In the name of Allah, The Most

Gracious, The Most Merciful

‫الإعجاز المعرفي في‬
‫القرآن الكريم و السنة‬
‫النبوية الشريفة‬
‫د‪ .‬زيد قاسم محمد غزاوي‬
‫الموقع اللكتروني‪www.quran-miracle.com :‬‬

‫كيفية تعلم علم الخلية‬
‫بالكامل من القرآن‬
‫الكريم ؟‬
‫‪How to learn Cell Sciences from‬‬
‫?‪the Noble Qur’an‬‬

‫القرآن‬
‫الكريم‬
‫كتاب يحتوي على علم كل‬
‫شيء‬
‫علم الخلق بالكامل من‬

‫أفضل علم يهدينا اليه ال عز‬
‫و جل في القرآن الكريم‬

‫أفضل منهجية بحث‬
‫يرشدنا اليها الخالق عز‬
‫و جل في كتابه العزيز‬
‫أفضل لغة لوصف هذا‬
‫العلم موجودة في‬
‫القرآن الكريم‬

‫بسم الله‬
‫الرحيم‬
‫الرحمن‬
‫َ‬
‫ن الل ّهِ يَتْلوُ‬
‫ٌ‬
‫م‬
‫ل‬
‫سو‬
‫ر‬
‫}‬
‫ِ‬
‫ُ‬
‫ّ‬
‫َ‬
‫َ‬
‫َ‬
‫فا ُّ‬
‫َ‬
‫مطهَّرة ً *‬
‫ح ً‬
‫ص ُ‬
‫ُ‬

‫سورة البينة‬

‫ُ‬
‫َ‬
‫ة{‬
‫م‬
‫ي‬
‫ق‬
‫ب‬
‫ت‬
‫صحفا فِيهَا‬
‫مطهرةك ُ ٌ ِّ َ ٌ‬

‫القرآن الكريم‬

‫فيها كتب قيمة‬

‫كتب تحتوي على علم‬
‫كل شيء‬

‫منهاج كامل في علم الخلية من‬
‫القرآن الكريم‬
Derivation of All Cell Sciences
from the Noble Qur’an

‫سورة النمل‬

‫الجبال‬

‫تخلق بعملية صنع‬

‫مخلوق من مخلوقات ال عز و جل‬
‫الصنع بحاجة الى مصنع‬

‫يصف ال عز و جل خلقه بعملية صنع‬
‫الصنع بحاجة الى مصنع‬
‫اذن يجب ان يكون هناك مصانع تنتج مركبّات الخلق‬

‫عملية الصنع بحاجة الى‪:‬‬

‫مصنع‬

‫ماهي المصانع في خلق ال سبحانه‬
‫و تعالى؟‬

‫كيفية معرفة ان الخليا هي مصانع لخلق ال عز و جل؟‬

‫المواد الخام اللزمة‬
‫للخلق‬
‫العناصر الموجودة‬
‫في التراب‬

‫المصنع‬
‫الخلية‬

‫المنتج‬
‫مركّب الكولجين‬

‫الخلية (مصنع‬
‫المركبات في جسم‬
‫النسان)‬

‫‪The Cell‬‬

‫أفضل مواصفات للمصنع‬
‫أن يكون هناك عدد كبير من المصانع التي تنتج نفس المركبات‬
‫‪‬‬

‫‪‬‬
‫‪‬‬

‫في حالة وقوع ضرر لعدد منها فإن المصانع المتبقية تفي بحاجة‬
‫الجسم (أي كمية النتاج المطلوبة)‬

‫أن يكون الناتج من المصنع غير ضار بالمخلوق‬
‫المواصفات المثالية للبيت الذي يحتوي على المصنع‪:‬‬
‫‪‬‬
‫‪‬‬
‫‪‬‬

‫أن يكون وزنه أخف ما يمكن‬
‫أن تكون قساوته و قوته عاليتين‬
‫أن يكون متزن‬

‫تصميم الهيكل الخارجي‬
‫للخلية‬

‫الخلية (مصنع‬
‫المركبات في جسم‬
‫النسان)‬

‫‪The Cell‬‬

‫كيفية معرفة المواصفات‬
‫المثالية لتصميم أي منشأ؟‬
‫يمكن معرفة الجواب من القرآن الكريم‬

