Curso: Biología Celular y Molecular

Oscar Nolasco Cárdenas MSc.
oscarnol@hotmail.com
Noviembre 2012

DNA - historia
1866 Gregor Mendel Publico sus resultados sobre los factores de la herencia.

1868 descubrimiento de la nucleina (DNA) Friedrich Miescher

1902 Walter Sutton Interrelaciona la citología y el Mendelismo (morfología & herencia). Cromosomas son unidades hereditarias. Esta teoría también fue desarrollada por Theodor Boveri

1928 Fred Griffith Propuso la existencia de un principio transformante en sus ensayos con diplococos.

1944 Oswald Avery,Colin MacLeod,Maclyn McCarty. Reportaron que el principio transformante de Griffith era el DNA.

Oswald Avery Colin McLeod

Neumococos R vivos inoculados junto con neumococos S inactivados por calor producían la muerte del ratón

Maclyn McCarty
live S strain

1950 Erwin Chargaff Determino que los organismos vivos presentan una razon constante entre Adeninas con Timinas y Guaninas con Citocinas.

1951 Rosalind Franklin Obtuvo las fotografias de difraccion de rayos X del DNA

Rosalind Franklin

Maurice Wilkins

1952 Martha Chase y Alfred Hershey empleando bacteriofagos marcados con 35S y 32P demostraron que el DNA es una molécula hereditaria

1953 Francis Crick y James Watson resolvieron la estructura tridimensional del DNA.

1958 Matthew Meselson y Frank Stahl empleando isotopos demostraron la propiedad semiconservativa de la replicación del DNA.

1958 Arthur Kornberg Purifico la DNA polimerasa I de E. coli, La primera enzima que sintetisa DNA en un tubo de ensayo 1966 Marshall Nirenberg, H. Gobind Khorana Led descifran el código genético determinan que los codones (tripletes de nucleotidos de mRNA) son específicos para un aminoácido. 1970 Hamilton Smith Kent Wilcox Aislo la primera enzima de restricción, HindII: que corta el DNA en un sitio de reconocimiento especifico. 1977 Fred Sanger Desarrolla el método del nucleotido terminador para el secuenciamiento de DNA. 1978 Somatostatin es la primera hormona humana en producirse por la tecnologia del DNA recombinante. 1983 Kary B. Mullis Propuso el método de Reacción en Cadena de la Polimerasa (PCR) para amplificar DNA 1988 - 2003 Se desarrolla el proyecto genoma Humano 2007 DNA de J Watson secuenciado en 2 meses 454 Life sciences (ROCHE)

EL DOGMA CENTRAL DE LA BIOLOGIA MOLECULAR

DNA
.

Replicación

CCTGAGCCAACTATTGATGAA

transcripción Reversa RNA CCUGAGCCAACUAUUGAUGAA traducción Proteína

PEPTIDE

Acido Nucléico: polímero de nucleótidos

Componentes de un nucleótido:
base N + pentosa + fosfato

Componentes de un nucleósido:
base N + pentosa

Azúcares de los ácidos nucléicos

DNA
Bases nitrogenadas de los ácidos nucléicos

RNA

(DNA)

(RNA)

Nomenclatura de nucleótidos y nucleósidos BASE Purinas Adenina Adenosina Desoxiadenosina Guanina Guanosina Desoxiguanosina Adenilato RNA Nucleósido Nucleótido Acido nucleico

Desoxiadenilato DNA Guanilato RNA

Desoxiguanilato DNA

Pirimidinas
Citocina Timina Uracilo Citidina Deoxicitidina Timidina o deoxitimidina Uridina Citidilato Deoxicitidilato Timidilato o deoxitimidilato Uridilato DNA DNA DNA RNA

