You are on page 1of 69

Oi... Bom dia!!!

Pietro: 26 semanas (32)

Avisos
•Material da aula encontra-se no yahoo! •Quem ainda não selecionou artigo tem até 02/09. •Aula prática- consultar no site do grupo e responder o estudo para ser entregue antes da aula. •As estruturas de DNA do trabalho em grupo devem ser entregues na aula prática, com a devida legenda, nome do grupo e colocada em cima de uma base (suporte) •A aula prática vai ser dividida em 2 etapas (8:00 – 9:00 e das 9:00- 10:00) e os trabalhos serão em duplas. •Bibliografia... •Dúvidas... Aulas ... Relatório... Modelo .... Artigo... Visitas... •O endereço para plotar mais acessível é : –Na Protásio –Próximo ao viaduto da João Pessoa –Leo

Biologia Molecular

RNA
Claudia Bica

Transcrição & Processamento RNA: eficiente & eficaz .

Dogma Central da Biologia Molecular .

.TRANSCRIÇÃO • Processo pelo qual uma molécula de RNA é sintetizada a partir da informação contida na seqüência de nucleotídeos de uma molécula de DNA fita dupla. • Enquanto a síntese de DNA deve ser precisa e uniforme. é extremamente variável para atender às suas necessidades. • A transcrição representa a diversidade e a complexidade da expressão dos genes contidos em um determinado genoma. a transcrição reflete o estado fisiológico da célula e. portanto.

TRANSCRIÇÃO Características Gerais: •Complementaridade •Antiparalelismo ( T = U) •Síntese 5'  3„ •RNA Polimerase (RNAP): • Funções reconhecem e ligam-se desnaturam DNA mantém estável a dupla fita aberta mantém estável DNA:RNA terminam síntese restauram DNA .

G. • Esta enzima foi denominada RNA polimerase. portanto.TRANSCRIÇÃO • Apenas uma das fitas do DNA é utilizada como molde. a molécula de RNA sintetizada é complementar à fita de DNA que lhe deu origem e idêntica à outra fita de DNA. C. Hurwitz. sendo as timinas substituídas por uracilas • Em 1960. Stevens e Weiss descobriram. U. independentemente. uma enzima capaz de sintetizar RNA na presença de DNA fita dupla e dos nucleotídeos A. .

• Denatura o DNA expondo nucleotídeos a ser copiada.RNA POLIMERASE • Reconhece e liga-se a seqüências específicas de DNA. • Renatura o DNA na posterior à da síntese. a seqüência de • Mantém as fitas de DNA separadas na região de síntese. região imediatamente • Sozinha. termina a síntese do RNA. proteínas . ou com o auxílio de específicas.

RNA polimerase I – localizada no nucléolo e responsável pela síntese do RNA ribossômico . RNA polimerase III – também localizada no nucleoplasma e responsável pela síntese do RNA transportador . RNA polimerase II – localizada no nucleoplasma e responsável pela síntese do RNA mensageiro .RNA POLIMERASE Em eucariotos existem vários subtipos de RNA polimerases envolvidas na síntese de RNAs específicos: .

TRANSCRIÇÃO • Reação ocorre entre o radical hidroxil da extremidade 3’ de um ribonucleotídeo e o grupo fosfato do carbono 5’ do ribonucleotídeo a ser incorporado • A reação processa-se no sentido 5’ de DNA copiada é a de sentido 3’ 5’ 3’ e a fita • Diferentemente da DNA polimerase. a RNA polimerase não necessita de um iniciador para processar a síntese da nova fita .

TRANSCRIÇÃO 1. ALONGAMENTO Incorporação dos ribonucleotídeos 3. TERMINAÇÃO Seqüências no DNA são reconhecidas e a síntese é interrompida .INÍCIO Reconhecimento de seqüências específicas no DNA 2.

reconhecidos por fatores de transcrição que. formando um complexo ao qual a RNA polimerase se associa. . denominadas PROMOTORES. que sinalizam exatamente onde a síntese do RNA deve ser iniciada. ligados ao DNA. • Os promotores são. primeiramente. interagem com outros fatores.INÍCIO DA TRANSCRIÇÃO • O DNA apresenta seqüências específicas.

elementos promotores: seqüências de 100 a 200 nucleotídeos próximos ao sítio de início da transcrição que possuem seqüências consenso TATA denominadas “TATA box” . elementos “enhancer” ou amplificadores: seqüências pequenas de DNA que podem ocorrer na região 5’ do gene. Ativam a expressão do mesmo. .INÍCIO DA TRANSCRIÇÃO • As seqüências reguladoras da transcrição podem ser divididas em: .

