MD.MAHTAB M.Sc.

BIOTECHNOLOGY

Era of DNA Technology: Information through DNA

“The molecule is so beautiful. Its glory was reflected on Francis and me.” - James Watson on DNA

Biometrics uniquely recognizing humans .

It is the job of DNA to control the order in which these 20 different amino acids are put together. .The molecule of life: DNA The “blueprints” (genetic information) for making proteins is stored within our DNA.1% that makes all the difference! Any type of organism can be identified by examination of DNA sequences which is unique to that species.9% the same. The DNA of every human being on the planet is 99. It is the 0.

Technology Transition       “ DNA Fingerprinting” – Dr. Alec Jeffrey – 1985 “DNA Profiling” – FBI (RFLP) – 1988 PCR STRs – 1993 Mitochondrial DNA .1996 SNPs Chips .

genes. are used to make specific strings of DNA letters that are cut into patterns of shorter strings separated by length these banding patterns can identify a unique human being! YOUR DNA Banding Pattern Will Identify YOU! Image of a DNA fingerprint .YOUR DNA: Your Ultimate Genetic Bar Code DNA Fingerprinting is a method where: •a person’s genetic traits.

.

Restriction Fragment Length Polymorphism (RFLP) •Detects a single base pair change in DNA •Must occur within a restriction enzyme cleavage sequence to be visible •It is the length differences associated with DNA strands or RFLPs that allow one to distinguish one person from another •Often used in disease screening such as in the detection of sickle cell anemia .

RFLP .

.

What creates this unique pattern? Satellite DNA: repetitive DNA sequence. Macrosatellite: core sequence 100 to 6500bp Minisatellite: core sequence of 10-20bp repeated multiple times Microsatellite: small arrays of tandem repeats of 2 to 4bp in length .

Repeats of Satellite DNA Repeat units vary in length from 2bp to long stretches of 6000bp or more These repeat units are lined up head to tail and compose satellite DNA and are interspersed throughout the genome The number of units varies person to person Thus these sequences are called VNTRs (variable number of tandem repeats) A VNTR is a locus that is hyper variable due to a large number of alleles each characterized by a different number of repeat units .

Southern blotting can be used to visualize the variation Probes specific to the repeat unit are hybridized to DNA cut with a restriction enzyme that cuts just outside the VNTR This allows for the difference in VNTR length to be detected Two commonly used probes are known as: 33.6 (AGGGCTGGAGG)18 31.5 (AGAGGTGGGCAGGTGG)29 These are multi-locus minisatellite probes and show about 17 different DNA bands for each individual .

or hair roots Instead of digesting the DNA PCR is used to amplify the VNTRs and the products are run on a gel and visualized by staining This process requires primers that anneal just outside the VNTR .PCR amplification of VNTR PCR is particularly useful in forensic analysis as it allows minute amounts of DNA to be analyzed DNA can be obtained from blood stains. semen. saliva.

.

.

but use the smallest repeats units often only 2 to 4 bp in length aatttttgtattttttttagagacggggtttcaccatgttggtcaggctgactatgga gt tattttaaggttaatatatataaagggtatgatagaacacttgtcatagtttagaacg aa ctaacgatagatagatagatagatagatagatagatagatagatagatagatagacag at tgatagtttttttttatctcactaaatagtctatagtaaacatttaattaccaatatt tg 13 core loci of tetrameric repeats are tested together to make a DNA profile The sequence above is locus D7S280 which is located on chromosome 7 .Short Tandem Repeats (STR) Are a variation on VNTRs.

Applications of DNA Fingerprinting .

DNA isolated from those evidence can be compared through VNTR patterns. Useful in solving crimes like murder and rape. Example: The scandal of President Clinton with Monica Lewinsky   . blood or semen.Criminal Identification & Forensics    DNA fingerprints can be used as biological evidence Strands of DNA can be found on hair.

CODIS – Combined DNA Index System • National software developed by the FBI • Distributed to local. and national crime labs • All 50 states mandate inclusion of DNA fingerprint (if available) from violent and sexually motivated crimes • Mostly a database of STR regions • Thousands of matches have led to the capture of criminals that otherwise would not have been caught •This has led numerous people to suggest a national DNA database that would include only polymorphism information… . state.

.

the excluded male. the biological father. No bands are shared between the child and alleged father #2 (AF2).Parentage tests  determine if the alleged father of a child is the biological father  The child (C) will share one band with the biological mother (M) and one band with alleged father #1 (AF1). .

Accessexcellence.org. 2006 Kathleen McNamara-Schroeder‡. 2008. Sixth Edition. Butler.D. (http://www. and in revised form.fbi. (2008) Forensics. Wikicrimeline. As Retrieved 2010-02-09 John M.co.D. Simon Chu. (Write Science Right) © 2008 Nature Education Citation: Chial.htm) Kijk magazine. 2009-09-01. Ph. Nature Education 1(1) "CODIS — National DNA Index System". Maria C.gov/hq/lab/codis/clickmap. Fbi. Forensic DNA Typing: Biology. San Diego State University. The Columbia Encyclopedia. November 21. Cheryl Olonan‡.gov. Mahta Alviri. K. DNA fingerprinting. Second Edition. (2008) DNA fingerprinting using amplified fragment length polymorphisms (AFLP): No genome sequence required. and CODIS. 2005. "Restrictions on use and destruction of fingerprints and samples". San Diego. Technology. Academic Press. Love§ From the Department of Chemistry and Biochemistry. Retrieved 2010-04-03. Nature Education 1(1) Forensics. and John J. DNA Fingerprinting. Shannon Ginty. 01 January 2009 Use of DNA in Identification". Ph. Lewinsky scandal". 2005.uk. 06/2008. DNA Fingerprint Analysis of Three Short Tandem Repeat (STR) Loci for Biochemistry and Forensic Science Laboratory Courses□S Received for publication. and Genetics of STR Markers. Montoya. H. (Write Science Right) © 2008 Nature Education Citation: Norrgard. Codis Statistics. California 92182-1030          . April 3. Retrieved 2010-04-03.References  DNA Fingerprinting Using Amplified Fragment Length Polymorphisms (RFLP) By: Heidi Chial. and CODIS By: Karen Norrgard. Retrieved 2010-04-03.

Sign up to vote on this title
UsefulNot useful