In the Name of Allah, the Most Gracious, the Most Merciful

Miracles of Knowledge Found in The Noble Qur’an and The Teachings of Prophet Mohammad Peace Be Upon Him
Dr. Zaid Kasim Mohammad Ghazzawi Website: www.quran-miracle.com

How to learn Cell Sciences from the Noble Qur’an?

The Noble Qur’an
A Book which contains The Knowledge of ِ Everything The Knowledge of Creation from The Creator

The Noble Qur’an
38. Allah (God) Almighty did not leave anything out from the Noble Qur’an, then people will be gathered to their Lord.

In The Name of Allah (God) Almighty The Most Gracious The Most Merciful

The knowledge of all branches of knowledge can be found in the Noble Qur’an The optimal research methodology can be found in the Noble Qur’an The terminology to describe all branches of knowledge can be found in the Noble Qur’an

In The Name of Allah (God) Almighty The Most Gracious The Most Merciful

2. A messenger from Allah (God) reciting purified pages 3. Which contain valuable books
The Noble Qur’an (98: 2-3)

Purified Pages
Containing valuable books

The Noble Qur’an
The books that contain the knowledge of everything

Derivation of All Cell Sciences from the Noble Qur’an

In the Name of Allah (God) Almighty The Most Gracious The Most Merciful

The Noble Qur’an (27: 88) 88. And you see the mountains and think them solid without movement, but they pass away as the passing away of the clouds. The manufacturing of Allah (God) Almighty, Who perfected all things, verily! He is Well-Acquainted with what you do.

The Mountains

A created being of Allah (God) Almighty

Allah (God) Almighty describes that it is created by a process of manufacturing

A manufacturing process needs a factory

Manufacturing process needs the following:

Factory

What are the factories in the ?creation of Allah (God) Almighty

The Cell

The cell (The factory in the creation of Allah (God) Almighty)

How is it concluded that that the cells are the factories in the creation of Allah (God) Almighty?

The product (Collagen molecule)

The factory ((The Cell

Raw materials needed for creation (Elements found in the soil)

Optimal Specifications for A Factory

That there should be a large number of factories which produce the same product:

In the case that if there is damage to a number of factories the remaining ones can produce the required products

 

That the product should not be harmful to the creature The optimal specifications for the structure to contain the factory:
  

It should have light weight It should have high stiffness and strength It should be stable

Cell structure
Cell cytoskeleton

The Cell

The cell (The factory in the creation of Allah (God) Almighty)

How to know the design that satisfies the optimal ?requirements for a structure
The answer can be found in the Noble Qur’an

In the Name of Allah (God) Almighty The Most Gracious The Most Merciful

68. And your Lord inspired the bee, saying: "Take you habitations in the mountains and in the trees and in what they erect.
The Noble Qur’an (16: 68)

Why does Allah (God) Almighty mention certain creatures in ?(.The Noble Qur’an (like for example, camels, bees, etc

To encourage people to think and ponder about these creatures and to learn from their design and function

Bees
A Living System

http://ag.arizona.edu/pubs/insects/ahb/inf3.html

Bee hives handle the following: 2. The weight of the bees 3. Vibrations produced by the bees

Stiff material (wax)

Hexagonal arrangement of bee hives

Soft material (Honey)

http://www.ars.usda.gov/is/graphics/photos/k7585-1.htm

The Miracles of Knowledge Found in the Hexagonal Design of Structures

The hexagonal structure is the optimal design for the distribution of matter

Covering maximum volume with minimum amount of material

The hexagonal structure is the optimal design to construct structures with, which ensures the following:
 

Complete stability Prevention of structural failure

Cell cytoskeleton

HIV virus

Structure of Ice water

http://www.sbu.ac.uk/water/ice1h.html

HIV virus

Manufacturing process needs the following: Factory Raw materials needed for products

