You are on page 1of 19

Aqu se describe un nuevo procedimiento para aumentar el nivel de multiplexacin PCR. Usamos la supresin de PCR (PS) efecto .

Esto permite la amplificacin de PCR con un nico objetivo cebador especfico; otro cebador es comn para todos los objetivos y corresponde a un adaptador se lig a ambos extremos de los fragmentos genmicos (Fig. 1 ). En PS basada en PCR (PCR PS) del adaptador es de alrededor de 40 bases de largo y tiene un alto contenido de GC. Durante la PCR, despus de cada etapa de desnaturalizacin, autocomplementarios ricos en GC extremos de cadena sencilla (ss) fragmentos formar dplex fuertes, por lo que todos los fragmentos de ADN ss adoptar estructuras de horquilla. La replicacin de estos fragmentos de ADN utilizando el cebador correspondiente al adaptador (A cebador) se suprime. Sin embargo, la sntesis se puede producir a partir de un cebador (cebador T) complementaria a un objetivo situado dentro del bucle de ss de la estructura de horquilla, y este producto se amplifica a continuacin de manera eficiente por los cebadores A y T. Como resultado, eficiente PCR slo es posible para que contienen fragmentos de destino-. Debido a que el cebador A es el mismo para todos los objetivos, tales PCR permite la amplificacin con un nico cebador especfico de la diana. PS PCR se ha utilizado con xito en una ), variedad de aplicaciones: Ruta del genoma , la hibridacin de sustraccin de cDNA y dirigido presentacin diferencial genmico Aqu nos muestran que la PS PCR permite la amplificacin eficiente de destino multiplex con la especificidad de alelo.

Multiplex PCR es una tcnica generalizada biologa molecular para la amplificacin de mltiples objetivos en un nico experimento de PCR. En un ensayo de multiplexacin, ms de una secuencia diana puede ser amplificado mediante el uso de mltiples pares de cebadores en una mezcla de reaccin. Como una extensin de la utilizacin prctica de la PCR, esta tcnica tiene el potencial de producir un ahorro considerable de tiempo y esfuerzo en el laboratorio sin comprometer la utilidad del experimento. Multiplex PCR es una tcnica generalizada biologa molecular para la amplificacin de mltiples objetivos en un nico experimento de PCR. En un ensayo de multiplexacin, ms de una secuencia diana puede ser amplificado mediante el uso de mltiples pares de cebadores en una mezcla de reaccin. Como una extensin de la utilizacin prctica de la PCR, esta tcnica tiene el potencial de producir un ahorro considerable de tiempo y esfuerzo en el laboratorio sin comprometer la utilidad del experimento. .

Primer Parmetros de diseo para Multiplex PCR Diseo de conjuntos de cebadores especficos es esencial para una reaccin multiplex xito. Las consideraciones de diseo importantes de cebadores se describen a continuacin son una clave para la amplificacin especfica con un alto rendimiento. 1. Primer Largo Multiplex PCR ensayos implican el diseo de gran nmero de cebadores, por lo tanto, se requiere que el cebador diseado debe ser de longitud apropiada. Por lo general, los cebadores de corta longitud, en el intervalo de 18-22 bases se utilizan. 2. Temperatura de fusin Cebadores con Tm similares, preferiblemente entre 55 C-60 C se utilizan. Para las secuencias con alto contenido de GC, cebadores con una Tm superior (preferiblemente 75 C-80 C) se recomiendan. Una variacin de Tm entre 3 -5 C es aceptable para los primers utilizados en una piscina. 3. Especificidad Es importante tener en cuenta la especificidad de los cebadores diseados para las secuencias diana, mientras que la preparacin de un ensayo mltiple, especialmente dado que la competencia existe cuando varias secuencias diana estn en un solo recipiente de reaccin. 4. Evitar la formacin de Primer Dimer Los cebadores diseados deben ser revisadas para la formacin de dmeros de cebadores, con todos los cebadores presentes en la mezcla de reaccin. La dimerizacin conduce a la amplificacin inespecfica. El resto de parmetros son similares a las directrices estndar de PCR primer diseo

Ventajas de Multiplex PCR

1. Controles Internos
Los problemas potenciales en una PCR simple incluir falsos negativos debido a la falta de reaccin o falsos positivos debido a la contaminacin. Los falsos negativos a menudo se revela en ensayos multiplex porque cada uno de amplificacin permite un control interno para los otros fragmentos amplificados. 2. Eficiencia El gasto de los reactivos y tiempo de preparacin es menor en PCR multiplex que en sistemas en los que varios tubos de PCR Uniplex se utilizan. Una reaccin multiplex es ideal para la conservacin de la polimerasa costoso y plantillas escasas. 3. Indicacin de Calidad Plantilla La calidad de la plantilla se puede determinar con ms eficacia en multiplex que en una simple reaccin de PCR. 4. Indicacin de la cantidad de plantilla La amplificacin exponencial y estndares internos de PCR mltiple se puede utilizar para evaluar la cantidad de una plantilla determinada en una muestra. Para cuantificar con precisin por plantillas multiplex PCR, la cantidad de plantilla de referencia, el nmero de ciclos de reaccin, y la inhibicin de la duplicacin mnimo terico de producto para cada ciclo debe tenerse en cuenta. Aplicaciones de la PCR Multiplex La identificacin de patgenos Alto rendimiento SNP genotipificacin Anlisis de mutacin Gene anlisis de delecin Plantilla de cuantificacin El anlisis de ligamiento La deteccin del ARN Estudios Forenses