‫بسم الله الرحمن الرحيم‬

‫سورة النحل‬

‫لماذا يذكر ال عز و جل النحل‪ ،‬النمل‪ ،‬البل و غيرها‬
‫في القرآن الكريم؟‬

‫ليحث المؤمن على التفكر في هذه المخلوقات‬
‫ودراستها‬

‫النحل‬
‫نظام حيوي‬

http://ag.arizona.edu/pubs/insects/ahb/inf3.html

:‫يتحمل بيت النحل‬
‫ وزن النحل‬.2
‫ اهتزازات كبيرة جدا‬.3

‫إعجاز ال عز و جل في الشكل السداسي من‬
‫ناحية إنشائية‬
‫‪‬‬

‫الشكل السداسي هو أفضل شكل لتوزيع المادة‬
‫‪‬‬

‫‪‬‬

‫تغطية أكبر حجم بأقل كمية من المادة‬

‫الشكل السداسي هو أفضل شكل لبناء المنشآت‬
‫‪‬‬
‫‪‬‬

‫استقرار كامل للمنشأ (كالبنيان المرصوص يشد بعضه بعضا)‬
‫حماية المنشأ من النهيار و تحمل الهتزازات‬

‫يؤثر وزن النحل بصورة عمودية على جدر الشكل السداسي لبيوت النحل‬

‫تحليل القوى على جدر بيوت النحل‬
F

120o

F

120o

120o

ΣF (in x-direction) = F – (2*F*cos60) =
0
ΣF (in y-direction) = F*sin60 – F*sin60
=0

F

‫التطبيقات الهندسية الناتجة من التفكر في بيوت النحل‬
‫‪‬‬

‫تعلّم أفضل تصميم لمنشأ يتحمل الوزن (الساسات على سبيل‬
‫المثال)‪:‬‬
‫‪‬‬

‫‪‬‬

‫تحمل اهتزازات كبيرة جدا بدون حدوث ازاحات كبيرة و كسور‬
‫‪‬‬

‫‪‬‬

‫أعلى قساوة و قوة للمنشأ باستخدام سبع المادة إذا ما قورنت بأساس‬
‫مسمط‬
‫التصميم السداسي للجدر (بنيان يشد بعضه بعضا)‬

‫القدرة على توصيل الطاقة الميكانيكية من نقطة لخرى بدون‬
‫ضياع في الطاقة‬

B

A

F

‫تصميم الهيكل الخارجي للخلية‬

‫‪HIV virus‬‬
‫فيروس اليدز‬

‫تصميم الثلج‬

http://www.sbu.ac.uk/water/ice1h.html

‫فيروس اليدز‬

‫عملية الصنع بحاجة الى‪:‬‬
‫مصنع‬

‫المواد الخام لتصنيع المنتجات‬

‫الرض (التراب)‬

‫بسم ال الرحمن الرحيم‬

‫سورة الحج‬

‫تحليل المواد الموجودة في التراب‬
‫‪‬‬
‫‪‬‬
‫‪‬‬
‫‪‬‬
‫‪‬‬
‫‪‬‬
‫‪‬‬
‫‪‬‬
‫‪‬‬
‫‪‬‬
‫‪‬‬

‫هيدروجين ((‪H‬‬
‫نيتروجين (‪)N‬‬
‫أوكسجين (‪)O‬‬
‫كاربون (‪)C‬‬
‫كالسيوم (‪)Ca‬‬
‫فوسفور(‪)P‬‬
‫بوتاسيوم(‪)K‬‬
‫كبريت (‪)S‬‬
‫صوديوم (‪)Na‬‬
‫كلور(‪)Cl‬‬
‫مغنيسيوم ( (‪Mg‬‬

‫‪‬‬
‫‪‬‬
‫‪‬‬
‫‪‬‬

‫يود(‪)I‬‬
‫حديد(‪)Fe‬‬
‫نحاس(‪)Cu‬‬
‫سيليكون (‪)Si‬‬

‫‪‬‬

‫المواد النشائية (الحماض المينية)‬

‫‪‬‬

‫هيدروجين ((‪H‬‬
‫نيتروجين (‪)N‬‬
‫أوكسجين (‪)O‬‬
‫كاربون (‪)C‬‬

‫‪‬‬

‫المعادن المستخدمة في نقل الطاقة و النمو‬

‫‪‬‬

‫كالسيوم (‪)Ca‬‬
‫فوسفور(‪)P‬‬
‫بوتاسيوم(‪)K‬‬
‫كبريت (‪)S‬‬
‫صوديوم (‪)Na‬‬
‫كلور(‪)Cl‬‬
‫مغنيسيوم ( (‪Mg‬‬