Características de los Nucleótidos

Las bases nitrogenadas se unen al azúcar por enlace B glucosidico

Los nucleótidos en el DNA se unen mediante enlace fosfodiester

Apareamiento de bases en el DNA: Puentes de hidrogeno

A
C

T
G

DNA: Dos hebras antiparalelas forman la doble hélice de DNA

A Vista del enlace de las bases B Vista de inicio a fin de las cadenas

Formas de DNA

Forma A

Forma B

Forma Z

Sentido de la helice Diametro Bases por torcion

Hacia la derecha aprox 26 Å 11

Hacia la derecha aprox 20 Å 10.5 3.4 Å

Hacia la izquierda aprox 18 Å 12 3.7 Å

Distancia entre pares de bases 2.6 Å

La forma B es referida a la de Watson – Crick Z alternancia de G y C, presente como segmentos en eucariotes y procariotes, con funcion quizas regulatoria de expresión

El DNA puede disociarse o asociarse por la complementaridad de su secuencia nucleotidica: Denaturación reversible del DNA

La renaturación permite hacer análisis de hibridación cuando se mezclan dos hebras de DNA que comparten cierto grado de similaridad en su secuencia

La denaturación esta relacionada al % de GC.
Organismos que presentan mayor % de GC en su secuencia genómica soportan temperaturas altas

Una secuencia con mayor % de GC presentara un tm mayor que una secuencia con alto contenido de AT (El tm es la Temperatura media de Melting o de disociación en el que la denaturacion de las hebras de ADN es del 50%)

Debido a las bases nitrogenadas el DNA absorbe luz ultravioleta. El efecto denominado hipercromicidad se da al denaturar el DNA, así las bases están expuestas y puede absorber mayor cantidad de luz ultravioleta

Replicación de DNA

Replicación del DNA según Watson y Crick

La replicación

Ocurre en un origen de replicación único en DNA circulares (plasmidos)

En eucariotes es complejo y se da en varios origenes de replicación

La síntesis de la nueva hebra es en sentido 5’

a 3’

La síntesis de DNA en E. coli, Empieza con la unión de proteínas dnaA a la secuencia de origen (ori)
Secuencia Ori 5’ 3’

A

A

A

3’ 5’

Unión de proteínas de dnaA

La región rica en A T es denaturada y hexameros de DnaB (helicasa) se unen al DNA en colaboración con DnaA

Iniciación de la síntesis de DNA en E. coli origen (ori)
Secuencia Ori
5’ 3’

A A

A

A

3’ 5’

Unión de proteínas dnaA

A A
A

A

A

Inducción de la denaturación del DNA por las proteínas de dnaA

Las proteínas dnaB y dnaC se unen al single-stranded DN

A
A A

A
A

A

B C

dnaB desenrrolla el DNA

Se une la dnaG (primase)

A
A A

A

A

G

B C
A

dnaB desenrrolla las hélices, desplazando a las dnaA

A
A A

...y se sintetiza un cebador RNA primer

G

A
A A

B C

RNA primer

G B C

Primasoma dna B (helicasa) dna C dna G (primasa)

5’

DNA molde (template strand) 3’ 3’ OH 5’ RNA primer (~5 nucleotidos)

• DNA girasa es una topoisomerasa II, que rompe el DNA e introduce
superocoil negativo a la cabeza de la horquilla de replicación • Fluoroquinolona inhibe DNA girasas en muchas bacteras gram-negativas: ciprofloxacina y levofloxacina (Levaquin)

Telomeros y edad
Metaphase chromosome

Telomeros son capuchones protectivos“caps” sobre el extremo de los cromosomas y consisten de repeticiones cortas en tandem de 5-8 bp de una secuencia rica en GC, Previenen desde fusiones Cromosomas y rearreglos del kariotipo.

telomero

centromero

telomero <1 to >12 kb (TTAGGG)muchos Edad joven

telomero estructura

(TTAGGG)poco

Edad senil

• telomerasa (una enzima) requerida para mantener la longitud de las células germinales • La mayoría de las células somaticas disminuye el nivel de la actividad de la telomerasaevels of telomerase y asi sus cromosomas se acortan en cada división

