Aquí se describe un nuevo procedimiento para aumentar el nivel de multiplexación PCR. Usamos la supresión de PCR (PS) efecto . Esto permite la amplificación de PCR con un único objetivo cebador específico; otro cebador es común para todos los objetivos y corresponde a un adaptador se ligó a ambos extremos de los fragmentos genómicos (Fig. 1 ). En PS basada en PCR (PCR PS) del adaptador es de alrededor de 40 bases de largo y tiene un alto contenido de GC. Durante la PCR, después de cada etapa de desnaturalización, autocomplementarios ricos en GC extremos de cadena sencilla (ss) fragmentos formar dúplex fuertes, por lo que todos los fragmentos de ADN ss adoptar estructuras de horquilla. La replicación de estos fragmentos de ADN utilizando el cebador correspondiente al adaptador (A cebador) se suprime. Sin embargo, la síntesis se puede producir a partir de un cebador (cebador T) complementaria a un objetivo situado dentro del bucle de ss de la estructura de horquilla, y este producto se amplifica a continuación de manera eficiente por los cebadores A y T. Como resultado, eficiente PCR sólo es posible para que contienen fragmentos de destino-. Debido a que el cebador A es el mismo para todos los objetivos, tales PCR permite la amplificación con un único cebador específico de la diana. PS PCR se ha utilizado con éxito en una ), variedad de aplicaciones: Ruta del genoma , la hibridación de sustracción de cDNA y dirigido presentación diferencial genómico Aquí nos muestran que la PS PCR permite la amplificación eficiente de destino multiplex con la especificidad de alelo.

Multiplex PCR es una técnica generalizada biología molecular para la amplificación de múltiples objetivos en un único experimento de PCR. En un ensayo de multiplexación, más de una secuencia diana puede ser amplificado mediante el uso de múltiples pares de cebadores en una mezcla de reacción. Como una extensión de la utilización práctica de la PCR, esta técnica tiene el potencial de producir un ahorro considerable de tiempo y esfuerzo en el laboratorio sin comprometer la utilidad del experimento. Multiplex PCR es una técnica generalizada biología molecular para la amplificación de múltiples objetivos en un único experimento de PCR. En un ensayo de multiplexación, más de una secuencia diana puede ser amplificado mediante el uso de múltiples pares de cebadores en una mezcla de reacción. Como una extensión de la utilización práctica de la PCR, esta técnica tiene el potencial de producir un ahorro considerable de tiempo y esfuerzo en el laboratorio sin comprometer la utilidad del experimento. • .

Primer Parámetros de diseño para Multiplex PCR Diseño de conjuntos de cebadores específicos es esencial para una reacción multiplex éxito. Las consideraciones de diseño importantes de cebadores se describen a continuación son una clave para la amplificación específica con un alto rendimiento. • 1. Primer Largo Multiplex PCR ensayos implican el diseño de gran número de cebadores, por lo tanto, se requiere que el cebador diseñado debe ser de longitud apropiada. Por lo general, los cebadores de corta longitud, en el intervalo de 18-22 bases se utilizan. 2. Temperatura de fusión Cebadores con Tm similares, preferiblemente entre 55 ° C-60 ° C se utilizan. Para las secuencias con alto contenido de GC, cebadores con una Tm superior (preferiblemente 75 ° C-80 ° C) se recomiendan. Una variación de Tm entre 3 ° -5 ° C es aceptable para los primers utilizados en una piscina. 3. Especificidad Es importante tener en cuenta la especificidad de los cebadores diseñados para las secuencias diana, mientras que la preparación de un ensayo múltiple, especialmente dado que la competencia existe cuando varias secuencias diana están en un solo recipiente de reacción. 4. Evitar la formación de Primer Dimer Los cebadores diseñados deben ser revisadas para la formación de dímeros de cebadores, con todos los cebadores presentes en la mezcla de reacción. La dimerización conduce a la amplificación inespecífica. El resto de parámetros son similares a las directrices estándar de PCR primer diseño

• •

Ventajas de Multiplex PCR

1. Controles Internos
Los problemas potenciales en una PCR simple incluir falsos negativos debido a la falta de reacción o falsos positivos debido a la contaminación. Los falsos negativos a menudo se revela en ensayos multiplex porque cada uno de amplificación permite un control interno para los otros fragmentos amplificados. 2. Eficiencia El gasto de los reactivos y tiempo de preparación es menor en PCR multiplex que en sistemas en los que varios tubos de PCR Uniplex se utilizan. Una reacción multiplex es ideal para la conservación de la polimerasa costoso y plantillas escasas. 3. Indicación de Calidad Plantilla La calidad de la plantilla se puede determinar con más eficacia en multiplex que en una simple reacción de PCR. 4. Indicación de la cantidad de plantilla La amplificación exponencial y estándares internos de PCR múltiple se puede utilizar para evaluar la cantidad de una plantilla determinada en una muestra. Para cuantificar con precisión por plantillas multiplex PCR, la cantidad de plantilla de referencia, el número de ciclos de reacción, y la inhibición de la duplicación mínimo teórico de producto para cada ciclo debe tenerse en cuenta. Aplicaciones de la PCR Multiplex • • • • • • • • La identificación de patógenos Alto rendimiento SNP genotipificación Análisis de mutación Gene análisis de deleción Plantilla de cuantificación El análisis de ligamiento La detección del ARN Estudios Forenses