‫‪‬‬

‫يود(‪)I‬‬
‫حديد(‪)Fe‬‬
‫نحاس(‪)Cu‬‬
‫سيليكون (‬

‫‪‬‬
‫‪‬‬
‫‪‬‬

‫‪‬‬
‫‪‬‬
‫‪‬‬
‫‪‬‬
‫‪‬‬
‫‪‬‬

‫‪‬‬
‫‪‬‬
‫‪‬‬

‫تطابق كامل بين‬
‫المواد و المعادن‬
‫الموجودة في‬
‫التراب و الموجودة‬
‫في جسم النسان‬

Amino acids
http://www.chemie.fu-berlin.de/chemistry/bio/amino-acids_en.html

‫الحماض ألمينية‬

Alanine

Proline

Valine

‫عملية الصنع بحاجة الى‪:‬‬
‫مصنع‬
‫المواد الخام‬
‫لتصنيع المنتجات‬

‫خطوط امداد‬

‫لتزويد المصنع بالمواد‬
‫اللزمة للمنتج‬
‫(عملية التصنيع)‬

‫لخذ مخلفات المصنع‬

‫الدورة الدموية‬
‫توصيل الحماض المينية الى الخليا‬
‫(المصانع)‬

‫الشعيرات التي تمتص الماء‬
‫و المواد العضوية في‬
‫النسان‬

‫عملية الصنع بحاجة الى‪:‬‬
‫مصنع‬
‫المواد الخام‬
‫لتصنيع المنتجات‬

‫خطوط امداد‬

‫داخل الخلية (المصنع)‬
‫مالذي انت بحاجة اليه؟‬

‫عملية الصنع بحاجة الى‪:‬‬
‫مصنع‬
‫المواد الخام‬
‫لتصنيع المنتجات‬

‫خطوط امداد‬
‫معلومات (كلمات) تحتوي على المعلومات الهندسية‬
‫للمركبات المختلفة في المخلوق الذي سوف يكون‬

‫ماهي الكلمة في الخلية؟‬
‫تخزين المعلومات بطريقة هندسية‬

DNA ‫مركب‬

Tortora and Grabowski, 1996

‫وظيفة مركّب ‪DNA‬‬

‫وظيفة مركّب ‪DNA‬‬
‫‪ DNA ‬يحتوي على كلم ال عز و جل لتصنيع‬
‫المركبّات المختلفة لجسم النسان (مركب الجلد‪,‬‬
‫العظم‪ ,‬العضلت‪ ,‬و غيرها)‬
‫‪ ‬لحدوث عملية الخلق يجب أن تقرأ كلمات ال عز و‬
‫جل الموجودة على حبل (شريط) ‪DNA‬‬
‫‪ ‬ينتج خلق لمركبات الجسم البشري المختلفة عندما‬
‫تتم قراءة كلمات ال عز و جل في ‪DNA‬‬

‫تخزين المعلومات بطريقة هندسية‬
Storing of information using geometrical
methods

‫خلق مركب الكولجين (كلمة من ال عز و جل)‬

‫‪+‬‬

Collagen type V sequence
‫كلم ال عز و جل لصنع مركب الكولجين‬
Start
codon

‫تبدأ عملية القراءة بقراءة ثلث قواعد‬

AGAGGGTCCTCGGGGGCCTGGTGGACCAGGAGG
GCCCATCTGGCCCACGTCTCCTGTCTCGCCCTTTT
CTCCTGGAGGTCCTGGCAAACCCTGCAATCCC
ACTGGCCCGGGGGGTCCTGGGAAACCTCTTGAA
CCTTCATCTCCTTTCTGCCCAAACAGGCCCTGCT
GTCCACGAGGGCCAGGTTCACCATCTGCTCCCG
AAGGGCCTGGCTGTCCAATCGGGCCTTGAGGAC
CGGTAGGCCCAGGAGGACCCTGCTCGCCTTTGTC
GCCCTTGCTTCCCTTCTGCCCTGGCTCTCCGATC

‫ف تتم عملية الصنع (الخلق)‬
‫وحدات اساسية لزمة للصنع‬

‫لّف اللّه عز و جل بينها و يصبح منت‬

‫صنع (خلق)‬
‫النسان‬

‫صنع (خلق) النسان‬
‫وحدات اساسية لزمة للصنع‬

‫لّف اللّه عز و جل بينها و يصبح منت‬
‫المركبّات المؤلّفة لجسم النسان)‬

‫الوحدات الساسية‬
‫لصنع (خلق) النسان‬
‫الحماض المينية‬

19 = ‫عدد الحماض المينية‬

Amino acids
http://www.chemie.fu-berlin.de/chemistry/bio/amino-acids_en.html

‫الحماض ألمينية‬

DNA ‫مركب‬

Tortora and Grabowski, 1996

‫كلم ال عز و جل لخلق النسان‬
‫المعلومات اللزمة لصنع‬
‫مركب الحٌبٌك‬
‫(الكولجين)‬

‫الحبل الذي يحتوي على‬
‫كلم ال عز و جل لخلق‬
‫النسان‬
‫المعلومات اللزمة لصنع‬
‫مركب ‪Elastin‬‬