32

Mecanismo de duplicación en el DNA mitocondrial

La duplicacion se inicia en el loop D

Duplicación en el proceso de conjugación bacteriana. Transferencia del pili F (plasmido sexual)

Organización común de las DNA polimerasa

Los nucleótidos adicionados son nucleótidos trifosfatos

El mecanismo involucra iones Mg que coordinan con el grupo fosfato y tres residuos Asp de La enzima DNA polimerasa

Las enzimas polimeras tienen un mecanismo de relectura o de proofreading (actividad exonucleasa 3’ a 5’) Evita la mala incorporación de un nucleotido La DNA polimerasa controla la fidelidad de la replicación

Sistemas de reparación corrigen el daño en el DNA

El sistema de excision de nucleotido NER repara los daños provocados por radiación ultravioleta: Puede ocurrir la reparación en forma global o acoplada a la transcripción

El sistema de reparación excision de base BER, repara daños de deaminacion o rupturas en una sola cadena

El sistema de reparación por recombinación homologa HR y de unión de extremos EJ, reparan la ruptura de las cadenas de DNA

Sistema de reparación de una mala incorporación o mal apareamiento MMR

Cambios tautoméricos durante la replicación

Cromosomas

El DNA es altamente comprimido en todos los tipos de genomas

En el bacteriofago

En bacterias

En mamiferos

Los cromosomas están divididos en distintas regiones. Un bandeo característico se da por facilidad de coloración de algunas regiones, se desconoce el porque solo se conoce que las regiones decoloradas contienen mas cantidad de GC

• En eucariotas, el DNA se encuentra empaquetado con proteinas histonas dentro de la cromatina. • Las unidades básicas de la cromatina son los nucleosomas.

Organización del DNA en el cromosoma

Estructura de los nucleosomas
• Nucleosoma
• 146 pb de DNA alrededor de 8 moléculas de histonas • Cinco tipos de histonas 2 x (H2A, H2B, H3, H4) forman el núcleo octamérico H1 interacciona con el DNA conector y delimita al nucleosoma 2 vueltas adicionales de DNA 200pb

Modificaciones covalentes de las histonas regulan la funcionalidad del DNA
• Los eventos epigenéticos son aquellas variaciones en la expresión de un gen que no se acompañan de cambios en la secuencia de DNA. • Las cadenas laterales de las histonas sufren modificaciones. • Modificaciones postraduccionales: – Acetilación – Fosforilación – Metilación(más estable) – Otras…

HISTONAS

Acetilación de histonas
• Se produce en residuos de lisina y es reversible. • Las histonas acetiladas están asociadas a la cromatina transcripcionalmente activa y las histonas desacetiladas a la cromatina inactiva. • La acetilación neutraliza la carga positiva de las lisinas.

HATs
• Histona acetiltransferasas. • Estas modificaciones ocurren en el extremo amino terminal de las histonas. • La primera familia de las HATs es la superfamilia GNAT, que incluye las proteínas que envuelven, unen e inician la transcripción como la Gcn5 y PCAF, elongación como Elp3.

HDACs
• Están asociados a complejos proteicos. • Se han encontrado deacetilasas en subunidades de complejos polipeptídicos que actúan como correpresores y silenciadores de genes. • La Rpd3 y Hda1eliminan grupos acetil críticos de las histonas, empaquetando la cromatina en una forma inactiva (heterocromatina).

• La formación de la heterocromatina es mediado por proteínas Sir2, Sir3 y Sir4, estudios recientes han encontrado que Sir2 presentan un Nad dependiente de la actividad HDAC. • También se ha visto que la desacetilación de la lisina 16 de H4 es importante para la interacción de Sir3 y Sir4.

Metilacion de Histonas
•Es uno de los mecanismos de regulación que pta diversas funciones asociadas a la activación o a la represión de un gen.

•HMTs

Sign up to vote on this title
UsefulNot useful