• • • • •

Oligonucleótidos no fosforilados, sin etiqueta o etiquetado con fluorescencia, ADN a partir de linfocitos de sangre periférica de donantes anónimos se aisló utilizando un kit Qiagen Blood de acuerdo con el protocolo del fabricante (Qiagen, Chatsworth, CA). AmpliTaq y AmpliTaq Gold ADN polimerasas son de Applied Biosystems, polimerasa KlenTaq ADN de péptidos Ab (St. Louis), y Taq ADN polimerasa de Amersham Pharmacia El DNA genómico humano se digirió con Rsa I enzima de restricción (New England Biolabs) y se ligó con adaptadores compuestos de dos oligonucleótidos hibridados: TGTAGCGTGAAGACGACAGAAAGGGCGTGGTGCGGACGCGGG y CCCGCGTCCGC. Los oligonucleótidos complementarios son de diferentes longitudes para asegurar la polaridad correcta de la ligación a fragmentos genómicos de extremos romos. Los extremos con muescasde los fragmentos de ADN ligados se llena de forma automática en la primera ronda de PCR posterior en presencia de dNTPs y ADN polimerasa.

Adaptador-ligated ADN (2-5 ng) se amplificó por PCR en un volumen de reacción de 25μ l que contiene: 1 x tampón de PCR (dependiendo de la ADN polimerasa) • • • • • 2,5 mM de MgCl 2 250 mM de cada dNTP, 5-10 pmol de cada uno cebador, 2,5 unidades de ADN polimerasa termoestable. Las mezclas de PCR que contienen todos los componentes, excepto los cebadores fueron desnaturalizados a 95 ° C durante 3-10 min, la mezcla de cebador (5-10 pmol de cada uno) se añadió a 95 ° C, y 38 ciclos de PCR (94 ° C durante 10 sec , 68 ° C durante 15 s, y 72 ° C durante 1 min) se realizaron. El cebador A común para todos los objetivos fue marcado con fluoresceína, y los productos de PCR se analizaron por electroforesis en un gel de agarosa 2% y por 6% PAGE desnaturalizante. Para realizar la determinación del genotipo de fibrosis quística (FQ) en una mpxPCR ADN, muestras de ADN fueron preamplificada en un ciclo de PCR con los cebadores 15 1, 2, 4 (Tabla 1 ), el anidado regulador de conductanciatransmembrana de la fibrosis quística (CFTR) cebador 12 (Tabla 2 ), y el cebador A, TGTAGCGTGAAGACGACAGAA. Entonces 1 l de producto diluido 500 veces PCR se volvió a amplificar en una PCR 38-ciclo con una mezcla de los cuatro cebadores T (incluyendo cebador CFTR normal o mutante, cebadores 10 o 11, Tabla 2 ) y el cebador A, GAAAGGGCGTGGTGCGGACGCGG, utilizando las mismas condiciones de PCR descritas anteriormente.

• •

Productos de PCR (2-3 μl) se desnaturalizaron durante 3 min a 90 °C en una solución stop, y se analizaron usando PAGE de 6% desnaturalizante y se analizó en un sistema automatizado de fluorescencia láser (ALF) instrumento de secuenciación (Amersham Pharmacia).

CFTR fragmentos de ADN fueron amplificados de ADN mediante el uso de fluoresceína GGGAGAACTGGAGCCTTCAGAG y en el primers GGGTAGTGTGAAGGGTTCATATGC. • Producto de PCR (5-10 fmol) se secuenció mediante el uso de un fmol DNA kit de secuenciación (Promega) de acuerdo con el protocolo del fabricante y los productos se resolvieron mediante 6% PAGE en un instrumento ALF secuenciación (Amersham Pharmacia).