‫مركّب ‪DNA‬‬

‫الحماض المينية‬

‫خلق مركب الكولجين (كلمة من ال عز و جل)‬

‫‪+‬‬

‫عملية الصنع بحاجة الى‪:‬‬
‫مصنع‬
‫المواد الخام‬
‫لتصنيع المنتجات‬

‫خطوط امداد‬
‫معلومات (كلمات) تحتوي على المعلومات الهندسية‬
‫للمركبات المختلفة في المخلوق الذي سوف يكون‬

‫مركّب ‪DNA‬‬

‫الخلية (مصنع‬
‫المركبات في جسم‬
‫النسان)‬

‫‪The Cell‬‬

‫عملية الصنع بحاجة الى‪:‬‬
‫مصنع‬

‫خطوط امداد‬

‫المواد الخام‬
‫لتصنيع المنتجات‬
‫معلومات (كلمات) تحتوي على المعلومات الهندسية‬
‫للمركبات المختلفة في المخلوق الذي سوف يكون‬

‫خط انتاج‬

‫خط النتاج في الخلية‬

‫عملية الصنع بحاجة الى‪:‬‬
‫مصنع‬

‫خطوط امداد‬

‫المواد الخام‬
‫لتصنيع المنتجات‬
‫معلومات (كلمات) تحتوي على المعلومات الهندسية‬
‫للمركبات المختلفة في المخلوق الذي سوف يكون‬

‫خط انتاج‬

‫عاملون لنقل المواد الخام الى خط النتاج‬

‫العاملون في الخلية‬

‫عملية الصنع بحاجة الى‪:‬‬
‫مصنع‬

‫خطوط امداد‬

‫خط انتاج‬

‫المواد الخام‬
‫لتصنيع المنتجات‬
‫معلومات (كلمات) تحتوي على المعلومات الهندسية‬
‫للمركبات المختلفة في المخلوق الذي سوف يكون‬

‫عاملون لنقل المواد الخام الى خط النتاج‬

‫رسول لنقل المعلومات اللزمة الى خط النتاج‬

‫الخلية (مصنع‬
‫المركبات في جسم‬
‫النسان)‬

‫‪The Cell‬‬

‫عملية الصنع بحاجة الى‪:‬‬
‫مصنع‬

‫خطوط امداد‬

‫خط انتاج‬

‫المواد الخام‬
‫لتصنيع المنتجات‬
‫معلومات (كلمات) تحتوي على المعلومات الهندسية‬
‫للمركبات المختلفة في المخلوق الذي سوف يكون‬