(Earth (The Soil

‫بسم ال الرحمن الرحيم‬

‫سورة الحج‬

Analysis of Elements Found in The Soil
          

Hydrogen (H) Nitrogen (N) Oxygen (O) Carbon (C) Calcium (Ca) Phosphorus (P) Potassium (K) Sulfur (S) Sodium (Na) Chlorine (Cl) Magnesium (Mg)

   

Iodine (I) Ferrous (Fe) Copper (Cu) Silicon (Si)

Elements Comprising The Basic Building Blocks of the Human Body (i.e. Amino Acids)

Elements in The Soil Hydrogen (H) Nitrogen (N) Oxygen (O) Carbon (C)

   

   

Elements Comprising Amino Acids Hydrogen (H) Nitrogen (N) Oxygen (O) Carbon (C)

http://www.chemie.fu-berlin.de/chemistry/bio/amino-acids_en.html

The Use of the Elements Found in The Soil In the Physiological Functions of The Human Body
         

Sodium (Na) and Potassium (K) are used in the transmission of neural signals Calcium (Ca) is used in cell signaling and muscle function Ferrous (Fe) is used in mass bio-transport in the human body Phosphorus (P) is used in the construction of bone material Iodine (I) is needed for healthy functioning of glands Chlorine (Cl) is used to maintain fluids balance Copper (Cu) is used in the transmission of electrical signals Silicon (Si) is a constructional material in the human body Sulfur (S) is used in muscular proteins Magnesium (Mg) is used in the construction of bone material

Perfect correlation between the elements found in the soil and those found in the human body

Constructional Material (Amino Acids)
              

Hydrogen (H) Nitrogen (N) Oxygen (O) Carbon (C) Calcium (Ca) Phosphorus (P) Potassium (K) Sulfur (S) Sodium (Na) Chlorine (Cl) Magnesium (Mg) Iodine (I) Ferrous (Fe) Copper (Cu) Silicon (Si)

Functional Material

Amino acids
http://www.chemie.fu-berlin.de/chemistry/bio/amino-acids_en.html

Alanine

Proline

Valine

Manufacturing process needs the following:

Factory

Supply Lines
To take factory products

Raw materials needed for products

To supply the factory with raw materials

Blood Circulatory System
Delivering amino acids to the (cells (factories

Projections that absorb water and nutrients in humans

Inside the Cells ((Factory
?What is needed there

Manufacturing process needs the following:

Factory

Raw materials needed for products

Supply Lines
Information that contains the engineering design for the products to be manufactured

What is the word in ?the cell
Storing of information using a geometrical code

The word of Allah (God) Almighty for creation is found in the DNA molecule
Storing information using a geometric code

In the Name of Allah (God) Almighty The Most Gracious The Most Merciful

The Noble Qur’an (82: 8)

8. In whatever form Allah (God) Almighty willed He assembled you together

Allah (God) Almighty describes that the human body is made in a process of assembly

Thus there is a need for the information which describes the sequence and number of the basic units to be assembled

This information is the word of Allah (God) Almighty for creation (Be and it is)

DNA molecule

Tortora and Grabowski, 1996

http://www.chemie.fu-berlin.de/chemistry/bio/amino-acids_en.html

Amino acids

Every three geometrical units codes for one amino acid
DNA Molecule

Amino Acids

The word for the creation of collagen protein (Storing of Information using a geometrical code)

+
Assembly of amino acids in a specific type, number, and sequence to create proteins

The Manufacturing of Proteins within the Human Body

Start codon

Collagen type V sequence The Word of Allah (God) Almighty to create The Collagen Protein

AGAGGGTCCTCGGGGGCCTGGTGGACCAGGAGG GCCCATCTGGCCCACGTCTCCTGTCTCGCCCTTTT CTCCTGGAGGTCCTGGCAAACCCTGCAATCCC ACTGGCCCGGGGGGTCCTGGGAAACCTCTTGAA CCTTCATCTCCTTTCTGCCCAAACAGGCCCTGCT GTCCACGAGGGCCAGGTTCACCATCTGCTCCCG AAGGGCCTGGCTGTCCAATCGGGCCTTGAGGAC CGGTAGGCCCAGGAGGACCCTGCTCGCCTTTGTC GCCCTTGCTTCCCTTCTGCCCTGGCTCTCCGATC