Oligonucletidos no fosforilados, sin etiqueta o etiquetado con fluorescencia, ADN a partir de linfocitos de sangre perifrica de donantes annimos se aisl utilizando un kit Qiagen Blood de acuerdo con el protocolo del fabricante (Qiagen, Chatsworth, CA). AmpliTaq y AmpliTaq Gold ADN polimerasas son de Applied Biosystems, polimerasa KlenTaq ADN de pptidos Ab (St. Louis), y Taq ADN polimerasa de Amersham Pharmacia El DNA genmico humano se digiri con Rsa I enzima de restriccin (New England Biolabs) y se lig con adaptadores compuestos de dos oligonucletidos hibridados: TGTAGCGTGAAGACGACAGAAAGGGCGTGGTGCGGACGCGGG y CCCGCGTCCGC. Los oligonucletidos complementarios son de diferentes longitudes para asegurar la polaridad correcta de la ligacin a fragmentos genmicos de extremos romos. Los extremos con muescasde los fragmentos de ADN ligados se llena de forma automtica en la primera ronda de PCR posterior en presencia de dNTPs y ADN polimerasa.

Adaptador-ligated ADN (2-5 ng) se amplific por PCR en un volumen de reaccin de 25 l que contiene: 1 x tampn de PCR (dependiendo de la ADN polimerasa) 2,5 mM de MgCl 2 250 mM de cada dNTP, 5-10 pmol de cada uno cebador, 2,5 unidades de ADN polimerasa termoestable. Las mezclas de PCR que contienen todos los componentes, excepto los cebadores fueron desnaturalizados a 95 C durante 3-10 min, la mezcla de cebador (5-10 pmol de cada uno) se aadi a 95 C, y 38 ciclos de PCR (94 C durante 10 sec , 68 C durante 15 s, y 72 C durante 1 min) se realizaron. El cebador A comn para todos los objetivos fue marcado con fluorescena, y los productos de PCR se analizaron por electroforesis en un gel de agarosa 2% y por 6% PAGE desnaturalizante. Para realizar la determinacin del genotipo de fibrosis qustica (FQ) en una mpxPCR ADN, muestras de ADN fueron preamplificada en un ciclo de PCR con los cebadores 15 1, 2, 4 (Tabla 1 ), el anidado regulador de conductanciatransmembrana de la fibrosis qustica (CFTR) cebador 12 (Tabla 2 ), y el cebador A, TGTAGCGTGAAGACGACAGAA. Entonces 1 l de producto diluido 500 veces PCR se volvi a amplificar en una PCR 38-ciclo con una mezcla de los cuatro cebadores T (incluyendo cebador CFTR normal o mutante, cebadores 10 o 11, Tabla 2 ) y el cebador A, GAAAGGGCGTGGTGCGGACGCGG, utilizando las mismas condiciones de PCR descritas anteriormente.

Productos de PCR (2-3 l) se desnaturalizaron durante 3 min a 90 C en una solucin stop, y se analizaron usando PAGE de 6% desnaturalizante y se analiz en un sistema automatizado de fluorescencia lser (ALF) instrumento de secuenciacin (Amersham Pharmacia).

CFTR fragmentos de ADN fueron amplificados de ADN mediante el uso de fluorescena GGGAGAACTGGAGCCTTCAGAG y en el primers GGGTAGTGTGAAGGGTTCATATGC. Producto de PCR (5-10 fmol) se secuenci mediante el uso de un fmol DNA kit de secuenciacin (Promega) de acuerdo con el protocolo del fabricante y los productos se resolvieron mediante 6% PAGE en un instrumento ALF secuenciacin (Amersham Pharmacia).