Amplificam o sinal 100 vezes e os fatores de transcrição que se ligam a eles são chamados ativadores .

desta forma. A fita molde fica exposta e. mais especificamente no “TATA box”. . a síntese da cadeia complementar de RNA pode ser iniciada.INÍCIO DA TRANSCRIÇÃO As fitas do DNA se separam 10 bases upstream ao sítio de iniciação.

.ALONGAMENTO DA CADEIA A polimerase desliza ao longo da fita molde extendendo um cadeia de RNA crescente no sentido 5’ 3’ através da adição de ribonucleotídeos. Este processo ocorre até a RNA polimerase encontrar uma seqüência específica no DNA que determina o término do alongamento.

ela se desliga do DNA juntamente com a nova cadeia de RNA sintetizada devido à uma desestabilização do complexo de transcrição • O desligamento do RNA do sistema provoca a ruptura do complexo de transcrição e as fitas do DNA são renaturadas .TÉRMINO DA TRANSCRIÇÃO • Quando a RNA polimerase encontra o sítio de terminação na fita molde.

.

esses transcritos não representam a molécula madura. ou seja. • Esses transcritos necessitam sofrer modificações que fazem parte do processamento do RNA. • Na maioria das vezes. .O PROCESSAMENTO DO RNA • Os diferentes RNAs sintetizados no processo de transcrição são chamados de transcritos primários. aquela cuja seqüência e estrutura correspondem à forma final do RNA funcional.

então. transportado ao citoplasma onde será traduzido . O RNA maduro é.PROCESSAMENTO DO mRNA O transcrito primário da molécula de mRNA é também conhecido como pré-mRNA Este RNA precursor é sintetizado no núcleo e sofre várias alterações transformado-se no que se chama mRNA maduro ou processado.

metilação (adição do radical metil) na posição 7 da guanina resultando na formação do nucleotídeo 7-metilguanilato. é utilizado para reconhecimento. • O “cap” protege a extremidade 5’ da ação de exonucleases e.PROCESSAMENTO DO mRNA • Após o início da transcrição da molécula de mRNA é adicionado um resíduo de guanina à sua extremidade 5’. pelo ribossomo. • Este resíduo chamado “cap” sofre. também. do sítio de início do processo de síntese protéica. então. .

altamente conservada e localizada 10 a 30 nucleotídeos “upstream” ao sítio de poliadenilação. . • Quando se reconhece a seqüência AAUAAA. é um sinal de que a molécula está terminando e que deve ser adicionada a cauda poliA à extremidade da mesma.PROCESSAMENTO DO mRNA • A maioria dos mRNAs possui uma seqüência de resíduos de adenina na sua extremidade 3’ que é chamada de cauda poliA e é adicionada à molécula durante a transcrição.

GU e AG. são altamente conservados.PROCESSAMENTO DO mRNA • Após a adição do “cap” 5’ e da cauda poliA. mecanismo conhecido como “splicing” e migra para o citoplasma da célula. ( • Os introns apresentam um grau de conservação maior do que os exons além de apresentarem uma característica muito importante: Os primeiros e os últimos dois nucleotídeos da extremidade 5’ e 3’. a molécula de pré-mRNA sofre o processo de excisão dos introns e junção dos exons. .

RNAm liga-se as Ribonucleoproteínas nucleares pequenas (snRNPs) Splicing mediado por spliceossomo: Utiliza ATP •FUNÇÃO:  ajuda a clivar no sítio de splicing remove intron une os éxons anteriores e posteriores .

PROCESSAMENTO DO mRNA Splicing: •FUNÇÃO:  ajuda a clivar no sítio de splicing remove intron impede afastamento dos éxons une os éxons .

PROCESSAMENTO DO mRNA .

Estrutura do mRNA .

.

PROCESSAMENTO DO mRNA • Um transcrito primário pode ser processado de diferentes maneiras sendo que o que é intron para um mRNA pode ser exon para outro mRNA que provém do mesmo RNA precursor • Esta diferença de processamento pode ser devida à presença de dois ou mais sítios de poliadenilação e/ou à diferença no processo de “splicing” do pré-mRNA .

MOLÉCULAS DE RNA • RNA mensageiro – carrega a informação copiada do DNA sob a forma de inúmeros “triplets” cada um especificando um aminoácido • RNA transportador – decifra o código representado pelo mRNA • RNA ribossômico – associa-se com uma série de proteínas para formar os ribossomos .