‫عاملون لنقل المواد الخام الى خط النتاج‬

‫رسول لنقل المعلومات اللزمة الى خط النتاج‬

‫مصدر طاقة لتحريك خط النتاج‬

‫الخلية (مصنع‬
‫المركبات في جسم‬
‫النسان)‬

‫‪The Cell‬‬

‫أوكسجين‬

‫ثاني اكسيد الكربون‬

‫حرارة‬
‫جلوكوز (سكر)‬

‫ماء‬

‫عملية الصنع بحاجة الى‪:‬‬
‫مصنع‬
‫المواد الخام‬
‫لتصنيع المنتجات‬

‫خطوط امداد‬

‫لتزويد المصنع بالمواد‬
‫اللزمة للمنتج‬
‫(عملية التصنيع)‬

‫لخذ مخلفات‬
‫المصنع‬

‫نقل مخلفات الخلية (المصنع)‬
‫بواسطة الدورة الدموية من الخليا‬

‫نقل ثاني اكسيد الكربون الى الرئة‬

‫نقل الماء الزائد الى الكلى‬

‫نقل الحرارة من الخليا الى الجلد‬
‫بواسطة الدورة الدموية من الخليا‬

‫هبوب الرياح على جلد‬
‫النسان‬
‫‪Wind flow on human skin‬‬

‫جلد النسان‬

http://www.chem.boun.edu.tr/FacultyStaff/TerezaVarnali/TVFolder/Deri/skinsec.h

‫الترتيب السداسي للشعر‬
‫في جلد النسان‬

‫)(وفي أنفسكم أفل تبصرون‬
‫صدق ال العظيم‬

‫الشعر‬

‫جلد النسان‬

‫الترتيب السداسي للشعر على جلد النسان‬

‫نمط هبوب الرياح على الجلد‬

‫شعرة‬

‫أهمية التوزيع السداسي للشعر على جلد النسان‬

‫‪ ‬ينتج نمط لجريان الرياح على الجلد مطابق‬
‫لمواج الماء‬
‫‪ ‬ينتج إثارة للرياح على سطح الجلد‬
‫‪ ‬سحب الحرارة من الجسم بأعلى كفاءة‬
‫(أكبر سرعة) (متطلب رحمة)‬

‫طريق‪:‬‬

‫راءة المعلومات الهندسية لصنع المنتج عن طريق ر‬
‫تحدد المواد الساسية اللزمة لصنع المنتج‬
‫يبدأ خط النتاج بالحركة‬

‫يبدأ العاملون بنقل المواد الساسية الى خط النتاج‬

‫كب المواد الساسية مع بعضها البعض لتكوين المنت‬

Collagen type V sequence
‫كلم ال عز و جل لصنع مركب الكولجين‬
Start
codon

‫تبدأ عملية القراءة بقراءة ثلث قواعد‬

AGAGGGTCCTCGGGGGCCTGGTGGACCAGGAGG
GCCCATCTGGCCCACGTCTCCTGTCTCGCCCTTTT
CTCCTGGAGGTCCTGGCAAACCCTGCAATCCC
ACTGGCCCGGGGGGTCCTGGGAAACCTCTTGAA
CCTTCATCTCCTTTCTGCCCAAACAGGCCCTGCT
GTCCACGAGGGCCAGGTTCACCATCTGCTCCCG
AAGGGCCTGGCTGTCCAATCGGGCCTTGAGGAC
CGGTAGGCCCAGGAGGACCCTGCTCGCCTTTGTC
GCCCTTGCTTCCCTTCTGCCCTGGCTCTCCGATC

