You are on page 1of 134

THE FLOW OF GENETIC INFORMATION

2 DNA 1 DNA RNA

3 PROTEIN

1. REPLICATION (DNA SYNTHESIS) 2. TRANSCRIPTION (RNA SYNTHESIS) 3. TRANSLATION (PROTEIN SYNTHESIS)

DNA Structure and Chemistry


a). Evidence that DNA is the genetic information i). DNA transformation know this term ii). Transgenic experiments know this process iii). Mutation alters phenotype be able to define genotype and phenotype b). Structure of DNA i). Structure of the bases, nucleosides, and nucleotides ii). Structure of the DNA double helix iii). Complementarity of the DNA strands c). Chemistry of DNA i). Forces contributing to the stability of the double helix ii). Denaturation of DNA

Structures of the bases


Purines Pyrimidines

Adenine (A)

Thymine (T)

5-Methylcytosine (5mC)

Guanine (G)

Cytosine (C)

Nucleoside

[structure of deoxyadenosine]

Nucleotide

Nomenclature

Base Purines adenine guanine


hypoxanthine

Nucleoside +deoxyribose

Nucleotide +phosphate

adenosine guanosine
inosine

Pyrimidines thymine cytosine


+ribose uracil

thymidine cytidine uridine

ii). Structure the Structure of theof DNA DNA doublechain helix polynucleotide

3 polynucleotide chain 3,5-phosphodiester bond

A-T base pair

Hydrogen bonding of the bases

G-C base pair


Chargaffs rule: The content of A equals the content of T, and the content of G equals the content of C in double-stranded DNA from any species

Double-stranded DNA
5 3

Major groove Minor groove

B DNA
3 5 3 5

Chemistry of DNA
Forces affecting the stability of the DNA double helix

hydrophobic interactions - stabilize - hydrophobic inside and hydrophilic outside stacking interactions - stabilize - relatively weak but additive van der Waals forces hydrogen bonding - stabilize - relatively weak but additive and facilitates stacking electrostatic interactions - destabilize - contributed primarily by the (negative) phosphates - affect intrastrand and interstrand interactions - repulsion can be neutralized with positive charges (e.g., positively charged Na+ ions or proteins)

Stacking interactions Charge repulsion Charge repulsion

Model of double-stranded DNA showing three base pairs

Denaturation of DNA
Double-stranded DNA Strand separation and formation of single-stranded random coils

Extremes in pH or A-T rich regions high temperature denature first

Cooperative unwinding of the DNA strands

Electron micrograph of partially melted DNA

Double-stranded, G-C rich DNA has not yet melted

A-T rich region of DNA has melted into a single-stranded bubble

A-T rich regions melt first, followed by G-C rich regions

Hyperchromicity
Absorbance maximum for single-stranded DNA Absorbance Absorbance maximum for double-stranded DNA

220

260

300

The absorbance at 260 nm of a DNA solution increases when the double helix is melted into single strands.

DNA melting curve


Percent hyperchromicity 100

50

0 50 70 Temperature oC 90

Tm is the temperature at the midpoint of the transition

Tm is dependent on the G-C content of the DNA


Percent hyperchromicity

50

E. coli DNA is 50% G-C

60

70 Temperature oC

80

Average base composition (G-C content) can be determined from the melting temperature of DNA

Genomic DNA, Genes, Chromatin


a). Complexity of chromosomal DNA i). DNA reassociation ii). Repetitive DNA and Alu sequences iii). Genome size and complexity of genomic DNA b). Gene structure i). Introns and exons ii). Properties of the human genome iii). Mutations caused by Alu sequences c). Chromosome structure - packaging of genomic DNA i). Nucleosomes ii). Histones iii). Nucleofilament structure iv). Telomeres, aging, and cancer

DNA reassociation (renaturation)


Double-stranded DNA

Denatured, single-stranded DNA

k2
Slower, rate-limiting, second-order process of finding complementary sequences to nucleate base-pairing

Faster, zippering reaction to form long molecules of doublestranded DNA

DNA reassociation kinetics for human genomic DNA


Cot1/2 = 1 / k2 k2 = second-order rate constant Co = DNA concentration (initial) t1/2 = time for half reaction of each component or fraction
fast (repeated) intermediate (repeated)
Cot1/2 Cot1/2

% DNA reassociated

Kinetic fractions:
fast intermediate slow

50

Cot1/2

slow (single-copy)

100

I I I log Cot

106 copies per genome of a low complexity sequence of e.g. 300 base pairs

1 copy per genome of a high complexity sequence of e.g. 300 x 106 base pairs

high k2

low k2

Type of DNA Single-copy (unique) Repetitive Interspersed

% of Genome ~75% ~15%

Features Includes most genes 1 Interspersed throughout genome between and within genes; includes Alu sequences 2 and VNTRs or mini (micro) satellites Highly repeated, low complexity sequences usually located in centromeres and telomeres

Satellite (tandem) 0

~10%

fast ~10% intermediate ~15% Alu sequences are about 300 bp in length and are repeated about 300,000 times in the genome. They can be found adjacent to or within genes in introns or nontranslated regions.
2

50
slow (single-copy) ~75% 100
1 Some

genes are repeated a few times to thousands-fold and thus would be in the repetitive DNA fraction

Classes of repetitive DNA

Interspersed (dispersed) repeats (e.g., Alu sequences) GCTGAGG GCTGAGG GCTGAGG

Tandem repeats (e.g., microsatellites)

