megint a magasba emelkedett. mint valami rongybaba. és lecsapott a kocsi tetejére. Megszólalt Malcolm: – Tudod. a földet is megpillantotta valahol mélyen maga alatt. ahogy elhalványult a villám fénye.. – Atyaúristen! Mi lett a kocsival?! Grant hunyorgott. és bömbölt egyet. . Meredt tekintettel bámult előre. – Nem. Nem védte. mi történt ezután. – Úgy hangzott.. És nem tett semmit. – Úgy hangzott. amint a pálmafák törzse lefelé elsiklik mellette –. a karmok fémes csikorgással siklottak le róla. vakító fény pillanatában elborzadva látta. Állt a Land Cruiser mellett. – Hm! Van valami javaslatod arra nézve. hogy valami lassan kúszó kimerültség lesz rajta úrrá. Mellette vágtatott a tyrannosaurus. de nem támadott.. Hirtelen magához tért.– Timmy! – sikított Lex bele a fülébe. Ilyen közelről rémisztően hangos volt az üvöltése. Vagy eszik valamit ott. A dinoszaurusz – az alakja elmosódott az eső áztatta szélvédő üvegén – most az ő kocsijuk felé tartott. és előbb az egyik. és belekapaszkodott a bátyjába. megpróbált látni valamit az eső csíkozta szélvédőn át. érezte a tyrannosaurus forró bömbölését. szembe fordult vele. Újabb villám csapott le. elnémult a világ. és Grant a hirtelen felvillanó. – Timmy! – ordított Lex. Mi történik itt? A hatalmas állkapcsok nyíltak és csukódtak. De alighogy elindult. és Malcolm teste úgy repült a levegőben. A tyrannosaurus dühödten üvöltött. – A kislány volt az? – szólalt meg végre Malcolm. – Látsz valamit? – kérdezte Malcolm a szemét meregetve. A dinoszaurusz sötétben állt előttük az úton. ha a kihalt állatok kihaltak maradnának.. hogy fájt. Tim pedig látta. tompán a kislány sikítását hallotta az eső zaján át. s a tyrannosaurus legfeljebb három méterre volt tőle. Fülelt. Malcolm futott. hogy most mit tegyünk? – Halvány fogalmam sincs – felelte Grant. de ahhoz elég jól látták. hallotta. Baljós. igen. fémes csikordulással kiesett a tyrannosaurus fogai közül. hogy a fák közé rohanjon. hogy reszket a hidegtől és a félelemtől. nem takarta semmi. amikor a tyrannosaurus egyszerre csak megpördült. Grant már látta. hogy talán jobb volna.. Röpködött a sár a lába nyomán. hogy tudják: most éppen lehajol. lassú léptekkel egyenesen feléjük jött.. nem hallja-e a kislányt. – Nem tudom. amint a tyrannosaurus újból lecsapta a kocsit. óriás farka himbálózott a levegőben. Hatalmas zuhanás következett és Timnek egy pillanatra még felfordult a gyomra. hogy a tyrannosaurus ordítva előreveti magát. Érezte. Aztán a kocsi egyetlen éles. Indult volna. hogy késő. De nem. a villogó szemet. Nem sokat – felelte Grant. Ültek a kocsiban.. A másik kocsi nem volt ott! Grant nem hitt a szemének. Grant megfeszítette izmait. Grant számára nem volt teljesen tiszta. mert a következő pillanatban vadul megfordult körülötte minden – látta. olyan közelről. mintha ő lett volna. aztán a másik szemével a Land Cruisert nézte.. A kocsi tetején dörömbölt az eső. a pálmafák tetejét. Kezét az ajtóborítás féméhez szorította. és tisztán látta: a kocsi eltűnt. és füleltek mindketten. – Mi történt? – kérdezte Malcolm. A tyrannosaurus hátat fordított. és megint bolondul elfordult a világ. Újabb villám. de Tim nem tudott válaszolni. Tim hasító fájdalmat érzett az oldalában. Grant távolról. bőrig áztatta az eső. Grant érezte. és szaglászik a földön. mielőtt végleg elsötétedett. kirúgta az ajtót. alig néhány centiméterre Granttól. hogy enged alatta az ajtó.

Aztán a kocsi hátulja felé haladtában belökte az ajtót. hogy érezze. Mi történt? Lehetséges volna. és hogy lássa: csak úgy rohan felé a föld. az édeskés vérszagot. amíg kibírja. és egyenesen Grant felé tartott. hogy ott van valahol. hogy az állat a kocsi hátuljára erősített gumit szagolgatja. az óriás fej emelkedett. és látta. Nem. s ezzel egy időben meglepő élményben volt része: átélte.A láb a sárba vágódott. és egyetlen mozdulattal felrúgta a kocsit. Kétségbeesetten igyekezett megőrizni mozdulatlanságát.. miként válik hidegebbé a világ. A száj kinyílt előtte. Az az arcán érezte az állat meglepően forró leheletét. hogy a tyrannosaurus nem látta őt? Pedig úgy tűnt. Bömbölésével próbál ráijeszteni. és elárulja magát. kívülről figyelő zugában meg is találta erre a választ. Láthatatlan. Ám a nagy fej elsiklott mellette. Grant égő fájdalmat érzett. hogy érezte a szájában rohadó hús szagát. Végül. hát inkább zavarodottnak látszott. várta az elkerülhetetlent. Ha valaminek. aki mozdulatlanul állt. Bekukucskált az elülső szélvédőn. hogy arcul vágja. Orrával megpiszkálta a kereket. Olyan közel volt az állat. Újra Grant felé közeledett. hogy ne üssön semmiféle zajt. a szíve dörömbölt a mellkasában. hogy a saját teste repül a levegőben. de sejti. Grant számára azonban már világos volt. Az állat nem látja őt. . hátha ijedtében megmozdul. addig biztonságban van. a húsevő undorító bűzét. bizonyára nem. De hogyan lehet az? Grant hátralesett. Grant pislantott egyet. a tyrannosaurus nem látja őt! Ha mozdulatlanul áll. nem. A tyrannosaurus belebőgött az éjszakába. Grant azonban most már kezdte érteni. és az ajkába harapott. mintegy a tehetetlen düh mozdulataként.. Teste megfeszült. amiért. De a tyrannosaurus nem szimatolt kutya módjára. azután a fej visszalendült. Agyának egy távoli. Szédelgett a félelemtől. felemelkedett a hatalmas hátsó láb. Mintha valahogy lassan történt volna az egész. az okot.. s az állat horkantva megvizsgálta a kocsit. kitágult orrlikainak ürege csak centiméterekre volt Granttól.. bőven volt rá ideje. Ezúttal az állat megállt félúton. Fekete. a kocsi vége felé. hogy amíg nem mozdul. Grant körmét a tenyerébe vájta. A fej lassú ívben lebillent.

vidd valamelyik kiszolgáló járművet. – Nyilván a vihar az oka – mondta Gennaro. Az egy kicsit hosszabb. Vagy ameddig megtaláljuk Nedryt. A villám impulzusa a telefonvonalon át visszamászik a számítógépbe. és képregényt olvas. – Az nem jó jel – mondta Muldoon. minthogy a vén szaros itt ugráljon. és újra délnek indult az éjszakában. Akárhogy is. A Land Cruiserek csupán elakadtak az esőben. és ordibáljon nekem! Pillanatnyilag minden rendben. lehet. – Felvette a rádiót. Megint azon törte a fejét. míg a karbantartók csapata ide ér. azt hiszem. – Szólt már valaki Hammondnak. majd két kilométerre innen. – Mekkora fa! – Ki tudjuk kerülni – mondta Harding. Ha szűnik valamit az eső. de egyik sem felel. az egész teste megfeszült. Nincs számítógép. – Valaki még azt az istenverte dzsipet is elvitte! – mondta dühösen Muldoon. Mind a hat csatornát megpróbáltam. és forgatni kezdte a csatornakereső tárcsát. és hátramenetbe kapcsolt. azt azonban Arnold nem tudhatta. hogy vannak rádiók a kocsikban. hogy kutassák át utána az épületet. Úristen! Csak ne most! Ne most! Még ez hiányzott! Hogy a viharban mindenhol kimenjen az áram! A hálózati áramkörök persze mind impulzus védettek voltak. Kevesen tudják. és már kívül esnek ennek a kis készüléknek a hatósugarán. Órákig is eltarthat. az élelmet szállító teherautóknak meg a többinek.VISSZAÚTON – Az ördögbe is! – szólt Harding. Nincs file. – Azt kell használnom. – Tudtál már beszélni a Land Cruiserekkel? – Nem jönnek be a rádión – felelte Arnold. milyen modemeket használ Nedry az adatátvitelhez. – Más sem kell. hogy a kis csirkefogó újra bekapcsolja a rendszereket. – Ezt nem értem – mondta. válasz nem érkezett. hogy a gyerekek még nem jöttek vissza? – Az ördögbe is. hogy egy modemen át egy egész rendszer működésképtelenné válhat. Tudom. hacsak nem tévedünk el. – Van egy utunk a látogatók számára. – Na tessék! Harding benzinmotoros dzsipjében ültek. . és nem is jelentkeztek be. s szemüket meresztve igyekeztek a suhogó ablaktörlőn túli világot pontosabban kivenni a szélvédőn át. Harding újabb csatornákkal próbálkozott. visszafelé tart. hogy érdekesnek fogja találni. Már öt perce elküldte az őröket. aki visszaért a helyiségbe. mert a fő kommunikációs rendszer kiment. Aztán hátradőlt. Arnold megkönnyebbülten sóhajtott. Villám sújtott le. hol lehet Nedry. Szerencsénkre van még egy úthálózat – mondta magyarázólag Harding. – Én vinném – mondta Muldoon –. és nem olyan látványos. – Biztos a villám – mondta Gennaro. De lehet. de működnie kellene. már meg kellett volna találniuk. – Visszamegyek a fordulóig. Harminc-negyven perc alatt így is vissza kell érnünk – tette hozzá Harding –. A kövér disznó biztosan valahol a vécén ül. Megfordult a dzsippel. de onnan sem kapott választ. – Biztos – felelte Harding. és összecsuklott a székben. Ez gyenge. meg egy másik az állatápolóknak. Letette a készüléket. Visszamegyünk erre a szervizútra. – Ők meg nyilván visszaértek a táborba. és eltávolítja azt a fát. hogyan viselkednek az állatok éjszaka. A képernyők felvillantak. aztán rátérünk a szervizútra. Nincs többé RAM. ha beszólok Arnoldnak a vezérlőbe. Várhatnak egy kicsit. Nincs többé előhívható állomány. Arnold mereven előrehajolt. csakhogy azok a keleti garázsban vannak. – Megszakadt minden rádió-összeköttetés. – Ha ki akarsz menni és megnézni. és a vezérlőben egyszerre elsötétedett minden monitor. – Semmi – mondta. hogy kapunk némi bepillantást abba. nem kellene itt maradnunk. – De jó lesz. És Harding hol van? – Gondolom. míg Harding behozza őket. – Próbálja meg a Land Cruisereket hívni – szólt közbe Ellie. és bumm! Leáll az egész. Aztán egyenként újra életre keltek. De az őrök nem tértek vissza. Öt perce! Ha Nedry az épületben van. – Hello. John! Hallasz. John? A készülék csak sistergett. dehogy! – mondta haragosan Arnold.

Nem tudok rájönni. De Nedry csinált velük valamit. – Megpróbáltam. de ha be kell jutnom magába a kódba. az órákig is eltarthat. Szükségünk van Nedryre! Azonnal meg kell találnunk azt a marhát! . mit.– Miért. te nem tudod? Arnold megrázta a fejét.

majd kiszállt. Azt hinné az ember. és meglátta. úgy. Fel kell adnia az eredeti tervet. tudta. hogy a lába puha talajba süpped. Fehér villanás a fényszórók előtt. amelyet esővíz csíkoz. Egyszóval mindenre gondolt. újra be kell hatolnia a komputerbe. hol a fenében van. Mély lélegzetet vett. Nedry szinte észre sem vette. Arra az esetre. – A folyónál. Nedry mindent a legaprólékosabban kidolgozott. hogy az út két méter magas szürke betonakadályokban végződik. Csak nem az óceán? Nedry sietősre fogta lépteit. leadja az embriókat. Megtehetné. hogy visszamegy odáig. egyre idegesebb lett a terve miatt. és szélesre tárta. . Egy darabig nem mozdult. A fékre taposott. Nagy patkánynak látszott. ha netán Dodgson megfeledkezne a pénz hátralévő részéről. de Nedry úgy érezte. Órájára pillantott. Már el kellett volna érnie a keleti dokkot. bugyborékoló hang erősödött. Az állat vastag farkát maga után húzva gyorsan befúrta magát a bozótba. hogy látni akarja a pénzt. Visszament a dzsiphez. egyre beljebb vonzotta. holnap estére. hogy szinte fájt a verése. de nemsokára meg kell pillantania a partot és az óceánt. Érezte. bagoly huhogott halkan az erdőben. Nem is emlékezett semmiféle útelágazásra. A számítógép automatikusan megjegyez minden telefonhívást. és néhány másodpercen belül vissza is ér. Hol a pokolban van? Megkerülte a beton útakadályt. fuccs az egész tervnek! Nedry pedig nem várhat soká. hogy egy oposszum megélhet itt. Balra lesz! „Ez az istenverte vihar! – gondolta. Kinyitotta a kaput. mert hamarosan hiányolni fogják a vezérlőteremben. Az egész elképzelés lényege – a terv ezen alapult – az volt. Gyorsan hajtott – túlságosan is gyorsan –. De akkor hol a dokk? Kis híján sokkot kapott. mormoló víz zaját hallotta. s a túloldalon. A folyó! Az őserdei folyónál van! „Az istenit! – káromkodott magában. hogy szétfröcskölnek a fején a súlyos esőcseppek. még mielőtt bárki is észrevehetne akármit. és becsukta a kaput maga után. és előrehajolt a kormány fölött. érezte. behajtott. Csak az ablaktörlők ütemes surrogását hallotta. Vagy oposszumnak. és már legalább öt perce volt úton. hogy Nedry a kocsival elmegy a keleti dokkba. Inkább rá kellene jönnie. de az túl soká tartana. és megpillantotta a folyó sötétlő áramát. van rá esélye. az eső hangjával együtt. A dolog lényege. mert feltűnik a távolléte. egészen odáig ment. Az igazi indok persze egészen más volt: Nedry titokban magnóra akarta venni a beszélgetésüket. És ezzel már benn is volt magában a parkban. hogy kifutott az időből. Nincs már választása. Rossz irányba fordult volna az útkereszteződésnél? Aligha. hogy a dinoszauruszok kipusztították már az efféle állatokat. amikor Nedry odaér. de tartania kellett a menetrendet. és lassan kiengedte a levegőt. Hol van már az az átkozott dokk? Gyorsan hajtott. hogy jobban lásson az esőmosta szélvédőn át. és törölnie a hívásra vonatkozó feljegyzést. ÉRINTÉSE ÉLETVESZÉLYES!” Nedry azonban puszta kézzel nyúlt hozzá. – A végén még mindent elront!” – Mert ha Dodgson hajója nincs a keleti dokkban. Kiszállt a dzsipből. hogy közben néven is nevezi Dodgsont. hogy neki fog rohanni –. Egy azonban biztos: nem maradhat tovább idekinn a parkban. talán másfél kilométernyire a keleti dokktól. Visszanézett. belerohan a falba – sőt. Mintha csak válaszolna. Már a hetedik perc is elmúlt. aztán kétségbeesetten forgatta a kormányt ide-oda. Leveleken csattanó esőcseppek. amikor befordult a sarkon. ahogy menet közben a szeme egyre inkább hozzászokott a sötétséghez. Kivéve ezt az átkozott vihart. míg a dzsip végül csúszva megállt. Dennis! – jegyezte meg magának hangosan. Biztos. Keskeny úton vezette a dzsipet. míg hirtelen kibukkant a növényzet közül. Rátaposott a gázra. Igyekeznie kell. hogy szervezzen meg egy újabb találkozót a számára a keleti dokknál.000 VOLT. Újra az órájára nézett. A mormoló. hogy Dodgsont is rávette arra az indulás előtti utolsó találkozóra a San Francisco-i reptéren azzal az ürüggyel. és megpróbálja valahogy értesíteni Dodgsont. de hol?!” A folyó több kilométeren át húzódik a dzsungelen keresztül. Fura.NEDRY A táblán ez állt: „ELEKTROMOS KERÍTÉS. Sűrű dzsungel mind a két oldalon. hogy meg is valósítsa mindezt. olyan kemény esővel. Nedry egy szörnyű pillanatig azt hitte. Valami átfutott előtte az úton. minthogy visszamegy a vezérlőbe. Nedry a szalagról készült másolatot is mellékelte az embriókhoz. hogy valahol rossz felé fordult. Fekete őserdő szegélyezte az utat mindkétfelől. az orra alig fél méternyire a faltól. és megpördült a tengelye körül. helyreállítja a számítógépet. végig az úton. és megnyomta a gombot. FESZÜLTSÉG 10. mire a dzsip megcsúszott. – Bajban vagy. Miután Nedry felveszi a kapcsolatot Dodgsonnal. Hat perc múlt el. Nem tehet mást. Igazi trópusi vihar volt. hogy kigyulladjon a digitális kijelző.

Amint hallgatózott. És a keze is viszketett. Megreszketett alatta a föld. félig mászva megkerülte az akadályt. értetlenül odanyúlt. Lenézett. huhogó hangját. mégsem látott semmit. és egy nagy. Nedry érezte. és vadul csapkodott a levegőben. és újra hallotta. A dinoszaurusz meredten nézte őt. Összeszorította a szemét. de még így is hallotta. habos csomót pillantott meg átázott ingén. . És közel. fekete foltokkal. Megint hallotta a halk bagolyhuhogást. Nedry nem járta végig az utat a többiekkel. mintha valami nagy dolog közeledne felé lassan az őserdőn át. s amint érezte. és Nedry érezte: a dinoszaurusz közeledik. Egy pillanat múlva a kocsiban lesz. Talán megijesztette az autó fényszórója. nem támad-e mégis. Az állat már ott volt. A kín fokozódott. hogy eltakarja. hogy valami nedvesen a mellének csapódik. Nyál! A dinoszaurusz leköpte! „Undorító!” – gondolta. Letörölte a kezével. zörgő hangot hallott az aljnövényzetben. hogy kinyissa a szemét. Várt. Az útakadály függőleges falát súroló reflektorfénytől kezdte jobban érezni magát. mint a saját bele. de már látta maga előtt a dzsipet. és valami pikkelyesre és hűvösre zuhant. csapódó. hogy az állat előtör a növények közül. s érezte. és szinte azonnal újabb nedves ütést érzett. a fájdalom már teljesen úrrá lett rajta. és imbolyogva a kocsi oldalának dőlt. Nedry kinyitotta a kocsiajtót.. Valami nagy. hogy meggyőződjön. hogy lábára állítják. kínzó fájdalmat érzett a szemében. hogy a feje ismét felcsapódik. aztán valami furcsa. amikor hirtelen szörnyű. irányt vesztetten. valahonnan jobb felől. hogy közeledik. meglepően meleg masszát érzett. Bőrig ázott. s még a lélegzete is elakadt a fájdalomtól. már csak egyetlen. Nedry várt. És akkor újabb. de gusztustalan! Csakhogy a nyakán a bőr már kezdett viszketni és égni. Még közelebb van! A sötétben belebotlott a gyökerekbe. Térdre esett. mintha tüzes kést döftek volna a hasába. aztán megint újabb fájdalom hasított a fejébe mindkét oldalon. mint a tűz. szinte üvöltő fájdalmon át. De látni nem látta. védekezésül a támadás ellen. közelről jön. és noha a fájdalom ellenére rákényszerítette magát. Köpés. a dzsungelből. csak ismét hallatta halk.Nedry visszaindult. aztán egy hirtelen mozdulattal felkapta a fejét. és nem látta a dinoszauruszok különféle fajtáit. és aztán tűnés innen a pokolba! Félig futva. És huhog. A dinoszaurusz immár közel volt. s amikor ezt felfogta. Majdnem olyan érzés volt. érezte. Odakapott a kezével. Kíváncsian. huhogó kiáltását. Valahogy nem egészen olyan volt. A dinoszaurusz tíz-tizenkét méterre állt tőle. közben visszapillantott a dinoszauruszra. a fény alkotta tisztás peremén. És úgy tűnt. A dinoszaurusz nem mozdult. Célba vette a kocsi világító fényszóróját. s a fején két vörös. Semmit sem látott. és hortyogó lélegzetvételének hangját is halványan felfogta. Leste. és iszonyattal fogta fel. hogy a dinoszaurusz foga közt van a feje. V-alakú taréj futott végig. az oldalára dőlt. A dinoszaurusz szembeköpte! De mire felfogta ezt.. csak villogó fényfoltokat a fekete háttér előtt. Egy nagy dinoszaurusz! Ki innen! Nedry futásnak eredt. amint Nedry valahogyan lábra állt. Jókora zajt csapott futás közben. s a lélegzete csak távoli sípszóként szólt azon az állandó. végső kívánsága maradt. mintha sav ért volna hozzá. Úristen. hogy minél hamarább véget érjen minden. csöpögő. és ekkor megdermedt. s ezúttal megállt. Kifejezetten úgy hangzott. égő fájdalom hasított belé. mintha a tarkójáig érő tüskéket döftek volna mindkettőbe. mint a bagoly hangja. arca a nedves földbe nyomódott. és távol tartotta. Nedry rogyadozott. A háromméteres test sárga volt. már tudta. De nem támadott. látta. A saját beleit tartja a kezében! A dinoszaurusz felszakította a hasát! Kidőltek a belei! Nedry összeesett. Hányinger és szédülés fogta el. zihálva. Megvakult! A huhogás erősödött. éppen az inggallérja felett. hogy síkos hab csurog lefelé az orra két oldalán. s a rettegése leírhatatlan volt. az. De nem közel. Összecsuklott. Az állat lába volt az. de ez nagyon furán nézett ki. amitől villogó fényfoltok tűntek fel szorosan összepréselt szemhéjai mögött. amelyről tudta: azonnal bekövetkezik. támad-e az állat. vakon az inge feltépett széleit tapogatta. Előrenyújtotta kezét. Négykézláb kúszott tovább a víztől csöpögő bokrok között. ezúttal a nyakán. hogy az nem más. Hallotta lágy. pocsékul érezte magát. Visszapillantott a dinoszauruszra.

Henry! Henry Wu lelke hirtelen megkönnyebbült. önfeledten boldog gyerekarcokat.. hogy minden úgy legyen. – Friss gyömbérből készült. – De azért a fagylaltnak hagyjon egy kis helyet. falra erősített videomonitorára. – Ugyan. Részben talán abban. dehogy – mondta Hammond. hogy a korral jár. – Nincs arra semmi ok. Talán az öreg végül mégiscsak szembenéz a tényekkel! – Miféle félelmei? – Hát tudja. Ha valami probléma volna. hogy végre a saját szemükkel láthatják a csodás állatokat. akkor az egész Jurapark kétségessé válik: a genetikai fejlesztési eljárásaik. – De engem egyik sem nyomaszt annyira – mondta Hammond –. – Vagy tán Nedry még mindig nem végzett az adatátvitellel. ismétli önmagát.. hogy a dinoszauruszok szaporodnak.. – Köszönöm. – Tényleg? – pillantott oda az. hol meg könnyes érzelmesség lesz rajta úrrá. ahogy kimegy a szobából. Hammond azonban makacsul ragaszkodott hozzá. Wut szinte sokkolták azok a jelek (még ő sem tudta rávenni magát. Eltántoríthatatlan akarat. Részben pedig egyfajta érzelmi kiegyensúlyozatlanságban: hol hirtelen felfortyan. Ha pedig ezek az állatok valóban szaporodnak. Ezt azonban még mind úgy is fel lehetett fogni. hogy folytonosan el-elkalandozik. Mégis volt Hammond viselkedésében valami. Wu egész vacsora alatt azon tűnődött. Nem keveset kell rendbehoznia ezen a hétvégén... Egyfajta ellenállás. hogy nem láthatom azokat a ragyogó. amelyek arra utalnak. a Jurapark igazából gyerekek számára készült. amibe belefogtunk. régi történeteit meséli újra meg újra. amit a sziget keleti részén szedtek. a kontrolmódszer. mi a helyzet – mondta Wu. a vonalak egyszerűsége. Nedry zseni a maga műfajában. arról már tudnánk. a gyerekek nem ijednek meg egy kis vihartól.. eltolva székét az asztaltól. jó. Miután Grant kétéltű-DNS felől kérdezősködött. hallgatag szolgálólányt. amelyet Hammond önmagának építtetett. Henry! – szólt Hammond. – Talán át kellene mennem a vezérlőbe. hogy a bungaló. és megnézni. Tipikus aggastyánszenvedély: fagylalt! De azért. nem kérek – felelte Henry Wu. és letette a kagylót.. és boldogok – igazán boldogok – lesznek itt! Ragyogni fog az arcocskájuk az örömtől. – Mindjárt beszólok Johnnak a vezérlőbe. Hammond vállat vont. – A telefonkagylóért nyúlt. és az utolsó pillanatig keményen kézben kell tartani. nekem vannak bizonyos félelmeim ezzel a parkkal kapcsolatban. – Hammond bungalójának ebédlőjében ültek. ahogy neki tetszik. – Csak egy kicsit kóstoljon meg belőle. Wunak el kellett ismernie. Wu azt tervezte. Odakünn felragyogott a villámfény. igazán elegáns. és hátradőlt. A világon minden gyerek imádja a dinoszauruszokat. de más. mint az. Henry Wu halogatás nélkül utána akart nézni az adatoknak. hogy a személyzet még nem is volt teljes. – Ó. Henry – mondta Hammond. hogy a telefonból csak zörej szól. – De nem tehetek róla. – Nyilván bedöglöttek a telefonvonalak is – mondta. de folyton hajtani kell. – Semmi nem megy már le a torkomon. dísztelensége már-már japános tisztaságot sugároz.. Csak attól félek. s szinte azonnal követte a mennydörgés csattanása.A BUNGALÓ – Még egy kis kávét? – kérdezte udvariasan Hammond. Csakhogy volt még valami ezen túl is. aztán felpillantott a helyiség egyetlen. – Nem működik a monitora – mondta Hammondnak. és utánanéz a különböző DNS-együttesekről készült számítógépes kimutatásoknak. – Ez közel volt – jegyezte meg Wu. azt nem hinném – felelte Hammond. minden rendben legyen. hogy én ezt már nem érem meg. Henry. Az épület a park egy félreeső zugában bújt meg.. – Wu elnézte a szép. ami nyugtalanította Wut. S ha még . John Hammond végül is már majdnem hetvenhét éves. Tudja. És mindennek eredményeképpen még csak foglalkozni sem hajlandó azzal a valósággal. A képernyő sötét volt. Belekósolt a fagylaltba. – María gyömbérfagylaltja egyenesen mennyei! – No. – Remélem. nem messze a laboratóriumoktól. Wu engedelmesen megmártotta kanalát a fagylaltban. ha azt akarjuk. különösen ha figyelembe vesszük. Ó! María tért vissza a szobába két tányér fagylalttal. hogy ne kelljen szembenéznie a tényekkel. Mert ha a dinoszauruszok tényleg szaporodnak. ha csak egy árnyalatnyit is. miben is áll ez a másság. pillanatnyilag más problémáink is vannak – komorodott el Wu. hogy bizonyítékként fogadja el őket). hogy azonnal a laboratóriumba megy. – Én azt hiszem. Hogy én már sosem fogom látni azokat a ragyogó arcocskákat. minden! Még a lizin-függőség is gyanúba kerül. Az öreg valahogyan más volt. hogy vacsorázzon vele. Wu hallotta. Követte a tekintetével. amely most a szigetét fenyegeti. és vadon is megélnek. És a vacsora is kitűnő volt. A mi diadalunk ez a park! Megvalósítottuk. – Biztos a vihar az oka.

. Üzleti szempontból tehát az emberiség igen rossz befektetés. ha szerencséje van. hogy idejöjjön. Elutasítják a szabadalmi kérelmét. Semmi okot sem látok arra. amitől észretér – és sokkal olcsóbban adja majd a gyógyszerét. Nedry az a kövér ember. nincs az épületben. Ismét mosolygott. Szóval bizonyára emlékszik. „Rablás!” – fogják kiabálni kórusban ők is. a betegséget? Nagy ég.és más mellékes bevételek pedig megduplázzák ezt az összeget. – Az őr habozott. Lewis Dodgson azt hiszi. – A jó édesanyját! – kiáltott fel Muldoon. mint a Genentech és a Cetus. A szórakozás senkinek sem létszükséglet. igaz? Parancsol még egy kis fagylaltot. – Haitiből jött. dehogy! Micsoda szörnyű ötlet! Az az új technológia igen alacsony hatékonyságú alkalmazása volna. és persze nekik a pénzük is sokkal több. hogy kis otthoni állatkákat állítsunk elő gyerekeknek. – És mégis. ha ő találta fel a gyógyszert. És azt is tudta.emlékszik. A magas árat pedig. nemhogy rablásnak vennék.. Mr. – A garázsba?! Mikor? – Úgy tíz-tizenöt perce. Mondjuk. Wu már tudta. látta a kövér embert lemenni a garázsba. – Ha maga biotechnológiai céget akarna alapítani. Felemelte a kezét. maga mit csinálna? Olyan termékeket. – Találják meg! – Azt hiszem. egyenesen növeli a park vonzerejét. Sok-sok pénzt. aki a főhallban van. Státusszimbólum lesz belőle. hogy hálásak lennének. hogy bárhol is vagyunk a világon. Hammond elmosolyodott. Henry. A két következő park építési munkálatai már a jövő év elején megkezdődnek. mi volt az az eredeti cél. hogy Hammond megint valamelyik régi beszédének előadására készül. Hammond szomorúan ingatta a fejét. – Nem idevalósi – mondta rápillantva Hammond. Én személy szerint sosem segíteném az emberiséget semmiben! Wu nem először hallotta már ezeket az érveket. ne legyünk kitéve a kormány beavatkozásának. fel lesznek háborodva. – Nos – folytatta Hammond –. – Semmi szükség nincs rá. a szándékunk kezdettől fogva az volt. ezt tervezem. Henry. reklám. Ott lesz a „Jurapark Japán”. És ha napi ötezer dollárt kérnék a parkomért? Ki szólna bele? Ki akadályozná meg? Végül is senkinek sem kényszer. ha a tömegszórakoztatással foglalkozik. hogy a gyógyszerek útjában rengeteg az akadály. . Addigra a közvetlen bevételek meghaladják majd a tízmillió dollárt. hogy az emberiség leküzdje a járványokat. Nem avatkozik bele semmiféle kormány. – Én jól ismerem mindezt. Ahelyett. mennyire más minden. Az ember azt hihetné. – Igen. Hammond végzett a fagylalttal. Pedig hallom. Muldoon megpördült a sarkán.. Adjunk új gyógyszereket az emberiségnek! Igen-igen nemes cél! Csak az a baj. Történik valami.. hogy a kormány ezt meg is fogja engedni magának? Nem. Csak a Szövetségi Gyógyszerészeti Hivatal engedélyezési eljárása öttől nyolc évet vesz igénybe. – Szóval Jimmy. és semmilyen más szervezet sem. nem engedi! A betegek nem fognak ezer dollárt fizetni egy adag életfontosságú gyógyszerért. Akkor aztán valami közbejön. és María némán kivitte az edényt. ő fizette a fejlesztést és a vizsgálatokat. hogy a génsebészet újonnan kifejlődött technológiája révén pénzt keressünk. – Vizsgálják át a karbantartó épületet. amely arra késztetett bennünket. akkor az az ő előjoga. Ronda kövér alak. adagonként ezer vagy kétezer dollárt lehetne kérni érte. Guam közelében pedig még régebben vásároltunk meg egy szigetet. ugye? – Úgy van – felelte Arnold. Az anyja francia. mind gyógyszergyártással kezdték. Arnold. hogy mennyit kér érte: amennyit akar. azt mondja. – Évi húszmilliárd dollár! – mondta halkan Wu. a legelső géntechnológiai cégek.. Arnold – mondta az.. a kereskedelmi. és érthetetlen problémákba ütköztek. hogy szélsőséges spekulációkba bonyolódjunk. A fejét csóválta. – Akkor keressék a kastélyban! – mondta Arnold. talán emlékszik. – Ha már a világ többi részéről van szó. hogy Hammondnak igaza van: egyes génsebészeti úton előállított gyógyszerek valóban indokolatlan késéseket szenvedtek. De azt hiszi. de találják meg nekem! – Az a helyzet. sikerül valami csodaszert készítenie a rák vagy a szívbaj ellen – mint a Genentechnek. akkor gondoljon bele. Nem adják ki az engedélyeit. nézzenek körül mindenütt. a raktárat. televíziós-. hogy ebbe az irányba mozduljon a cég: az. Henry. Henry? – Megtalálták?! – förmedt rá Arnold a vezérlőterembe lépő őrre. – Nem. Nem fizet a Vöröskereszt. Azt pedig minden amerikai imádja. De ami még nagyobb baj: külső erők is beleszólnak a piaci viszonyokba. – Mr. és ez nagyon óvatos becslés – mondta Hammond. Négy éven belül nyitni fognak. – Kövér. – Már bérbe is vettünk egy jelentős részt az Azori-szigeteken a „Jurapark Európa” számára. John. Tegyük fel. ha idelátogat valaki. Meg a japánok is. Mr. amelyek célja.

de rémségesen drága. Az állatok továbbhaladtak. kellemetlen szagú tárgy a környezetükben. hogy a tudósok megpróbálják majd korlátok közé szorítani a tevékenységét. Nem haladni akarnak. „Procompsognathidák – gondolta Ellie. hogyan – mondta Hammond. A csapat hat állatból állt mindegyikük akkora volt. – Én nem erre gondoltam – szólt közbe Wu. Hirtelen ismét a fékre taposott. – Valószínűleg akkor sem reagálnának. amit akarnak. de amióta csak az apatosaurusok átkeltek előttük az úton. – Vajon ezek hová mennek? A kompik nem éjjeli állatok. imádni fogják! A dzsip hátsó ülésén Ellie Sattler kibámult az ablakon. A dinoszauruszok látási élessége kiváló. Ez volt az az állat. A reflektorok fényében Ellie egy apatosauruscsordát látott átvonulni az úton. – Már közel vagyunk az őserdei folyóhoz – mondta vezetés közben Harding. Ezek az állatok azonban nem mutattak félelmet. – De hát mégiscsak látnak! Vagyis ha kiszállnánk a kocsiból. aztán leültek a hátsó lábukra. mint egy teljesen kifejlett ló. Henry! – mondta bosszúsan Hammond. még csak rá sem néztek a dzsipre és a világító fényszórókra. Meg a tyrannosaurus is tudja. mint a Genentech gyógyszerei. Az apatosaurusok sietség nélkül. ahol a létrehozott állatok egyszerűen túl drágák ahhoz. és láthatná őket!” – tette hozzá magában. – Közben ő és Hammond átköltöztek a nappaliba. ezért nem is érdekes.. A kocsi csúszva megállt. Az apatosaurusok akkorák. hogy lezárassák. aki megakadályozzon benne. – Nekem az az érzésem – mondta Wu –. És én mondom magának.A dzsip hirtelen. nagy meglepetésben lesz részünk. Henry. – Arra van. – Nem egészen. és körülfogná a kocsit. bőrük csillogott az esőben. A technológia ragyogó. mint egy ház –. trombitálna. Vagy akár leállíttatni. Harding megvonta a vállát. – Nem látnak bennünket? – kérdezte Ellie. hogy a maga parkja éppúgy nyomásnak lesz kitéve.. éppen csak nem vesznek tudomást rólunk. hogy kijöttem éjszaka egy-egy beteg állathoz. éppen egy kis. És ezt tudják jól. Egyetlen farokcsapással ki tudnák törni egy tyrannosaurus nyakát. – Ezek kompik. hogy miért nem? Hát természetesen azért. – Ez nem Amerika! Még csak nem is Costa Rica! Ez itt az én szigetem! Én vagyok a tulajdonosa. és amikor visszafelé tartottam. – Csakhogy ezt egyszerűen nem tehetik meg! – mondta Hammond. még Montanában. és egy kis vizet nyalt fel egy pocsolyából az út közepén. – Magnóról lejátszottam nekik egy tyrannosaurus-üvöltést. – Vállat vont. de a vizuális rendszerük olyan. amely akkora lehetett. Az a helyzet. – Vagy legalábbis a gazdag gyerekekére. hogy megnyissam a Juraparkot a világ gyermekeinek örömére. aztán továbbsiettek az éjszakába. – Bárcsak itt lenne Grant. – Ilyen az élet! – De ha megpróbálkoznak vele. Attól rögtön mozgásba indultak. tudja? Felmásznak egy fára. Előfordult már. Nem vagyunk más. Csicseregtek egy kicsit. – És akkor mit csinált? Harding szája mosolyra húzódott. hogy nem is igazán vannak ragadozó ellenfeleik. Nem mintha túlságosan izgatnák őket a tyrannosaurusok. – Nem tudom elképzelni. folytathatjuk az utat – mondta. Csakhogy az ember eljut addig a pontig. Hammond felsóhajtott. – Azt hiszem. – Egészen jó előadásban van részünk ma este – mondta. – Bizonyára érdekes lenne a tudósoknak. tapasztalni fogja. meg egy bébiből. így nincs tapasztalatuk az autóról. . Amely nem jelent fenyegetést. hogy szemügyre vegyék a kocsit.. amelyet a faxon láttak. Csak kutatni! Nos. – Lehet. aztán továbbállt. csikorogva fékezett. A bébi még le is hajolt. hogy csak szórakoztatóipari tevékenységgel tartható fenn. és a nagy ablakon át gyönyörködtek a parkot korbácsoló vihar látványában. mindig is ez volt. – Különös – jegyezte meg Harding. – És tudja. – Nézzen már szembe a tényekkel. A kis zöld procompsognathidák átszaladtak az út túloldalára. – Bocsánat! – szólt Harding. Egy hasonló nagyságú elefántcsorda megijedt volna a kocsi érkezésétől. Harding menetbe kapcsolt. nem – felelte Harding. hogy kutatásra használják őket. mint általában a kétéltűeké: a mozgásra van beállítva. És nincs az az isten. Mozdulatlan dolgokat szinte alig látnak. Szinte sosem jövünk ki kocsival éjszaka. egy kicsit bal felé. Ujjával játékosan megfenyegette Wut. hogy kutassanak. mert kutatni akarnak! Ez minden. csak valami furcsa. ezek az apróságok órákig is elzárták az utat. zöld állatokból álló csorda előtt. Már vagy húsz perce hajtottak az eső áztatta vadonon át.. – A szó szoros értelmében persze látnak. zajtalanul mozogtak. semmit sem láttak. és kivárják a reggelt. – Elnevette magát. Nem eredményeket akarnak elérni.

és borzasztóan jó a szaglásuk. – Hát magam is kíváncsi vagyok – felelte az állatorvos. Vonzzák őket a döglődő állatok. mint a keselyűk. Megfordult a kocsival. merre tartanak. A kompik dögevők. – El nem tudom képzelni. – Végül is miért ne? Nézzük meg. – Ezek szerint haldokló állatokhoz tartanak? – Haldoklóhoz vagy döglötthöz. ha utánuk mennénk? – kérdezte Ellie. . – Mi lenne.– Akkor most miért vannak idekinn? – kérdezte Ellie. Több kilométernyi távolságból is megérzik a haldokló állatot. és elindult vissza. a kompikhoz.

vigyázva Tim hátranyúlt. és szimatoló hangokat hallatva csoszogott tova. Kinyitotta a szemét. Fejfájása miatt csak lassan. Már alig esett. mozog vele minden. Nem emlékezett rá. Most mit tegyen? Lábujjhegyre állt. s a hátára gurult. a lába. hogyan tört be a szélvédő. s amely olyan volt. amelyet folyamatosan hallott. Tim egy pillanatra eltűnődött. mint aki tengeribeteg. Az agya lüktetett. amely mozgott a szélben. Valami sötét forma haladt el alatta. Az oldalán fekve ring előre-hátra. émelygő gyomra valóban azt az érzést keltette benne. s ezért nem tudja elfordítani. és körülnézett. Áthajolt az első ülésen. amely szemmel láthatóan meggyógyult. Óvatosan. de még mindig hullottak rá vízcsöppek a törött első szélvédőn át. Ez a test széles volt. Csak aludni vágyott. amint tovább himbálózott. Beragadt az ajtó. s Tim látta. Vajon hová lettek a többiek: Gennaro. Tájékozódni próbált. Ki kell jutnia innen! . – A rohadt életbe! A rohadt életbe! – ismételgette Tim. Nehézkesen felkönyökölt. Azon túl pedig szélben mozgó faágakat. Újra elfogta a rosszullét. majd továbbvonult. Elfordult a hányáshalomtól. De a levelek közt itt-ott rések voltak. Bent volt a Land Cruiserben. s a Land Cruiser nyikorgása. A Land Cruiser egy nagy fa ágai közt hevert az oldalán. mert Tim a hátán feküdt. Az utasajtón állva átkukucskált a műszerfal fölött. szédült. A Land Cruiser azonnal megingott a súlypontváltozástól. Tim lenézett. a számlap is összegörbült. Sattler doktornő és az állatorvos? Utoljára a stegosaurus közelében látta őket. Kíváncsian vizsgálgatta az üvegcserepeket. A Land Cruiser még egy méterrel lejjebb került. Szédülő feje. többé nem hallatszott más. A talaj. ahol a kilincsnek nyomódott. és azonnal elhányta magát. ritmusos.. mintegy hét méterrel a föld fölött. Amint megmoccant. s ide-oda ringott a szélben. lüktető fájdalommal. csak arra. a kocsi az oldalára billent. A farka ide-oda libegett. Ez volt az utolsó. De úgy látszott. úgy bámult kifelé. A stegosaurus hangosan szuszogott. hogy az út közepén parkoltak. amire emlékezni tudott. És legszívesebben álomba menekült volna az elől a roppant fájdalom elől. de annak üvegje betörött. amely vagy hétméternyire alatta volt! Tim értetlenül bámult. és megforgatta a hátsó ajtó kilincsét. ügyetlenül felkelt. hol lehet. méghozzá az utasülés ajtaján. Megpróbálta letekerni az ablakot. mintha mozogna az egész világ. a gyomra émelygett. Csend lett. fájdalom hasított az arccsontjába. látta. Most jutott el a tudatáig az az állandó. s a keze fejével letörölte a száját. – A rohadt életbe! – mondta. hogy hosszú tüskék vannak rajta. Hátha azt ki lehetne nyitni. Mikor is volt az? Az órájára pillantott. Az ajtókilincsen állt. s kinézett a kitört szélvédőn át. de annyit meg tudott állapítani.TIM Tim Murphy a Land Cruiserben feküdt. s a kormányt látta maga fölött. Lecsatolta és félredobta az órát.. Még a számokat sem tudta kivenni. gömbölyded. mintha valami hajón himbálózna ide-oda. Semmire sem emlékezett. Nem lesz képes kinyitni az ajtót. és behunyta a szemét. hogy az egész kocsi folyamatosan mozog vele. A kerék üresen forgott a kezében. s ezzel egyidejűleg egy-két méterrel lejjebb esett a fán. Fájt az egész teste. Négykézlábra kuporodott. mindkét karja. Savanykás epeízt érzett. majd a Land Cruiser hangos reccsenéssel helyzetet változtatott. fokozatosan tért vissza az öntudata. Mozog az egész kocsi! Tim óvatosan. Nem látta valami jól a sötétben. de az is beragadt. s azokon át látszott a talaj. – A rohadt életbe! Reccs! Ezúttal még hangosabban. – Hogy jut ki innen? Horkantó hang hallatszott. míg a hányinger elmúlt. Rosszul volt: továbbra is úgy érezte. A stegosaurus volt az. mint az előbb. Először csak sűrű levélzetet látott. apránként szedte a levegőt. hogy közelebbről is megvizsgálja a kilincset. nyikorgó hang. Szeretett volna jobban látni. de legfőként a feje – rettenetesen. Amikor azonban megint kinyitotta a szemét. hogy kifelé görbült. hogy ez igaz is: a Land Cruiser tényleg mozog. az arca a kocsiajtó kilincséhez nyomódott. Ki kell jutni innen! Tim lenézett a lábára. Támasztékot keresve a kormánykerékbe kapaszkodott. Tim nyöszörgött. Lassan. Nem a tyrannosaurus volt. amikor elindult feléjük a tyrannosaurus. Ekkor eszébe jutott a hátsó ajtó. még az ingét is bemocskolta. csak a szél zaja a levelek közt. ő pedig Grant doktorral beszélt. mint egy himbálózó hajó pallóinak nyikorgása.

. de a helyzete megmaradt. elektromos szikrák esője hullott és ropogott szanaszét. néma volt. és hozzávágta. és megtalálta a rádiót. A rádió összetört. Aztán már csak zuhant. nagyon lassan orrával lefelé fordult. hogy a parkon belül van valahol. egyenesen felé. ez most már biztos! Tim sietve kúszott lefelé. A nagy. Tim erőt vett magán. és elforgatta a kilincset. mint valami sátáni száj. még a levegő is kiszállt belőle. A Land Cruiser nyöszörgött. Bemászott a Land Cruiser összezúzott első szélvédőjén át. aztán legelőször Tim válla ütközött a puha talajnak.. A kisfiú zuhant. Tim felkapott egy követ. és megindult.. és a főúton találta magát. és visszacsoszogott arra. Úgy mozgott. lefelé – és megakadt egy fél méterrel lejjebb lévő faágban. Látta. és felsisteregtek. foszforeszkáló zöld képet. zöld rácsozat és a fényszórók éppen Tim feje fölött hintáztak.. kifér rajta. amelyen alig néhány perce még Tim hevert. egyre sebesebben rohant Tim felé. Recccs! A kocsi megmozdult. Az állat morgott. balra nézve meglátta az összeroncsolt kerítést. a gyomra égett a fájdalomtól. Ekkor eszébe jutott az éjszakai nézőszerkezet. Tim nekidőlt az összevissza horpadt Land Cruisernek. és elindult arrafelé. vakító fény az agyában. ahogy tudott.. Felvette magára. de Tim úgy gondolta. hogy mi a baj: zárva van! Tim felhúzta a zárórudacskát. A fiú összehúzta magát.. bután mozgott. Odafutott. Vissza kell jutnia a többiekhez valahogy. A kocsi horpadt orra csak centiméterekkel volt a fiú arcától. minden testrésze fájt. A nagy. Nyilván a Land Cruiser zuhanásának hangja csalta oda. a lába kilógott a kocsiból. egy rándulás. Ügyes mászó volt. A néző azonban működött. Az ág abban a pillanatban meghajolt. ágról ágra ütődött a teste. Kétoldalt az ajtókeretbe kapaszkodva Tim lassan leereszkedett az ajtónyíláson át.. de a tyrannosaurus könnyedén letiporta. Tim átsietett rajta. Pontosan olyan ostobán. akármilyen gyorsan mászik is lefelé. ahogy a Land Cruiser úgy tör át az ágakon a nyomában. gurult. és benézett. így hát egyszerűen elengedte az ágat. aztán ránehezedett. és Tim tudta. mély lélegzetet vett. amely a stegosaurus fejét találta el. Tim felnézett. hogy a stegosaurus visszajött. Ütődött. Hamarosan a hasán feküdt a lejtősen elhelyezkedő ajtón. ahonnan jött. aztán eltörik. pedig. és éppen annak az ágnak ütközött. s forró. A kisfiú még mindig vagy négy méterrel lehetett a földtől. És ezen a fán jól lehetett mászni. amelyek égették a fiú bőrét. sem Malcolm doktornak semmi nyoma. A kerítés négy méter magas volt. egy arc... alacsonyan tartotta fejét. és megpróbálta erőltetni. Sem Grant doktornak. A Land Cruiser nagy.. . Olaj csepegett Tim arcára. melyen a fényszórók a szemek.. de az meg sem moccant. az ajtó pedig szélesebbre nyílt. éppen akkor. nem menekülhet előle. Alig egyméternyit haladt még csak lefelé. szinte lépcsőt formáztak. A stegosaurus tovább közeledett. hogy odafönn meghajlik az ág a Land Cruiser súlya alatt. Az ajtó kitárult. áthaladt a sűrű növényzettel borított sávon. hallotta. de nem tévedhet el! Tudta. míg úgy oda nem szorította testét a fa törzséhez. Egy vastag faágon feküdt. Lélegzetét visszafojtva lassan visszakúszott a hátsó ülésbe. keze-lába lelógott. és körülnézett a sötétben. lassan megfordult. és látta. A kocsi megmozdult. és látta a megnyugtató. Lába meg-megcsúszott a nedves ágakon. majd kihunytak körülötte a nyirkos földön.. Befelé hajlott. Nézőjén keresztül látta a másik Land Cruisert.. amikor a Land Cruiser egy végső nyikordulással lassan.. amely az oldalán hevert. A kocsi üres volt. – Menj innen! A kő tompa puffanással verődött vissza a lemezekről. mint valami őt üldöző vadállat. Aztán újra: reccs. Ekkor azonban a fiú rájött. hogy szinte belebújt. Reccs! – hallatszott megint. És lassan. és kipottyantotta Timet a Land Cruiserből. meg a nézőt. sötét árnyéknak tűnt felette. Közel voltak egymáshoz az ágak. újabb ágat talált. Mászni kezdett lefelé. Valamikor szeretett fára mászni. Bekapcsolta. amikor hangos.Tim megmarkolta a kilincset... mint valami óriásira nőtt teknős. a kocsi pedig repül. A dinoszaurusz esetlenül. Hallotta a csoszogást a sötétben. puffant. Szűk volt a nyílás. Tim lassan lábra állt. alighanem közel a főúthoz. rovátkolt lemezek két sorban futottak végig a hátán. sietni próbált. Ha legalább tájékozódni tudna! Alig látni valamit a sötétben. és előretolta. És ott megállt. égő fájdalom. aztán a Land Cruiser elszabadulva zuhanni kezdett. – Menj már innen! Menj! Újabb követ vágott hozzá. Egy kicsit kalimpált a levegőben – míg valami szilárdat nem ért a lába – egy ágat –. a keze ragacsos lett a gyantától. Lenyúlt. amelybe kapaszkodott. így hát otthagyta. Nagy ütődéssel megállt. és lejjebb kúszott. fémes csengéssel-csattanással a Land Cruiser is földet ért.

Megnézte a mélyhűtő ajtaján lévő rekordert. aztán próbáld a kocsikat hívni! Henry Wu kinyitotta a FERTILIZÁCIÓ feliratú ajtót. hogy az a szubsztancia. a grafikont a csúcsot. Csak állt az úton. mint számítógépen. Benne maradt? Vagy kijött belőle? Összezavarodtak az emlékei. Arnold elnyomta cigarettáját. Dinoszauruszainak előállítása során Wu úgy manipulálta a DNS-t. Rabul ejtette. közben puszta beidegződésből ellenőrizte a műszereket. és lehívta a DNS-sel kapcsolatos nyilvántartásokat. Úgy megsajnálta magát. Elindította a keresőprogramot a számítógépen. egyből elfelejtette a mélyhűtőt. voltaképpen egy olyan vegyület. mint a szobrász az anyagot vagy a márványt. míg lefut. Lex baseball-labdája volt. – Harding dzsipjének már itt kellene lennie. – Vidd a töltőt is! Ezek a mi vésztartalék rádióink. ahogy egyedül állt ott az őserdei úton. hogy olyan DNS-t használjon. De ki menne oda éjjel? A számítógép sípolt. Végül aztán abbahagyta. Wu habozás nélkül a számítógép-terminálhoz ment. Mind a tizenöt fajt le kellett ellenőriznie. Halk volt. Még rágondolni is rossz érzés volt. Végül is a legtöbb élőlény DNS-e teljesen azonos. Ez annyit jelentett. hogy az elemeknek legfeljebb tíz százaléka más. – Biztos. – Szétosztom ezeket az épületben lévők között. Felkelt. Ez furcsa. A DNS-molekula olyan régi. A régi gének egy-két újabb kombinációját – és azt is ritkán. Amint megpillantotta a képernyőt. amely szinte egyidős a Földdel magával. Még nincs. egy felborult. és levegő után kapkodott rémületében. – Nedrynek még mindig nincs nyoma? – kérdezte Muldoon. Még most sem volt világos a számára. és egy darabig csak nyöszörgött. Ezeket nem is lehetett volna másképp tárolni. Felvette. egyszál magában. hogy Lex is a Land Cruiserben volt. mit talált a gép. Wu odament. amely mindennek a közepe – amely körül az élet tánca valaha elkezdődött –. – Lex! Mintha összezárult volna körülötte az éjszaka. kocsi mellett. hogy két vagy három percig is eltart. és belépett az elsötétített laboratóriumba. valaki járt a hűtőben. hogy minden fajnál tíz gigabitnyi optikai lemezkapacitásra volt szükség ahhoz. senkinek sem jutott eszébe. A DNS hihetetlenül ősi anyag. hogy iszonyatos mennyiségű információt kell végigkeresnie. üres. miért tulajdonít Grant ekkora fontosságot a béka-DNS-nek. csakúgy örvénylett körülötte a zöld színű világ a nézőn át. Egyszerre csak megragadta a tekintetét valami halvány dolog az út mentén. Méghozzá nem is régen – a legutóbbi félórában. Muldoon kinyitotta a dobozt. Ha egy ember DNS-ét összehasonlítjuk egy semmi kis baktériuméval. és letörölte róla a sarat. ám valahonnan továbbra is nyöszörgés hallatszott. de mondanom sem kell. Szabadon alkotott. – Mióta már? – kérdezte a terembe lépő Muldoon. Töltsd föl úgy húsz percig. azt látjuk. Nem tudta pontosan felidézni. mindent. . – Átnyújtott egyet Arnoldnak. Hegyes csúcsot vett észre a grafikonon. Azt jelenti. Maga Wu sokszor meg sem tudta különböztetni az egyik DNS-fajtát a másiktól. hogy egy-két perc. hogy az összes ismétlődés és változat tárolható legyen. A mai világban sétafikáló.. Fekete fémdoboz volt a kezében. – Lex! Rémlett. amely jelezte a hűtő hőfokának változásait az elmúlt időszakban. – Félórája. amilyet csak akar. Nem volt ott senki. gondolta. hogyan zajlott le a támadás. és itt lesznek. amikor a tyrannosaurus megtámadta őket. Azóta alig mutatott bármi újat. A DNS-nek ez az alapvető konzervativizmusa arra bátorította Wut.Hová lettek? Hová tűnt mindenki? Hirtelen pánik fogta el. hogy a fejlődése lényegében több mint kétmilliárd éve befejeződött. A DNS akkora molekula. – Nincs. és valahonnan az út egy távolabbi részéről jött. jelezve.. hogy az első adatkeresés befejeződött. rózsaszín bébijeiket hintáztató emberek nemigen gondolnak bele. Jól tudta. amelyben hat hordozható rádió adó-vevő volt. hogy beleült a hideg esővízbe az úton. hogy megnézze. hogy be is dugja őket az áramba. és körbejárta a laboratóriumot. A laborosok nyilván még mindig vacsoráztak. Körbe-körbe forgott.

Azt azonban többé nem tagadhatta. A dinoszauruszok szaporodnak! Futva indult a vezérlőbe.7 Az eredmény egyértelmű volt: minden szaporodó dinoszauruszfajban van rana-.7 3. A többi állatban nincs.LEITZKE-FÉLE DNS-KERESŐ ALGORITMUS DNS: Verziókeresési kritériumok: RNA/összes.0-3.4-2.9 3. Wu még mindig nem értette.1-3. hogy Grantnak igaza van. azaz béka-DNS.0-3. hogyan idézi elő ez a szaporodást.1-2.0 2.7 1. töredék len >0/ RNA=töredékeket tartalmazó DNS Verzió Maisaurus Procompsognathida Othnielia Velocilaptor Hypsilophodontida 2. .

Tisztában volt vele. – Elment. – Még nincs – felelte a bátyja. Aztán kijött. Odabenn sötét volt. Nem jönnél ki inkább? Lex megint kezdte a csőbe veregetni a fejét. Furcsa érzés fogta el. hogy Grant jön feléjük. és újra meg újra a cső falába verte a fejét. A Tyrannosaurus rex. – De biztosan mindjárt itt lesznek. – Ő otthon maradt. – Pihenek. Remegett a hidegtől. Nedves volt alatta a föld. Leült a fűre a csövön kívül.LEX A kislány egy nagy. – De hiszen az előbb itt volt. A kislány értetlenül bámult. ahol a kislány láthatta őt. Nagy kő esett le a szívéről: a húga sértetlennek látszott. – Titeket kereslek! Ed Regis reszketegen talpra állt. hogy már útban is vannak ide. – Hová ment? – Honnan a csudából tudjam? – mondta Lex. és ezt kérdezte: – Hol van Grant doktor bácsi? – Nem tudom. hogy lássa. csak mindenféle csúfnevet. de . ahogy a fejét verdesi a falhoz. Jobb felől jött. Tim megint hallotta a kongó hangot. egy kis alvadt vér tapadt a homlokára. Valószínűleg túl sötét volt hozzá. – Tim remélte. Baseball-kesztyűjével a szájában előre-hátra hintázott. – Egyáltalán van kint felnőtt? – kérdezte a kislány. – Hová? – Azt nem tudom. Meglepetten körülnézett. amelyet Tim alig néhány perce hagyott ott. Lex évek óta nem használta ezt a szót. – Ott van az az óriás. de egy pillanat múlva már válaszkiáltást hallott. méteres vízvezetékcsőben kuporgott. Lex azonban nem mozdult. – Az állatok elmentek – mondta. Igencsak pocsék félórát töltött el két nagy szikla közé fúródva az út alatti domb lejtőjén. hogy „állat”. Magához ölelte a térdét. – Hála Istennek! – szólalt meg. Nem volt jobb ötlete. de a néző segítségével Tim mindent látott. Jókora darabon elhasadt az inge a vállán. Meg hideg is. – Nagyon kényelmetlen lehet ott benn. de egyébként nem volt semmi baja. és várt. – Itt? Mikor? – Az előbb – ismételte Lex. és az orrát ráncolta. Kiabálni kezdett: – Hallóóóó! Hallóóó! Grant doktor? Grant doktor! Timet egy kicsit nyugtalanította a zaj – esetleg visszacsalhatja a tyrannosaurust –. Tim a nézőjén át megkönnyebbülten látta. Ettől Tim egy pillanatra meghökkent. Tim! A kislány nem válaszolt. hogy Lex megmozdul a csőben. igaz is. hogy ez nem valami óriási rejtekhely. Csak ütögette a fejét a csőhöz. Fogadok. – Nézd. – Gyere már ki! Lex szótlanul megrázta a fejét. nagyjából a Land Cruiser irányából. de ezen kívül úgy tűnt. nem esett baja. Lex. én vagyok az. – A labdád. – Miért nem? – Állatok vannak odakinn. – Lex. mi van nálam! – mondta a kezét feltartva Tim. Lex. – Ülök itt egy kicsit – mondta. – Hát anyu? – Ő sincs itt. de már nincs itt. amikor még a csőben voltam. – Láttam. Lex! Megtaláltam a labdád! – Na és? A bátyja most másképpen próbálkozott. – Apu odakint van? – Nincs – felelte Tim. és letörölte arcáról és kezéről a hideg sarat. Ekkor hallotta. oda. hogy amit mond. mely az út alatt húzódott át.