The production of collagen proteins within the human body

‫مركب‬ ‫الكولجين‬

Tortora and Grabowski, 1996

Sequence for Elastin Molecule
The Word of Allah (God) Almighty to create The Elastin Protein

1 gagtcctccc cgagatggcg ggtctgacag cggtagtccc gcagcctggc gtcttgctga 61 tcctcttgct caacctcctc catcccgcgc agcctggagg ggttccagga gctgtgcctg 121 gcggacttcc tggtggagtt cccggtggag tctattatcc aggggctggt attggaggcc 181 tgggaggagg aggaggagct ctgggacctg gaggaaaacc acctaagcca ggtgccggac 241 ttctgggaac gtttggagca ggtcctggag gacttggagg tgctggcccg ggtgcaggtc 301 tcggggcctt tcctgcaggc accttcccag gggcaggagc tctggtgccc gggggagcag 361 caggggctgc tgcggcttat aaagctgccg ccaaagctgg ggctgggctt ggtggcgttg 421 gcggagtccc aggtggtgtt ggcgttggtg gagttccagg tggtgttgga gttggcggag 481 tcccaggtgg tgttggagtt ggtggagtcc ctggcggtgt tggtggtatt ggtggcatcg 541 gtggcttagg agtctcgaca ggtgctgtgg tgccccaagt cggagctggc atcggagctg 601 gaggaaagcc tgggaaagtt cctggtgttg gtcttccagg tgtataccca ggcggagtgc 661 tcccaggaac aggagctcgg ttccctggtg tgggggtgct ccctggagtt cccactggca 721 caggagtcaa agccaaggct ccaggtggag gtggtgcttt tgctggaatc ccaggggtcg 781 gaccctttgg gggtcagcag cctggtgtcc cactgggtta tcccatcaaa gcaccaaagc 841 tgccaggtgg ctacggactg ccctatacca atgggaaatt gccctatgga gtagctggtg 901 cagggggcaa ggctggctac ccaacaggga caggggtcgg atcccaggcg gcggcggcag 961 cagctaaagc agccaagtat ggtgctgggg gagctggagt cctccctggt gttggagggg 1021 gtggcattcc tggtggtgct ggcgcaattc ctgggattgg aggcattgca ggcgctggaa 1081 ctcctgcagc agcagctgct gcaaaggctg ctgctaaggc tgctaagtat ggagctgctg 1141 gaggtttagt gcctggtgga ccaggagtta ggctcccagg tgctggaatc ccaggtgttg 1201 gtggcattcc tggtgttggt ggcatcccag gtgttggggg ccctggtatt ggaggtccag 1261 gcattgtggg tggaccagga gctgtgtcac cagctgcagc tgctaaagct gctgccaaag 1321 ctgccaaata cggagccaga ggtggagttg gcatcccgac atatggggtt ggtgctggtg 1381 gctttcctgg ctatggtgtt ggagctggag caggacttgg aggtgcaagc ccagctgctg 1441 ctgctgccgc cgccaaagct gctaagtatg gtgctggagg agctggagcc ctgggaggcc 1501 tggtgccagg tgcagtacca ggtgcactgc caggtgcagt accagctgtg ccgggagctg 1561 gtggagtgcc aggagcaggt acccctgcag ctgcagctgc tgccgccgcc gctaaagcag 1621 ccgccaaagc aggtttgggt cctggtgttg gtggggttcc tggtggagtt ggtgttggtg 1681 ggattcccgg tggagttggt gttggtgggg ttcctggtgg agttggccct ggtggtgtta 1741 ctggtattgg agctggtcct ggcggtcttg gaggagcagg gtcaccggct gccgctaaat 1801 ctgctgctaa