TTAGGGTTAGGGTTAGGGTTAGGG

Genome sizes in nucleotide pairs (base-pairs)


plasmids viruses bacteria fungi

plants algae
insects mollusks bony fish amphibians reptiles

The size of the human genome is ~ 3 X 109 bp; almost all of its complexity is in single-copy DNA.

birds
The human genome is thought to contain ~30,000 to 40,000 genes. 104 105 106 107 mammals 108 109 1010 1011

Gene structure
promoter region exons (filled and unfilled boxed regions)

+1 introns (between exons) transcribed region mRNA structure

5
translated region

The (exon-intron-exon)n structure of various genes histone total = 400 bp; exon = 400 bp

b-globin
total = 1,660 bp; exons = 990 bp HGPRT (HPRT) total = 42,830 bp; exons = 1263 bp

factor VIII total = ~186,000 bp; exons = ~9,000 bp

Properties of the human genome


Nuclear genome the haploid human genome has ~3 X 109 bp of DNA single-copy DNA comprises ~75% of the human genome the human genome contains ~30,000 to 40,000 genes most genes are single-copy in the haploid genome genes are composed of from 1 to >75 exons genes vary in length from <100 to >2,300,000 bp Alu sequences are present throughout the genome Mitochondrial genome circular genome of ~17,000 bp contains <40 genes

Alu sequences can be mutagenic


Familial hypercholesterolemia autosomal dominant LDL receptor deficiency

From Nussbaum, R.L. et al. "Thompson & Thompson Genetics in Medicine," 6th edition (Revised Reprint), Saunders, 2004.

LDL receptor gene Alu repeats present within introns

4 unequal crossing over

5 6

Alu repeats in exons


4 Alu 5 Alu 6

X
4 Alu 5 Alu 6

one product has a deleted exon 5


4 Alu 6
(the other product is not shown)

Chromatin structure

EM of chromatin shows presence of nucleosomes as beads on a string

Nucleosome structure

Nucleosome core (left) 146 bp DNA; 1 3/4 turns of DNA DNA is negatively supercoiled two each: H2A, H2B, H3, H4 (histone octomer) Nucleosome (right) ~200 bp DNA; 2 turns of DNA plus spacer also includes H1 histone

Histones (H1, H2A, H2B, H3, H4) small proteins arginine or lysine rich: positively charged interact with negatively charged DNA can be extensively modified - modifications in general make them less positively charged
Phosphorylation Poly(ADP) ribosylation Methylation Acetylation Hypoacetylation by histone deacetylase (facilitated by Rb) tight nucleosomes assoc with transcriptional repression Hyperacetylation by histone acetylase (facilitated by TFs) loose nucleosomes assoc with transcriptional activation

Nucleofilament structure

Condensation and decondensation of a chromosome in the cell cycle

Telomeres and aging


Metaphase chromosome

Telomeres are protective caps on chromosome ends consisting of short 5-8 bp tandemly repeated GC-rich DNA sequences, that prevent chromosomes from fusing and causing karyotypic rearrangements.

telomere

centromere

telomere

telomere structure

<1 to >12 kb
(TTAGGG)many (TTAGGG)few senescent young

telomerase (an enzyme) is required to maintain telomere length in germline cells

most differentiated somatic cells have decreased levels of telomerase and therefore their chromosomes shorten with each cell division

The mammalian cell cycle


Rapid growth and preparation for DNA synthesis DNA synthesis and histone synthesis phase

G0
Quiescent cells

G1
phase

phase

phase

G2

Growth and preparation for cell division

Mitosis

DNA replication is semi-conservative

Parental DNA strands

Each of the parental strands serves as a template for a daughter strand

Daughter DNA strands

Origins of DNA replication on mammalian chromosomes


origins of DNA replication (every ~150 kb) 5 3 3 5

bidirectional replication replication bubble

5 3 5 3

fusion of bubbles daughter chromosomes

3 5 3 5

Initiation of DNA synthesis at the E. coli origin (ori) origin DNA sequence 5 3 A A A 3 5 binding of dnaA proteins

A A A

A
A

DNA melting induced by the dnaA proteins

dnaA proteins coalesce

dnaB and dnaC proteins b to the single-stranded D

A
A A

A
A

B C

dnaB further unwinds the helix

dnaG (primase) binds...

A A A

B C
A

dnaB further unwinds the helix and displaces dnaA proteins

A A A A A A

...and synthesizes an RNA prim

G
RNA primer

B C

B C

Primasome dna B (helicase) dna C dna G (primase)

template strand 3 3 OH 5 RNA primer (~5 nucleotides)

DNA polymerase
5 5 RNA primer 3

5 newly synthesized DNA

Discontinuous synthesis of DNA

5 3

3 5

5 3

3 5

5 3

3 5

Because DNA is always synthesized in a 5 to 3 direction synthesis of one of the strands... 5

3
...has to be discontinuous. This is the lagging strand.