és undorodva az erdőbe hajította az állatot. biztosan az egész testét elborítják! Hiszen végiggurult a dombon. csak futott. futott. Ekkor jött rá. Megint jött a pánik. Szeretik a sötét. Tim orra dagadt volt és fájt. mi a teendő. Rémlett. Miért hagyta abba a kiáltozást? Ed Regis ment tovább. Azzal nyugtatta magát. sziklás lyukak is. sárral borított nyílásban. meleg helyeket. hogy eltörött. Lehet. Ha pedig történt. és ő úgysem tehetne értük semmit. hiszen mindig azt hitte magáról. A kocsi felé. Szinte odabenn van a szájában! Borzongva. hogy zuhanás közben megsérült. míg valami szikla felfogta a testét. mi történt a gyerekekkel. de ő nem állt meg. Mit is meséltek a munkások? A piócák még az ember alsóneműjébe is bemásznak. A Land Cruiserek meg nyilván odafönn vannak a dombtetőn. hogy semmi bajom – kérdezte Lex bosszúsan.. És ez most a legfontosabb. Azt tudta. tehát legokosabb. hogy a duzzadt hús nem más. Egyszerűen elszaladt. de közben már arra gondolt. Nem is tehetett volna semmit. ha marad. ami mintha elzsibbadt volna. amikor azonban kibújt a sövény sűrűjéből. Rajta kívül senki sem fogja tudni. gyerekes szólongatás. és akkor úrrá lett rajta a borzalom és a szégyen. Atyaisten. amikor megtudja. Valahogy a domb aljára került. Ahogy jön felé. ahogy a pocsolyákba taposott. Lex nem mutatott semmiféle fájdalmat. és bizsergett. Egyáltalán nem is látta a kocsikat.. mert most már tudta. és elbújt. Lehet. és igyekezett összeszedni magát. Ed Regis nem nagyon emlékezett. Sem fájdalom. sem ijedtég nem hallatszott benne. hogy Lex szólt hozzá. Így hát Regis maradt a sziklák között. már kezdte átgondolni. Malcolm is. ahogy ott gubbasztott a sziklák közé bújva. És teli vannak a sötét. és csak a tyrannosaurus járt a fejében. A srác nem volt ennyire szerencsés. és nem gondolni rá. Emberi hangot hozott a szél. hogy eddig bujkált. egy kicsit megszorította mindkét karját és lábát. Csodálatos: a homlokán lévő kis vágástól eltekintve teljesen sértetlen. hogy ezután valahogy bemászott a sziklák közé. Már nem hallotta a kislányt. hogy különben is reménytelen a dolog. és hogy mit fog majd szólni mindehhez Hammond. hogy úgy látszik. Ami végül mégiscsak mozgásra késztette. hogy most vissza kell mennie. Máris összeszedte magát. amit gondolt. de fájni nem fájt. egy pillanatra megzavarodott. Annyival is rövidebb a menekülés útja. a domb lábánál. hogy megmentse őket. jó. hogy mindenki megmaradt. Grant is. főleg a szája sarkánál. Jobb válla csúnyán összehorzsolódott. és elindult hazafelé. rettegett. Csak makacs. gurulni és zuhanni kezdett. ahogy az ember egyből kijózanodik. hogy nem az történt. hogyan is irányítsa a dolgokat ettől a pillanattól kezdve. és nem tudott világosan gondolkodni. Hátborzongató ez a hatalmas csend! Ed Regis sarkon fordult. vissza az útra. mi történt valójában. lassan megnyugodott egy kicsit. vagy elpusztultak. már fogalmazta a mondókáját. hátha történt a gyerekkel valami. szóval valószínűleg erre futotta az erejéből. és hogy esetleg a többiek még élnek. csak a saját menekülésére gondolt! Tudta. amiért ott hagyta a gyerekeket. levegőt is alig kapott. Most át kell vennie a dolgok irányítását! Felmászott. Végül aztán. már tervezte is a következő lépést. Ed lassan a tudatára ébredt. hogy a tyrannosaurus még mindig arra jár. nem bírt megállni. ha a kocsiját leinti a rendőr. – Jó.. s érezte. hányingertől reszketve Regis letépte ajkáról a piócát. és dagadt húst tapintott. de azért mégiscsak meg kellett győződnöm róla. Sáros víz fröccsent a lába nyomán. közben igyekezett leküzdeni a rettegést. azt is lehúzta. . Mindkét gyerek tud menni. vagy félórán át. Kiköpött. mi történt ezután. élnek-e. az valami különös érzés volt a szájában. gondolta Regis. fel az úton. talán mégsem kellene odamennie. Ő viszont idelenn van. Elindult fölfelé a dombon a Land Cruiserekhez. – Hallóóó! Grant doktor! Te jóságos ég! Hiszen ez a kislány! Ed Regis figyelte a gyerek hangjának tónusát. Az alkarján is észrevett egy piócát. hogy meleg vér fröcsköl a szájába. Az arcához nyúlt. mint egy vértől dagadó pióca teste. – Hát nem megmondtam. Ha a gyerekek odafenn vannak az úton. de hiába próbált újra meg újra erőt venni magán.megbénította a rettegés. Lihegett. mint valami patkány. Alan Grant végigsimított a kislány testén. aligha maradhattak vagy maradhatnak életben. Grant tartott tőle. Nagy volt a csend. és az is feldagadt. túl az úton meg egyszerre csak kiszakadt a föld a lába alól. Látta sötét nyomát. és képtelen volt megmozdulni. De úgy látszott. amely az ajkát szívja. Szeretnek belemászni az ember. és veszélyhelyzetben is megőrzi a lélekjelenlétét. Eltüntette a rejtőzködés nyomát. ahol van. Ott feküdt a hideg. – Hallóóó! Megmerevedett. És amint mászott kifelé a sziklák közül.. és kísérletet tenni. És ettől a felismeréstől egyetlen pillanat alatt magához tért. Ezek az őserdei dombok teli vannak piócával. És olyan nagy csend van. meg hogy ott elég volt számára a hely. korábban sem. Már nem is szégyellte. Lehet. a tyrannosaurus elment – de legalábbis nem támadott –. utánakiáltott. Fura érzés volt. Regis letörülte a hideg sarat a szájáról és a kezéről. hogy bátor ember. Ő pedig tehetetlen. De csak a dinoszauruszt látta maga előtt. valahogy úgy. a lába ép. végül valahogy sosem sikerült. és magukra hagyta őket.

nem tart soká – felelte neki Grant. Grant betapasztotta tenyerével a száját. Grant azonban a fejét rázta. Kezdetben vérzett a mellkasa. majdnem. – Akkor menjünk lefelé az úton a szállodához – mondta Tim. ahol Regis állt. . nagy. A „kicsi” volt az. Milyen állat lehetett az? Csak egy lehetőség jutott az eszébe: a kis tyrannosaurus. Minden lépésnél megállt. a hang ismét feléjük sodródott a széllel. és futásnak eredt. Lex is meghallotta. Tim óvatosan előrehajolt. ne hagyjatok itt. mitől óvja.Grant maga szintén sértetlen volt. Reccs! Hallották. Elhaladt a fa mellett. horkantó hang hallatszott: a kiengedett levegőé. Az út mindkét oldalán magas kerítés van – mondta Grant. Nem tudta eldönteni. – Ne hagyjatok itt. Odalenn sötét volt az út. – Ha valamelyik dinoszaurusz odalenn van. aztán lassan kilesett a fa mögül. ahányszor csak levegőt vett. ti. Akkor aztán útnak indult. és lefelé mutatott a dombról. Esetlenül mozgott. és a gyerekeket. A tücsökciripelés és békakuruttyolás állandó háttérzaja hirtelen elnémult. Grantot leginkább egy ló légzésére emlékeztette. De hát akkor miért nem tette? – Éhes vagyok! – szólalt meg Lex. hogy lenézzen a dombról. tudni szerette volna. Csak csendes levélsusogás hallatszott. Halkan mint egy sóhaj. Ekkor a domb alja felől emberi köhögést hallottak. – Hát még én! – mondta erre Grant. hogy Lex lássa. halk. látta a mozgó árnyakat. – Igen. szögletes fej. és kikukucskált. hogy ez jó volna. – Ne mozdulj! – mondta Tim. s a szél zúgása. Grant látta. Ed Regis eltűnt. s ahogy a nagy fák ágai mozogtak a szélben. mint egy bocs vagy egy kölyökkutya. – Remélem. Grant lenézett Regisre. amikor a tyrannosaurus belerúgott. hajlott nyak. – Nem hiszem. – Vissza kell mennünk a civilizációba. de mégsem látszott komolynak. amit akkor kapott. de Grant a legközelebbi fa törzséhez húzta.. Aztán. hogy elmondhassuk. vagy tíz méterre a Land Cruisertől. mi történik. eltekintve attól a karmolt sebtől. valahonnan egészen közelről. azt hiszem. A tyrannosaurus számára gyermekjáték lett volna. és főként a legkevésbé sem akadályozta vagy korlátozta a mozgásban. hogy még él. csak azután indult tovább. az a legokosabb – felelte Grant. Az erdő továbbra is néma maradt. a réseken átszűrődő holdfény állandóan változott. foltos mintákat rajzolt. Megint hallották a kilégzés hangját. mert felhagyott a küszködéssel. távolabb az úton. Tim. ezért faleveleket tapasztott a sebre. A fiatal tyrannosaurus csoszogva elindult lefelé az ösvényen. így jelezve. még mielőtt a támadás megkezdődött volna. Tim azonnal követte őket. és vele együtt maga is a fa aljánál lévő göcsörtös gyökerek közé bújt. a domb lábánál Ed Regis állt meredten. de nem mozdult: erős. de semmi jelét nem adta. hogy nyögve felült az erdőben. De csak egy pillanat kellett hozzá. a maga két és fél méterével. Regis elfordította a fejét. Lex is. és Grant után szaladt. csapdába kerülünk. Malcolmot kereste. Az erdő halálos csenddel vette körül mindannyiukat. – De én éhes vagyok! – mondta megint Lex. mi van a hajón. Rávetült a többire. s egy idő múlva alvadni kezdett a vér. Ott állt egy nagy fa mellett. Meg nem moccant. hogy Grant tekintete újra megtalálja. Csak halvány emlékei voltak arról. ha értünk jönnek. hogy észrevette volna. – Én nem akarok itt maradni – mondta erre Lex. Lex azonban követte a bátyját. és lemutatott a dombról. – Akkor várjunk itt? – kérdezte Tim.. Grant elgondolkodott ezen. ahogy az emlékek lassan visszatértek. hogy mindőjüket megölje. Alig volt hangosabb a szélnél. hogy Regis feszes testtartása ernyed egy kicsit. Muszáj visszajutnunk. – Csak mi. A kislány kalimpálva ellenállt. És egy dolog járt a fejében: az a sötét árny. Grant a szájához emelte az ujját. és ekkor egy tyrannosaurus lépett ki az ösvényre. hogy még egy árnyék van ott. Ez ugyan égett. Lex szóra nyitotta a száját. – Várjuk be. – Ne mozduljatok! – szólt Grant. ami közvetlenül azelőtt történt. igyekezett kilesni a tyrannosaurust a fa túloldalánál. És szólnunk kell. ahogy egy ág eltörik. és átölelte a törzsét. mozdulatlanul. elvesztette-e az eszméletét egy időre. igyekezett valamiféle értelmes rendbe rakni őket. és beleszagolt a levegőbe. Lex türelmetlenül megráncigálta Grant ingét. mint a kölyökállatok. Odalenn. Grant alig tudta elhinni. amelyeket a holdfény vetett a fa törzsére – és ekkor vette észre. lenyomta. amely áthaladt a Land Cruiserek között az úton. míg ideér valaki. – Csak mi tudunk róla? – kérdezte Tim. – Így találkozunk velük. hogy maradjanak csendben.

Ekkor apránként visszatértek az erdő zajai: egy béka óvatosan brekegett. Regis az öklével verte az orrát. és a kezével hessegette. . – Vissza. Megint csak hagyta. – Hé! – ordította estében Regis. egészen magas hangon. és újra leterítette. hogy eloszlassa a feszültséget. Regis ellépett a fától. Szó már nem érkezett felőle. Aztán hirtelen elnémult a sikoly is. amelyek apró martalékától jöttek. Regis megnyugodni látszott. ez játszik vele! – ismerte fel Grant az odalent folyó színjáték lényegét. és rohanni kezdett velük. A kölyök bömbölt. és fémes kongással a földre pottyant. A kölyök kíváncsian bámulta tovább a fura. amely előtte állt. – Menj innen! Tűnés! Tűnj el! Menj már! – kiabálta Regis teljes erőből. A támadás balról jött. Regis pedig üvölteni kezdett. De a tyrannosaurus rávetette magát. Már nem ölelte a fát olyan szorosan. nekiugrott. rákiáltott a dinoszauruszra. mert Regis többé nem mozdult a helyéről csak felült az ösvényen. és az eltávozott dinoszaurusz irányába nézett. Regis még vagy fél percig a fa mellett maradt. Éjszakai nézője lecsúszott a homlokáról. ám ekkor az utolsó pillanatban a kölyök megint ugrott. hogy talpra álljon. Ám az őserdő még mindig néma volt. és a dombtető felé nézett. Az ifjú tyrannosaurust láthatóan zavarba hozták a fura hangok és mozdulatok. hagyta. te hülye! Hallod? Vissza! – Úgy kiáltozott. ne! – nyögte halkan Lex. és kíváncsian megszaglászta. aztán rákezdett az egész kórus. – Hagyd már abba! – ordította Regis. mert hirtelen hányinger fogta el. s amikor a kölyök felemelte a fejét. de a kölyök nem üldözte.Odalenn az úton az állat most kiesett Granték látóköréből. Jóságos ég. és a dinoszaurusz meghátrált. Tim még éppen fel tudta venni a szemüveget a földről. Regis tovább kiáltozott: – Jól van! Hallod?! Most aztán tűnés! Menj a fenébe! Tűnj el innen! – s közben távolodott a dinoszaurusztól. véres húscafatot látott a pofájában. Mellette Tim elfordult. amint Grant mindkettőjüket kézen ragadta. A férfi felugrott. Kiabálva feltápászkodott. te! Vissza! – kiabálta közben. aztán a kis tyrannosaurus lehajtotta rá a fejét. Lehajtotta a fejét. – Jaj. Grant tépett. Kilépett az út közepére. mintha elijeszthetné. és feldöntötte Regist. és Regis ismét elterült a hátán. a fák és a magas sövény irányába. aki elterült a földön. zajos kis állatot. de mihelyt Regis még néhány lépést tett. és alighanem a földhöz szegezte a hátsó lábával. és megrázta a vállát. egyetlen tücsök ciripelt. – Vissza. Regis most óvatosan jobbfelé oldalazott. csak sikoly. ahogy a feje előrelendült. és tovább hátrált. mint valami oroszlánszelídítő. A kölyök felkapta a fejét. hogy talpra álljon. de nem támadott. A kicsi bömbölt.

– Tán vissza kellene mennünk! Harding vállat vont. megvagyunk! Itt vagyunk a folyó közelében. – Akkor miért nem viszi a másik autót? – Lenyomta az adógombot. – Kikapcsolta a készüléket..hol. akadt. Grant ásatásánál Montanában mindig Ellie kezelte a rádiótelefont. Arnold.. gatsz rám. – Ez viszont érthetetlen – jegyezte meg erre Harding....tok. vissza. ide! – Ez úgy hangzik. John.. Harding újból benyomta a gombot. Aztán: – . – John? Ismételd. recsegő adásfoszlányok mozaikját. Újabb recsegés. ell... amint azt kérdi: – . – Mit mond? – kérdezte Gennaro..A VEZÉRLŐTEREM A kompik árnyéka az út mentén suhant az éjszakában.. marha. ezzel nem megyünk semmire – mondta Harding.. – Szinte reflektornak látszik.vagytok? – Ó.. Harding benyomta a gombot. tűnt. és a kompikat követjük. távolabbra az úton.ség.. – Másfél kilométerre a hipsziktől. kocsi. ha minden mindig előírásszerűen történik. a maga kocsija kell neki. maga csirkefogó! Az istenit! Állítsa vissza a rendet ebben a parkban.... Tudja. – Attól tartok. – Valamit a kocsiról – mondta Ellie. Megint recsegés. s már fel is tűntek a Szafarikastély barátságos fényei. hogyan kell összeállítani a zavart. a kocsitokra. Felismerték John Arnold hangját. John. látták.... légy szíves. – Hát jó. csak a tiétek. tek.bi.... mi ez a nagy izgalom! Harding magasabb sebességre kapcsolt. hogy vigye a másik kocsit! Ott van a garázsban. hogy Muldoon rohan feléjük. azonnal. majd recsegni kezdett a rádió.. – Azt hiszem. de azonnal! És hozza vissza az unokáimat! Rögtön! – John Hammond a vezérlőben állt. Amint azonban Harding fékezett a látogatóközpont előtt. Tíz percbe sem tellett. Fülsiketítő mennydörgés. Roppant érdekes. – No végre! Lenyomta a gombot. Muldoonnak kell. a folyó közelében... Ezt már legalább két perce folytatta. Hirtelen zúgni. milyenek a műszaki emberek. . és toporzékolt kicsi lábával.... – Nem valami fény az ott? – Meglehet – felelte Harding. – Johnnak gyakran van gondja. – A többi kocsi elakadt az úton a viharban. Légköri zavar sercegése. – . – ... Az autó a garázsban van! Megint légköri zavar. és vadul hadonászik a kezével. és megfordult a kocsival... – .... Majd: – . A készülék megreccsent.. – Lenyomta a gombot a rádiókészüléken.. Kompikat követünk.. Harding megvonta a vállát. Ellie előremutatott.. – . – Megvan – szólt Ellie. Hosszan sercegett utána a készülék. – Az istenit magának. – Azt mondja.... Félreérthetetlen feszültség volt Arnold hangjában.. – Szó sem. hát megkerültek! – kiáltott fel Harding... – John? Mondd meg Muldoonnak. ordítozott.. Rendben. neki. – Mondom: a garázsban.nem. Csak akkor jó nekik. – Csak azt tudnám... Aztán Arnold feszült hangja szólt ismét.... s a dzsip bőgve száguldott velük az úton a sötétségben. Hosszú évek tapasztalata megtanította rá. miközben Henry Wu döbbenten álldogált a sarokban.. hogy Muldoonnak kell a kocsink? – Úgy hangzott – felelte Ellie. John! Máris indulunk vissza.. Harding dzsipje némi távolságból követte őket. és Muldoon el akar jutni hozzájuk.edry.Moldoo.... Gennaro összeráncolta a homlokát. – Igen.. mintha valami baj volna ott – komorult el a botanikusnő.. – John? Ott vagy? Elég rosszul hallunk! John? Villámfény borította el a tájat.. sik..

– Hallani sem akarok semmiféle Malcolm-effektusról itt! – mondta Hammond. bármennyire szélsőségesek is legyenek. – Áttekintéssel? Az egy örökkévalóságig fog tartani.lev {void MeterVis $303} Random(3# *MaxFid) on SetSystem(!Dn) set shp_val.vst Include: net.sys Include: sysrom. Mr.– Nos. Sosem értik a technikai gondokat. 7*tty]} if ValidMeter(mH) (**mH). mint most is. hogy neki magának kell behatolnia a számítógép kódrendszerébe. Az olyan problémákkal szemben viszont. A műszaki rendszerek teljes mértékben közömbösek az emberi emóciókkal szemben. Wu lépett hozzá.sys Include: pwr. s nincs hozzá magyarázat. uram. hogy ha ordítoznak az emberrel.mdl */ */Initialize SetMain [42]2002/9A {total CoreSysop %4 [vig. Sőt. – Nekem mondod? – kérdezte Arnold. ValdidMeter(Vdd) return on SetSystem(!Telcom) set mxcpl. és azt képzelik. mit sem ér bármiféle ordibálás. – Miért nem iszik egy kávét odalenn a büfében? – kérdezte Arnold. John? – Ellenőrzöm a kódot. majd minden rendbejön. akit Arnold valaha ismert. Aprólékos. ehhez pedig nyugodtnak. – Nyugalom. Éppenséggel nem volt boldogító a számára a tudat. hogy pontosan azt tegye. – Nekem? . Muldoon már úton van. – Jelenteni fogom önnek. – Mit csinálsz. fárasztó feladat állt előtte. amely eligazítja a komputert. melynek legnagyobb része dokumentálatlan. Gombokat nyomott le a konzolján. – Ha lesz valami újság. ami azt jelenti. Belépett a színfalak mögé. hogy ez néha így is van – ha a titkárnőjükkel ordítoznak. Hammond – szólt Arnold –. amit ön mond. mint az összes többi vállalati vezetőember. – Arnold elfordult. az ordítozás leginkább csak hátráltatja a dolgokat. vagy sem. Meter Vis return Term Call 909 c. azonnal szólunk. a lépésenkénti utasítássort.obj to lim(Val {d}) SumVal if SetMeter(mH) (**mH). Hammond is csak olyan. amikor Arnold számára lényegében már bizonyossá vált. mint amelyet most Arnoldnak meg kellett oldania. hogy a Jurapark programja több mint félmillió sornyi kódot tartalmaz. ezek a menedzserpofák mindig egyformák. mi történhetett. Lehet az a Disney-cég vagy a haditengerészet. hogyan viselkedjék. hogy megvizsgálja a kódot. A számítógép fütyül rá.obj to lim(Val {pd}) NextVal Arnold immár nem csupán használta a számítógépet. */Jurapark. hogy Nedry nem fog visszajönni. nem lesz Malcolm-effektus – felelte erre Arnold. figyelmesnek kell lennie. – Most pedig volna szíves végre dolgozni hagyni? – Azt Isten verje meg magát! – ismételte Hammond. és rájönnie. hogy állítsa már elő a limuzinjukat. mire az ismerős monitorképek megváltoztak a szeme előtt. hogy ordítoznak-e vele. főmodulok/ */ */ Call Libs Include: biostat. ha hallok Muldoonról – válaszolta hűvösen Arnold. És lehet. és új cigarettára gyújtott.

Gennaro kiugrott. – Muldoon felnézett a dombra.. – Képes vagyok. Gennaro mély lélegzetet vett. Közben csak úgy dőlt a vér végig a karján a csonkból. – Ha én már egy órája ülnék egy mozdulatlan kocsiban. – Valahogy nem is rendjén való. – Gennaro! – Muldoon hangja éles volt. A szirt mentén haladó úton robogtak. és előreszaladt. de nem az volt. micsoda kosz lesz a kocsiban! Nézze már meg. ami az út menti páfrányok között feküdt. s a dzsip megcsúszott a sárban. ahol megfogta a bokát. Felfordítva tartotta a letépett lábat. térdére tette a kezét. . – Atyaúristen! – kiemelte a lábat a levelek közül. Feszült volt az arca. – Nem kétséges. hogy Muldoonnal megy. Elrohant Gennaro mellett. ha ezt magunkkal visszük – mondta. mi az. a folyót mélyen alattuk most elnyelte a sötétség. kékesfehér színű volt. mi az. véres csonkban végződött ott. Gennaro még mindig egyméternyire állt tőle. – Meg sem szólal – válaszolta Muldoon. Megint csúszott egyet a kocsi az éles kanyarban. – Ezt nem harapták le.AZ ÚTON Muldoon vadul vette a kanyart. hogy valami mással foglalhatja le a gondolatait. egy kartondoboz. nem? – kérdezte Gennaro. Talált egy vászonzsákot. – Álljon meg! – kiáltotta. és leguggolt a láb fölött. ökölbe szorította a kezét. Muldoon kihajolt a kocsiból. – Jól van? – kérdezte. A lábszár húsa halvány. Újra elindult. és mélyeket lélegzett.. és Gennarót megint elfogta a hányinger. Gennaro a fejét ingatta.. – Tényleg azt gondolod. rex végzett vele. amit Ed Regis viselt. – Az ízület vonalánál szakadt le – szólt Muldoon. Gennaróra. Gyorsan lehajolt. – Már egy órája – szólt Muldoon. de egészen lassan. az biztos. Gennaro dermedten megállt. – Képes tovább jönni? – Igen – felelte Gennaro. Az út újabb kanyart vett. Olyasmit. és letépte! – Muldoon felegyenesedett. aztán vissza. Kétméternyi távolságból is tisztán látta. amint kritikus szemmel vizsgálgatja a lábat. úgyhogy a vércseppek most már a páfrányokra hullottak. Addigra már Muldoon is kinn volt a kocsiból. Egyszerűen megcsavarták és letépték. – A T. és odébb lépett. hogy csak úgy itt hagyjam. Benne szerszámkészlet. zuhogó esőben. de azért nyugodtabb leszek. Hacsak egy pillanatra is. Muldoon a lábbal a kezében visszafelé tartott a dzsiphez. jobb. aki mellette ült. nincs-e valami ott hátul! Valami takaró vagy afféle. ahol valamikor a térd volt. Véres keze összemaszatolta a zoknit. és matatni kezdett a hátsó ülés mögötti raktérben. Ellie és Harding a látogatóközponban maradtak. – Mi van? – Menjen arrébb! Takarja a fényt. Mikor kinyitotta a szemét. és barna papucscipőt. Valami ruhadarabnak látszott. hogy megpróbálnák rádión segítséget kérni. minden mást kiszorított az agyából. hogy az autó lámpáinak fényébe kerüljön. – Mennyi még? – kérdezte Gennaro.. erősen lehunyta a szemét.. hogy semmi hír a többi kocsiról. Gennaro ajánlkozott. Gennaro kinyitotta a hátsó ajtót. hanem. – Én is – mondta Muldoon. majd felfutott egy dombra. Gennaro. – De hiszen van rádiójuk. – Azt hiszem. A kérdés. nehogy rosszul legyen. ha majd látom őket végre. hogy mi történt – szólt Muldoon hangja. hogy valami bajuk esett? – Valószínűleg semmi a világon – mondta Muldoon –. Szinte hálás volt. Lejjebb Gennaro fehér zoknit látott. és. kerékabroncs. Fogta. Muldoon taposta a gázt. Muldoont látta. mire Muldoon azonnal fékezett. Gennaro elkomorult. és tépett. – Három-négy kilométer. Úristen.. hogy mibe és miként lehet becsomagolni egy letépett lábat. A domb lábánál Gennaro észrevett valami fehéret. Egyébként most már bármelyik percben előbukkanhatnak. – Már egy teljes órája. úgy kérdezte: – Mi az? – Egy láb – válaszolta Gennaro. hogy a dzsip reflektorfényénél megnézze.

mennyire megrongálódott a kocsi. Muldoon pedig visszaült a volán mögé. Minden esetben meglepően kevés nyom maradt hátra. Gennaro pislogva nézett rá. – Valószínűtlen? – Igen – hangzott a válasz. – Akkor essünk túr rajta! – mondta.. Muldoon bevilágított. Néhány cserepet még előbb. és kiszállt a dzsipből. és felvette azt a fekete valamit.– Van itt két műanyagtakaró – mondta. . Gennaro egyre tisztábban látta. Savanykás bűzt érzett a kocsiban. míg meg nem látta az oldalajtó borításáról csöpögő hányást. – Micsoda? Karóra? – kérdezte Gennaro. és sosem tért volna vissza onnan. Égő zseblámpájuk ide-oda himbálózott az éjszakában. amikor benézett. és az immár alaktalan csomagot Gennaro kezébe nyomta. Addig világított körben a lámpájával. A ragadozó képes megölni egy gyereket egyszerűen úgy. – Jóságos Isten! – szólt halkan Muldoon. Ez északon volt. a tetőn a fényszórók egy pillanatig még felfelé vetették a fényüket. Nyomta a gázpedált. De a kocsi iszonyatosan szét volt verve. vércsöppek sora. Aztán a dzsip megugrott és felrobogott a dombon. – Lehet. – A másik Land Cruiser összevissza lapulva egy fa tövénél feküdt. Aztán egy bivalytámadás Amboseli közelében. és elragadott egy hároméves gyereket. Muldoon elmondta. de nem sok üvegdarab volt a közelben. Gondosan előreengedte Muldoont. s ezzel eltöri a nyakát. – Üres? – kérdezte feszült. mintha elnyelte volna a föld. – Nagyon valószínűtlen. mintha besétált volna a bozótba. – Hajította? – kérdezte döbbenten Gennaro. – Nyugi! – mondta Muldoon. majd egy pillanatra beásódtak. amikor krokodilok támadtak. – És van benn egy rádió is. Nem volt benne biztos. és semmit sem hagynak maguk után. – Van ennek valami jelentősége? – Igen. A ragadozók elhurcolják a gyerekeket – előszeretettel a gyerekeket! –. Az meglepődött.. különösen. hogy többnyire sehol semmi nyom. Ezáltal azonban alapos meglepetés érte. rex. a levelekre. azt hiszi. de a hátsó ajtón át be tudott mászni. hogy bárkit is találunk benne. hogy az egyik gyerek él – mondta. hogy ne guruljon ide-oda. Zseblámpájának visszfénye egy összetört kézi rádió adó-vevőn csillant. Azaz a szélvédő alighanem még ott tört össze. Belecsavarta a lábat a műanyagba. gondolta. Zseblámpájának fényénél alaposabban megvizsgálta. – Egy karóra! – mondta Muldoon. Az első ajtók benyomódtak. Muldoon arcán komor kifejezés ült. – Nem egészen – felelte Muldoon. – Muldoon szaglászott. mint amit gyerekek hordanak. És legtöbbször semmi mást sem talál az ember. – Adja ide az egyiket! – mondta Muldoon. Néha egy inggombot vagy egy kis gumidarabkát a cipőtalpról. majd a fénycsóva lebillent.. valami keskeny fekete. – Szépen összehajtva. De legtöbbször semmit. aki még mindig kívül állt. de mindenesetre olyasfajta óra volt. Megérintette: még friss. Gennaro csak egyetlen Land Cruisert látott. – Az – felelte Muldoon. hogy a gyerekeknek akár a legkisebb maradványa is előkerülne. Odasietett a második Land Cruiserhez. hogy a kisfiúé volt.. – Hát az meg hogy került oda? – Odahajította a T. hozzáöntött fekete gumiszíjjal. milyen nehéznek érzi. Átkúszott az ülésen. Lehet. Olcsó digitális óra volt. az úton látott. hadd nézzen be előbb. – Ez nem igaz! – kiáltott fel. És van még valami. mielőtt a tyrannosaurus felkapta volna a kocsit. – Oké! – Gennaro hátrarakta a csomagot. Úgy eltűnik. két oroszlántámadás. A folyadékkristályos számlap összetört. Muldoon ezért igen valószínűtlennek tartotta. Az igazság azonban az. Általában még vérnyomok sem maradnak utána. Muldoon már menet közben megpróbálta rekonstruálni a jelenetet. és idehajította volna. Ahogy közeledtek felé. – Csak rakja be oda hátra – mondta Muldoon. Odafönn. és beragadtak. mondjuk csecsemő vagy kisgyerek. és egy alkalom. fojtott hangon Gennaro. aztán valami mást is megpillantott a kocsi padlóján. A másiknak nyoma sem volt. ha az áldozat kicsi. ami az áldozatoktól származna. aztán balra mutatott. Aki nem ért hozzá. mely a bozótba vezet. az állatok támadásának iszonyú tanújelei vannak – letépett végtagmaradványok egy sátorban. de törött. vérrel szennyezett ruhafoszlányok a táborhelyen és így tovább. A Land Cruiser első szélvédője betörött. – Hol lehet a másik kocsi? Muldoon gyorsan körbejártatta a tekintetét. Meru közelében. – Ott van. hajlott tárgyat. – Ha be tudná ékelni valahová. és Gennaro megpillantotta az utat maguk előtt. mely az oldalán hevert az út közepén. hogy afrikai évei alatt vagy fél tucatszor kellett állattámadások színhelyére kimennie a bozótba. hogy megrázza. a kerekek pörögtek a sárban. Volt közte leopárd-támadás: a leopárd éjszaka feltépte a sátrat.

hanem valaki mástól származnak. A rádió is összetört. ezek meg felnőtt méretű lábnyomok.. és meg kell semmisíteni! Bármit is beszél Muldoon. Kicsik. – Csak a szél az – mondta Gennaro. majdnem mintha összebújtak volna sugdolózni.. Nem úgy hangzott. – Lássuk.. Talán visszajött a tyrannosaurus. míg értem jönnek. komor elszántsággal töltötte el. nem veszi már hasznukat. – Arra! Gennaro a fejét rázta. – Miféle nyomokat? – kérdezte Gennaro.. amit látni szeretne! Muldoon talpra állt. A közvetlenül előttük lévő levélzet közül jött. – Azt hiszem. – Ami azt jelenti. – A távolba mutatott. amint térden állva a talajt vizsgálgatja lámpája fényénél. – Ez igaz – ismerte el Muldoon.. körben haladnak. Az a számlap a támadáskor tört össze.. mintha állat volna. de Muldoon azért óvatosan közelítette . látta. – De ez bármikor történhetett – ellenkezett Gennaro. és hosszú léptekkel a főút felé indult. Gennarót azonban nem tudja meggyőzni. De Gennaro csak sarat látott. hogy összetörjenek. hogy legalább az egyik gyerek életben van. túlzott reménykedésnek vette. hogy nem maradhatott itt. fedik egymást. Figyelje meg a jellegzetes mintázatot.. Lehet. – Jól látható – folytatta Muldoon –. És? – Gondoljon csak bele – mondta Muldoon. én bármibe lefogadom. Ránézett az órájára. és felsóhajtott. – Ki a fene tudja? Muldoon lassan haladt tovább az út széle felé. – De akkor hová ment? – kérdezte Gennaro. – Ezt a gyerek maga vette le. Érezte. – Mondjon. Már el is indult egy puha földből emelt töltés felé.. Nem – mondta határozottan Muldoon. A sokk. – Ezek a kristályok sokat kibírnak. ahol egy esőlevezető cső volt. hogy a felnőtt lábnyomok ide jönnek. Muldoon tényleg hisz benne. feltéve. Nem a szél volt. hogy levegye az óráját? – Tán letépte az állat. – Úristen! – szólt Gennaro. amikor ráakadt arra a letépett lábszárra. Keresi a nyomát. – Hallgassa csak! – szólt Gennaro. Lámpájának fénye tócsákról verődött vissza. hogy az egyik gyerek életben van. futni látszanak. és hátrább lépett. Sőt. – Ha olyan nagyon értelmes.. Egyértelműen állati hang volt. – Úgy van – mondta Muldoon. – Szinte lehetetlen letépni az órát valakinek a csuklójáról. – De lehet. – Szóval a gyerek levette az óráját. és tudta. Ezúttal azonban tisztán hallották a nehézkes légzés hangját. tehát azt is itt hagyta. és körbeforgatta kezében. rajta feszült figyelem. – Bármikor. – Tudniillik én a helyében el sem mozdulok innen.– És ezt miből gondolja? – Az óra rá a bizonyíték – mondta Muldoon. amely az utat szegélyezte. – Látja ezeket a nyomokat? – kérdezte Muldoon. Lenézett a földre. talán még egy felnőtt is. anélkül hogy a kezét is vele tépnénk.. és.. hogy pánik keríti hatalmába. hogy elmenjen innen. Gennaro Muldoont figyelte. aztán közepes méretűek. – Hát ezeket a lábnyomokat. és hallgatózott. hogy? – Hogy a gyerek levette... – Mit viselt az a kislány? – kérdezte. és bevárom. Gennaro mindezt csak indokolatlan lelkesedésnek. akkor hová mehetett? – kérdezte Gennaro. – Törött a kristály – jegyezte meg. Értelmes kölyök. – A gyereknek itt kellett lennie a kocsiban a támadást követően. Valamiféle gumisarkú cipő.. rájövünk-e? – szólt Muldoon. Akárhogy is: valami arra késztette. amely akkor érte. hogy ezek a nyomok nem Registől. hogy összetört. Döntött: ezt a parkot be kell záratni. Megállt. Látja? Felénk tartanak az út felől. jobb lenne. arca centiméterekre a sáros földtől. Volt rá ideje! – De mikor? – Csak a támadás után történhetett – válaszolta Muldoon. maga megállna. Ekkor sípoló légzés zaját hallották.. – Maga azt lát ebben a sárban. még a támadás előtt.. aki lámpája fénysugarában tartotta. – Ha magát megtámadná egy tyrannosaurus. és itt más nyomokkal találkoznak. Átadta az órát Gennarónak. mire levette. a tekintete továbbra is a földön. Vagy valami más állat. Át kell kutatnunk a parkot! – Most? Éjjel? – kérdezte Gennaro. Maradok. hogy mind a kettő. De most meg itt. – Nem – mondta Muldoon. Erős ütés kell hozzá. – Ssss! – némította el őt Muldoon. Különben is: a szíj sértetlen.. – És a szíj sértetlen. amit akar. De Muldoon oda sem figyelt rá..

hogy volt lélekjelenléte és szorítókötést tett magára.meg. Gondolkodott. Gennaro segített Muldoonnak felemelni a férfit.. majd kiáltott. Ian Malcolm a hátán feküdt. Szürkésfehér volt a bőre. Lex. Malcolmnak más sérülése is lehet. Gennaro szorosabbra húzta az övet a lába körül. A dzsiphez cipelték Malcolmot. – Azonnal be kell vinnünk – mondta Muldoon. – Lex – szólalt meg. Muldoon félretolta egy pálma ágait. Belehalhat.. – Akkor mennünk kell – fogadta el az érveket Gennaro. amint a dzsip elindult. A jobb boka kifelé fordult. Malcolm nyöszörgött. Ha viszont otthagyják. Muldoon hátralépett. és szaggatottan. Gennaro végigvitte a fényt lefelé a lábon. Akár a gerince is eltörhetett. majd lehajolt. Malcolm öve szorosan a jobb combja köré volt tekerve. mire Malcolm felnyögött.. Vagyis akár meg is mozdíthatják. Üggyel-bajjal a vállukra vették. Akkor pedig egyenesen odamehetünk értük. mit is tegyen most. Muldoon felcsúsztatta a nadrág szárát. mint ötven négyzetkilométer – rázta a fejét Muldoon. Gennaro a földön fekvő férfi lábára világított. – Szorítókötést tett magára – mondta. lehetetlen szögben állt a lábhoz képest. átitatta a vér. – Nem találok sérülést – mondta. akkor a sokkba pusztul bele. az érzékelők előbb-utóbb jelzik a hollétüket. hörögve lélegzett. – Megmondja Hammondnak. a mellkas. Ha a srácok élnek. nehézkesen szedte a levegőt. a karok. Láthatóvá vált a szinte kásássá zúzott hús. a kiálló. hogy megvizsgálja a testet. hogy nem vérzett el máris. – Mi az? – kérdezte Gennaro. Muldoon gyengéden megérintette a bokát. – Malcolm – mondta Muldoon. – Ha bármit is meg akarunk találni odabenn. az nem kevesebb. a szája kissé nyitva. Ha viszont Malcolm doktort nem visszük vissza most azonnal. a nadrágszár lelapult. – Nem – felelte Muldoon. hogy vége. – El akar menni? A gyerekek nélkül? – döbbent meg Gennaro. – Ha bementek a parkba. – Ki az a Lex? – kérdezte Muldoon. – Maga fogja megmondani neki! . ment. és a parkban járnak. és üggyel-bajjal begyömöszölték a hátsó ülésre. – Lex.. – A feje rendben. de a sípoló hang jellege nem változott. fénytelen csontszilánkok. De hát a sorsa valószínűleg így is. Muldoon Gennaro kezébe adta a zseblámpáját. ha megmozdítják.. Sípolva... – A kislány – felelte Gennaro. úgy is megpecsételődött. az csak a mozgásérzékelők segítségével sikerülhet. hogy a gyerekek eltűntek? – kérdezte Gennaro. biztos.. Csak annak köszönhető. Ide-oda mozgatta fénysugarát. – Mennünk bizony! Beszálltak a kocsiba.

13. – Az öreg megfontoltan.43.77. – Hát jó – mondta Wu. biztos lehet benne. Volt egy kis üzemzavar a vihar miatt.146. – Míg végül aztán rászánta magát.13.55.13.103.12.63.52.13. – Az tuti – mondta erre Arnold. Donald! – mondta. Ettől Gennarónak végigfutott a hideg a hátán.09. Ennyi! És meg fogunk birkózni vele.103.13.13. vagy mit tudom én.46. akik hozzáférhettek a rendszerhez. majd újból hangnemet váltott. uram – mondta erre Gennaro.89.32. és ezért megtartották.100.19.121. mint hogy az egész park a gyerekeknek épült! Gennaro újból megszólalt: – Nézze.88. hogy hozzákezdjen. – Ez eszembe sem jutott! Biztosan működnek. hogy mire végzek ezzel a fagylalttal. A védőrendszereket csak a fő vezérlőtáblánál lehet kikapcsolni! – Na tessék! – mondta Wu.44. hogy megtalálja őket! Hiszen mást sem mondok folyton mindenkinek.13.67.77. A Jurapark számítógéprendszereibe többszintű védelmi rendszert építettek.60.13. – Például a „Keycheck”? Meg ez az egész? – Te jó isten! – csapott a homlokára Arnold.13. miért. system nedry goto command level nedry 040/ ≠ xy/67& mr goodbytes security keycheck off safety off sl off security whte-rbt.44. Elkezdte nyomkodni a gombokat. jó? – Ahogy gondolja. hogyan alakul a helyzet.88. – Nézze. – Nekem úgy tűnt.102.21.A VEZÉRLŐ Donald Gennaro értetlenül bámulta Hammondot.57.100. 13. Az öregember rendületlen nyugalommal kanalazgatta a fagylaltot az elhagyott presszóban. én csak azt akartam. mit csinált Nedry. – Akkor biztosan meg is fogja találni őket. – Ó. Egy pillanat múlva már ott is volt a képernyőn.13. hogy tisztában legyen vele: a gyerekek eltűntek. mert az hiszem.99. – Azt én is remélem – mondta Gennaro. – Azért akarom leellenőrizni. Az egyik – a „Keycheck”. amelyet azok a kezelők tápláltak be. Úgyhogy idegeskedés helyett szépen várjuk ki. Nem kell mindjárt szélsőségekbe esni.90.23. 57.144.98. – Nyilván csak az időt húzta – felelte Wu. – Azért. .13.52. már itt is lesznek. pontosan végigkövetheted.122.31. – Vagyis Muldoon szerint a gyerekek a parkban vannak valahol? – kérdezte. és ennek következtében rendkívül sajnálatos és tragikus baleset történt.88. de felismerték a biztonsági értékét.13.13. amit Nedry a nap folyamán beütött a gépbe.103. hogy eltűntek?! Végül is még nem vagyok teljesen szenilis! – Sóhajtott egyet. Muldoon meg megkeresi és behozza a gyerekeket.9. Eredetileg hibavizsgáló és korrigáló rendszernek készült. – De végiggondoltad-e. órákig vacakol. A védelmi rendszerek sem működnek már? – kérdezte Wu. 112. – Nem is tudom.obj – Ennyi az egész? – kérdezte meglepetten Arnold.13.87. – Eltűntek?! – csattant fel az öreg. Hogy ez miért nem jutott az eszébe eddig? Pedig annyira kézenfekvő. igen.77.109.42.99. – Ha a „Keycheck” él.44. Nedry babrált valamit a kóddal – felelte Arnold. egy ablakban minden egyes karakter.122.14.13.13. azaz a billentyűket ellenőrző program – figyelemmel követett és megjegyzett minden egyes leütést. Arnold helyrehozza a számítógépeket. – Az a véleményem. 13. – Már hogyne lennék tisztában azzal. és nekem semmi kétségem. gondosan evett tovább. milyen választási lehetőségeid vannak? – Miféle lehetőségeim volnának? – lepődött meg Arnold. – De miért? – kérdezte szemét a képernyőre függesztve Henry Wu.

mit csinált. mire készül. A számok annyit jelentettek. – És szemmel láthatóan nem tudja. sorról sorra. és hozzáférhessen magához a kódhoz. hogy eltévedt. a „biztonságot” kérte. aki az egész rendszert tervezte. – Most ugrik a majom a vízbe! whte-rbt. és Nedry megismételte. . hogy bárki is észrevegye. mi lehet a szerepe. amely ide-oda mozgatható. A parancsok listáját vizsgálgatta. hogy elhagyhassa a közönséges felhasználói szintet. a komputer legmagasabb vezérlési szintjére kívánt lépni. – Próbáld a kódlistát végigkeresni! – javasolta neki Wu. Nedry három változattal is megpróbálkozott: keycheck off safety off sl off – A védőrendszereket próbálja kikapcsolni – jegyezte meg Wu. különleges biztonsági feltételeknek kellett eleget tennie. hogy szinte elmosódtak a szem előtt. Arnold begépelte: FIND/LISTINGS WHTE RBT. a gép feltételezése csak az lehetett. majd a robogás hirtelen megállt. és úgy használható. Vagyis Nedry először csak körülnézett. nem történt-e valami változtatás. Mivel azonban a megfelelő jogosítványok segítségével lépett be. hol szeretne lenni. amelyek lehetővé tették. azután az azonosítási számát. – Minden „off”-parancsa erre vonatkozik. azaz „rendszer”: így kért Nedry engedélyt rá. felfrissíti a képernyőt. aki a géppel dolgozik. Majd egy percig tartott ez így. miként haladt Nedry egyre beljebb a rendszerbe. System. Ezért a komputer újra megkérdezte tőle. amely megrajzoltat egy képet. Számítógépes szaknyelven az objekt egy olyan kódblokk. Objekt lehet például egy parancssor. és ő válaszolt: nedry. hogy kövesse. mielőtt beljebb megy. – Ez nem is létezik! – morgott Arnold. hogy többé már nem lehet a rendszereket másképp kikapcsolni csak kézzel.A kezdeti számsor azoknak a billentyűknek az ASC-II-es kódszámát tartalmazta. Következő lépésként Nedry a goto command level utasítást adta. Ez a név fel volt jogosítva rá. vagy elvégeztet egy bizonyos számítást. ahol van. végül a jelszót. amit az ember nem várna éppen attól. Nedry sorban válaszolt a kérdésekre: nedry 040/ ≠ xy/67& mr goodbytes E szavak bevitelével Nedry eljutott a parancsszintre. Amint a biztonsági szintre ért. egy széket visz körbe a szobában. Ehhez további. hogy ekkor még a közönséges felhasználói kommunikációs szinten volt. – Talán rájövünk.OBJ – Keresd a fehér nyúl-objektet! Már villogott is a komputer válasza: OBJECT NOT FOUND IN LIBRARIES – Az objekt nincs a könyvtárakban. Innen a security-t. A három sikertelen kísérlet után a számítógép automatikusan nyugtalankodni kezdett Nedry felől. – Pontosan – mondta Arnold. mint ahogy az ember. a kapcsolótáblán.obj – Hát ez meg mi a fene? – kérdezte Arnold. mint bárki.OBJ Erre olyan gyorsan kezdtek rohanni a képernyőn a kódsorok. és beírta: FIND WHTE – RBT. hogy a kódhoz jusson. amelyeket Nedry a maga termináljánál leütött. hogy ott maradjon. – No! – szólt Wu. amit arról a szintről nem oldhat meg. mondjuk. – Talán csak azt akarta tudni. vagyis a „parancsszintre”. A számítógép erre a nevét kérdezte. És mivel a feltételeknek eleget tett. – Most legalább látjuk. – Nézzünk utána. tehát a gép előbb megint a nevét kérdezte. – Lehet – mondta Arnold. hogy valami olyasmivel próbálkozik. tehát megvolt rá a jogosítványa. A programkezelői szintre lépett. a gép be is engedte oda. hol van ez a kódban! – szólt Arnold. Nem akarja. hogy a biztonsági rendszerek szintjén: security És a gép megengedte. – White rabbit? „Fehér nyúl”? Valami hülye vicc a saját szórakoztatására? – „Object” a megjelölése – mondta Wu.

Nem volt az a fajta nő. – A Land Cruisereket egy órával ezelőtt támadás érte. 0 {limit . nem volt ivóvize. a ruhája sárfoltos.MeterVis return. aki könnyen.obj to lim(Val{d})-Xval. – És a többiek? – Sajnos a többieket még nem találtuk meg. ám amikor ajtót nyitott. de sokkos állapotban van. Kérem. mégis visszajött. – Addig is – mondta lassan – addig is. Ez rejtekajtó – mondta Arnold. és eltűnt. oktalanul pánikba esik. de lefektettem a szobájában.5 = setzero. limitDat. Megteszi. Ahhoz fér. amikor egy szikla leomlott alatta. on DrawMeter(!gN)set shp_val.) horRange = {maxRange-setlim/2} tempHgn(fdn-&ddx$105).lt} tempRgn2 {itm.. – És nem is objekt. hanem parancs. De addig is Malcolm sürgős segítségre szorul. Megpróbálom az összekapcsolás végrehajtási módját nyomon követni – tette hozzá. vertRange = {maxRange+setlim} tempVgn(fdn-&bb + $404. – Megigazította a csomagot a hóna alatt.obj print. megvan – mondta Arnold. – De hát csak ide tudnak hívni egy orvost vala. jobb lesz.– Ott van – mondta Wu. Harding is útban van ide. Már hívtam Hardingot. limitDat. Még mindig eszméletlen. hanem parancs: összekapcsolja a biztonsági és a külső peremsávvédelmi rendszereket. if ValidMeter(mH) (**mH). Ellie éppen kezdett volna nedves ruháitól megszabadulni a szobájában. Sattler doktornő – felelte Muldoon. – De akkor annak is megvan a módja. mint egy dinoszauruszszakértő? . mi a parancs. a törött lábán. – Alan? – kérdezte.dd4}. doktornő. – Összeráncolt homlokkal meredt a monitorra. A képernyőn nyíl jelent meg. Azt hisszük. nos. Ellie megrázta a fejét. És ha Alan Grant odakünn van a parkban. setfive. A jobb lába eltörött. ami valójában nem is az. Ellie Sattler a megdöbbenéstől szédelegve ült le az ágyára. hogy elhessegesse a gondolatot.. Súlyosan megsebesült a lábán. Grant képes a vészhelyzetekkel megbirkózni. – Azt a hét szentségit! Ügyes! – csóválta a fejét elhűlten Arnold.. Egyszer négy teljes napra eltűnt a kősivatagban. Csak Hardingra hagyatkozhatunk. – Nem! – vágott közbe fejét rázva Muldoon. – Az meg mi? – Semmi. – Harding? – kérdezte Ellie. – A telefonvonalak bedöglöttek. – A parkban? Bementek a parkba? – Ez a véleményünk.04} set on. if Meterhandl(vGT) ((DrawBack(tY)) return. – Te jó isten! – De úgy véljük. – Még csak nem is a kóddal csinálta! – Nem. – A kövér csirkefogó beépített egy látszólagos objekthívást. Wu is a fejét ingatta. Ezután a park minden része tárva-nyitva áll előtte.dt} tempRgn {itm. Másfelől viszont a gyerekek. A gyerekek alighanem Granttal vannak.. a parkban vannak valahol. és segítsen Hardingnak.4 = maxBits (%33) to {limit . ugye? Ezzel Muldoon sarkon fordult. gyalog.2-var(szh)}. és ő autóstul harminc métert zuhant. – Meglátjuk..sst {security. Ő is csuromvizes volt. Nem megy ki a hívásunk. menjen Malcolm szobájába. amely egyetlen kódsorra mutatott. és volt elég alkalma rá. hogy megmentse őket. amihez akar. perimeter} set to off. curH = GetHandl {ssd. minthogy valaki körülbelül egy órával ezelőtt a mélyhűtőben járt. akkor van-e alkalmasabb ember arra. void DrawMeter send_screen. – Nem kellene az orvost hívni? – A szigeten nincs orvos.. → on whte_rbt. Wu felkelt a székéről. Muldoon állt ott valami műanyagba csavart csomaggal a hóna alatt. – Igen. hová jutunk így. Malcolmot sikerült visszahoznunk. – Csak rá kell jönnünk. amikor kopogtak az ajtón. – Ne haragudjon. hogy Grant doktor és a gyerekek életben vannak. ha megszámolom az embriókat. hogy meggyőződjék. bele egy vízmosásba.dd2}. A beszéde egyre inkább lelassult. hogyan kapcsolhatjuk újra be ezeket – jegyezte meg Wu. curV = GetHandl {ssm. de szükségünk van a segítségére – mondta. aztán egyszerre kikapcsolja mindet.obj call link.

– Azt hiszem. hamarosan kijutunk belőle. Csökkenő nagyságot mutatott a számuk. hogy cipeltesd magad! – szólt rá Tim. A munkahelyéről ismeri. – Legalább annyi kiderült. – Be akar menni az erdőbe? – kérdezte Tim. Grant többé-kevésbé biztos volt benne. hogy mihelyt valamiféle akadályba ütköznek. és átlépik – akár kerítés. Előttük. – Aha. hogy a dobozokat alighanem valamiféle földrajzi rendszer szerint helyezték el egy központ körül. A következő doboz jele T/N/01 volt. Folyton azokat a krikszkrakszokat látta maga előtt. és felkapta a kislányt. – Fejével a húga felé intett. de a gyaloglást veszélyessé tette. Gyorsan talpra állt. – Hogy bírod. – Igen – mondta Grant. és hajfürtjeit csavargatta. igaz? Tim sóhajtott. Némelyik magában állt. – Milyen? – Rendes – mondta Tim. te tényleg nehéz vagy! Majdnem este kilenc óra volt már. – Ő mostanában már sosem cipeli a húgomat. a tyrannosaurus-részben lehetünk. – De azt hiszem. de tévedett: csak egy doboz volt ez is. Ez látványnak szép volt. Most már saját lakása van Mill Valleyben. s mintha a saját halványan körülrajzolt árnyékuk vezette volna őket. Fák tornyosultak felettük mindkét oldalon. a távolba vesző sötét erdő felé. a mozgásérzékelők száma alapján tudunk majd navigálni. Van egy palija. akár vizesárok vagy mindkettő –. Fel sem igen emeli. aztán elbotlott egy indában. a ködcsíkozta holdfényben Grant a T/S/04 jelű dobozt látta. – Azt. Grant rájött. – Az is valami – felelte Grant. hogy jó irányban haladunk – jegyezte meg Tim. – És anyukádnak? – Neki nem. – Jól van. – Apu a múlt hónapban elköltözött. – Csak néha. Tovább gyalogoltak egy kicsit. Mindegyik érzékelődoboz közepén üveglencse ült. hogy a tyrannosaurusokat a többi állattól elszigetelve tartották. – Sajnos. át a nyílt mezőn. – Aha – mondta Grant. hogy cipelnie kellett a kislányt. amely az odalenn kavargó párába veszett. hogy ott vagyunk. Remélem. onnan viszont újra nőni kezdtek. és a T/N/02 jött utána. Tim ott botladozott Grant mellett. Beléptek az erdőbe. akkor ki is jutottak ebből a részből. Grant bácsi! – Túl nagy vagy már hozzá. Grant elfáradt attól. Grant gondolataiba mélyedt. A kislány a vállán nyugtatta fejét. Nemsokára a T/S/01-et is elérték. alatta kódszám. Tim? – Jól – mondta a fiú. – És azt mondja. Csakhogy eddig nyomát sem látták semmiféle kerítésnek. és remélte. A telihold fényét el-elhalványította a levegőben úszó pára. – Tyű. Alacsonyan szálló. Grant a szenzorokat leste. A mozgásérzékelők sárga dobozok voltak. másokat fákhoz erősítettek. Hamarosan már csendesen horkolt is. egy kicsivel több mint egy méterrel a talaj fölött. ahová a legkevésbé vágyott. Azt próbálta meghatározni. az erdő annál sötétebbnek és félelmetesebbnek látszott. hogy viszonylag kis területen belül mozog. Elhaladt a T/S/03 és a T/S/02 mellett. Minél közelebb kerültek hozzá. ami annyit jelent. amelyet a tyrannosaurus leszaggatott. – Hiányzik? – Nem igazán – felelte Tim. Lex. – Fiatalabb a papámnál. A gyerekek és ő most minden valószínűség szerint éppen ott vannak. ez a tyrannosaurus-terület határának közelgését jelzi. szinte a talajhoz tapadó ködfelhők gomolyogtak a fák töve körül a holdfényben. Egyik sem működött. Ezek szerint ők délről észak felé haladnak. hol járhatnak. s amelyek azt mutatták. Grant azonban azt sem felejtette el. az erdő kellős közepén. mint az iránytű.A PARKBAN – Fáradt vagyok – mondta Lex. amelyeket a számítógép rajzolt a képernyőre az állat mozgásáról. Éppen ott. így a számok addig csökkentek. én majdnem biztos vagyok benne. míg a közepet elérték. Mivel induláskor átlépték a kerítést. neked meg az agyadra mentek a dinoszauruszok. hogy valahol a tyrannosaurusok számára elkerített részben vannak. – Az én szüleim válnak – szólalt meg egyszer csak Tim. csak kopasz. Neki jobban hiányzik. mert a jelek szerint az áram még mindig ki volt kapcsolva. . Tim elmosolyodott. – mondta Grant. – Tessék engem vinni.

Emlékezett rá. – És mikor állunk meg? – kérdezte Tim. Úgy tűnt. aztán elektromos kerítés és vizesárok. Fölülről. Már régen.. Lex némi kétséggel az arcán nézett a kerítésre. az ágak közül jól belátta az erdőt. – És el tetszik venni Sattler doktornőt feleségül? – Nem. amelyeket még a repülőgépen nézegetett. – De még időben vagyunk. a sauropodák területe. mi lesz ezután. – Vannak gyerekei? – Nincsenek – felelte Grant. Ráadásul a faágak kemények: nem tudnák kipihenni magukat. mielőtt még kikötne a hajó. egyenesen a holdfényes éjszakába. Rendesen. Négy méter magas volt. – A karórájára pillantott. meg akarja szerettetni magát. . hogy biztonságban legyenek az állatoktól. pontosan hol vannak. nyílt mező. – Grant bácsi elvált? – Nem – mondta Grant. – És most Sattler doktornővel tetszik lenni? Grant mosolygott a sötétben. – Úgy tűnt. a T/N/05-öt és a T/N/04-et is maguk mögött hagyva. de távolról. Lehet. Megint mentek egy kicsit. Egy nagyon rendes chicagói orvos a vőlegénye. Meglepően közel vannak az erdő széléhez. hogy fel kellene mászniuk egy fára. amíg átlódította Lexet a másik vállára. De nagyon magasra kellene menniük. csak a tücskök ciripeltek. De ez másfajta követelményt jelentett. amit keresett: a szerviz sötét sávja. – Mi baj? – Állatot hallottam. Ő legalábbis biztosan nem. amely egy tető lapos négyszögéhez vezetett. – Valamikor meg kell állnunk. Amikor lemászott a fáról. Legfeljebb egy fél kilométernyire a fától. A vizesárok közvetlenül a túloldalon volt. Legalább tizenöt óránk van rá. Néha azt hiszem. csak arra. – Nem bánt minket. A legjobb stratégia pedig. leszállás előtt. hogy minden egyes szektorban van egy-egy külső épület. – Még szép! Könnyen. s egy-egy béka brekegett fel néha a fák tövénél. – Meghalt a feleségem. hogy visszaérjünk. – De fogadok. aztán előtűnt. de ott volt. tisztás következik. amelyről azt sejtette. – Meg tudod mászni? – kérdezte tőle Grant. és azzal is körülnézett. Ő a tanítványom. hogy szanaszét a parkban. Fenn ülök a szobámban. Eszébe jutottak a térképek. – Hát akkor kit tetszik feleségül venni? – Nem hiszem. – Tim.– Hogy bánik veled? – Nem is tudom. pontosan előttük már vége is a fáknak. Azon túl nagy. Tovább gyalogoltak. el kell adnunk a házat. akkor gyere! A kerítéshez vezette a kislányt. nem bírnám – válaszolta Grant. Nem tudom. A vihar dél felé távolodott. hogy megnősülnék – mondta Grant. a számítógéppel játszom. és félő. aztán a ködös holdfény már az óceánon csillant. Tudósok iskolájába. Csend volt az erdőben.. És arra sem emlékezett már. Először arra gondolt. Jövőre fognak összeházasodni valamikor. Tekintetével követte a vizesárok szürke kanyarulatát. Lex ébren szipogott. és ott aludni. Szóval felébredtél? Na. Az épület alig emelkedett a talajszint fölé. de hallom őket. amint veszekszenek egymással. Lex a kezébe adta a kesztyűjét és a baseball-labdáját. tetején a szögesdrót spirálja. hogy valahol a közelben is van ilyen épület. és körülnézek. mert az egyes épületek tervrajzai közül ezek hiányoztak. Máskor meg éjjel hallom. – Egész éjjel menni fogunk? – kérdezte a kisfiú. – Félek. – Én sem – mondta férfiasan Tim. meglepődött. És közel. hogy álmában Lex esetleg lepottyan. Timmy nem tud felmászni. Tudod. Feltette Tim éjszakai nézőszemüvegét. Valami egészen biztonságos hely kellene. Jobbra és balra fák koronái. legalább egypár órára. hogy még iskolába jár? – Hát pedig olyasféléről van szó. Távolabb újabb fák. – Dehogy. – Tényleg? – kérdezte Tim. aztán mentek is tovább. – Aha – mondta megint Grant. Grant is ezen tűnődött. Azt nem tudta. megfognád a húgodat helyettem egy kicsit? Felmászom egy fára. – Mászni kezdett. milyenek ezek. Egy épületet megtalálni: ehhez valamiféle keresési stratégia kell. mintha magasra nyúlna fölöttük. Néha anyu azt mondja. – Csak nem azt tetszik mondani. Valahonnan egy dinoszaurusz bőgését hallotta. Mennydörgés morajlott a távolban. mint egyszerűen átkelni egy határon és kijutni a tyrannosaurusok területéről. – Grant csak annyi időre állt meg.

– Ez jéghideg! – szólt Lex. errefelé?! – kérdezte riadtan Lex. – Micsoda egy hülye liba! – morogta Tim. Távolról ijesztőnek látszott. Lex egyszerűen bebújt a rácsok között. Lex összehúzta magát. Grant is átpréselte magát a rácsok között. érezte. – Vajon nincs itt valami ennivaló? – kérdezte Lex. Grant bácsi – mondta. és Grant most a kiutat kereste. – Gyertek már. – Csak széna. Tim ment előre a vizesárokban. és érj utol! Grant Tim felé fordult. Alighogy beért. – De félsz! – Nem igaz! – Akkor gyere. Baleset nélkül megmásztak a kerítést. és még mindig nem hozták rendbe. – Itt van. és hosszú inda nyúlt le a víz felé. Mindkét gyerek elnémult. mint két órája. Súlyos rácsok védték. benne fűhalmok. – Az más. és szétterítette a betonon. attól az apróságtól eltekintve. és lehunyta a szemét. Szinte leterítette őket az álom. – Többnyire tényleg félni szokott! – Hálás köszönetem a segítségért – felelte gúnyosan Tim. – Azt hiszem. – Kuss. hogy akár egy teherautó is behajthasson rajta. sem a világítás.Tim mérgesen megpördült. Őszintén remélte. Lehunyta a szemét. mellé bújt. elöntötte a kimerültség hulláma. Miközben Grant ezt vizsgálgatta. – Biztonságos – felelte Grant. ahol a betonfal megrepedt. Aztán egyenként lecsúsztak a vizesárokba. – Már más részében vagyunk a parknak. Derékig vízben álltak a mély betonárok alján. magának is sikerülni fog. Megrángatta az indát. és már bent is volt a fészerben. aki még a sötétben is sápadtnak látszott. Lefeküdtek. Látták. hogy így is van. – Grant felszakította az egyik bálát. hogy Tim inge beleakadt a szögesdrótba a tetőn. hogy az megbírja a súlyát. hogy megszűnt az áramszolgáltatás. – Nem félek. hogy az épület odabenn nem más. Tim? – Persze! – Ne segítsek? – Tim gyáva nyúl! – kiabált le Lex. hogy még mindig nem működnek sem a szenzorok. szénabálák és különféle szerszámok. Középen meleg volt a széna. Az indába kapaszkodva kezdtek felmászni a fenti mező felé. hogy megnézze az óráját. hogyan trombitáinak a távolban a sauropodák. Egy-két perc alatt át is keltek a rossz minőségű műszaki úthoz vezető töltésig. A kaput nehéz lakat zárta le. – Nem bánt. – Fog menni az a kerítés. Már több. Valahol a távolban felordított a tyrannosaurus. Grant felemelte a karját. srácok! – mondta. és elindult felfelé. A beton sima volt. A kisfiú nem mozdult. – Legalább áthoztam Timmyt a kerítésen magának – jegyezte meg Lex. közben a túloldali meredek falat nézte. Ezt aligha tudják megmászni! – Juj! – mondta Lex a vízre mutatva. A bejárati kapu elég széles volt hozzá. mint valami bunker. Jobbra már látszott a karbantartó raktárépület. hogy lássa is. Úszó. – Miféle hely ez? – kérdezte Lex. Két mozgásérzékelő mellett haladtak el. – Nem – nyugtatta Grant. de túl sötét volt hozzá. Grant hallotta. Testén érezte az alvó gyerekek melegét. és érezték a melegét. s Grant enyhe nyugtalansággal vette észre. és elszakadt. Timmy fél a magasban. Lex feljebb ment. Lex. Grant végre talált egy helyet. – Indulás. Tim követte. és közeledtek a betonépülethez. Tim pedig átölelte a húgát. érted? Fára mászni is tudok. és ő is elaludt. . fiúk! – mondta büszkén. – Lesiklottak a füves töltésről. Igazat mondott: ha nehezen is. csomós valamik látszottak a felszínen. mint nyitott fészer.

obj set link. setfive.itl} tempCall {itm. Jól kifundálta! Gennaro a fejét ingatta.A VEZÉRLŐ Muldoon és Gennaro éppen akkor léptek a terembe.obj Vg1 = GetHandl {dat. – Hát ez nem igaz! – rázta a fejét Arnold. és kibámultak.04} set on limitDat.4 = maxBits (%33 to {limit . perimeter} restore → on fini. Gennaro szólt: – Csak nem azt jelenti ez. amelyek rá vonatkoznak. – Pontosan az érintett három sor tűnt el.temp} Vg2 = GetHandl {dat. fini.Vg2) return if Link(Vg2. Vg1 = GetHandl {dat. – Az ezután következő „delete”-paranccsal törli az összes kódsort. hogy tudja mit jelent. te szemét! – Mi van? – kérdezte Gennaro. – Csakhogy ez nem minden – folytatta Arnold. Mindhárman az ablakhoz futottak. – Végre megtaláltam az eredeti kód visszaállítására vonatkozó parancsot. – No. perimeter (Vg2) limitDat.Vg2) return if Link(Vg2.Vg1) set Lim(Vg2.obj” utasítást is. A „fini.2 = setzero.obj delete line rf whte_rbt.obj.2-var (szh)} – Hát ez az! – mondta elégedetten Arnold.sst {security.1 = maxBits (%22 to {limit . és felkiáltott: – Megvagy. – Nézzétek! – Odakünn a parkban körös-körül kigyulladtak a nagy kvarclámpák. akkor lássuk! – mondta Arnold.2 = setzero.2-var(dzh)} Vg1 = GetHandl {dat. Arnold a képernyőre mutatott.dt} tempCall {itm. setfive.obj” utasítás visszaállítja az összekapcsolt paramétereket a „restore”-ral.5 = setzero. setfive. – Remek! – szólt Muldoon.itl} tempCall {itm. És ezzel a nyomát is eltüntette. tehát a „fehér nyúl” objektet meg magát a „fini.dt} tempCall {itm. 0 {limit . perimeter} set to on → on fini.temp} if Link(Vg1. – Mi az az ez? – kérdezte Gennaro. 0 {limit .Vg1) set Lim(Vg2.itl} tempCall {itm.Vg1) return → on whte_rbt. amikor Arnold összecsapta a kezét. 0 {limit . hogy nagy-nagy baj van. – Nem sokat értek a számítógépekhez – mondta. 0 {limit . és új parancsot írt be: FINI OBJ A monitoron egy szemvillanás alatt megváltozott a kép: Vg1 = GetHandl {dat.temp} Vg2 = GetHandl {dat.obj link set security (Vg1).1 = maxBits (%22 to {limit .4 = maxBits (%33 to {limit .obj call linksst {security.04} set on limitDat.Vg2) set Lim(Vg1. hogy az elektromos kerítésekben is újra áram van? .5 = setzero. setfive.temp} limitDat.04} set on limitDat. hogy egyáltalán ott volt.dt} tempCall {itm.dt} tempCall {itm.temp} limitDat. Muldoon az ablakokra mutatott. Azt jelenti.itl} tempCall {itm.04} set on limitDat.Vg2) set Lim(Vg1.Vg1) return limitDat.2-var(dzh)} → on fini.2-var (szh)} – Ahogy mondtam – nyugtázta Arnold. ha egy csúcstechnológiával dolgozó cégnek vissza kell mennie a forráskódhoz. Ahhoz azért eleget értett.temp} if Link(Vg1.temp} Vg2 = GetHandl {dat.temp} Vg2 = GetHandl {dat.