ggcagctgcc aaagcccagt acagagctgc cgctgggctt ggagctggtg 1861 tccctggatt tggggctggt gctggtgtcc ccggatttgg ggctggtgct ggtgtccccg 1921 gatttggggc tggtgctggt gtccccggat ttggggctgg tgctggtgtc cctggatttg 1981 gagctggagc agtacctgga tcgctggctg catccaaagc tgctaaatat ggagcagcag 2041 gtggccttgg tggccctgga ggtctcggtg gccctggagg tctcggtgga cctggaggac 2101 ttggtggggc tggtgttccc ggtagagtag caggagctgc accccctgct gctgccgctg 2161 ctgctgccaa agctgctgct aaggctgccc agtatggcct tggtggagcc ggaggattgg 2221 gagccggtgg actgggggcc ggtggactgg gagccggtgg actgggagct ggtggactgg 2281 gagccggtgg actgggagct ggtggactgg gagccggtgg actgggagct ggtggaggtg 2341 tgtcccctgc tgcagctgct aaggcagcca aatatggtgc tgctggcctt ggaggtgtcc 2401 taggagccag gccattccca ggtggaggag ttgcagcaag acctggcttt ggactttctc 2461 ccatttatcc aggtggtggt gctgggggcc tgggagttgg tggaaaaccc ccgaagccct 2521 atggaggagc ccttggagcc ctgggatacc aaggtggggg ctgctttggg aaatcctgtg 2581 gccggaagag aaagtgatct tctggggacc cctgactcgc gacctcatca acgttggtgc 2641 tactgcttgg tggagaatgt aaaccttcta tgaccacccc ctcctccatc cccctgaccc 2701 ccacctggga ggggacaaca ggccagtggc cttggaaacc cacaggacaa ggaaatcaga 2761 cagcagcagc catgcagccc taaccagaaa ctccccccac cctatatcag aggccagggc 2821 gggtgtccca tctcttccca cccaggagct cccccccaca gtctccatct ccaagggaaa 2881 ttggtgctac atgttggtgc ttcttctttg tggggggagg gaggagggaa gggtatccca 2941 ggggggattg cccccttccc tgaagcccct ctattaagat ggtgcacacc tttgttgggc 3001 agtcccacct ccccctgccc accaggagcc attcctggct gcatcccatt ggtacccaaa 3061 taccggaagc cttgacgatg gatttggtga catgatccct ctctctttgg ttcccctgtc 3121 cctgcctcct gttacctaaa gctacttccc acatctggga caccctggag tcagatggct 3181 cctcacactg ggaatagctc ccttgttctt atggaatcca cctgccatcc acccatccac 3241 ctactcatcc atccatccat ccatccatcc atccgtccat cttgactgcc tagtaccact 3301 aagctggctg ggcataccca ctatcaacct ggttcacctg tcatggcagc ctgtccccgt 3361 ccccaccaca caccccgatc ctggcctagg gtgcaaaggg ttgtgtgggc tggttgtccc 3421 cacatgcagt actgtaaccc cgttcttcct ggagccactc ttacagagca tgtctcacca 3481 ccccacctct ttgtgtttcg ctgtgataga tcaataaaat attttatttt ttgtcctgga 3541 tatttgggga tgatgtttga ttgttggtgt gctctttggg tttatttttg tggctaattg 3601 gggagagaga gagagaaaaa aaaatttcta atctggggag ctatatcctc aggagaaaat 3661 tcattttaat cgctttggta taactctgga tgaaacacac atttaaaaaa aaatcaaaaa 3721 cgaaataaga aaagagaatt aattgctcta gcaatgacta ataaatataa actttttaaa 3781 gg