Each replication fork has a leading and a lagging strand

leading strand (synthesized continuously)


replication fork 5 3 3 5

replication for

5 3
3 5

5 3

3 5

lagging strand (synthesized discontinuously) The leading and lagging strand arrows show the direction
of DNA chain elongation in a 5 to 3 direction The small DNA pieces on the lagging strand are called Okazaki fragments (100-1000 bases in length)

RNA primer direction of leading strand synthesis 3 5 5 3 replication fork

3 5 direction of lagging strand synthesis

Strand separation at the replication fork causes positive supercoiling of the downstream double helix 3 5 5 3

DNA gyrase is a topoisomerase II, which

breaks and reseals the DNA to introduce negative supercoils ahead of the fork Fluoroquinolone antibiotics target DNA gyrases in many gram-negative bacteria: ciprofloxacin and levofloxacin (Levaquin)

3 5

Movement of the replication fork

5 3

5 3

Movement of the replication fork

RNA primer Okazaki fragment

RNA primer

RNA primer 5

pol III

DNA polymerase III initiates at the primer and elongates DNA up to the next RNA primer 3 5 5

newly synthesized DNA (100-1000 bases) (Okazaki fragment) 5

pol I

DNA polymerase I inititates at the end of the Okazaki fragment and further elongates the DNA chain while simultaneously removing the RNA primer with its 5 to 3 exonuclease activity

newly synthesized DNA (Okazaki fragment)

DNA ligase seals the gap by catalyzing the formation of a 3, 5-phosphodiester bond in an ATP-dependent react 5

Proteins at the replication fork in E. coli

Rep protein (helicase)


pol III

3 5

5 3
Single-strand binding protein (SSB)

Primasome DNA ligase

C B

pol III

DNA gyrase - this is a topoisomerase II, which breaks and reseals double-stranded DNA to introduce negative supercoils ahead of the fork pol I

Components of the replication apparatus


dnaA Primasome dnaB dnaC dnaG DNA gyrase binds to origin DNA sequence helicase (unwinds DNA at origin) binds dnaB primase (synthesizes RNA primer) introduces negative supercoils ahead of the replication fork helicase (unwinds DNA at fork) binds to single-stranded DNA primary replicating polymerase removes primer and fills gap seals gap by forming 3, 5-phosphodiester bond

Rep protein SSB DNA pol III DNA pol I DNA ligase

Properties of DNA polymerases

DNA polymerases of E. coli_


Polymerization: 5 to 3 Proofreading exonuclease: 3 to 5 Repair exonuclease: 5 to 3 pol I yes yes yes pol II pol III (core) yes yes yes yes no no

DNA polymerase III is the main replicating enzyme DNA polymerase I has a role in replication to fill gaps and excise primers on the lagging strand, and it is also a repair enzyme and is used in making recombinant DNA molecules

all DNA polymerases require a primer with a free 3 OH group


all DNA polymerases catalyze chain growth in a 5 to 3 direction some DNA polymerases have a 3 to 5 proofreading activity

Mutation

Types and rates of mutation


Type Genome mutation

Mechanism Frequency____ chromosome 10-2 per cell division missegregation (e.g., aneuploidy)

Chromosome chromosome mutation rearrangement (e.g., translocation) Gene mutation

6 X 10-4 per cell d

base pair mutation 10-10 per base pair per (e.g., point mutation, cell division or or small deletion or 10-5 - 10-6 per loc insertion generation

Many polymorphisms exist in the genome the number of existing polymorphisms is ~1 per 500 bp there are ~5.8 million differences per haploid genome polymorphisms were caused by mutations over time polymorphisms called single nucleotide polymorphisms (or SNPs) are being catalogued by the Human Genome Project as an ongoing project

Types of base pair mutations normal sequence

CATTCACCTGTACCA GTAAGTGGACATGGT

CATCCACCTGTACCA GTAGGTGGACATGGT

transition (T-A to C-G)

CATGCACCTGTACCA GTACGTGGACATGGT

transversion (T-A to G-C)

CATCACCTGTACCA GTAGTGGACATGGT

base pair substitutions transition: pyrimidine to pyrimidine transversion: pyrimidine to purine deletion insertion

CATGTCACCTGTACCA GTACAGTGGACATGGT

deletions and insertions can involve one

Spontaneous mutations can be caused by tautomers Tautomeric forms of the DNA bases

Adenine

Cytosine

AMINO

IMINO

Tautomeric forms of the DNA bases

Guanine

Thymine

KETO

ENOL

Mutation caused by tautomer of cytosine

Cytosine

Normal tautomeric form

Guanine

Cytosine

Rare imino tautomeric form

Adenine

cytosine mispairs with adenine resulting in a transition mu

Mutation is perpetuated by replication

C G
C G C A

C G
C A

replication of C-G should give daughter strands each with C-G

tautomer formation C during replication will result in mispairing and insertion of an improper A in one of the daughter strands

T A

which could result in a C-G to T-A transition mutation in the next round of replication, or if improperly repaired

Chemical mutagens

Deamination by nitrous acid

Attack by oxygen free radicals leading to oxidative damage


many different oxidative modifications occur by smoking, etc. 8-oxyG causes G to T transversions O
H N O NH N NH2 NH

O
N NH NH N NH2

guanine

8-oxyguanine (8-oxyG)
the MTH1 protein degrades 8-oxy-dGTP preventing misincorporation mutation of the MTH1 gene causes increased tumor formation in mice

Ames test for mutagen detection


named for Bruce Ames reversion of histidine mutations by test compounds His- Salmonella typhimurium cannot grow without histidine if test compound is mutagenic, reversion to His+ may occur reversion is correlated with carcinogenicity

Thymine dimer formation by UV light

Summary of DNA lesions


Missing base Acid and heat depurination (~104 purines per day per cell in humans) Ionizing radiation; alkylating agents Spontaneous deaminations cytosine to uracil adenine to hypoxanthine Intercalating reagents (acridines) UV irradiation Ionizing radiation; chemicals (bleomycin) Psoralen derivatives; mitomycin C Spontaneous and transient

Altered base Incorrect base

Deletion-insertion Dimer formation Strand breaks Interstrand cross-links Tautomer formation