‫عملية الصنع في الخل‬

‫خلق مركب الكولجين‬
‫من قراءة كلم ال عز‬
‫و جل للخلق‬

‫مركب‬
‫الكولجين‬

‫‪Tortora and Grabowski, 1996‬‬

‫جسم النسان خُلق بعملية تركيب‬

Sequence for Elastin Molecule
Elastin ‫كلم ال عز و جل لصنع مركب‬
gagtcctccc cgagatggcg ggtctgacag cggtagtccc gcagcctggc gtcttgctga 61 tcctcttgct caacctcctc catcccgcgc agcctggagg ggttccagga gctgtgcctg 1
121 gcggacttcc tggtggagtt cccggtggag tctattatcc aggggctggt attggaggcc 181 tgggaggagg aggaggagct ctgggacctg gaggaaaacc acctaagcca
ggtgccggac 241 ttctgggaac gtttggagca ggtcctggag gacttggagg tgctggcccg ggtgcaggtc 301 tcggggcctt tcctgcaggc accttcccag gggcaggagc
tctggtgccc gggggagcag 361 caggggctgc tgcggcttat aaagctgccg ccaaagctgg ggctgggctt ggtggcgttg 421 gcggagtccc aggtggtgtt ggcgttggtg
gagttccagg tggtgttgga gttggcggag 481 tcccaggtgg tgttggagtt ggtggagtcc ctggcggtgt tggtggtatt ggtggcatcg 541 gtggcttagg agtctcgaca
ggtgctgtgg tgccccaagt cggagctggc atcggagctg 601 gaggaaagcc tgggaaagtt cctggtgttg gtcttccagg tgtataccca ggcggagtgc 661 tcccaggaac
aggagctcgg ttccctggtg tgggggtgct ccctggagtt cccactggca 721 caggagtcaa agccaaggct ccaggtggag gtggtgcttt tgctggaatc ccaggggtcg 781
gaccctttgg gggtcagcag cctggtgtcc cactgggtta tcccatcaaa gcaccaaagc 841 tgccaggtgg ctacggactg ccctatacca atgggaaatt gccctatgga gtagctggtg
901 cagggggcaa ggctggctac ccaacaggga caggggtcgg atcccaggcg gcggcggcag 961 cagctaaagc agccaagtat ggtgctgggg gagctggagt cctccctggt
gttggagggg 1021 gtggcattcc tggtggtgct ggcgcaattc ctgggattgg aggcattgca ggcgctggaa 1081 ctcctgcagc agcagctgct gcaaaggctg ctgctaaggc
tgctaagtat ggagctgctg 1141 gaggtttagt gcctggtgga ccaggagtta ggctcccagg tgctggaatc ccaggtgttg 1201 gtggcattcc tggtgttggt ggcatcccag
gtgttggggg ccctggtatt ggaggtccag 1261 gcattgtggg tggaccagga gctgtgtcac cagctgcagc tgctaaagct gctgccaaag 1321 ctgccaaata cggagccaga
ggtggagttg gcatcccgac atatggggtt ggtgctggtg 1381 gctttcctgg ctatggtgtt ggagctggag caggacttgg aggtgcaagc ccagctgctg 1441 ctgctgccgc
cgccaaagct gctaagtatg gtgctggagg agctggagcc ctgggaggcc 1501 tggtgccagg tgcagtacca ggtgcactgc caggtgcagt accagctgtg ccgggagctg 1561
gtggagtgcc aggagcaggt acccctgcag ctgcagctgc tgccgccgcc gctaaagcag 1621 ccgccaaagc aggtttgggt cctggtgttg gtggggttcc tggtggagtt
ggtgttggtg 1681 ggattcccgg tggagttggt gttggtgggg ttcctggtgg agttggccct ggtggtgtta 1741 ctggtattgg agctggtcct ggcggtcttg gaggagcagg
gtcaccggct gccgctaaat 1801 ctgctgctaa ggcagctgcc aaagcccagt acagagctgc cgctgggctt ggagctggtg 1861 tccctggatt tggggctggt gctggtgtcc
ccggatttgg ggctggtgct ggtgtccccg 1921 gatttggggc tggtgctggt gtccccggat ttggggctgg tgctggtgtc cctggatttg 1981 gagctggagc agtacctgga
tcgctggctg catccaaagc tgctaaatat ggagcagcag 2041 gtggccttgg tggccctgga ggtctcggtg gccctggagg tctcggtgga cctggaggac 2101 ttggtggggc
tggtgttccc ggtagagtag caggagctgc accccctgct gctgccgctg 2161 ctgctgccaa agctgctgct aaggctgccc agtatggcct tggtggagcc ggaggattgg 2221
gagccggtgg actgggggcc ggtggactgg gagccggtgg actgggagct ggtggactgg 2281 gagccggtgg actgggagct ggtggactgg gagccggtgg actgggagct
ggtggaggtg 2341 tgtcccctgc tgcagctgct aaggcagcca aatatggtgc tgctggcctt ggaggtgtcc 2401 taggagccag gccattccca ggtggaggag ttgcagcaag
acctggcttt ggactttctc 2461 ccatttatcc aggtggtggt gctgggggcc tgggagttgg tggaaaaccc ccgaagccct 2521 atggaggagc ccttggagcc ctgggatacc
aaggtggggg ctgctttggg aaatcctgtg 2581 gccggaagag aaagtgatct tctggggacc cctgactcgc gacctcatca acgttggtgc 2641 tactgcttgg tggagaatgt
aaaccttcta tgaccacccc ctcctccatc cccctgaccc 2701 ccacctggga ggggacaaca ggccagtggc cttggaaacc cacaggacaa ggaaatcaga 2761 cagcagcagc
catgcagccc taaccagaaa ctccccccac cctatatcag aggccagggc 2821 gggtgtccca tctcttccca cccaggagct cccccccaca gtctccatct ccaagggaaa 2881
ttggtgctac atgttggtgc ttcttctttg tggggggagg gaggagggaa gggtatccca 2941 ggggggattg cccccttccc tgaagcccct ctattaagat ggtgcacacc tttgttgggc
3001 agtcccacct ccccctgccc accaggagcc attcctggct gcatcccatt ggtacccaaa 3061 taccggaagc cttgacgatg gatttggtga catgatccct ctctctttgg
ttcccctgtc 3121 cctgcctcct gttacctaaa gctacttccc acatctggga caccctggag tcagatggct 3181 cctcacactg ggaatagctc ccttgttctt atggaatcca
cctgccatcc acccatccac 3241 ctactcatcc atccatccat ccatccatcc atccgtccat cttgactgcc tagtaccact 3301 aagctggctg ggcataccca ctatcaacct
ggttcacctg tcatggcagc ctgtccccgt 3361 ccccaccaca caccccgatc ctggcctagg gtgcaaaggg ttgtgtgggc tggttgtccc 3421 cacatgcagt actgtaaccc
cgttcttcct ggagccactc ttacagagca tgtctcacca 3481 ccccacctct ttgtgtttcg ctgtgataga tcaataaaat attttatttt ttgtcctgga 3541 tatttgggga tgatgtttga
ttgttggtgt gctctttggg tttatttttg tggctaattg 3601 gggagagaga gagagaaaaa aaaatttcta atctggggag ctatatcctc aggagaaaat 3661 tcattttaat cgctttggta
taactctgga tgaaacacac atttaaaaaa aaatcaaaaa 3721 cgaaataaga aaagagaatt aattgctcta gcaatgacta ataaatataa actttttaaa 3781 gg