TRADUÇÃO • Processo que se baseia na seqüência do mRNA para determinar e unir os aminoácidos formando. • Cada aminoácido é codificado na seqüência de DNA como um códon contendo uma seqüência de três nucleotídeos. . a proteína. • Moléculas de RNA transportador transferem a informação contida no genoma à uma seqüência de aminoácidos nas proteínas. assim.

• Pareia com a seqüência do codon do mRNA adicionando o aminoácido que carrega à uma cadeia de peptídeos crescente. através da enzima aminoacil –tRNA sintetase.RNA TRANSPORTADOR • Liga-se quimicamente à um aminoácido específico. de aminoacil-tRNA. . sendo chamado. desta forma.

RNA TRANSPORTADOR .

RIBOSSOMOS A eficiência da tradução se deve. à ligação da molécula de mRNA e dos aminoaciltRNAs ao maior complexo RNA-proteína da célula – o ribossomo – que direciona o crescimento da cadeia polipeptídica Durante a síntese protéica. o ribossomo se move ao longo da cadeia de mRNA interagindo com vários fatores protéicos e o tRNA . principalmente.

na proteína.CÓDIGO GENÉTICO A relação entre a seqüência de bases no DNA e a seqüência correspondente de aminoácidos. é chamada de código genético O código genético encontra-se na forma de triplets – os códons .

TRADUÇÃO • O codon AUG. • Quando AUG está colocado no início este é lido como uma formil-metionina. . • O tRNAMet reconhece codons AUG internos. age como o codon de iniciação na maioria das moléculas de mRNA. é lido como metionina. não carregando nunca uma metionina formilada. quando está dentro da região codificadora. que codifica o aminoácido metionina.

na direção 5’ 3’. sintetizando a proteína no sentido amino-terminal para carboxi-terminal . possibilitando um pareamento entre esse e os tRNAs que carregam os diferentes aminoácidos que irão compor as proteínas Os ribossomos deslocam-se ao longo do mRNA.TRADUÇÃO Durante a síntese de proteínas. os ribossomos deslocam-se ao longo do mRNA.

TRADUÇÃO A terminação da síntese de proteínas ocorre pelo aparecimento de códons de terminação na molécula de mRNA O reconhecimento desses códons é realizado por proteínas e não por moléculas de tRNA. diferentemente do que ocorre nos outros códons .

Dogma Central da biologia Molecular .

Núcleo RNA polimerase Gene Transcrição hnRNA Processamento mRNA Tradução Citoplasma proteína .

Transcrição: RNA polimerase Gene ativo 5’ ACGTA TGCAT 3’ 5’ 3’ 3’ A T 5’ Molécula de RNA nascente .

Tradução: aa livre Ribossomo Glu Phe Asp Gly His Proteína Met Ala Cys 5’ tRNA 3’ AU G G CAU G C GAC GAAU U C G GACACAUA Molécula de mRNA Direção do avanço do ribossomo codon .

Phe Glu Asp Met Ala Cys Gly His 5’ AU G G CAU G C GAC GAAU U C G GACACAUA 3’ .

Phe Glu Met Ala Cys Gly His Asp 5’ AU G G CAU G C GAC GAAU U C G GACACAUA 3’ .

His Gly Met Ala Cys Asp Phe Glu 5’ AU G G CAU G C GAC GAAU U C G GACACAUA 3’ .

Ile Met Ala Cys Asp Glu His Gly Phe 5’ AU G G CAU G C GAC GAAU U C G GACACAUA 3’ .

Lys Met Ala Cys Asp Glu Phe Ile His Gly 5’ AU G G CAU G C GAC GAAU U C G GACACAUA 3’ .

Met Ala Cys Asp Glu Phe Gly Lys Ile His 5’ AU G G CAU G C GAC GAAU U C G GACACAUA 3’ .

Met Ala Cys Asp Glu Phe Gly His Lys Ile 5’ AU G G CAU G C GAC GAAU U C G GACACAUA 3’ .

Met Ala Cys Asp Glu Phe Gly His Ile Leu Lys 5’ G CAU G C GAC GAAU U C G GACACAUAAAA 3’ .

Met Ala Cys Asp Glu Phe Gly His Ile Lys Met Leu 5’ U G C GAC GAAU U C G GACACAUAAAAU UA 3’ .

Met Ala Cys Asp Glu Phe Gly His Ile Lys Leu Asn Met 5’ GAC GAAU U C G GACACAUAAAAU UAAU G 3’ .

Met Ala Cys Asp Glu Phe Gly His Ile Lys Leu Met Pro Asn 5’ GAAU U C G GACACAUAAAAU UAAU GAAC 3’ .