Mechanisms of Repair

Mutations that occur during DNA replication are repaired when


possible by proofreading by the DNA polymerases Mutations that are not repaired by proofreading are repaired by mismatch (post-replication) repair followed by excision repair Mutations that occur spontaneously any time are repaired by excision repair (base excision or nucleotide excision)

Deamination of cytosine can be repaired

cytosine

uracil

Deamination of 5-methylcytosine cannot be repaired

5-methylcytosine

thymine

More than 30% of all single base changes that have been detected as a cause of genetic disease have occurred at 5-mCpG-3 sites

Correlation between DNA repair activity in fibroblast cells from various mammalian species and the life span of the organism 100

human elephant cow

Life span

10

hamster rat mouse shrew


1

DNA repair activity

Defects in DNA repair or replication


All are associated with a high frequency of chromosome and gene (base pair) mutations; most are also associated with a predisposition to cancer, particularly leukemias
Xeroderma pigmentosum caused by mutations in genes involved in nucleotide excision repair associated with a >1000-fold increase of sunlight-induced skin cancer and with other types of cancer such as melanoma Ataxia telangiectasia caused by gene that detects DNA damage increased risk of X-ray associated with increased breast cancer in carriers Fanconi anemia caused by a gene involved in DNA repair increased risk of X-ray and sensitivity to sunlight Bloom syndrome caused by mutations in a a DNA helicase gene increased risk of X-ray sensitivity to sunlight Cockayne syndrome caused by a defect in transcription-linked DNA repair sensitivity to sunlight Werners syndrome caused by mutations in a DNA helicase gene premature aging

3. RNA Structure and Transcription


a). Chemistry of RNA i). Bases found in RNA ii). Ribose sugar iii). RNA polynucleotide chain iv). Secondary and tertiary structure b). Characteristics of prokaryotic RNA i). Classes of prokaryotic RNA ii). Structure of prokaryotic messenger RNA c). Transcription initiation in prokaryotes i). Transcription ii). Promoter structure iii). Prokaryotic RNA polymerase structure iv). Initiation of transcription and the sigma cycle d). Regulation of the lactose operon i). Function of the lactose operon ii). Negative control: Lac repressor and inducer iii). Positive control: CAP and cAMP

The major bases found in DNA and RNA DNA


Adenine Cytosine Guanine Thymine

RNA
Adenine Cytosine Guanine Uracil (U)

thymine-adenine base pair

uracil-adenine base pair

RNA polynucleotide chain


2 -OH makes 3, 5 phosphodiester bond unstable

DNA polynucleotide chain

Secondary structure

Tertiary structure

Classes of prokaryotic RNA


ribosomal RNA (rRNA) 16S (small ribosomal subunit) 23S (large ribosomal subunit) 5S (large ribosomal subunit) transfer RNA (tRNA) messenger RNA (mRNA)

Structure of prokaryotic messenger RNA


5 Shine-Dalgarno sequence PuPuPuPuPuPuPuPu initiation AUG

translated region
3 AAU termination

The Shine-Dalgarno (SD) sequence base-pairs with a pyrimidine-rich sequence in 16S rRNA to facilitate the initiation of protein synthesis

closed promoter complex


RNA polymerase

Transcription

open promoter complex

initiation elongation

termination
RNA product

Promoter structure in prokaryotes


5

mRNA
PuPuPuPuPuPuPuPu AUG

[
-30 region TTGACA AACTGT -36 -31

-30
Promoter

-10 +1

]
5 mRNA

transcription start site


-10 region TATAAT ATATTA -12 -7 Pribnow box +1

+20

T T G AC A
82 84 79 64 53 45%

TATA AT
79 95 44 59 51 96%

consensus sequences

Prokaryotic RNA polymerase structure


RNA polymerase of bacteria is a multisubunit protein
Subunit Number Role

a b (Rifampicin target) b s

2 1 1 1

uncertain forms phosphodiester bonds binds DNA template recognizes promoter and facilitates initiation

a2bbs
holoenzyme

a2bb
core polymerase

sigma factor

closed promoter complex (moderately stable) the sigma subunit binds to the -10 region

RNA polymerase holoenzyme (+ s factor)


open promoter complex (highly stable) the holoenzyme has very high affinity for promoter regions because of sigma factor

once initiation takes place, RNA polymerase does not need very high affinity for the promoter sigma factor dissociates from the core polymerase after a few elongation reactions

elongation takes place with the core RNA polymerase The sigma cycle

sigma can re-bind other core enzymes

Mechanism of RNA synthesis

RNA
A=T

RNA
A = T

U=A

U=A

RNA synthesis usually initiated with ATP or GTP (the first nucleotide) RNA chains are synthesized in a 5 to 3 direction

The lactose operon in E. coli

promoter binds CAP and RNA polymerase operator binds the lac repressor promoter - operator lac I P O lac Z lac Y lac A
lac repressor
LACTOSE

b-galactosidase
b-galactosidase

permease

acetylase

GLUCOSE + GALACTOSE

the function of the lactose (lac) operon is to produce the enzymes required to metabolize lactose for energy when it is required by the cell