Nemsokára leellenőrizhetjük a monitoron. – Ezek meg mik? – Hát az állatok. A sauropodák ellátóépülete közelében. Gennaro – magyarázta türelmesen Arnold –. Mindjárt megy is. – Miért tart ilyen soká? – érdeklődött Gennaro. aztán kimegy a mezőre. Még csak fél tíz. újra a kastélyban. – Kell egypár másodperc hozzá. és mindannyian a saját ágyukban fejezik be az éjszakát. mint amit reméltem. Csak egypár perc. és megállapítja hollétüket. – Pontosan. – Ott forralunk vizet a kötözésekhez. törülközőkkel és egy lavór forró vízzel a kezében. Muldoon megrázta a fejét. – Kiesés? – kérdezte Gennaro. A gyerekek alighanem fenn vannak egy fán vagy valami más helyen. Minden. A kapu rácsozatán át ragyogó kék fény öntötte el az épület belsejét. a főút közelében? – Az az a hely. és a komputer is számlálásba kezd – mondta Arnold. ahogy az elektromos áram haladt a kerítéseken. – A számítógép létszám fölötti állatnak fogja tekinteni őket. Itt a tizenegyes szektorban meg van egy másik. A komputernek le kell választania minden háttérmozgást. – Nem kíváncsi rá. – És a mozgásérzékelők? – kérdezte Gennaro. és a generátornak végig fel kell töltenie a kapacitorokat. ahol a rex letiporta a kerítést – mondta Muldoon. Ahogy Gennaro a térképet nézte. A mozgásérzékelők újra bekapcsolódtak. – Összesen csak három kiesés van az egész parkban. és máris újra működik minden az egész elátkozott parkban! Grant kinyitotta a szemét. A számlálásnak vége. hogy Muldoonnak úgy egy óra múlva szüksége lesz rá. – Meg kell értenie. – Pontosan. és a számítógép kezdi azonosítani a parkban lévő állatokat. Ez eltarthat. Kiviszem a legénységet. – És a gyerekek? Őket nem látja? – kérdezte Gennaro. A térképen fényes vörös vonalak rohantak kígyózva szanaszét a parkban. De fél perc múlva már minden működni fog. Lassacskán megtelt zöld pöttyökkel meg számokkal. – E pillanatban semmi nem látható a térképen a létszám fölött. Mr. Van állat is több. kocsit küldenek értük. akkor ötöt kell visszaterelnünk a saját részére. ó! Már rendben is van.. és integetni kezd. – Látja azt a nagy lyukat a tizenkettes szektorban. – Nem – felelte. Ez sokkal jobb. A harmadik pedig ott van. odaáll a mozgásérzékelők elé. – Már bekapcsolódtak azok is. hogy azt jelenti! – vágta rá Arnold. hogy rengeteg más jellegű mozgás folyik odakünn. Akkor majd felismerik. Kvarcfény: újra bekapcsolódott az áram! Szédelegve az órájára pillantott. Ki kell javítanunk a kerítéseket.. Úgy döntött. – Arnold a park álló üvegtérképére mutatott. Hogy az mitől lehet. az a szeme előtt vált egyre bonyolultabbá. Én egyenlőre nem aggódnék. hogy hívja vissza az ellátóhajót. Egyszerűen nem tudhatjuk. amelyik még nem került elő. és egy utolsó pillantást vetett a térképre. Lehet. és ismét lehunyta a szemét. mivel nyolcvan kilométernyi kerítés van odakinn. A vezérlő rájuk talál. repkedő madarak és így tovább. Például a nagy rex. és belépett a Szafarikastély bejáratán. ha mielőbb hozzálátunk – mondta. – A térképet nézte. hogy elérjék a teljes feszültséget. mert alszik valahol. Felül kell vizsgálnia a terelést. Ásított. Egy-két perc. – Hogy van Malcolm? – kérdezte Gennaro. hogy az odakinn lévő emberek is alszanak. – A kerítésből automatikusan kizáródnak a rövidzárlatos szakaszok – magyarázta Arnold. – Fél tíz van. – Isten tudja – mondta Arnold.– De még mennyire. – Csakhogy egyelőre nem látok létszám fölöttit. Nyilván azért. – Jobb lesz. – Grantra és a gyerekekre gondol? – kérdezte még mindig a térképet bámulva Gennaro. Arnold Gennaróhoz fordult. Gennaro áthaladt a vaskapukon. hogy van Malcolm doktor? Egyúttal szólhatna Hardingnak. – Biztosan viharkár vagy egy kidőlt fa. . – Túloldalt van a konyha – mondta. a dzsungelfolyónál. Hammondot. – Nem is rossz! – jegyezte meg Arnold a villogó térképre függesztve szemét. – Vajon az a rész mitől ment ki? – kérdezte Gennaro. és nem látjuk. az állatokat pedig vissza kell vinnünk a helyükre! Ha hihetek annak a gépnek. Szélben mozgó ágak. ő szól Arnoldnak. Arnold székestül visszafordult. Egyébként mindenki másét is. hogy hozzákezdünk a dolgok végső rendezéséhez. Ellie Sattler jött éppen a folyosón. Felemeltük és négyszázra állítottuk a keresőszámot – mondta Arnold. azt sem tudom. Alig néhány perce aludt csak el. és jelzi majd. ahol nem láthatjuk őket. szunyókál még egy-két percet. amit odakinn találtunk. azonosított dinoszaurusz. Én addig értesítem Mr.

azon kívül persze. – A törzsemnél fogva – mondta Malcolm. mint egy teherautó vagy egy családi ház. lyukszerű nyomok futottak végig széles félkörívben a vállától a köldökéig. Hol van attól az enyém? Gennaro Hardinghoz fordulva mondta: – Mindjárt kezdik javítani a kerítéseket. hogy kéne lennem egy többszörös lábtöréssel. hogy az ember sose veszítse el a humorérzékét. Harding kiegészítette a matematikus mondanivalóját: – A legtöbb nagy húsevő állkapcsa nem különösebben erős. hogy szükségük van a maga segítségére az állatok összetereléséhez. amely alighanem elfertőződött. Horzsolt. – Gondolja. Ő persze lekötötte az enyémet. hogyan futott el a Land Cruisertől az esőben. hogy az én esetemben ez nem lesz éppen túl hosszú idő. hogy is fejezzem ki magam?. – Hogy? – kérdezte megdöbbenve Gennaro. – Malcolm elég nagy dózis morfiumot kapott – mondta neki Harding. hogy majd meghaltam a rémülettől. de én pánikba estem. amíg el nem hajított. így igaz – mondta Malcolm.. Az eséskor törött el a lábam. – Nagy a baj. majd eldobta. – Nicsak. a fogak csak tartják az áldozatot. Arnold üzeni.. semmi bajom sem volt mindaddig. – Aligha éltem volna túl az egészet. – Malcolm sóhajtott. és hogyan érte őt utol a tyrannosaurus. mi? – kérdezte mosolyogva Malcolm. a legfőbb dolog.. – Oké – mondta Harding. Az igazi erő a nyak izomzatában rejlik. hogy érzésem szerint nem kötöttem le teljesen a figyelmét. hogy mielőbb helikoptert hívjanak. és lassanként már az illata is kezd. sajnos még nem – felelte Gennaro. – Ne hagyja magát megtéveszteni – mondta... – Sajnos azt hiszem. – Legalábbis a körülményekhez képest. – A saját hülyeségem az oka az egésznek – mondta. – Mi az a Malcolm-effektus? – kérdezte Gennaro. Gennaro! Hát eljött meglátogatni engem? Akkor most már maga is látja. aztán egyszerűen elhajított. – És hacsak nem következik be a Malcolm-effektus itt. Inkább maradtam a vécépapírnál!” Harding nagyot nevetett. mi történt? – Még szép hogy emlékszem! – méltatlankodott Malcolm. nem is fájt olyan nagyon. ha az ellenfél kisebb. de az a nagy dög igazán nem is vette komolyan a dolgát. – Csak tudnám. és ez lelkileg is megviseli. és egy pillanat múlva már aludt is. mindaddig. Harding pedig éppen új infúziót kötött be. és elvigyék a szigetről! . De azt az apró lényt. Persze meglehet. hogy részletes magyarázatot adjak egy jelenségre. Gennaro utánament Malcolm szobájába. ez nekem nem ízlett. ha az ember nem oda teszi a lábát. – Gondolja. Mikorra lehet végre helikoptert hívni? – Helikoptert? – Azt a lábat meg kell operálni. az volt a benyomásom. Ellie kikísérte Gennarót a folyosóra. De hát az ő súlya nyolc tonna. de őszintén be kell ismernem – mondta Malcolm –. Gondoskodjon róla. és felemelte az ingét. különben belehal. egyszerűen megrázta. hogy az ilyesmit az ember egy életen át nem felejtheti el. amilyen az ő számára Malcolm doktor volt. nos. emlékszem. És semmi bajom sem volt. mi lesz. miért fukarkodik vele úgy! Egyébként megtalálták már a többieket? – Nem. hogy távolról sem elég nagyot – jegyezte meg erre Malcolm. – Szerénységem tiltja. melyet csekélységemről neveztek el – mondta sóhajtva Malcolm. amíg itt hagyja nekem Sattler doktornőt meg elegendő morfiumot – szólt közbe Malcolm. Ha egészen őszinte akarok lenni. piszkosul megrázott. míg a nyak csavar és tép. igen.. Az állkapcsok. – Miért. hogy nem volt benne igazi elszántság? – Kellemetlen. ahová kell. – Nem bánom. Malcolm a hátán feküdt az ágyban. állíthatom. és valóban elképedten hallotta a matematikus harsány nevetését. méghozzá hamar. – Állíthatom. Végül is egyszerűen a foga közé kapott.. – Emlékszik rá.. – A foga közé kapott. Gennaro egy kicsit bizonytalanul óvakodott be a szobába. hogy a rex meglehetősen ügyetlen támadó. – Túl közel volt már. – Nem rossz. Malcolm elmesélte. De. – Mire a másik azt mondja: „Megmondom őszintén Bill. hogy egy Tyrannosaurus rex harapása a könnyen felejthető élmények közé tartozik? Szó sincs róla. felemelt. kissé erélyes lenni? De mindig azt mondom. De a harapás nem volt veszélyes. Mr. hogy maga ilyen jól van. Gennaro mosolygott.– Meglepően jól – felelte Ellie. – De igazán örülök. Lehunyta a szemét.

A PARK

A hordozható áramfejlesztő pufogott, majd felbúgva életre kelt. A kvarcfényszórók felragyogtak a kezükben. Muldoon alig néhány méterről hallotta a folyó csörgedezését észak felől. Visszafordult a teherautóhoz, ahonnan az egyik munkás éppen egy nagy villanyfűrészt emelt le. – Nem, nem! – szólt Muldoon. – Csak a köteleket, Carlos! Nem kell elvágnunk. Visszafordult, hogy megnézze a kerítést. Eléggé nehezen találtak rá a zárlatos részre, mert nem volt feltűnő. Csupán egy kis ősfa dőlt neki a kerítésnek. Ebből a fajtából többet is ültettek errefelé, mivel tollazatszerű levelei jól eltakarták a kerítést a szem elől. Ez a fa azonban drótkötéllel és feszítőcsavarokkal volt megerősítve. A drótok elszakadtak a viharban, a feszítőcsavarok pedig a kerítésnek csapódtak, és rövidre zárták. Ennek persze nem lett volna szabad előfordulnia. A munkásoknak utasításuk volt rá, hogy a kerítés közelében csak műanyag borítású kábeleket és porcelán feszítőcsavarokat használhatnak. De hát mégis megtörtént. Mindenesetre látszott: ez nem lesz nagy feladat. Nincs más tennivaló, mint felhúzni a kis fát a kerítésről, eltávolítani a fémillesztékeket, és megjelölni a kertészek számára, hogy reggel majd hozzák rendbe. Húsz percet sem fog igénybe venni az egész munka. Ami szerencse is, mert Muldoon tudta, hogy a dilophosaurusok mindig a víz közelében maradnak. Bár a munkások és a folyó közt ott a kerítés, a dilók képesek rá, hogy átköpjenek rajta, és célba juttassák halálos mérgüket. Ramón, az egyik munkás lépett hozzá. – Señor Muldoon – szólt hozzá. – Látta azt a fényt? – Miféle fényt? – kérdezte Muldoon. Ramón kelet felé mutatott, a dzsungelen túlra. – Már akkor feltűnt, amikor jöttünk. Ott van, ni, bár igen halvány. Látja? Olyannak látszik, mint egy autó reflektorfénye, de nem mozog. Muldoon összehúzta a szemét. Valószínűleg valamiféle karbantartó lámpa. Végül is van már áram újra mindenütt. – Majd foglalkozunk azzal is, de később – mondta. Most mindenesetre szedjük le azt a fát a kerítésről! Arnold vidám hangulatban volt. A parkban szinte már teljesen helyreállt a rend, Muldoon javítja a kerítéseket, Hammond meg elment, hogy Hardinggal együtt ellenőrizze, hogyan terelik vissza az állatokat. Fáradt volt ugyan, de mégis jól érezte magát. Annyira jól, hogy még arra is hajlandó volt, hogy az ügyvéd, Gennaro kedvébe járjon. – Szóval a Malcolm-effektus? – kérdezte. – Amiatt nyugtalankodik? – Csak kíváncsi vagyok, mi az, ennyi az egész – mondta Gennaro. – Más szóval mondjam el magának, miért nincs Ian Malcolmnak igaza? – Hát persze. Arnold újabb cigarettára gyújtott. – Szakkérdés. – Nem baj. Tegyen velem próbát, hátha felfogom. – Oké – mondta Arnold. – A káoszelmélet nonlineáris rendszereket ír le. Napjainkra már igen széles körben alkalmazott elméletté vált, és a legkülönbözőbb dolgok vizsgálatára használják, a tőzsdétől a tömegzavargásokig vagy az epilepsziás roham alatti agyhullámokig. Kifejezetten felkapott elmélet. Nagy divat manapság ezt alkalmazni minden olyan komplex rendszerre, ahol felléphet a kiszámíthatatlanság eleme. Idáig rendben? – Rendben. – Jó, akkor menjünk tovább. Ian Malcolm olyan matematikus, akinek szakterülete a káoszelmélet. Igazán szórakoztató és érdekes ember, de a fő foglalkozása – már amellett, hogy feketében jár – az, hogy számítógéppel komplex rendszerek viselkedését modellezi. Mivel pedig John Hammond minden új tudományos hóbortot imád, felkérte Ian Malcolmot, hogy modellezze le a Jurapark rendszerét. Malcolm ezt el is végezte. Malcolm modellei fázistérbeli formák a komputer képernyőjén. Maga látott már ilyet? – Nem, azt még nem – mondta Gennaro. – Úgy képzelje el őket, mint valamiféle fura, tekert hajópropellereket. Malcolm szerint minden rendszer viselkedése a propeller felszínét követi. Ezt is érti még? – Már nem egészen – vallotta be Gennaro. Arnold felemelte a kezét.

– Mondjuk, hogy egy csepp vizet csepegtetek a kézfejemre. Az a csepp le fog folyni a kezemről. Lehet, hogy a csuklóm felé folyik. Lehet, hogy a hüvelykujjam felé, de az is, hogy a két ujjam között folyik le. Nem tudhatom biztosan, hogy merre fog folyni, de azt tudom, hogy valahol a kézfejem mentén. Nem folyhat másfelé. – Oké – jelezte Gennaro, hogy érti. – A káoszelmélet az egész rendszert úgy kezeli, mint egy vízcseppet, amely egy bonyolult propellerfelszínen mozog. Lehet, hogy a csepp spirálban halad lefelé, vagy kifelé siklik a perem irányában. A legkülönbözőbb módokon viselkedhet, mindenfélétől függően. De mindig a propeller felszínén mozog. – Oké. – Malcolm modelljein többnyire van valami perem, vagy meredek lejtő valahol, ahol a vízcsepp erősen felgyorsul. Ezt a felgyorsuló mozgást nevezi ő szerényen „Malcolm-effektus”-nak. Eredményeképpen váratlanul összeomolhat az egész rendszer. És pontosan ezt állította a Juraparkról is. Hogy bele van építve az instabilitás. – Az instabilitás? – kérdezte Gennaro. – És mit tettek, amikor megkapták a jelentését? – Természetesen nem értettünk vele egyet, és nem vettünk tudomást róla – felelte Arnold. – Okos dolog volt ez? – Az magától értetődik – mondta határozottan Arnold. – Végül is itt élő rendszerekkel dolgozunk. Ez itt a való élet, nem pedig számítógépes modell. A hypsilophodonta éles kvarcfénytől megvilágított feje kicsúszott a hevederből, a nyelve kilógott, a szeme fénytelen volt. – Óvatosan! Óvatosan! – kiabálta Hammond, amint a daru emelni kezdte. Harding felmordult, és óvatosan visszatette a fejet a bőrből készült hevederre. Nem szerette volna, ha a nyaki ütőér elszorul. A hidraulikus daru felszisszent, ahogy a levegőbe emelte az állatot, majd a várakozó teherautó platójára engedte. A hipszi kis dinoszaurusz volt, nem sokkal több, mint két méter hosszú, a súlya talán kétszázhúsz kiló. Sötétzöld volt, barna foltokkal. Lassan vette a levegőt, de egészségesnek látszott. Harding alig néhány perce lőtte belé a nyugtatólövedékét, és a jelek szerint eltalálta a megfelelő dózist. Mindig feszült pillanat volt, amíg ezeknél a nagy állatoknál kiderült, jó-e a dózis. Ha túl kicsi, elfutnak az erdőbe, és olyan helyen esnek össze, ahol nem lehet hozzájuk férni. Ha túl nagy, véglegesen leállhat a szívműködés. Ez a hipszi egyet ugrott, aztán egyszerűen feldőlt. A dózis tökéletes volt. – Vigyázzanak már! Óvatosan! – kiabált a munkásokkal Hammond. – Mr. Hammond! – szólt hozzá Harding. – Kérem! – Tudhatják jól, hogy vigyázni kell... – És vigyáznak is! – mondta Harding. Mire a hipszi leért, ő is felmászott a platóra, és a tartószíjba igazította az állatot. A nyakára csúsztatta az EKG-nyakörvet, amely a szívverést ellenőrizte, aztán felkapta a nagy, elektronikus hőmérőt, és bedugta az állat végbelébe. A hőmérő pittyegett. Harmincöt nyolc. – Hogy van? – kérdezte idegesen Hammond. – Kitűnően – felelte Harding. – Alig egy fokkal csökkent a hőmérséklete. – Az túl sok! – mondta erre Hammond. – Túl alacsony! – Gondolom, nem akarja, hogy felébredjen, és leugorjon a kocsiról! – fortyant fel Harding. Mielőtt idejött volna a parkba, Harding a Sand Diegó-i állatkert főállatorvosa volt, és a világ legismertebb madárgondozási szakértője. Járta a világot, hol Európában, hol Indiában, hol meg Japánban adott tanácsokat a különféle egzotikus madarak tartásával kapcsolatban. Először nem is érdekelte, amikor megjelent ez a fura kis ember, hogy állást ajánljon neki egy magánállatkertben. Ám amikor megtudta, mit hozott létre Hammond... Ezt nem lehetett kihagyni! Hardingnak volt tudósi vénája, és az a kilátás, hogy ő lehet az első olyan könyv szerzője, melynek a címe, mondjuk: Állatorvosi belgyógyászati kézikönyv: a dinoszauruszok megbetegedései, vonzó volt. A huszadik század végére az állatorvostudomány igen előrehaladott. A legjobb állatkertekben szabályos klinikák működtek, amelyek alig különböztek a kórházaktól. Egy világszínvonalú, gyakorló állatorvos számára már nem volt mit meghódítani. De elsőnek lenni egy egész új alosztály gondozása területén: az már valami! És Harding sosem bánta meg a választását. Jelentős szakértelemre tett szert ezekkel az állatokkal kapcsolatban. Most pedig azt akarta, hogy Hammond fogja be a száját. A hipszi horkantott és megrándult. Még mindig gyengén lélegzett, és még az okuláris reflex sem működött. De ideje volt már, hogy induljanak. – Mindenki a fedélzetre! – kiáltotta Harding. – Gyerünk, vigyük vissza ezt a kislányt, ahová való! – Szóval az élő rendszerek – folytatta Arnold – nem olyanok, mint a mechanikai rendszerek. Az élő rendszerek sosincsenek egyensúlyban. Eleve instabilak. Elképzelhető, hogy stabilaknak látszanak, de akkor sem azok. Minden mozog, változik. Bizonyos értelemben minden az összeomlás peremén van. Gennaro összevonta a szemöldökét. – De hát bizonyos dolgok nem változnak: nem változik a testhőmérséklet, meg mindenfajta...

– A testhőmérséklet állandóan változik – vágott közbe Arnold. – Állandóan! Először is változik ciklikusan huszonnégy óránként: reggel alacsonyabb, délután a legmagasabb. Aztán változik a hangulattal, a betegséggel, a mozgással, a külső hőmérséklet következtében, a tápláléktól függően. Örökösen fel-le ingadozik. De ezek csak apró hullámvonalak a grafikonon. Ugyanis minden pillanatban vannak erők, amelyek felfelé nyomják a hőmérsékletet, és mások, amelyek lefelé húzzák. Belső instabilitás jellemzi. És az élő rendszerek minden egyes vonatkozásukban ilyenek. – Vagyis azt mondja, hogy... – Malcolm elméleti ember – mondta Arnold. – Ült az irodájában, és készített egy matematikai modellt, de az meg sem fordult a fejében, hogy azok amiket hiányosságoknak lát, voltaképpen szükségszerűségek. Nézze, amikor rakétákkal dolgoztam, volt egy jelenség, amelyet úgy hívtunk: „rezonáns kitérés”. Ez azt jelentette, hogy ha egy rakéta csak egy kicsit is instabil, amikor elhagyja a kilövőállást, egyben már reménytelen is. Elkerülhetetlenül irányíthatatlanná válik, és nem lehet visszahozni. Egy enyhe kis billegés addig fokozódhat, míg az egész rendszer összeomlik. De ezek a kis billegések az élő rendszereknél lényegi sajátosságot jelentenek. Pontosan ezek jelzik, hogy a rendszer egészséges és reakcióképes. Malcolm ezt sosem értette meg... – És maga biztos abban, hogy nem értette? Nekem úgy tűnt, nagyon is tisztában van az élő és élettelen... – Nézze! – mondta Arnold. – Itt a bizonyíték az orra előtt! – A monitorokra mutatott. – Egy óra sem kell hozzá, és a park egész rendszere helyreáll. Egyetlen dolgot kell már csak tisztáznom: a telefonvonalak dolgát. Azok valamilyen okból még mindig halottak. De minden más rövidesen működni fog. És ez nem elmélet. Ez tény. A tű mélyen a nyakba fúródott, Harding pedig befecskendezte a medrint az elérzéstelenített nőstény állatba, mely az oldalán feküdt a földön. A dinoszaurusz szinte azonnal kezdett magához térni. Hortyogott, és rugdalózott erős hátsó lábával. – Vissza! Mindenki, vissza! – kiabálta Harding, és maga is gyorsan felugrott, és hátrált. – Húzódjanak vissza! A dinoszaurusz nehézkesen talpra állt, és részegen imbolygott. Megrázta gyíkfejét, szemét a kvarcfényben hátráló emberekre meresztette, és pislogott. – Nyáladzik – jegyezte meg nyugtalanul Hammond. – Az csak átmeneti – mondta Harding. – Abbamarad. A dinoszaurusz köhögésszerű hangot hallatott, aztán lassan elindult a mezőn át, távolodva a fényszóróktól. – Miért nem üget? – Majd fog – mondta Harding. – Szerintem még egy jó óra kell hozzá, hogy teljesen helyrejöjjön. De semmi baja. – Visszafordult a kocsihoz. – Jól van, fiúk! Akkor menjünk vissza, és intézzük el a stegót. Muldoon nézte, ahogy az utolsó cölöpöt is beverik a földbe. A drótkötelek megfeszültek, a fa elvált a kerítéstől, és felemelkedett. Muldoon látta a megfeketedett, elszenesedett csíkokat az ezüstszínű drótkerítésen, ott, ahol a rövidzárlat keletkezett. Több kerámiaszigetelő is szétrepedt a kerítés aljánál. Ezeket ki kell cserélni. De csak akkor, ha majd Arnold kikapcsolja az áramot a kerítésekben. – Vezérlő, itt Muldoon! Kezdenénk a javítást! – Rendben – szólt Arnold hangja. – Kezdjétek! Kikapcsolom a szakaszotokat. Muldoon az órájára pillantott. Halk huhogást hallott a távolból. Bagolynak hangzott, de Muldoon tudta, hogy valamelyik dilophosaurus az. Ramónhoz lépett, és így szólt: – Gyerünk, fejezzük be már! Szeretnék a többi kerítésszakaszhoz is eljutni! Eltelt egy óra. Donald Gennaro a vezérlőteremben lévő világító ellenőrzőtérképet figyelte, hogyan villognak és változnak rajta a pöttyök és a számok. – Most mi történik? Arnold a kapcsolótáblánál dolgozott. – Még mindig a telefonokat próbálom rendbehozni. Hogy gépet hívhassunk Malcolmért. – Nem arra gondoltam, hanem arra, hogy mi van odakinn, a parkban. Arnold a térképre pillantott. – Úgy tűnik, nagyjából végeztek az állatokkal és két szakasszal. Ahogy mondtam magának, a parkban visszaállt a rend. Mindenféle Malcolm-effektus nélkül. Voltaképpen már csak a harmadik kerítésszakasz van hátra, és... – Arnold! – szólt a hangszóróból Muldoon hangja. – Tessék. – Láttad már ezt az istenverte kerítést? – Várj egy pillanatig! Gennaro az egyik monitoron magas szögből közvetített képet látott, amely egy mezőre nézett le. A fű ingadozott a szélben. A távolban betontető látszott.

– Az ott a sauropodák ellátóépülete – magyarázta Arnold. – Ilyen épületeket használunk a felszerelések, a táplálék meg a többi tárolására. Mindenütt ott vannak a parkban, minden elkerített állatrészhez tartozik egy. – A videokép pásztázott. – Körülforgatjuk a kamerát, hogy jobban lássuk... Gennaro megpillantotta a drótháló fénylő, fémes falát. Egy helyen leszaggatták, a földre taposták. Muldoon dzsipje és emberei éppen ott voltak. – Ejha! – szólt Arnold. – Úgy látszik a rex bement a sauropodarészbe! Muldoon a rádión át válaszolt: – Megvan a mai vacsora. – Ki kell hoznunk onnan! – mondta Arnold. – Aztán mivel? – kérdezte Muldoon. – Semmink sincs, ami egy rexhez elég. A kerítést rendbehozom, de be nem megyek oda napkeltéig! – Ez Hammondnak nem lesz ínyére. – Előbb visszajövök. Majd aztán beszélünk róla. – Hány állatot fog megölni a rex? – kérdezte Hammond. Idegesen járt fel-alá a vezérlőteremben. – Valószínűleg csak egyet – felelte Harding. – A sauropodák nagyok. A rexnek több napra is elég, ha eggyel végez. – Ki kell mennünk, és még ma éjjel be kell hoznunk – mondta Hammond. Muldoon megrázta a fejét. – Én ugyan be nem megyek napkelte előtt! Hammond fel-le hintázott a talpán. Mindig így tett, ha dühbe jött. – Nem felejtette el, hogy maga az én alkalmazottam? – Nem, Mr. Hammond, nem felejtettem el. Csakhogy az a tyrannosaurus odakinn teljesen kifejlett, felnőtt példány. Hogy képzeli, hogyan fogjuk el? – Vannak nyugtatólövedékes puskáink. – Igen, vannak. Húszköbcentis lövedéket tudnak kilőni. Ami egy két-háromszáz kilós állatnak elég is. Az a tyrannosaurus viszont nyolc tonna. Még csak meg sem fogja érezni. – Rendelt nagyobb fegyvert is... – Három nagyobb fegyvert rendeltem, Mr. Hammond, de maga kettőt kihúzott a listáról, és így csak egyet kaptunk. Az az egy pedig már nincs meg. Nedry elvitte magával, amikor meglépett. – Az is jókora ostobaság volt! Ki hagyta, hogy meglépjen? – Nedry nem tartozik rám, Mr. Hammond – mondta erre Muldoon. – Szóval azt akarja mondani – kérdezte Hammond –, hogy e pillanatban nincs, ami megfékezhetné a tyrannosaurust? – Pontosan ezt akarom mondani – felelte Muldoon. – Ez nevetséges! – mondta megvetően Hammond. – Ahogy gondolja, Mr. Hammond. De ez a maga parkja itt. Maga nem akarta, hogy bárki is árthasson a kincset érő dinoszauruszainak. Hát most aztán itt van: egy rex van odabenn a sauropodák között, és ha a feje tetejére áll, akkor sem tehet ellene semmit! – Ezzel Muldoon sarkon fordult, és kivonult a teremből. – Hé, várjon már! – kiáltotta Hammond, és utánasietett. Gennaro a képernyőket nézte, s közben a folyosóról beszűrődő hangos szóváltásra fülelt. Halkan odaszólt Arnoldnak: – Mintha mégsem lenne még teljes a rend odakünn a parkban! – Maga csak legyen nyugodt! – mondta Arnold, és újabb cigarettára gyújtott. – A park megvan. Néhány óra múlva már hajnalodik. Lehet, hogy vesztünk egy-két dinót, mielőtt kihozzuk onnan a rexet, de higgye el, a park megvan, és nem lesz vele semmi baj.

Grantnak eszébe jutott. hogy az valamiféle raktárhelyiség. aztán felszisszent. Nem voltak még szarvak a fején. ahogy megint beléhasított a fájdalom. Megpróbálta a rácsokon át visszahúzni a fejét. – Meg lehet simogatni. – És nagyon éhes. Ralph. Grant lassan felállt. hogy a telefonok még mindig nem működnek. Lex felé tolta az orrát a rácson át. és látta. Ralph? Az állat bőre száraz volt. mint amikor futball-labdát simogat az ember. van itt elég széna. csak elektromos sistergés szólt belőle. Úgy látszik. s közben újabb maréknyi szénát söpört fel a padlóról. – Így már jobb – mondta Lex. Két további bála ment a nyomában. És az sem tetszett sehogyan. Grant közelebb ment. és a rácsnál találta a kislányt. Marékkal nyújtotta a szénát egy állatnak. szénakazlakkal. Tisztára feldagadt az orra. Ki kellene mennie. és semmi jelét nem mutatta a félelemnek. Aztán a kongás elhallgatott. Szereti. Most. mint a rozsdás kerék nyikorgás. csakhogy az a csipkézet szélénél beakadt. s a szemével követte a kislányt. . A kölyökállat befejezte a rágást. csontos csipkézet a nagy. Kinyitotta a dobozt. nagyjából akkora. éppoly hirtelen. Triceratops-bébi volt. lágy szemek mögött. – Ő a barátom.. Grant ásított. Még mindig majdnem hat óra addig. amelyet ütemes. mint Ralph. Percről-percre világosabb lett. sárga fény ömlött be az oldalablakokon.. a telefonok még mindig nem működnek. – Ez itt Ralph – mondta. és észrevette Grantot. és aktiválni az egyik mozgásérzékelőt odakinn. hogy egy dinoszaurusz aligha reagálhat valamiféle megszokott módon. rózsaszínű malacra emlékeztetett. csak valamiféle hajlott.HAJNAL Grant hangos. csikorgó zajra ébredt. majd tágra nyitotta. aki tovább etette a szénával. – Rágd meg rendesen. – Akarja velem együtt etetni Ralphot? A kis triceratops felnézett Grantra. megnyalta száját. és a padlóra hullott. amely odakint állt. – Nem kell félni tőle – mondta Lex. Ez állt rajta: SAUROPODÁK ELLÁTÓÉPÜLETE /04/. Az agya lüktetett. hogy hagyná! – erősködött Lex. – Miért hívod Ralphnak? – Mert pont olyan. olyat. ahogy kezdődött. Hirtelen mély horkantás hallatszott. és hatalmas. gondolta. szerszámokkal és más effélékkel. mint egy póniló. – Oké. és felszisszent. – Nyugi. úgy viselkedsz. – Ne légy malac. A bébi erre hirtelen izgalomba jött. – Azt azért inkább ne! – Pedig fogadok. éles fogakat és a csőrszerű felső állkapcsot. – Komolyan mondom. Ralph Lexről Grantra nézett evés közben. Végül is akár egy órába is beletelhet. és úgy fájt az egész teste. Vastag farkát ide-oda lengette örömében a rácson kívül. és gyengéden megérintette az állat nyakát. amely egy nagy papagájra emlékeztetett. míg a hajót vissza lehet hívni. Grant bácsi – szólt Lex. csak egy perc – mondta Lex. Újabb horkantás hallatszott. Szereti a szénát. – Hol van Tim? – Pisil – mondta Lex. mi. és telefonkészüléket talált benne. Kinyitotta a szemét. – Elég rosszul néz ki. Az egy srác a suliban. Grant előrelépett. mint valami hatalmas lóé. de amikor a füléhez emelte a hallgatót. Jól sejtette hát: a sauropodák számára elkerített területen vannak. mire az állat ijedtében felsivított. Igaz. – Szereted a szénát. meleg és árkos. gépies kongás követett. Nyüszítő hangot hallott a sarokból. Mindkét oldalt kilógott a széna a szájából. – Nagy szám volna dinoszauruszon lovagolni! Grant kinézett a rácson át a nyílt mezőre. – Egészen szelíd – jegyezte meg Lex. hogy egy szénabála halad el a szeme előtt futószalagon. Ralph! Grant befordult a sarkon. Erre aztán felült. Grant látta a karcsú. – Rosszul is érzem magam. – Nagyon rondán eszik – mondta Lex. ha simogatják. Ralph! – hallotta Lex hangját. és körülnézett az épületben. ha emberrel találkozik. míg a vezérlőből a segítségükre jönnek. Szürke fémdobozt pillantott meg a falon. – Tán még lovagolhatnék is rajta – mondta Lex. Tőle jöttek a sivalkodó hangok. s a betonépületben ismét csend lett. – Megveregette a bébi fejét. Ralph? Megfordult. mintha összeverték volna. mintha sose kapnál enni a mamádtól. Álmosan nyújtózkodott egyet. Reggel volt: végigaludta az éjszakát! Gyorsan az órájára nézett: öt óra. a nap fényénél látta. a mennyezet felé. az állat mögé. úgy várta a folytatást. és teste megrándult a hirtelen fájdalomtól. Ezúttal közelebbről. – Tim is. Nyögve a hátára gurult. Lágy. Aztán Lex nevetését.

Ralph felágaskodott a hátsó lábán, s már-már kétségbeesetten igyekezett kiszabadulni a rácsok mögül. Ide-oda forgatta a fejét, odadörzsölte a rácsokhoz. – Nyugi, Ralph! – szólt rá Lex. – Segítsünk neki. Nyomjuk ki – mondta Grant. Ő maga felnyúlt Ralph fejéhez, nekifeszült, és egyszerre nyomta az állatot oldalt és hátra. A csontcsipkézet hirtelen kiugrott, a bébi a rácsokon túlra lódult, elvesztette az egyensúlyát, és az oldalára pottyant. Aztán árnyék vetült rá, és fatörzs szélességű láb jelent meg a szemük előtt. Öt hajlott körmű lábujja volt, mint egy elefántnak. Ralph felnézett és nyüszített. Hatalmas fej tűnt elő: két méter hosszú volt, rajta három, hosszú fehér szarv, mindkét nagy barna szem fölött egy, a harmadik kisebb, pedig középen, az orrhegy fölött. Felnőtt, teljesen fejlett triceratops volt. A hatalmas állat lassan pislogva megvizsgálta Lexet és Grantot, majd kinyúlt a nyelve, és végignyalta Ralphot. Az nyüszített, és boldogan dörzsölte magát a vastag lábhoz. – Ez az anyukája? – kérdezte Lex. – Úgy néz ki – felelte Grant. – Megetessük a mamát is? A felnőtt triceratops azonban már lökdöste is Ralphot elfelé az orrával. Kezdte eltávolítani a rácsoktól. – Inkább ne – mondta Grant. A kölyök elfordult a rácstól, és elment. Az óriás anya időről-időre meg-meglökdöste orrával, mintegy kormányozva kicsinyét, míg el nem tűntek a szem elől. – Szia, Ralph! – integetett Lex. Közben Tim is előjött az épület árnyából. – Mondok valamit – szólt Grant. – Én most fölmegyek a dombra, és működésbe hozom a mozgásérzékelőket, hogy értünk jöjjenek végre. Ti ketten addig itt maradtok, és megvártok engem! – Nem! – mondta erre Lex. – Miért nem? Itt maradtok. Itt biztonságban vagytok. – Nem fog itt hagyni minket, Grant bácsi! – mondta konokul Lex. – Így van, Timmy? – Így – erősítette meg Tim. – Hát jó – sóhajtott Grant. Kifurakodtak a rácsok között, és kint álltak a mezőn. Közeledett a reggel. Meleg, nyirkos volt a levegő, az ég lágy rózsaszín és bíborszínekben derengett. Fehér köd tapadt mélyen a talajhoz. Egy kissé távolabb az anya- és a bébitriceratopsot látták, amint kacsacsőrű hadrosaurusok csordája felé haladnak. Közben a leveleket legelészték a lagúna mentén. A hadrosaurusok közül néhány térdig a vízben állt. Ittak. Lapos fejük leereszkedett, és szembetalálkozott saját tükörképével a víz felszínén. Aztán újra felnéztek, fejük himbálózott. A víz szélénél az egyik bébi kimerészkedett, felnyüszített, majd hanyatt-homlok igyekezett vissza. A nagyok elnéző türelemmel figyelték. Délebbre további hadrosaurusok legelésztek az alacsony növények között. Néha felágaskodtak, és hátsó lábukra álltak. Mellső végtagjukat egy-egy fatörzsön nyugtatták, hogy elérjék a magasabb ágakon lévő leveleket is. Messze távolban hatalmas apatosaurus nyúlt ki a fák közül, kicsiny feje ide-oda himbálózott hosszú nyakán. Olyan békés volt a látvány, hogy Grant alig tudott bármiféle veszélyre gondolni. – Jujj! – kiáltott Lex, és hirtelen lekapta a fejét. Két gigászi szitakötő zúgott el mellettük. Kiterjesztett szárnyuk fesztávolsága legalább két méter volt. – Mi volt ez? – Szitakötők – felelte Grant. – A jurakor az óriás rovarok kora volt. – Csípnek? – kérdezte Lex. – Nem hiszem – válaszolta a tudós. Tim megállt, és előrenyújtotta a kezét. Az egyik szitakötő letelepedett rá. A fiú érezte a hatalmas rovar súlyát. – Vigyázz, megcsíp! – figyelmeztette Lex. A szitakötő azonban csak lassan, méltóságteljesen meglebegtette áttetsző, vörös eres szárnyait, aztán mihelyt Tim megmozdította a karját, újból a levegőbe emelkedett. – Merre megyünk? – kérdezte Lex. – Arra. Elindultak a mezőn át. Odaértek az első mozgásérzékelőkhöz, egy háromlábú állványra erősített fekete dobozhoz. Grant elé állt, és lengetni kezdte előtte a karját, de semmi sem történt. Ha a telefonok nem működnek, ki tudja, tán a szenzorok sem működnek még. – Keresünk egy másikat, és azt is megpróbáljuk – mondta, és messzebbre mutatott a réten. Ekkor valami nagy állat üvöltése hallatszott a távolból.

– Az ördög vigye el! – morgott Arnold. Kávéját szürcsölte, és kivörösödött szemmel bámulta a képernyőket. Az összes videomonitort kikapcsolta, csak a számítógép kódját vizsgálta még mindig. Időnként úrrá lett rajta a kimerültség: immár tizenkét órája dolgozott egyfolytában. Wuhoz fordult, aki közben visszajött a laboratóriumból. – Nem találom. – Mit nem találsz? – Még mindig döglöttek a telefonvonalak. Egyszerűen nem tudom visszakapcsolni őket. Azt hiszem, Nedry a telefonokkal is csinált valamit. Wu felemelte a kagylót, s hallotta benne a sistergést. – A hangzása után modem. – De nem az – mondta Arnold. – Tudniillik lementem az alagsorba, és az összes modemet kikapcsoltam. Amit hallasz, közönséges háttérzörej. Csak úgy hangzik, mintha egy modem adná. – Vagyis a telefonvonalak eldugultak? – Lényegében igen. Nedry igen alaposan eldugaszolta őket. Valamiféle záróparancsot épített be a programkódba, amit most már meg sem tudok találni, mert kiadtam azt a parancsot, amely törölte a programlista egy részét. De a jelek szerint a telefonokat lezáró parancs még mindig ott van a komputer memóriájában. Wu értetlenül vonta meg a vállát. – Akkor meg mi a baj? Indítsd újra! Kapcsold ki a rendszert, állítsd le, és kiüríted a memóriát. – Azt még sosem csináltam – mondta Arnold. – És félek is tőle. Lehet, hogy az újraindításkor az összes rendszer visszajön, de mi van, ha mégsem? Én nem vagyok számítógépes szakember, és te sem vagy az. Legalábbis nem igazán. És működő telefonvonalak nélkül még csak tanácsot sem tudunk kérni senkitől, aki az. – Ha a parancs RAM-rezidens, akkor nem fog jelentkezni a kódban. Végigkutathatod a RAM-et, de azt sem tudod, mit keresel. Szerintem az egyetlen, amit tehetsz, a leállítás és újraindítás. Gennaro rontott be. – Még mindig nincs egyetlen rohadt telefonunk sem! – Éppen azon dolgozunk. – Éjfél óta erre hivatkoznak! Közben Malcolm állapota egyre romlik. Orvosi ellátásra van szüksége! – Ez azt jelenti, hogy le kell állítanom a rendszert – mondta Arnold. – Nincs garancia rá, hogy minden újra működésbe jön utána. Gennaro felemelte a hangját. – Ide figyeljen! Súlyos beteg van odaát a kastélyban. Ha nem jön az orvos, meghal. Ha nincs telefon, nem tudunk orvost hívni. És valószínű, hogy már eddig is meghaltak négyen. Úgy hogy gyerünk, kapcsolja ki a gépet, állítsa le, és hozza rendbe a telefonvonalakat! Most, azonnal! Arnold habozott. – Nos? – kérdezte Gennaro. – Nézze, a helyzet az, hogy a védőrendszerek nem engedik, hogy a számítógépet lezárják, és... – Akkor kapcsolja ki a rohadt védőrendszereit is! Nem képes felfogni végre, hogy egy ember meghal, ha nem kapunk segítséget? Miféle alak maga? – Hát jó! – sóhajtott Arnold. Felállt, és a főkapcsolóhoz ment. Felnyitotta az ajtaját, és feltárultak a védelmi rendszer kézi kapcsolóbillentyűi. Sorra, egyenként lekattintotta őket. – Maga akarta – mondta Arnold. – Hát most megkapja. Lecsapta a főkapcsolót. A vezérlőterem elsötétült. Minden monitor elsötétedett. Ott álltak hárman a sötétben. – Mennyi ideig kell várnunk? – kérdezte Gennaro. – Harminc másodpercig – felelte Arnold. – Fuu! – szólalt meg Lex, ahogy áthaladtak a réten. – Mi baj? – kérdezte Grant. – Ez a szag! – mondta Lex. – Büdös, mint a rothadó káposzta. Grant habozott. A távoli fák felé tekintett a réten át, nem mozog-e valami. De semmit sem látott. Szellő is alig lebbentette az ágakat. Béke és csend honolt a kora reggeli tájon. – Azt hiszem, képzelődsz – mondta. – De én nem... Ekkor felhangzott a gágogó hang. A hátuk mögül jött, a kacsacsőrű hadrosaurusok csordájától. Először csak egy állat kezdte, aztán sorra vették át a többiek, míg a végén az egész csapat hangosan gágogott. Izgatottság lett úrrá rajtuk. Tekeregtek, forgolódtak, kisiettek a vízből, védelmezően köröztek a kicsik körül... „Ők is érzik a szagot” – gondolta Grant.

A tyrannosaurus hátborzongató ordítással rontott elő a fák közül, talán ötven méterre tőlük, a lagúna mellett. Óriás léptekkel rohant, ki a nyílt mezőre. Ügyet sem vetve rájuk, a hadrosaurusok felé tartott. – Megmondtam! – sikította Lex. – De énrám senki sem hallgat! Távolabb a kacsacsőrűek vadul gágogtak, és futásnak eredtek. Grant érezte, reng a föld a lába alatt. – Gyerünk, gyerekek! – Megragadta Lexet, és felkapta a levegőbe, Timnek pedig a kezét fogta meg, úgy futott velük a füvön át. Futás közben még meg-megpillantotta a tyrannosaurust odalenn a lagúnánál, amint a hadrosaurusokra veti magát, amelyek védekezve lengették vastag farkukat, s hangosan, egyfolytában gágogtak. Aztán növények és fák recsegését-ropogását hallotta, s amikor ismét hátranézett, a kacsacsőrűek már rohamoztak is. Az elsötétült vezérlőben Arnold az órájára pillantott. Harminc másodperc. A memóriának most már üresnek kell lennie. Újra felkattintotta a főkapcsolót. Nem történt semmi. Arnold gyomra összeszorult. Lekattintotta a kapcsolót, majd ismét föl. Még mindig nem történt semmi. Izzadság öntötte el a homlokát. – Mi baj? – kérdezte Gennaro. – Ó, én marha! – kiáltott fel Arnold. Ekkor jutott eszébe, hogy a védőrendszer kapcsolóit is be kell kapcsolnia, mielőtt újraindítja a gépet. Felkattintotta a három védelmi kapcsolót, és visszaengedte rájuk a takarót. Aztán lélegzetét visszafojtva újból felkattintotta a főkapcsolót. Kigyúltak a fények a teremben. A komputer sípolt. A monitorok zümmögni kezdtek. – Hála Istennek! – sóhajtott hangosan Arnold. A főmonitorhoz sietett. Címkesorok jelentek meg a képernyőn: ŐSLÉNYPARK – RENDSZER INDUL
INDÍTÁS AB(0)
Biztonság Fő SetGrids DNL Kritikus zárak Kontroll Áthaladás Monitor Fő View VBB TeleCom VBB TeleCom RSD Parancs Fő Belépés TNL Reset Revert Eloszt. Fő Elektromos Fő Fűtés Hűtés Vész Világ. FNCC Params

INDÍTÁS CN/D
Hidraulika Fő Ajtók Interface GAS/VLD Fő II Robbanás Tűzveszély Mester Fő SAAG Rnd Közös Interface Séma Fő Zoolog. Fő Javítás Raktározás Státus Fő Biztonság/ Egészség

Gennaro a telefonért nyúlt, de az még mindig hallgatott. A statikus elektromosság zaja megszűnt, immár teljes volt a némaság a készülékben. – Ez most mi? – Várjon már egy pillanatig! – szólt Arnold. – Újraindítás után a rendszer összes moduljait manuálisan kell beindítani, azaz kézzel, egyenként. – Miért manuálisan? – kérdezte Gennaro. – Nem hagyna dolgozni? Az Isten áldja már meg magát! Wu szólalt meg: – A rendszer tervezésekor nem vették számításba, hogy valaha is szándékosan le kelljen állítani, így aztán, ha leáll, a gép feltételezi, hogy probléma van valahol. Ezért megkívánja, hogy mindent kézzel indítsanak. Máskülönben ha valahol rövidzárlat lenne, a rendszer elindulna, rövidre zárulna, megint elindulna, aztán megint rövidre zárulna, és így tovább, egészen a végtelenségig. – Oké! – szólt Arnold. – Elindulhatunk. Gennaro felkapta a telefont, és tárcsázni kezdett, de hirtelen abbahagyta. – Atyaúristen! – kiáltott fel. – Oda nézzenek! A videomonitorokra mutatott. De Arnold nem figyelt rá. A térképre meredt, ahol a lagúna mellett szorosan egymás mellett lévő pontok egy csoportja egyszerre csak összehangolt mozgásba kezdett. Gyorsan haladtak előre, egyfajta örvénylő mozgással. – Mi történik ott? – kérdezte Gennaro. – A kacsacsőrűek – válaszolt fakó hangon Arnold. – Menekülésbe kezdtek.

A kacsacsőrűek meglepő gyorsasággal rohamoztak. Hatalmas testük szorosan összetapadt, gágogtak és bőgtek, a kicsik pedig azon igyekeztek, hogy el ne tapossák őket az óriás lábak. A csorda nagy, sárga porfelhőt vert fel. A tyrannosaurust Grant nem is látta. A kacsacsőrűek egyenesen feléjük rohantak. Lexet még mindig a karjában tartva, Grant Timmel együtt futott egy kiemelkedő, köves dombra, amelyen nagy tűlevelű fák csoportja állt. Teljes erőből rohantak, közben érezték, hogy reng a föld a lábuk alatt. A közelgő csorda fülsiketítő zajt csapott, akkorát, mint a beindított hajtóművek a repülőtéren. Megtöltötte a levegőt, belefájdult a fülük is. Lex kiabált valamit, de Grant nem tudta kivenni, mit mond. Alighogy felkapaszkodtak a sziklákra, máris körülvette őket a csorda. Grant látta az első hadrosaurusok hatalmas lábát, amint elrohantak mellettük. Minden egyes állat öt tonnát nyomott. De aztán semmit sem látott tisztán, olyan sűrű porfelhő borította be őket. Csak villanásszerűen tűnt föl egy-egy hatalmas test, gigászi végtag, fájdalmas bőgések hallatszottak, amint az állatok ide-oda forognak, köröznek. Az egyik kacsacsőrű egy nagyobb sziklafalnak ütközött, feldőlt, és elgurult mellettük, ki a mezőre. Alig láttak a köveken túl a hatalmas porfelhőtől. Belekapaszkodtak a sziklákba, hallgatták a visításokat és gágogásokat, a bőgést és a tyrannosaurus rémisztő üvöltését. Lex Grant vállába mélyesztette körmét. Újabb hadrosaurus csapta neki óriás farkát a sziklának. Forró vér fröcskölt rájuk a nyomán. Grant várt, míg a harci zaj egy kissé eltávolodik bal felé, aztán lökdösni és tolni kezdte a gyerekeket föl egy nagy fára. Gyorsan másztak fölfelé, kezükkel tapogatva ki az ágakat, míg az állatok körülöttük rohangáltak fejvesztve az óriás porfelhőben. Hat métert haladtak fölfelé, ekkor azonban Lex Grantba kapaszkodott, és nem volt hajlandó továbbmászni. Tim is elfáradt, Grant pedig úgy gondolta, már elég magasan vannak. Lenézve a porfelhőn át látták odalenn az állatok széles hátát, amint forognak, lökdösődnek és gágognak. Grant a fatörzs durva kérgének támaszkodott, köhögött a portól, lehunyta a szemét, és várt. Arnold igazított egyet a kamerán, ahogy a csorda odébb haladt. Lassan leülepedett a por. Látta, hogy a hadrosaurusok szétszóródtak, a tyrannosaurus pedig már nem fut, ami csak azt jelenthette, hogy a vadászat sikerrel járt. Elejtette valamelyik állatot. A tyrannosaurus most a lagúnánál volt. Arnold a videomonitorra pillantott, és így szólt: – Ki kell küldeni Muldoont, hogy megnézhesse, mennyire súlyos a helyzet! – Mindjárt szólok neki – mondta Gennaro, és kiment a teremből.

és vizsla szemmel nézegette az ágat.A PARK Halk. A békák vizsgálata kimutatta. mint egy tehén. míg a kicsi végez az evéssel. és megette a szája két sarkából kilógó ágakat. s a hang forrását kereste. már csak azért is. hogy itt vagyunk. Felfelé hajló. A hadrosaurus elhúzta a fejét a fától. hogy az kis híján leesett a fáról. – Nem – felelte Grant. ropogó hang. Kinyitotta a szemét.” . Grant makacs csiripelést hallott. Mozgására a hadrosaurus megint rémülten trombitált. hogy ilyen közelről látja az állatot. – Én itt nem maradok. amelyen Grant és Lex ült. A kacsacsőr kinyílt. hogy a kétéltűek csak a mozgó dolgokat látják. és újra négy lábra ereszkedik. – Csak ráijesztettél. mint a kétéltűeké. mintha folyton mosolyognának. mosolygó szája mulatságos külsőt kölcsönzött a dinoszaurusznak. Valami meleg. a dinoszauruszoknál is így van. alig néhány méterre tőle. Aztán a nagy fej újra Grant irányába emelkedett. hogy lássa a felnőtt állat lába körül totyogó-nyomakodó bébit. egy hosszú pillanat eltelte után. – Egy perc múlva pedig a szó szoros értelmében elfelejti. hogy ne is moccanjon. ha nem mozgunk! – gondolta. bizonytalanul viselkedett. Köhögött egyet. ahogy az állat eszik. ebből elég! – szólt Lex. Eszébe jutott. amint az állat rágcsált tovább. mit is tegyen. A meleg ajkak ismét megérintették a bokáját. és még egyet trombitált. Aztán. amíg azok már gondoskodni tudtak magukról. s a hatalmas fej lebillent. hogy el akarja ijeszteni őket onnan. éppen annyit. Grant megszemlélte a két hosszúkás légnyílást a lapos felső csőr fölött. az állkapcsok felhagytak a rágással. ahol volt. késő-krétakori maiasaurusok egy példányával találta szemben magát. Valószínűleg éppen a Montanában talált. mert ezt az állatot bizonyos értelemben a sajátjának érezte. aki leírta ezt a fajt. Az állat nyilván nem érezte Grant szagát. lágyak voltak. A nagy egészen a földig leengedte a fejét. A kicsi sötétdrapp volt. visszhangzó gágogása pedig úgy megijesztette Lexet. fekete tollakkal. A nevük ezt jelentette: „jó anyagyík”. Ha valami nem mozog. Megint gágogott. Nyilván folytatni akarta a legelést. Grant végleg elképedt. Az anya türelmesen megvárta. A paleontológus egy kicsit arrébb mozdult. „Döbbenetes!” – gondolta Grant. amitől úgy néztek ki. és lerágcsált néhány kisebb ágacskát arról a nagyobb ágról. az biztos! – Elkezdett lefelé mászni a fáról. Kacsacsőrű hadrosaurus. mellső lábait az anyja állkapcsának támasztotta. tesz egy próbát. hogy a múlt éjjel a tyrannosaurus sem látta. világosbarna fejet látott. míg a bébi a hátsó lábára állt. míg az hátrált a fától. Pontosan így volt a tyrannosaurus is – azaz még egy klasszikus példa arra. hogy Grant semmiféle fenyegetettséget nem érzett. aki a karján ült: – Hé! Ez meg mi? A hadrosaurus a zajra rémülten trombitált. Noha igazi óriás volt. A lapos kacsacsőr fölött kidudorodó szemek jámborak. nedves dolog csiklandozta meg Grant bokáját. A hadrosaurus tovább legelt. – Na. és körülbelül egy perc múlva a hadrosaurus ismét közeledni kezdett a faághoz. mint a tehén tekintete. Némán vártak. például a rovarokat. ez meg éppenséggel úgy viselkedett. Grant elképedt. Ekkor kinyitotta a szemét. mint amikor ég a tűz a kandallóban. és mozdulatlanul várt. – Na és akkor leenged bennünket? – kérdezte Lex. Zavarodottan. Maradt. Úgy gondolta. de annyira békés és nyugodt. A maiasaurusoknak felfelé görbült az ajkuk. Látta a lapos fogakat a szájában. és figyelte. S noha a bal szem pontosan rámeredt. Nem mintha félt volna: a kacsacsőrű dinoszauruszok minden faja növényevő volt. és ott totyorászott az anyja lábai alatt. hangos. John Hornerrel együtt Grant volt az első. Csak a szem mozgott. A bébi csiripelt. mert az általános vélemény szerint a maiasaurusok védelmezték a tojásaikat és a kicsinyeiket. Az állkapcsa már előre rágó mozgást végzett. – Ne dühítsd! – szólt Tim néhány ággal magasabbról. a hadrosaurus valamilyen okból nem reagált a jelenlétére. A hadrosaurus abban a szempillanatban megdermedt. amikor már kiderült. egészen addig. De a jelek szerint nem igazán tudta. amelyen Grant ült. hogy nincs veszély. és hatalmas. Úgy látszik. az ágon. Grantnak az volt a benyomása. és megszólalt Lex. hogy a látószervük úgy működik. amely egy csőrszerű száj irányában keskenyedett lefelé. Vigyázott. – Vagy mi lesz? A hadrosaurus háromméternyit elhátrált a fától. Az anya félrebillentette a fejét. – Ez buta? – kérdezte Lex. a hadrosaurus folytatni kezdte az evést. azt egészen egyszerűen nem látják. Grant talán azért is döbbent meg annyira. „Ez tényleg nem lát bennünket.

talált fűnyíró felszerelést. Nyilván ez is karbantartó út. Odakint volt Gennaróval együtt. Arnold nagyot sóhajtott. Muldoon pedig ragaszkodott ehhez. – De hol a tutaj? – Ott kell lennie valahol – felelte egy kicsit bizonytalanul Tim. – Hű! – szólalt meg Tim. – Akkor menjünk azzal! – mondta. a lagúnához. amit korábban láttak –. Leértek a földre. látni akarták a hadrosaurusok csapatos menekülésének eredményét.. Arnold vizuális keresőmódra állt... rézcső. magunknak kell visszamennünk. ezért felülről nem volt látható. és látta is: Ott van a betonfalban. csak feltételeztem.Mindenesetre a maiasaurust most már láthatóan túlságosan idegesítették a fáról lemászó fura kis lények. – Miért nem megyünk tutajjal? – kérdezte Tim. Körülöttük mindenütt lelapult a fű. Visszahajtogatta a lapokat. Mintha az Úr hangja szólalt volna meg. A térképek topográfiai részletességgel ábrázolták a sziget fő területrészét. – Én ugyan nem! – mondta Lex. – Mivel pedig a mozgásérzékelőkről. Egy autónak is elég széles.. egyenesen keresztülhalad a madárházon. ha indulunk. Az út a talajszint alá volt süllyesztve. most azonban. ahol most voltak. Vérfoltok látszottak a földön. gyerekek! – mondta.. alacsony betonépületre mutatott. – Éhes vagyok. Most reggel hét óra van. Itt várjuk. – Ide kíván jönni. és onnan a látogatóépülettől alig nyolcszáz méterre folyik tovább. Fárasztó volt figyelni. egészen bizonyosan gyorsabban haladnának. és méltóságteljes lassúsággal elindult. visszanézett rájuk. Több mint tizenkét kilométert kell még megtenniük. Hammond? – Nem. lámpákat és kábeleket. Talált viszont egy térképcsomagot. Hogyan jussanak le a lagúnához? A térképek szerint hátsó ajtónak is kell lennie az épületben. Arnold. Ha tutajjal hajóznak a folyón lefelé. Kellettek a fegyverek. ahol az éjszakát töltötték.. – Csak tessék keresni! Meglesz! Cementzsákok. Grant a raktárépület mélyében kotorászott. s a levegőben savanyú szag érződött. de ez volt a leggyorsabb módja. feltekerve és penészfoltosan a nedvességtől. kerítéshez való dróttekercseket. Arnold – mondta Hammond. – Láttam ott egy tutajt – mondta. tutajt nem talált. pótgumikat a dzsiphez. beszélhetnék magával egy pillanatig? Hammond volt. porcelánszigetelőket ládástul. közvetlenül a lagúna partján. Kinyitotta. Kattant a rádiótelefon hangszórója: – Mr. Két másodpercenként új és új kép tűnt fel. és hátat fordított a monitoroknak. s figyelte. amely egy falra akasztott fémszekrény hátuljába volt bedugva. azt a részt. Húsz méterre lehetett tőlük a réten át. – Jobb lesz. mint a szárazföldön. Lex megrázta magát. Grant egy pillanat alatt átlátta a tutaj előnyeit. – Én itt semmiféle tutajt nem látok. ötven kilós műtrágyás zsákokat.. Egy utolsó trombitálással arrébb lökdöste a bébit. Sokáig nézegette a térképeket.. – Miféle tutajjal? Tim a lapos tetejű. és két műanyag evező a betonfalra akasztva! – No jó – mondta Grant. mindenáron meg akarta találni a kocsit. üres olajtartályokat. Eszerint a lagúna folyóvá keskenyül – folyóvá. A dokkra pedig olvashatóan ez volt felírva: TUTAJRAKTÁR. . – Ide tessék nézni! – Fémdobozt nyújtott át Grantnak. Mindkét gyereket finom porréteg borította. hogy ott van az is. úgy látszik. hogyan pásztázzák a monitorok a parkot. Mr. Grant felnézett. Hordószám tolta félre a növényirtó szereket. Grant az órájára nézett. – Én oda nem megyek soha többé! – Pedig muszáj! – Miért? – Mert szólnunk kell a hajóról – mondta Grant. És egy kis dokkhoz vezet. Betonozott út vitt tőle egyenesen lefelé. hogy megtalálják Nedry dzsipjét. Egyszer még megállt. ahol vannak. közben lesepert egy jókora pókot. zöld pamutháló. – Szóval látni nem láttad? – Nem. Hiába kutatott tovább Grant a különféle holmik között. nem vesznek észre minket. Kiteregette a térképeket a padlón. – Jöjjön maga! Itt vagyok a genetikai laboratóriumban Wu doktornál.. hogy már felkelt a nap. északnak kanyarodik. aztán folytatta útját. Mr. – Várj egy pillanatig. Nincs más választásunk..