In the Name of Allah (God) Almighty The Most Gracious The Most Merciful

The Noble Qur’an (18: 109)

109. Say (O Muhammad peace be upon Him to mankind). "If the sea were ink for (writing) the Words of my Lord, surely, the sea would be exhausted before the Words of my Lord would be finished, even if we brought (another sea) like it for its aid."

The human body is created in a process of assembly

The Manufacturing (Creation) of The Human Body

The Manufacturing (Creation) of The Human Body

Basic units needed for the manufacturing process

Allah (God) Almighty links them together and products are created (products needed for the assembly of the human body)

The Basic Units needed for The Manufacturing (Creation) of The Human Body
Amino Acids

Amino Acids
http://www.chemie.fu-berlin.de/chemistry/bio/amino-acids_en.html

DNA molecule

Tortora and Grabowski, 1996

The Words of Allah (God) Almighty for the Creation of The Human Body
Information needed for the assembly of collagen protein

The rope that contains the information for the assembly of each component of the human body Information needed for the assembly of elastin protein

DNA Molecule
DNA Molecule

Amino Acids

The word for the creation of collagen protein (Storing of Information using a geometrical code)

+
Assembly of amino acids in a specific type, number, and sequence to create proteins

Manufacturing process needs the following:

Factory

Raw materials needed for products

Supply Lines
Information that contains the engineering design for the products to be manufactured

DNA Molecule

The Cell

Manufacturing process needs the following:
Information that contains the engineering design for the products to be manufactured Factory
Raw materials needed for products

Supply Lines

Assembly Line

Assembly Line in the Cell

Manufacturing process needs the following:
Information that contains the engineering design for the products to be manufactured Factory
Raw materials needed for products

Assembly Line

Supply Lines Workers to transport raw materials to the assembly line

Workers in the Cell

Manufacturing process needs the following:
Information that contains the engineering design for the products to be manufactured Factory
Raw materials needed for products

Assembly Line

Supply Lines

A messenger to transport information to the assembly line

The Cell

Manufacturing process needs the following:
Information that contains the engineering design for the products to be manufactured

Factory
Raw materials needed for products

Assembly Line
A messenger to transport information to the assembly line

Supply Lines

Energy to activate the assembly line

The Cell

Carbon Dioxide

Oxygen

Heat

Water

Glucose (Sugar)

The manufacturing process needs:

Assembly Line
To take factory products
To supply the factory with raw materials

Transporting Factory Products Using Blood Circulatory System

Transporting Carbon Dioxide to the Lungs

Transporting Excess Water to the Kidneys

Transporting Heat from The Cells to The Skin
Using Blood Circulatory System

Wind flow on human skin

Human Skin

http://www.chem.boun.edu.tr/FacultyStaff/TerezaVarnali/TVFolder/Deri/skinsec.h

Hexagonal arrangement of hair on human skin

Hair

Human Skin

Hexagonal arrangement of hair on human skin

Hair

The pattern wind makes on human skin with hair

The Importance of The Hexagonal Arrangement of Hair
 Produces

a pattern of wind flow exactly like the flow of water waves
It generates turbulence on the surface of the skin  Removal of heat with maximum efficiency

The manufacturing process follows the following steps: Information is read by a messenger to assemble the products Basic raw materials needed for assembly are selected Assembly line is activated Workers start to carry raw materials to the assembly line Raw materials are assembled together to create the product

Start codon

Collagen type V sequence The Word of Allah (God) Almighty to create The Collagen Protein

AGAGGGTCCTCGGGGGCCTGGTGGACCAGGAGG GCCCATCTGGCCCACGTCTCCTGTCTCGCCCTTTT CTCCTGGAGGTCCTGGCAAACCCTGCAATCCC ACTGGCCCGGGGGGTCCTGGGAAACCTCTTGAA CCTTCATCTCCTTTCTGCCCAAACAGGCCCTGCT GTCCACGAGGGCCAGGTTCACCATCTGCTCCCG AAGGGCCTGGCTGTCCAATCGGGCCTTGAGGAC CGGTAGGCCCAGGAGGACCCTGCTCGCCTTTGTC GCCCTTGCTTCCCTTCTGCCCTGGCTCTCCGATC

The Manufacturing of Proteins within the Human Body

The production of collagen proteins within the human body

‫مركب‬ ‫الكولجين‬

Tortora and Grabowski, 1996

The human body is created in a process of assembly

Sequence for Elastin Molecule
The Word of Allah (God) Almighty to create The Elastin Protein