Regulation of the lactose operon - negative control promoter - operator lac I P O lac Z lac repressor
RNA polymerase from binding to the promoter

lac Y

lac A

the repressor tetramer binds to the operator and prev

lac I

lac Z

lac Y

lac A

NO TRANSCRIPTION RNA polymerase is blocked from the promoter

RNA pol

Alleviation of negative control - action of the inducer of the lac operon

when lactose becomes available, it is taken up by the cell


allolactose (an intermediate in the hydrolysis of lactose) is produced one molecule of allolactose binds to each of the repressor subunits binding of allolactose results in a conformational change in the repressor the conformational change results in decreased affinity of the repressor for the operator and dissociation of the repressor from the DNA

allolactose

lac I

lac Z

lac Y

lac A

lac I

lac Z

lac Y

lac A

IPTG (isopropyl thiogalactoside) is also used as a (non-physiological) inducer

NO TRANSCRIPTION

repressor (with bound allolactose) dissociates from the op negative control (repression) is alleviated, however...

lac I

lac Z

lac Y

lac A

NO TRANSCRIPTION
RNA pol

RNA polymerase cannot form a stable complex with the p

Regulation of the lactose operon - positive control in the presence of both lactose and glucose it is not necessary
for the cell to metabolize lactose for energy in the absence of glucose and in the presence of lactose it becomes advantageous to make use of the available lactose for energy in the absence of glucose cells synthesize cyclic AMP (cAMP) cAMP1 serves as a positive regulator of catabolite operons (lac operon) cAMP binds the dimeric cAMP binding protein (CAP)2 binding of cAMP increases the affinity of CAP for the promoter binding of CAP to the promoter facilitates the binding of RNA polymerase
1 cAMP = 3, 5 cyclic adenosine monophosphate

active CAP

cAMP inactive CAP

+
lac I P O lac Z lac Y lac A

2 also termed catabolite activator protein

NO TRANSCRIPTION

Activation of lac operon transcription

lac I

RNA pol

lac Z

lac Y

lac A

lac repressor

TRANSCRIPTION AND TRANSLATION OCCUR

b-galactosidase

permease

acetylase

inactive repressor the function of the lactose (lac) operon is to produce the enzymes
required to metabolize lactose for energy when it is required by the cell

6. RNA Processing
a). Steps in mRNA processing i). Capping ii). Cleavage and polyadenylation iii). Splicing b). Chemistry of mRNA splicing c). Spliceosome assembly and splice site recognition i). Donor and acceptor splice sites ii). Small nuclear RNAs d). Mutations that disrupt splicing e). Alternative splicing

Steps in mRNA processing (hnRNA is the precursor of mRNA) capping (occurs co-transcriptionally) cleavage and polyadenylation (forms the 3 end) splicing (occurs in the nucleus prior to transport)
exon 1 intron 1 exon 2

Transcription of pre-mRNA and capping at the 5 end cap

Cleavage of the 3 end and polyadenylation


cap cap Splicing to remove intron sequences cap poly(A) poly(A)

Transport of mature mRNA to the cytoplasm

Capping occurs co-transcriptionally shortly after initiation guanylyltransferase (nuclear) transfers G residue to 5 end methyltransferases (nuclear and cytoplasmic) add methyl groups to 5 terminal G and at two 2 ribose positions on the next two nucleotides
pppNpN

mGpppNmpNm

capping involves formation of a 5- 5 triphosphate bond cap function protects 5 end of mRNA (increases mRNA stability) required for initiation of protein synthesis

Polyadenylation cleavage of the primary transcript occurs approximately 10-30 nucleotides 3-ward of the AAUAAA consensus site polyadenylation catalyzed by poly(A) polymerase approximately 200 adenylate residues are added

cleavage
AAUAAA mGpppNmpNm

AAUAAA mGpppNmpNm

A A A

polyadenylation
A A 3

poly(A) is associated with poly(A) binding protein (PBP) function of poly(A) tail is to stabilize mRNA

Chemistry of mRNA splicing two cleavage-ligation reactions transesterification reactions - exchange of one phosphodiester bond for another - not catalyzed by traditional enzymes branch site adenosine forms 2, 5 phosphodiester bond with guanosine at 5 end of intron

intron 1

Pre-mRNA

2OH-A

branch site adenosine

exon 1

G-p-G-U -

A-G-p-G

exon 2

First clevage-ligation (transesterification) reaction

ligation of exons releases lariat RNA (intron)


intron 1

U-G-5-p-2-A A

Splicing intermediate

exon 1

G-OH O 3

exon 2 A-G-p-G A -

Second clevage-ligation reaction


intron 1

Lariat
U-G-5-p-2-A A

Spliced mRNA
5 exon 1 G-p-G

3 G-A exon 2

Mutations that disrupt splicing bo-thalassemia - no b-chain synthesis b+-thalassemia - some b-chain synthesis
Normal splice pattern:
Exon 1 Intron 1 Donor site: /GU Exon 2 Intron 2 Acceptor site: AG/ Exon 3

Intron 2 acceptor site b mutation: no use of mutant site; use of cryptic splice site in intron 2
Translation of the retained portion of intron 2 results in premature termination of translation due to a stop codon within the intron, 15 codons from the cryptic splice site

Exon 1 Intron 1

Exon 2

Intron 2 cryptic acceptor site: UUUCUUUCAG/G

mutant site: GG/

Patterns of alternative exon usage one gene can produce several (or numerous) different but related protein species (isoforms)

Cassette

Mutually exclusive

Internal acceptor site

Alternative promoters

The Troponin T (muscle protein) premRNA is alternatively spliced to give rise to 64 different isoforms of the protein Constitutively spliced exons (exons 1-3, 9-15, and 18) Mutually exclusive exons (exons 16 and 17) Alternatively spliced exons (exons 4-8)

Exons 4-8 are spliced in every possible way giving rise to 32 different possibilities Exons 16 and 17, which are mutually exclusive, double the possibilities; hence 64 isoforms