PS basada mpxPCR dirigido a varias secuencias annimos en el cromosoma 7 de ADN. 5 ng de Rsa I digerido con ADN genmico humano con adaptador ligado se amplific en una reaccin de 25 l que contiene 1 x tampn de PCR (PE), 2,5 mM de MgCl 2 , 250 mM de dNTP, 2,5 unidades de ADN polimerasa termoestable [a (1:1 : 1) mezcla de Taq , AmpliTaq, y AmpliTaq Gold ADN polimerasas] y 5 pmol de cada cebador. El marcado fluorescentemente Un cebador fue TGTAGCGTGAAGACGACAGAA, que corresponda a la parte 5 'ms exterior de la adaptador ligado. Para los cebadores T vase la Tabla 1 . ( A ) Rsa I mapas de restriccin de dos fragmentos de cromosoma 7 humano con los cebadores de PCR. ( B ) La resolucin de los productos mpxPCR mediante el uso de 2% electroforesis en gel de agarosa. ( 1 ) PCR con los cebadores T 1 + 2; ( 2 ) PCR con los cebadores T 3 + 4; ( 3 ) PCR con cebadores de la T 1 + 2 + 3 + 4 (vase la Tabla 1 ), (M) 100 - pb marcador de tamao. ( C ) Resolucin de la 4-plex ( Top ; cebadores 1-4 en la Tabla 1 ) y 5-plex ( Bottom ; cebadores 1-5 en la Tabla 1 ) productos de la PCR mediante el uso de 6% PAGE y un secuenciador ALF. Los nmeros por encima de los picos muestran las longitudes de amplicn. El amplicn 1-kb-PCR larga est ms all de la ventana emergente.

14-fold mpxPCR. a ) A 5-plex PCR se realiz con los cebadores 1-5 (Tabla 1 ), ( b ) 4-plex PCR con cebadores 2, 3, 5, y 8 (Tabla 2 ), ( c ) 5-plex PCR con cebadores 1, 4, 6, 7, y 9 (Tabla 2 ): ( d ) 14-plex PCR con cebadores 1-5 (Tabla 1 ) ms cebadores 1-9 (Tabla2 ). Primers 2, 3, y 5 (Tabla 2 ) fueron los tipos normales.Otras condiciones fueron como en la fig. 2 . El fragmento de 450 pb (gen de aldolasa B; cebador 4 en la Tabla 2 ) apareci como un pico doble, como ya lo hizo en una PCR uniplex (datos no mostrados). El fragmento 1-kb de longitud (producto generado por el cebador 5 en la Tabla 1 ) est ms all de la ventana mostrada. Longitudes de los fragmentos (pb) se indican encima de los picos. El amplicn de 200 bp de largo IL2 est marcada por una flecha.

Diferentes polimerasas de ADN mostrar especificidad diferente en mpxPCR. 4-plex PCR utilizado los cebadores 1, 2, 3, y 4 en la Tabla 1 . ADN polimerasa termoestable (2,5 unidades) o una mezcla de dos ADN polimerasas (2,5 unidades) se utiliz en la PCR. Otras condiciones fueron como en la fig. 2 . PD-primer dmeros.

( A ) Uniplex reacciones con normal (N) y mutado (M) cebadores dirigidos al gen de la interleucina-2 (IL2), el gen de la neurofibromatosis (NFM), y 2 macroglobulina gen (MG). ( B ) Una PCR 4plex con una mezcla equimolar de tipo normal (N) o cebadores mutantes (M). El cuarto objetivo en ambas reacciones era un fragmento del gen integrina subunidad B 2de la (cebador 8 en la Tabla 2 ). Los productos de PCR se visualizaron en un gel de agarosa 2%. ( C ) Una ventana que muestra la ausencia de los dos objetivos (MG y IL2, marcada por las flechas) amplificados con los cebadores mutantes en una PCR 14-Plex. Los productos de PCR se resolvieron mediante el uso de 6% PAGE en un instrumento secuenciacin

Genotipificacin de las muestras de ADN humano CF. ( A) Uniplex reacciones con cebadores dirigidos tipo normal ( 1 ), F508-CFTR homocigotos ( 2 ), y F508-CFTR heterocigtico ( 3 ) de ADN. Los productos de PCR se analizaron en un gel de agarosa 2%. ( B ) Genotipado de las mismas muestras de ADN en una PCR 4plex. En esta reaccin, el tipo de CFTR normal (N) y CFTR mutante (M) primers (cebadores 10 y 11, respectivamente, en la Tabla 2 ) se utiliza en una mezcla con los cebadores 1, 2, y 4 (Tabla 1 )

Se desarrollado un enfoque para mpxPCR basado en el efecto PS Este nuevo enfoque requiere la mitad del nmero de cebadores en comparacin con mpxPCR convencional. Esto simplifica considerablemente el diseo del cebador y reduce los costos de cebadores. Al utilizar este mtodo, se han realizado 14-plex PCR dirigidos a fragmentos de ADN de diferentes cromosomas humanos. La preparacin de muestras de ADN para PCR PS incluye la digestin del ADN genmico con una enzima de restriccin y ligacin con los adaptadores de PS-conduccin. Las condiciones de PCR, que hemos utilizado para mpxPCR, no requieren optimizacin especial y debe ser considerada como condiciones predeterminadas aplicables para la amplificacin de cualquier objetivo, siempre Tm del cebador no tolera 65-68 C.