Vagy féltucat sárga mentőmellény függött a falon. A gumi hangos sziszegéssel terjeszkedni kezdett. zizegő zaj is kísérte. Meglepően nehéz volt. Az hangos csobbanással zuhant a vízbe. Lex hátradőlt. Grant megfordult. és becsúsztatta őket az evezővillába. aztán a férfi további gesztusai a csónakba irányították. körülbelül ujjnyi vastagok. Grant izmai megfeszültek. lazán szétnyitott állkapcsán. amikor Grant hirtelen megdermedt. Hang nélkül jelezte Timnek és Lexnek. A ritmikus hortyogás erősödött. – Biztosan lesz ott tutaj? – kérdezte az orrát összeráncolva Lex. – Talán tudunk majd halat fogni – mondta a kislány. Lex arcára undor ült ki. Grant a vállán az evezőkkel. honnan jön. Grant már úszott az izzadságban a feszültségtől. hortyogásának ritmusa sem változott. Grant csendesen kinyitotta az ajtót. – Ez ügyes volt. Fából ácsolt fészerféle állt a dokk végénél. – Remélem. ahol vannak. hortyogó hangot hallottak. Mocorogni kezdett. és egy hevedert. – Nyugi – mondta Grant. és a szájára szorította a kezét. Tim! – mondta Grant. és megtalálta a felfúvóhengert. ritmikus. de meg sem mozdult. de Grant nem látta. neki a fatörzsnek. ahogy közeledtek a lagúnához. véres fogain. az arca holtsápadt a félelemtől. Grant mérgesen bökdöste a levegőt az ujjával. elég nagy az a tutaj – mondta Lex –. bár a nagy állat nem adta jelét. A hatalmas állat aludt tovább. és benézett. A tutajok! Grant visszanézett Lexre. s a tyrannosaurus orra előtt a dokkra lépett. Elindultak az úton. Utána Tim is beszállt. Ezeket is betette a tutajba.Amikor Grant kinyitotta. Grant biztosra vette. hogy beleolvadjon a növényzetbe. és már a szemük előtt volt a betondokk. néhány kötegnyi kötél és két nagy gumikocka. igen. A kislány mozgó szája némán formázta: – Nincs tutaj? Grant hevesen bólogatott: – De van! A tyrannosaurus felemelte mellső lábát. Mentek az úton. A zaj rémisztően hangosnak tűnt. Nyitva volt a szeme. Távolodni kezdtek a dokktól. – Gyertek! Lex. hogy maradjanak. A feliratuk: MORO-709. majd visszadőlt. Ő maga lassan elindult. aztán hívó mozdulatot tett a gyerekek felé. Eltartott egy pillanatig. – Valószínűleg – felelte Grant. és hosszan. Ott mászkáltak a legyek a pofáján. A tyrannosaurus alig húsz méterre volt. – Az biztosan a dokkban lesz – felelte Grant. hogy látja őket. Grant a padlóra húzta az egyik kockát. Ülve. de most már folyamatos búgó. és a tyrannosaurusra lesett. Grant felkapta az evezőket. és mindketten magukra öltötték a mentőmellényt. nyílvesszőszerű lövedékkel. a tyrannosaurus alszik. . – Nyugtatólövedékek? – Gondolom. és visszament a fészerbe két mentőmellényért. Kezével az arca előtt legyezett. hogy elhessentse az orra körül röpködő legyeket. Hat darab volt belőlük. a pisztolyhoz való. A zümmögő hang attól a légyrajtól származott. egy légpisztolyt talált benne. mely az oldalán feküdt a tyrannosaurus mellett. amely felhőként vette körül. horkantott. és szinte elborították az elejtett hadrosaurus vörös lábait. Elérték az út végét. terepszínűre festve. míg rájött. A dinoszaurusz aludt tovább. de az állat csak megváltoztatta óriás testének helyzetét. Kikapcsolta a hevedereket. majd sssz. A hevedert a vállára dobta. Szinte abban a pillanatban rémület ült ki az arcára. hátsó lába előrenyúlt. mert én nem tudok úszni. visszaintett: – Nem! Grant újra mutatta: – De igen! A tyrannosaurus csak aludt tovább. és nagyot sóhajtott a megkönnyebbüléstől. Néma rángásoktól reszketett a teste: köhögését próbálta visszafojtani. Grant a dokkhoz kötözte a hajót. hupp! – teljes nagyságában kipattant a pallón. De semmilyen más mozdulatot nem tett. A tyrannosaurus volt ott! Egyenesen ült egy fa árnyékában. alattuk a padlón több tekercs drótháló. Kétoldalt a töltés lejtősen magaslott föléjük. Csak ült ott. Mély. Az állat nyögött. csak a feje emelkedett és süllyedt minden egyes horkantással. – Na és a csónak? – kérdezte Lex. Végighúzta a gumitutajt a dokk pallóján. a pisztolyt pedig a nadrágja övrészébe dugta. már futni készült. dörögve böfögött. Erre Lex némán elindult.

te kis hülye! – ordított rá Tim. hisztérikusan Lex. A kislány kétségbeesetten ingatta a fejét. . A tyrannosaurus lustán ásított. Az óriás fej a vízbe csapódott. Grant hallotta reszelős. Lex megragadta a tutaj peremét. mintha csak fegyverdörrenés visszhangzana körös-körül a tájon. aztán újra elköhögte magát. – Kapaszkodjatok! – kiáltotta. A tyrannosaurus megrázta a fejét. talán akkor. és hátsó lábával megvakarta a füle tövét. minden hüllő tud úszni! – A kígyó sem tud. a szemén vagy az orrán.. – Már elég messze vagyunk. dühösen Tim. Szánalmasan kicsinek tűnt a kezében. és kapaszkodjatok bele valamibe! – Grant a tyrannosaurust nézte.. hortyogó légzését. csiklandozza odabent. Az állat most mellmagasságig a vízben volt. Timmy! – sikította kétségbeesetten. A fej mögött időről időre előtűnt a vízből a hát hajlata és a farok hosszában futó árkok. és üvöltött. – De hát honnan tudhattam volna? – kérdezte a kislány. majd gyűrűző hullámvonal indult el közvetlenül a felszín alatt.. és úgy úszott.. Addigra már olyan látványt nyújtott. Tágra nyitotta a pofáját. egyenesen a csónak felé tartott. és csak lassan tért magához. – Különben sem számít – mondta a kislány. De későn. fulladozó. amint az óriás fej a gumicsónak alatt kipattant a vízből. Ha továbbhalad. hallgass! – szólt rá Tim. Grant evezett. Tim áthajolt a tutaj oldalán. úgy pedig sokkal gyorsabban halad. hogyan úszik. mielőtt visszaesett volna a felszínre. – Akármit! Grant előhúzta övéből a légpisztolyt. Újabb.. – Nem tehettem róla. – Belefulladt? – Dehogy – mondta Grant. hogy a tyrannosaurus eddig nem is úszott. Aztán megint ásított.. Lexből hatalmas köhögés robbant ki. Grant csak akkor fogta fel. amely válaszul érkezett. ahogy csak bírt. mint egy krokodil. – Mit tetszik csinálni? A tyrannosaurus már csak egy-két méterre volt. – Mindenki tudja. nagyobb buborékok tűntek fel a vízen. az kiemelkedett a vízből. A víz fölött sodorta feléjük a szél. Grant vadul evezett. és csak egy hajszállal tévesztette el annak gumiperemét. A tyrannosaurus most a csónak mellett bukkant a felszínre. de hatalmas fejét magasan a felszín fölött tudta tartani. és északnak kezdett evezni. és vadul megpörgött. a világ legnagyobb krokodilja!” – Bocsánatot kérek. és a torkára mutatott. Ő meg nem tud úszni. Csak úgy forrt a nyomában a víz. A parton a tyrannosaurus lelépett a dokkról. hanem gyalogolt. hogy ha valami érzékeny ponton találja el az állatot. A tyrannosaurus a víz alá süllyedt. és visszanézett. amint közeledett feléjük. és újra felordított. – Dehogy nem tud. szélesre tárta a pofáját. – Egy fenét nem! Te szerencsétlen! – Hagyjátok abba! – szólt rájuk Grant. Bőséges lakomája alaposan elálmosította. kimutatva a hajlott fogak hosszú sorait.. Ők már kis híján elérték a közepét. csak nagy bugyborékok maradtak utána a felszínen. hatalmas farkát ide-oda himbálva. aztán izmainak egyetlen rándulásával előrevetette magát. A parton azonban a tyrannosaurus feltápászkodott. és az állat pofájába csapódott. – Nem akartam! Grant hátralesett a vállán át. Egy korty víz kellett volna. ez mit jelent: valami kaparja. a víz ismét elsekélyesedik. – Csináljon már valamit! – sikította Lex is.Mindig a legrosszabbkor jön rá a köhögés! – Lex! – súgta összeszorított szájjal. minden erejével a lagúna közepére igyekezett juttatni a tutajt. A kezében tartott evezőkre pillantott. de volt némi esélye. közben visszanézett a partra. – Nem tehetek róla – súgta a kislány. és a tenyerében tartott vizet a húga felé nyújtotta. Grant célzott és lőtt. gurgulázó hangok törtek elő. Meghajlította a tutajt. A lövedék megvillant a fényben. Grant egyetlen lendülettel körbefordította a csónakot. különösen a sekély vízben. – Inkább húzódjatok le. de azok könnyű műanyagból voltak – ez fegyvernek mit sem ér! A tyrannosaurus hátravetette a fejét. A tyrannosaurus megint lábon járhat. „Pontosan mint egy krokodil – gondolta elkeseredetten Grant –. Máris gyorsan haladt a nyomukban a lagúnában. – Nem tehettem róla! – Ssss! Grant evezett. – Lex. Grant bácsi! – könyörgött sírva Lex. Tim tudta. neki a tutajnak. Ekkor azonban váratlanul egy másik ordítást hallottak. A csónakban Lexből apró. és a vízbe merült. a tutaj vadul himbálózott a loccsanás keltette hullámzásban. hogy a tyrannosaurus tud úszni! Minden könyvben benne van! Különben is.. a szemek és az orrlyukak. amikor alig néhány pillanat múlva már csak a feje legteteje látszott ki a vízből. A lagúna szélessége itt nem volt több száz méternél. a lagúnába merítette a kezét. akár egy kutya.

Lexnek igaza volt. és elaludt. aztán sürgősen menekülésre fogta a dolgot. s a reakció egy pillanatot sem váratott magára: azonnal megfordult. mintha el akarná tulajdonítani a zsákmányt. A vízbe dugta egy kicsit a kezét. amit én mondok? – O-ké! – sóhajtotta a kislány. elrobogott a megölt sauropoda teteme mellett. rá. Legalább két órának tűnt. majd magasra emelte a fejét. mennyi az idő. Lihegve feküdt a tutaj alján. Nyilván elértük. és összecsapta kezét örömében. Alig tizenöt perc telt el azóta. Mellkasa vadul süllyedt és emelkedett. és elüvöltötte magát. amint a dokk mellett felvágtatott a dombra. A leölt sauropoda mellett kuporgott. – Elmegy! – sikította Lex. úgy zihált. Még mindig alig kapott levegőt. hajrá! Hülye dinoszaurusz! A parton kihívóan ordított az ifjú tyrannosaurus. – Az áramlat észak felé vitte őket. A nagy tyrannosaurus üldözőbe vette. Hatalmas testéről csak úgy repkedett a víz. – Jól van. Grant az ifjabbik tyrannosaurust pillantotta meg a parton. fenyegető ordítását. hogy mégis haladunk? Grant felült. A „kicsi” gyorsan még egyszer lecsapott a fejével. A tutaj egyenletesen úszott észak felé. és a nyomot nézte. a hotel irányába. Az órájára nézett. hogy mostantól fogva azt teszed. . Még hallották távoli. lehunyta a szemét. Grant hátradőlt. és eltűnt a domb mögött. és alig hitt a szemének: negyed nyolc volt. amint a tutaj a lagúna egy kanyarulatát megkerülve északnak tartott. amelyet húzott. – Elfáradtam – mondta Grant. – Nem is tetszik evezni – szólalt meg. mintha a világ legképtelenebb kívánságának kellene eleget tennie. hogy utoljára megnézte. Grant az evezéstől kimerülten dőlt hátra.Amikor visszafordult. a pofája még mindig teli tépett hússal. neki a tutaj gumiperemének. – Akkor hogy lehet. és gyors úszással a part felé indult. A „nagy” is látta ezt. Grant bácsi? – kérdezte Lex. A felnőtt állat erre szinte kirobbant dühében a vízből. a folyó felé. – A folyó árama. – Megígéred. A „kicsi” belemart a tetembe. – Elmegy! Rá. hogy megvédje prédáját.

IAN MALCOLM .ÖTÖDIK ISMÉTLŐDÉS Most kezdenek igazán súlyossá válni a rendszer hibái.

aztán befelé fordultak. – A példány száma HD/09. – Van egy hírem a számodra – mondta Arnold. amely a dzsungelfolyónak tartott. – Ezt miből gondolja? – kérdezte tőle Gennaro. Egy nagy pálmafa gyökerestül kidőlt. A dzsip keresztülrobogott a keleti utat szegélyező pálmafasoron. Valami különös valótlanságérzet fogta el. Gennaro kikászálódott a dzsipből. – Fiatal hadrosaurus – mondta a tetemet bámulva Muldoon. egyre kisebb koncentrikus körökben haladtak. De a hadróval az a nagy harapás végzett. – Ezek az otiktól származnak. amely most a telep térképét mutatta. Muldoon sebességbe kapcsolt. éppen előttük. míg el nem érték a mezőn azt a részt. – Van még egy döglött hadrónk. Gennaro ujjaival dobolt a műszerfalon. – Mire várunk? Muldoon nem felelt azonnal. – Ennyi rohadt légy! – morogta. – Mihelyt letérünk erről az útról. ahonnan a kis othnieliák ugrottak elő. – Még egyszer meghúzta a whiskys üveget. . – A rex odakinn van valahol – mondta kisvártatva hunyorgó tekintetét a napfényes tájra függesztve. Gennaro a tetem fölé hajolt. hallgatta a légyzümmögést. és egy keskenyebb üzemi útra fordult. s a forró levegőben ingadozó távoli pálmafákra meredt. ha nyolcvan-száz kilométeres sebességgel tudunk haladni. és elindult a füvön. Dögevőktől. ugye? – az pedig csak a T. Semmi kétség. Aztán egyszerre csak megállt. Az otik ilyenek. ahogy az esetlenül széthajigált végtagokat nézte. látja azt az óriási vágást a lapockák alatt. – Dzsipben vagyunk. – De tény. fojtó. szinte bűzös volt az őserdő. Mellette Muldoon felkattintotta a rádióját. a rex gyorsabb a dzsipnél. – Látja ezeket a kicsiket itt? – A hasra mutatott. hogy nem sok mozgást látok arra. és megvizsgálta a jobb láb sarkát. Az neki semmi. Nagy kört írtak le a kocsival a letiport rész körül. Az állat pusztulása után. rajta száradt vér. hogy a tyrannosaurus nem később jött? – A harapások elrendeződéséről – felelte Muldoon. – Látja azokat a krétafehér darabokat a fűben? Az hadrószéklet. Mr. A húgysavtól olyan fehér. rajta a rácsbeosztás vonalai. Sötét alakot látott a fűben.KERESÉS Gennaro ült a dzsipben. Megpróbálhatjuk. – Hozza a rádiót! – mondta neki Muldoon. – Muldoon sóhajtott. – Muldoon lehajolt a legyek közé. Muldoon közben a dzsipben lévő komputermonitorral bajmolódott. Vártak és figyeltek. tőlük jobbra pedig egy kiemelkedő köves magaslat. és a T. a négykerék-meghajtással is legfeljebb. Reccsent a rádió. Nagy vértócsák szanaszét a füvön. – Az ürüléknyomokból – felelte Muldoon. Szám volt rátetoválva. A kimúlt állat húsát harapásnyomok tömege tépte szét. – Ugyan. Muldoon szólalt meg mellette: – Semmi kétség. Szeret veszélyesen élni? – Miért ne? – mondta Gennaro. A váratlan zaj két kis othnieliát riasztott föl a letaposott fűből. Valóságos csatatér terült el döbbent tekintete előtt: legalább százméternyi laposra tiport fű minden irányban. – És nincs valamirevaló fegyverünk. De ha odanéz – térdmagasságú halomra mutatott a fűben –. és odasietett. rex elkapta. – Mi az? – kérdezte Gennaro. ez a kölyök elszakadt tőlük. Már távolról megérezte a kezdődő rothadás savany-édes szagát. Sűrű légyraj reppent fel a fűből. Kölyök. Muldoon beindította a motort. egyre távolabb a dzsiptől. Itt Muldoon kiszállt. és rácsavarta a kupakot. – Híred? Micsoda? – Megtaláltam Nedryt. rex lehetett. – Vezérlő? – Itt vagyok – hangzott John Arnold hangja a készülékből. a rex a hadrosaurusok között járt. Gennaro – rázta a fejét Muldoon. Forróság uralkodott errefelé. – Meglódult az egész csorda. az a tyrannosaurus széklete. Vígan utolér. nos. – És azt honnan tudja. a lábai szanaszét.

még mintha egy kicsit gyorsabban is haladtak volna. Közelebb és közelebb kerültek egymáshoz kétfelől a partok. amelyek nem messze kuporogtak a hátsó lábukon. Beült a kormány mögé. és a magasba nyúl. Egy tucat procompsognathida állt az erdőszélen. mit kell tenni! – De igenis tudja! – sóhajtott a húga újra. – Megrázta a fejét. Nem mintha ez jelentett volna valamit ennek a nyomorult csirkefogónak. . ami valami kísértetiesen emberi jelleget adott nekik. Teste össze volt marcangolva. és. – Wu szerint tizenöt embriót. – Kompik – szólt Muldoon. – Ne beszélj hülyeségeket! – vágott közbe mérgesen Tim. hogy Lex a csónak orrában feláll. – Látja azokat a foltokat? Az ingén meg az arcán? Érzi ezt a szagot? Olyan. és a faágakat nézte odafönn. mígnem fák és az alácsüggő levélzet odafönn egyesülve a napot is eltakarták. A dilók megvakították. – Nem – mondta Grant.. – A 1104-es szektor éppen előttünk van. De leginkább csend volt. – A mindenit! – szólalt meg Muldoon. – Valahol kétmillió és tízmillió dollár között – mondta Muldoon. Ronda egy halál! Talán mégiscsak van igazság ezen a földön! A procompsognathidák sivalkodtak. Muldoon a csövet a másik dzsiphez vitte. aki sosem tudja. mit kell tenni. – No. – Nagy tétekben játszott az ürge. és fel-le ugráltak. Az egyik felugrott. ezek a bogyók ehetők? – A fákra mutatott. míg Muldoon kinyitotta a hátsó ajtót. – Éppen ő az. Tim néha madárdalt hallott. Sőt. mellette egy parkoló dzsipet. Megtörölték a pofájukat és az állukat. rátelepedett Nedry nyitott szájára. A kislány kelletlenül sóhajtott. és zöld volt – ám ahogy a dzsip odagurult és fékezett. de nem végzetes.. – Mit vitt el? – kérdezte Gennaro. A folyómeder egyre szűkült. A mellettük elhaladó fákra függesztette szemét. Borzasztó fájdalmas. Tudja. Izgatottan csicseregtek. – Nyilván rossz helyen tért le a szemét kis csirkefogó – mondta Muldoon. nem nagyobbak a kacsáknál. Nyolc óra. ha a szemébe kapja az ember. Szürke fémcsőfélét vett elő. kicsi ragadozók. – Hiszen nem is a kompik voltak! – Hogyan? Muldoon a fejét ingatta. a zöld alakok szétszóródtak. – Indított. hogy a kompik folytatják a lakomát. Kezdett elege lenni abból. – Ő mindig tudja. ezt észrevette. Két sötét hengert nyújtott oda Gennarónak. – Hé. hol ott feltűnő fényfoltok között. és betette hátulra. Érezte jól. – Aminek látszanak – válaszolta Muldoon. Gennaro csak a szemét forgatta. Két órán belül kimosható antiveninnel. száradt hányadéké. Alaktalanul olvadt össze a környezettel. hogy Grant a főnök.. – Amikor Gennaro hátrálni kezdett. – Miért nem? Azok a kis dinoszauruszok eszik őket. Dennis Nedry a hátán feküdt. – Nekünk dolgunk van. – Mit tetszik gondolni. mint eddig. – Hogy ő? – kérdezte Muldoon. hogy megérinthették. A forró levegő szinte állt az ágkupola alatt. gyerünk! – Na és ő? – mutatott a holttestre Gennaro. – A kislány az ágak között szaladgáló apró dinoszauruszokra mutatott. te mit csinálsz! – kérdezte. azt az egész vörösséget. rászólt: – Csak óvatosan! Nehogy rálépjen valamire! Gennaro figyelmesen átlépett Nedry holtteste fölött. aztán felhasították a hasát. és az embereket figyelték. Tim élénkvörös bogyófürtöket látott az ágakon. s az ágak közt ugrabugráló kicsiny dinoszauruszok csiripelését. úgy csipegette az orra húsát. – Rakéták.. mennyit ér az? Gennaro csak a fejét rázta. egyik lábát átharapták. Visszanézve Gennaro látta. Látta. Nagy göcsörtös gyökereik a víz széléig nyúltak. – Ezek mik? – kérdezte az. Békésen lebegtek a vízen a hol itt. Lex. és egy rozsdamentes acélból készült dobozt. – Megtalálták a kompik. Kisfiús arca most puffadt és vörös volt. Grant az órájára pillantott. Grant immár éberen feküdt a hátán. – Akkor sem.– Távirányítású videokamerával találták meg – mondta. mert nem te vagy a kedvence. Amint közelebb értek. – Ez dilónyál – mondta Muldoon. Gennaro már látta is a kocsi mellett a holttestet. Távolabb az úton Gennaro betonakadályt pillantott meg. mint a régi. Nézze azokat a sérülésnyomokat a szaruhártyák körül. Tátott szája és duzzadt nyelve körül legyek rajzottak. törékeny testű. A kis dinoszauruszoknak ötujjú kezük volt. Gennaro gyorsan elfordult. a belek kiszakítva. – Csak azért. – A dilophosaurus köpése. – Bárcsak itt volna apu! – mondta. amint a két férfi kiszállt a kocsiból. hogy megnézze a kis kompikat. Némelyik annyira lecsüngött...

– Szerintem szándékosan nyitottnak készült – válaszolt rá Grant. ha nem több. de Grant felemelte a kezét. hány száz tonnát nyomhat az üveg. Percek múlva azonban a tető már oly magasan felettük ívelt. Mindhárman felfelé meregették a szemüket. – Ez nincs befejezve – szólalt meg Lex. – Ennyit a mozgásérzékelőitekről! Hát Grant meg a gyerekek? Őket látjátok? – Őket sem találják a mozgásérzékelők. – Utánanézünk – utánozta gúnyosan Arnoldot. és elindultak a pálmafák sűrű erdején át. hogy szinte teljesen beleveszett a ködbe. mert ő is meghallotta. A geodetikus szerkezet mintázata tompán csillogott a könnyű párán át. hogy nem jelentkezik? – Nincs a monitorokon. s Grant először arra gondolt. csend legyen! – Miért? – kérdezte Lex. – Na ne mondd! És ezt honnan tudod? – Aputól. – Mi az. Csőrös fejük volt. ott. – Microceratopsnak. Kikászálódtak a csónakból. nagyon is érdekel. A tyrannosaurusnak nyoma sem volt sehol. – Hátha lesz itt egy telefon – válaszolta Grant. – Azért ne félj! Apu téged is szeret. – És akkor most mi az öregistent csináljuk? – kérdezte Muldoon. míg rá nem jött. – Nézzétek! Nézzétek! A madárház óriás kupolája tornyosult közvetlenül előttük. Muldoon Gennaróhoz fordult. . milyen hatalmas a valóságban: legalább négyszáz méter volt a kupola átmérője. lábuk meg-megcsúszott a sáros parti emelkedőn. – A francba! – dühöngött Muldoon. De aztán elnémult. tőlük északra. amit akarok. ahová a folyó tartott. – Úgy emlékszem. Grant kihúzta a tutajt a vízből. – Tudod. Aztán a kötelet egy fához erősítette. halványsárga kis dinoszauruszok ugráltak ágról ágra. hogy hívják ezeket? – kérdezte Tim. – Én azt mondok. akkor nem – mondta Grant. az hétszentség! – Újra a sauropoda részben voltak. Tim kiabálni kezdett dühében. ahol a hadrosauruscsorda futásnak eredt. Immár a kupolán belül sodorta tovább őket a víz.. – Sehol sem jelentkezik – szólalt meg Arnold hangja egy perc múlva ismét. – Meg kell próbálnunk felvenni a kapcsolatot a vezérlőteremmel. kit érdekelnek a dinoszauruszok? Csak az egészen kis fiúkat – mondta Lex. – Vagy mozgásérzékelők. A folyó bevitte őket a kupola pereme alatt. – Eddig miért nem nézett utána? Miért nem követte nyomon? – Honnan tudjam? – kérdezte Gennaro. A rádióba beszélt: – Merthogy itt nincs. van itt egy második szálló a kupola alatt – szólt Grant. nemcsak engem. téged a számítógépek érdekelnek. – Hát hol a fenében van az az átkozott rex?! – kérdezte dühös hangon Muldoon. – Tudod. Na és? – Apu igazi sportbolond – magyarázta Grantnak Tim.Tim szótlanul elfordult. és kilépett a vonalból. A mozgásérzékelők sem találják. és csak most fogta fel. s a letiport füvet nézték. hogy üveg nincs is ott – csak a gerendázat. és ha. Az elemek között vékony háló feszült. – De hát akkor kiröpülhetnek a madarak. Jó. Múlik az idő. – Várjatok! – volt Arnold válasza a készülékből. mint a papagájoknak. Vérfagyasztó sivítás hangja szólt valahonnan távolabbról. – Nagy szám! – mondta erre Lex. Onnan.. Grant nem felelt. – Ha igazán nagyok. csak bólintott. és nem a sport. – Azt hittem. Grant eddig csak távolról látta. Fenn a levelek között alig félméteres. – A part felé kormányozta a tutajt. – Néhány pillanat múlva már látták is egy épület tetejét a fák fölött. – Gyerekek – mondta –. – Utánanézünk – válaszolta Arnold. – Meg akar állni? – kérdezte Tim.

amely csak az övék. Lehetetlen ott végiggyalogolni. – Egy cseppet sem egyértelmű mennyire is buták azok az állatok valójában – mondta Malcolm. Ő nyilván éppen azt szeretné. – Tudom. amiről nem tudunk. amely egyáltalán bemerészkedik az általuk kijelölt területre. A kapcsolótáblánál ült. ott összecsukják a szárnyukat. A szárazföldi terület kilencvenkét százalékát lefedik – mondta Malcolm. Ez pedig ténylegesen annyit jelent. súlyos sérülésekkel tudtuk csak kihozni onnan. A szobájában volt. tudniillik keresztülhalad a madárházon. Nem értem. hogy ezt tudják. de még ha így is volna – vitatkozott Arnold –. és hibátlanul funkcionál. ha észrevennék. a dzsungelfolyót. Négy dactylusunk van most a madárházban – ezek voltaképpen cearadactylusok. Az eredeti terveken a fák tetejével egyező magasságú szállóépület szerepelt. – Pedig egyszerű az oka – mondta Malcolm. – Csakhogy ha a maradék területet kivetíti a térképre. Azóta. látni fogja.A MADÁRHÁZ – Egyszerűen nem értem – mondta a telefonba John Arnold.. – Még hogy nem elégséges? – csattant fel Arnold. – És Grantot meg a két srácot sem leli. – Grant nem bolond. – Például a rexet? – Semelyik rendszer nem jelzi. hogy Nedry tönkretette a Juraparkot irányító számítógépet. de Grantot meg a gyerekeket sem. Arnold türelmesen. hogy bármely állat szabadon járhat-kelhet a parkban. A mi halevőink ugyanis területi alapon állnak. – Támadnak? – De még hogy! Azt látni kell – mondta Arnold. Magyarán egybefüggő területről van szó. Mint kiderült. egyenként sorra keltette életre a különböző rendszereket. Szombat reggel nyolc óra volt. az állatok túl buták ahhoz. igaz? – Nem. Arnold kimerült. nem? – Hát legalábbis nem találom. – Területin? – Méghozzá keményen – mondta Arnold. és bármely más állatot megtámadnak. . hacsak nem tért nyugovóra ismét. amelyek halevők. – El nem tudom képzelni. – Felsiklanak a madárház kupolájának tetejéig. – De a mozgásérzékelőkkel gondja van. ott hívta fel Arnold. vagyis tizenegy órája. a partot vagy mit tudom én. mit. – A park minden rendszere újra működik.. Malcolm köhögött a vonal túlfelén. Vagy a folyón vannak. – Nem látom a rexet.. hogy nincsenek ott – tette hozzá aztán jóval bizonytalanabbul. – Megküzdenek egymással a maguk területéért. – Én legalábbis őszintén remélem. Több munkásunkat ájultan. ez óriási hiba volt. Már hívtam orvost magához.. és kikerülheti a megfigyelést. a dactylusokat már a kupola alatt helyeztük el. – Szóval ha azok a gyerekek a madárházban vannak. aztán elveszett. A vezérlőterem padlóját lassan beborították a papírtálcák és a félig elfogyasztott szendvicsek maradványai. de az nem éppen a legbiztonságosabb útvonal. – És a dactylusok nem szenvednek sérüléseket ettől? – Eddig még soha. – És mi baj velük? – Míg az épületen dolgoztunk. amit keresek. miközben megint elfogta a köhögés.. amely a szemük elé kerül. magasan a talaj felett. hogy az a bizonyos fennmaradó hányad topográfiailag egységes. – Hiszen kilencvenkét százalékát. hogy valami más problémájuk van. a kastélyban. Ő meg a gyerekek biztosan minden mozgásérzékelőnek integetnek. – Alig tudtuk felállítani. – Jó. – Nincsenek! – vágta rá Arnold. Onnan a kupola alatt. Jók már a telefonok is. ha mondjuk egy üzemutat követ. mintha egy halom tégla csapná fejbe. – A mozgásérzékelők által lefedett terület nem elégséges.. miért volnának a folyón. Nagyon összeszűkül a part. és újabb csésze kávét hajtott fel. – És ha csónakon jönnének a vízen? Idehozná őket a folyó? Egészen végig? – Igen. Egy ilyen húsz-huszonöt kilós állat úgy leterít egy embert. a repülési magasságuk szintjén nézhették volna a látogatók a pterodactylusokat. – Miért nem szerepelt a madárház a túra útvonalán? – kérdezte Malcolm. – Maga szerint Grant és a gyerekek is kerülik a megfigyelést? – Ők holtbiztosan nem – mondta Malcolm. miért. Körülbelül húsz perce indult északnak a lagúna partja mentén. és zuhanásba kezdenek. hadd szokják. De lehet.

Mintha csak valami hatalmas árnyék húzott volna el fölöttük. Éppen futni kezdett volna. visítva. hogy az állatokban minden nagyságuk ellenére van valami törékenység. – Nem hiszem. – Hogy lehet az. Túl nagyok hozzá. Megint az utolsó pillanatban nyomta le a gyerekeket a földre. a testük szőrös. Az egyik dactylus csigavonalban leereszkedett. Pillanatok múlva elborította őket. Grant egy szemvillanásnyi ideig látta fogakkal teli csőrét és a szőrös testet. Hosszú. – Ez meg mi? – Nem tudom. nagy szárnycsattogással elrepült fölöttük. – De vajon ezek miért nem szerepelnek a kiránduláson? – kérdezte Tim. hogy egy hatalmas sötét alak siklik el fölöttük. Mint valami óriási denevér. Sokkal gyorsabban repült. közben hallották a közeledő süvöltést. – Fuj! – mondta undorral Lex.– Ez egy kastély? – kérdezte utálkozva Lex. – Megharapott! – Mit csinált? – döbbent meg Grant. sötét alakokká összehúzódva zuhantak a föld felé. Fenn a magasban két újabb dactylus csukta össze a szárnyát. Miközben Grant nézte őket. ahogy a tutaj felé igyekeztek. – Nem láthatnak minket? – kérdezte. és visszafelé vitorlázott feléjük. Hiszen oly szépek. – Gyerünk! – mondta. hogy kiterjesztett szárnyuk távolsága legalább öt méter. az – felelte neki Tim. hátulról jött. Fenn a magasban kisebb repülőgépnek látszottak.. – Ez egy szeméttelep! – Úgy látszik. pergamenszerű szárnyai. A levegőt is valami jellegzetes. savanykás szag töltötte be. – Hű! – szólt Lex. valami okból nem fejezték be – mondta Grant. Csak cearadactylusok lehetnek. felrántotta Lexet. elvarázsolta az óriás. Grant ugyanezen töprengett. Ekkor csapott le a második dactylus. – Jaj! – kiáltott fel Lex. Ugyanakkor meglepte. repülő állat döbbenetes látványa. Halat esznek. hogy nem bánthatnak bennünket? – Majdnem teljesen biztos. Az órájára nézett. menjünk vissza a hajónkhoz! Előbújt a nap is. Még a napot is eltakarta. s látta. amikor elvette a kezét. és kézen ragadta a gyerekeket. Szinte megbénította. – De büdös van itt! – szólt Lex. mint az első. amely az erdő túlfeléről jött válaszul. – Akkor gyerünk. Grant látta rajta a madárürülék fehér csíkját. és savanykás szag maradt a levegőben utána. Grant a fölöttük magasló kupola rácsszerkezetének árnyékát nézte a földön. hogy éles karmok tépik fel az ingét a hátán. Látta. Aztán Grant felhőárnyat vett észre előttük a füves réten. Grant érezte. melyeken átsütött a napfény. Grant eszében azonban az járt. mint amit az épület oldalán is észrevett. éppen amikor a két dactylus fütyülve. Felkászálódott. s látta. fejük pedig mint a krokodilé. – Tűnés! – kiáltotta Grant. egy második pterodactylus is megjelent az égen. hogy a talajt és a növényzetet mindenütt ugyanannak a fehér anyagnak a széles csíkjai borítják. Futottak a réten át. Grant nem szólt. gondolta. miközben a két madár oldalra billentve ismét megfordult a magasban. sivító hangot hallattak. De már talpon is volt. amikor Lex rémülten felsikított. Felnézett. Hátrafordult. A hatalmasra tárt szárnyak közt feszülő rózsaszín hártya egészen áttetszően vékony volt. Közben valami ijesztő. – Hát ezek tényleg nagyok! – Aztán egy cseppnyi szünet után megint megkérdezte: – Biztos. – Megharapott! Megharapott! – Véres volt az ujja. és felnézett az égre. Amikor lejjebb ereszkedtek. repülő dinoszauruszok. a korai krétakor repülő sárkánygyíkjai. és a hajába markolt. s a hatalmas árnyak csapkodva libbentek el fölöttük. kecsesen megfordult. alacsony fűvel borított tisztásra léptek. Biztos a madarak potyogtatták el.” Lex kezével beárnyékolta a szemét. hogy az egyik dactylus hátsó karmaival a kislány vállába kapaszkodik. Aztán egy másik füttyszót. hogy nem fejezték be az épületet? Vadvirágokkal beszórt. és vidámabbá varázsolta a reggelt. – Juj! – kiáltott fel Lex. láthatóvá vált. és újabb néhány métert futottak mindhárman. – Dél-Amerika és Mexikó. Kis. oly kecsesek és méltóságteljesek voltak a levegőben sikló. Fenn a magasban a pterodactylus mély füttyszót hallatott. Grant az utolsó pillanatban vetette magát a földre. magával rántva a gyerekeket is. és sikítva feléjük zuhant. majd egy harmadik és egy negyedik is. úgy húzott el közvetlenül a fejük fölött. – Ez egy pterodactylus? – Igen. Meleg levegő fuvallata csapta meg őket. ott . Óriás.. Ám ez az árnyék igen sebesen mozgott. – Mik ezek a fehér izék? – Gyíkürüléknek látszanak. hogy ezek nem közönséges pterodactylusok. mély füttyszót hallottak. Igyekezett titkolni a csalódottságát. – Talán mert nincs még kész az épület – mondta Lex. „Halevők – jutott eszébe.

– Elvitték a kesztyűmet – mondta Lex. De lehet. A sebességtől egy kis szellő támadt körülöttük a faágak alatt. . az állatvilágban a szaporodásnak és a szexualitásnak szinte elképesztően sok változata létezik. mi volt a stegosaurusnál? Tegnap este? – Hogyne. csipogva csapkodott a szárnyaival. – Kíváncsi lettem volna. hunyorogva igyekezett kivenni. Aztán a felmagasló part ismét összezárult. és vadul csapkodott a karjaival. és ez esetben alighanem hatástalan. Kellemes érzés volt. miközben futni kezd. és felemelkedett. amely sivítva. a sivítás és a száraz. hogy ennyivel is hamarább érnek majd vissza.. Grant csak találgatta. – Nos. Grant ellökte magát a dactylustól. – Az jutott eszembe. engedi-e. te buta – mondta a kislány. Az állat fel akart emelkedni. s borzadva látta. s a meleg gumitest alatt átfolyó víz halk mormolását hallgatta. a besugárzás köztudottan igen megbízhatatlan eljárás. kis szárnykarmaira emelkedett. elvesztette az egyensúlyát. amikor elhagyják a tutajt. felugrott. s Grant a szőrös testre esett. fel a magasba. Tim átölelte a húga vállát. amint a vízen lebegve maguk mögött hagyták a madárház kupoláját. – Mi történt? – kérdezte Grant. Küszködés közben többször is a kislány feje felé kapott hosszú.. hogy esetleg már csak egy órányi gyalogútra lesznek a szállótól. nem hallott. hogyan szaporodhatnak a dinoszauruszok.csapkodtak kétfelől Lex mellett. Lex sikoltozott. De még mindig ott az a probléma. Szerintem. hogy Lex karjával próbálja védeni a fejét. s megint összeértek a fák. megfulladnak tőle. A negyedik dactylus esetlenül csapdosott. A folyó jobban elkeskenyedett. s a lecsüngő ágak is gyorsabban siklottak a fejük fölött. Grant megint az órájára nézett. és egész testével az állatra vetette magát. Most sebesebben haladtak. A három dactylus haragos sivítással üldözőbe vette az elsőt. És máris lecsapott az első. – Én is – mondta Tim. – Pedig de nagy szám lett volna Ralphon lovagolni! Tim fordult Granthoz. Az állat sivított. – Miért tetszett a béka-DNS-ről érdeklődni? – A szaporodás miatt – felelte Grant. mi történt. Grant hátradőlt a tutajban. – Biztos már nem is él szegény! – Dehogy nem. Grant elrántotta a fejét az állkapcsok elől. pergamenszerű hártyák. Lex örömkiáltásban tört ki. és hátrébb húzódott. Már előttük is volt a csónak a parton.. Grant elképedten megállt. és üldözőbe vették az elsőt. Grantnak semmi más nem jutott eszébe. s az áramlás is felgyorsult. hogy megérintse a lecsüggő ágakat. Lex szólt közbe: – Timet nagyon izgatja ám a szex! Oda sem figyeltek rá. visszafordult a hátáról. ez itt be is fog bizonyosodni. hogy meglovagoljam – sóhajtott a kislány álmosan a meleg naptól. Ismét útnak indultak. Lex felnyúlt. hogy semmi baja. hogy jó néhányat. Mintha sátorban lett volna. hány kilométert tehettek meg eddig. sok helyütt a három métert sem érte el. odarohant. Magukra maradtak a réten. sem Grant. Ekkor azonban a kislány hozzávágott valamit. hogy vajon hogy van Ralph – mondta Lex. ha mind az? – Hogyan? – kérdezte Tim. És különleges méret. Fogadok. amióta elhagyták a raktárépületet. mire a dactylus váratlanul elfüttyentette magát. amikor mind nőstény. Abban a pillanatban a magasba emelkedett a másik kettő is. és csapkodott a csőrével. csakhogy Lex túl nehéz volt neki. De a madárházban lezajlott kaland után Grantnak valahogy nem akarózott újra elhagyni a vizet. ahol az éjszakát töltötték. hegyes pofájával. Karmos lábak kapkodtak vadul a mellkasa felé. Ez akár azt is jelentheti. míg nehézkesen a levegőbe emelkedett. de biztos. Grant pedig szédült. hogy visszaérjenek. hogy még annál is többet. – Nos. Grant felnézett. De azt is jelentette ez. Egyelőre különben is jó tempóban haladtak. s a tetejében még be is sugarazzák őket. – Jól vagy? – Persze. mint eddig bárhol. Hogyan szaporodhatnak. – Tetszik még emlékezni. Lex sikított. aztán a többiek nyomába eredt az is. Az az ütéstől a hátára zuhant. Tud járni a szárnyain! Lederer elképzelése helyes! De aztán a többi dactylus is rájuk vetette magát. – Csak azt remélem. Már csak két és fél órájuk van rá. – Én is remélem. és megdöglenek. szélviharban.. – Pedig márkás volt. Nyolc harminc. nem volt más. – Ez igaz. és elindult rajtuk. Tim meg teljes hangerővel ordít. Talán nyolc-kilenc kilométert. miközben az óriás szárnyak a teste körül suhogtak. Nem látott. – Nincs rá magyarázat. sem Tim. csak a csapkodó szárnyak. hogy a dinoszauruszok mindegyike nőstény.

Megszökik. . A túlpartra evezett. Tim bólogatott. Vannak állatok. – Akkor menjen végig az összes szobán itt az emeleten. rángatta és forgatta a fejét. – Pontosan olyankor szokott bekövetkezni – felelte erre a matematikus. és otthagyta őket. Olyan keskeny volt a folyó. – A Malcolm-effektus értelmében katasztrofális változások várhatók. mint az embereknél. – De nem is egy van belőlük. – Nincs. Wu is olyasféle. – Mi csinálja ezt? – kérdezte Lex. ami közvetlenül a szemük előtt van. A következő pillanatban a tyrannosaurus óriás feje tört át bal felől a levelek sűrűjében. amely anélkül szaporodik. Ellie megkérdezte: – Maga nincs valami nagy véleménnyel Arnoldról. a csónak előtt haladt. – Figyeljetek csak! Morgást hallottak. De megint csak csődöt mondott. Miért. s ott megragadott egy ágat. amely egy kicsit távolabb.– Például nagyon sok állat van – mondta Grant –. Mennyi van összegyűjtve? Eltéve. és rést keres a fák között. Mintha csak alagútban hajókáztak volna. – Mondja. Reszkettek az ágak a nyomukban. Tim és Lex tehetetlenül nézték. amelybe ismétlődő. amint a hajót magával sodorta az áramlat. hogy bármi olyasmit tenne. amint északnak tart velük együtt. A tutaj úszott velük tovább. Nem látják a következményeket. amelyeknél a hím és a nőstény sokkal egyformább. s a microceratopsok rémülten szaladtak szerteszét. s ezt „célirányos” gondolkodásnak mondják. Grant megrendülten dőlt hátra a csónakban. – Hé! – kiáltott fel Lex. A tyrannosaurus fennakadt a sűrű növényzeten. Mert olyan nincs. hogy éppen csak elfért rajta a tutaj.. De a fák túl sűrűn szegélyezték a folyópartot. előttük volt a folyón. Ezt képtelenek felfogni. Töltse fel a fürdőkádakat! Ellie elkomorult. hogy megállítsa a hajót. Ez a fajta kapcsolódás nem kíván olyan nagy fizikai különbséget hím és nőstény között. A hím spermahordozót bocsát ki magából – ebben van a sperma –. – Fogalmam sincs – mondta Grant. igaz? – Semmi bajom vele. hogy a tyrannosaurus újra meg újra kísérletet tesz rá. A gumiperemek gyakran a földet súrolták. és nem adta fel. amelyet aztán a nőstény később magához vesz. vagy jobban hasonlít egymásra. Megint felhangzott a vicsorgó morgás. mire készül? Földrengés lesz? – Valami olyasmi – mondta Malcolm. Csak nézőkörük – én legalábbis így hívom. így jöhet létre egy olyan sziget. Grant fülelt. Már kis híján kilenc. Szűk látókörűen gondolkodnak. ott sivítoztak. hogy létrehozunk egy állatot. A kis microceratopsok mind a másik partra menekültek. – Továbbá – folytatta Malcolm – Walkie-talkie-jaink vannak-e? Hát zseblámpáink? Gyufánk? Petróleumfőzőnk? Ilyesmi? – Körülnézek. De műszaki ember. Malcolm felnyögött. a sorsuk megpecsételődött. de azt már nem feltételezzük róla. de a folyó szélessége csak három méter volt. mint amilyet általában el szoktunk képzelni. Malcolm sóhajtott. Mind a kettő technikai szemmel nézi a világot. A szűk látókörű gondolkodás eredményeként.. Tovább indult a folyó mentén. szaladgáltak és ugráltak fel-alá. Attól. mintha egy csomó bagoly volna ott – szólt Tim. A hatalmas állkapcsok a tutaj felé kaptak. mint ez. Grant pedig vadul evezni kezdett a túloldal felé. majd felordított. – De mi van a békákkal? Hirtelen sivalkodás zaja hangzott fentről a fák közül. hogy élőlény módjára fog viselkedni is. Aztán végre felhagyott a hiábavaló próbálkozással. – De hiszen Arnold szerint az összes rendszer kifogástalanul működik. – Nem kaphatok morfiumot? – Még nincs itt az ideje – mondta Ellie. Nincs igazi látókörük. huhogó kiáltás vegyült. – Gyűlölöm! Gyűlölöm! – mondta Lex. hogy csak nézőköre van valakinek. az biztos. Lex rémülten sikított. Aztán a huhogások is. amit mi szexnek hívunk. Ha a tyrannosaurusnak sikerül áttörnie. A hangok egy kanyar mögül jöttek. Nem látják a környezetüket. Dühödten rázta az ágakat. Az órájára pillantott. Csak azt látják. Hogy kiszámíthatatlan lesz. Látták a tyrannosaurus óriás. Van egyáltalán? Ellie vállat vont. A tyrannosaurus tovább követte a folyót. hogy áttörjön. sötét alakját a partot szegélyező fákon keresztül. Újra hallotta a huhogást. Aztán visszahúzta a fejét. – Nem azt kérdem. mennyi vizünk van? – Mit tudom én? Elég folyik a csapból. – Úgy hangzik. A tutajban Grant.

miszerint ők azt kutatják. Mert. gyönyörűek a naplementék. Ennyi idő után már tudnunk kellene. – Úgy látszik. – Csak a hulladék marad.. kérdem én? Ellie nem válaszolt.. dehogy! – mondta Malcolm. Az űrhajósok szemetet hagynak a Holdon. – Vagyis ásatásra még jut. s a világ többi részén – szinte mindenütt – rosszul lesznek tőle. ugye. hogy ott jártak a tudósok. hogy meglegyen az élelme. Melléktermékek.. alhatott. . Muszáj. akiknek csak „nézőkörük” van! Ne az övék legyen a hatalom! – De hát mi lesz akkor a haladással? – Miféle haladással? – kérdezte bosszúsan Malcolm. – Ez izgat legkevésbé. és megszakította a monológot: – Nem gondolja. nem hozzák rendbe a földet az ásatás után? – Nem. ami jólesett.. Az nem lehet. Minden felfedezés erőszakot tesz a világon. – Megvonaglott a fájdalomtól. mintha azt mondaná: az az emberi természet. – Harmincezer évvel ezelőtt.. hogy ők legyenek az elsők! Ez a tudomány játszmája. Mindez beleépült a tudomány szövetébe. a mosogatógép. ami a fejükben jár. a szemétledobó. – A teljesítmény. – Dehogy – felelte Malcolm. mire jó és mire nem. Ami voltaképpen igaz is. hogy csak nézzék a dolgokat.. Kizárólag a nyugati iskolázás eredménye. hogy szalonnás rántottát reggelizünk. Szó sincs róla. de a helyrehozatalra már nem? – Kopár vidéken dolgozunk. hogy nyomuk maradjon. Ez a tudós dolga. Mellékhatások. ha ők nem teszik meg. a mosó. ahol tiszta volt a levegő. mint „az igazság keresése”. A fennmaradó időben játszhatott. Hogy csak értékeljék. – Hát azért. és hátrahanyatlott. utána pedig a szó szoros értelmében megváltozik a világ. hulladék meg mellékhatások. a morfiumtól filozofikus leszek. ha elérik. csak megfigyeléseket végezzenek. – A nők ma ugyanannyi órát fordítanak háztartási munkára. hiába az úgynevezett haladás. Megmondjam magának. Abba soha bele nem gondolnak. szépek voltak a fák. Még a legtisztábban tudományos felfedezés is agresszív. Mindig marad nyoma. arra már nincs pénz. – De akkor mi a válasz? – Szabaduljanak meg azoktól. Gondoljon bele! Heti húsz! Harmincezer évvel ezelőtt! – Maga visszafordítaná az órát? – kérdezte Ellie. hát majd megteszi más. tette. Roppant kényelmesen „értelmezhetetlennek” mondják az efféle megfontolásokat. Ezért hát arra összpontosítanak. Itt az idő a változásra! – Mielőtt elpusztítanánk a bolygót? – kérdezte Ellie. és radioaktív melléktermékek maradnak utánuk. – Eltúlzom? Hogy néznek ki a maguk ásatásai úgy egy év múlva? – Hát elég pocsékul – ismerte be Ellie. ha az emberek felébrednének végre. és lehunyta a szemét. hogy eltúlozza. s immár egész társadalmak igyekeznek „tudományosak” lenni ezen a földön. Ezzel megnyugtatják magukat. az az. Aztán megpillantotta a dinoszauruszokat. hogy egyszerűen ilyen az emberi természet? – kérdezte Ellie. csak éppen nem ez hajtja őket. helyes-e. így aztán csak az számít. Mindenhová be kell dugniuk a műszereiket. – Kopár vidéken – mondta a fejét ingatva Malcolm. hogy el tudnak-e érni valamit. hogy a tudósok pontosan így akarják! Melléktermék kell nekik. Muszáj valami természetellenes dolgot tenniük. – Te jó ég. Hiába a porszívó. – És miért nem? Ellie megvonta a vállát. És természetes világban élt. Gondolom. mi az igazság a természetben. Mindig. Ellie kihasználta az alkalmat. harcias behatolás. Senkit sem hajtanak olyan elvont dolgok. és elvégezték a maguk felfedezését. a mikrohullámú sütő. amit látnak. A hangok nem szűntek. Hogy beilleszkedjenek a természet rendjébe. – Nagyot sóhajtott. tiszta a víz. – Nem is tudom. minden. mint 1930ban. a ruházata és a fedél a feje fölött.és szárítógép. Hatalmas arzenálra van hozzá szükség.. mint 1930-ban. és egyre katasztrofálisabb a hatása. – Csakhogy a tudósok pontosan ezt akarják. mi a baj a mérnökökkel és a tudósokkal? A tudósoknak részletesen kidolgozott elméletük van rá – baromság az egész! –. – Csak azt szeretném. A részecskegyorsítók felsebzik a tájat. Malcolm felsóhajtott. A felfedezés – gondolják ők – elkerülhetetlen. Négyszáz éve létezik a modern tudomány. – Ez olyan. Grant az egyik ágtól a másikig kapaszkodva hajtotta előre a hajót a dzsungelfolyó sötét alagútjában. Miért telik ma is ugyanannyi időbe kitakarítani a házat. a lascaux-i barlangrajzok korában az ember heti húsz órát dolgozott. Csak azt szeretném megértetni magával.– Nem gondolja. – Szóval ültetik be a terepet. az eredmény. – Te jóságos ég! – mondta.. – Kér egy kis vizet? – Nem. mert nem történt semmiféle haladás – felelt saját szónoki kérdésére Malcolm.

– Akárhogy is! A dilophosaurusok csak ittak és huhogtak tovább. Az megint át akart törni a növényzeten. s a folyón túli fák felé tülköltek. sáros talajon. Édeskés és undorító volt egyszerre. – Nem. Grant pedig visszafojtotta a lélegzetét. hogy efféle rítusaikat az állatok néha órákig művelik egyfolytában. A mozgásuk viszont madárszerű volt. De aztán ismét mozgásba jött. Dilophosaurusok. és ne moccanjatok. Alul a hasuk élénkzöld volt. – Grant tudta. éppen a víz legszélénél. Tágra nyitotta száját. A dilophosaurusok méterekre voltak tőlük. tülköltek. Ám a következő pillanatban. s ekkor különös szagot éreztek.. szertartásszerű ismétlődés volt a viselkedésükben. Zátonyra futottak. Grant elmosolyodott. Kettő állt a folyóparton. Folytatták az utat a folyón. mint a gyíkoké. és az is ivott. . aztán elvonult. Grant nagyot sóhajtott válaszul. A dilophosaurusok kisebbek voltak a tyrannosaurusnál. kimutatta csupasz. A szag szinte kibírhatatlanul undorító volt. amelyek még mindig hátat fordítottak a folyónak. és most ellenkező irányba nézett. és a lábukkal dobogtak a sárban. hogy a jobb oldali állat kisebb. A tutaj elúszott mellettük. meglepődött. Ahogyan Grant már sejtette. Háromméteres testüket sárga és fekete foltok borították. – Ha tudnám! Leült a tutajban. Ilyenkor nem esznek. pontosabban fennakadtak a part víz alatti részén. Grantnak feltűnt. Kilenc óra húsz. – Egek! – mondta. hogy átférjenek a folyót szegélyező fák között. Puff! A tutaj megállt. nem törődnek semmivel. V alakot formázva a fejen. és megvizsgálta a tárat. A tutaj még egy utolsó kanyart megkerült. mint a száradt hányás szaga. elég kicsik ahhoz. hogy igyanak belőle. gyerekek! Most lefeküsztök a gumipadlóra! Megpróbálunk olyan gyorsan elhúzni mellettük. Valami furcsa. ameddig így állnak. Közeledtek a dilophosaurusokhoz. Mindkét állat elfordult a folyótól. – Azt hiszem.– Nem ezek azok.. – Ez mi? – kérdezte Lex. Órájára pillantott. De aztán újra elhuhogta magát.. idegtépően csikorgott. a másik pedig visszahuhogott neki. A tyrannosaurus felüvöltött. Lex suttogva kérdezte: – Szálljunk ki. Grant ennek ellenére előhúzta a légpisztolyt. A dilophosaurusok trombitálása hangosodott. amelyek mérgezőek? – De igen. amennyire csak lehet. Aztán fokozatosan felgyorsult.. még mindig csak néhány méternyi távolságra a dilophosaurusoktól. hosszú fogsorait. A tutajt továbbsodorta a víz lefelé a folyón. csúszott a köves. Grant felkapta a fejét. úgy hajoltak rá a vízre. A bal oldalon álló állat lehajolt. Ráadásul a mozgásuk is gyorsnak látszott. a szemüktől az orrukig. a dilók tülkölése a tyrannosaurusnak szólt. amely kölcsönösnek tűnt. – Óriási! – suttogta Lex a csónak fenekén. alighanem meglátta a tutajt.. a foltok is kisebbek a hátán. vicsorogtak és huhogtak. – Ide figyeljetek. – Hiszen ez párzási rítus! – Nem tudunk elmenni mellettük? – kérdezte Tim. és rémült szemeket meresztett rá. A tutaj folytatta útját. A jobb oldali állat erre visszahuhogott. – Most mit csináljunk? – kérdezte megint Tim. A dilophosaurusok egyszerre csak izgatott tülkölésbe és bőgésbe kezdtek. pontosan ugyanúgy. Az egyik dilophosaurus úgy tűnt. aztán felkapták a fejüket. – Ezek megmérgeznek! – Pedig muszáj – mondta erre Grant. bármi is történjék! Oké? A tutaj lassan sodródva elindult a folyón a huhogó dilophosaurusok felé. ivott. – De a csónakban nem mehetünk el mellettük – mondta Lex. a taraja nem annyira élénkvörös. – Ellökte a tutajt a parttól. a dilók erre huhogtak. aztán huhogott. – Csak ez hiányzott! A tutaj hosszan.. Utána elölről kezdődött az egész. Lex Grant lábánál feküdt. amint egymásra morogtak és huhogtak. Két ívelő taréj futott végig a fejük tetején. szinte tükörképét adva az első állat mozdulatainak. végre kaptunk egy kis segítséget. és menjünk gyalog? Grant nemet intett a fejével. A tyrannosaurus még egyet bömbölt. De egyet ne feledjetek: ki ne nyissátok a szátokat.

A TYRANNOSAURUS

A dzsip bukdácsolt a tűző napon. Muldoon ült a vezetőülésben, mellette Gennaro. A nyílt mezőn voltak, egyre távolabb a növényzet és a pálmafák sűrűjétől, mely a folyót szegélyezte, s jelezte, merre halad: úgy száz méterre keletre tőlük. Emelkedőhöz értek, és Muldoon fékezett. – A szentségit, de nagy a hőség! – mondta, és karjával megtörölte a homlokát. Meghúzta a térde között tartott whiskys üveget, aztán odanyújtotta Gennarónak. Gennaro megrázta a fejét. Nézte, hogyan rezeg, csillámlik a táj a reggeli fényben. Aztán a kocsiban lévő komputerre és a műszerfalba épített videomonitorra esett a tekintete. A monitor a park egyes részeit mutatta, a távirányítós kamerák képeit. Még mindig nem volt nyoma sem Grantnak, sem a gyerekeknek. A tyrannosaurusnak sem. Reccsent a rádió. – Muldoon? Muldoon felkapta a mikrofont. – Ja! – Működik a géped? Megvan a rex! A 442-es kockában van. Most megy át a 443-ba. – Pillanat – mondta Muldoon, és igazított egyet a monitoron. – Igen. Már megvan. A folyó mentén halad. – Az állat észak felé lopakodott a folyópartot szegélyező növényzet mentén. – Vigyázz rá! Csak bénítsd meg! – Ne izgulj! – szólt Muldoon. Hunyorgott az erős napfényben. – Nem esik baja. – Ne feledd: a tyrannosaurus a park legfőbb látványossága a turisták számára! Muldoon kikapcsolta sercegő készülékét. – Barom! – mondta. – Ezeknek még mindig a turisták a fő gondjuk. – Beindította a motort. – Hát akkor látogassuk meg Rexit, és adjunk be neki egy adagot. A dzsip nagyot zökkent egy göröngyön. – Maga ezt élvezi! Látom, alig várja – szólt Gennaro. – Ami igaz, az igaz. Régóta várom, hogy belelőhessem a tűt abba a nagy dögbe – felelte Muldoon. – Tessék, ott van! Nagy rándulással megálltak. Gennaro a szélvédőn át megpillantotta a tyrannosaurust. Pontosan előttük volt. A folyó menti pálmafák között haladt. Muldoon kiitta a maradék whiskyt, az üveget pedig a hátsó ülésre dobta. Kilövőcsövéért nyúlt. Gennaro a videomonitorra pillantott, amelyen pontosan látszott a dzsipjük és a tyrannosaurus. Nyilván egy kamera van valahol a fák közé rejtve. – Ha segíteni akar – szólt hozzá Muldoon –, akkor nyissa fel az egyik fémdobozt ott a lábánál. Gennaro lehajolt, és felnyitotta a rozsdamentes acélból készült dobozt. Habszivaccsal volt kibélelve. A habszivacsban négy henger nyugodott, akkorák, mint egy-egy literes tejesüveg. Mindegyiken rajta volt a felirat: MORO-709. Kivett egyet. – Pattintsa le a tetejét, és csavarjon bele egy tűt! – rendelkezett Muldoon. Gennaro megtalálta a műanyagból készült tűdobozt. Egy-egy tű átmérője akkora lehet, mint az ujjhegyéé. Rácsavart egyet a lövedék végére. Látta, hogy a másik végén kerek ólomsúly van. – Tulajdonképpen ez az ütőszeg – magyarázta Muldoon. – Találatkor összenyomódik. – A térdére fektette a légfegyvert, és előrehajolt. A kilövőszerkezet súlyos, szürke, cső alakú fémből készült, és leginkább valami tankelhárítóra vagy páncélökölre emlékeztette Gennarót. – Mi az a MORO-709? – Szabványos állatnyugtató – felelte Muldoon. – Ezt használják az állatkertekben világszerte. Próbálkozzunk kezdetnek ezer köbcentivel! – Felnyitotta a tárat, amely akkora volt, hogy belefért az ökle. Belecsúsztatta az egyik lövedéket, és becsukta. – Remélem, ez elég lesz – mondta. – Egy elefánt átlagosan körülbelül kétszáz köbcentit kap, csakhogy annak két-három tonna a súlya a Tyrannosaurus rexé viszont hét, és sokkal vadabb az elefántnál. Nem mindegy a dózis szempontjából. – Miért? – A dózist részben az állat súlya, részben a temperamentuma határozza meg. Mondjuk hogy ugyanannyi 709-est lövünk be egy elefántba, egy vízilóba meg egy rinóba. Az elefántot megbénítjuk vele, csak áll ott, mint egy szobor. A vízilovat már csak lelassítjuk. Elég álmos lesz, de mozog tovább. Ugyanettől azonban a rinó csak begorombul, és

támadni kezd. Másfelől viszont, ha több mint öt percen át kergetünk autóval egy rinocéroszt, fogja magát, és holtan esik össze az adrenalinsokktól. Fura egy kombinációja az erőnek és az érzékenységnek. Muldoon lassan a folyó felé vezette a dzsipet, egyre közelebb a tyrannosaurushoz. – Igen ám, csakhogy ezek mind emlősök. Sokat tudunk róluk, mert az állatkertek mind a nagy emlősökre épülnek, ők a főattrakciók: az oroszlánok, tigrisek, medvék, elefántok. A hüllőkről már jóval kevesebbet tudunk. A dinoszauruszokról meg senki sem tud semmit. Ezek új állatok. – Hüllőknek tekintik őket? – kérdezte Gennaro. – Nem. – Muldoon sebességet váltott. – A dinoszauruszok nem illenek bele a már ismert kategóriákba. – Elrántotta a kormányt, hogy kikerüljön egy sziklát. A kocsi megcsúszott, de folytatta útját. – Voltaképpen rájöttünk, hogy ahány dinoszaurusz, annyiféle. Éppen úgy, mint az emlősök. Egyesek szelídek és aranyosak, mások gonoszok és vadak. Némelyik jól lát, némelyik nem. Van, amelyik ostoba, és van, amelyik igen-igen intelligens. – Mint a raptorok? – kérdezte Gennaro. Muldoon bólintott. – A raptorok okosak. Nagyon ravaszak. Mondok magának valamit. – Egy kis szünetet tartott. – Az összes eddigi problémánk semmi ahhoz képest, mi lenne itt, ha egyszer a raptorok kiszabadulnának a karámjukból. Na! Azt hiszem megérkeztünk, ennél közelebb már nem mehetünk a mi kis Rexinkhez. Előttük a tyrannosaurus átdugta a fejét az ágak közt, s a folyót leste. Megpróbált átjutni. Aztán néhány méterrel lejjebb ment a víz folyása mentén, és újabb kísérletet tett. – Vajon mi az ördögöt láthat ott? – szólt Gennaro. – Ki tudja? – mondta Muldoon. – Lehet, hogy a microceratopsokat akarja elkapni, amik az ágakon ugrálnak. Ha igen, azok jól megfuttatják. Muldoon a tyrannosaurustól körülbelül ötven méterre állította le a dzsipet, és körbetekerte a kormányt. A motort nem kapcsolta ki. – Üljön a volán mögé! – mondta Gennarónak. – És csatolja be a biztonsági övet! – Még egy lövedéket elővett, és az ingébe akasztotta, aztán kiszállt. Gennaro a kormánykerék mögé csúszott. – Gyakran csinálja ezt? – kérdezte. Muldoon böfögött. – Eddig még soha. A hallójárat mögött próbálom eltalálni. Aztán, meglátjuk, mi lesz. – Tíz métert ment a dzsip mögött, aztán fél térdre ereszkedett a fűben. A vállára támasztotta a nagy fegyvert, felcsapta a teleszkópos irányzékot. Célba vette a tyrannosaurust, amely még mindig tudomást sem vett róla. Halvány gázfelhő csapott fel, és Gennaro fehér csíkot látott a tyrannosaurus felé robogni a levegőben. De láthatóan nem történt semmi. Aztán a tyrannosaurus lassan megfordult, és kíváncsian szemügyre vette őket. Ide-oda ingatta hatalmas fejét, mintha hol az egyik, hol a másik szemével nézné őket. Muldoon levette a kilövőt a válláról, és betöltötte a második lövedéket. – Eltalálta? – kérdezte Gennaro. Muldoon a fejét rázta. – Eltévesztettem. Az a rohadt lézeres irányzék.... Nézzen körül, nincs-e elem a dobozban. – Hogy micsoda? – kérdezte Gennaro. – Elem – felelte Muldoon. – Körülbelül ujjnyi nagyságú. Szürke jelzés van rajta. Gennaro hátrahajolt, hogy belenézzen az acéldobozba. Közben érezte a dzsip remegését, a motor halk berregését. Nem látott elemet. Ebben a pillanatban a tyrannosaurus felüvöltött. Rémületes volt az állat hatalmas mellüregének mélyéről előtörő, mennydörgő bömbölés, amely szinte betöltötte a tájat. Gennaro iszonyatosnak hallotta. Hirtelen kiegyenesedett, megragadta a kormánykereket, a másik keze pedig máris a sebességváltón nyugodott. Megszólalt a rádió is: – Muldoon, itt Arnold! Azonnal tűnés onnan! Vége! – Tudom, mit csinálok – morogta Muldoon. A tyrannosaurus rohamra indult. Muldoon nem vesztette el a fejét. Miközben az állat vad iramban vágtatott feléje, a vadász lassan, módszeres alapossággal ismét a vállára emelte fegyverét, célzott és lőtt. Gennaro ismét látta a felszálló füstfelhőt, és az állat irányába robogó lövedék csíkját. Semmi hatás. A tyrannosaurus folytatta a támadást. Most azonban Muldoon már talpon volt, futott, és közben kiabált: – Indulás! Indulás! – Gennaro sebességbe tette a dzsipet, Muldoon pedig az oldalajtóra vetette magát, miközben a kocsi nekilendült. A tyrannosaurus sebesen közeledett. Muldoon egy lendülettel feltépte az ajtót, és bekászálódott a dzsipbe. – Gyerünk már, a szentségit! Gyerünk!