7. Protein Synthesis and the Genetic Code


a). Overview of translation i). Requirements for protein synthesis ii). messenger RNA iii). Ribosomes and polysomes iv). Polarity of protein synthesis b). Transfer RNA i). tRNA as an adaptor ii). Amino acid activation iii). Aminoacyl tRNA synthetases iv). Charged tRNA c). The genetic code i). Codon-anticodon interactions ii). Initiation codon in prokaryotes vs. eukaryotes iii). Reading frame d). Mutations affecting translation i). Frameshift mutations ii). Missense and nonsense mutations

Overview of translation
last step in the flow of genetic information definition of translation requirements for protein synthesis mRNA ribosomes initiation factors elongation and termination factors GTP aminoacyl tRNAs amino acids aminoacyl tRNA synthetases ATP

Messenger RNA (mRNA)

Cap m7Gppp

5 untranslated region

initiation codon

AUG

translated (coding) region

UGA
3 untranslated region termination codon

AAUAAA

(AAAA)n 3
poly(A) tail

Ribosomes prokaryotic ribosome

50S subunit
23S rRNA 5S rRNA 35 proteins

70S ribosome

30S subunit
16S rRNA 21 proteins

eukaryotic ribosome
60S subunit
28S rRNA 5S rRNA 5.8S rRNA 49 proteins

80S ribosome

40S subunit
18S rRNA 33 proteins

Polysomes direction of translation is 5 to 3 along the mRNA

direction of protein synthesis is N terminus to C terminus


nascent polypeptide large ribosomal subunit

N
5 AUG UGA

polysome

small ribosomal subunit

subunits dissociate

Transfer RNA tRNA is the adaptor molecule in protein synthesis acceptor stem CCA-3 terminus to which amino acid is coupled carries amino acid on terminal adenosine anticodon stem and anticodon loop

Amino acid activation and aminoacyl tRNA synthetases

aminoacyl tRNA synthetases are the enzymes that charg 20 amino acids one aminoacyl tRNA synthetase for each amino acid can be several different isoacceptor tRNAs for each am all isoacceptor tRNAs for an amino acid use the same sy

each aminoacyl tRNA synthetase binds amino acid ATP isoacceptor tRNAs

ATP

RO H2N-C-C-OH H - = - =

amino acid

uncharged tRNA 3

PPi

adenylated (activated) RO amino acid H2N-C-C-O-P-O-ribose-adenine H AMP RO H2N-C-C-O H

Amino acid activation and tRNA charging

- =

aminoacyl (charged) tRNA

The genetic code


consists of 64 triplet codons (A, G, C, U) 43 = 64 all codons are used in protein synthesis 20 amino acids 3 termination (stop) codons: UAA, UAG, UGA

AUG (methionine) is the start codon (also used interna multiple codons for a single amino acid = degeneracy

5 amino acids are specified by the first two nucleotide

3 additional amino acids (Arg, Leu, and Ser) are speci

The Genetic Code


UUU UUC UUA UUG CUU CUC CUA CUG AUU AUC AUA AUG GUU GUC GUA GUG Phe Leu UCU UCC Ser UCA UCG CCU CCC Pro CCA CCG ACU ACC Thr ACA ACG GCU GCC Ala GCA GCG UAU UAC UAA UAG CAU CAC CAA CAG AAU AAC AAA AAG GAU GAC GAA GAG

Tyr
Stop

UGU Cys UGC UGA Stop UGG Trp CGU CGC Arg CGA CGG AGU Ser AGC AGA Arg AGG GGU GGC Gly GGA GGG

His
Gln

Leu

Ile Met

Asn
Lys

Asp
Glu

Val

Codon-anticodon interactions codon-anticodon base-pairing is antiparallel the third position in the codon is frequently degenerate one tRNA can interact with more than one codon (therefore 50 tRNAs) wobble rules C with G or I (inosine) A with U or I 3 5 tRNAmet G with C or U U with A, G, or I I with C, U, or A UAC AUG mRNA

5
3 one tRNAleu can read two of the leucine codons GAU CUA G 5 tRNAleu

wobble base

mRNA 5

Wobble Interactions
Inosine = Cytidine Inosine = Adenosine

Inosine = Uridine

Guanosine = Uridine

Initiation in prokaryotes and eukaryotes initiation can occur at internal AUG codons in prokaryotic mRNA initiation in eukaryotes occurs only at the first AUG codon lac operon in E. coli is transcribed as a polycistronic mRNA with multiple AUG codons

lac I

O
AUG

lac Z
AUG

lac Y
AUG

lac A
AUG

SD

AUG

AUG internal Met codon does not have Shine-Dalgarno site

SD

AUG

initiation codon with Shine-Dalgarno site

initiation codon with Shine-Dalgarno site

5 cap

AUG

AUG internal (downstream) Met codon cannot serve as an initiation site

initiation can only occur at first AUG codon downstream of the 5 cap

Reading frame
reading frame is determined by the AUG initiation codon every subsequent triplet is read as a codon until reaching a stop codon

...AGAGCGGA.AUG.GCA.GAG.UGG.CUA.AGC.AUG.UCG.UGA.UCGAAUAAA... MET.ALA.GLU.TRP.LEU.SER.MET.SER

a frameshift mutation
...AGAGCGGA.AUG.GCA.GA .UGG.CUA.AGC.AUG.UCG.UGA.UCGAAUAAA...