1 gagtcctccc cgagatggcg ggtctgacag cggtagtccc gcagcctggc gtcttgctga 61 tcctcttgct caacctcctc catcccgcgc agcctggagg ggttccagga gctgtgcctg 121 gcggacttcc tggtggagtt cccggtggag tctattatcc aggggctggt attggaggcc 181 tgggaggagg aggaggagct ctgggacctg gaggaaaacc acctaagcca ggtgccggac 241 ttctgggaac gtttggagca ggtcctggag gacttggagg tgctggcccg ggtgcaggtc 301 tcggggcctt tcctgcaggc accttcccag gggcaggagc tctggtgccc gggggagcag 361 caggggctgc tgcggcttat aaagctgccg ccaaagctgg ggctgggctt ggtggcgttg 421 gcggagtccc aggtggtgtt ggcgttggtg gagttccagg tggtgttgga gttggcggag 481 tcccaggtgg tgttggagtt ggtggagtcc ctggcggtgt tggtggtatt ggtggcatcg 541 gtggcttagg agtctcgaca ggtgctgtgg tgccccaagt cggagctggc atcggagctg 601 gaggaaagcc tgggaaagtt cctggtgttg gtcttccagg tgtataccca ggcggagtgc 661 tcccaggaac aggagctcgg ttccctggtg tgggggtgct ccctggagtt cccactggca 721 caggagtcaa agccaaggct ccaggtggag gtggtgcttt tgctggaatc ccaggggtcg 781 gaccctttgg gggtcagcag cctggtgtcc cactgggtta tcccatcaaa gcaccaaagc 841 tgccaggtgg ctacggactg ccctatacca atgggaaatt gccctatgga gtagctggtg 901 cagggggcaa ggctggctac ccaacaggga caggggtcgg atcccaggcg gcggcggcag 961 cagctaaagc agccaagtat ggtgctgggg gagctggagt cctccctggt gttggagggg 1021 gtggcattcc tggtggtgct ggcgcaattc ctgggattgg aggcattgca ggcgctggaa 1081 ctcctgcagc agcagctgct gcaaaggctg ctgctaaggc tgctaagtat ggagctgctg 1141 gaggtttagt gcctggtgga ccaggagtta ggctcccagg tgctggaatc ccaggtgttg 1201 gtggcattcc tggtgttggt ggcatcccag gtgttggggg ccctggtatt ggaggtccag 1261 gcattgtggg tggaccagga gctgtgtcac cagctgcagc tgctaaagct gctgccaaag 1321 ctgccaaata cggagccaga ggtggagttg gcatcccgac atatggggtt ggtgctggtg 1381 gctttcctgg ctatggtgtt ggagctggag caggacttgg aggtgcaagc ccagctgctg 1441 ctgctgccgc cgccaaagct gctaagtatg gtgctggagg agctggagcc ctgggaggcc 1501 tggtgccagg tgcagtacca ggtgcactgc caggtgcagt accagctgtg ccgggagctg 1561 gtggagtgcc aggagcaggt acccctgcag ctgcagctgc tgccgccgcc gctaaagcag 1621 ccgccaaagc aggtttgggt cctggtgttg gtggggttcc tggtggagtt ggtgttggtg 1681 ggattcccgg tggagttggt gttggtgggg ttcctggtgg agttggccct ggtggtgtta 1741 ctggtattgg agctggtcct ggcggtcttg gaggagcagg gtcaccggct gccgctaaat 1801 ctgctgctaa ggcagctgcc aaagcccagt acagagctgc cgctgggctt ggagctggtg 1861 tccctggatt tggggctggt gctggtgtcc ccggatttgg ggctggtgct ggtgtccccg 1921 gatttggggc tggtgctggt gtccccggat ttggggctgg tgctggtgtc cctggatttg 1981 gagctggagc agtacctgga tcgctggctg catccaaagc tgctaaatat ggagcagcag 2041 gtggccttgg tggccctgga ggtctcggtg gccctggagg tctcggtgga cctggaggac 2101 ttggtggggc tggtgttccc ggtagagtag caggagctgc accccctgct gctgccgctg 2161 ctgctgccaa agctgctgct aaggctgccc agtatggcct tggtggagcc ggaggattgg 2221 gagccggtgg actgggggcc ggtggactgg gagccggtgg actgggagct ggtggactgg 2281 gagccggtgg actgggagct ggtggactgg gagccggtgg actgggagct ggtggaggtg 2341 tgtcccctgc tgcagctgct aaggcagcca aatatggtgc tgctggcctt ggaggtgtcc 2401 taggagccag gccattccca ggtggaggag ttgcagcaag acctggcttt ggactttctc 2461 ccatttatcc aggtggtggt gctgggggcc tgggagttgg tggaaaaccc ccgaagccct 2521 atggaggagc ccttggagcc ctgggatacc aaggtggggg ctgctttggg aaatcctgtg 2581 gccggaagag aaagtgatct tctggggacc cctgactcgc gacctcatca acgttggtgc 2641 tactgcttgg tggagaatgt aaaccttcta tgaccacccc ctcctccatc cccctgaccc 2701 ccacctggga ggggacaaca ggccagtggc cttggaaacc cacaggacaa ggaaatcaga 2761 cagcagcagc catgcagccc taaccagaaa ctccccccac cctatatcag aggccagggc 2821 gggtgtccca tctcttccca cccaggagct cccccccaca gtctccatct ccaagggaaa 2881 ttggtgctac atgttggtgc ttcttctttg tggggggagg gaggagggaa gggtatccca 2941 ggggggattg cccccttccc tgaagcccct ctattaagat ggtgcacacc tttgttgggc 3001 agtcccacct ccccctgccc accaggagcc attcctggct gcatcccatt ggtacccaaa 3061 taccggaagc cttgacgatg gatttggtga catgatccct ctctctttgg ttcccctgtc 3121 cctgcctcct gttacctaaa gctacttccc acatctggga caccctggag tcagatggct 3181 cctcacactg ggaatagctc ccttgttctt atggaatcca cctgccatcc acccatccac 3241 ctactcatcc atccatccat ccatccatcc atccgtccat cttgactgcc tagtaccact 3301 aagctggctg ggcataccca ctatcaacct ggttcacctg tcatggcagc ctgtccccgt 3361 ccccaccaca caccccgatc ctggcctagg gtgcaaaggg ttgtgtgggc tggttgtccc 3421 cacatgcagt actgtaaccc cgttcttcct ggagccactc ttacagagca tgtctcacca 3481 ccccacctct ttgtgtttcg ctgtgataga tcaataaaat attttatttt ttgtcctgga 3541 tatttgggga tgatgtttga ttgttggtgt gctctttggg tttatttttg tggctaattg 3601 gggagagaga gagagaaaaa aaaatttcta atctggggag ctatatcctc aggagaaaat 3661 tcattttaat cgctttggta taactctgga tgaaacacac atttaaaaaa aaatcaaaaa 3721 cgaaataaga aaagagaatt aattgctcta gcaatgacta ataaatataa actttttaaa 3781 gg