PS basada mpxPCR dirigido a varias secuencias anónimos en el cromosoma 7 de ADN. 5 ng de Rsa I digerido con ADN genómico humano con adaptador ligado se amplificó en una reacción de 25 l que contiene 1 x tampón de PCR (PE), 2,5 mM de MgCl 2 , 250 mM de dNTP, 2,5 unidades de ADN polimerasa termoestable [a (1:1 : 1) mezcla de Taq , AmpliTaq, y AmpliTaq Gold ADN polimerasas] y 5 pmol de cada cebador. El marcado fluorescentemente Un cebador fue TGTAGCGTGAAGACGACAGAA, que correspondía a la parte 5 'más exterior de la adaptador ligado. Para los cebadores T véase la Tabla 1 . • • ( A ) Rsa I mapas de restricción de dos fragmentos de cromosoma 7 humano con los cebadores de PCR. ( B ) La resolución de los productos mpxPCR mediante el uso de 2% electroforesis en gel de agarosa. ( 1 ) PCR con los cebadores T 1 + 2; ( 2 ) PCR con los cebadores T 3 + 4; ( 3 ) PCR con cebadores de la T 1 + 2 + 3 + 4 (véase la Tabla 1 ), (M) 100 - pb marcador de tamaño. ( C ) Resolución de la 4-plex ( Top ; cebadores 1-4 en la Tabla 1 ) y 5-plex ( Bottom ; cebadores 1-5 en la Tabla 1 ) productos de la PCR mediante el uso de 6% PAGE y un secuenciador ALF. Los números por encima de los picos muestran las longitudes de amplicón. El amplicón 1-kb-PCR larga está más allá de la ventana emergente.

14-fold mpxPCR. a ) A 5-plex PCR se realizó con los cebadores 1-5 (Tabla 1 ), ( b ) 4-plex PCR con cebadores 2, 3, 5, y 8 (Tabla 2 ), ( c ) 5-plex PCR con cebadores 1, 4, 6, 7, y 9 (Tabla 2 ): ( d ) 14-plex PCR con cebadores 1-5 (Tabla 1 ) más cebadores 1-9 (Tabla2 ). Primers 2, 3, y 5 (Tabla 2 ) fueron los tipos normales.Otras condiciones fueron como en la fig. 2 . El fragmento de 450 pb (gen de aldolasa B; cebador 4 en la Tabla 2 ) apareció como un pico doble, como ya lo hizo en una PCR uniplex (datos no mostrados). El fragmento 1-kb de longitud (producto generado por el cebador 5 en la Tabla 1 ) está más allá de la ventana mostrada. Longitudes de los fragmentos (pb) se indican encima de los picos. El amplicón de 200 bp de largo IL2 está marcada por una flecha.

Diferentes polimerasas de ADN mostrar especificidad diferente en mpxPCR. 4-plex PCR utilizado los cebadores 1, 2, 3, y 4 en la Tabla 1 . ADN polimerasa termoestable (2,5 unidades) o una mezcla de dos ADN polimerasas (2,5 unidades) se utilizó en la PCR. Otras condiciones fueron como en la fig. 2 . PD-primer dímeros.

( A ) Uniplex reacciones con normal (N) y mutado (M) cebadores dirigidos al gen de la interleucina-2 (IL2), el gen de la neurofibromatosis (NFM), y α 2 macroglobulina gen (MG). ( B ) Una PCR 4plex con una mezcla equimolar de tipo normal (N) o cebadores mutantes (M). El cuarto objetivo en ambas reacciones era un fragmento del gen integrina subunidad B 2de la (cebador 8 en la Tabla 2 ). Los productos de PCR se visualizaron en un gel de agarosa 2%. ( C ) Una ventana que muestra la ausencia de los dos objetivos (MG y IL2, marcada por las flechas) amplificados con los cebadores mutantes en una PCR 14-Plex. Los productos de PCR se resolvieron mediante el uso de 6% PAGE en un instrumento secuenciación

Genotipificación de las muestras de ADN humano CF. ( A) Uniplex reacciones con cebadores dirigidos tipo normal ( 1 ), F508-CFTR homocigotos ( 2 ), y F508-CFTR heterocigótico ( 3 ) de ADN. Los productos de PCR se analizaron en un gel de agarosa 2%. ( B ) Genotipado de las mismas muestras de ADN en una PCR 4plex. En esta reacción, el tipo de CFTR normal (N) y CFTR mutante (M) primers (cebadores 10 y 11, respectivamente, en la Tabla 2 ) se utiliza en una mezcla con los cebadores 1, 2, y 4 (Tabla 1 )

• Se desarrollado un enfoque para mpxPCR basado en el efecto PS Este nuevo enfoque requiere la mitad del número de cebadores en comparación con mpxPCR convencional. Esto simplifica considerablemente el diseño del cebador y reduce los costos de cebadores. • Al utilizar este método, se han realizado 14-plex PCR dirigidos a fragmentos de ADN de diferentes cromosomas humanos. • La preparación de muestras de ADN para PCR PS incluye la digestión del ADN genómico con una enzima de restricción y ligación con los adaptadores de PS-conducción. • Las condiciones de PCR, que hemos utilizado para mpxPCR, no requieren optimización especial y debe ser considerada como condiciones predeterminadas aplicables para la amplificación de cualquier objetivo, siempre Tm del cebador no tolera 65-68 ° C.

Sign up to vote on this title
UsefulNot useful