the new reading frame results in the wrong amino acid sequence and the formation of a truncated protein
...AGAGCGGA.AUG.GCA.GAU.GGC.UAA.GCAUGUCGUGAUCGAAUAAA... MET.ALA.ASP.GLY

Mutations affecting translation hemoglobin Wayne (3 terminal frameshift mutation)


Normal a-globin Wayne a-globin .ACG.UCU.AAA.UAC.CGU.UAA.GCU GGA GCC UCG GUA .THR.SER.LYS.TYR.ARG .ACG.UCA.AAU.ACC.GUU.AAG.CUG.GAG.CCU.CGG.UAG .THR.SER.ASN.THR.VAL.LYS.LEU.GLU.PRO.ARG mutated region

missense mutations (e.g., AGC Ser to AGA Arg) nonsense mutations (e.g., UGG Trp to UGA Stop) read through, reverse terminator, or sense mutations (e.g., UAA Stop to CAA Gln) as in hemoglobin Constant Spring

silent mutations (e.g., CUA Leu to CUG Leu) do not affect translation

8. Protein Synthesis and Protein Processing


a). Ribosome structure b). Protein synthesis i). Initiation of protein synthesis ii). Peptide bond formation; peptidyl transferase iii). Elongation and termination iv). Inhibitors of protein synthesis Antiviral action of interferon Induction of 2-5A synthase Induction of eIF2 kinase Antibiotics c). Protein processing i). Synthesis of secreted and integral membrane proteins ii). Glycosylation and protein targeting iii). Proteolytic processing

Learning Objectives for Lecture 8: Understand the structure of the ribosome in the context of the translation process Understand the steps in the initiation of protein synthesis Understand the mechanism of peptide bond formation, and that it is RNA catalyzed Understand the processes of elongation and termination Understand how interferon inhibits viral protein synthesis Understand the mechanisms by which antibiotics inhibit protein synthesis how some organisms become resistant to antibiotics Understand how secreted and membrane-bound proteins are synthesized Understand how proteins are glycosylated and what the functions of the carbohydrates are Understand the role of proteolytic processing in protein maturation

and

Ribosome structure

P PP

P P P P P A

Large subunit

P-site peptidyl tRNA site

A-site aminoacyl tRNA site

5 Small subunit

mRNA

Ribosome with bound tRNAs and mRNA

Initiation of protein synthesis: mRNA binding


M Initiator tRNA bound to the small ribosomal subunit with the eukaryotic initiation factor-2 (eIF2) eIF2 40S subunit

The small subunit finds the 5 cap and scans down the mRNA to the first AUG codon 5 cap AUG mRNA

60S subunit the initiation codon is recognized eIF2 dissociates from the complex the large ribosomal subunit binds

eIF2
M

AUG 40S subunit

mRNA

A M

AUG GCC

mRNA

M A aminoacyl tRNA binds the A-site first peptide bond is formed 5 initiation is complete AUG GCC mRNA

Peptide bond formation

P-site NH2 CH3-S-CH2-CH2-CH O=C C O tRNA

A-site N 2 NH CH3-CH O=C O tRNA

peptide bond formation is catalyzed by peptidyl transferase peptidyl transferase is contained within NH2 a sequence of 23S rRNA in the CH3-S-CH2-CH2-CH prokaryotic large ribosomal subunit; therefore, it is probably within O=C the 28S rRNA in eukaryotes NH the energy for peptide bond formation CH3-CH comes from the ATP used in tRNA charging O=C peptide bond formation results in a shift of the nascent peptide from the P-site OH O to the A-site

tRNA

tRNA

Large ribosomal subunit


23S RNA (orange and white) makes up the core of the subunit Protein (purple) lies on the surface

Structure shows only RNA in the active site Adenine 2451 carries out acid-base catalysis

Cech (2000) Science 289:878-879 Ban et al. (2000) Science 289:905-920 Nissen et al. (2000) Science 289:920-930

Elongation

P P P P P
UCA GCA GGG UAG

following peptide bond formation the uncharged tRNA dissociates from the P-site the ribosome shifts one codon along the mRNA, moving peptidyl tRNA from the A-site to the P-site; this translocation requires the elongation factor EF2 the next aminoacyl tRNA then binds within the A-site; this tRNA binding requires the elongation factor EF1 energy for elongation is provided by the hydrolysis of two GTPs: one for translocation one for aminoacyl tRNA binding

EF1 EF2
A

P P P P P
UCA GCA GGG UAG

Termination
RF

P P P P P
UCA GCA GGG UAG

when translation reaches the stop codon, a release factor (RF) binds within the A-site, recognizing the stop codon

PPPP PPP P

release factor catalyzes the hydrolysis of the completed polypeptide from the peptidyl tRNA, and the entire complex dissociates

UCA GCA GGG UAG

Induction and action of interferon

cell makes interferon in response to viral RNA interferon binds to receptors on neighboring ce virus cell cannot and activates the cells itself virus invades protect cell cell synthesizes antiviral proteins virus replicates in response to cell succumbs interferon activation virus invades neighboring cell cell protected from viral infection by antiviral proteins

Functions of two antiviral proteins


inactive endonuclease ATP viral dsRNA 2-5A synthase oligo 2-5 adenylate (2-5A) [-A-2-p-5-A-2-p-5A-] N active endonuclease: viral mRNA degraded

interferon induces

eIF2 kinase eIF2 active viral dsRNA eIF2

inactive: viral protein synthesis cannot initiate

Inhibitors of protein synthesis


Inhibitor Kasugamycin Streptomycin Tetracycline Erythromycin Lincomycin Clindamycin Chloramphenicol Process Affected Site of Action initiator tRNA binding 30S subunit initiation, elongation 30S subunit aminoacyl tRNA binding A-site peptidyl transferase 50S subunit peptidyl transferase 50S subunit peptidyl transferase 50S subunit peptidyl transferase 50S subunit