‫كلم ال عز و جل لخلق‬ ‫المرك ّات في نحلة‬ ‫ب‬
tggtgccagg tgcagtacca ggtgcactgc caggtgcagt accagctgtg ccgggagctg 1561 gtggagtgcc aggagcaggt acccctgcag ctgcagctgc tgccgccgcc gctaaagcag 1621 ccgccaaagc aggtttgggt cctggtgttg gtggggttcc tggtggagtt ggtgttggtg 1681 ggattcccgg tggagttggt gttggtgggg ttcctggtgg agttggccct ggtggtgtta 1741 ctggtattgg agctggtcct ggcggtcttg gaggagcagg gtcaccggct gccgctaaat 1801 ctgctgctaa ggcagctgcc aaagcccagt acagagctgc cgctgggctt ggagctggtg 1861 tccctggatt tggggctggt gctggtgtcc ccggatttgg ggctggtgct ggtgtccccg 1921 gatttggggc tggtgctggt gtccccggat ttggggctgg tgctggtgtc cctggatttg 1981 gagctggagc agtacctgga tcgctggctg catccaaagc tgctaaatat ggagcagcag 2041 gtggccttgg tggccctgga ggtctcggtg gccctggagg tctcggtgga cctggaggac 2101 ttggtggggc tggtgttccc ggtagagtag caggagctgc accccctgct gctgccgctg 2161 ctgctgccaa agctgctgct aaggctgccc agtatggcct tggtggagcc ggaggattgg 2221 gagccggtgg actgggggcc ggtggactgg gagccggtgg actgggagct ggtggactgg 2281 gagccggtgg actgggagct ggtggactgg gagccggtgg actgggagct ggtggaggtg 2341 tgtcccctgc tgcagctgct aaggcagcca aatatggtgc tgctggcctt ggaggtgtcc 2401