Gennaro tövig nyomta a gázpedált. A dzsip vadul ugrált, bukdácsolt. Az egyik pillanatban olyan magasan volt az orra, hogy csak az eget lehetett látni a szélvédőn át, a következőben már zökkenve földet is ért, és vadul száguldott tovább. Gennaro a bal oldali fasor felé tartott. Nem változtatott a kocsi sebességén, míg csak a visszapillantó tükörben meg nem látta, hogy a tyrannosaurus egy végső üvöltéssel megfordul. Gennaro lassított. – Te jóságos ég! Muldoon a fejét ingatta. – Esküdni mertem volna, hogy másodikra eltaláltam. – Szerintem nem talált – mondta Gennaro. – Biztosan letört a tű, mielőtt az ütőszeg belőtte volna a szert. – Ismerje már be, hogy nem talált! – Na, jó! – sóhajtotta Muldoon. – Hát akkor nem találtam. Döglött volt az elem abban az átkozott lézeres irányzékban. Én tehetek róla. Ellenőriznem kellett volna! Gyerünk vissza, és hozzunk még egy-két lövedéket. A dzsip északnak tartott, a hotel felé. Muldoon felemelte a rádiót. – Vezérlő! – Itt vagyok – szólt Arnold. – Megyünk vissza a bázisra. Keskeny volt a folyó, és robogott. Egyre jobban száguldott velük a tutaj is. Lassan kezdték úgy érezni magukat, mintha valami angolparki robogón ülnének. – Juhúúúúú! – kiabálta Lex. – Gyorsabban! Gyorsabban! Grant előreszegezte tekintetét. Még keskeny és sötét volt a folyó, ám már látta, hogy távolabb a fák sora véget ér, azon túl pedig vakítóan süt a nap. A messzeségből dübörgés hallatszott. Úgy látszott, mintha valami különös, egyenes vonalban véget érne ott a folyó... A tutaj azonban még mindig csak gyorsult, rohant velük előre. Grant az evezők után kapott. – Mi van ott? – Vízesés! – mondta Grant. A lecsüngő ágak sötét öleléséből a tutaj egyszerre csak vakító, délelőtti ragyogásba siklott, s a robogó áramlat egyenest a vízesés pereme felé röpítette. A zuhatag a fülükben dübörgött. Grant evezett, ahogy csak bírt, de csak arra futotta az erejéből, hogy újra meg újra körbefordítsa a tutajt. Az megállíthatatlanul közeledett a perem felé. Lex Granthoz hajolt. – Nem tudok úszni! – A férfi látta, hogy nincs becsatolva a mentőmellénye, de tehetetlen volt; rémisztő sebességgel érték el a peremet, s a vízesés mennydörgése már az egész világot betöltötte. Grant mélyen a vízbe döfte az evezőjét, érezte, hogy megakad, és megtartja őket, pontosan a vízesés peremének legszélén. A gumitutaj rezgett az áramlatban, de nem zuhant le. Grant teljes erejéből az evezőnek feszült, s a vízesés széléről lenézve látta, hogy legalább tizenöt méter magasan vannak, alattuk pedig kerek, habzó tó. S a habzó tóban, rájuk várva, ott áll a tyrannosaurus. Lex kétségbeesetten sikított, aztán a csónak megfordult, a hátulja egyszerre csak eltűnt, ők pedig egyenként kihullottak belőle, ki a levegőbe és a dübörgő vízbe, s megkezdődött a halálos zuhanás. Grant csapkodott a karjával, aztán egyszerre csak lassú, néma lett a világ. Úgy érezte, percekig zuhan. Volt ideje megfigyelni, hogy Lex narancssárga mellényébe kapaszkodva repül mellette, hogy Tim lenéz a mélybe; volt ideje meglátni a vízesés jeges, fehér falát s a fortyogó tavacskát odalenn, miközben lassan némán hullott felé. Ostorcsapásként érte, amikor a víz felszínének vágódott a teste, majd belemerült. Hideg, fehér zubogó buborékok ölelték körül. Billegett, pörgött, egy pillanatra látta a tyrannosaurus lábát, amint elsodródott mellette, végig a tavacskán, aztán továbbsiklott a tavon túli folyómederbe. Úszni kezdett a part felé, meleg kövekbe kapaszkodott, lecsúszott, majd egy ágat ragadott meg, és végre sikerült felhúzódzkodnia, kikerülnie a főáramlatból. Zihálva, lihegve, hason kúszva kivonszolta magát a sziklákra, és éppen akkor pillantott vissza a folyóra, amikor az üres barna gumitutaj tovabukdácsolt mellette. Aztán Timet pillantotta meg, amint az áramlattal küszködik. Odanyújtotta a kezét, és a köhögő, reszkető kisfiút kihúzta maga mellé a partra. Grant újra a vízesés felé nézett. Látta, hogy a tyrannosaurus hirtelen egyenest a lábánál lévő tó vizébe meríti fejét. Az óriás fej ide-oda csapkodott, rázkódott, vizet fröcskölve mindenfelé. Valami volt a foga között. Aztán újra felemelte a fejét. Lex narancssárga mellénye lógott ki a szájából.

Egy pillanattal később maga Lex is a felszínre bukkant a tyrannosaurus hosszú farka mellett. Arccal lefelé feküdt a vízen, kicsi testét lefelé sodorta a folyó árama. Grant utána ugrott a vízbe, újból megmerítkezve a fortyogó áramlatban. Egy pillanat múlva már a kövekre is húzta a kislányt, mint valami élettelen, elnehezült súlyt. Szürke volt az arca. A szájából ömlött a víz. Grant fölé hajolt, hogy szájon át adjon neki mesterséges légzést, ám a kislány köhögni kezdett. Aztán sárgászöld folyadékot hányt, majd újabb köhögési roham fogta el. Szempillái meglibbentek. – Hello! – szólalt meg. Erőtlen mosoly jelent meg az arcán. – Megúsztuk! Tim sírva fakadt. A kislány ismét köhögni kezdett. – Abbahagynád? – kérdezte aztán. – Most meg mit bőgsz? – Csak! – Féltettünk téged – mondta Grant. Fehér anyagdarabkák úsztak lefelé a folyón. A tyrannosaurus éppen a mentőmellényt szaggatta szét. Még mindig háttal állt nekik, a vízesés felé fordulva. De bármelyik pillanatban megfordulhat, és észreveheti őket... – Gyerünk, gyerekek! – adta ki a parancsot Grant. – Hová megyünk? – kérdezte köhögve Lex. – Gyere már! – Grant búvóhelyet keresett. Amerre a folyó haladt, arra csak nyílt, füves mezőt látott, amely nem nyújthatott menedéket. A folyón felfelé viszont ott állt a tyrannosaurus. Grant ekkor keskeny földutat vett észre a folyó mentén. Úgy látszott, felfelé vezet, a vízeséshez. A földben pedig világosan látszott egy férficipő lenyomata. Felfelé haladt az úton. A tyrannosaurus most végre megfordult. Morgott, s a füves rét felé nézett. Úgy tűnt, megértette, hogy áldozatai kicsúsztak a karmai közül. A vízfolyás irányában kereste őket. Grant és a gyerekek gyorsan lekapták a fejüket a partot szegélyező hatalmas páfrányok közé. Közben Grant óvatosan a folyással ellenkező irányban vezette őket. – De hát hová megyünk? – kérdezte rémülten Lex. – Visszafelé tartunk! – Tudom – mondta Grant. Megint közelebb kerültek a vízeséshez. Nőttön-nőtt a zaj. A sziklák csúszóssá váltak, az út sarassá. Függönyként borult rájuk a pára, mintha felhőn haladtak volna keresztül. Úgy látszott, hogy az ösvény egyenest a robogó vízbe visz, amint azonban közelebb értek, kiderült, hogy a valóságban a vízesés mögé vezet. A tyrannosaurus még mindig lefelé lesett, a folyás irányába, s a hátát mutatta nekik. Sietve igyekeztek az ösvényen a vízesés felé, és kis híján sikerült is a zuhatag vízfüggönye mögé kerülniük, amikor Grant látta, hogy a tyrannosaurus megfordul. De a következő pillanatban már teljesen a vízesés mögött voltak, s Grant többé nem látott át az ezüstös vízfüggönyön. Megfordult és meglepetten nézett körül. Kis mélyedést látott, alig nagyobbat egy beépített szekrénynél, ám ez a mélyedés tele volt gépezetekkel; zümmögő szivattyúkkal, nagy szűrőkkel és csővezetékekkel. Vizes és hideg volt minden. – Látott minket? – kérdezte Lex a zuhatag dübörgését túlkiabálva. – Hol vagyunk?! Mi ez a hely itt? Meglátott? – Várj egy kicsit! – mondta Grant. Nézte a berendezést. Nyilvánvalóan szabályszerű szórakoztatóparki gépezet volt. Akkor pedig áramnak is kell lennie, ami hajtja, tehát lehet, hogy egy telefonkészülék is van valahol a kapcsolattartás végett. Keze a szűrők és csövek között kutatott. – Mit tetszik csinálni?! – kiabálta Lex. – Telefont keresek. – Majdnem tíz óra volt már. Alig több mint egy órájuk van már csak rá, hogy kapcsolatba lépjenek a hajóval, még mielőtt az partot ér. A mélyedés hátsó falában ajtót talált, rajta felirat – 04.sz. KARBANTART. – de zárva volt, nem is mozdult. Nyílás volt mellette a falban a biztonsági ellenőrzőkártya számára. Az ajtó mellett egy sor fémdobozt látott. Sorra nyitogatta őket, de csak kapcsolók és órák voltak bennük. Telefon sehol. Az ajtót pedig nem volt mivel kinyitni. Majdnem elkerülte a figyelmét, hogy az ajtótól balra is van egy doboz. Kilencgombos billentyűtáblát talált benne, amikor kinyitotta. Imitt-amott penészfoltok voltak rajta, de úgy nézett ki, mintha az ajtó kinyitására szolgálna, s Grant szinte biztosan érezte, hogy az ajtó mögött telefonkészülék van. A doboz fémlapjára valaki számot karcolt: 1023. Grant benyomta ezt a számot. Szisszenve nyílt az ajtó. Sötétség tátongott odabenn, s betonlépcsők sora vezetett a mélybe. A hátsó falon felirat állt: 04/22. sz. SZOLG. GÉPK. TÖLTŐ, s egy nyíl mutatott lefelé, a lépcsők mentén. Lehet, hogy valóban autó van odalenn? – Gyerünk, gyerekek! – Azt már nem! – jelentette ki Lex. – Oda én nem megyek! – Ne hülyéskedj, Lex, gyere! – mondta Tim. – Szó sem lehet róla! – válaszolta a kislány. – Nincs világítás, nincs semmi! Én nem megyek oda. – Hát jó – mondta Grant. – Érezte, nincs idő vitatkozni. – Ti itt maradtok, és én lemegyek. Mindjárt visszajövök. – De hová tetszik menni?! – kérdezte Lex hirtelen riadalommal, a hangjában. Grant válasz helyett belépett az ajtón. Az elektronikus sípszót hallatott, majd becsapódott a háta mögött.

Mintha kútba zuhant volna, úgy borult Grantra a vaksötétség. Egy pillanatnyi meglepett zavarodottság után visszafordult az ajtóhoz, és végigtapogatta nyirkos felszínét. Sehol egy gomb, kilincs vagy zár. A falakat is végigkutatta az ajtó két oldalán valami kapcsoló, vezérlődoboz vagy akármi más után... Semmit sem talált. Már a pánikkal küzdött, amikor a tapogatózó ujjai egy fémhenger körül zárultak össze. Végigfuttatta rajta a kezét. A pereme kidudorodik, a teteje lapos... zseblámpa! Bekapcsolta. Meglepően erős volt a sugár ragyogása. Visszatekintett az ajtóra, és látta, hogy azt nem lesz képes kinyitni. Meg kell majd várnia, míg a gyerekek nyitják ki. Addig is... A lépcsőhöz indult. Nedvesek, penésztől síkosak voltak a lépcsőfokok, óvatosan kellett haladnia. Félúton lefelé szimatoló hangot hallott, és betonon kaparászó karmok csikorgását. Előhúzta kábítópisztolyát, és óvatosan továbbhaladt. A lépcsők a saroknál bekanyarodtak, s amint arra világított, különös visszfény csillant fel. Egy pillanat múlva már ki is vette, mi az: egy autó! Villanyautó volt, mint egy golfkocsi, s egy hosszú alagút felé fordult az orrával, amely úgy tűnt, kilométerekre nyúlik. A kocsi volánja mellett vörös fény parázslott, vagyis valószínűleg fel volt töltve az akkumulátora. Ismét felhangzott a szuszogó hang. Grant megperdült a tengelye körül, s csak azt látta, hogy valami sápadt, halvány alak emelkedik fel, majd tágra nyitott pofával repül felé a levegőn át. Gondolkodás nélkül lőtt. Az állat rázuhant, ledöntötte a lábáról, s Grant rémülten hengergőzött félre, lámpája vadul himbálózott összevissza. De az állat nem kelt fel, s amikor végre szemügyre vette, Grant egy kicsit nevetségesnek érezte magát. Velociraptor volt, de még kölyök, egyévesnél is fiatalabb. Valamivel nagyobb lehetett egy fél méternél, de legfeljebb akkora, mint egy közepes méretű kutya. Alig lélegzett, ahogy ott hevert a földön, a nyakából kiállt a tű. Alighanem túl nagy az adag a testsúlyához képest, gondolta Grant, és gyorsan kihúzta. A velociraptor kissé ködös tekintettel nézett rá. Valami különös, szinte érezhető intelligencia sugárzott az állatból, s egyfajta lágyság, amely szöges ellentétben állt azzal a fenyegetéssel, amely a karámban tartott felnőtt példányokból áradt. Megsimogatta a velociraptor fejét, remélve, hogy megnyugtatja. Végignézett a testén, amely enyhén reszketett, ahogy fokozatosan hatni kezdett a nyugtató. És döbbenten látta, hogy hím. Fiatal állat, és hím! Nem lehetett kétség afelől, hogy mit lát. Ez a velociraptor vadon született! Felfedezésétől izgatottan sietett vissza a lépcsőn az ajtóhoz. Lámpájával végigpásztázta a lapos, egyenletesen sima felületet s a belső falakat. Végigfuttatta a kezét az ajtón, és csak ekkor fogta fel igazán, hogy nem tudja kinyitni, hogy fogoly, s hogy erre nincs kiút, hacsak a gyerekekben nincs annyi lélekjelenlét, hogy kinyissák az ajtót. Tompán hallotta is a hangjukat az ajtó túloldaláról. Lex az öklével dörömbölt az ajtón. – Grant bácsi! – kiabálta. – Grant doktor! – Nyugi! – szólt Tim. – Visszajön! – De hová lett? – Ide figyelj! Grant professzor tudja, mit csinál. Egy perc, és itt lesz – mondta Tim. – De most legyen itt! Azt akarom! – kiáltotta Lex. Csípőjére szorította összezárt öklét, könyökét szélesre feszítette. Dühösen toporzékolt. Ekkor azonban iszonyatos bömbölés reszkettette meg a levegőt, s a tyrannosaurus feje áttört a zuhatag vízfalán. Feléjük nyomult. Tim megdermedt, és bénult rettenettel nézte, amint az óriás száj hatalmasra nyílik. Lex sikított, és a földre vetette magát. A fej ide-oda ingott, majd visszahúzódott. Tim azonban továbbra is látta az állat árnyát a vízfüggönyön. Beljebb rántotta Lexet a mélyedésbe, éppen abban a pillanatban, amikor újabb üvöltés hangzott fel, s az állkapcsok ismét áttörtek a zuhatagon. A vastag nyelv ki-be járt. A fejről fröcskölt a víz mindenfelé. Aztán megint visszahúzódott. Lex remegve bújt Timhez. – Gyűlölöm! – mondta. Hátrahúzódva lekuporodott, de a mélyedés csak egy-két méteres volt, az is teli mindenféle gépezettel. Nem volt hová bújniuk. A fej újra feléjük közeledett a vízesésen át, ám ezúttal lassan, majd megállt, s az állkapocs megpihent a földön. A tyrannosaurus tágra nyílt orrlikakkal szaglászott, szívta a levegőt, ám a szemei még mindig kívül voltak a vízesésen. Tim fejében ez járt: „Nem lát minket! Tudja, hogy itt vagyunk, de nem lát át a vízen!” A tyrannosaurus szaglászott. – Mit csinál? – szólalt meg újra Lex. – Ssss!

Mélyről jövő morgás, aztán az állkapcsok lassan szétnyíltak, és kisiklott a nyelv. Vastag volt, kékesfekete, kis, kétfelé ágazó bemélyedéssel a hegyén. Másfél méteres hossza könnyen elért a mélyedés hátsó faláig. Súrlódó zajjal végigsiklott a szűrőhengereken. Tim és Lex a csövekhez tapadt. A nyelv lassan balra csúszott, majd jobbra. Loccsanva ütődött a gépezeteknek. Felfelé hajló hegye körültapogatta a csöveket és a szelepeket. Tim látta, hogy az izommozgásai olyanok, mint egy elefánt ormányáé. A nyelv a mélyedés jobb oldala mentén visszahúzódott. Közben végigsiklott Lex lábán. – Juj! – szólt halkan a kislány. A nyelv abban a pillanatban megállt. Hegye hátragördült, mint egy kígyó, kezdett felemelkedni a kislány teste mentén... – Nehogy megmozdulj! – súgta Tim. ...végig az arcán, aztán föl tovább Tim vállára, s végül a kisfiú arca köré tekeredett. Tim összeszorította a szemét, amint a nyálkás izomköteg az arcához ért, és eltakarta. Forró volt, nedves, a bűze mint a vizeleté. A nyelv immár teljesen körbetekerte, majd lassan, nagyon lassan húzni kezdte a nyitott állkapocs felé. – Timmy... Tim nem bírt válaszolni; száját betapasztotta a lapos, fekete nyelv. Látni látott, de szólni nem tudott. Lex a kezét rángatta. – Timmy, gyere! A nyelv továbbhúzta, egyre közelebb a hortyogó szájhoz. Forró lehelet csapta meg a lábát. Lex rángatta, de hiába: nem bírt a bátyját fogva tartó izomerővel. Tim elengedte, és mindkét kezét a nyelvnek feszítette, megpróbálta felfelé nyomni a fején, letolni magáról. Mozdítani sem tudta. Sarkát szinte beásta a sáros talajba, de az sem használt. A nyelv csak vonszolta előre. Lex a dereka köré fonta karjait, úgy igyekezett visszatartani, közben kiáltozott, de semmihez sem volt elég az ereje. Tim kezdett csillagokat látni. Lassan egyfajta békesség szállta meg, megnyugvás, beletörődés az elkerülhetetlenbe, amint végzete felé vonszolódott. – Timmy? És ekkor a nyelv szorítása hirtelen lazult, és kezdett letekeredni róla. Tim érezte, amint lecsúszik az arcáról. Undorító, fehér, habos ragacs borította a testét, ám a nyelv erőtlenül a talajra hullott. Az állkapcsok lecsapódtak, ráharaptak a nyelvre. Sötét vér patakzott elő, s összekeveredett a sárral. Az orrlikak szaggatott horkantásokkal ugyan, de még tovább szedték a levegőt. – Mit csinál ez?! – kiáltotta Lex. Aztán lassan, nagyon lassan a fej kezdett hátrafelé csúszni, kifelé a mélyedésből, hosszú nyomot hagyva maga után a sárban. Majd végül teljesen eltűnt, s ismét csak a lezúduló víz ezüstfüggönye volt a szemük előtt.

A VEZÉRLŐ

– Oké – szólalt meg Arnold a vezérlőteremben. – A rex lefeküdt. – Hátratolta székét, szája széles mosolyra húzódott, rágyújtott az utolsó cigarettára, és összegyűrte a kiürült dobozt. Ez is megvan hát: az utolsó lépés, ami még hiányzott ahhoz, hogy a parkban teljesen helyreálljon a rend. Már csak az maradt hátra, hogy kimenjenek, és a helyére vigyék az állatot. – A jó édesanyját! – morogta a monitort figyelve Muldoon. – Hát szóval mégis csak eltaláltam akkor. – Gennaróhoz fordult. – Csak éppen egy óra kellett hozzá, hogy meg is érezze. Henry Wu elkomorult a kép láttán. – De vízbe is fúlhat ebben a testhelyzetben... – Nem fog vízbefúlni – vágott közbe Muldoon. – Nem találkoztam még állattal, amellyel nehezebb lett volna végezni. – Gondolom, ki kell mennünk, és el kell szállítanunk. – Majd kimegyünk – mondta Muldoon. Nem hangzott valami lelkesnek. – Értékes állat! – Nagyon jól tudom, hogy értékes állat – mondta erre Muldoon. Arnold Gennaróhoz fordult. Nem tudott ellenállni a kísértésnek, hogy legalább egy pillanatra ki ne élvezze győzelmét. – Szeretnék rámutatni – mondta –, hogy a park immár teljes egészében ismét rendben működik. Bármit is jósolt Malcolm matematikai modellje. Újra minden az ellenőrzésünk alatt áll. Gennaro azonban az Arnold feje mögötti képernyőre mutatott, és ezt kérdezte: – Az meg mi? Arnold megfordult. A rendszer állapotát jelző kocka volt a képernyő felső sarkában, normális körülmények között mindig üres. Arnold meglepetten látta, hogy most a következő felirat villog rajta sárgán: TART. ENERGIASZINT ALACSONY. Egy pillanatig nem is értette. Miért lenne alacsony a tartalékenergia szintje? A főáramforrásról működnek, nem a tartalékról. Arra gondolt, talán a gép rutinellenőrzést végez a tartalék áramforrás állapotáról, talán az üzemanyag-tartályok szintjét ellenőrzi, vagy az akkumulátortöltést... – Henry – szólt Wuhoz. – Nézd csak ezt! – Miért a tartalék áramforrásról működteted a rendszert – kérdezte az. – Dehogy működtetem arról! – mondta erre Arnold. – Pedig úgy látszik. – Az lehetetlen. – Nyomtasd ki az állapotnaplót! – kérte Wu. – Ez a feljegyzéskor azt tartalmazta, mikor milyen volt a rendszer állapota az elmúlt órákban. Arnold lenyomott egy gombot. Nyomtató zúgása hallatszott a sarokból. Wu odament. Arnold a képernyőre meredt. A kocka színe villogó sárgáról vörösre váltott, s az üzenet most így szólt: TART. ENERG. KIMERÜL. Számok kezdtek futni rajta húsztól visszafelé. – Mi a jóisten történik itt?! – kérdezte döbbenten Arnold. Tim óvatosan tett néhány lépést a sáros ösvényen, a sötétből a napsütésbe. Kilesett a vízesés mögül. Látta: a tyrannosaurus a vízben lebegve az oldalán hever odalenn. – Remélem, megdöglött – mondta Lex. Tim látta, hogy él. A dinoszaurusz mellkasa most is mozgott, s az egyik mellső végtag görcsösen rángatózott. De valami nem volt rendben vele. Ekkor aztán Tim észrevette a fej hátsó részéből kiálló, tartályszerű lövedéket. – Kábítót lőttek bele – mondta. – Hála Istennek! – sóhajtott fel Lex. – Majdnem megevett bennünket! Tim figyelte az állat nehézkes légzését. Önmagát is meglepte azzal, hogy sajnálatot érez. Szégyenérzet fogta el, hogy egy ilyen hatalmas állatot így megalázva lát. Nem akarta, hogy elpusztuljon. – Nem ő tehet róla – mondta. – Jó vagy?! – kérdezte Lex. – Kis híján megevett bennünket, és nem ő tehet róla! – Húsevő. Csak azt tette, amit muszáj neki. – Nem mondhatnád ezt, ha most éppen a gyomrában volnál! – vágott vissza Lex. Ekkor hirtelen megváltozott a vízesés hangja. A fülsiketítő dübörgés lágyabb, halkabb lett. A víz mennydörgő fala elvékonyodott, aztán már csak folydogált... És leállt.

. – Mi nem is csináltunk semmit – mondta Lex. egyik a másik után. még csak eszébe sem jutott. Majd elektromágneses zárszerkezet kattanása hallatszott. View Állapotellenőrz. Bekap.: Tart. Tim a fejét rázta.: Tart. – Megállt a vízesés! Már csak cseperészett. AVZ2 Operatív . hogy Arnoldnak le kellett volna zárnia a fő áramforrást. Amikor újra ráadta az energiát. Vészjelz. Bizt.: Tart. és beengedte a fényt az ablakon át. Bizt. összevissza.Tart.Tart. gépezettel teli mélyedésben. Ott álltak fenn a barlangszerű.Tart. en.Tart. AVZ1 Operatív .: Kerítések (N. – Ez a sor mit jelent? – kérdezte a listára mutatva Muldoon. és így szólt: – Kösz.Á. – Jóságos ég! – mondta kétségbeesetten Arnold. Operatív . Leállásparancs Indítóparancs Bizt. sötétség borult az egész vezérlőre. Operatív . s ennek következtében – mialatt a rexet hajkurászták.Tart. Indítóparancs Monitor-Hálóz. csak a tartalékforrás kapcsolt be..Tart. A jelek szerint a főáramforrás a reggeli leállás óta be sem volt kapcsolva. üzemanyag (10%) Vészjelz. en.– Timmy! – szólt Lex. Muldoon kinyitotta az elsötétítőket.Tart. egyenként sötétedtek el a monitorok. en. 05:14:57 Vészjelz. – Az most nem érdekes – mondta Grant. aztán hol ezt tették. Operatív . Operatív .Tart. 1. 3. – Vízesések nem szoktak leállni – jegyezte meg Lex.: Tart. Kikap. és kigyulladtak a fények. Sőt. Grant lépett elő. Pedig nem volt. kialudtak a fények.. Kikap. és a 04. Ez érthetetlennek tűnt.Tart.. Odalenn a tó felülete meg sem rezdült. Bizt. 2. üzemanyag (0%) Rendszerállapot Operatív Operatív Operatív Áll Áll Áll Áll Áll Indul . Bizt. Csakhogy eddig még nem adódott rá alkalom. onnan bámultak lefelé. így tervezték a rendszert. – A hátuk mögött sorra kikapcsolódtak a szivattyúk és szűrők.: Kerítések (N. tartalék áramra álltál át. en. így azután amikor a vezérlőben újra kivilágosodtak a képernyők. Operatív .Tart.-Hálóz. Egymás után. nézzétek meg. csak most kezdte igazán felfogni. – Ezt nézd meg! – mondta Wu. en. Hunyorgott a napfénytől. míg Arnold rá nem döbbent. ügyesek voltatok! Sikerült kinyitnotok az ajtót. Operatív . 2. Operatív . üzemanyag (20%) Vészjelz.) Vészjelz. en. en. Bekap. en. s a gépek elhallgattak. 3. mint a rosszul elzárt vízcsap. s amikor újra indítottad. sz.Tart. mit találtam! Arnold bénultan meredt maga elé. Egyszerre kezdett el kiabálni mindenki. majd a terem világítása is kialudt. Bizt. KARBANTART. AV09 . .Tart. üzemanyag (1%) Vészjelz. Idő 05:12:44 05:12:45 05:12:46 05:12:51 05:13:48 05:13:55 05:13:57 05:13:59 05:14:08 05:14:18 05:14:19 05:14:22 05:14:24 05:14:29 05:14:32 05:14:37 05:14:44 05:14:57 09:11:37 09:33:19 09:53:19 09:53:39 Esemény Bizt. en. Wu pedig odahozta a kinyomtatott listát. en. hol azt – az egész park mindvégig a tartalék áramforrásról működött. 1.) Működő. mi mindennel járhat. en. AV0 Áll Wu folytatta: – Ma reggel öt óra tizenhárom perckor állítottad le a rendszert. hogy ez a normális! Pontosan így kellett történnie! Hiszen ésszerű: először a tartalék generátor gyújt.Tart. en. Bekap. Parancs-Hálóz. en. mert a fő hálózati generátor indításához nagy impulzus szükséges. feliratú ajtó lassan feltárult. srácok. – Gyertek. Kikap. Valaki elzárta az áramot. TeleCom-VBB Schematic-Hálóz. Biztosan az áram. hogy a fő áramforrás még nincs helyreállítva. S ez igen-igen szerencsétlen dolog volt. – Leállt az áram – tette hozzá Tim. Operatív . Á. Operatív . en. Labor-Hálóz. [Kód] [AV12] [AV12] [AV12] [AV0] [AV0] AV0 AV0 AV0 AV1 AV04 AV05 AV06 AV08 AV09 AV09 AV09 AV09 AV09 AVZZ Operatív . – Ezt gépek működtetik.Tart.

hogy azok a szörnyetegek azóta szabadon vannak! Ekkor valahonnan a távolból sikoly hallatszott. de lépést tartott vele. – Van kedve megint veszélyesen élni? – Nem igazán – felelte sápadtan Gennaro. – Az a baj ezekkel a dinókkal – mondta Muldoon –. A raptorok száma a karámban viszont nyolc. és maradjon benn. Leértek a földszintre. így azokat a rendszer automatikusan áramtalanította. – Öt órája! Lehet. – Az istenit. amíg nem hall felőlem. Mr. Az újra töltött. – Még a velociraptorkarám kerítésében sem? Arnold felsóhajtott. te a vezérlőben maradsz! Te vagy az egyetlen. amikor a bal oldali állat egyszer csak a szó szoros értelmében felrobbant. Sajnos csak hat lövedékünk van. hogy nem is érdemes a szívükre célozni. hogy az elektromos kerítések működni tudjanak. hogy szétszórt az idegrendszerük. a farok ide-oda csapkodott. Arnold a gépház épületének vetve hátát három raptort igyekezett távol tartani magától. – Jó. és futva elindult a folyosón. – Gennaro becsúsztatta a lövedéket a kilövő végébe. uraim.Á. ha telibe találjuk az agyukat. – Egyikben sem? És most sincs? Hajnali öt óra óta? – Nincs. A törzs alsó része összecsuklott a földön. hogy a gép figyelmeztetést küldött a rendszer állapotáról a vezérlőben lévő monitoroknak – felelte Arnold. amit remélhetünk. Gennaro hátán végigfutott a hideg. A raptorok már dühödt vicsorgással közeledtek Arnoldhoz. – Te jóságos Úristen! – kiáltotta Muldoon. a lábak a levegőt rugdalták. – Tölts! – szólt. úgy. – És az mit jelent. még akkor sem. közben lefelé nézett az erkélyen túli gépház felé. Összehangoltan. . Egy középen maradt. felbillentve a kilövőt. – Te láttad ezt a figyelmeztetést? Arnold a fejét rázta. hogy Gennaro mellé szegődött. szinte hadart. hogy beindítsa a fő áramforrást. felkapta a szürke rakétakilövőt. – Mi az? Meggondolta magát?! – mordult rá Muldoon. Falkatámadás! Muldoon azonban már fél térden is volt. – A kérdés az: mit csinálnak az állatok velünk? Aztán szó nélkül sarkon fordult. – Az megeshet. és hordozható rádiókészülékeket nyomott az ott lévők kezébe. Mr. – Egyik hengert nyitotta ki a másik után. míg ti a terepen voltatok. úgy fröcskölte be a vér az épület falát. Törzsének felső része a levegőbe röpült. Közben körbejárta a termet. hogy a gránát Gennaro markába esett. menjen vissza a kastélyba! Ne vitatkozzon velem! Menjen máris! Zárja be a kapukat. Széles. Hat henger és hat fémtartály volt benne. – Nem. – Arnold a gépházba megy. – Gennaróhoz fordult. és mindegyikbe beleejtett egy tartályt. Akkor menjen a többiekkel a kastélyba. Nyilván éppen veletek beszéltem. és irodája felé sietett a folyosón. – A legtöbb. Hammond. de semmi sem történt. és egy rudat lóbált feléjük. hogy hatot kinyírunk. Hammond! – csattant fel Muldoon. Nem múlnak ki gyorsan. – Muldoon belépett a „Főállatőr” feliratú szobába. és kinyitott egy rejtett szekrényt a falban. Zökkenőmentes precizitással. Mindenesetre nem vettem észre. Muldoon erre hirtelen nagyon gyorsan kezdett beszélni. a másik kettő kétfelől támadott. – Abban sem. – Muldoon elfordult tőle. Muldoon kilépett az ajtón. fordítva tetted be! morogta Muldoon. Muldoon felhördült: – Mit beszélsz?! Nem volt áram a kerítésekben? – Nem volt. hogy közben tegezésre váltott. úgy közeledtek. kiléptek az üvegajtón. – Tedd fel! – Észre sem vette. Olyan vastagok a bordáik. hogy elbánjunk a raptorokkal. Kiabált. vállán a rakétaindító. – De mit akar csinálni az állataimmal? – Most nem ez a kérdés. Gennaro lihegett. hálóval megerősített töltényövet nyújtott oda Gennarónak. Alig vette észre. hogy „Vészjelzés: Kerítések (N. aki elboldogul a számítógépekkel. Wu. én ezt akkor ugyan nem tudtam. s a lábukat vagy a hátsójukat is alig lehet komolyan megnyomorítani. Az állatok szinte szabályos katonai alakzatban szóródtak szét. ám ott Muldoon hirtelen megállt. s mintha csak valami óriás paradicsom durrant volna szét. Elektromos sistergés hallatszott. de a rendszer mindvégig a tartalék energiaforrásról működött – válaszolta a főmérnök. Én Arnoldnak segítek. Muldoon pedig a lövedékeket kezdte adogatni neki. – Ez minden. Ráadásul igen erős a testfelépítésük.– Azt. az íróasztala mögött. Most pedig indíts! Hammond szinte sírt. – Hátha mégis segítségre lesz szüksége – mondta Gennaro. – A kerítések miatt. Gennaro a derekára csatolta az övet.)”? – Nos. kérem. Gyerünk! Maradj mellettem! Nálad vannak a lövedékek. – A tartalék viszont nem fejleszt elegendő áramerősséget ahhoz.

hogy felüljön. maga nagyképű alak! – Ha emlékezetem nem csal – mondta Malcolm –. Ha Arnold képes visszakapcsolni az áramot – akár csak egy pillanatra is –. Mit érdeklik őt az olyan kicsinységek. Valahonnan a messzeségből. Mintha Muldoon lett volna. – Tölts! – Ennyi volt Muldoon válasza. – Csak nem? – Malcolm kissé hörögve szedte a levegőt. hogy lehetséges kihalt állatok DNS-ét klónozni. – Úgy hangzik. hanem Muldoon után vetették magukat. eddig is meg voltam győződve. hogy tartalék forrásról működteti. A raptorok nem törődtek vele. mintha háború lenne odakinn. Mivel pedig olyannyira izgalmasnak tűnt. hova a pokolba menekülhetne.. A maga Wu doktora még a nevét sem ismeri azoknak a valamiknek. Munkatársaim és én évekkel ezelőtt úgy láttuk. aztán megállt. birtokolják is őket. és elfelejtik. és egy székre zuttyant. mint gondoltam! Pedig Isten az atyám. és közben a kerítések kikapcsolódtak. – Íme. – Kiszabadultak a raptorok – mondta Hammond. ahogy maguk fütyülnek. és visszahanyatlott a hátára. hogy Gennaro ellenkező irányban rohan. lehetségesnek is. s közben halványan végigfutott a tudatán. sőt mi több. van saját intelligenciájuk. Borzasztóan szeretett volna kikerülni innen. hogy hozzálátunk. mi a baj a tudományos hatalommal? – kérdezte Malcolm. A rádióból egyszerre csak fémes sikoltás szólt. Annak azonban esze ágában sem volt engedelmeskedni. Tehetetlenül kerülgette a kapcsolótáblákat. – Nyilván nem kerülte el a figyelmét. amit létrehoz. és megpróbálta visszafektetni a matematikust. a maga „egyszerű gondolata!” Egyszerű! Új életformákat hoznak létre. Muldoon szaggató fájdalmat érzett a bokájában.. Mindig beválik. mekkora seggfejek a született gazdagok. Csodás gondolatnak látszott ez a számunkra. Vagy még annyi sem. hogy az egységes kerítésrendszer csődöt fog mondani. – Teljesen tiszta a tudatom. mégis azt hiszik. hogy legfeljebb tíz másodperce van még. – Az. és Muldoon meg Gennaro felé indultak. Hammond lépett a szobába. Egészen egyszerű volt az egész. egyfajta időutazásnak – az egyetlen időutazásnak a világon. Hátranézve látta. hogy az is egyfajta öröklött vagyon. ki sem ismerik őket. . – Aztán hogy történhetett ez? – Hiba csúszott a rendszer kezelésébe. a lényegét tekintve rendkívül egyszerű gondolat. hogy esetleg egyáltalán nem úgy ugrálnak. Köhögve hanyatlott hátra. – Az ördög vigye el az egészet! – mondta a fejét rázva. hogy mi a neve annak. – Hogy van a beteg? – kérdezte. Csak azt felejtik el. legurult egy földhányásról. akkor ő újraindíthatja a főgenerátort. Egymástól eltávolodva közeledtek. hogy fogalma sincs. be az erdőbe. Valahogy elég energiára lelt ahhoz. amit mi itt megkíséreltünk. Hallotta. s futva ért talajt.. és dolgozni kezdtünk. a kastély felől sikolyok hallatszottak. – Egy fenét vagyok! – szólalt meg Malcolm.. hogy kapitális marha! – Malcolm doktor! – szólt nyugtatólag Ellie. és ezért azt hiszik. Tudta ugyanis. hogy az. A matematikus sóhajtott. Hammond nagyot sóhajtott. és életre kelteni őket. amiket létrehoz. Muldoon futás közben teljes erőből ordított. hogy mi az! Rövid időn belül megalkotnak egy csomót. amit van képük egyszerűnek nevezni. Már alig húsz méterre voltak tőle. – Valami komoly katasztrófa lehet – mondta Gennaro. hiszen maguk alkották. – Még tartja magát – mondta Harding. – Ez magának egyszerű? Maga ostobább. Ott kell maradnia a teremben. Élve visszahozni őket: úgy is mondhatnám. úgy határoztunk. Malcolm csak Ellie segítségével tudott oldalra fordulni. Arnold késve jött rá. Henry Wu hallotta a robbanásokat. milyen keveset tudnak róluk. Isten az égben. amelyből kiáltások és sikolyok hangzottak. Észrevehetően gyöngült percről percre. hogy mennyire inkompetensek saját maguk. Arnold a gépház ajtaja felé rohant. Azt pedig pontosan tudjuk. úgy ugrálnak majd. A velociraptorok megfordultak. – Nahát! Mit nem mond! – Mit fölényeskedik? Menjen a fenébe. hogy Harding beledöfhesse a morfiuminjekciót. nem is szólva arról. amelyekről semmit sem tudnak. – Tudja. – Enyhén delíriumos állapotban van.– Ettől majd felébrednek! – morogta Muldoon. hogy valaki ordít. – A rádióra füleltek. Megszereztük ezt a szigetet. én megjósoltam. mennyire nem értenek ahhoz. aztán elkapják az állatok. – Egyszerű? – kérdezte Malcolm. Tíz másodperc. A rádióra mutatott. ahogy maguk fütyülnek. de tudta: maradnia kell. majd a látogatóközpont felől tompa robbanások zaja hallatszott. – Mi ez? Mi folyik odakinn? – mondta. hogy ezek a lények élnek. s a vezérlőterem ajtaja felé nézett.

szabadalmaztattad és el is adtad. és máris megteheti a következő lépést. immár századszor is végiggondolta. Gyorsan lerúgta az egyik cipőjét. hazudj. Már előtte volt a generátorokhoz levezető lépcső. De legalább látott. aki el akarja érni. Majd szétvetette a feszültség. az egyik hangos. azonnal megnyomja. így már elég volt a fény. az erőfeszítést. Meg kell találnia a járópallót! Vigyáznia kell. addigra el is jutott az érettségnek arra a fokára. Még azt sem tudod igazán. – Ebben a folyamatban az az érdekes. Folyton mozgásban volt. ahol nem fog meggondolatlanul élni vele. A vevő egyszerűen megvásárolja a hatalmat. nehogy a nyakát szegje! A palló. és óvatosan kinyitotta néhány centire. Visszament az ajtóhoz. és belépett a sötétségbe. De nyitva is kell tartania az ajtót... Még tíz méter. a tér leheletét az alatta lévő kétemeletnyi mélység ásítását. A szó szoros értelmében az önfegyelem és a tanulás eredménye. Az kacsintott. Benne még csak fel sem merül bármiféle önfegyelem szükségessége. Senkinek sincsenek elvei. Az bólintott. legolcsóbb pisztoly formájában vásárolta meg a hatalmat. Senki sem fog bírálni. Arnold visszanézett az ajtóra. és hamar. mint benned. Nincs meg a természetnek kijáró alázat. mint az öröklött gazdagság. Elindult a bordás vaslemezen. akiben nincs önfegyelem. hogy Malcolm félrebeszél. A vevőben pedig aztán még annyi önfegyelem sincs. Évekig kell inaskodnia. hol ott futtatta végig a kezét a gombokon.Hammond döbbenten kérdezte. sercegett. – Wu! – a rádió sivított. hogy nem fognak égni a lámpák! Érezte a levegő hűvösét. gondolnia kellett volna rá. hamisíts! semmi sem számít. nincs önkorlátozás. míg csak rá nem jött: nincs értelme. Hát ezért hiszi maga is. benne lakik az emberben. Hammond nem bírta tovább. Az állat lehajolt. Visszament a járópallóhoz. de már publikáltad. Egészen fiatalon is megteheti. . Be kell engednie valami fényt ide. hogy a fényt egy velociraptor teste takarja el. Hol itt. tanulnia. – Mivel pedig óriások vállára állhatsz. gyorsan el is érhetsz valamit. Vakon tapogatózott. Most már jól látta. – Majd én megmondom magának. legyen az akárki. – Akkor egyszerű leszek – mondta Malcolm. aki a „szombat esti spécinek” csúfolt. – A karatemester nem öl embert puszta kézzel. mit csináltál. Sem neked. – De egyszerű is volt – makacskodott Hammond. Utánakapott. Önfegyelem nélkül jut hozzá a tulajdonosa. a másik puha. miről beszél? – kérdezte Ellie-től. Nem lehet csak úgy odaadni. Henry Wu fel-alá járkált idegességében. Rendkívül gyorsan haladhat. Mindenki ugyanazt akarja. mozdulataival jelezte. be ne csukódjon. – Akkor most miért mondta fel a szolgálatot? John Arnold az izgalomtól szédelegve tépte fel a gépház ajtaját. Megszűnt a fény. hogy puszta kézzel ölni tudjon. – Nekem halvány gőzöm sincs – mondta Hammond. hogy egy ilyen helyet fölépíteni egyszerű dolog. Hallható volt a két lábának zaja közti különbség. A cég elnöke akar lenni? Fekete övet akar karatéban? Szellemi guru lenne? Ha el akarja érni. mint amelyet a tudomány táplál. Nincs évtizedekig tartó inaskodás. mit értek el mások. Bármiféle is legyen az a hatalom. Az öl. és az ajtóba dugta. és látta. Fontosnak kell lennie. Sok mindenről le is kell mondania érte. – A hatalom legtöbb fajtája jelentős áldozatot követel attól. sem a kollégáidnak. rá kell szánnia az időt. a gyakorlást. amelyet a tudomány tesz lehetővé. ugyanazt igyekszik elérni: valami nagyot alkotni. A hatalom eléréséhez szükséges önfegyelem megváltoztatja az embert: nem fog visszaélni vele. mércéi. Nem veszti el a fejét. Az ember csak elolvassa. Csak egyetlen filozófia létezik: gazdagodj meg mielőbb. önkorlátozó tanulási folyamat. a számítógépbillentyűkön. és elmélyülten szaglászta a cipőjét. úgy mint bármilyen más árut. hogy mire valaki megszerezte azt a képességet. Ez a hatalom pedig ugyanolyan. mit fog tenni. Vagyis ebben a fajta hatalomban van egy beépített önkontroll. válj híressé mielőbb! Csalj. Sietnie kell! Amint kivilágosodik az első monitor. – Miről beszél ez? Harding némán integetett. Anélkül nem megy semmire. Nincs hatalom a tudás fölött: az öreg tudósokkal a kutya sem törődik. miről beszélek – mondta. akkor az övé. De még mekkora sötétségbe! Úristen. – A tudományos hatalom azonban olyan. – Maga tudja. és nem üti agyon a feleségét. Vaksötétség. a munkát. Újra. De ha az ember egyszer elérte.

neki ugyan túl szűk. Aztán lapos betont ért a lába. – Gennaróról van hírünk? Gennaro lenyomta a gombot. és akkor fogta csak fel. Elfordult. az idegen gépi szagok teszik óvatossá. Arnold hátrafordult. de már a húsába is martak az óriás karmok. aztán onnan le a következő szintre. Hallani lehetett a halálos karmok pendülését a fémen. hiszen még három vagy négy morog-vicsorog körülötte odakinn. A betonpadlón ott állt a raptor. azt nem tudom. öreg! – mondta Arnold. és a hátára zuhant. Furcsán szólt. Vízlevezető csövek álltak egymáson halomban a látogatóközpont mögött. vagy már sohasem fogja. mint valami hülye rák. de ide nem jöhettek utána. A raptor tehetetlen haraggal csalódottan morgott. mely a felette mozgó fejből áradt felé. megcsapta a bűzös lehelet. Kint is mintha elült volna a zaj. csak a palló rácsa. Ellie a kezében tartotta rádióját. hogy az állat rajta áll. A legutóbbi percekben azonban már nem jött senki. kézzel-lábbal segítve magát. most meg nem tudta megnézni. még csak az kell. Muldoon csak azt sajnálta. Van valami ötleted? – Nincs – mondta Wu. Már csak néhány méterre volt a lépcső. meredek lépcsőn nem. – Nem hiszem – felelte Muldoon. még ebben a halvány fényben is. Persze még mindig van esélye ilyesmire. – Te csak ne mozdulj onnan! Várd ki! Nem látta.” Arnold ugyanis meglehetősen biztosra vette. Arnold tudta. Hátralesett a vállán át. úgy figyelt. kitapogatta a korlátot. s kezdett lefelé mászni a szinte függőleges lépcsőn. – Ha el tudok jutni a lépcsőig.– Igen! Itt vagyok. hogy az állat jól lát. s azóta a többiek tisztelettudóbban viselkedtek. Két újabb indián munkás kért menedéket a kastélyban.. A raptor üvöltve vonszolta el magát. A kíváncsi dög túl közel merészkedett a csőhöz. – Te hol vagy? – Betömve. hogy Muldoon él.. – És pillanatnyilag nagy népszerűségnek örvendek. A szentségit. vicsorgott odafenn. mintha valami üregből jönne. Leugrott! Arnold kétségbeesetten nézett körül. Ott van! Hátranyúlt. és vicsorított. milyen a cső másik vége – túl gyorsan mászott bele hátrafelé –. hogy a cső távolabbi vége nem nyitott. Arnold eljutott a gépházba. rendkívül népszerű vagyok – ismételte a rádióba. – Mi van avval a rohadt árammal? Van már? – Ez Muldoon hangja volt. Már a tartalék generátor közvetlen közelében járt. Szorosan beékelődött. Még néhány lépés. Legalábbis azóta nem.. Különösen keskeny. Méteres cső volt. De lassan jött. ő pedig kitátotta a száját. Muldoon kérdése hallatszott a rádióból: – Mennyi idő telt el? Wu válaszolt: – Négy-öt perc. „Pontosabban szólva csőbe ékeltem magam” – gondolta Muldoon. de hirtelen heves taszítás érte. Elmosolyodott örömében. amióta ellőtte a lábát az egyiknek. – Igen. hogy nem várta meg míg az állat orra jelenik meg a cső végénél. Hogy aztán mi történt. Még néhány lépés. láthatólag tudták. A velociraptor alig tíz méterre volt tőle. hogy valamelyik dög a seggébe harapjon! Arnold hátrafelé araszolt a járópallón. és ő egész egyszerűen belehátrált a legközelebbibe. Tompa zuhanás hallatszott a háta mögött. – Nincs – felelte Wu. hét méterrel felette a járópallón. – Pech. lopakodva közeledett a félhomályban. s kitört belőle az üvöltés. hogy alig kapott levegőt. – Azt hiszem. Akkora súly nehezedett a mellére. ott biztonságban vannak.. Wu szólalt meg: – Arnoldnál van rádió? – kérdezte. – Arnoldnak már el kellett volna intéznie a dolgot – mondta Muldoon –. hátha talál valami fegyvert. . hanem azonnal meghúzta a ravaszt. és meg is pillantja. – Micsoda? – Be vagyok tömve egy rohadt csőbe – mondta Muldoon. hogy a velociraptorok nem tudnak lépcsőn járni. Csak remélte. „Ez az óvatosság az egyetlen esélyem – gondolta Arnold.

hogy a dzsungelben legyenek. hogy a gépház valahol kelet felé van. – Van valami hír? – A világon semmi – hangzott Wu válasza. mely a látogatóépülethez vezetett. hogy a raptor az oldalára esett. Puha pára úszott a levegőben. A raptor még mindig a padlón lihegett. ami fegyverül szolgálhat. hogyan kalapál a szíve. Madárcsiripelés hallatszott a fákról. hogy lelassítsa lépéseit. De Gennaro úgy gondolta. – Most indulok a gépházba. megállapította. amennyire csak tudott. Donald Gennaro alól pedig kiszaladt a föld. Egyszerre csak ráébredt. Vér csöpögött a karmairól. de a távolban. Kényszerítette magát. Megtalálta az ajtót. Malcolm felsóhajtott. Felnézett. Igyekezett olyan csendben mozogni. Belebotlott valamibe. Gennaro elindult. Az istenit. A lábaival van valami baj. és megkerülte az épület oldalát. A hangja visszhangzott a sötétben. és a földre lökte. Morgott. Egyik kezével a csöveket tapogatva haladt előre. de letért az ösvényről. Van kedve veszélyesen élni? Nem igazán. Fülelt. hogy így is túl nagy zajt csap. látta. van egy terve. Semmi sem indokolja. De aztán mégis meglátta a tetőt a pálmafák fölött. s liheg. nem volt semmi kedve. Szünet. Igen: sérült. a növények közt tört utat. mint a víz. vagy legalábbis egy lehetőség. – Hol a francban vagy? – kérdezte tőle Muldoon. Érezte. hogy egyáltalán észre sem veszi a gépházat. hová kell mennie. – Alig várom már. Vagy legalábbis remélte. Fogak. Vér. Arra ment. és odébb hengergett a betonon. Mintha jobb felől jött volna a hang. Lefelé vezető lépcsőt talált.– Itt vagyok. Ragadt. Gennaro teljesen körbefordult. Így igaz. meg tudja közelíteni a gépházat hátulról. Gennaro erős férfi volt. feltornászta magát. Valami a vállára és csupasz karjára csöpögött. hogy azt sem tudja. Talán van rádió az épületben valahol. Megszagolta. de a hang nem ismétlődött. Ha nincs. és elvágódott. s a helyzetet. Kezdett attól tartani. A rádiót meg ott hagyta. s fegyver után nézett. Amikor azonban visszafordult. – A francba! – fakadt ki Muldoon. és éppen eléggé idegesítette. Errefelé igen sűrű volt a növényzet. Egy fél pár férficipő! Gennaro elgondolkodott. Alig látott valamit. de a raptor a hátára ugrott. mást nem tehet. verejtékben fürdő Malcolm a sercegő rádiót hallgatta. Óvatosan megindult előre. dél felé. s kinyújtott kézzel tapogatózott. Nem látott két-három méternél messzebb maga elé. Az ágyban fekvő. mint aki kívülről figyeli önmagát. jobbra tőle. Járópallót pillantott meg közvetlenül maga előtt. Meleg volt. kinyitotta. Hallgatózott. Amikor megfordult. Aztán futásnak eredt. Kívánjatok nekem sok szerencsét! Gennaro lehúzta a fejét a bokrok között. hogy megtudjam. ami esetleg beválhat. hogy neki ne menjen valaminek. Lent sötétebb volt. Az állat harapdálja! A raptor félrerántotta a fejét. és megdermedt. a másikat maga elé tartotta. a raptor már nem volt ott. Szélesre tárta és kitámasztotta az ajtót. A férfi kétségbeesetten keresett valamit – akármit –. és besurrant. Közvetlenül előtte volt a növényekkel szegélyezett út. aztán beljebb indult az épületbe. Állati morgást hallott. hogy milyen újabb tervvel fog előállni majd! . Aztán éles fájdalmat érzett a jobb karjában. Raptor üvöltött valahol. A raptor a csővezetéken ült. hát megkeresi azt a generátort. hogy semmi. alig néhány méterre a fejétől. A raptorok valószínűleg mind a többi épület körül vannak. hogy sérültnek látszik. Ha végig a főépület-komplexustól északra marad. Nyilván valahol lent van az alsó szinten. Gennaro. letaszította a raptort magáról. Öld meg! Gennaro felkászálódott. Gennaro tudta. Nagyon sötét volt odabenn. – Van valami? – kérdezte Muldoon. Megérintette a sötétben.

a tudomány formális nyelve elé. A genetikai hatalom pedig sokkal nagyobb. hogy az. Először jön Heisenberg a bizonytalansági relációjával. Csend lett. de előbb-utóbb mindent tudni fog. mi itt az igazi tét. igazolása. Senki sem szólt. vagy hogy miképpen éljünk. – Ez azért erős túlzás – mondta a fejét rázva Hammond. a víz. Erre Gödel teorémája hasonló korlátokat állít a matematika. És vele pusztult a legtöbb jogcím. a vallási dogmák. És éppen úgy. És ott lesz . és Ellie már azt hitte. mint a gyermek. a tudomány is egyre kevésbé felel meg a mai világnak. S a világunk kezd a legalapvetőbb szempontokból elszennyeződni – a levegő. Olyan közönséges dolgokról van szó. – A tudomány korának végnapjait éljük. És most megtudjuk. és korlátokat szab annak. amit a tudomány tesz. hogy a természeti törvények megismerése révén ellenőrizhetővé válik. mint az előre megjósolhatatlan zivatar. amikor még Firenze volt a világ közepe. – Nyugodjon meg. aki a ház tetejéről a mélybe ugrik. és ott átcsoportosulnának. Mert az hatalom volt a javából. úgy válik egyre képtelenebbe rá. hogy az objektív. amit az elemi részecskék világáról egyáltalán megtudhatunk. A tudomány alapeszméje – az. amely a logika törvényeiből ered. ahogyan képzeltük. csakhogy a valóságban ez azért történt. Mert most már igencsak felgyorsultak a dolgok. – Ha odahajthatnék vele hozzád. hogy eldönthessük. amelyek ötszáz évesek. hogy katasztrofális! Wu hangja hallatszott: – A raptorok követni fognak bennünket oda. Ma már látjuk. hogy az ő nyelvük valami belső. – Most pedig a káoszelmélet szépen bebizonyítja. tud repülni. Malcolm végre elaludt. Na és akkor mi van? mondhatjuk erre. nem hit kérdése. – Van egy dzsip a látogatóközpont előtt – mondta Wu. hogy bánni is tudjon a hatalommal. hogyan. kérem – mondta neki Ellie. Olyan nevetséges és felelőtlen. – Egy vezérlő áram nélkül nem vezérlő. – Ez az örökös igyekezet. – Egy cseppet sem rózsás a helyzet. A tudomány mindig azt mondta. hogy ez nem igaz. Nem különleges olyan módon. amely akkor is már sok száz éve uralkodott. Hirtelen újra felült. ahogy annak idején a középkor rendszere. Ahogy a hatalma nő. És amiért hallgatnunk kellene rá. Malcolm lehunyta a szemét. – Na jó – mondta Muldoon. Igen ám. Mint minden más elavult rendszer.– Azt szeretném a legjobban – szólt Muldoon –. nehezen lélegzett. hogy lehet. el tudnál jutni a kocsihoz? – Talán. – Ez egyébként mindenki előtt ismert. Olyan nyugati magatartásformákról van szó. több milliárd ember él összezsúfolva a világon. mikor ne építsünk. Csak azt nem tudom. Hála főként a tudománynak. nem más. Ki él az elemi részecskék világában. de azt nem tudja megmondani. – Sóhajtott. – Próbáljuk meg! De nem valami rózsás a helyzet. hogy a káosz be van építve mindennapi életünkbe. elemi igazsággal rendelkezik. Mondhatnánk úgy is. De nem. sem nemzetiségé... mint az atomhatalom. A tudomány akkora hatalomra tett szert. több száz éves látomása – a teljes uralom álma – századunkban tehát meghalt. Newton és Descartes kora óta a tudomány nyíltan a teljes uralom vízióját vetítette elénk. A huszadik századra azonban ez az állítás menthetetlenül megdőlt. amely több száz éves. Képes atomreaktort építeni. Ennek semmi gyakorlati hatása nincs arra. hogy a hatalmunkba kerítsük. – De nem ám! – mondta az ágyban fekvő Malcolm. De abban már nem segít a tudomány. – Indulás! A rádió egy kattanással elhallgatott. takarékoskodni egyre fogyó erejével. középkori eszmerendszert. de azt nem tudja megmondani. az igazolás mindarra. hogy mindennapi életünket éljük. miről van szó voltaképpen – mondta Malcolm. A matematikusok eddig abban a hitben éltek. többre képes. Azt állította. Ám tíz év sem telt bele. hogy új módon kell nézni a valóságot. A tudomány nagy. – Úgysem tudok itt mit csinálni. és a bombát követte a genetikai hatalom kezdete. Nem működött már gazdaságilag. – Akkor is jobb helyzetben leszünk – válaszolta Muldoon. ha mindenkit sikerülne bejuttatni a kastélyba. a gyűlölködő babonák középkori világa összeomlott a tudomány előtt. A feudális politika. Malcolm köhögött. Igyekezett lassan lélegezni. a föld – az irányíthatatlan tudomány jóvoltából. – Ugyanakkor azonban megszűnt a tudomány nagy szellemi jogalapja. hogy racionális – ez a gondolat akkor friss volt. amit „rációnak” nevezünk. s elsöpörte a régi. Tud rovarirtót előállítani. – Ha lehet. nem működött szellemileg. s áll kölcsönös kapcsolatban egymással. Ötven évvel ezelőtt mindenkinek az atombomba volt a mániája. – Most azonban – folytatta – a tudomány az a hitrendszer. Abból az időből valók. hogy ne használjuk. izgalmas. Malcolm lehunyt szemmel feküdt. ne izgassa fel magát! – Maga is tudja. mert azt hiszi. Sokat ígért. mint önkényes játék. De akkor üres maradna a vezérlő. és nem felelt meg a kialakuló új világnak. ma még nem tud mindent. Annál nagyobbat el sem tudott képzelni senki. hogy kezdenek előtűnni gyakorlati korlátai. Puszta kérkedés. mit csináljunk ezzel a világgal. azzal kecsegtetett. mert a középkori világ működőképtelenné vált. – Hát ez bizony igaz – kommentálta a párbeszédet. reményt nyújtott a jövőre nézve. a tudomány is önmagát rombolja.

akár bármelyikük is élve kijut erről a szigetről? . Malcolm megint felsóhajtott. – Szegény ember! – mondta fejét ingatva Hammond. mennyire valószínűtlen. – Mondja.mindenki kezében. Malcolm vállat vont. hogy akár maga. hogy feltegye a kérdést: „Mit kezdjek a hatalommal?” – pontosan azt a kérdést. mint a halál – felelte a matematikus. – Miféle változás? – Minden nagy jelentőségű változás olyan. tisztában van maga azzal. nem tud felelni rá. A terroristák és diktátorok olcsó laboratóriumaiban. ha már odaát vagy. Benne lesz a hétvégi kertész szerszámkészletében. A gyerekek iskolai kísérleteiben. – Csak akkor pillantod meg a túloldalt. amelyről a tudomány azt mondja. – Változás következik. – Ezzel lehunyta a szemét. – És mi fog történni? – kérdezte Ellie. Ez pedig mindenkit rá fog kényszeríteni arra.

HATODIK ISMÉTLŐDÉS A rendszer helyreállítása lehetetlennek bizonyulhat. IAN MALCOLM .

Az alagút fala sima volt. – Hogy lehet. tíz óra. . hogy „morbid”? És nem vagyok az! Aztán megreccsent a rádió. – Halló. melyet ernyő védett az esőtől. Tim és Lex riadtan a biztonsági őr elárvult pultjához húzódott. Sok helyen látott azonban száradt.. – Elpusztul? – Remélem. Halvány zöld köd úszott a levegőben. – Honnan tetszik tudni. Pontosan a garázs elé érkeztek! – Hurrá! – kiáltotta Lex. miközben Grant beállt a garázsba a kis villanyautóval. ahol a velociraptor hevert. hasából kilátszottak a csövek és vezetékek. és így bejutott némi fény is. Az ablakon át elmosódott pálmafasorok rajzolódtak ki halványan a ködben. De most inkább előre világíts. – Mi az. Grant elkapta a karját. – Számításom szerint pillanatokon belül a látogatóközponthoz érünk. a szeme pislogva követte a lámpa fénysugarát. és. Tim szólalt meg: – Ami azt jelenti. Állatketrecek egész tömege volt egymásra halmozva az egyik falnál. itt Grant! Lex kerekre nyílt szemmel bámulta az őr testét. – Halló. Grant azonnal látta: a látogatóközpont az. Az „AMIKOR DINOSZAURUSZOK URALTÁK A FÖLDET” feliratú tábla a sarkánál fogva lógott lefelé. az üresen ásító nagyteremben hűvös. csak itt-ott törte meg egy-egy szellőzőnyílás. egy tál víz kíséretében. lába az égnek állt. itt Grant! Hall engem valaki? Halló. – Hú! – kiáltott fel Tim. és átkukucskált a pult pereme fölött. hátravilágított a zseblámpával. Aztán elindultak lefelé a látogatóközpont földszinti bejáratához vezető lépcsőn.. amivel szinte kirobbantak a napfényre. – Mit mutat? – Azt. hogy már csak negyven percünk van rá. kinyitották az ajtót. – Tényleg? – kérdezte Lex. Az óriás tyrannosaurusrobot feldőlt. szürke pára úszkált a levegőben. A látogatóközpont bejárati halljának üvegablakai betörtek. itt Grant! Halló! Lex előrehajolt. – Hurrá! Sikerült! – Fel-le ugrált az ülésen örömében. hogy szaporodnak? – Onnan. aki mellette ült. hogy felvegyük a kapcsolatot a hajóval. – Miért visszük magunkkal? – kérdezte Lex. de úgy érezte. Grant a padlóig nyomta a sebességpedált. eleltakarva az épületet. az alagút már enyhén felfelé lejt. Lex. – Már közel kell lennünk – mondta Grant.. hogy ez kölyök – felelte Grant. Csak a lába látszott ki. mely a padlón hevert. – Miért lélegzik olyan nehezen? – kérdezte. Nyikorgott a szélben. hogy. – Most rögtön megyek hamburgert enni! Rósejbnivel! Meg csokifagylaltot! Nem lesz több dinoszaurusz! Hurrá! – Odaértek a hallhoz. Most vette csak észre. hogy nem is igazán vörös? – Morbid vagy – szólt rá Tim.. – Nem volt biztos benne.. – Bizony. amely közvetlenül előttük magaslott.. nem. Az egyikbe betették a velociraptort. föld alatti alagútban. – mégpedig fiú dinoszaurusz. – Oké. s az óráját a kislány felé fordította. Semmi kétség: jó néhány állat járt erre. – Hogy mindenkinek bebizonyítsuk a központban: a dinoszauruszok tényleg szaporodnak. állati ürüléket. És elnémultak. Megdöbbentő volt a sebesség. Grant felvette az őr rádiókészülékét... – Hé! Ezt ne csináld! – Meghalt? Mi az ott a padlón? Vér? – Igen. tizenöt perc. légy szíves! – Kinyújtotta a kezét. jobbra tőle. – Mert nyugtatót lőttem bele – válaszolta Grant.VISSZATÉRÉS A kis villanyautó zümmögve robogott tovább a sötét. és végigpróbálta az összes csatornát. visszaviszi őket a felszínre.