Staphylococcus resistance to erythromycin


certain strains of Staphylococcus can carry a plasmid that encodes an RNA methylase this RNA methylase converts a single adenosine residue in 23S rRNA to N6-dimethyladenosine this is the site of action of erythromycin, lincomycin, and clindamycin N6-dimethyladenosine blocks the action of these antibiotics the organism that produces erythromycin has its own RNA methylase and thus is resistent to the antibiotic it makes

Protein maturation: modification, secretion, targeting


3. the SRP docks with the SRP receptor on the cytosolic side of the ER membrane and positions the signal peptide for insertion through a pore ER lumen c SRP receptor

Translation of a secreted protein


2. the signal recognition particlea (SRP) binds the signal peptideb and halts translation SRP

cytosol

AUG polysome for secreted protein

1. translation initiates as usual on a cytosolic mRNA athe signal recognition particle (SRP) consists of protein and RNA (7SL RNA); it binds to the signal peptide, to the ribosome, and to the SRP receptor on the ER membrane bthe signal peptide is a polypeptide extension of 10-40 residues, usually at the N-terminus of a protein, that consists mostly of hydrophobic amino acids cER = endoplasmic reticulum

4. translation resumes and the nascent polypeptide moves into the ER lumen 5. signal peptidase, which is in the ER lumen, cleaves off the signal peptide

ER lumen cytosol

5
7. the ribosomes dock onto the ER membrane; the rough ER is ER studded with polysomes

6. the SRP is released and is recycled

8. translation continues with the nascent polypeptide emerging into the ER lumen
9. at termination of translation, the completed protein is within the ER and is further processed prior to secretion

ER lumen

completed protein is processed and secreted

cytosol

UGA

Examples of secreted proteins: polypeptide hormones (e.g., insulin) albumin collagen immunoglobulins

Integral membrane proteins are also synthesized by the same mechanisms; they may be considered partially secreted Examples of integral membrane proteins: polypeptide hormone receptors (e.g., insulin receptor) transport proteins ion channels cytoskeletal anchoring proteins (e.g., band 3)

Glycosylation of proteins
most integral membrane proteins and secreted proteins are glycosylated during translation on the ER membrane the protein begins to be glycosylated various oligosaccharide modifications occur in the ER and in the Golgi complex

to hydroxyl group) N-linked (Asn linked) oligosaccharides (linked to amide group) Biosynthesis of N-linked oligosaccharides (first 7 steps) P Dolichol phosphate (polyprenol lipid (2) UDPER lumen (1) UMP, (1) UDP (5) GDP(5) GDP
Cytosol

O-linked (Ser, Thr linked) oligosaccharides (linked

reorientation

N-acetylglucosamine (GlcNAc) = onosaccharides are transferred by specific glycosyltransferases Mannose =

Biosynthesis of N-linked oligosaccharides (second

7 steps)

PP P (4)

ER lumen

PP P

(3)

Dolicol-phosphates are the sugar donors in the ER lumen; they are synthesized in the cytosol prior to being translocated to the lumen P Dolicol-P-mannose = P Dolicol-P-glucose =

PP
Cytosol

Transfer of oligosaccharide to protein

PP
ER lumen

Transfer of oligosaccharide cha to the growing polypeptide

Asn I X Linkage is to the amide group of an aspa I followed Ser (Thr) by any (X) amino acid (except p followed by serine or threonine
Cytosol

Following synthesis, the protein is transferr to the Golgi complex, where trimming and fu building of the oligosaccharides occurs

Formation of complex type oligosaccharides

Asn
I

X
I

Ser (Thr)

Trimming by glycosidases; Building by glycosyltransferases = common core stru

Golgi lumen

Asn
I I

Cytosol

X A complex type oligosaccharide Ser (Thr) fucose = galactose = sialic ac come from nucleotide sugars transloca The type of carbohydrate across the Golgidetermines membrane wh the protein is targeted to the membran

Targeting of proteins to lysosomes (I-cell disease)

Asn

UDPP Asn P P Asn P

Proteins containing mannose-6-phospha are targeted to lysoso These proteins include lysosomal hydrolases Phosphate groups are mannose by transfer phosphate from UDP Patients with I-cell (for body) disease have a in the enzyme that tra GlcNAc phosphate to As a result, the hydrola residues in the Golgi be targeted to the lys The resulting deficienc lysosomal hydrolases an accumulation (inc

Proteolytic processing
Processing of insulin (synthesized in the ER of pancreatic b-cells)
Signal peptide

cleavage of signal peptide C by signal Preproinsulin peptidase B-chain Insulin N Further trimming by a S S N I I S S carboxypeptidase B-like A-chain S S C I I N S S C C enzyme removes two C-chain basic residues from by trypsin-like enzyme each of Cleavage the new ends releases the C-peptide The C-chain is C-chain packaged in the secretory

Disulfide bond I I formation S S C Proinsulin


S S

Preproopiomelanocortin

multiple functional polypeptides from a single prec processed in a cell-specific manner 26aa N Signal peptide 48aa 12aa 40aa Proopiomelanocortin 5aa 21aa 14aa C

g-MSH Corticotropin (ACTH) a-MSH

b-Lipotropin 31aa b-MSH Endorphin

g-Lipotropin Enkephalin (