‫يقرأ كلم ال عز و جل لخلق‬ ‫المر ّب‬ ‫ك‬

http://www.ars.usda.gov/is/graphics/photos/k7585-1.htm

Every manufacturing process needs:

A signal to start and stop production

How does the cell know when to start producing ?proteins ‫)و ترى الرض هامدة فإذا أنزلنا عليها الماء اهتزت و ربت( صدق‬ ‫ال العظيم‬

Need a stimulating signal which can be:

   

Mechanical: by deformations of the cytoskeleton of the cell Electrical: AC electric current Magnetic: Varying magnetic field Fluidic: Oscillating flow Hormonal: proteins that work on the surface of the cell stimulating the production of a certain protein

Mechanical and electrical stimulation of cells
Mechanical stimulation Electrical stimulation

Electrons

Mechanical and electrical stimulation of cells
Fluidic stimulation Hormonal stimulation Hormone

Ca flux

Every manufacturing process needs:
A signal to start and stop production

How is the signal for starting and stopping production generated?

How is the signal for starting and stopping production generated?

Staring signal is generated when there is a need for the product When there is a need for new collagen and hydroxy apatite for example

Osteocytes Monitoring bone displacements

Internal Design of Bone

Increase in bone displacements due to an increase in muscle tension

Stimulation signal to start bone production
An increase in the magnetic field generated from collagen molecules

Vibratory magnetic field is the stimulation signal for osteoblasts cells

Production of new collagen and hydroxy apatite crystals

How is the signal for starting and stopping production generated?

Stopping signal is generated when there is no need for the product When there is no need for new collagen and hydroxy apatite for example

Decrease in bone displacements due to increase bone mass

Stopping signal to stop bone production
A decrease in the magnetic field generated from collagen molecule

Reduction in vibratory signal seen by bone cells

Stopping the production of new bone material

Every manufacturing process needs:

Quality Control

Manufacturing collagen molecule by reading of Allah (God) Almighty words

‫مركب‬ ‫الكولجين‬

Tortora and Grabowski, 1996

In the Name of Allah (God) Almighty The Most Gracious The Most Merciful

282. So be afraid of Allah (God); and Allah (God) teaches you. And Allah (God) is the All-Knower of each and everything.
The Noble Qur’an (2: 282)

Be a God fearing person

And Allah (God) will teach you i.e. Allah (God) Almighty will increase you from His knowledge and the knowledge of Allah (God) Almighty is found in the Noble Qur’an

Allah (God) Almighty did not mention a source of knowledge besides the Noble Qur’an

In The Name of Allah (God) The Most Compassionate The Most Merciful

The Noble Qur’an (17: 82)

82. Allah

(God) sends down the Qur’an that is healing and mercy to those who believe and it increases the wrong-doers nothing but loss.

Dr. Zaid Kasim Ghazzawi my For detailed information please visit
Website at:

E-mail: zaidquran@yahoo.co m

www.quranmiracle.com

Master your semester with Scribd & The New York Times

Special offer for students: Only $4.99/month.

Master your semester with Scribd & The New York Times

Cancel anytime.