– Uramisten! – hallatszott egy hang. elvékonyodott szakaszok voltak mindenfelé. és elhallgatott. és. – egy pillanatra kimaradt az adás. – Átrágják a rácsokat? – Homlokát ráncolva próbálta maga elé képzelni a dolgot. – És a gyerekek? Láttad őket? – Itt vannak velem – felelte Grant. hogy az üveg betört. Muldoon krákogott. – No és? Az épület áthatolhatatlan. Erős hátsó lábát az ablakra tette. Grant doktor! A rádió kattant. Grant magyarázatba kezdett a hajóról. sikerült idejuttatni őket a kastélyba. A főépület halljában. – Mi a kastélyban vagyunk. horkantásait. De mindenki más itt van. ahogy az acélrácsokat rágják.túl közel ültettek egy fát a kerítéshez. – Jössz vissza? A rádió recsegett. – mondta Wu. Habos nyál fröccsent a lepedőkre és az ágy melletti asztalkára. – Recsegett a rádió. A raptorok átjutottak a kerítés fölött a tetőre. Ellie odanyúlt. – Milyen gyorsan? – ismételte meg a kérdést Grant. már hallották a raptorok morgását. Az egész rendszer kikapcsolódott. – .. – Ők is jól vannak. – Hála legyen Istennek! – mondta Ellie. Senki sem számolt azzal. – Hogyan tudnánk a rendszert újra beindítani? – Azzal próbálkozunk. Képesek kinyitni az ajtókat is. ahol ti. tíz-tizenöt percünk lehet. Olyanok mint a hiénák.ol vagytok? – A hallban. – Ha Grant valahogy be tudna jutni a gépházba. . benn az épületben. – Gondolom. Ezüstös. A Malcolm ágya fölötti üvegablakon a raptorok már átrágták magukat az első acélrácsokon. – És a többiek? Muldoon. – Hogy tudhatna? – vágott közbe Muldoon. Egyébként az üvegtetőn lévő acélrudakban is áramnak kellene futnia. s az üveg betört. Itt nincs! – Hogyhogy? – Néhány raptor a nyomunkba szegődött. – Hát ez remek! És te hol vagy? – kérdezte Grant. – De rondák! – szólt felnézve Malcolm. húzta hátrafelé.. – Milyen gyorsan? – Gyorsan – felelte Muldoon. míg teljesen átrágják magukat. nincs bajom. – Grant? Te vagy az? Aztán: – Alan! Alan! – Ellie volt az. fogaik csikorgását. Grant tovább kérdezett.. Sántikálva járkált körbe a szobában megrándult lábán.. – Hála Istennek! Lex négykézláb mászva igyekezett megkerülni a pultot. átharapják az acélrudat is. Fényes cserepei Malcolm ágyára záporoztak. mindenki más? – Néhányan elvesztek. amikor Muldoon félbeszakította: – Azt hiszem. Már nincs egy félóránk. hogy ott vannak. csak éppen ki van kapcsolva minden. Már elkezdték átrágni az ablak acélrácsait. és ráncigálta. Grant megdöbbent. amerre harapdálták. – Míg át nem rágnak még egy rácsot. – Legalább egyelőre még nem tudnak bejönni – mondta Ellie. Lehet. – Megvagyok... ön nincs tisztában a helyzettel. Ó. egy pillanat. Grant a bokájára csapott. Most Wu hangját hallotta a készülékben. még pedig azonnal! Ha nem sikerül. a raptorok félórán belül elérik a szárazföldet. Mihelyt pedig bent vannak. Grant doktor. és a nagyobb darabokat leszedte a takaróról.... figyelj! – szólt Ellie. – Egek ura! Itt vannak! – Alan. Most. Pillanatnyilag a tetőn van kettő. Már egy ideje. Az egyik állat megragadta a rúd végét.. – A jelek szerint nem. – A raptorok kiszabadultak. hogy állatok juthatnak a tetőre. – Muszáj valahogy bekapcsolni – mondta Grant –. s a tető üvegén át bejutnak az épületbe. – Hát a telefonok működnek-e? – Nem. Nem működik semmi. – A harapóerejük több mint ezer kiló négyzetcentiméterenként. – . – Nincs bajod? – Nem.

az? Velem nem mentek semmire.. akkor figyeljen! – mondta Wu. De Ellie már hajolt is.. fenn a tetőn. de ebben nem lehetünk biztosak. – Igen – mondta megint Malcolm. hogy még legalább négy van odakinn. és haragosan elfordult. Végig kapcsolatban kell lenned Granttal. míg elindítja a rendszert. – Ideges lesz... – Figyeljen. amely a pálmafasoron át egyenesen a gépházhoz vezet. maga körül. Hűvös ködfoltok úsztak el mellettük. – Nem lehetne. Készre ment a bokám. – Majd én – mondta erre Wu.– Nem elég az idő.. ha elérte a gépházat! – Oké. Tényleg csak tegnap lett volna. A rádió percek óta hallgatott. – Elterelni a figyelmüket? Hogyan lehetne? – Menjenek. hogy a rendszert is bekapcsolja? – Pontosan. ott biztonságban lesznek. Ahhoz nem. – Nem – mondta Ellie. mit kell csinálni a számítógéppel. Wu folytatta: – Van egy ösvény. – Azt nem – tiltakozott Muldoon. nry Wu beszél.. A rádió megreccsent.. – Igen – gyenge volt a hangja. – Képtelenség – mondta Muldoon. ott van. – Nem lehetne? Mit? – Elterelni a. – Oké. kérem! – szólt Wu. – Hagyja a gyerekeket a büfében. hogy ennek véget vessen. – Megpróbálnak kitalálni valamit – mondta Grant. – Akkor majd én – szólt Harding. hogy még idejében visszakapcsolja az áramot. . Látta azt az épületet tegnap. – Azt reméljük. – És után még vissza is menne a vezérlőbe. és megpróbálkozhatnánk vele. alig több valamiféle hörgésnél. hogy befűzze a tornacipőjét. arról szó sem lehet! – csattant fel Muldoon. Alig értette a kérdést.. – De kapcsolja ki indulás előtt. Néma csend volt a hallban. ha megtudja. – Várj egy pillanatig! – mondta Wu. és beindíthatná a generátort. Itt csak két raptor van. – És akkor mi van? – Akkor Grant nyugodtan bemehetne a gépházba. nehogy zajt csapjon odakinn! És hívjon. – De ha ide tudjuk csalni a raptorokat – vitatkozott Wu –. – Pontosan.. a kerítéshez. Ott van még? – Itt vagyok – felelte Grant. Ami azt jelenti. Csak te tudod. ellátok. Grant kikapcsolta a készüléket. – Igen? És mit csináljunk? Malcolm kimerülten elmosolyodott. ahol most van? Grant átnézett a hátsó üvegablakokon. – Mit mond? – kérdezte Muldoon.. – Igaza van... – Malcolmnak szüksége van magára. talán még arról az üvegtetőről is lemennének. – Csak Grantnak ne mondják meg – kérte. Pálmafák. – Nos. Lex előmászott. – Megvonaglott a fájdalomtól.. Megpróbálni mindenképpen érdemes! – Vagyis valakinek el kell játszania a csalétek szerepét – mondta Muldoon. hogy eltereljük a figyelmüket. hogy belesett abba az épületbe? Mintha évek teltek volna el azóta. – Nincs már annyi idő. hogy sikerül az összes raptort idecsalnunk. – Igen. Vigye magával a rádiót. Úgyhogy legyen óvatos! Adjon nekünk öt percet! – Oké – felelte Grant.. . Ahol a generátorok és más berendezések vannak. – Dugják ki a kezüket! – Jókor viccel! – szólt Muldoon. ugye? – Láttam – válaszolta Grant.Hátha sikerülne. – Raptorok lesznek mindenütt. Kimehetnénk. Tim megkérdezte: – Miért nem szólnak hozzánk? – Én éhes vagyok – jelentette ki Lex. – Ellát a látogatóközpont hátuljáig onnan. – Grant. köd. – Ördögöt. Lehetetlen. – De ki legyen. Malcolm köhögött. bár egy pillanatra meglepődött. Én megyek.

Tim! – Oké. Raptor volt. Sőt. gyerekek. hogy vigyázz rá. mintha ebédhez szólító gongot ütne. Ellie még mindig ideges volt. – Azért vedd el ezeket! – Fagyit. – Jó neked. Felálltak. . mellette állvány. – Akkor fagylaltot! – Tim. – Nem hinném. Idegesen nézett a tető felé. Azonnal megérezte a hűvös párát az arcán és a lábán. Kézen fogva vezette a kislányt előre. Közvetlenül előtte feltűntek a sűrű ködben a vastag rácsok. hogy fagyit kérek! – tiltakozott Lex. hogy lehet főzni. Ha nem sikerül a raptorokat a kastélyhoz csalnia. hogy a kerítésen belül teljes biztonságban van. Különben is. hogy beszélsz? – Akkor menjünk lassabban! Kétszárnyú lengőajtó volt a székek és asztalok mögött. A büfé teljes sötétségbe borult. – Itt a kaja. halvány állatalak tűnt fel a ködben Ellie látótávolságának legkülső határánál. és kifejezetten bántotta a férfi akasztófahumora. Oké? – Oké. miről van szó. Felmarkolt egy csomó csokirudat. A rácson túl azonban alig látott valamit. ha itt maradnátok. gyerekek! Ebéd! Terítve van! – Nagyon vicces! – szólt Ellie. – Egy kis időre magatokra kell hagyjalak benneteket – mondta Grant. Nem hiszem. – Hamburgert akarok! – közölte Lex. és elindultak a hallban úszkáló ködön át. – Azt nem lehet. A ködbe burkolódzott látogatóépület felé nézett. nagyjából csak felfogják.. Amikor kinyitotta. amit valamelyik benti építkezésről hozott magával. Ellie kezdett nyugtalankodni. Rendben? – Rendben. Szeretném. Muldoon megint kongatni kezdte a kerítést a rúddal. Muldoon az ajtókeretnek dőlt. Ti csak maradjatok itt. Foszforeszkáló zöld színben látta az asztalokat és székeket. – Nincs áram. – Kapcsold fel a villanyt! – kérte. – Nem lehet – felelte Tim. Grant szögletes étkezőasztalokat és székeket látott. – Jól van. és kitárta. benne kis kerek ablakok. Grant veszélybe kerül. Még húsz méter. Nyilván a konyhába vezetett. és beljebb vezette Lexet az étterembe. a kertekben s a fák között hátborzongató csend uralkodott. – Hé! – kiáltott bizonytalanul a ködbe. – Maradok. Ellie Sattler kilépett a kastély első ajtaján. hogy ez elég lesz – mondta. Szükségem van rá. – Pedig így van. – Maga túl nagy lármát csap – mondta Muldoonnak. a húgoddal kell maradnod. de egy lépéssel sem jött közelebb. – Nem értenek angolul – vigyorgott Muldoon. Öt perc múlva itt vagyok. A kislány megrángatta a kezét. A raptor – fehér árnyék – eltűnt. aztán tejfehérré vált a táj. – Te csak gyere velem! Fogd a kezem. hogy zajt kelt! – Kibicegett. s furcsa módon mintha kíváncsi sem lett volna rá. – Megjött az első vendég – mondta Muldoon. De velem mi lesz? – Csak fogd a kezem! Keresünk valami ennivalót. oké. Acélrúd volt a kezében. – Nincs áram. csokoládés állványt.. – Tudom. Beléptek a büfé ajtaján. – Oda – mondta Grant. miféle zaj jön a kastély felől. Kísérteties. Lex megfogta a bátyja kezét. jobbra meg a csillogó pénztárgépet és a rágógumis. Nem látott raptort. Tim belökte az egyik ajtószárnyat.– A büfébe megyünk? – kérdezte. noha tudta. De tessék itt hagyni nekünk a rádiót – mondta Lex. Vadul dobogott a szíve. – De gondolom. – Mondtam. – Egy frászt! – felelte az. – Szart se látok! – mondta. majd újra előtűnt. Mögöttük rozsdamentes acélból készült lengőajtók. Úgy kongatta vele az acélkerítést. És nem látott semmiféle raptort sehol. – Ő azonban a szemére húzta az éjszakai nézőt. teli rágógumival és csokoládéval. A közelben pénztárgép. Tim a zsebébe gyömöszölte a csokoládérudakat. bármi történjék is. Grant behúzta maga után az ajtót. – Arról volt szó.

Ez azt jelenti. Ellie most már hátra sem nézve rohant. mint valami gyakorlott sprinter. amint szélesre tárja a kaput előtte. de Ellie azonnal sarkon fordult. Egy pillanat múlva már láthatatlanná vált. De a botanikusnő már nem figyelt rá. – Hall engem. – Maga túl sokat ivott – szólt közbe Ellie. megnézte a karcolásokat és kék foltokat. és gyorsan haladt előre a ködben. és kinyitotta a kaput. Hátul. és megragadja a karját. hogy futás közben kapja el őt. majd újabb nyikorgással megint kinyitotta. hogy a köd. nem is igazán igyekeztek Ellie-hez férni. Odalépett az oldalablakhoz. Fél pár férficipővel volt kitámasztva. – Úristen. Újra meg újra a kerítésnek vetették magukat. nem igazán nagy. Kezébe kapta a rádiókészüléket. hogy lásson valamit. – Azt mondják. Hunyorogva próbált kivenni valamit a sötétben. amint először egy. a kapun. Ugrott. felugrottak. Az örökös párától megrozsdásodott sarokvasak hangosan nyikorogtak. Karmait előremeresztve felugrott. mint a csimpánzok. Jobb felé. Visszavicsorgott rájuk. . és futásnak eredt. Lassan körbeforgott. és nagyot sóhajtott: – A lövedékek Gennarónál vannak. a növényzet felé mozog. ahogy várta. s a földre zuhant. még idejében. valahol másutt van! – Gyerünk. A kapuhoz ment. Az első állat egy fa aljnövényzetéből rontott elő. – Szórakoztassuk még egy kicsit őket! Grant maga mögött hagyta a látogatóközpontot. kiált neki. Grant belépett. hadd hozzam a rakétakilövőt! – Hát hozza! Muldoon észbe kapott. ahogy a lába a sarat tapossa.. Olyan vadul kalapált a szíve. És nyitva hagyta. közönséges ajtót pillantott meg. ennek nem sok híja volt! Mekkorát tudnak ugrani ezek a dögök! Ellie talpra állt. a rácsokon kívülre. s már meg is pillantotta a ködből előtűnő kerítést. és végignézett magán. utána nyúl. Legalább annyira. amely félelmetes sebességgel kezdett eltünedezni a ködben. kettő a tetőn. jöjjön vissza. és északnak indult rajta. Támadtak. – Annak szólítom. mindenfelé igyekezett figyelni. – Azok is.. hogy az egyik kis híján elérte a tetejét. aztán kettő – majd három – állat ugrik neki a kerítésnek. hogy egy még hiányzik. Szándékosan ingerelni kezdte az állatokat. – Akkor tartsa nyitva a szemét. amitől azok teljesen megvadultak. látta Muldoont. Láb. de azonnal! – Hogy mer engem „kislánynak” szólítani? – kiáltott vissza neki Ellie.és vállizmai szinte fájtak a feszültségtől. Csak egy dolog járt az eszében: három állat van itt. Odakinn a három velociraptor újabb és újabb támadásokat intézett a kerítés ellen. hogy lássa. Grant leugrott.. – Ezzel kilépett a kapun. Van-e annyi intelligenciájuk. Eltávolodott a kerítéstől. de mintha kezdte volna elvonni a figyelmüket a kintről jövő zaj. – Bízza rám! – Bízzam? És mit akar csinálni? Ellie nem válaszolt. – Szép volt! – kiáltotta Muldoon. A férfi oly hevesen rántotta be. – Jó – mondta Ellie. Zárva volt. levegő után kapkodva. a lábán lefolyó vért. és bekapcsolta. Sehol sem látott rajta ajtót. Ellie biztonságban szaladgált fel-alá a rácsok mögött. és bordázott acélból készült tolóajtóval találta szemközt magát. a növényzettől félig eltakarva rakodórámpát látott teherautók számára. Már legalább húsz méterre volt a kerítéstől. a hétszentségit?! – ordította Muldoon. megkerülte a sarkát. mint enyhén szitáló eső. hogy bekerítsék. Erőltette a szemét. Ellie becsukta az ajtót. segítsen! – szólt rá Muldoon. Továbbment. – Akkor talán felismerik ezt a hangot – mondta Ellie. „Mennyire eszesek ezek az állatok?” – tűnődött Ellie. Nem ment a növények közelébe. aminek akarom! – dühöngött Muldoon. Nem hagytak fel vele. megfeszült a teste. olyan erővel. a raptorok intelligensek. s az állat a sáros földre zuhant. és vicsorogva morog. Pontosan. A második a másik oldalról támadt. Kitűnő. Felmászott rá. – Itt Grant! – mondta – Benn vagyok! Wu felnézett a tetőablakra. – Vagy ha ragaszkodik hozzá. s látta. hogy szinte azt sem érezte.– Én ismerem ezeket az állatokat. Megtalálta a pálmafák közti ösvényt. De a raptorok mintha már nem vették volna komolyan a dolgot. kicsit távolabb. kislány. és folytatta útját az épület körül. Szemben előtűnt a ködből a gépház szögletes épülete. A két raptor még mindig be-benézett odafentről Malcolm szobájába. Aztán megfordult. de Ellie teljes erőből futott. hogy elvágják az útját visszafelé? Nem nagy ugyan a távolság a kerítésig. Nyilván az volt a szándéka. – Ezt én nem tenném – jegyezte meg Muldoon. Hangtalanul. hogy elvesztette az egyensúlyát. Szürke árnyalatok világában járt.. – A hallásuk is jó? – Az. Muldoon részeg izgalommal a hangjában azonnal ordítozni kezdett: – Az istenit neki.

– Megvan. Sárga és vörös? – Az az – felelte Wu. rajta két gombbal. klikk – nagyon gyorsan egymás után. – Oké. Nem is igazán próbálnak. – Dühösnek hangzott. Lent vagyok a létra alján – szólalt meg Grant. Kört írtak le. amelynek szellőzőnyílások vannak az oldalán. – Másodszorra sem sikerült. Alatta meg valami szöveg spanyolul. – Négyhüvelykes PVC? – Az. Már rájöttek. – Látom – mondta Grant.gyok. Ha a tartályok aljára nézel. mintha generátor volna. – Oké. Wu és Muldoon egymásra meredt. Szevasz! – Kösz. – Az is – mondta Wu. előbb-utóbb egy létrához érsz. akkor egy másik. ezért most át kell kapcsolnunk a másikra. – A sárgát nyomtad be előbb. – A generátor két üzemanyagtartálya. – Jól vagy? – Persze. – Akkor most két sárga tartálynak kell előtted lennie. látod. – „Gyúlékony” – az áll rajtuk. Azt mondja. oké – válaszolta Grant. felágaskodtak. Grant doktor? – Igen – felelte Grant.. – Indulj el a pallón! – Indulok. Rajtuk felirat: „Robbanásveszélyes”. amit mondtál. Csak. és utána a vöröset? – kérdezte Wu. Alan! Ha éppen a keleti ajtón belül állsz. A kettő közül az egyik kiürült. – Menj le a létrán! Hosszú szünet következett. nyomd be a vöröset! – Rendben. – Kövesd tovább a csövet! – Oké... – Az a generátor! Ha megkerülöd. követem.. – A rádióból gyengén hallani lehetett a léptek kongását a fémen. játszanak.. Au! – Mi történt? – Semmi. – . – Megismételné. jól. amely két emelet mélységbe nyúlik le. Wu megragadta a maga készülékét. Valami zúgni kezdett. – Már látom. Grant doktor? – Benn vagyok – mondta újra Grant. Csend. és az oldalához mész. hogy jobban maga elé képzelje a helyszínt. a fejem. vicsorogtak. aztán végül következet a roham. Balra tőled fémből készült járópalló. – Pontosan azt tettem. Újabb szünet következett. pontosan – mondta Grant. . kapcsolótáblát látsz. klikk. – Először nyomd be a sárgát. – Bent van a gépházban. – Menj azon. – Látom. – Egyenesen előtted. aztán a zúgás abbamaradt. Úgy néz ki. mint a madarak! – szólt Muldoon. nem igazi támadásra. eltávolodtak a kerítéstől. – Oké. Aztán hozzátette: – Egyébként inkább szólíts Alannek. Majdnem egy percig tartott. – Próbáld meg még egyszer! – Már megpróbáltam – mondta Grant. Ingerültnek tűnt a hangja. – Jó – mondta Wu. Csak bevágtam a fejem. – Előadást rendeznek. rendben. süllyesztett víztartály van. Muldoon feszülten ráncolta a homlokát. és levezet a mélybe. utána semmi. egy csomó csővezetéket kell látnod. megint köröztek. Baloldalt van.Szinte úgy tűnt. – Ahogy haladsz – irányította tovább Wu –. Megreccsent a rádió. majd három kattanás – klikk. – Igen. De a viselkedésük egyre inkább valamiféle bemutatóra emlékeztetett. – Wu lehunyta a szemét. korláttal. „Honda”. és míg benyomva tartod. Szünet.. – Ha nyolc-tíz métert mégy előre. Wu nedves hajába túrt az ujjaival. PVC. – Intelligensek. az épület közepén egy nagy. A cső egy nagy alumíniumkasznihoz vezet. Wu rábólintott. hogy nem tudnak a nőhöz férni. leereszkedtek. Hülye vagyok. – Alan? – Nem sikerült – szólt Grant. – Azok azok – mondta Wu. Kövesd a csövet befelé! – Oké. – Tisztára. hogy fehér cső nyúlik ki belőlük. jobbra tartó pallót látsz.

– Mik azok a jelzőfények? – kérdezte Lex. – Ebben a hűtőben aztán volt minden. de Tim valahogy tudta. Fagylalt után kutatott. Otthon villanytűzhelyük volt. – Úgy van – mondta Wu. Rengeteg doboz tej. utána Grant ismét szólt: – A cső egy kerek... talán tudok főzni neked valamit. Füst szállt belőlük a nyirkos levegőbe. – Bravó. Benzinszaga van. – Nem tudnál legalább egy percig békén hagyni? – kérdezte ingerülten a kisfiú. oda. van valami idebenn! A kislány suttogott. – Félek. hogy beindult. – Alan? A rádió süket volt. hogy a tűzhely be van kapcsolva? – kérdezte a kezét elengedve Lex. – Még mindig ragaszkodsz a fagylalthoz? – Megmondtam. – De azt jelenti. – Megvan. amíg. ahol a műanyag cső betorkollik. Csavard ki. és végig irányítlak. fekete hengerbe fut be. hogyan állítsd helyre a rendszert kézi vezérléssel. – Sok kis kék lángot látok. amely azt jelentette. Lex az acél munkaasztalnál állt. – Szelepet? – Ki kell állnia felül. Tim a konyhaajtóhoz lopózott. és belépett a konyhába.. – Ezért nem indult a szivattyú. kinyitotta. Alan! Nagyszerű voltál! – Jó. Acélajtaján széles. Alig lehetett hallani is. nem? A következő hűtőszekrény igazán hatalmas volt. – Oké. Várj. mint valami üzemanyag-szivattyú. Tompa. zakatoló hang. – Hogy lehet. ami úgy néz ki.. – Neked keresek fagylaltot! – Timmy. majd elnémult. vízszintes fogantyú.. csak fagylalt nem.. A hang csendesen emelkedett és süllyedt. hogy a generátor gyújtani próbál. rengeteg égővel. Megrántotta. olyannyira. . egy kis forgatható fémkupakkal. Nagy.– Jó. a levegője metszően fagyos.de már folyadék jön. Alan? – Igen. Hátrafelé nézett. és járni kezd.. – Menj vissza a vezérlőbe. és kilesett. Valóságos szoba. majd kattog egy-kettőt. A készülék egy utolsót sistergett. – Oké. – Azok jelzőfények. – Szóval most az következik? – Az. mint valami nagyon nagy kígyóét. Zárd le a szelepet! – Wu a fejét ingatva Muldoonhoz fordult. – Timmy. hogy nem az. aztán megszólalt az egyenletes. Aztán sietve kihátrált a hűtőből. sziszegő hangot hallott. – Úgy tűnik. de most mi van? – kérdezte Grant. Keress egy kis szelepet a tetején. – Még csak a lámpák sem gyulladtak ki itt. de valami okból nem megy. – Kerülj a generátor hátuljához. ahányszor kinyitott egyet.. zöldség halomban. – Oké – mondta Grant. ahogy a generátor megfordul. – Nem érdekes – mondta Tim.. hogy az ajtó széleit ragyogó zöld füst veszi körül. ahogy a motor felköhög. hal – minden. Tim kinyitotta az étterem végében lévő lengőajtót. – Rövid szünet. Tim elkezdte nyitogatni a hűtőket. hogy Tim először fel sem fogta a szavait. – Most próbáld meg újra a gombokat! Egy pillanat múlva Wu hallotta. nem a tetején. rozsdamentes acélból készült asztal a helyiség közepén. és újabb hűtőszekrényt nyitott ki. Alan? – Itt vagyok. s látta. – Levegő jön belőle. hogy csak a szél. – Oké. élettelen volt a hangja. balra nagy tűzhely. mögötte pedig hatalmas. Embernagyságú mélyhűtő volt. – Timmy – suttogta a kislány. jelentkezem. a konyhaajtó felé. Még az is lehet. – Elindult! – jelentette Grant. – Pontosan az is: üzemanyag-szivattyú.. A fiú halk. hússzeletek egymáson. akkor várj egy pillanatig – kérte Wu. járható hűtőszekrények. – Az a jó. – . – Ha odaérek. De oldalt van. – Nincs bekapcsolva.

. ami mind csak fokozta az állat madárszerűségét. jól boldogul. Innen. parancsolóan suttogta: – Nem mozdulsz! – Aztán a fagyasztószekrényhez futott. Tim legalább annyira félt az átható. szabályos rendben álltak a szögletes. A velociraptor újra előrenézett. Nehéz volt ebben a sötétben visszatalálni. foltos mintázatot a hátán. mint az éles fogsoroktól. Ilyenkor gyors. hogy még valami mást is hall az épületben a generátorzajon kívül. Megtalálta a hússzeletet! . az ereje hihetetlen.. míg meg nem győződött róla. A szagukat követné? Minden könyvben az áll. Csendesen letette az első szeletet a padlóra. kutató tekintettől. úgy tűnt. gondolta. és visszasietett az ajtóhoz. Időről időre lehajolt. A nagy szemek forogtak csontos üregükben. Tim nem válaszolt. Tim addig figyelte. s megint ide-oda rebbent. Még mindig nem takarja semmi. és a másodikat is letette. de nem volt ideje. – Hol van?! – kiáltotta Grant. A gépház sötétjében Grant a csövek mentén tapogatózva igyekezett vissza a létrához. a sziszegő légzés. s nézőjén át látta. De közben már érezte a nagy sárkánygyík penészes szagát. Tim csak a felső törzsét látta. zöld alakokat látott mozogni a sötétben. fejét ide-oda kapkodta. A sarokban az asztal alá nyomta a húgát. Valahogy még rémisztőbb volt egy konyhában szembenézni egy ilyen szörnyeteggel. De hát különben is: mit érnek a könyvek? Ez itt az igazi! És jön felé. feltárva borotvaéles fogsorait. majd a negyediket is. madárszerűen kapkodta a fejét ide-oda. közelről a velociraptor még a tyrannosaurusnál is sokkalta ijesztőbb volt! A tyrannosaurus óriás volt. néma ragadozó madár! Sötét volt az étkezőben. de a raptor nyilvánvalóan elég jól látott ahhoz. – Itt – válaszolta Gennaro. Látta a világító.. az asztal alá süllyedt. az asztalok alá engedve fejét. Rosszabbul lát. hogy elrejtőzzék: a feje és válla az asztallap fölé emelkedett. A kisfiú megdermedt. A létrához ért.. aztán néhány lépést hátrált. egy nagy hulladéktartály mögé. Tim érezte.. Kiáltozó emberi hang! Mintha Gennaro lett volna az. és fülelt. és már elindult rajta felfelé. hogy Lex kikukucskál a szeméttartály mögül. hogy egyenletesen haladjon előre. A két mellső végtag szorosan a test mellé szorult. Gigászi. hogy a dinoszauruszok szaglóérzéke gyenge volt. hogy a velociraptor a konyha felé közeledik. Tim számára dermesztő volt a csend. mint valami szellem – csak sziszegő légzése hallatszott – ott lopakodott egy velociraptor. s a nagy fej óvatosan körülpillantott. a hosszú egyenes farok pedig lecsüggött. A sziszegés felerősödött. szimatoló hangokat hallatott. közben egyre beljebb hátrált a konyhába. gondolta Tim. Grant semmiféle teherkocsit sem látott. Közöttük pedig. A velociraptor éberen figyelt. Lassan lehajolt. némán. és farkasszemet nézett vele. s a generátor zaja valahogy zavarta a tájékozódásban. Ez az óriás méret. a karmok lefelé himbálóztak. Itt sötétebb van. és keményen. Csillogó. hogy a szíve majd kiugrik a helyéről. Nézőjén át látta. Jobbra-balra tekingetve közeledett. és feléfordult. A velociraptor lekapta a fejét. de ez. feltűnően gyors és intelligens. amint a dinoszaurusz némán ásít. A velociraptor embernagyságú.Az elsötétített étteremben szép. A velociraptor tisztán láthatta őt. Összehúzott szemmel igyekezett kivenni valamit a sötétben. Aztán megpillantotta a teherkocsit. Lex! Úgy látszik. és csupa erő. A velociraptor megállt. majd a karmos mellső láb megragadta az ajtót. Ezért még óvatosabb. ez az orrfacsaró bűz. Tim lassan leengedte a testét. Lerakta a harmadik szeletet. Felkapott egy maroknyi hideg hússzeletet. Visszaugrott a konyhába. valahogyan érzi a szagát! Tim szíve dübörgött mellkasában. Az állat szaglászott. Előbbre lépett. amikor rájött. Tim félig guggoló helyzetben állt a helyiség végében. Aztán a fej éberen felcsapódott. de nem különösebben okos. Közel hajolt hozzá. mint odakünn az őserdőben. A szeme sarkából lesett. az asztal távolabbi lába mellett. zöld asztalok. bár izmos lábait és farkát eltakarták az asztalok. Járás közben a fej fel és lefelé is mozgott. – Van valami ott kinn? – kérdezte Lex.. A velociraptor megállt a konyha ajtajában. Csak nem mozdulni! A velociraptor moccanás nélkül állt a konyhaajtóban. mint egy madáré. és egyenesen Lex felé vette az irányt. Grant megállt. A velociraptor két méter magas volt. És szaglászott. – A teherkocsiban.

Újabb szippantás. – Gyerünk! – mondta. Felfedezte a harmadik hússzeletet. – Van egy pöcök. közvetlen közelből.. Eltűnt a fej. teljes súlyával a mélyhűtő ajtajának vetette magát és rácsukta az állatra. Már a fagyasztószekrény nyitott ajtajánál volt. Tudta.. még kinyitja az ajtót. nem megy be. Bele a lyukba. csapdát sejt. Tim akaratlanul is hátrább lépett ijedtében – és a farok eltűnt! Tim bevágta az ajtót. úgy hallgatta a rágcsáló-ropogtató hangot. A velociraptor most már igen gyorsan haladt. Szaglászott. veri az acélt.. Az egyik óriáskarmú láb felemelkedett. az asztal alá nézni. miközben a csapszeget keresi a kezével. csak most ne. hogy a hús nem él. Miért nem ette meg az állat a második hússzeletet? Tucatnyi indok suhant át a fiú agyán. és hallotta a zár kattanását. majd le. egy kis fémláncon. pontosan érezte a kislány rettenetes félelmét.. szörnyű vérfagyasztóan erős volt a hangja. Csend. A velociraptor szippantott. ahogy apránként kapkod a levegő után. „Megtalált! – gondolta Tim. lekapta a fejét. s ha a raptor eltalálja. Tim egyetlen dologra összpontosított. Becsukódott! – Lex. felnyúlt a sötétben. – Felülről dugd be! Felülről! A kislány újra feltartotta. aztán a merev farok is. de ellenálltak.. kinyílt! – de az állat nem számított erre. Egész testével az ajtónak rontott. amint felemelkedik. szinte szuggerálni próbálta húgát: „Lex.. Az rácsapódott a farok végére! Nem akart csukódni! A velociraptor felüvöltött. hogy az állat képes legyen kinyitni az ajtót. és ment is tovább. guggolásba merevedve. s ekkor a velociraptor az ajtónak vágódott. megérinti az övét. és egyenesen Timre nézett. s így Tim újra becsapta. – Megvan! – sikította. – Nem látok semmit! – kiáltotta Lex. átlendítette a fogón. . amely az állat lába felé kúszott a padlón. A súlyos fémsarkak minden rohamnál nagyot nyikordultak. újra felnézett. majd a test. felemelte láncán. Kézen fogta a húgát. gondolta Tim. A dinoszaurusz alig egy-két méterre volt tőle.. Túl nagy a hideg. – Úristen. hogy zárva tartsa. s Tim csak ekkor fogta fel. Nem tetszik neki.” A velociraptor megszagolta a húst. és az kinyílt. pásztáz a teremben. és továbbhaladt. hogy előrenézzen. de nem mert. A dinoszaurusz bement. Gyorsan előrement. hogy a raptor az ajtón dörömböl. hogy levegő után ne kapjon ijedtében. Hallotta. A száradt vért a „kéz” karmain. Meglelte a második szeletet. Nem szereti hidegen. Hangját tompította a vastag acél. Bezárta! A velociraptor ordított. Merev. ahogy a hüllőszem forog. egy csapszeg. és a lyukba nyomta. – Itt van! – Nem látom! – sikította a kislány. Tim felpattant. A raptor nem ette meg. Tim most már nem tartotta valószínűnek. Lex! – kiabálta. és már visszafordult az újabb rohamhoz. majd némán visszaereszkedett.. kérlek. s az állat folytatta útját az ötödik hússzelet felé.. amint az állat újra meg újra nekirontott belülről. Nem fog bemenni. Az kicsúszott. de nem mozdult. Tim lába már fájt a guggolástól. hogy csak rajta van néző. az állkapocs alatt. könyörgöm. – Mit akarsz? Tim a vízszintes fogantyúnak feszült. Tim és Lex hátrált az ajtótól. s így. A fej felemelkedett. Látta a lábszár izmainak apró rándulásait. s a bőrredőket a nyakon. – A csapszeg az ajtó fogantyúja mögött lóg.. Nézte. Felkapta a fejét. túl hideg van. Megmarkolta a csapszeget. hogy van egy lapos acélgomb odabenn. nem megy be. A raptor be volt zárva! Óriásit sóhajtott. Nem ízlik neki a marhahús.Tim szeretett volna lebukni. Tim alig tudta megállni. és futásnak eredtek. – Tapogasd ki! Látta a húga kis kezét. mint egy oroszlán. érzi Lex szagát. csak most ne mozdulj. mint egy rudacska add ide! A velociraptor bömbölt. Lehajolt. – Végem!” Aztán a fej hátrarándult. Tim szagát. és körülnézett. mindenestül! A raptor felemelte keskeny fejét. Ott állt. meglátta Timet. A dinoszaurusz habozott. olyan. Tim a lélegzetét is visszafojtotta. Tim látta a kitóduló füstöt. A dinoszaurusz eszi a húst! Csontostul. Látta az árkok finom mintázatát a foltos mintán belül. Lex visszatámolygott. nem megy be. Rá kell zárni valahogy! – Lex! A kislány ott volt mellette. feszült volt az egész teste.

az ajtó meg nyitva. és Wunak kezdett olyan érzése támadnia. méghozzá nem is akármilyen erővel. – Ellie! Befelé! Jöjjön azonnal! Az értetlenül nézett rá. mint annak idején. Szinte már úgy látszott. és csak vártak. valahogyan mégis nyugtalanságot ébresztett benne az állatok viselkedésének makacs változatlansága. és odabenn van – mondta Grant. egy antik faliórát próbál javítgatni hozzáértés nélkül. mert sérült volt. s végső soron megválaszolhatatlan. amelyik megtámadta? – kérdezte Grant. Wut valami egyszerűen kirántotta az ajtón. hasonló ahhoz. – Legalább kéttucatnyian voltak. s az intelligens állatok hamar beleunnak az ismétlődésbe. hogy egy enzim visszatartásával függővé tesszük az állatot valamilyen étkezési elemtől. Egyfajta barkácsolás volt az egész. egyenesen következett belőle. Ezenkívül pedig az intelligens állatok terveket alakítanak ki. kint pedig Ellie sikolya hallatszott. vissza a bejárati ajtóhoz. Senki sem tudhatta. hogy Wu ott áll. hiszen a DNS-nek a viselkedés a másodrendű hatásai közé tartozik. ahogy az ember. ami nem él. a maguk korában? Nyitott kérdés volt ez. hogy ezután jobban jár-e. Gondolom. Elmentek. – Dögevők – mondta Grant. Nincs olyan. Olyan precizitással alkotott újjá egy több millió éves élőlényt. például úgy. Múltbeli dologgal kellett foglalkozni. Nem is lehet igazán megjósolni. s éppen szóvá akarta ezt tenni. Sohasem volt biztos benne – a legkevésbé sem lehetett biztos –. hogy él. – Csak egy perce – mondta Harding. – Tudom. amely ősi anyagokból állt. amikor látta. jöjjön! Muldoonnak sehogy sem tetszett. és ősi szabályok szerint működött. Csak az efféle viselkedési zavarok hatására tért vissza a tervezőasztalhoz. hogy Wu a hátán . – Mi történt azzal a raptorral. ugyanúgy ahogy először Ellie az övéket. Muldoon a lábába lőtt. Felfelé mentek a létrán. – Nem tudom – felelte Gennaro. hogy Wu helyesen rakta össze a mozaikdarabkákat. Be kellett másznom a teherautóba előlük.– Ezt látnia kellett volna! – mondta Gennaro. Régóta folyt ez már így. Lehetetlen. Wu kitárta a bejárati ajtót. hogy túlságosan is rég. sem befolyásolni. aki igazit egyet az órán. Vajon tényleg úgy viselkednek-e. – Jó lesz behívni! A raptorok már nincsenek a tetőablakon. Minden rendben. voltaképpen igazolta a munkáját. – Elment? – Én nem láttam. És ez így is volt rendjén. Nem láttam. mi történt. És csak a durva viselkedési hibákat próbálta korrigálni: ha az állat képtelen volt távol tartani magát az elektromos kerítésektől. De. hogy egy árnyék ereszkedik le a magasból. legalábbis mozdulatlan. és. Még mindig játékosnak tűntek. megfelelően alakul-e az állatok viselkedése.. én azért tudtam meglógni előle. Egy szaporodó állat azt jelentette. mint a keselyűk. vagy sebesre dörzsölte bőrét a fatörzseken. ráadásul pedig már korábban is időtlen idők óta javítgatták. Általában azonban a viselkedési hatások ma még egyszerűen kívül esnek a megértés határain. Wu is különféle kiigazításokat hajtott végre. aztán megfigyeli. vagy sem. Harding jött ki a folyosóra Malcolm szobájából. De amikor maga idejött. hogy az még önmaga reprodukálására is képes! Most azonban. Ott ültek. miért éppen úgy működik. – Semmit sem támadnak meg. mintha fordult volna a kocka. A tudománynak e korlátai azonban valamiféle misztikus hiányérzetet hagytak benne a park dinoszauruszaival kapcsolatban. – De hisz nincs semmi baj. hogy megdöglött. folytatták áltámadásaikat Ellie ellen. mintha most ők próbálnák Ellie figyelmét lekötni. míg idebenn volt. s látta. hogy a raptorokat figyelte odakinn. hogy az ember ránéz a DNS-szekvenciára. – De az is lehet. Azt hiszem. elszaladtak.. – Igen? Mikor? – kérdezte Wu az ajtó felé indulva. csak igen durva módon. ami mozog vagy erősnek látszik. – Hol van Ellie? – Még mindig odakinn. a hétszentségit. az a felfedezés. – Azonnal! Ellie megrázta a fejét.. Kompik.. A dinoszauruszok viselkedése Wu számára mindig is másodlagos kérdés volt. vagy majdnem halott. mit teszek! – Ellie. hogy bizonyítottan életképes. A raptorok intelligensek voltak. mondjuk. Csak annak mennek neki. S bár ezt Wu sosem ismerte volna el. és abból megjósolja a viselkedést. Mint a szerelő. Wu a kastély folyosói ablakán át nézte a kerítésen kívül futkározó raptorokat. kilesett. Muldoon az ajtóhoz rohant. ahogyan. utána pedig figyelte. és azonnal megértette. Lehet. Teli volt velük a szélvédő. Így aztán Wu munkája teljes egészében empirikus jellegű lett. miközben Grant kifelé vezette a gépház épületéből. Vérzett is. hogy az állatok viselkedése történetileg pontosan megfelel-e a valóságnak. hogy a dinoszauruszok szaporodnak. igazítgatták az evolúció erői.

Ajtó volt a tetőn: bejuthat az épületbe! Egyetlen óriás lendülettel a levegőbe vetette magát. Fenn van a tetőn. míg eufóriáján áthatolt. amely betöltötte. ami következik. és a ködbe meresztette a szemét. aztán a tető másik széle felé futott. tudta. megfeszítette hasizmát. Összehorzsolta az arcát. Megpillantotta az úszómedencét. és látta. amikor a fa tövénél feltűnt az első állat. amint elrohantak mellette. a raptor pedig a fejét kapkodva rángatja Wu beleit. A raptorok közelebb kerültek hozzá. vágtatott a tető pereme felé. hogy. de a raptorok még mindig követték. hogy ezek az állatok végezni fognak vele. nyúlt és húzódzkodott. Inkább egyfajta örömmámor töltötte el. s nincs út lefelé. testét már feltépte a hatalmas karom. Az a fejét rázta: nem! Grant közel hajolt hozzá.fekszik. gondolta. Az épület hátsó végéhez futott. s valahogy elhinni sem tudta. mit is jelent ez. A raptorok lassan közeledtek felé. amint a raptorok a fa ágait rázzák. elgyengült kezével még mindig a nagy fejet próbálja eltolni magától. a tetőablakok piramisait. A két raptor felé mászott a nyomában a fán. ő azonnal sarkon fordult. mint a saját lihegését. és az üregbe vetette magát. és futott. de nem volt. Egy pillanat múlva a testük is felvillant. pedig az még él. hogy az állatok üldöznék. Közben hallotta a háta mögül. hogy túl messze van. a ködbe nyúlva. és gyorsan felhúzódzkodott. a látogatóépület felé. Semmiféle pánikot nem érzett. és Wura támadtak. Zárva van az ajtó! Kétségbeesetten dörömbölt az ajtón. Némán lopakodtak az üvegpiramisok közt. és nekifutott. amelyen lemászhatna. Kezdtek eltávolodni egymástól. és elforgatta a gombját. Zárva volt! Eltartott egy pillanatig. majd egy magasabban lévő ág köré kulcsolta. Rohant. közelednek. hogy a kerítésen kívül három raptor futva távolodik. Feltápászkodott. Muldoon pedig a borzalomtól szédelegve becsapta az ajtót. Ellie hátrált. Amikor a raptorok a kerítésen belül levetették magukat. nyúlt és húzódzkodott. egészen a tető hátsó végéig. és futásnak eredt a kerítés mentén. nem hallott mást. hogy gondolkodjék. de valamiért még mindig a mámor volt az egyetlen érzés. s már szinte látta az épület tetejét. Látta. Az ablakhoz ment. A raptorok felmordultak. Megkerülte az épületet. Visszafelé tartottak. és a fülébe súgta: – Nincs más választásunk! Be kell kapcsolnunk a komputert! Grant eltűnt a ködben. Megkezdődött a vadászat. aztán mély lélegzetet vett. kit érdekel?. Az ajtó zárva. Sehol egy másik fa. ahogy csak bírt a kastély távolabbi vége felé. Ellie gyorsan folytatta az útját felfelé. Úgy tűnt. és azonnal ugrott. Annyira gyorsan történt minden! Harding szólalt meg mellette: – Leugrott a tetőről? Muldoon bólintott. elkapott egy ágat. Véres volt a pofája. Grant elérte a gépház szélét. Túl nagy ahhoz. . s a lépcsőházba nyíló ajtó felé rohant. amint a raptorok könnyedén leugranak a tetőre. hátha onnan le lehet jutni valahogy. de az állat élve ette őt. aztán elterült a salakon. még mindig benne volt a mámor. s csak a győzelem volna a tét. Ellie rohant. Sehol egy tűzlétra. De nem Ellie-t követték. inas húsdarabok lógtak az állkapcsáról. Négy méterre volt a talajtól. és a magasba lendült. és távolabb. Alig másfél méterre magától látta a salakot. hogy ott is van egy ajtó. kinézett. Szóval még a fán vannak! Odaért az ajtóhoz. mintha csak valamiféle játékról volna szó. A medencét betonburkolatú sáv vette körül. Visszanézett Gennaróra. Egyszerűen nem hitt abban. Ekkor megint lenézett. Fogás jött fogás után. Túl messze. Az lehetetlen! Puha kabátként ölelte körül valami védelmező jókedv. aztán Ellie abbahagyta a sikoltozást. Hallotta a raptorok morgását. Három vagy négy méterre volt tőle az úszómedence. amint felrúgta két lábát. Egy pillanat múlva követte Gennaro is. reménykedve. hogy így ér majd véget az élete. amely a ház oldalánál nőtt. Nem hallotta. de csak az úszómedence zöld körvonalait látta fel-feltünedezni a gomolygó ködön át. megpillantott egy fát. Ellie lenézett. Sehol semmi! Ellie visszafordult. s már kezdett megnyugodni. átugorja. Ellie meg sem állt. Ellie most a háztető szintjére ért. A látogatóközpont felé tartottak. Ellie-nek – teljesen logikátlanul – az járt az eszében: Hát nem mindig így van? Valami apróság mindig közbeszól! Még mindig szédült egy kicsit. Három-négy méternyi beton. Talán öt méter széles volt a sáv az épület és a kerítés között.

Gyorsan kimászott az úszómedencéből... – Juj! – sikított fel Lex. Nem lehetett kérdéses: ha neki sikerült. míg felfogta. de borzasztó! – szólt Lex.. a megdöbbenéstől szótlanul ment egyenest előre. Vezérlőasztal a szoba közepén. mint a krokodilok. és minden erejét össze kellett szednie. négy székkel és négy számítógép-monitorral. A következő pillanatban a karmos mellső végtag átcsapott az ajtó széle körül. és jeges hideg ölelte körül. ütés. – Most azzal ne törődj! PARKFELÜGYELŐ. – Hát hol van itt rádió? – kérdezte Lex. Fémes kattanással csapódott le a zár. Köd gomolygott az üvegpiramisok körül. – Tim a kiragasztott feliratokat nézegette az ajtókon. Harding pedig köhögve a padlóra omlott. – Hova megyünk? – kérdezte Lex. Aztán hallatszott. Aztán elhallgatott. Ezért fordultak meg a raptorok. Aztán csípős csattanás. – Ellie! Annyira lefoglalta a gondolatait Ellie Sattler. – A vezérlőbe – mondta Tim. Lentről hallotta.. A látogatóközpont második emeletén jártak.. hogy tudnak. és most őt vették célba.. REVÍZIÓ. Hívnunk kell valakit. – Ne törődj vele! – Tim visszafordult a monitorokhoz. Távolról felhangzott a raptorok morgása.. Üvegből készült válaszfalhoz értek. Üvegfalú folyosó futott végig az épületen. – Hogy lehet az. – Ott vannak.. és arrébb lépett. mint akkor. – Ügy látszik van már áram. amikor végigvezették őket az épületen. A raptorokat nem lehetett látni. IGAZGATÓ. A víz alatt volt. A vezérlőterem ugyanolyan volt. – Juj. Látnia kellene az állatokat!. amelyeken mind egy-egy sor színes négyszög világított.. Hátranézett. – Az hol van? – Itt valahol... A raptorok lenéztek rá. hogy Muldoon kiabál: – Már bent van! Idebent van! A raptor dühödten morgott az ajtó túloldalán. Tim nem látott emberi testet sehol. míg elhaladtak mellettük. és mellbe találta. – suttogta Lex. Harding még egyszer becsapta az ajtót.. de Tim egyszerűen benyomta az ajtót. – Mi van? – A fülén álltam valaminek – mondta a kislány. – Minek megyünk a vezérlőbe? – kérdezte az.. Ám a raptorok egyszer csak elfordultak a tető peremétől.. Az üvegajtón túl folytatódott a folyosó. mikor beléptek. és látta: csak egy fül hever ott magában. A képernyőkre meredt. Irodák lehettek: FŐÁLLATŐR. melyen ez állt: ZÁRT TERÜLET BELÉPÉS CSAK ENGEDÉLLYEL Ott volt a biztonsági kártyák számára készült nyílás. hogy hátra tudjon húzódni. és fellesett a tetőre. Teljes sötétség honolt a szobában. MŰVELETIRÁNYÍTÁS. Sikerült! A felszínre emelkedett. Tágra nyílt szemmel. – Rádiót keresni.. Látta már. és a kastély felé rohant. hogy az állatorvos most nyitotta ki a tetőajtót. amint nekicsapódnak az üvegnek odalenn. Gyorsan úszott. Mintha közeledtek volna. Belökte az ajtót. a monitorokat kivéve. hogy kinyílt? – Nincs áram – emlékeztette húgát Tim. és gondolkodás nélkül kitárta a tetőajtót. Be vannak kapcsolva! Ez csak azt jelentheti. de későn.. hogy beletellett egy pillanatba. amikor utoljára látta. Lex igyekezett lépést tartani vele. – Ez az! – szólt Tim. s közben ezen gondolkodott: Tudnak-e úszni a raptorok? Szinte biztos volt benne. FŐ VEZÉRLŐ. mekkora hibát követett el. odakinn. Biztosan úgy úsznak.. .És zuhanni kezdett. jutott eszébe. Tim emlékezett erre a részre. – Ne izgulj! – Mit keresnek itt? – kérdezte Lex. – Ellie! – kiáltotta. fröcskölte a vizet.. Hardingnak pedig végre sikerült becsuknia. a raptorok könnyen utánacsinálhatják. Harding kettesével vette a lépcsőfokokat.. De Tim már rég megfeledkezett a rádióról. VENDÉGSZOLGÁLAT. Parázsló fájdalom hasított a testébe.. Harding hangja hallatszott – Ellie? – és Ellie azonnal megértette. mire a karom visszahúzódott. és rácsukja az ajtót a karomra.

És szinte mindig volt egy „HELP”. Távoli rádiórecsegést hallott. hogyan ugranak a raptorok vicsorogva újra meg újra a látogatóépület üvegfalának. mint a fűtő. Színes címkesorok álltak a képernyőn: ŐSLÉNYPARK – RENDSZER INDUL INDÍTÁS AB(0) Biztonság Fő SetGrids DNL Kritikus zárak Kontroll Áthaladás Monitor Fő View VBB TeleCom VBB TeleCom RSD Parancs Fő Belépés TNL Reset Revert Eloszt. Itt azonban nem volt ilyen. nem fogok. mintha valami távoli zaj után hallgatóznának. De a morgások között azonban időről időre elnémultak. – Mi az ördög folyik ott?! – szólalt meg Muldoon hangja. s a raptorok egyszerre izgatottabban kezdtek ugrálni. – Úgy tűnik. most ne azzal törődj! Hunyorogva alaposabban szemügyre vette a monitort. Tim rájött. azaz segélykérő jelzés is arra az esetre.. Látott viszont valami mást: az ernyő bal felső sarkában számok futottak. Azért még egyszer megnézte. – Mondom. nyöszörgő hangokat hallottak. . – Mit csinálnak ezek? – kérdezte Gennaro. – mondta egy kissé tétován Grant. aztán eltűnt az épületben. Légköri rádiósercegést hallott. én vagyok. – Be tudnak törni az üvegen át? – Nem. – Halló? Halló? – . – Add ide azonnal! – Ez az enyém! Én találtam! – Add ide. Most éppen 10:47:22 állt ott. – Nekem nem akar szólni. Grant visszahőkölt.. csak könnyebb volt megérteni őket. s félrebillentették a fejüket. Tim látott már bonyolult számítógépeket. hogyan verik bele minduntalan a fejüket. FNCC Params INDÍTÁS CN/D Hidraulika Fő Ajtók Interface GAS/VLD Fő II Robbanás Tűzveszély Mester Fő SAAG Rnd Közös Interface Séma Fő Zoolog. mígnem végül az emeleti balkonon landolt. – Nyugi. és a gombokat nyomkodta. ha az ember meg akart tudni valamit a rendszerről. mint ez – egy csomó színes címke –. Ott gépek vezéreltek mindent: a lifteket vagy a védelmet éppúgy. hogy ennyi az idő. amelyeken az apja dolgozott. – Hogy működik ez? – kérdezte. Az emeleti vezérlőben Tim felkapta a rádiót. s látta. hogy megbizonyosodjék róla.. Csavargatta a tárcsákat. Lex! – Én akarom előbb kipróbálni! – Lex! A készülék váratlanul megreccsent. Megfordult. melyet Lex leejtett.vagy az. és lekuporodott a pálmafák közé.. például azokban az épületekben. Lényegében ugyanúgy néztek ki. nem hiszem. Egyik a másik után ugrott egyre magasabbra és magasabbra.és hűtőrendszereket.– De kié lehetett ez? Hol van belőle a többi? – kérdezte a kislány. Timmy! – szólt rá Lex. Már csak tizenhárom perc van hátra a hajó kikötéséig – de e pillanatban jobban izgatta a kastélyban lévők sorsa. be akarnak törni a büfébe. hogy a húga rádiókészüléket tart a kezében. Benyomta a gombot. Tim? – Igen. A gomolygó ködön át látta. Aztán halk. Lex ijedtében elejtette a rádiót. – Miért. Fő Elektromos Fő Fűtés Hűtés Vész Világ. Grant figyelt. mi van ott? – Ott hagytam a gyerekeket. Fő Javítás Raktározás Státus Fő Biztonság/ Egészség – Szerintem ne nyúlj hozzá.

Timmy – mondta a húga. Muldoon bácsi? Senki sem tudja? – Hihetetlennek hangzott. mindent alaposan megnézett. – Azt hiszem.. hogyan kell bekapcsolni a komputert. Tim? Tim a képernyőre bámult. amilyen volt. – Akkor akár meg is próbálkozhatsz vele – mondta Muldoon. – Akkor megpróbálom. – Fogalmad sincs az egészről. Kikapcsolta a rádiót.. Megérintette a képernyőt.. Tim megdöbbent.. És Grant sem ért hozzá. újrakezdést jelző REST/REVERT feliratú négyzetecskét. Aztán más billentyűket is leütött.. s a képernyőn ismét teljes egészében ott volt az eddigi kép. – Mondd. – Úgysem tudja itt senki. mit kell csinálni! – De tudom. Tim megnézte a képernyő széleit. – Ha valaki elmondja. Újra vizsgálgatni kezdte a komputert. valami főhálózatról van szó. és színes. – Timmy! – szólt rá Lex. – Valami van. Megérintette a visszaállítást. INDÍTÁS CN/D Hidraulika Fő Ajtók Interface GAS/VLD Fő II Mester Fő SAAG Rnd Közös Interface Séma Fő Zoolog... Vörös pontocskák körös-körül. Megérintette a képernyőt! Érintésre működik! Azok a vörös fények a képernyő peremén nyilván infravörös érzékelők. mire sípoló hang hallatszott. mi a tennivaló. FNCC Robbanás Fő Params Tűzveszély Az üzenetet közvetítő négyszög néhány pillanat múlva eltűnt. Ugyanott helyezkedtek el rajta a funkcióbillentyűk. Halvány visszfények jelentek meg rajta. Csend volt. és lenyomta a kurzorbillentyűket. én megcsinálom.– Hol vagy? – A vezérlőteremben. – Nem is tudod. Van áram! – Ez remek. Mi lehet ez? Ujját a képernyőhöz közelítette. A főhálózatot kell bekapcsolni. akkor rajta! – Várj egy kicsit! – Kezdetnek odahúzta a széket a billentyűzethez. de már olvasott róla a képeslapokban. hogy kell. és sok halvány. Tim eddig még nem látott ilyen monitort. – Halló! – mondta Tim. a képernyő pedig nagy volt. Vizsgálgatta. – Ha tudod. szóval. tűhegynyi vörös fénypontot vett észre rajta.. Azonnal változott a kép. – Valami nincs rendben – szólt Tim elgondolkodva. – Tetszettek hallani? – Hát sajnos ezzel gondunk van – mondta Muldoon. – Senki. – Szünet. Tim. Nem kapott választ. – Nem. Ezek mozgatják a kurzort ide-oda a képernyőn. – Igen – felelte Tim. Timmy! – mondta. – Oké – egyezett bele Tim. – Viccelnek. – Mit csináltál? Hozzányúltál valamihez! „Hát persze!” – jött rá Tim. A képernyő maradt. hogy nincs. Új válaszüzenet érkezett: . aki itt van. és a képernyőre meredt. Neked van valami fogalmad számítógépekről.. – Na? – kérdezte Lex. – Mi történt? – kérdezte Lex.. Fő Javítás Raktározás Státus Fő Biztonság/ Egészség ÖN MÁR BELÉPETT válaszon a főábráról Eloszt. Tim! – mondta Muldoon. A monitor háza azonban szokatlan volt valahogy. De nem történt semmi. ŐSLÉNYPARK – RENDSZER INDUL INDÍTÁS AB(0) Biztonság Fő SetGrids DNL Kritikus zárak Kontroll Áthaladás Monitor Fő View VBB TeleCom VBB TeleCom RSD Parancs Fő Belépés TNL Reset Revert Elektromos Fő Fűtés Hűtés Vész Világ. nem tudja. mint bármely személyi számítógépen. Mármint bekapcsolni a gépet. Lex bökdöste. ööö.

egy beállítás azonban egy rövid ideig a kastélyt mutatta kívülről. aztán egy másikon hirtelen egy hajó orra látszott vakító napfényben. amely a szafarikastély külső képet mutatta. egy raptorral a tetőn.H Monitor Interval Monitor Control Optimize Sequence Rotation Specify Remote Camera Set Auto AO(19) Hold Man DD(33) REMOTE CLC VIDEO .. Televíziós képek jelentek meg körös-körül a monitorokon. és a hajó partot ér. Tim többször egymás után megérintette a képernyőt. – Nem próbálom. SUBROUTINES – VIEW VIDEO INTERFACE ENVIRONMENTAL VATCH REMOTE CLC VIDEO . mellette Ellie állt. előtte az óceán. – Micsoda? – Hát az a kép az előbb! De addigra a hajó már eltűnt. A figyelmét azonban most a másik képernyő ragadta meg. – Látni szeretnék valamit – jelentette ki Lex. – Hagyd. Megreccsent a rádió. aztán az ágyban fekvő Malcolmot. – De sikerült! – vitatkozott az. helységről helységre. – Nem. Tim! – Itt vagyok – felelte Tim. de csak további „almenüket” kapott. HAJÓFEDÉLZET (VND). Majd még továbbiakat. szürke ködben. A képernyő váltott. – Összezavarod az egészet! – Hallgass már! Mit tudsz te a számítógépekről! Most tűnt fel a megfigyelőkamerák listája a képernyőn. jó? – mondta a bátyja. és velük együtt ő is felfelé fordította a tekintetét.A GÉP VISSZAÁLLT VÁLASSZON A FŐÁBRÁRÓL A rádió sercegését kezdte túlharsogni a raptorok acsargása odakint. Lex! – De én akkor is a VIEW-t akarom! – követelte a kislány. hiszen csak az előző nap repült el felette a helikopteren. A képernyőn Malcolm a szájához emelte a rádiót. Az egyik így szólt: SZAFARIKASTÉLY LV2-4. Mind a ketten felfelé néztek. hol ott érintette meg a képernyőt. Az egyikben a szállítóhajó orr-része látszott. s már a kastély belsejét látták. amelyekről választhat. Tim a távolban a szárazföldet látta: part menti épületeket és egy kikötőt. A legtöbb kép homályos vagy tejfehér volt az odakinn gomolygó ködtől. Aggodalom ült mindhármuk arcán. már csak percek vannak hátra. – Minket látnak – mondta Lex. Aztán egy harmadik képernyőn egy szoba belsejébe látott. és belebeszélt: – Halló.. . – Állítsd már meg! – kiáltott Lex. A raptorokat nagyrészt eltakarták a piramisok. Az utóbbit felismerte. – A VIEW-t próbáld meg! Az azt jelenti. már meg is érintette a VIEW – betekintés – feliratú négyzetet.P Monitor Interval Monitor Control Optimize Sequence Rotation RGB Image Parameters Command Sequence – Nini! – szólt Lex.. abba. Napfény és. Egy másik meg: TÁV. – Látom őket! Tim hol itt. azt nem hiszem. listákat. – Várjál! – szólt rá Lex. Malcolm feküdt ott az ágyon. Közben Muldoon lépett be a szobába. és újra meg újra feltűnt. de a fejük fel-le mozgott. – Nézd meg! Tessék! Körös-körül a teremben a monitorok sebesen változó képeket mutattak a park legkülönbözőbb részeiről.. és mielőtt még Tim elkaphatta volna a kezét. Puntarenas! Úgy tűnt. – Hát ez meg mi volt?! – kiáltott fel Tim előredőlve.

Áthatolt az üvegen. lenézett. – Aztán Tim meghallotta a raptorok morgását. és a fogait csattogtatta. s látta.– Hát az a helyzet – mondta fojtottan Malcolm –. Timmy! – szólt Lex. Jó lenne. – Siess. hogy nagyon fogy már az időnk. – Kapcsold már be az áramot! . ha mihamarább sikerülne bekapcsolnod az elektromos hálózatot valahogy. hogy az egyik hosszúkás fej benyúlik a képbe felülről.

CHANGE. hogyan. Go AHEAD.1 b24 REVIVE INFO SYSTEMS CONNOTE Developed by Integrated Computer Systems. hát nem találta. Hátha ebben a rendszerben a „segítség” neve „info”. milyen parancsot adjon. All Rights Reserved GO AHEAD REPEAT REPORT OPTIONS TRACK DELETE COLLATE GO BACK TRIAL – Timmííííí – nyúzta Lex. – Csinálj már valamit. de sikerült. Timmy? Timmy válaszra sem méltatta. FŐ”-t. amellyel vissza lehet hozni az előző képet vagy a „főmenüt”. Inc. és elgondolkodott.A HÁLÓZAT Tim váratlanul különböző. Végre nagy nehezen visszajutott a legelső képhez. Itt azonban nem volt ilyen – vagy ha mégis.1 b24 REVIVE INFO SYSTEMS CONNOTE Developed by Integrated Computer Systems. CHANGE. Timmy! – Fogd már be a szád! Nem látod. Cambridge Mass Jurassic Park Common User Interface ESTIMTE Project Supervisor: Dennis Nedru Command:FIND FIND PRMTRS Programmer: Mike Backes SEARCH MONITOR TEST Chief FIND is a context-sensitive command. és mindennek a tetejébe Lex összevissza ugrált. Közös interface ADVISE Jurassic Park Common User Interface ORDER Version 1. OPTIONS. FIND. miközben az eredeti ábrához szeretett volna visszajutni. Megállt. A legtöbb rendszerben van egy billentyű vagy egy bizonyos parancs. teli mindenféle egymáshoz kapcsolódó négyszögekkel meg nyilakkal. de azokat sem lelte. Bonyolult diagram jelent meg a képernyőn. REVIEW TRIAL . hogy valahol kell segítségkérő parancsoknak is lenniük. a FIND-ot is benyomta. amitől ideges lett. COLLATE GO BACK See also: SEARCH. Közös interface ADVISE ESTIMTE Jurassic Park Common User Interface ORDER Version 1. See also: SEARCH. GO BACK GO AHEAD REPEAT REPORT Jurassic Park Common User Interface OPTIONS DELAY TRACK DELETE Command: GO BACK Cannot GO BACK without a specific search option. Erre a GO BACK – menj vissza! – paranccsal próbálkozott. Inc. Ezúttal megint egy hasznavehetetlen „ablakot” kapott. Abban is biztos volt. Initiate FIND © Jurassic Park. egymásból kiinduló monitorvezérlő-képek sorába bonyolódott. és kiabált. Megnyomta: INFO. All Rights Reserved at any point. hogy segíteni próbálok? Megnyomta az „ELOSZT. Cambridge Mass Project Supervisor: Dennis Nedry FIND PRMTRS Programmer: Mike Backes SEARCH MONITOR TEST DELAY Chief © Jurassic Park. – Miért nem az áramot kapcsolod vissza. Nem jó! Nem jó! Megpróbálta a „KÖZÖS INTERFACE”-et. Nem tudta maga sem. Inc. de Tim addigra már a kereső parancsot. A kép változott: Közös interface ADVISE ESTIMTE ORDER REVIVE INFO SYSTEMS CONNOTE FIND PRMTRS SEARCH MONITOR TEST DELAY GO AHEAD REPEAT REPORT OPTIONS TRACK DELETE COLLATE GO BACK TRIAL – Ez meg mi? – kérdezte Lex. Inc.