Met Ala Cys Asp Glu Phe Gly His Ile Lys Leu Met Asn Gln Pro 5’ U U C G GACACAUAAAAU UAAU GAAC C CA 3’ .

Met Ala Cys Asp Glu Phe Gly His Ile Lys Leu Met Asn Pro Gln 5’ G GACACAUAAAAU UAAU GAAC C CACAA 3’ .

Met Ala Cys Asp Glu Phe Gly His Ile Lys Leu Met Asn Pro Gln 5’ STOP 3’ CACAUAAAAU UAAU GAAC C CACAAUAA .

Ala Cys Asp Glu Phe Met Gly His Ile Lys Leu Met Asn Pro Gln

5’

STOP

3’

AUAAAAU UAAU GAAC C CACAAUAAAAA

Ala Cys Asp Glu Phe Met Gly His Ile Lys Leu Met Asn Pro Gln

5’

STOP

3’

AUAAAAU UAAU GAAC C CACAAUAATAC

Ala Cys Asp Glu Phe Met Gly His Ile Gln Lys Pro Leu Asn Met

5’
AUAAAAU UAAU GAAC C CACAAUAATAC

3’

VARIAÇÃO GENÉTICA =POLIMORFISMO Ala Cys Asp Glu Phe Met Gly His Ile Gln Lys Pro Leu Asn Met 3’ 5’ AUAAAAU UAAU GAAC C CACAAUAATAC Ala Cys Asp Glu Phe Met Gly His Ile Gln Lys Pro Leu Asn CYS 5’ A U A A A A U U A A U G A A C AA A C A A U A A T A C Muda a forma e função 3’ .

Hemoglobina-sangue .Proteína da cor do cabelo (Melanina) PROTEÍNA .REPRESENTAÇÃO LINEAR A MOLÉCULA DO DNA 5’ATTCGGCGCTATGCATGCTATGCG3’ aa1 aa2 aa3 aa4 aa5 aa6 aa7 aa8 .Queratina.Estrutura do cabelo .cabelo .sangue .Albumina.

cor dos olhos Não passa para os filhos Ex.VARIAÇÕES GENÉTICAS Acontecem no nosso DNA Células germinativas Células somáticas Passa para os filhos Ex. câncer .

(1ª etapa da expressão gênica) • Sem a RNA polimerase não há vida!!! • Sem RNA polimerase não há enzimas!!!! • A inibição da RNA polimerase leva à morte do organismo. ...RNApolimerase • É essencial na transcrição....Lembrar..

inibindo assim a síntese de mRNA. • Gastrointerites.Correlação Clínica • Antibióticos e Toxinas que têm como alvo a RNA Polimerase: – Toxina do cogumelo Amanita phalloides ou “chapéu da morte”. altamente tóxico. – A toxina mais letal. -amanitina. inibe a subunidade maior da RNA polimerase II. para TB . insuficiência hepática (RNA essenciais são degradados e não são substituídos). – Ação do antibiótico Rifampicina.

O DNA metilado se torna inativo. de modo que o mRNA de FMR1 não é sintetizado. – A ausência deste gene leva a patologia da doença .Correlação Clínica • Síndrome do X frágil: uma doença da Cromatina? – Retardo mental hereditário – Inativação do gene FMR1 – Doença resulta da repetição da sequência CGC • Indivíduos normais 30-200 cópias • Indivíduos com síndrome 200-milhares de cópias – A presença do número elevado de CGC induz a uma extensa metilação do DNA da região promotora do gene FMR1.

uma prédisposição ao ca de mama e a sarcoma de córtex adrenal. – A p53 inibe a transcrição de genes com sequência TATA. leucemina. ligando-se ao complexo formado entre os fatores de transcrição e a sequência TATA. Paralelamente a p53 ligase a pontos específicos de genes de reparo. . etc. Uma cópia mutada desta causa a síndrome de Li-Fraumeni. – Mutações representam a perda da função ou estabilidade ou capacidade de se ligar ao DNA.Correlação Clínica • Fatores Transcripcionais na Carcinogênese – P53 (proteína supressora de tumor).

deformidade faciel. . pacientes apresentam alterações de desenvolvimento e neurológicas .Correlação Clínica • Auto –imunidade em doença do tecido conjuntivo: Lúpus eritematoso (splicing) • Talassemia devido a defeitos na síntese de RNA mensageiro (anemia). Morem 20 anos. mutações que levam à terminação prematura da síntese da beta-globina • Síndrome de Cockayne. Mutação afeta a transcrição de alguns genes (atividade da RNA polimeraseII). autossômica recessiva. etc.

.. .Ufa! Até eu cansei.