‫سورة الكهف‬

‫كلم ال عز و جل لخلق‬
‫المركبّات في نحلة‬
tggtgccagg tgcagtacca ggtgcactgc caggtgcagt accagctgtg
ccgggagctg 1561 gtggagtgcc aggagcaggt acccctgcag
ctgcagctgc tgccgccgcc gctaaagcag 1621 ccgccaaagc
aggtttgggt cctggtgttg gtggggttcc tggtggagtt ggtgttggtg
1681 ggattcccgg tggagttggt gttggtgggg ttcctggtgg
agttggccct ggtggtgtta 1741 ctggtattgg agctggtcct
ggcggtcttg gaggagcagg gtcaccggct gccgctaaat 1801
ctgctgctaa ggcagctgcc aaagcccagt acagagctgc cgctgggctt
ggagctggtg 1861 tccctggatt tggggctggt gctggtgtcc
ccggatttgg ggctggtgct ggtgtccccg 1921 gatttggggc
tggtgctggt gtccccggat ttggggctgg tgctggtgtc cctggatttg
1981 gagctggagc agtacctgga tcgctggctg catccaaagc
tgctaaatat ggagcagcag 2041 gtggccttgg tggccctgga
ggtctcggtg gccctggagg tctcggtgga cctggaggac 2101
ttggtggggc tggtgttccc ggtagagtag caggagctgc accccctgct
gctgccgctg 2161 ctgctgccaa agctgctgct aaggctgccc
agtatggcct tggtggagcc ggaggattgg 2221 gagccggtgg
actgggggcc ggtggactgg gagccggtgg actgggagct
ggtggactgg 2281 gagccggtgg actgggagct ggtggactgg
gagccggtgg actgggagct ggtggaggtg 2341 tgtcccctgc
tgcagctgct aaggcagcca aatatggtgc tgctggcctt ggaggtgtcc
2401

‫يقرأ كلم ال عز و جل لخلق‬
‫المركّب‬

http://www.ars.usda.gov/is/graphics/photos/k7585-1.htm

AGAGGGTCCTCGGGGGCCTGGTGGACCAGG
AGGGCCCATCTGGCCCACGTCTCCTGT
CTCGCCCTTTTCTCCTGGAGGTCCTGGC
AAACCCTGCAATCCC
ACTGGCCCGGGGGGTCCTGGGAAACCT
CTTGAACCTTCATCTCCTTTCTGCCCAA
ACAGGCCCTGCTGTCCACGAGGGCCA
GGTTCACCATCTGCTCCCG
AAGGGCCTGGCTGTCCAATCGGGCCTT
GAGGACCGGTAGGCCCAGGAGGACCC
TGCTCGCCTTTGTCGCCCTTGCTTCCCT
TCTGCCCTGGCTCTCCGATC

‫كلم ال عز و جل‬
‫لخلق مركب إنشائي‬
‫في النبات‬

‫عملية الصنع بحاجة الى‪:‬‬

‫شارة لبداية و نهاية النتا‬

‫ما هي اللية التي و ضعها ال عز و جل في الخلية لتعرف متى تبدأ و‬
‫توقف النتاج؟‬
‫(و ترى الرض هامدة فإذا أنزلنا عليها الماء اهتزت و ربت) صدق‬
‫ال العظيم‬
‫‪‬‬

‫بحاجة الى أشارة لبدأ و توقيف النتاج‪:‬‬
‫‪‬‬

‫‪‬‬
‫‪‬‬
‫‪‬‬
‫‪‬‬

‫اشارة ميكانيكية‪ :‬عن طريق الزاحات الناتجة في الهيكل الخارجي‬
‫للخلية‬
‫اشارة كهربائية‪ :‬تيار متذبذب تحسه الخلية‬
‫اشارة مغناطيسية‪ :‬مجال مغناطيسي متغير مع الزمن تحسه الخلية‬
‫اشارة من مائع‪ :‬تدفق متذبذب للسائل المحيط بالخلية تحسه الخلية‬
‫اشارة هرمونية‪ :‬مركبات عندما تصل الى سطح الخلية تحسها الخلية‬