Muldoon hangja szólt a rádióból: – Hogy haladsz. a hálózatokhoz. F4. Fő Javítás Raktározás Státus Fő Biztonság/ Egészség Elmélyülten nézte a képernyőt.Megint nem jutott előre. míg rájött: ezúttal nagyon is fontos információ birtokába jutott. Hirtelen. mintha köze volna a rácsokhoz. visszajött a kiinduló főábra. Megtudta a kastély hálózatának koordinátáit! Megnyomta az F4-es számú hálózati rácsot. STANDARD PARAMETERS Parkhálózati rácsok B6-C6 Külső hálózati rácsok Zoológiái hálózati rácsok B8-D7 Karám hálózati rácsok Kastélyhálózati rácsok F4-D4 Karbant. minden előzetes figyelmeztetés nélkül. Mind az „ELEKTROMOS/FŐ”. Döntenie kellett. Fő Elektromos Fő Fűtés Hűtés Vész Világ. és kétségbeesetten felnyögött az eredmény láttán: SET GRIDS DNL CUSTOM PARAMETERS ELECTRICAL SECONDARY (H) MAIN GRID LEVEL MAIN GRID LEVEL A4 C9 B4 R5 C7 D5 D4 E3 E9 G4 STANDARD PARAMETERS ELECTRICAL SECONDARY (P) MAIN GRID LEVEL MAIN GRID LEVEL MAIN GRID LEVEL MAIN GRID LEVEL A2 C9 A8 P4 B3 R5 B1 R8 C6 D5 C8 P4 D11 E3 D8 E5 E2 G4 E8 L6 ELECTRICAL SECONDARY (M) MAIN GRID LEVEL MAIN GRID LEVEL A1 C4 B1 R4 C1 D4 D2 E5 E2 G6 Ezzel nem tudott mit kezdeni. Hallotta a raptorok acsargását. kétségbeesetten rázta a fejét. SZ: ELEKTROMOS HÁLÓZATI RÁCS (SZAFARIKASTÉLY) . FNCC Params INDÍTÁS CN/D Hidraulika Fő Ajtók Interface GAS/VLD Fő II Robbanás Tűzveszély Mester Fő SAAG Rnd Közös Interface Séma Fő Zoolog. Timmy? – Nem volt ideje válaszolni. mind a SETGRIDS/DNL olybá tűnt. Megérintette a SETGRIDS DNL-t. Lázasan nyomkodta a jelzéseket a képernyőn. hálózati rácsok A4-B5 Gyökér hálózati rácsok Áramkörök épsége bevizsgálatlan Biztonsági hálózati rácsok automatikusak C2-D2 R1-R4 E5-L6 D5-G4 A1-C1 Tim tehetetlenül. hogy a „KRITIKUS ZÁRAK” és a „BIZTONSÁG/EGÉSZSÉG” is fontos lehet. ŐSLÉNYPARK – RENDSZER INDUL INDÍTÁS AB(0) Biztonság Fő SetGrids DNL Kritikus zárak Kontroll Áthaladás Monitor Fő View VBB TeleCom VBB TeleCom RSD Parancs Fő Belépés TNL Reset Revert Eloszt. Az is átfutott az agyán. Kellett egy-két pillanat. rácsok Főhálózati rácsok C4-G7 Szenzor hálózati rácsok Kieg. Azért megnyomta a STANDARD PARAMETERS-t. mert ehhez a parancshoz konkrét keresőutasításnak kellett volna társulnia. hálóz.

Vicsorogtak. amelyet kiadott. távolodni egymástól a folyosón. majd libasorban megindultak előre. Eszerint az elektromos ellátás nem összeegyeztethető azzal a paranccsal. hogy egyáltalán nem a mélyhűtőből került elő az előző sem. hogy bekeríthessék Timet és Lexet.09-4.. Valamitől újra aktiválódtak a biztonsági zárak. Tim óvatosan kicsusszant az ajtón. ahányszor csak be akarja kapcsolni valamelyik hálózatot.09-4.) – Nem jó – mondta Lex. HIBA-505 (ELEKTROMOS ELLÁTÁS ÉS A HIBÁS PARANCS NEM ÖSSZEEGYEZTETHETŐ L. teste tökéletes egyensúllyal fogta a korlátot. kézikönyv 4. – Nézd! – A biztonsági kártya nyílására mutatott az ajtó mellett. hogy ki tudja gondolni. és rávicsorogtak az emberekre odalent. Vagy még annál is többet. A kártya segítségével kinyitotta a legközelebbi ajtót a folyosón. Hogyan juthatott ki a mélyhűtőből? Aztán hirtelen a szeme láttára feltűnt egy második raptor is az erkélyen. A hatalmas állat három métert ugrott felfelé. hogy zajt ne csapjon. De mit jelenthet ez? Mi az. A Malcolm ágya fölötti tetőablakon a raptorok már kishíján átrágták a második acélrácsot is. hogy megőrizze nyugalmát. Ez azt jelenti. o. Aztán ő is meghallotta a raptorok morgását.) Tim minden erejét összeszedte. – Nem tarthat már soká – szólt Muldoon.11 o. Be-bedugták. 4. A képernyőn újra ugyanaz villant fel: F4. Tim és Lex felé. . ott vagy? Nem kapott választ. Lex! – szólt rá. Egy sor további ajtót látott. HIBA-505 (ELEKTROMOS ELLÁTÁS ÉS A HIBÁS PARANCS NEM ÖSSZEEGYEZTETHETŐ L. de azok mellett is mind ott égett a vörös fény. Azonnal támadnak! Tim számára egyetlen megoldás maradt. és a folyosó túlvégén azonnal meglátta a velociraptort. – Azt én is tudom! Újabb gombot nyomott le. Futva indultak az őr felé. – De igenis. hogy benyomja. Ott állt az erkélynél. Úgy hevert ott. Micsoda erő lehet azokban a lábakban! Lex ezt suttogta mellette: – Pedig azt mondtad. kizártál minket! Tim végignézett a folyosón. SZ. és már rohamoztak is. Valamilyen okból ugyanazt a hibaüzenetet kapja.. ügyelve. Fehér biztonsági kártya volt a derekára csatolva. hogy nem összeegyeztethető az elektromosság? – Timmy. Befért a fejük a törött üvegen át. ide nem.. Egyszerűen felugrott odalentről! A második raptor némán landolt. A folyosó felől jöttek. – Gyerünk! – súgta. Már kezdtek is különválni. csak ne most. de nem tudta levenni tekintetét az erkélyről. Tim elvette a kártyáját. Egy őr holtteste volt. – Megnyomta a gombot a rádión. hogy minden ajtó zárva! Nincs hová menniük! Ekkor azonban összecsuklott alakot pillantott meg a folyosó túlvégén. és visszafordult. – Tim. Meg sem rezzent. ELEKTROMOS HÁLÓZATI RÁCS (SZAFARIKASTÉLY) PARANCS VÉGREHAJTHATATLAN. Fejüket ütemesen mozgatták fel-le. Tim. Az állatok egy kis ideig céltalanul forgolódtak a folyosón. Miközben lassan bezárult mögöttük az ajtó. majd visszahúzták. Gondolkodni próbált. és egyfajta ámult rémülettel nézte. Kívülről jött. és folytatták a fémrudak rágcsálását. amint szinte berepül egy harmadik raptor is. mi lehet a baj. Ám az meg sem mozdult. – Az Isten szerelmére. – Legfeljebb három-négy percünk van. – Te hülye. mint valami rongycsomó.. most! – mondta a kislány. Tim döbbenten nézte. a raptorok sziszegtek. és elálltak a vezérlőbe visszavezető utat. s a karjánál fogva elhúzta a képernyőtől meg a billentyűktől. és utánaugrott. – Sssss! – hallgattatta el a húgát Tim. – Lex a karját ráncigálta.PARANCS VÉGREHAJTHATATLAN. – Ki vagyunk zárva! – súgta Lex. és visszahúzódhassanak a vezérlőbe. lassan nekivetette a hátát az ajtónak. belökte a húgát. kézikönyv.11. Fényes vörös pont égett fölötte. Erősebben nyomta. A raptorok persze közben észrevették őket. és Tim ekkor értette meg. Tim nem hitt a szemének.

– Mint mindenki más. de a konyhaajtó nyitva állt. Órák óta csak ezt hallom: „én megmondtam előre”. Szegényke biztosan majd’ éhen hal. – Timmy! – kiáltott rá Lex. Meghaladja az értelmét. hogy igyekszik úrrá lenni a helyzeten – mondta Malcolm. plasztikcsörgő. és nem is lesznek. Soha sem voltak. Imádkozik. Tim és Lex a fehér „óvodában” voltak. azt hiszi. hogy hatalmukba hajtják a természetet. a lelkét leheli ki vele. a gyerekek pedig sehol. hogy minden szusszanásánál attól kellett tartani. ingét karmok szaggatták. hogy többé nem lesznek kiszolgáltatva a természetnek. Malcolm szólalt meg: – Rondák. a kisfiú a hátára esett. Mégis. felhangzott a raptorok morgása. a folyosóról. hogy élelmet szerezzen a családjának. hatalmába keríti majd a természetet? Dehogy hiszi. Lassan beszélt. Kétségbeesetten csiripelt. mintsem azt a ráció erejéről szőtt álmaik elhitetik magukkal. – Hagyják ezt. a természet olyasvalami. . – És Grant is! Mi lehet Granttal? Grant elérte a látogatóközpont hátsó ajtaját. a fájdalomcsillapítók ködén át. mit tud megvalósítani valaki. amely gondoskodik róla. nem lehet az ura. – Ki gondolta volna. – Én nem gondoltam. – Még mindig semmi hír? – Nem tudom. Felment a lépcsőn. Ködös tekintettel nézte a raptorokat. Csakhogy nem képesek rá. Építhetnek repülőgépet. Hammond szótlanul bámult felfelé. – Hová ment Tim? Olyan érett kisfiúnak tűnt! – Biztos. ugyanis nem képesek rá. gondolta a fiú. Grant nem tudott bejutni. Harding megmérte a vérnyomását. Senki sem akarta. A nyakához dörgölődzött. Ment tovább a konyhába. hogy így történjék. Ő van kiszolgáltatva a természetnek. Játékok hevertek szanaszét: egy sárga labda. Én kiszámítottam! Hammond felsóhajtott. Maguk viszont egyszerűen elhatározták. Ne keverjük össze a dolgokat! Készíthetnek hajót. de óceánt nem tudnak készíteni. – Miért csinálja ezt? – kérdezte a kislány. Közben egy pillanatra megállt annál az őrpultnál. Újra bekapcsolódtak a biztonsági zárak! A szentségit! Futva megkerülte az épületet. nagyon kérem. hogy megkeresse a gyerekeket. – Hiszen ez a raptorbébi! – szólt Lex. s a bébi átugrott az ő vállára. és máris nyakig ülnek a bajban. – Már megint nem értem. ahol korábban is. Kártya nélkül nem boldogult vele. – A kérdés mindig az. az erdő termékenységéhez. Ellie Sattler egy takaróba burkolózott. – Mi lehet Timmel? – törte meg a csendet Hammond. Elhatározták. amely megint csak zárva volt. s a betört üvegajtón át belépett a főelőcsarnokba. mit gondol.A KASTÉLY Ian Malcolm már olyan nehezen lélegzett. elkomorult. Az ajtó nem nyílt. hogy ez lesz belőle! – A jelek szerint például Malcolm – felelte a szónoki kérdésre Ellie. Úgy gondolja. – Téved – mondta Malcolm. Pergamenszerű hüllőbőr érintette Tim arcát. Muldoon a falnak dőlve ült a sarokban. Velociraptorbébi ült a vállán. Aztán észrevette a kis piros jelzőfényt. már olyan rendszereket hoztak létre. Mind a rádió szavát lesték. a főbejárathoz ment. Esetleg imádkozik a természethez. – Tán fél? – Nem tudom – felelte Tim. hogy megkíséreljék. – Nem is akarat kérdése – mondta erre hunyt szemmel Malcolm. Valahonnan bentről. Hallotta rádiójának egyenletes sistergését. mert tudja. mit beszélt – szólt mély sóhajjal Hammond. ugyanazt a bejáratot. Nincs hatalma fölötte. Tim felkászálódott. ami messze túl van rajta. Sokkal kisebb a hatalmuk. rázta a hideg. Megrántotta a kilincset. amelyek egyenesen megkövetelik. de csak a ZÁRT TERÜLET feliratú üvegajtóig jutott. aztán még egyszer megmérte. baba. a bátyja vállába kapaszkodó állatkára mutatva. Lex közelebb jött. A kis raptor fejével Tim nyakába bújt. Talán a vadász. de levegőt soha. és visítozott. amelyen át húsz perccel ezelőtt távozott. mi? Piszkosul rondák! Hammond a fejét ingatta. amikor elindul az őserdőbe. és rémületében felordított.

s a kicsi állat végtagjait rángatta. valami utat. közben fejüket időről időre lekapva meg-megszaglászták a padlót. fejük összecsapódott. Biztosra vette. amely alighanem riasztóval volt ellátva. Fel-felágaskodtak. Szinte nekiugrott. és áthajította a szobán. kié legyen a még nyüszítő bébi. velőt rázó visítás hasított a levegőbe. ezek megették! – szólt Lex. – Vigye őket a vezérlőbe. Visszarohant. Tim végre talált egy ajtót – nyitva volt –. és kicsi. Kell találnia egy ajtót valahol. aztán megint felszaladt a felső folyosóra. Mellette pedig ott állt Gennaro bácsi.. amelyeken még mindig a számítógép által megfejtett DNSkódok végtelen sorai villogtak szüntelen. Grant tudta. és a vállán át a túloldali ajtó felé mutatott. el a képernyők mellett. – Van egy tervem – mondta. Tim kézen fogta Lexet. s amelyek segítségével újjáalakították a parkban lévő ősállatokat. A kettő egymásnak esett. – De tűnjenek már el! Gennaro magával vitte a gyerekeket. s a mennyezeti lámpák is hol kialudtak. Végül is az is csak raptor.. és beljebb vonta az óvodába. és őt nézték. Kapkodta a fejét ide-oda. A többiek mind ott álltak az üvegajtó túloldalán. melyen a biológiai veszély kék jele világított. hol minden kivilágosodott körülötte – aztán megint jött a sötétség. fekete-fehér képei látszottak. Grant hallotta az ajtó kattanását maga mögött. és maga is azonnal a DNS-extrakciós laboratóriumba futott. hogy egyszerre csak újabb emberek tűntek fel. mert amint átléptek rajta. A bébi egyre rémültebben csiripelt és ugrált Tim vállán. A bébi a nagyok lába között futkározott. A folyosóajtó nem záródott be mögöttük. A hatalmas nagyító erejű képernyőkön fagyott rovarok óriás. A fiú tudta. aztán együtt. nyüszített. Grant Gennaro karjába lökte a gyerekeket.. Grant észrevette. Megborzongott. sziréna sivított fel. A raptorok tovább küzdöttek egymással a bébi maradványaiért. Végigrohantak a laboratóriumon. és Lex kétségbeesetten felsikított. éles hangja betöltötte a keskeny folyosót.. csoportosan indulnak el. A második velociraptor is közelebb jött. és Lexet maga után húzva átlépett rajta. aztán egy második is. Amint visszanézett. elvette. míg rájött. hogy a halott őrnek az előcsarnokban bizonyára van biztonsági kártyája. Azoké a legyeké és szúnyogoké. hogy a bébi a felnőtt állat állkapcsai közt van. Megint újabb helyiségben voltak. Falkában vadásznak. Szaggatott. és rákiáltott: – Vigye őket valami biztos helyre! – De. és válla fölött hátranézett. húgát is berántva rajta. Letépte a válláról a belekapaszkodó állatkát. A bébi csiripelt.. Magas. A sztereómikroszkópok elhagyottan sorakoztak a munkaasztalokon. A raptorok hangját követte. Ám mintha egy pillanatra megzavarta volna őket. Nem hitt a szemének. – Nyugi. és. Az első raptor leengedte a pofáját. A raptorok lassan egyre közelebb kerültek Granthoz. – Arra! – mondta Grant. Közben Tim hallotta a nyomukba szegődött raptorok egyre közelebbi horkantásait és acsargását. Habozás nélkül nyomultak előre. Grant professzor alakja tornyosult fölé.. Lex nyögdécselt és nyöszörgött félelmében. Talán a bébi elvonja a figyelmüket. valamiért nagyon nyugtalan szegényke. és izgatottan ugrált fel-le a vállán. úgy igyekezett kiszakítani az első raptor szájából. s ott egy ajtót. Haboztak. Ott mind biztonságban lesznek. A folyosón futva Tim hol sötétségbe zuhant. – Tim! – súgta Lex. hogy bevárják egymást. amelyek évmilliókkal ezelőtt a dinoszauruszok vérét szívták. hol kigyulladtak. hogy a DNSkivonással foglalkozó laboratóriumba jutottak. És ott találkozott a gyerekekkel. Semmi kétség. Üres volt. gyerekek! – szólalt meg egy hang. melyen át elmenekülhetnek. Tim csak annyit látott. De még a riasztó zaját is el-elnyomta az üldöző raptorok ordítása. Odakünn a folyosón Grantnak közel két percébe tellett. s ekkor váratlanul valami nagy testbe ütközött. és sietve elindult előre. – De maga mit akar csinálni? – kérdezte Gennaro. Vér hullott nagy cseppekben a padlóra. amikor az „óvodába” léptek. hogy a gyerekek a következő helyiségbe mentek. – Jóisten. és rájuk is talált: éppen harcukat vívták az óvodában. ha lehet. Először egy. Elhaladtak a szuperkomputerek mellett.. De már közeledtek is a raptorok. s az azt betöltő mélyzöld ragyogásból Tim azonnal rájött. hogy ez mit jelent.Lex visszaadta a kis raptort Timnek. s éppen most jelentek meg a nagy velociraptorok. Onnan nem vezet ajtó a vezérlőbe! Gennaro és a gyerekek csapdában vannak! Minden rajta múlik! . A raptorok az ajtónál álltak. és gondosan megszagolta a bébit. Tim újabb ajtót pillantott meg maga előtt. hogy el kell menekülniük valahogy. Aztán elérték a laboratórium hátsó végét. úgy figyelt mindenfelé.. Tim csak értetlenül pislogott. Gennaro megrázta a fejét.

rajtuk halálfejes üvegek sorakoztak. Aztán ott hagyta! Felegyenesedett. amelyeken tojások sorakoztak. mint egy rögbilabda. csupa kényes.. Odabenn hirtelen kékre vált még a ruházata is. Ráhajolt. az ajtónak ugrott. úgy figyelték. a raptorok felé. Őt keresték. leemelte. Grant mindig is feltételezte. és belenyomta a fecskendő tartalmát. A raptorok a terembe léptek. Az élen haladó állat mellső lábával megtörülte véres pofáját. Grant újra megvizsgálta a fedelet. a hosszú asztalok között. és visszapillantott a nagyterembe. bele a ködbe. belenyomta az injekciót. Mellettük üvegtálka állt. végig a padlón. Az istenit! Grant megismételte az egészet: csendben felnyúlt egy tojásért. és belépett rajta. Grant vigyázva fogta a tojást. Még az orrával is görgetett rajta egy kicsit. krémszínű. hogy nem téved. és lassan folytatta útját. Igen! Ott volt.. Volt is elképzelése arról. Méterekre az első raptortól. és megszagolgatta a fénylő tojást. melyekről régóta az volt az általános vélemény. akármi legyen is az. mint ahogy bizonyos mai madarak is megeszik más madarak tojásait. süket csendbe. mennyit ér a tudománya! A velociraptorok kis termetű. a vadászatot. közelebb a bejárathoz. Egész eddigi életét a dinoszauruszok tanulmányozásának szentelte..Grant lassan elindult. Az asztalt halkan kattogva és zúgva szabályos időközönként megringatta egy szerkezet. Az üvegekben lévő folyadékok halványzölden csillogtak az ibolyántúli fényben. lebegve a padlóra kúszott. Újabb ajtót látott. hasonlók az oviraptorokhoz és a dromaesaurusokhoz. a keresést. sem gomb nem volt rajta. A fedél lágy szisszenéssel a mennyezetig siklott. Elég néhány molekulányi. Elindult előre. rángó mozdulatokkal körbenéztek. Megvizsgálta a feliratokat: CCK-55. Ennek valami másik laboratóriumot kell jelentenie. húsevő dinoszauruszok voltak.. s a hatás azonnali halál. Grant nem tudta alácsúsztatni a kezét. jutott Grant eszébe. és levett egy jókora tojást a himbálózó asztalról. Aztán furcsa alakú dobozkát fedezett fel az asztallapba süllyesztve. Grant egyenesen a keltető végébe rohant. ahová menni akart: a keltetőben. Felcsapta a fedelet.. A raptorok rendületlenül közeledtek. Próbálta felnyitni.. Elkúszott a keltető legközelebbi asztaláig. lombikok. Először csak óvatosan mozdultak. THYMOLEVIN X-1612. törékeny laboratóriumi holmi. Vegyi anyagok. A köd szinte leomlott az asztalok pereménél. Megnyomta. Ránézett a vékony tűre. s mindegyikükben volt egy kevéske zölden fénylő folyadék. A raptorok még mindig az asztalok között lopakodtak előre. A raptorok némán mozogtak a hosszú asztalok között. egy ibolyántúli fényben úszó üvegfalú laboratóriumba. reagensek. majd a raptorokhoz gurította. A raptorok felé.. Lassan felnyúlt. körülöttük gomolygó pára. az infravörös lámpák alatt. mint egy kerek fedéllel ellátott kerti villanykapcsoló. mi lehet. ringó asztalokat. Grant ismét lehajolt. benne injekciós fecskendők. Körülnézett. be a mély. A fecskendők kicsik voltak. Fejük le-lebukott. hogy tojásokat loptak. rajta a halálfejes jelzéssel. szimatolták a nedves levegőt. A kéklő sötétségben guggolva Grant az injekcióstálért nyúlt. A fogával húzta le az egyiket. A felirat is így szólt: VIGYÁZAT! BIOGENETIKUS MÉRGEK. tojásokkal teli. rózsaszín foltocskákkal... ahol eltűnt. Éppen úgy. hogy elcsalja a raptorokat a gyerekektől és Gennarótól. apró. s alatta feltűnt a gomb. AZ A4. Hozzáférhetetlennek látszott. A tűk hegyét plasztiksapka védte. Grant lekucorodott. A tojás megállt. A raptor meglepetten nézett le. TETRA-ALPHA-SECRETIN. sem kilincs. és őszintén remélte. Grant üvegpolcokat látott maga fölött. Grant lassan felegyenesedett. ha hozzájutottak. Most majd megtudja. A falhoz tapadva megkerülte a laboratóriumot.. Olyan volt. Az állatok a halk gördülő hang hallatára felkapták a fejüket. Az ajtón a biológiai kockázatot jelző kék fény égett. SZ. Látta az asztal alatt a velociraptorok lábát s az asztallapokról leomló ködöt. de sem ajtó. üvegtálak. mi lehet az asztalok alatt. gyanakodva lesték a hosszú. Felnézett. Aztán folytatták áldozatuk – Grant – lassú. s vette szemügyre a váratlan ajándékot. pipettákkal teli csőröspoharak. . Elgurította a fénylő tojást. milyen veszedelmes mérgek vannak itt. míg a tűt beszúrta a héjon át. A tojás halványkék fényben ragyogott. Megfordult.. és odaütődött a nagy lábujj karomhoz. gőzzé vált.. Grant megfordult. amelyen ez állt: A LABORATÓRIUMBA. és a kis laboratórium végébe kúszott. A fedél alja teljesen a laboratóriumi asztalba simult. Összehangoltan haladtak előre a teremben. óvatos becserkészését. Egy kicsit megingott. Az ezúttal az egyik raptor lábánál állt meg. meleg. Majdnem akkora volt. hogy a velociraptorok is ettek dinoszaurusztojást. s már látta is a fémfedelet. ELŐVIGYÁZATOSSÁGI ELJÁRÁSOK KÖVETENDŐK! Regis is mondta.

és bekapcsolta. hogy egyedül maradt. amely lassan. aztán a padlón nyalogatta a tojást. A rádió! Kikapta a zsebéből. Újra lehajolt. De még csak jelét sem mutatta bármiféle rosszullétnek. nyoma sem volt már benne annak a gyorsaságnak. Grant felé.. s a fénylő anyag lecsöpög az állán. Megfontolttá. A farok a földhöz csapódott. mit tegyen. majd lehajolt a rángó nyak. Nem tud mit tenni. és összeroppantották a tojás héját. Grant felnézett: az állat felfedezte őt. Óvatosan nézte a habzó fejet. hogy elállja a guruló tojás útját. Grant közben újabb tojásért nyúlt – és észrevette. és friss fecskendővel injekciózta be. Az döbbenten észlelte. Tucatnyi tojás gurult szanaszét. és amikor újra felemelkedett. A hatalmas állkapcsok lecsapódtak. némán elindult előre. Egy pillanatra sem vette le a tekintetét Grantról. Grantnál volt még egy fecskendő. Felköhögött.. célpontja. Ekkor a terem túlvégéből a velociraptor észrevette őt.Nem sikerül! Grant immár a harmadik tojásért nyúlt. Estében felborított egy asztalt.. akárcsak egy tekegolyót. Grant lenézett. de még volt ereje felfogni. és dörömbölt a padlón. majd még egy. hogy Grant már a fejét is alig látta tőle. hogy annyi asztal maradjon közte és az állat között. Átkelt a szobán. hogy lássa. a teste előrebillent. a lábak fölé. A tojás zajosan gördült végig a padlón. Most. mi vár rá. A haldokló állat vicsorgott. A raptor sokáig nem is mozdult. úgy vizsgálgatta. egy fénylő tojás volt a szájában! Grant nézte. Ez eddig egy! – gondolta Grant. Az állat vergődése szinte egy örökkévalóságig tartott. ám most annyi tojás került a földre. elővigyázatossá lett. egész teste rázkódott a padlón. A raptor egyre közeledett a sötétvörös. Fejét ide-oda kapkodta. Az első állat a földön fekvő raptor felé indult. te vagy az? . fogai a támadó nyakába mélyedtek. Ám az álló állat egy rántással kiszabadította magát. Grant a raptorra szegezte tekintetét. és megérezte a zsebében dudorodó rádiókészülék nyomását a testén. amikor az állatból hirtelen hörgő. – Alan? – Ide figyelj! – szólt halkan Grant.. A tenyerébe vette a fénylő tojást. mi közeledik. aztán a másik is... beleharaptak. oldalazva közeledett. Megint harapott. Grant elkeseredetten nézte őket. Az egyik félrebillentette a fejét. cipősarkaihoz ragacsos fehérje tapad. Az gyorsan körülnézett. Ez kettő! A második raptornál szinte azonnal bekövetkezett a hatás. amelyet a falkában mutatott. Mintha zavarba ejtette volna ez a furcsa végvonaglás. Nincs hová bújnia. a ziháló bordák. aztán fölöttük figyelt. Fel-le mozgott a feje. hogy egyék a törött tojásból. csak nézett. És kiharapott egy darabot a hátsó lábból. Megvan a második! – gondolta Grant. mintha a harc hirtelen túlságosan fárasztóvá vált volna. sejtelmes félhomályban... Grant érezte. A támadó ott hagyta. hirtelen felemelte és elfordította a fejét. A döglődő állat hangját fülelték. melyekbe időről időre hangos üvöltés keveredett. Annyi hab bugyborékolt elő a szájából. Továbbra is fuldokló hangokat hallatott. Aztán lassan.. Mint kígyók dőltek ki belőle a belek kötegei. A harmadik raptor még ott volt. óvatossá vált a mozgása. Hátsó karmai lecsaptak. és megint nyöszörgött. Farkasszemet nézett vele! Az állat fenyegetően felmordult. lassan. mi fog történni. Hosszú. s egyetlen gyors mozdulattal felhasította a földön heverő állat hasát. és ösztönszerűen üldözőbe vette a mozgó tárgyat. Szánalmasan nyöszörgött. Halkan.. Elgurította. hogy valami máshoz kellett folyamodnia. meglátta. ezúttal erővel. De szó sem volt „azonnali halálról”. Azon igyekezett. Leguggolt. gyorsan. Sebesen siklott az asztalok között. előbb mindig az asztalok alá nézett. A súlyos farok görcsösen verte a padlót. – Halló! Itt Grant! – Alan? – Ellie hangja szólt. gurgulázó hang tört elő. ahogy a raptor beleharap. Grant párhuzamosan mozgott vele. Egyik oldaláról a másikra billent a földön. A haldokló raptor már rángatózott. A raptor kiegyenesedett. Halvány színű albumin csöpögött le a fogai közül. amennyi csak lehetséges. és felhorkant.. Lassan. amikor az utolsó állat haragosan felhorkantott. – Csak beszélj. Zajosan megnyalta a száját. elképesztően sebes léptekkel igyekezett Grant felé. sziszegve szedte a levegőt kitágult orrlikain át. Vér ömlött a nyakából. Az egyik állat meghallotta a zajt – lekapta a fejét –. bal felé mozdult. A haldokló raptor sikolyai betöltötték a termet. hogy a teremben a többi raptor mozgás közben szinte kővé mered.. lehajolt. arra kérlek! – De Alan. Éppen azt igyekezett eldönteni. mi történik. A második raptor a leterített állat fölé hajolt. és a nagy test előrezuhant. hogy lába alatt tojások törnek. megdermedt a rémülettől.

– Alan! Kérlek. Grant irányába. én vagyok az! Nem tudom.. és beadta a mérget. mélyen a farok húsába döfte a tűt. Továbbgurult a padlón. mintha azt érezné. Grant a kezével jelezte. amint lecsapódott.Alan? A készülékben megszólaló fémes hang hallatára az állat megállt. és várt. Grant pedig hátraesett. csak a sziszegő légzés. és ugrott. és a rádió felé indult. A raptor lába ismét lecsapott. A velociraptor vadul felmordult. Mi van Ellie-vel? Nem értené? A raptor egyre közeledett a sötétben. Grant az egyik asztal lába mögé guggolt. aztán ellökte magától a készüléket. aztán az állat felkapta a fejét. A nagy farok éppen a férfi feje fölött volt. Grant odébb hengeredett. már nem volt hová bújnia. Grant látta a bordázott. s orrával óvatosan megbökte a rádiót. majd csend.. A rádió még mindig néma volt. fejét beverte a mennyezetről függő infravörös lámpasorba. A kislány a döglődő állatra nézett. majd rúgásra emelte karmos lábát. Az állat hörgött. van még valaki a teremben. így is éles fájdalom hasított a vállába. – . Megfordultak.. Gennaro lépett a terembe a gyerekekkel.– Beszélj! – ismételte Grant. amelyből szikrák pattogtak szanaszét. felágaskodott. Miért is nem lökte a rádiót még messzebb! A raptor arrafelé tartott. kérlek! Aztán recsegés. És hátrafelé felbukott. A teste most elfordult Granttól. Az állkapocs lecsapódott. Nem hallatszott más.. Orrát betöltötte a hüllő erős bűze. Az állat végső rúgásra emelte a lábát. közben törte-zúzta a tojásokat. amely vad himbálózásba kezdett. Rémisztő sebességgel. Grant gyorsan felnyúlt. Az a közeledő raptor felé siklott a padlón. A raptor közeledett. Az alvadt vér csíkjait a hajlott karmon. . A raptor fölé tornyosult. az arcát. Immár nem védte semmi. s csak ennyit mondott halkan: – Tyűha! Aztán Gennaro felsegítette Grantot. Vadul vicsorogva rúgott harmadszor is.. a fogak az asztallábon zárultak össze. A hatalmas láb ott volt előtte. – Alan. Alan? A raptor lehajolt. kavicsmintás bőrt. A rádió elnémult. összevissza kente a kezét. tátott szájjal lendült visszafelé. Tovább már nem volt út. de így is túl közel maradt. majd a vér melegét érezte az ingén. s a láb épp hogy csak elkerülte. – Alan! Szólj hozzám. A levegőbe szimatolt. Az asztal felbillent. Hab folyt a szájából. és együtt futottak a vezérlő felé. figyelj már rám!. hogy még maradjanak egy kicsit távolabb.. – Alan. Most a rádiót zúzta össze. hallasz-e? A raptor erre elfordult Granttól. a lágy zöldes csillogást. és Grant ekkor a falba ütközött. – Alan? A raptor hátrált egy kicsit.

– Igen? Tim megérintette az ELEKTROMOS/FŐ-t. Be kell kapcsolnod a fő energiaforrást. FŐ ELEKTROMOS VEZÉRLŐMODULOK MAIN Sec A1 . hol kigyullad.A211 Sec B1 . ŐSLÉNYPARK – RENDSZER INDUL INDÍTÁS AB(0) Biztonság Fő SetGrids DNL Kritikus zárak Kontroll Áthaladás Monitor Fő View VBB TeleCom VBB TeleCom RSD Parancs Fő Belépés TNL Reset Revert Eloszt. Már legfeljebb csak kétszáz méterre volt a dokktól. hogy Grant professzor a képernyőre mered. hol elalszik a rajz. – Mi történt? – kérdezte Lex.B0211 Sec A1 . Fő Javítás Raktározás Státus Fő Biztonság/ Egészség Tim látta. Morgásukat is hallotta a rádióból. – Azt jelenti. – Ez már egyszer előfordult – mondta. „A hálózati rácsok” – gondolta Tim. Fő Elektromos Fő Fűtés Hűtés Vész Világ.B9 Security (0) Security (1) Main Grid M Aux Grid 0/0 Aux Grid R/V Power Config Core Config . noha az villogott. Tim azonban be is siklott a „parancsnoki” ülésbe. – Én nem értek a számítógépekhez! – sóhajtotta.A011 A21 .B9 CSX (89A) CSX(1031) RSX (55-90) Aux Pwr (4) SUBMAIN Sec A1 . Gennaro csettintett egyet az ujjával. és a fejét rázta.B011 B021 . hogy kimerülőben van a tartalék energiaforrás. A képernyőn ott állt a válasz: FIGYELEM: PARANCSVÉGREHAJTÁS LEÁLL (TART.B9 B01 . A másik képernyőn a kastély belsejét látta. ENERGIASZINT ALACSONY) – Hát ez meg mit jelent? – kérdezte Tim. A videomonitorokon látszott.A VEZÉRLŐ Tim meglepetten látta. – Csinálj valamit. FNCC Params INDÍTÁS CN/D Hidraulika Fő Ajtók Interface GAS/VLD Fő II Robbanás Tűzveszély Mester Fő SAAG Rnd Közös Interface Séma Fő Zoolog. hogy a hajó gyorsan közeledik Puntarenashoz. és megnyomta a SETGRIDS/DNL-t. Timmy! – kérte Lex. és félszegen a billentyűk felé nyújtja a kezét.A9 TEMP CVD PERM CVD (0) Main Grid P Main Set 1 Main Set ATL Grid V-VX Reset Grids MAIN Sec B1 .A9 A01 . a mennyezetről lecsüngő raptorokkal. hogy a képernyő a vezérlőben immár villog.A9 Core (Aux) Security (N) Not In Use SUBMAIN Sec B1 . Gyorsan érintgetni kezdte a képernyőt.

Tim most a MAIN SET 1-et nyomta meg. és megint szemügyre vette az indítóábrát. Az örömteli hangok fémesen zörögtek a rádióban. A VÁRAKOZÓ HÍVÁSOK/ÜZENETEK SZÁMA 23. és kikötéshez készülődött.. – Most mit csinálsz? – kérdezte Grant. a kötelekhez. Lex kiabált vele. fiú! Megcsináltad! Sikerült! Ugráltak örömükben. sz. Látták. hogy a matrózok a hajóorr felé sietnek. A fiú előbb a videomonitorokra pillantott. amint a hajó balra fordult. ADJA MEG A HÁLÓZATI RÁCS PONTOS KÓDSZÁMÁT! Tim egy végtelennek tűnő pillanatig szinte jéggé dermedve ült a helyén: elfelejtette a számot. aztán vissza a fő képernyőre. Mind a TeleCom VBB. csak a feszültséget fogta fel. Tim megnyomta a MAIN-t. amelyben a „fő”. MEGHALLGATJA ŐKET? . – Ez az! Isteni! Tim megnyomta a RESET GRIDS-t. Csak úgy záporoztak a szikrák a szobában. – Ez az! – veregette vállon Timet Grant. – Mit csináltál? – hangzott Lex rémült kiáltása. vagyis a FŐ-t. amikor egyszerre csak megszólalt Lex: – Na és a hajó? Azzal mi lesz? – Mivel mi lesz? – Hát a hajóval! – ismételte meg a kislány. de az el sem jutott Tim tudatáig. A képernyő villogott tovább. ENERGIAFORRÁS BEKAPCSOLT Egyszerre kigyulladt a teremben az összes lámpa. Tim visszakászálódott az ülésbe. F4. mint aminek köze lehet a telefonokhoz. A hajó orrához közeledő épületek már egészen nagyra nőttek a képernyőn. Aztán Malcolm hangját: – Szentséges Isten!. Melyik hálózati rácsot kívánja visszaállítani? Park Karbantart/Ellát.. A TeleCom RSD-t nyomta meg. mind a Telecom RSD úgy nézett ki. FŐ ELEKTR. A monitor hirtelen teljesen kifehéredett. Közben az egész képernyő villogni kezdett. Aztán valahonnan előjött az emlékezetéből: F4! Megnyomta. Újabb jelet érintett meg. Tim most a MAIN GRID P-vel próbálkozott. és a képernyőre mutatott. a „rács” és az „energia” jele együtt szerepelt. A gyomra összeszorult a félelemtől. HÁLÓZAT EZZEL BEKAPCSOLT A kastélyt mutató képernyőn világos szikrakitörés látszott. és mindannyian látták. amely a tudós hangjában érződött. Kastély Egyéb Grant mondott valamit. KASTÉLY. De ő nem is akart a monitorra nézni többé. A FŐ HÁLÓZATI RÁCS NEM AKTÍV / CSAK A TARTALÉKFORRÁS MŰKÖDIK A képernyő még mindig villogott. hogy a raptorok a rácsok közé szorulva vonaglanak a szikraesőben Muldoon s a többiek örömrivalgása közepette. mintha mind gyerekek volnának. és jobb felé mozogtak. – Ez az.Tim felnyögött. Hallotta a meghajló rácsok nyikorgását a kastélyban s a raptorok harsány vicsorgását. Tim szíve a torkában dobogott. de máris visszajött a kép. Grant aggódó tekintetét a fiúra szegezte. Egy pillanatig nem történt semmi. Nem történt semmi. A monitorok villogása abbamaradt.

majd megszólalt egy hang: – Ööö.) – Nos. Timmy! – mondta Lex.. Körös-körül mindenki sorra kapkodta fel a telefonokat. Halló.. Magas. Sorban nyomogatta a gombokat a képernyő alatt. és azt szeretném mondani magának.. hogy a hajóról is jött hívás. hogy a hajó orra már-már beleütközik a puntarenasi dokkba. PRÓBÁLJA ISMÉT Megint megpróbálta. Úgyhogy leszel szíves tisztességesen bejelentkezni. – Hall engem? – szólt Gennaro a telefonba. HÍVÁSÁT TÁRCSÁZÁSSAL NEM TUDTUK KERESZTÜLVINNI (HIBA-598) KÉREM. – Ez lesz az? – kérdezte izgatottan Grant. (KAPT.. Vége. vége? – Felelj már! – kiáltott rá Lex. mire iszonyú mennyiségű név és szám öntötte el a képernyőt. Hallgatlak. légköri sercegés szólt a készülékből: – . amit keresett: VSL ANNE B. Biztosan van valami mód rá. – Pedig lehet.tos valami hülye vicc. hogy megtudja. és ránk vár! – szólt Lex. – Jól van. sípoló zaj hallatszott.. – Ha hall. de nagyon rosszkor szórakozol! Kikötés előtt állunk. úgy az Egységes Tengerhajózási Jogszabály 509.. . A lista hatalmas volt. Gennaro a telefonkagylóért nyúlt. – Hadd intézzem ezt én el. itt Tim Murphy. TÁRCSÁZÁS MOST VAGY KÉSŐBB? TÁRCSÁZÁS MOST – parancsolta Tim. Farrell kapitány úr! Elég tisztességes bejelentkezés az magának... Tim felkapta a kapcsolótáblán lévő telefonkagylót. ELNÉZÉST. – Talán így hozzájuthatnál a hívószámhoz! Tim nem is figyelt rá. jó? Meg tudod találni a nevét? Éles. öcsi! – jött a lassú. vagy azonnal kilépsz ebből a sávból! Ebben a pillanatban a képernyőn megjelent a kiírás: FARRELL. D.. – Halló.. Tim elmélyülten nyomkodta a billentyűket... Murphy?. Végül Tim észrevette.ádióamatőr . Aztán értetlen hang hallatszott: – Mintha valami ostoba kölyök hülyéskedne! Tim folytatta: – Ne kössenek ki a hajóval! Azonnal térjenek vissza a szigetre! Távoli. ki is ez a Freddy. TÁPLÁLJA BE A TÁRCSÁZANDÓ SZÁMOT VAGY KÉRJE A TELEFONLISTÁT F7-TEL Tim leütötte az F7-et. kérlek! – Ne kössenek ki! Hall engem? Rövid csend következett. még áttekintette és megtalálta. (FREDDY) 708-3902 Most már csak arra kell rájönnie. nevét.. válaszoljon! Vége. automatikusan tárcsázott számok zaja. Nem kis időbe tellett. de mindegyikből csak vonaljelzés hallatszott...– NEM – felelte Tim.rakozik.lán valami . itt Freddy. ki a fene vagy. John. Hallotok engem. – Gőzünk sincs.. – Halló... majd a gyors egymásutánban.. és nem volt ABC-sorrendbe szedve. FREDERICK. amerre csak talált egyet. ismételd. hogy a konzol oldalán is függ egy telefon. – Nem jól veszlek. Tim kétségbeesetten nézett a többiekre.. mérges válasz. ha közlöm. itt Freddy. és nem tér vissza erre a szigetre. vagy . vége? Tim megmarkolta a hallgatót. reszelős hangok érkeztek válaszul: – Mit mond?. és dolgunk van.. – Na ide figyelj. de csak vonalhangot hallott benne. hogy. Vonalhang hallatszott. John.. – De már majdnem ott vannak! – A képernyőn jól látszott. John.. Ki az? – Aztán egy másik hang: – Nem jól értem. hogy amennyiben nem fordítja meg a hajóját.. – Vezérlő? Halló! Itt Freddy. hogyan lehet tárcsázni. fölötte fény villog. Mi van. de tüstént.

értettem – majd egy másik: – Teljes gőzzel hátra! – A hajó manőverezésbe kezdett. Semmi kétség: a hajó egyre gyorsabban távolodott a parttól. – Gondolom. Grant Gennaróhoz fordult: – Mondja már. Lex örömujjongásban tört ki. és egyre jobban elfordult a dokktól. . – A neheze csak most kezdődik. – Válaszoljon. Tim összecsuklott a székében.§-ának értelmében engedélyének bevonásával minimálisan ötvenezer dollárnyi kártérítéssel. valamint öt évig terjedő börtönnel sújtható? Ért engem? Csend volt a készülékben. mégpedig azonnal! Megértette. mi a csuda az az Egységes Tengerhajózási Jogszabály? – Hát azt meg honnan tudjam? – felelte az ügyvéd. Mindannyian elégedetten nézték a képernyőt. – Dehogy – mondta. Farrell kapitány. amit mondtam? Rövid szünet után lemondó hang szólalt meg a messzeségben: – Igen. – No! – sóhajtott fel Gennaro. s a verejtéket törölgette a homlokáról. a nehezén végre túl vagyunk! Grant megrázta a fejét.

hogy legyen bátorságunk szembenézni azzal.HETEDIK ISMÉTLŐDÉS A matematikai képletek egyre sürgetőbben követelik. IAN MALCOLM . ami belőlük következik.

tűzhányókitörések.. az emlősöké. amikor a bolygó már nem lakhatatlan többé. akkor hadd mondjak magának egy-két dolgot erről a bolygóról – mondta.. majd haltak ki. ragadozók nélkül. a változást. hogy nem. aki szemlátomást összeszedte magát. – A szakemberek is mind úgy vélik. heves átalakulás: felszökő. hogy bennünket is túlél majd! Hammond összeráncolta a homlokát. mit beszél? Azt hiszi. De a Föld túlélné a mi balgaságunkat. – Maga nem képes megsemmisíteni ezt a bolygót. – Ez a bolygó négy és félmilliárd éves. Malcolm megint sóhajtott. és nem özönlötték el a világot. – Az. hogy régóta fennáll – mondta –. szükséges. – Hát nem szöktek ki az állatok. Aztán. legalább a katasztrófát sikerült elkerülnünk. Malcolm felkönyökölt. és tiszta ágyba fektették. mélyen a talaj alatt vagy talán a sarkvidéki jégbe fagyva. hiszen az volt a tét – mondta Hammond. – Miért.. tündököltek. egész kontinensek mozgásai. Elölről kezdődnék az evolúciós folyamat. hogy ez a bolygó bajban van. üstökösök becsapódásai. – Sok más viszont kihal – ellenkezett Hammond. Ezen a bolygón majdnem ugyanannyi ideje van élet is. Talán kellene hozzá néhány milliárd év. Csak mi – mondta Malcolm –. a szárazföldön. hogy először fordulna elő ilyesmi? Nem hallott még az oxigénről? – Tudom. – Mondjuk. És amikor bizonyos növényi sejtek hulladéktermékeként először képződött oxigén – úgy nagyjából hárommilliárd évvel ezelőtt –. bőrrákot okozhat. – Az a puszta tény. – Nos – mondta –. hogy bekövetkezik! – vágott közbe Malcolm. Rengeteg olyan életforma van. hogy ezek az állatok. – Maga egomániás idióta! – kiáltotta.. Hammond. Nagy energiát jelent. – Az ibolyántúli sugárzás hasznos az élet számára. és mind évmilliókig tartott. A mai napig e bolygó legnagyobb földrajzi látványossága onnan származik.. alig egy százalék az . mint a Vénusz. el tudja pusztítani a Földet? Szentséges Isten. Utána jöttek a különféle állatok nagy korszakai. Ha például bekövetkeznék valami nagyszabású sugárbaleset. Malcolm nagyot sóhajtott. Gyilkos gázt leheltek ki. – Maga azt hiszi.. mint amilyen most. hogy bolygónk végveszélyben van. a kétéltűeké. kiszabadulnak innen. És? – Hát. Az élet is túlélné. hogy szükséges az élethez. amelynek egyre nőtt a koncentrációja. Malcolm dühbe gurult.A VILÁG MEGSEMMISÍTÉSE Malcolmot átvitték egy másik szobába. – Aztán miféle katasztrófát? – kérdezte mély sóhajjal Malcolm. Az élet még így is fennmaradna valahol. sok-sok év múlva. Malcolm megrázta a fejét. felduzzadó. majd az első összetett lények a tengerekben. majd kiszáradó óceánok. hogy visszanyerje mai változatosságát. hogy örökkévaló. – De ha az ózonréteg el vékonyodik. Egy olyan bolygón. a dinoszauruszoké. amely egyenesen kivirágzik. – Csakhogy nincs – mondta Malcolm. és megsemmisítik az egész bolygót. hogy olyannyira súlyos. Az első baktériumok. amelyek féken tarthatnák őket. iszonyú válságot okozott minden más életforma számára ezen a bolygón. nem jelenti azt. Aztán később az első többsejtű állatok. – mondta Malcolm. – Tegyük fel. maga attól tartott? – Hát persze. Most. – vetette közbe Hammond. mint a fluorin. mennyire beleszédülhetett a hatalmába! – Malcolm visszadőlt az ágyra. És természetesen egészen más lenne. Három egész nyolctized milliárd éve. – De az oxigén voltaképpen mérgező anyagcseretermék. Nem kétséges. és összetorlódásuk sok millió év alatt létrehozta a Himalája hegységet. – Jó. Elősegíti a mutációt. hogy minden növény és állat elpusztul. És a maga idejében a bolygó mindent túlélt. csak mi hisszük. – Igen.. hogy egykor két nagy kontinens összeütközött.. újra magabiztosan sürgölődött. ha fokozódik az ibolyántúli sugárzás. melyet üvegmarásra használnak. – Egyáltalán van magának fogalma arról. Korrozív gáz. – Akkor erősebb ibolyántúli sugárzás éri a földet. Azok a növényi sejtek halálos méreggel szennyezték be a környezetet. És mindennek a hátterében folyamatos. Közel sem kerülhet hozzá! – Az emberek nagy része meg van győződve róla – jelentette ki Hammond –. s a Föld vagy százezer évig tűzforró marad. Élőlények egész dinasztiái emelkedtek fel. az élet ismét szétterjedne a bolygón. majd lepusztuló hegycsúcsok.

A Föld életében azonban száz év semmi. gigászi ritmusát mi el sem tudjuk képzelni. amely összeférhetetlen az élettel! Hammond bosszús képet vágott. tíz és végül huszonegy százalék! A Föld egész atmoszférája tiszta méreggé vált. – No és mit akar mondani ezzel? Ne is törődjünk a környezettel? – Ugyan. majd valahová a messzi távolba függesztette a tekintetét. dehogyisnem. hogy az élet a Földön képes vigyázni magára. . – Végül is hová akar kilyukadni? Oda. Lassú. – Hát akkor? Malcolm köhécselt.. Mi vagyunk veszélyben. vakcináink. – Bizony – mondta Malcolm. hogy eltűnünk – mondta fújtatva Hammond.. a Földnek nem fogunk hiányozni. hogy a bolygó a mai szennyező anyagokat is bekebelezi majd? – Nem – felelte Malcolm. és nincs meg bennünk az alázat sem. – Beszéljünk világosan! A bolygó nincs veszélyben. Egymillió év semmi. hogy önmagunkat megmentsük. Méreggé. Száz évvel ezelőtt nem volt autónk.oxigén. Ez a bolygó ennél sokkal hatalmasabb skálán él és lélegzik. – És könnyen megeshet. Nem áll hatalmunkban a világot megsemmisíteni – de megmenteni sem. – Csak azt akarom mondani. – Könnyen megeshet. számítógépeink. Egy emberi lény gondolkodásában száz év nagy idő. Egészen más volt akkor a világ. hogy megpróbáljuk. Arra azonban van még esély. A Földön azonban az oxigénkoncentráció rohanvást nőtt: öt. repülőgépünk. Egy puszta szemvillanásnyi ideje vagyunk még csak a lakói. Ha holnapra eltűnünk.

nyilván hívások sora futott ide-oda San José és Washington között.1 ?? 3. Tim egyre jobban belejött a számítógép kezelésébe. amint nyugat felől velociraptorfalka lépett be a képbe. tágra nyitott szemmel figyelt. hogy a kórházba vigyék Malcolmot. míg a segítség végül útnak indult. Addig pedig nem volt mit tenni. – Nem is tudom. Muldoon csendesen megjegyezte: – Szóval a jelek szerint e pillanatban az összes felnőtt raptor odakinn van. ám az egyik raptor még a hátára is ugrott. köröztek körülötte.3 4. – Most meg kevesebb állatot jelez a gép? Grant bólintott. amint a nyílt mezőn át raptorcsorda vágtat teljes sebességgel egy négytonnás hadrosaurus felé. Mindenki vagy a látogatóközpontban. a szigeten tartózkodó huszonnégy személyből nyolcan meghaltak. és az áldozat hosszú nyakába harapott. A Costa Rica-i gárda azonban feltűnő óvatossággal tárgyalt velük telefonon. A hadrosaurus megfordult. Most már csak telt-múlt a nap. amelyek az egyik hátulsó rakodótérben játszadoztak. és további hatan eltűntek. hogy bárki ezt akarta volna – mondta Gennaro. A hajó útban volt visszafelé.1 4. – Márpedig most összekeverednek.0 3. és most éppen új képet jelenített meg a képernyőn: Állatok összesen Faj Tyrannosaurus Maiasaurus Stegosaurus Triceratops Procompsognathida Othnielia Velociraptor Apatosaurus Hadrosaurus Dilophosaurus Pterosaurus Hypsilophodontida Euplocephalida Styracosaurus Microceratops Összesen 292 Várt 2 22 4 8 65 23 37 17 11 7 6 34 16 18 22 292 Talált 1 20 1 6 64 15 27 12 5 4 5 14 9 7 13 203 Ver 4. mind a Szafarikastély ismét biztonságban volt. a lábába kaptak. csak várni. hogy az állatok sosem fognak összekeveredni. hogy a hasába vágják rettenetes karmukat. – Alighanem. A hat raptor percek alatt leterítette a náluk sokkal nagyobb állatot.1 – Hát ez mi az ördög? – kiáltott fel Gennaro.1 3.1 ?? 3. Amennyire meg tudták állapítani. Már útban is volt a Costa Rica-i Nemzeti Gárda egy egysége. – Órák óra nyitva állnak a kerítések – mondta Grant. Grant némán.1 ?? 3. nem egészen így. a nap lassan alászállt. és a számítógép is kifogástalanul végezte a dolgát. – Ezt hogy érti? – Létrejön az egyensúly. A populációk egyensúlyba jutnak – valódi jurakori egyensúlyba! – Nem hiszem. reggelig kell várniuk.9 4. míg a többiek előrerohantak. Egy másik monitoron Grant látta. és menekülni próbált. és felugrottak. hogy képzeltem – felelte a férfi. – Grant a monitorokra mutatott. . a matrózok rátaláltak a három fiatal raptorra. vagy a kastélyban volt. – Nem.3 ?? 4. Isla Nublaron minden jel szerint elmúlt a közvetlen veszély. – Valahogy így képzelted? – kérdezte tőle Ellie. Mind a látogatóközpont. Ellie hozzátette: – A Juraparkban végre helyreáll a rend. A vezérlőteremben ismét működött a légkondicionálás. továbbá a légimentők. Tudták: ha a helikopterek nem jönnek hamar. és végeztek velük. Délután volt már.HELYREÁLL A REND Eltelt négy óra. – Az elképzelés úgy szólt. Segítségkérésük eljutott a San José-i hatóságokhoz.9 3. s a jelek szerint a külső védelmi övezetet sem fenyegették dinoszauruszok. – Az állatok keverednek egymással. Az egyiken éppen hypsilophodonták csapata szökött a magasba.

ott. Nem ellenőrizte egy olyan személy cselekedeteit. – Az jár az eszemben – mondta Muldoon –. Meg kell semmisíteni. Grant Muldoonhoz fordult. és vállalni is fogja a felelősséget! – De hiszen vállalom – nyögte köhögve Gennaro. A nyugati négyszögben a felnőtt triceratopsok egymás között verekedtek: újra meg újra egymásnak rontottak. amit fel sem fogott. – Olyanok. hogy ez a személy a történelem legveszedelmesebb technológiájával játszadozzon. intézzék ők el a dolgot. – Meg akarom keresni. Grant doktor. és hirtelen felforrt benne a méreg. – Induljunk! – Azt hiszem. és haláltusáját vívta. de mindenképpen bénító. Grantnak hirtelen eszébe jutott. Magas feszültség. Célpontnak. és hagyta. és levegőért kapkodott. amit tud! Muldoon elment. – Hogy állunk fegyverekkel? – Hálóink vannak.. és óvatosan kerülgette a kis tyrannosaurust. – Az nem megoldás – szólt közbe Grant. – Még mindig bujkál előle. Az egyik állat már a földön hevert. A csúcsokon lévő kapacitor érintésre áramütést ad. – Nem! – mondta makacsul. hogy belekapjon a tüskékbe. hogy hazug ember. – Ezt nekünk kell elintéznünk! – Bízzuk a szakemberekre! – mondta megint Gennaro. – Hozzon egyet! Van még valami. és összeakasztották a szarvukat. – Hát ide figyeljen. amikor rettegve gubbasztott egy teherautó vezetőfülkéjében. – Az nem lesz elég – mondta Grant.. és a Costa Rica-i gárda éppen ezt fogja tenni. Nem halálos. amelyet a lehető leggyorsabban meg kell semmisíteni. hogy maga kibújt a felelősség alól! Nem vállalta! Gennaro ismét köhögött. – A raptorfészekben – válaszolta Ellie. és a betonfalnak taszította. – Azt nagyon helyesen teszik – mondta Gennaro. Mármint ha tényleg meg akarja keresni azt a fészket. – Nem – mondta Grant. – A raptorfészekben? Grant tovább faggatta Muldoont. amely érdeklődve figyelte. és időnként eredménytelen kísérleteket tett arra. gyenge áramerősség. – Akkor meg mi a gondja? – kérdezte Gennaro. Résztulajdonosa lett egy üzletnek. – Ez a sziget túl veszélyes. Minden állattal végezni kell ezen a szigeten. – Csődbe húzta a befektetőket: belevitte őket egy vállalkozásba. – Nekem az a véleményem. Én igenis állítom. – Hát akkor hozzon. de nem gyakorolt felügyeletet fölötte. . – Egy fenét vállalja! Kezdettől fogva mást sem tesz mint igyekszik kibújni a felelősség alól. ahol belemart a raptor. hogyan talált rá Gennaróra alig hat órája. – Miféle fészekben? – kérdezte még mindig köhögve Gennaro. – Elengedte Gennarót. maga nincs tisztában a helyzettel. Az összes állatot el kell itt pusztítani. – Jó. De ennek most már vége. A déli részen a stegosaurus tüskés farkát lengette. Érti. Minél előbb. hát akkor most vállalom. hogy amikor majd jönnek a Costa Rica-iak. annál jobb. – Felállt. Grant Gennaróhoz fordult. Szerintem az ő szakértelmükre kell bíznunk magunkat. Muldoon ismét megszólalt: – Már legfeljebb csak egy óráig lesz elég világos odakint. Alan – mondta Gennaro. mint a cápák elleni védőkarók. Vállon ragadta az ügyvédet. hogy még ideggázt is bevetnek majd. – A levegőből fogják bombázni – folytatta Muldoon. de lehet. aki előrehajolt. maga kis csirkefogó! Maga is felelős ezért a helyzetért. – Talán napalmmal. – Mennyire jók ezek a botok? – kérdezte Grant.Grant először oda sem figyelt rá. Csak bámulta a monitorokat. – A fészekben semmiképp. – Rádiójeleket sugárzó nyakörveik vannak? – Persze hogy vannak – felelte az. a hatalmas állatok közt lejátszódó drámai jeleneteket. akiről tapasztalatból tudta. hogy ez a sziget túl veszélyes. – Hadműveletről van szó. ami védekezésül használható? Muldoon csak a fejét rázta. meg áramütést adó terelőbotjaink. Tegyék a dolgukat! Grantnak a hátába nyilallott a fájdalom. – Az ördögöt. – Remélem is – helyeselt Gennaro. ők alighanem katonai problémának tekintik majd ezt az egész szigetet. amit mondok? – Tökéletesen – felelte Grant. – Igaza van – kapott észbe Grant.

Odalenn többsornyi gázálarc függött a falakon. Számba kell vennünk minden egyes állatot. hogy mindvégig tudott erről! – Nem biztos – mondta erre Grant. A látogatóközpont garázsában álltak a kis raptor mellett. Lex pedig odatartotta. a part felől is van bejárat oda. Mintha óriás borsdarálókkal lenne teli a szoba. Utána aztán felégethetjük. A kockákban Grant kis. – Ez nem igaz! – szólt halkan. Rejtve vannak valahol. – Miért. – Hátha fegyverek – mondta erre Grant. mind műanyag tartóban. Nem tudom. – Találtam valamit. A raptor színe hirtelen élénkzöldre változott. – Nehéz a nyakörvet az állatra rakni? – kérdezte. acélfedővel a tetejükön. amint Lex becsatolta. Csakhogy ezt addig nem tehetjük meg. majd a csat fölé kapcsolta a tépőzárat. De előbb van még egy kis tennivalónk. Nagy föld alatti terület. hogy meg kell keresnünk a fészkeket a szigeten. amely most az állatok mozgáskörzetét mutatta. Valakinek csak tudnia kellett! – Tényleg. – A kapcsolótáblához fordult. melyet Grant fogott az alagútban. Ellie folytatta: – Azt hiszem. Mr. – A raptorok a déli szektorban tömörülnek. . hogy a raptor megszagolhassa. hol van most Hammond? – Még mindig a kastélyban. Kinyitották a talajba süllyesztett vasajtót. Amint végzett vele. – De ez szeret engem – ismételte Lex. – Tim. s alatta előtűntek a mélybe vezető betonlépcsők. – Tim! A fiú a billentyűk fölé hajolt. mi van benne. Az a kezéhez dörgölődzött. Tim a billentyűket nyomkodta. s a színe megint elhalványodott. Az egész kísérlet maga a csőd. hogy a meleget szeretik? – Van arra alkalmas rejtekhely? – Úgy tűnik. mutasd meg a réseket a gáton. Grant hallotta is a magas. Összeráncolt homlokkal forgatta a fényben. benyúlt. Ellie a falitérképet nézte. mi az? – kérdezte Grant. Meg kell találnunk és meg kell vizsgálnunk őket. – Meg sem próbált idejönni. Lex tovább simogatta a raptort a rácson át. Főként a raptorfészkeket. Ellie a térképre mutatott. – Én a helyedben nem próbálnám meg – szólt Muldoon. Beljebb világítottak lámpáikkal. Meg kell számolnunk a tojásokat. Gennaro. – Akkor meg Hammond tudta. A lépcső aljára értek. A kislány a ketrec rácsai közt benyúlva simogatta az állatot. van – felelte a botanikusnő. Muldoon felnyitotta az egyik tartály tetejét. – Egy pillanat! – szólt. – MORO-12 – felelte Muldoon. nehogy a víz elárassza a déli síkságot. méteres üvegkockát vettek észre. s ott több nehéz. Mind ott álltak a gépház épülete mögött. – Mibe. – Clarence-nek? – Annak – felelte a kislány. hogy nekem megengedi – makacskodott Lex. – Azért jobb lesz vigyázni! – figyelmeztette Muldoon. Lehet. – Akkor ott lesznek. – Én pedig fogadok. az állat megnyugodott. Grant bólintott. sípoló jelet a fülhallgatóban. míg meg nem tudjuk. És ezek itt gránátok! Csupa-csupa gránát! – Akkor induljunk! – mondta komoran Grant. – Pocsékul harapnak. – Átkozott Arnold! – mondta Muldoon. amely ezen a szigeten született. – Hatalmas betongát van ott. ahol vulkáni gőz tör fel a talajból. s kihúzott egy gömböt. ott. – Mi az? – Egy jelzés nélküli raktárhelyiség. – Fogadok. Aztán szép lassan az állat nyaka köré csúsztatta. – Szeret engem – mondta mosolyogva Lex.– A szigetük teljes csőd. Így hát Muldoon odaadta neki a nyakörvet. miközben fájós lábát húzva. A mocskot el kell takarítani. A bőrnyakörv a hozzáerősített fémdobozkával együtt Muldoon kezében volt. hogy nekem engedi? – mondta. – Clarence-nek hívják. gondolta. felemelték a napfényre. Víz és árnyék. Ez pedig annyit jelent. – Légzésbénító ideggáz. lefelé ugrált a lépcsőkön. kérlek! – Tim azonban nem hallotta. mekkora a baj. sötét gömböket látott. – Kiszámíthatatlanok.

a fején a fülhallgató. – Futás haza! A raptor megfordult. – Tudnia kell. mi van azzal a béka-DNS-sel. Kialakítottunk bizonyos feltevéseket. A nőstény vad elszántsággal őrzi az egy méter magas. hogy nyugatabbra tartson. gyakran segít nekik széttörni azt. s végül sikeresen párosodtak nőstényekkel. Grantnál volt a vevő. hanem a kétéltű-DNS. – Még egyfajta csoportos védelem is ismeretes. – Miféle jelenségről van szó? – Nemváltásról – mondta Grant. majd pedig a vízhez lökdösi őket. – Maga viccel! – mondta Gennaro. amelyre bármely felnőtt. hogyan szaporodnak? Végül is még mindig nem magyarázta meg. hogy még egyes ma élő csúszómászók. Az állatka egészen nyugodtnak. ha jól emlékszem. például a krokodilok és alligátorok fészekrakási és fészkelési viselkedéséről is keveset tudunk. hogy hajlandóvá tegye a befogadásra. hogy az amerikai alligátoroknál csak a nőstény őrzi a fészket. azt nem tudja senki. – Pontosan. Nos. – Én fosszilis dinoszauruszfészkeket ástam ki – mondta Grant. és engedi. – Menj már! Sicc! – szólt rá Lex. hogy a hím behelyezze a péniszét. és kezével jelezte Muldoonnak. – Fogalma sincs. Erről jut eszembe – fordult Granthoz –. azonnal a segítségére siet. képesek voltak néhány hónap leforgása alatt tökéletes hímmé átalakulni. és megkérdezte: – Vajon milyen az a fészek? – Azt senki sem tudja – felelte a tudós. bizonyos halakról és kagylókról és legújabban a békáktól. – Ó! – Gennaro elnémult. a hímnek már rég nyoma veszett. vulkáni mezőkön van. ijesztő magatartást vesz fel.és állatfajról tudják már. Nem csupán fenyegető. stimulálták a hormonokat. melyeket korábban láttak tojásokat rakni. szinte szelídnek látszott a kislány kezében. – Egyszerűen nemet változtatnak. addig igen. hogy maga már ásott ki ilyet. hogy ez történt. és Lex kiemelte a raptort a ketrecből. sőt néha a szájában viszi őket odáig. amelyik hallja – akár szülő. – Vagyis a felnőtt alligátorok védik a kicsinyeiket? – Úgy van – mondta Grant. Egyes békák. – Elmagyarázta. egy-két hipotézist. – És úgy gondolja. párzás idején a hím alligátor napokon át fekszik a nőstény mellett. Grant közben a sípjelre fülelt. és minden erejével heves támadásba kezd. de hogy a valóságban milyenek voltak a fészkek. Kora tavasszal. – És mitől következik be ez? – A jelek szerint az átalakulást az olyan környezet váltja ki. a kövületek eltorzulnak az évezredek súlya alatt. – A dinók viszont nem hüllők – jegyezte meg szárazon Muldoon. hogy képes élete során megváltoztatni a nemét. más. két hónappal később. ha mind nősténynek születik. míg végül eljuttatja odáig. – Vagyis a dolog lényege. hogy nem tudja! – mondta Gennaro. és beszaladt a sűrűbe. aztán elengedte. és buborékokat fúj a pofájára. és hímgonádokat növesztettek. megkeressük végre azt a fészket? Bezsúfolódtak a dzsipbe. – Ez a vadon született állat. s amikor a fiókák nyüszíteni kezdenek. hogy számos növény. – Ez kaméleon – mondta Lex. hogy Ellie-nek volt igaza: a fészek a déli. Különösen a nyugat-afrikai békáknál. utoljára megveregette a fejét. Muldoon vezetett. hogy az felemeli a farkát. Az állat nem akart elindulni. Úgy gondolom. amelyeket igen nehéz tanulmányozni. Gennaro Granthoz fordult. A fiatal alligátorok jellegzetes kiáltást hallatnak. Először a hímek harcra kész magatartását öltötték fel. amelyben minden állat azonos nemű. és várja be a tojások kikelését. milyen az a fészek? . Egyre inkább úgy látszott. most már ingerülten. – De hát én úgy tudtam. úgy látszik. és kifelé bújnak a tojásból. – Nem a béka-DNS a lényeg – felelte Grant –. Ismeretes azonban. Meglehet. Lex még egyszer. Olyan állatok ezek. aztán megtanulták a hímek párzási hívófüttyét. – De a fossziliák. hogy ez a történet a dinoszauruszokkal is? – Hát amíg nem találunk rá jobb magyarázatot – mondta Grant –. – A többi raptor erre nem volt képes – mondta elgondolkodva Muldoon. Mire azonban a nőstény megépíti a fészket. De a jelenség főként békák esetében jól dokumentált. teljes erővel támad. Azonnal. Ebben a helyzetben bizonyos kétéltűek elkezdenek spontán módon nőstényből hímmé alakulni. kúp alakú fészket. ha bajban vannak. A kocsi bukdácsolva száguldott a főúton dél felé.– Még ilyet! – döbbent meg Muldoon. akár nem –. orchideákról. Grant megrázta a fejét. hogy a dinoszauruszok fészkelési szokásai sokkal inkább rokoníthatók egy sor különféle madáréval.

aki a fejhallgatóval a fülén haladt mellette. Már érezte a kénszagot. és elgondolkodott. Gennaro viszont egy cseppet sem volt sem hűvös. A raptor újra megjelent. mint egy nyúlüreg. igen. Halálos félelem lett rajta úrrá. Gennaro bólintott. míg egy másik a tetőre mászik. Többet nem is szólt. – Ellie már elmesélte Grantnak. Arra jutott. S hogy van-e valami. Pislogott a fényben. az intelligenciájuk azonban kétségbevonhatatlan. és láthatóan mit sem vesztett hűvös nyugalmából. hogy képes terveket szőni és kivitelezni: a csimpánzokról. mint a csimpánz. bekapcsolta. hogy a szürke papagáj nem kevesebb jelképi intelligenciával rendelkezik. Tényleg úgy tűnt. Közönségesen és klasszikusan mindössze három fajról feltételezik. Aztán még többet. – Úgy értem. azt már nem! – szólalt meg Gennaro. És most kiderül: lehetséges. hozzácsatlakoztatva a hordozható monitor. míg beáll – válaszolta Grant. – De az is tény. Egy állat alakja rajzolódott ki halványan a gőzfelhők mögött. amint elindult. amire ő egész életében várt. hogy egész életében ez járt a fejében. Aztán elszaladt. . s most sziklás rét feküdt előttük. Cowboycsizmában volt. Nem is értette. majd sivítva elugrott. hogy a papagájok érzelmi fejlettsége egy hároméves gyermekének felel meg. vezeti őket. Képesek jelképekből következtetni. ez a viselkedés olyan szellemi képességeket feltételez. Grantnak hamarosan kis videokamera volt a kezében. akkor van min eltűnődnie. kénes oszlopok sisteregve emelkedtek vállmagasságig. pokoli helyen kell lennie. virágos. Majd mélyebb.– Nincs – mondta Grant. Az alagút felső részében elég volt a fény ahhoz. Ellie-hez fordult. hogy lássák a sima földfalakat. – Magát ez nem zavarja? – kérdezte Granttól Gennaro. farmerben. amiért ezen a bűzös. Visító hangokat hallottak a mikrofonon át. Ő is velük jött. – Ennyit érnek a híres-neves szakértők! Grant fel sem vette a megjegyzést. ahol ráadásul a velociraptorok is ott ólálkodnak valahol. sok állat hangját. trombitálásszerű zajt. Gennaro úgy érezte. és sarat köpött a magasba. A csimpánzok pedig kétségkívül képesek nyelvet használni. – Várjuk meg. Ott ült. Vagy a nő. Grantra nézett. újra előbújt a kis raptor. sem nyugodt. mintha a pokolban sétálna. – No. De mindenképpen kölyök. – Olyat viszont még nem hallottam. – Azt hiszem. a gorillákról és az emberről. – Hát ez meg hová lett? – kérdezte meglepetten Ellie. Gennaro elkomorult. hogy nagyon is izgatja – felelte Ellie. Előttük pedig már feltűntek a vulkáni mezők gőzoszlopai. Kötelet kötött a kamerára. – Remek! – morogta Gennaro. – Csak nem vezetni akar minket? – Az is meglehet. Ha ez igaz. Előresiettek. Tényleg forró! Itt-ott pedig bugyborékolt. – A raptor volt az? – kérdezte Ellie. – Elment. aztán az alagút egyszerre csak hirtelen kitágult. – Mennyire értelmesek ezek? – Ha mint madarakra gondol rájuk – mondta Grant –. Akkora lehetett. Grant a fejhallgatót figyelte. hogy egy papagáj embert ölt volna – morogta Gennaro. Hatvan-hetven centiméter lehetett az átmérője. miért olyan nyugodt Grant doktor? Miért nem izgatja ez az egész? – Lehet. – Így nem fog látni semmit – vetette ellen Gennaro. Mialatt vizsgálgatták. Ellie Sattler. gondolta Gennaro. aztán hirtelen eltűnt. vajon milyen érzés lehet ez. A kutatók véleménye ma az. A kis raptor felmászott az egyik sziklára. Az orrfacsaró. Gennaro az övére csatolt gázgránátokat markolászta idegességében. s a sziklák között egy kis lyukra leltek. kívül hordott ingben. – Nem tudom. – Mondja. Csak mentek előre a bugyborékoló gőznyílások között. amelynek a földi életformák között szinte alig akad párja. Vagy egy másik. A távolból már hallották a hullámverés zaját a sziget partja felől. hogyan tud Grant ennyire nyugodt maradni. A sípoló jel megszűnt. Bizonyos új vizsgálatok arra utalnak. Ez már bebizonyosodott. Ő meg Ellie a műszerekkel kezdtek babrálni. hogy nincs ilyen. hogyan játszottak vele a raptorok a kerítésnél. Kifutott a fényre. hogy egy dinoszaurusz is képes erre. Grant hunyorgott a napfényben. – Én oda be nem megyek! Grant nem szólt. Már maguk mögött hagyták a vulkáni mezőket. Forró a talaj. hogy lekössék a figyelmét. és nyugodtan nézelődött. és leengedte a nyílásba. Aztán elszaladt. és őket figyelte. nem izgatott? – Ennek meg kell lennie! – felelte Grant. s a sípjelekre figyelt.

Grant az arcára húzta a gázálarcot. hogy a maga teremtményei. Ellie közelebb lépett. – Nem én! – Dehogynem. – Miért nem dobjuk be előbb a gázgránátokat? Miért nem csak aztán megyünk? Nem ezt diktálná a józan ész? – Ellie. – Mit szól ahhoz. A nyílás felé hátrált. maga elé nyújtotta a két karját. – Általában görcsös rángásokkal jár. A pénze révén. hány állat kelt ki. – Ide figyeljen! – mondta Grant.– Hát a hang után ítélve tényleg ez a fészek – mondta Ellie. hogy létrejöttek. de. – Igen. Aztán bekapcsolta a rádiót. várjon még egy pillanatig! – mondta hirtelen rémülettel a hangjában Gennaro. és némelyik állat görcsei közepette a fészekre zuhan. de hallani jól hallok. Ellie odaadta neki az egyik elektromos botot.. Része volt benne. – Úgy félek. Aztán távoli hang szólt: – Itt vagyok. – Hé. mert most egy kicsit ideges. s hátrafelé kinyújtva a lábát. – Kövessenek! – szakította félbe Grant. s Grant eltűnt.. Amikor Grant végül megszólalt. – Nem élvezetből teszem. akkor úgy tönkreteheti. Én megyek előre. Ha előbb megöljük őket. hogy megtudjuk. Közben felnyögött: – Épp hogy beférek! Aztán mély lélegzetet vett. Gennaro. – De hát.. Az erőfeszítései révén. és letette a földre.. aztán maga jön. furcsán. Úgy is mondhatnám. – Mi lett vele?! – kérdezte rémülten Gennaro. – Minden a legnagyobb rendben – mondta. amit mondok? Mi a véleménye? – kérdezte újra Gennaro. . hogy az ilyesmi nem kellemes látvány. – Azért megyünk be ebbe a fészekbe. És nem ölheti le őket csupán azért.. Maga is.. – Ezt nem gondolhatja komolyan! Csak nem képzeli. nálad az elemlámpa? Ellie odanyújtotta a lámpát Grantnak. hogy majd. – Fülelt még egy kicsit. – Nem egy kicsit vagyok ideges – mondta Gennaro. aztán kihúzta a kamerát. Ellie lámpáért és elektromos botért ment. szinte elképedten szólt a hangja. Nagyon heves rángásokkal. – No. utánam Ellie. elhiszem. mi volt ott. akkor gyerünk! – Felmászott az üreg bejáratához. Vagyis ezt nem tehetjük. Mr. kissé esetlenül lekuporodott. Az üreg üresen. – Látott valaha is bármit mérgesgáztól kimúlni? – Nem. a nyíláshoz hajolt. sötéten tátongott. – Magam is örülnék. hogy többé már nem is látjuk. mennyi a tojás.. és halkan kérdezte: – Alan? Sokáig nem kapott választ. Grant hátrafelé bepréselte magát a nyílásba.. ha megtehetnénk – felelte Grant. – Nézze. De Grant igent intett a fejével. Alan? Megint hosszas csend következett. egyfajta suhogó zaj hallatszott. – Ezeket az állatokat maga hozta létre. és befelé hallgatózott. de látni a világon semmit sem lehet – vitatkozott Gennaro verejtékező homlokát törölgetve. – Az igaz – mondta erre Grant –. hogy lemegyünk oda! – tiltakozott Gennaro. – Minden rendben.

hogy magyarázkodjon Harding előtt. hogy Arnolddal. A képesség. hebehurgya Gennaro úgy dönt. Akárhogy is. Hammond a lelke mélyén gyanította. hogy a Tican törzsbeli indián munkások mind pimaszak. – Azt hiszem. Végül is az alkalmazottjáról van szó. ha kimegy az ember? – Nem valószínű – mondta Harding. s ezért hibákat követett el.. hogy ez volt az oka a park végső bukásának. egy másik országban. mikor ér ide. Wu tehet róla. Közben azon gondolkodott. és aggódott. s ezt Hammond előjelnek tekintette. Kilépett a kerítéskapun. ha én kimegyek egy kicsit.. Ide-oda vetette magát a párnán. Muldoon pedig részeges alak. pályájának erre a pontjára már túlságosan elfáradt..VALÓSÁGOS PARADIGMA A kastélyban John Hammond fel-alá járkált Malcolm szobájában. hogy tényleg meghalhat. amit akar. ez a terület teljesen biztonságos. Semmi szükség nem volt rá. sem Wu. romló emberi hús szaga. mintha a barátjáról lett volna szó. Aztán szélesebbre tárta az ablakot. Hammondot pedig szorongással és rettegéssel töltötte el a gondolat. Megigazította a vezetéket. parad. hogy felégeti. Legközelebb jobban meg kell majd gondolnia. Hammond a fejét rázta.. hogy egyenletesebben folyjon az antibiotikumos infúzió. Türelmetlen volt. – Akkor nem baj. és az az örökös aggodalmaskodása. hogy Malcolm addig meg is halhat.. Hammond ugyanis tudta. Harding a legjobb esetben közömbös. Rosszabb volt így. hogy megcsodálhassák a mesekönyveikből életre kelt. Késő délután volt. Most is kisütött. – Mindjárt visszajövök. mi késztette rá. sem Arnold nem volt alkalmas erre a feladatra. Nem volt kellőképpen összeszedett. – Minden. hogy az InGen Palo Altó-i központjában két páncélteremben több tucat mélyhűtött embriót őriznek. Most. Wuból és Arnoldból egyaránt hiányzott a legfontosabb: a látnoki képesség. igaz? – Rendben van – mondta Harding. de ki tudja. lenyűgöző lényeket. hogy megoldjuk a problémákat. Hammond tovább járkált. hogy Wu nem igazán volt alkalmas a feladatra. arra a következtetésre jutott. Ami azt illeti. hogy magyarázkodjon. kómába zuhant. Azzal. A képzelőerő. Azonkívül folyton a javításokon járt az esze. amely északnak vezetett a látogatóközpont mentén. Nem. – Jó. Azt is el kellett ismernie. Gondolataiba merülve elindult bungalója felé egy keskeny ösvényen. és néha a nap is előbújik. hogy több legyen a levegő. rettenetes volt már a szag a szobában. ennek a parknak igenis van jövője! Még ha az az ostoba. Harding a fejét rázta.. Hammond úgy érezte. Hanyag volt.. aki főhajtással üdvözölte. Ed Regis sem volt szerencsés választás. Az igazi fantázia! A jövőbe látás képessége. Arnold eddigi sikerei igen jól hatottak. Mondjon akárki. szintén rossz vásárt csinált. kiket választ. az sem számít túl sokat. és ezt már elviselni is alig tudná. – Mit mondott? Valamit a paradicsomról? – Nem jól értettem – felelte Harding. még azt is .. de úgy látszik. és végignézett a parkon. javítani akart rajtuk. hogy akár soha nem látott erőforrásokat is mozgósítson az ember. Igen. Hammond nem bólintott vissza. – szólalt meg hirtelen Malcolm. hogy mindent végiggondolt. hogy olyannyira nem kedvelte a matematikust. Ilyenkor szokott elvékonyodni a szüntelen pára. Súlyos hibákat. s most már Hammond is kezdett attól tartani. hogy Malcolm halála – amennyiben bekövetkeznék – egyfajta végső elutasítással lenne egyenértékű. Az volt a véleménye. Elhaladt az egyik munkás mellett. mint főmérnökkel.. – Magához tér? – kérdezte Hammond. Természetesen már hívták a helikoptert. És fonák módon Hammond számára csak még szörnyűbbé tette a dolgot. amikor már nem bírta tovább.. Hammond kilépett a napvilágra. Semmi problémát nem okoz majd újból felnevelni őket valahol egy másik szigeten. Egészen rettenetes. ahol izgatott gyerekek nyomakodnak a kerítéshez. Miután Malcolm még egyszer összeszedte az erejét a legutóbbi kirohanáshoz. a hatalom. A rothadó. Harding. Ahelyett hogy dinoszauruszokat állított volna elő. csakhogy megvalósítsa az álmot a jövőről.. amely képes a szem előtt felidézni egy gyönyörűséges parkot. Egyébként ha a lelke mélyére néz. megszólalt: – Lehet abból valami baj. Aztán.. így halad előre a világ. túl könnyen vett egy ekkora vállalkozást.

. arccal lefelé. Majdnem biztos.. Amikor pedig visszanézett.. – Nekünk itt kell maradnunk. és nem semmisítteti meg a szigetet. ezt hallgasd meg! Megnyomott egy gombot. utána pedig egyfajta hosszan tartó visszhang következett. rex? Hogy került a kerítésen kívülre? Hammondot egy pillanatra elöntötte a düh. Egy kis patakban feküdt. Mit keres itt a T. olyan éles fájdalom hasított a jobb bokájába. csak cserepes ajka mozgott.. hogy egyre vadabbul ver a szíve. aztán rajtakapta magát. Te. Nem fog még egyszer ennyire nyilvánvaló hibákat elkövetni. rémisztően közelről szólt. és vaktában berohanjon a sűrűbe az ösvény túloldalán. és. mondta Tim. de hát Gennarót most már úgysem lehet lebeszélni. hogy megtudja. míg végül a domb alján megpihent. – Az nekünk túl veszélyes lett volna –. Amint lábra állt. Bugyborékolt körülötte a víz. botladozott. mi lesz. Hammond ült a nyirkos földön. nedves levelek és nyirkos föld csapódott az arcába. mintha a kisebbik T. közben a fogát csikorgatta. és elesett. hogy a könnye is kicsordult. . Majd ha a tyrannosaurus elment. – Hát persze – felelte a fivére. – Hadd próbáljam ki! – kérte Lex. – Amikor. Uramisten! Borzongott a hang hallatán. Addig is itt nincs veszélyben. A tyrannosaurus üvöltése. amikor felharsant. de hát ezt ki engedte meg? Érezte. mire felvételről tyrannosaurusüvöltés hangja visszhangzott a hangszórókból az egész parkban. Szinte azonnal rázuhant a sötétség.. odaát. pörgött. Megnyomta a gombot. Elesett. s az őserdő hangjait hallgatta maga körül. Aztán egy kis idő múlva segítségért kezdett kiabálni.. egy másik világ szörnyű ordítása. aztán felkászálódott. Malcolm a halálról beszél. Most meredek domboldalon rohant lefelé. mi következik most. Semmi baj! Bár nem képes megmászni a dombot. – mondta. csúszott estében a puha talajon. továbbrohant. megint futott. hogy talpra álljon. Iszonyatos volt. – Te is megcsinálhatod – mondta neki Tim. hogy eltört.. Hammond voltaképpen azért hozta ide őket. aztán látta hogy az indián munkás fejvesztve menekül. mint az a másik.. Mit fog tenni a tyrannosaurus? Vajon elkapta azt a munkást? Hammond várt. állott vízbe csapódott az arca. A vízmosás alján kell kivárnia.. – Most még egyszer! Azok az istenverte gyerekek! Nem lett volna szabad idehoznia a gyerekeket! Csak baj volt velük az első perctől fogva. – Odaát? – Azt hitte. Timmy! Én is ki akarom próbálni! Hadd szólaltassam meg most én! A gyerekek! Megint felordított a tyrannosaurus. – Ez is jó! – szólt a kislány. s Hammond ezt a pillanatot használta ki arra. Nyugalmat erőltetett magára. visszhangja is van. Várt. hogy ez az egész Costa Rica-i sziget nem volt valami bölcs választás. A tyrannosaurus újra felüvöltött. – Ez jobb. és az orrába ment.. Erre közeledett. ezúttal azonban valami sajátos. Minden más. Sérült bokájával nem tud felmászni a dombra. – Ha ezt itt megnyomod. – Klassz! – mondta Lex. megint elesett. mert azt hitte. és valahogy nehezen lélegzik. elesett. és hosszú sóhaj hagyta el a száját.. Elvesztette a fejét! Milyen ostoba! A bungalójába kellett volna futnia! Hammond átkozta önmagát.. Óvatosan megérintette a bokáját: lehet.. – Csak tekerünk egyet ezen itt. és tehetetlenül gurult lefelé. segítségért kiált. Igen. legfeljebb száz méterre lehet saját bungalójától és a látogató központtól. – folytatta Malcolm. váltás. menti az irháját. A domb lábánál fekve Hammond ismét hallotta a tyrannosaurus bömbölését. – Váltás? Malcolm nem válaszolt. – Engedj már. Mindenkinek csak útban voltak. Sekély. – Bárcsak minket is elvittek volna a fészekhez! – szólt Lex Timhez a vezérlőben. rex árnyát látta volna elsuhanni a sűrűben. Aztán felerősített gyerekhangot hallott.. Hammond olyan hirtelen pördült meg a sarkán. és nem sikerült megőriznie az egyensúlyát. és játszani kezdtek ott. hogy tovább tartson? – kérdezte a kislány. kifejezetten zenei felhangja volt a bömbölésének. hogy eltört. de csak az őserdei tücskök ciripelését hallotta. Erőlködve kényszerítette magát. hogy visszatartja a lélegzetét. hogy teljes súlyával ránehezedjen. Gennaro ettől majd meggondolja magát. Malcolm hangja nem volt több halk suttogásnál.be kell vallania. hogy elvesztette egyensúlyát. A gyerekek pedig nyilván bejutottak a vezérlőbe. Harding közel hajolt hozzá. – Úgyis lehet.

. többet. Az ilyen változás viszonylag ritka. – Nem... minden erőfeszítésük ellenére Malcolm sebesen siklik a végső delírium felé. A tudósok használatában azonban a kifejezés ennél tágabb értelmű. odaát. A „paradigma” voltaképpen ugyanaz. – Paradigmaváltás? – kérdezte Harding. Vagy a kvantummechanika. többé. Vagy két évtizede jött divatba. egy egész világszemléletet jelent.– Paradigma. – mondta végül. minden másképp van.... – Nem – nyögte Malcolm.. mi a paradigmaváltás. – Mi az. – Mert.. azóta így illik beszélni mindenféle tudományos változásról. . – Túl a paradigmán? – kérdezte Harding.. paradigma. csak más szóval. Harding mélyet sóhajtott. hogy mi. mint a modell... Hiába.. Tudta.. – Már nem számít.. túl azon. Akkor beszélnek paradigmaváltásról.. amikor a tudományos világszemlélet alapvető változáson ment keresztül.. még ha kisebbet is. A láza emelkedik.. legfeljebb évszázadonként egyszer fordul elő.. ami nem számít? – Semmi – felelte kínlódva Malcolm. Paradigmaváltást kényszerített ki például a darwini evolúció elmélete. s már alig maradt antibiotikumuk. És elmosolyodott.

A teste kiszabadult. mi van odalenn – makacskodott Gennaro. Elindult a lyuk felé. A földfalak a sötétbe vesztek előtte. a teste is elcsavarodott közben. Előrenyújtva a karját. Gennaro verejtékben tört ki. Aztán pedig zuhant. Kinyújtott karjával előrenyúlt.. Nem kényszeríthet rá. betont és hideg levegőt. – Mondom. igen.ALÁSZÁLLÁS – Maga őrült! – szólt Gennaro Ellie Sattlerhez. betonon csúszott. hogy jobb lesz. pontok ugráltak a szeme előtt. nőttönnőtt. A nyílás sötéten tátongott. – Valószínűleg – mondta. – Nem. így legalább annyit láthat. Hangok a sötétben. – Csak a Jóisten tudja. Így az utolsó pillanatban megfordult. de túlságosan is eluralkodott rajta a félelem ahhoz.. s csak halványan észlelte. Általában kiüti az embert. megint visszafordult. szinte beleveszett a szorítás fájdalmába. Igaz persze. Fekete nyílás. mint a kőszikla. és fejjel előre mászott be. – Nem tudom megtenni! Képtelen vagyok rá! – Pedig várják odalenn – mondta Muldoon. Gennaro izzadt. Elveszti az eszméletét. s a gyötrelem már-már elviselhetetlenné vált. Megindulnak a belei. Arcára húzta a gázmaszkot. az üregre pillantott. – Muszáj mennie. – Őrült. hogy az ember sokkal kisebb.. siklott a feketeség felé. – Lélegzik. ijesztően. hogy megteszi. – . a levegőt is kipréselte a tüdejéből. amint karját előrenyújtva ő is bepréselte magát hátrafelé a nyílásba. – Szinte sohasem halálos. – És mihamarább! Gennaro megint az üregre nézett. Aztán hirtelen ismét lefelé lejtett az alagút.. – Dehogy nem – felelte az szenvtelenül. hogy képtelen vagyok rá! – Pedig mennie kell! Gennaro visszafordult... Legalábbis a dinóknál. majd összeszűkültek. – Nem megyek. hogy hová megy. Távolról kicsinek látszott. nagyon összeszűkültek. – Miért suttognak? – kérdezte vissza Gennaro. A lány elmosolyodott.. – Ezt nem meri megtenni! – Én csak annyit mondok. de ahogy közeledett hozzá. úgyhogy levegőért kapkodott kínjában. Gennaro hátrafelé bemászott a lyukba. ha lemegy megszámolni azokat az állatokat – szólt Muldoon. hogy így folytassa az útját. – Hall bennünket? – kérdezte. – Kapott már áramütést ilyesmitől? – kérdezte.oké? – Úgy látszik. Felemelte a rozsdamentes acélból készült terelőbotot. Kiszélesedett. Aztán egy pillanat alatt eltűnt ő is. és gurult. a feje szédült. és az üreg szélébe kapaszkodva hátrafelé tolta magát. Gennaro a botra lesett. Ujjak érintették a testét. – Remek! Női kéz simogatta meg az arcát.. Gennaro pedig durva felszínt érzett. De többnyire nincs maradandó hatása. A dzsip mellett ácsorgó Muldoonhoz fordult.. A következő pillanatban pedig már robogott is előre. – Bizonyára – mondta Muldoon.. mint valami barlangban. hogy az alagút most egy kicsit felfelé halad. és a lábával kapálózott. mintha a föld szája volna! Aztán megint Muldoonra pillantott. Hátrafelé az ismeretlenbe: a puszta gondolat bénító rettegéssel töltötte el. Ellie volt az. a hangok irányából nyúltak felé. . aki rezzenéstelenül állt ott. Olyan hideg volt a levegő. nincs baja. amely egyre csak fokozódott. – Ez az! – mondta Muldoon. – Én ezt nem csinálom! – mondta. – Nem olyan borzasztó – mondta szárazon Muldoon.

Odalenn a nagy teremben az egyik felnőtt állat kíváncsian a hang forrása felé indult. Egy nyelv nyúlt ki. és beleszagolt a levegőbe. a hátára. Gennaro nem mert lélegzetet venni. Ellie megveregette a fiókát. aki úgy maradt. Az egyik tavalyi. – Le. sötét szemükkel pásztáztak körbe figyelmesen. alig egy fél méterrel volt az állatok fejmagassága fölött. Időnként türelmetlenül felhorkantottak. egyik-másikhoz oda is kaptak. Látta. – És meddig kell itt maradnunk? – Csak addig. Két raptor! Ahogy a párkányon térdelt. és sivítozva közeledett feléjük. A felnőtt állatok lábánál fiókák nyüzsögtek és csiripeltek. s hagyta. Ott. Az lassan elindult. Aztán elmentek onnan. teljesen kifejlett velociraptor szeme elől. de a doboztól nem látta a lányt. óvatosan.. jó – mondta a lány. Az tiltakozásul csicsergett. Ettől nyugodtabbak. – Nem értem – suttogta Gennaro. Hátrébb a sötétben nagyobb kölykök hemperegtek és játszottak fel-felhorkantva. – Nem láthatnak minket. egy acéldoboz mögött. amelyet azonban emberkéz készített. morogva. De először csak egyetlenegy dolgot látott: világító szemeket. elhallgattatni. zöld szemeket. bár a fiókák keveredtek. A fiókák úgy négy hónaposnak látszanak. Körös-körül. A felnőttek a kicsikkel gyengéden. Már csak három-négy méterre volt tőlük. A felnőttek felkapták a fejüket. Amennyire Grant meg tudta állapítani. Több nagy. a nagyobbakkal szigorúbban bántak. A felnőttek azonban láthatóan most sem vették észre őket. igyekezett megnyugtatni. Az öntött beton varratait s a kiálló acélrudakat is látta. elővigyázatosan.. ahogy az egyre jobban hozzászokott a sötétséghez. rajta a fekete dobozzal. A terület nagyjából a fészkek szerint oszlott meg. Több tucatnyi szemet. A fiókát nem takarta semmi. alig másfél méternyire tőlük. Ebben a pillanatban egy raptor fióka Ellie-hez jött. egyfajta töltésen. – Mit gondolsz. csak nagy. . és harsányan rácsicsergett a betolakodókra. Sötétzöldek voltak. s Ellie keze továbbra is a nyakörvön nyugodott. és időnként más területére is áttévedtek. majd le a nyakán. kinyújtott. Egy helyen nedves volt. a kicsi mellett guggolva. Keze elindult a bőr nyakörv felé. és recsegő zajjal felszakította a tépőzárat. Kiegyenesedve álltak. a fészkek száma három volt. levehetem róla? – kérdezte Ellie. De lehet. Idegesen kapkodták a fejüket le-föl. immár védelemben. felemelte a fejét. – Négy vagy hat felnőtt. a másik idei. és gyengéden meglökdöste a kicsit. csak gyorsan csináld! – Jó. merev farkukra támaszkodva. De szinte abban a pillanatban előrejött az egyik felnőtt. Ebben a hatalmas. A fióka nyüszített. és a lábához dörgölte a fejét. Betonpárkányon volt. – Uramisten! – szólt riadtan Gennaro. és visszatértek a főcsoporthoz. Izzó. Ellie előtt állt meg. Nagy feje egészen közel volt Ellie kezéhez. amíg megszámoljuk őket – felelte Grant.– Azért – súgta Ellie. És e pillanatban tojások sincsenek itt. Aztán az egyik elindult feléjük. hogy a kicsi végigmásszon a fején. A felnőtt felemelte a fejét. ahogy elhaladt mellettük. hogy valamiféle hatalmas föld alatti építmény belsejében vannak. és előremutatott. acélból készült transzformátordoboz nyújtott ideiglenes védelmet a számukra. A botanikusnő lenézett. – Ne mozduljon! – szólt Grant. – Miért nem támadnak? Grant a fejét rázta. és az állatka mellé guggolt. nyakuk fel-le mozgott. Az egyik kíváncsi bébi felmászott a párkányra. ha a játékuk elfajulni látszott. Meregette a szemét. hogy még annál is több! – Egész kolónia – súgta Grant. s a felnőtt állat orrára állt. – A szentségit! – morogta a foga között Gennaro. Gennaro megfordult. Valószínűleg áprilisban keltek ki. és három szülőpár gondozta őket. aztán leugrott. hogy forduljon vissza. teljes csendben. Eltakarták őket a két. Legalább két fészekalja. és megpillantotta a bőr nyakörvet. barnás tigriscsíkokkal. A raptorok nyugtalannak látszottak. A felnőttek horkantgatni kezdtek. Azonkívül fel is dörzsölte a kis állat nyakát.. visszhangzó térben sok állat volt: Gennaro legalább harmincra becsülte a raptorok számát. melyek közvetlenül előttük álltak. A többi fióka vagy kölyök. a bébi megfordult. – Csak nyugi! A felnőtt állat körmei kopogtak a betonon. lassan talpra állt. vagy két és fél méterrel a padló fölött.. Gennaro szeme most már megszokta a sötétséget. – Nyugodtak? – kérdezte Gennaro. Az megint nyüszített.

Grant összeráncolta a homlokát. ahogy a padlóra esett. hogy kilenc tojást tartalmazott. ám a szünetekben. A második fészek félbetört. hiszen azok már régen széttörtek. Grant letette a gránátot. Ellie folytatta a találgatást. Grant gondolkodott. – És hányat lát? Grant erre csak a fejét rázta. Agyagból és szalmából készült. amikor vagy csak figyeltek. a formája széles. aztán végül megfordult.. A felnőtt állat feje egy kicsit feljebb rándult. A felnőtt még Ellie mellett maradt. Alan. – Holtbiztosak persze csak akkor lehetnénk.. – Elképzelésem sincs. majd kíváncsian félrebillentette. – És csak a bébik teszik ezt? – Nem. Grant az éjszakai néző zölden foszforeszkáló fényében lekukucskált a párkányról a szobába.. s fejével Ellie felé intett. – Tán hallanak valamit. Úgy látszott. – Hogy miféle térbeli rendszer szerint helyezkednek el. vagy valahogy úgy.. Grant azonban úgy becsülte meg. Én harminchármat számoltam össze. de úgy látszott. – De azt hiszem. ha fotóznánk is. Grant annak is látta jelét. De. hogy azonosíthassák egymást. hogy megvizsgálja a zaj okát. és visszasétált a fészek központjához.. hogy milyen égtáj felé sorakoznak fel. – Nem egyértelmű. Tudniillik mind ugyanazt csinálják. hogy szabályosan felsorakoznak. lapos kosárra emlékeztetett. vagy a szemben lévő felé. Ellie-nek igaza van. lekapcsolt egyet az övéről. – Mennyi van összesen? – kérdezte Gennaro. Ekkor azonban a kicsi boldogan sivítozva elszaladt.Grant gázgránátért nyúlt. De a szünetekben. A lányon nem volt gázálarc. Az állatok ott szaladgáltak szanaszét a terem tátongó mélyében. – De hát akkor mi ez? Valamiféle társadalomszerveződés. A felnőtt állat még mindig igen közel volt Ellie-hez. így azok maradandó nyomot hagytak az agyagban. A felnőttek is. hogy három már igen hamar széttört. amelynek célja. milyen irányban helyezkedik el a testük. Tizenháromra becsülte az állatok számát.. – És kölyköt? – Huszonkettőt. – Az iránytűt nézte. és arra fordulnak. – Mindig tudtam. nem egészen – felelte a botanikusnő. – Valami kifinomultabb dolognak tűnik. Alan. – Talán valami légáramlat. mintha csak láthatatlan vonalak volnának a padlóra festve. furcsán. – Tán a bíróságon veszi hasznát? – kérdezte tőle egy kicsit gúnyosan Grant. A jelek szerint a raptorok röviddel a tojásrakás előtt építették meg a fészküket. – A feleségemtől kaptam egyszer a születésnapomra. A harmadikban tizenöt volt a tojások száma. Tizennégy tojás maradványait sikerült összeszámolnia. most már munkához láthatunk. hogyan. hogy a kolóniának van valami metastruktúrája? Mint a méneknek? – Nem. jegyzetfüzetére irányítva a lámpáját. Ellie. hol vissza a sötétbe. de az agyagban látható bemélyedéseket számba kellett vennie.. amely térbeli felállásban fejeződik ki? – Az nem lehet. – Harmincnégy született – felelte Grant.. mi lehet ez – szólt Grant. Azt hiszem úgy nagyjából északkelet-délnyugat felé fordulnak. – Én figyeltem őket – mondta Ellie. – Nem. hogy jobban hallják. – Nem tudom. Az állatok a legkülönfélébb módokon viselkedtek. Valamiféle sajátos rend vagy minta alapján állnak fel. Mindannyian. darabjaik szanaszét szóródtak a földön. – Én semmit sem érzek. Szinte mintha felsorakoznának. de a fiókák mindegyikének más-más jelek vannak a pofáján.. – Elég sötét van. adott irányokba fordultak. A csat fémje kongott. hol arra bukdácsolnak. Gennaro lassan fújta ki a levegőt. – Jézusom! Mehetünk végre? – Nem – felelte Grant. – Vagy egyszerűen valami rituális viselkedésmódról van szó – folytatta Ellie. akkor hol erre. Gondolod. hogy nincs semmiféle tágabb jelentése. – . és az elektromos botért nyúlt. s már élesítette volna. Nézd csak meg magad is! Figyeld a kicsiket! Amikor játszanak. Ellie gyengéden lecsúsztatta az állatka nyakáról a bőrszíjat. Újra előreindult. Természetesen magukat a tojáshéjakat nem számolhatta meg. – Dehogy – rázta a fejét Gennaro. hogy ez egyszer még jól jöhet! Az óra számlapja alatt iránytű volt. – mondta elgondolkodva.. De az is lehet. – Fajspecifikus viselkedésről. te semmi különöset nem vettél észre rajtuk? – Mire gondolsz? – suttogta Grant. nézd meg. hogy egy tojás eltört. Gennaro felkattintotta az órája tetejét. Vagy a felé a fal felé néznek ott. és megnézte az első fészket. hol kifutottak a fényre. Olyan tendenciaféle. Figyeld őket! Mondom. Grant eltöprengett. ám Gennaro visszatartóan fogta meg a karját. meg szaladgálnak. amikor csak állnak. vagy pihentek.

Grant éppen ugyanerre gondolt. de mintha csak bujkálnának. Vagy egyfajta kommunikációról van szó. A felnőttek egy kis ideig szinte kíváncsian nézték őket. az összes dinoszaurusz egyszerre megfordult. Lehet.Felsóhajtott. amelyek csak úgy visszhangoztak az üres. A méhek képesek a térbeli kommunikációra egyfajta tánc révén. a távoli sötétségbe. lehet. Gennaro nézte őket. Grant vállat vont. Aztán hatalmas kiáltások és huhogások közepette. A következő pillanatban a kicsik egyszer csak izgatott ugrabugrálásba és visítozásba kezdtek. hogy a dinoszauruszok egyszerűen csak furák. tág teremben. – Csak furák. és futásnak eredt. hogy a dinoszauruszok is valahogy így tesznek. . Ki tudja. majd megszólalt: – De miért nem mennek ki? – Éjszakai állatok. végig a betonalagúton. – Igen.

hogy nincs veszélyben. hogy fél lábon ugráljon felfelé. Így már jobb! Hammond megfordult. mint a csirkék. hogy egy kis sötétzöld állat ugrándozik lefelé a dombon őfelé. nem hallották meg. Arra kényszerült. De tudta: meg kell másznia a dombot. Hammond dühösen leszakított egy faágat. Körülbelül akkorák lehettek. Hammond azonban tudta. olyan a hatása. amikor az egyik kompi a hátára ugrott. amely arra szolgál. hogy a száz esztendőt is megéri. – Sicc! Tűnjetek el! – kiáltott rájuk Hammond. amely már vagy tizenkét méterrel alatta volt. Már több mint egy órája mászott felfelé.. ahogy telt-múlt a délután. de azt be kellett ismernie önmaga előtt. elesett. A visítás hangosodott. A kompik hátráltak. fel kell másznia a dombra. mint egy kivénhedt kutya. de azonnal belehasított a combjába a fájdalom. Az ápoló azt mondta.. játszani akar velük. Mielőtt elindult a pataktól. Visszanézett a patakmederre. mozgásképtelen állatokkal. Nem mozdult. majd még egy. Nehezen tudta megőrizni az egyensúlyát. csicseregtek. és megpróbálta visszanyerni a lélegzetét. álmosító. sivító hangot hallott.. mint valami narkotikumé: nyugtató. Újra eszébe jutott a méreg. Semmi fájdalom. nagyon fáradt. és úgy is jöttek lefelé a dombon. hogy végezzen a sérült. oposszum. Nemsokára több is követte. karmos kezüket mozgatták. és még egy. micsoda hőség! – gondolta. A maga részéről őszintén bízott benne. sajgott a kimerültségtől. Új csodákat alkotnia. és ezúttal úgy hajította el. majd csicsergést. és feléjük csapott. Hullarablók.. Az egyik kompi felemelkedett a domboldalon. Különösen sérült lábbal. és minden egyes alkalommal segítségért kiáltott. Nem féltek tőle.. s a másik lába most már égett. Felsorakoztak. a levelek után kaptak. rájött. Elvégre hetvenhat éves. hogy ott hagyta a csörgedező vizet. És fáradt volt. Csak aludni vágyik tőle az ember. olyasféle idegesen rángatózó mozgással. és vidáman sivalkodtak. Valamivel több mint másfél méterre maradt tőle. Harapásuk lassan ható mérget tartalmaz. még ivott belőle. Valami jön. A többi állat azonnal hátrálni kezdett. És bőven van is miért élnie. Új parkokat kell építeni. Sérült állatok. de közben elvesztette az egyensúlyát. hogy pontosan mellbe talált egy kompit. és odadobott egy követ. gondosan célzott. A lába lüktetett. s kis földdarabkák gurultak el mellette lefelé.. kartávolságon kívül. Cincogó. Aztán látta. és elindult felfelé a dombon. Ebben a korban már nem szokás hegyet mászni. hogy a menekülés egyetlen útja felfelé vezet. Az egyik ápolót egyszer megharapta egy ketrecbe zárt kompi. lehúzták a fejüket. De hát hogy is ne lenne fáradt? – gondolta. le is lökte az állatot. És most ezen igyekezett. Felkapott egy követ.. A feje kóválygott. hogy mindig meg tudja oldani a felmerülő problémákat. Alig haladt két métert. és leszánkázott a . sötétlila volt a bokája. kígyó – gondolta. A hangja azonban valahogyan nem jutott el odáig. hogy nem bánthatja őket. és rámeredt. hogy ez nem bölcs dolog. Annak ellenére. Szomjas is volt. Az ördögbe a méreggel! – gondolta Hammond. de legfeljebb a dombtetőre vezető út harmadát tette meg. Azt persze tökéletesen tudta. hogy már nem igazán akaródzik felállnia és folytatnia az útját. A kompik elugrottak. de csak egy fél métert vagy egy kicsivel többet. hogy Hammond a korához képest kitűnő kondícióban volt. És miért ne? Az egész csak azon múlik. ameddig csak lehet. Mintha csak tisztában lettek volna vele. és újra elindult fölfelé a dombon. Teljesen képtelen volt már ránehezedni. – vonta össze a szemöldökét. Mindkét kezében egy-egy faággal ugrált a bal lábán. és el kell érnie az ösvényt odafönn. Nincs más választása. Mintha azt hinnék. hátraesett. Akár sérült a lába. Dagadt. Ahogy ott ült a domboldalon. – Úristen. Vadul csapkodni kezdett a kezével. és kis. Az állatka rémülten felvisított. hogy fáradt. csak nézte őt. hogy kitisztuljon az agya. hiszen kis híján látja is a bungalóját –. A kompik nem látszottak veszélyesnek. Így aztán. mint egy csirke.HAMMOND John Hammond lezökkent a domboldal nyirkos földjére. s gurult egyet a farkán. akár nem. hogy mérgesek.. Néha fel-le ugráltak. „Úristen. – Hőség és pára!” Mintha szivacson keresztül kellene lélegeznie. kezdte felfogni. hogy az ember tudjon magára vigyázni. Az elmúlt óra során többször is mintha lépéseket hallott volna föntről. Van itt mindenfajta kis állat: patkány. Azok a rohadt kölykök! Hammond megrázta a fejét. Kompik – gondolta – és megborzongott. Valami kis madárféle ugrándozott a fűben. Figyeltek. noha tudta. Most szédelgett. Lihegett. s néha megfordult vele a világ. Mintha órák teltek volna el azóta.

és leverte az állatot a nyakáról. Malcolm teljesen tévesen elemezte a helyzetet. ahogy a hátán feküdt a domboldalon. mint az izgatott madarak. és kínlódva újra felfelé igyekezett a domboldalon. és egy picit belekapott a kezébe. Újabb kompi ugrott a hátára. amint a kompi rágcsálni kezdte a torkát. amint az állat a tarkójába harapott.domboldalon. Alighogy megállt. Hammond egészen nyugodtan feküdt. Megfordult. Megállt. és csodás nyugalom töltötte el. és erősen zihálva szembefordult a kompikkal. és félrebillentett fejjel lesték őt. hogy nincs semmi baj. Amikor újabb kompi jött. csak tessék-lássék rúgott felé. Üvöltött. Az állat meglepően könnyű. Nem történt hiba. egészen aprót. hogy vér folyik az ujjai közt. fel-le ugrabugráltak. le a gerince mentén. s a bokájába harapott. Különös nyugalom szállt rá. oly mozdulatlanul. Mintha kívülről látta volna önmagát. már-már törékeny volt. Felemelte a fejét. mint csecsemő a bölcsőjében. előreugrott egy másik kompi. Az állatkák lassan közeledtek. Hammond csak apró fájdalmat érzett. Hammond iszonyattal látta. amikor újabb kompi ugrott a mellkasára. Azok körülvették. . s Hammond rövid ideig tartó fájdalmat érzett. Nemsokára már ott csiripeltek körülötte. ahogy lefelé folyt a nyakán lévő harapásból a vállán át. Érezte a vér melegét. De megértette.

hogy a felnőtt állatok közt sem teljes az egyenlőség. mint az előbb. – Én sem – szólt Grant –. mélyebben az erdőben ott zümmögött az elektromos kerítés. amely a barlangban kezdődött. nyilvánvaló volt. csoportos mozgásuk. Meghaladta az értelmét. Ekkor dízelmotorok zakatolása hallatszott a víz felől. Kollégáihoz hasonlóan Grant is igen nagy szakértelemre tett szert a csontokat illetően. csak azt látom. hogy a dinoszauruszok esetleg teljesen másfajta állatok lehettek. Grant számára megdöbbentő volt az állatok viselkedésének összehangoltsága. De talán nem is olyan nagy rejtély az egész. Ahogyan Grant elnézte őket. Mivel azonban a paleontológusoknak csak csontok álltak a rendelkezésükre. Az állatok álltak. Aztán az állatok – egyik a másik után – egyszerre visszavonultak a mangrovemocsár-széli pálmafák árnyékába. mindegyikük körül egy csomó fióka. Álltak. hogy akár bizonyos majomhordák. Teljesen tiszta volt a térbeli elhelyezkedésük most. Mondanak valamit arról is. A csontok elárulnak valamit abból. – Te jóságos ég! – mondta hangosan Grant. amelyek tökéletesen rejtélyesek maradtak kései emlősutódaik előtt. teljesen szabályosan. Sőt.. hogy életük olyan viselkedési és társadalmi rendbeli minták alapján is szerveződhetett. amelyet odabenn észleltek. hogy a napot nem szeretik. – Hát ezt nem értem – mondta Gennaro. Mereven bámultak dél felé. – Legalább azt megtudtuk. hogy letelepedtek a part mentén. hogy közeledik. Aztán meg ott volt az a különös északkelet-délnyugati irányultságuk. A nagyobb kölykök köztük sorakoztak. Nagyjából tízméterenként helyezkedett el egy-egy felnőtt.A PART Grant rohant a dinoszauruszok után. hogy jutnak át a kerítésen – mondta Ellie. szigorú rend szerint helyezkedtek el. Végül pedig az összes állat a partra özönlött. a dinoszauruszok valamilyen merev. gondolta. hát azokat használták fel. Aztán észrevették ezt a felnőttek is. hogy most a felnőttek uralják a helyzetet. milyen kevés információ nyerhető egy csontvázból. – Nyilván hallották. s ez a csíkos fejű állat a kolónia „alfa-nősténye”. Mivel a dinoszauruszok a legalapvetőbb szempontból madarak voltak. szemben a Csendes-óceánnal. Ezzel Grant egyszerűen nem is tudott mit kezdeni. A paleontológusok olyan régóta csak ásták és ásták a csontokat kifelé. s az óceánt halvány köd takarta. már-már katonás rendben álltak fel. és rugdalták a homokot körülötte. és nézték az óceánt. És valahol menet közben ő is egyre inkább megfeledkezett a bizonyíthatatlan lehetőségekről – arról. – Nem volt valami fényes a napsütés a parton. és megnézte. hogy nézhetett ki az állat nagyjából. Nyoma sem volt már annak az összevisszaságnak. Ez az eseménysor arra engedett következtetni. s egyszer csak a parton találta magát. De miért hagyták ott a fészket oly hirtelen? Mi hozta ki az egész kolóniát a partra? Gennaro felpattintotta órája számlapját. és némán figyelték. A valóságban azonban a csontváz nagyon is kevés forrás ahhoz. aztán a ködön át egy hajót pillantottak meg. igen jellegzetes csíkkal a fején. rugalmasan szerveződtek. Grant úgy sejtette. mekkora lehetett a súlya és a magassága.. Először a kicsik jöttek izgalomba. A hímek – látta – őrzőállást vettek fel a csoport szélein. benn. A hátuk mögött. s ezáltal kikövetkeztethető egy-két dolog az állat hajdani viselkedéséről. hogyan tapadtak az izmok. ott ismét felsorakoztak a maguk sajátos módján. – Északkelet-délnyugat! Ugyanúgy. amelyek lazán. amint a teherhajó elhalad előttük. – Szóval ezért jöttek elő! – kiáltott fel halkan Gennaro. valamivel a nagyok előtt. a raptorok is egyfajta matriarchális rangsor szerint szerveződnek. szinte mint valami katonai alakulat. Grant bólintott. aztán hirtelen szinte kirobbant egy hatalmas nyíláson. az helyezkedett el a parton sorakozó egész csoport legközepén. és lassan északnak tartott. merrefelé állnak az állatok. hogy az ember következtetéseket vonjon le belőle az állat egész viselkedésével kapcsolatosan. Agyában újra lepörgette az egész eseménysort. Aztán a felnőttek a partra vezették a csapatot. hogy már régen elfelejtették. Csakhogy a majmokkal ellentétben. Mindenfelé fiatal velociraptorkölykök ugráltak. Délre volt tőlük. . Volt köztük egy nőstény. Más szempontból viszont egy cseppet sem volt meglepve. könnyű pára lebegett a levegőben. Adnak egy-két támpontot a csontokat megtámadó betegségekre vonatkozóan is. A fészkeket rejtő barlangban ugyanez a nőstény volt középen. De Grantnak az is feltűnt. hogy az élesebb hallású fiatal állatok figyeltek fel először a hajóra. A csendet csak itt-ott törte meg egy-egy halk csiripelés vagy sivítás. követte a beton kanyarulatait és lejtőit. Nagy teherhajó volt.

– Hát ezek az állatok aztán ugyancsak szeretnének megszabadulni innen – mondta a fejét ingatva Gennaro. – Egyáltalán nem akarnak megszabadulni. – Nem! – vágta rá határozottan Grant. melyek némán lesték a hajót. mit is lát. – Nem? Hát mit akarnak? – Vándorolni – felelte Grant. És ekkor hirtelen megértette.Tágra nyílt szemmel bámulta a katonás rendben felsorakozott raptorokat. .

a bungalója közelében. ő tűrte. és megkérdezte: – Kérem. Az egyik katona angolul szólt hozzájuk: – Kérem. oda. de a halványuló fényben még éppen sikerült kivennie a kis rexet. Ellie átölelte a vállát. hogy bármit is érezzen. ha még látja őket. és neki is feltette ugyanazt a kérdést. majd keletnek fordult. – No és Malcolm? Muldoon csak a fejét rázta. miközben az egyik helikopter kört írt le. Szélesen mosolygott. és a fülébe kiabált: – Azonnal el akarnak vinni bennünket! Most rögtön csinálják! A katonák az ülésekbe nyomták Grantot. Feléjük rohantak. – De jól van? – kérdezte Grant. követte a hullámok vonalát. a hasukon felcsillant fegyverzetük. narancssárga tűzgolyó robbant fel. Az ajtó nyitva maradt. – Nincs. Egy tiszt jött oda Granthoz. A dombon találtunk rá. és elordította magát. jönni velünk! Kérem! Itt nincs idő már! Grant visszanézett a partra. Grant lefelé meresztette a szemét. és egyszerre érzett szomorúságot és megkönnyebbültséget emiatt. Grant Muldoonhoz hajolt: – Mi van a többiekkel?! – kiabálta. señor. Muldoon visszakiabált: – Hardingot meg egy-két munkást már elszállítottak. Hammondot baleset érte. – Hát ez egészen fantasztikus! – Az ám! – mondta Grant. ahol az előbb a raptorok sorakoztak. hogy egy utolsó pillantást vessen a raptorokra. nehogy odanézzen. és mennyire kimerültek. elesett. ha tehetnék. és abban a pillanatban mennydörögve áttörtek a ködön a hatalmas helikopterek. aki most látta csak igazán. Grant túl fáradt volt hozzá. Grant gyorsan pergő spanyol szavakat hallott. A tiszt továbbment Gennaróhoz. aztán rádöbbent. Egy pillanat múlva az épület helyén ragyogó. A raptorok rémülten szanaszét szaladtak. ön a vezető itt? – Nem – mondta Grant. – Ön a vezető? – Nem – felelte Gennaro is. kérem? – Nem tudom. hogy a pufogó forgószárnyak alá vezessék. Tim és Lex integettek Grantnak. aztán befelé fordult. Lex sírva fakadt. Észak felé tartott a sziget fölött. amint az elrepült fölötte. mint a madaraknál! – szólt Ellie. Újra előrejött a tiszt. vajon hová vándorolnának. Valahol a hátuk mögött robbanás hangzott. és szinte az arcába hajolt. ki az óceán fölé. és olajzöld egyenruhába öltözött katonák ugráltak ki belőle. Kitárult az ajtaja. hogy leszálljon a parton. Ellie megkérdezte: – Mégis. és még egy utolsó pillanatra láthatta a gazellakecsességgel felszökő hypsilophodontákat. A tiszt Ellie-re pillantott. Végeztek vele a kompik. hová szeretnének menni? – Fogalmam sincs – felelte Grant. Minden állat eltűnt. A katonák már ráncigálták. s látta. hogy Muldoon és a gyerekek már a fedélzeten vannak. mennyire kis gyerekek még. Elfordult. amely éppen a látogatóközpont fölött úszó ködöt törte át fordulás közben. és arra. Ellie-t és Gennarót. hogy ezt már sohasem fogják megtudni. de tőle nem kérdezett semmit. Úgy látszik. – Ki a felelős vezető itt. Mintha soha nem is léteztek volna. aztán egy másik helikoptert pillantottak meg maguk előtt. mit gondolsz. Oldalra dőlve húztak a táj fölött. Már sötétedett. Lex ásítozott. s a bátyja vállának dőlt. A parton álló dinoszauruszokra gondolt. és újra kinézett az ajtón. – Én nem vagyok vezető. . Muldoon odahajolt. de már nem voltak ott. amint a helikopter felemelkedett a partról. Grant hátradőlt az ülésen. és igyekezett visszatartani. s Grant kihajolt. alul.KÖZELGŐ SÖTÉTSÉG – Migráció! Vándorlás. Felnézett a helikopterre. amely véres pofával kuporgott egy hadrosaurus fölött a lagúnánál. és segítettek becsatolni a biztonsági öveket. a gép azonban a pálmafák fölött repült. A helikopterük emelkedett. mielőtt újabb tűzgolyó robbant alattuk. és bemászott a nagy ajtón át.

és lassan nagy nehezen behúzták. . ki az? – Senki – mondta Grant. A katonák az ajtónak feszültek. mígnem az egész sziget izzott: ragyogó fényfoltnak látszott. Sűrű ködbe burkolódzott. s látta a bíborszínű ég és a tenger hátterére rajzolódó szigetet. Gyors egymásutánban követték egymást.– Ön a vezető? – Nem – felelte Grant. A helikopter felgyorsulva repült a szárazföld felé. utoljára visszanézett. amely mögött elmosódtak a robbanások fehéren izzó fényei. – Kérem. señor. Míg erőlködtek. ahogy távolodtak tőle. Grant még egyszer. nagyon kérem. Hideg lett. amely egyre kisebbedett.

hazudik. valami különös módon úgy tűnt. ismeretlen állatok ették a termést. Hammond! Grant nem szólt semmit. – De gyanítja? . Ugyanazok a részletek. – Már csak néhány napig áshatok. hogy több állat is van? – kérdezte Grant. igen – mondta Guitierrez. mintha belecsíptek volna. – A hatóságok erről nem szólnak magának – szólalt meg végül Guitierrez –. és biztosította őket. Szabadon jöhettek-mehettek. Grant kapcsolt. megkérdezte. nincs-e szükségük valamire. mit tudott Grant a tervről. egyenes vonalban – szinte nyílegyenesen a partról fel a hegyekbe. nap nap után. Montanában már augusztusban leesik az első hó. – Maga volt. és egy kitűnő San José-i szállodában helyezték el őket. Idén tavasszal az ismaloyai körzetben. hogyan kapta azt a faxot New Yorkból. hogy Hammondot vagy Ian Malcolmot eltemessék. mintha várnának valamire. igaz? – Úgy van. mert. Tudja. Csak vártak. Tény volt azonban.. Grant úgy ült fel. Maga tán igen? – Nem – mondta Grant. Végül egy napon éppen a szálloda úszómedencéje mellett ült. Guitierrez bólintott. mielőtt beáll a tél. méghozzá igen különös módon. – Mint valamiféle vándorlás – tette hozzá Guitierrez. naponta újabb és újabb állami hivatalba viszik. akit csak akartak. hogy egy csomó ember halt meg egy Costa Rica területéhez tartozó szigeten. John Hammond félrevezette őket a szigettel kapcsolatban. A kormányhivatalnokok udvariasak voltak. Mégis. – Én sem. ahol mindig egy másik fiatal. – Nos. ha elővigyázatosak. Guitierrez vállat vont. hogy több állat is van. hála Istennek. Csak agamababot meg szóját. amikor egy amerikai férfi lépett hozzá khakiszínű sortban és ingben. Guitierrez hátradőlt a nyugágyon. Ebben a helyzetben a kormány nem mutatott különösebb hajlandóságot arra. – Ezért finanszírozott kizárólag északi ásatásokat a Hammond-alapítvány? Mert hideg éghajlaton valószínűbb volt. hogy Washington mindent elkövet annak érdekében. – Csupa lizinben gazdag táplálék! És mi lett ezekkel az állatokkal? – Feltehető – mondta Guitierrez –. ami történt. – Még nem találkoztunk – mondta az amerikai. miért ment a szigetre. – Megint csecsemőket harapdálnak? – Nem. Lehet. Kutatóként dolgozom itt a cararai állomáson. – Persze – felelte Grant. hogy ki akarnak szedni belőle valamit. – Nem gondolja? – Milyen növényeket ettek? – kérdezte Grant. – Bizonyára nagyon vágyik már haza. Még abba sem egyeztek bele. és talán neheztelnek is magára azért. aki az első procompsognathus-példányt találta. – Marty Guitierrez a nevem. De az országot nem hagyhatták el. – A kormány aggódik.EPILÓGUS: SAN JOSÉ Teltek-múltak a napok. Mindenesetre nem találják őket. hogy érintetlen genetikai anyagot találnak? – Igen. Azt feltételezem. Persze nehéz is volna a dzsungelben keresgélni utánuk. Tény. Grant jó ideig arra gondolt. Újra meg újra el kellett mondania az egész történetet: hogyan ismerte meg Grant John Hammondot. s azt hívhattak fel telefonon. Mindennap meglátogatta őket egy fiatalember az amerikai követségről. Ugyanaz a mese. De valami különös dolog folyik a vidéki területeken. hogy mielőbb hazautazhassanak. a vízben játszadozó Timet és Lexet nézte. az éveket is eltölthetne ott hiába. hogy elsiesse a túlélők szabadon bocsátását. mindig elölről. – Gondolja. jobb. Grant úgy érezte. – Én nem tudom. Leült Grant mellé. – Minket pedig azért tartanak itt. hogy éppen csak sikerült elkerülni egy súlyos ökológiai katasztrófát. – Csavaros eszű egy ember volt ez a Mr. az abbamaradt! De van valami más. Még több gond.. hogy bevették magukat az őserdőbe. intelligens hivatalnok faggatja ugyanarról. Mi történt a szigeten. Úgy gondolják. az is különös. mit. Ha expedíciót küldenének az ismaloyai hegyekbe. És néha csirkét is. hogy azt hiszik. Napról-napra haladtak. be az őserdőbe. amely északon van. bár elképzelni sem tudta. mert félnek. Costa Rica kormánya úgy vélte.

Aztán sarkon fordult. – Azt akarja mondani. hogy miért ne tennék. – Egyikünk sem megy innen sehová. és elindult a szálloda kijárata felé. – Feltette a napszemüvegét.Grant bólintott. hogy nem mehetek innen sehová? – kérdezte Grant. . – Egyetértek. Valószínű. és felállt. – Nem látom okát. Grant doktor – mondta mosolyogva Guitierrez. – Lehetséges. Odaintett a medencében játszó Timnek és Lexnek. hogy igen. Guitierrez felnyomta magát a nyugágyból. – Érezze jól magát közöttünk. Grant doktor úr! Szép ország ez itt. – A gyerekeket nyilván hazaküldik – mondta.

John Ostroméból és Gregory Pauléból. A káoszelméletről folytatott eszmefuttatások részben Ivar Ekeland és James Gleick magyarázataiból származnak. a paleo-DNS-sel. George O. Stephen és Sylvia Czerkas. s az itt kifejezésre juttatott nézetek mind az enyémek. John Horneréből. köztük Kenneth Carpenter. Bőven vettem hasznát az új illusztrátornemzedék rajzainak. Ők alkotják a Berkeley Egyetem kihalt DNS-sel foglalkozó kutatócsoportját. Bizonyos. itt megjelenő gondolatoknak Charles Pellegrino adott először formát. Mindazonáltal ez a könyv merő kitalálás. Douglas Henderson és William Stout rekonstrukcióinak. John Gurche. amely a szövegben előfordulhat. a kihalt állatok genetikai anyagával kapcsolatos. Ian Malcolm alakjához a megboldogult Heinz Pagels és munkája adta a modellt. főként Robert Bakkeréből. hogyan viselkedtek a dinoszauruszok. .KÖSZÖNETNYILVÁNÍTÁS E könyv elkészítésekor sok kiváló paleontológus munkásságából merítettem. melyek új felfogást tükröznek arról. Margaret Colbert. akárcsak minden ténybeli hiba. Poinar és Roberta Hess kutatásai alapján. A grafikák egy részét Bob Gross számítógépes programjai ihlették. Mark Hallett.