‫التحفيز الميكانيكي و الكهربائي للخلية‬
‫تحفيز كهربائي‬
‫تحفيز ميكانيكي‬

‫‪Electrons‬‬

‫التحفيز عن طريق مائع و هرمون للخلية‬
‫تحفيز هرموني‬
‫هرمون‬

‫تدفق‬
‫كالسيوم‬

‫تحفيز عن طريق مائع‬

‫عملية الصنع بحاجة الى‪:‬‬

‫شارة لبداية و نهاية النتا‬

‫يف تنتج اشارة بداية و نهاية‬
‫النتاج؟‬

‫كيف تنتج اشارة بداية و نهاية‬
‫النتاج؟‬

‫اشارة بداية النتاج تنتج‬
‫عندما يكون هناك حاجة‬
‫للمنتج‬
‫عندما يكون هناك حاجة لمركبات‬
‫الكالسيوم و الكولجين في العظم‬

‫الستنتاج‬
‫ال عز و جل يذكر في الية الكريمة أنه‬
‫خلق كل شيء بتقدير معين‬
‫بالنسبة للعظم‪:‬‬
‫ازاحات بتقدير معين في العظم (على اساس‬
‫الرحمة أي ل تحدث ألم أثناء الوظيفة)‬

‫إذن يوجد كل شيء في خلق ال‬
‫عز و جل على الفطرة‬

‫ال عز و جل يذكر في الية الكريمة أنه ل يوجد تغيّر لفطرة‬
‫ال عز و جل في خلقه‬

‫لضمان أنه ليوجد تغيّر في فطرة ال عز‬
‫و جل في خلقه‪ ,‬ال عز و جل وضع آليات‬
‫في خلقه تضمن أن الفطرة التي خلقت‬
‫عليها المور تبقى ثابتة و ل تتغير‬

‫اذا زادت ازاحات العظم فإن آلية التأقلم الوظيفي تعمل لرجاع العظم الى ازاحات‬
‫الفطرة التي ل تحدث الم اثناء الوظيفة‬

Osteocytes
Monitoring bone displacements

‫التركيب الداخلي للعظم‬

Increase in bone
displacements due to an
increase in muscle tension

Stimulation
signal to start
bone production
An increase in the magnetic field
generated from collagen molecules

Vibratory magnetic field is the
stimulation signal for osteoblasts
cells

Production of new collagen and
hydroxy apatite crystals

‫كيف تنتج اشارة بداية و نهاية‬
‫النتاج؟‬

‫اشارة وقف النتاج تنتج‬
‫عندما ل يكون هناك حاجة‬
‫للمنتج‬
‫عندما ل يكون هناك حاجة لمركبات‬
‫الكالسيوم و الكولجين في العظم‬

Decrease in bone
displacements due to increase
bone mass

Stopping signal
to stop bone
production
A decrease in the magnetic field
generated from collagen molecule

Reduction in vibratory signal seen by
bone cells

Stopping the production of new bone
material

‫عملية الصنع بحاجة الى‪:‬‬

‫مراقبة الجودة‬

‫خلق مركب الكولجين‬
‫من قراءة كلم ال عز‬
‫و جل للخلق‬

‫مركب‬
‫الكولجين‬

‫‪Tortora and Grabowski, 1996‬‬

‫بسم الله‬
‫الرحمن الرحيم‬
‫سورة البقرة‬

‫اتقوا ال‬
‫أي اعتصموا بال و‬
‫لتكن عندكم مخافة ال‬
‫عز و جل‬

‫ويعلمكم ال‬
‫أي يعلمكم ال عز و جل من علمه‬
‫و علم ال عز و جل موجود في‬
‫القرآن الكريم‬

‫لم يذكر ال عز و جل مصدر للعلم غير القرآن الكريم‬

‫بسم الله الرحمن‬
‫الرحيم‬

‫سورة السراء‬

‫د‪ .‬زيد قاسم غزاوي‬

‫الموقع اللكتروني‪:‬‬
‫‪www.quran‬‬‫‪miracle.com‬‬
‫‪:‬البريد اللكتروني‬
‫‪zaidquran@gmail.c‬‬
‫‪om‬‬