You are on page 1of 31

Is behavior caused by genes or environment?

Is behavior caused by genes or environment?

Can the environment influence the function of genes?

Gene sequence is inherited (youre stuck with what you have)


atgtcagccgataactgactgatcgtaaattgagtttt

gene However: Gene expression is influenced by inheritance AND age, tissue type, physical environment and social environment protein
gene expression = mRNA abundance

messenger RNA (mRNA)


atgtcagccgataactgactgatcgtaaattgagtttt

gene

Variation in gene sequence (DNA polymorphisms) can be found by gene mapping and DNA sequencing
atgtcagccgataactgactgatcgtaaattgagtttt atgtcagccgataactgactgatggtaaattgagtttt

DNA polymorphism

Variation in gene expression can be found using microarrays


gene expression = mRNA abundance

protein

messenger RNA (mRNA)


atgtcagccgataactgactgatcgtaaattgagtttt

Microarrays measure mRNA abundance for 1000s of genes simultaneously

gene

Behavioral division of labor in the honey bee colony

Behavioral division of labor in the honey bee colony

Behavioral division of labor in the honey bee colony Age at onset of foraging is socially regulated
% introduced bees that initiated foraging by day 14

50 40 30 20 10

10

20

30

40

% old foragers in colony

Behavioral division of labor in the honey bee colony Age at onset of foraging is socially regulated

Inhibitory social pheromone

Nurse

Forager

Behavioral division of labor in the honey bee colony Age at onset of foraging is also genetically variable
% of introduced bees foraging at 15 days of age

60 40 20 0

Introduced bees Host colony

m c l m

m c c

m c l l

m, c and l are different genetic strains

Honey bee brain microarray

Each pair of spots is a detector for mRNA abundance for 1 bee gene.
We can analyze mRNA abundance for ~5500 different genes at the same time (in a single dissected bee brain)

Comparing gene expression in a nurse brain vs. a forager brain


Dissected nurse brain Dissected forager brain

microarray hybridization

Forager mRNA level

labeling reaction

Nurse mRNA level

Do age-related changes in behavior involve changes in gene expression in the brain?

Typical host colonies (ca. 40,000 mixed-age bees)

Collect marked bees day 7 day 30

~700 one-dayold bees (marked)

Young nurses (n = 18)

Old foragers (n = 18)

YN

OF

Yellow = high mRNA abundance Blue = low mRNA abundance YN = young nurse OF = old forager

Genes

About 1/3 of genes expressed in the bee brain show differences in expression! But Are gene expression differences really associated with behavior differences or with age?

Bee brains

YN

OF

Yellow = high mRNA abundance Blue = low mRNA abundance YN = young nurse OF = old forager

Genes

About 1/3 of genes expressed in the bee brain show differences in expression!

Bee brains

Changing age-demography in the colony (i.e., social environment) allows us to collect precocious young forgers and over-aged old nurses
Collect marked bees ~1500 one-day-old bees (marked) All bees are same age!!! day 7 Young nurses (n = 6) Young foragers (n = 6) day 30 Old nurses (n = 6) Old foragers (n = 6)

YN

OF

YN YF ON OF

Yellow = high mRNA abundance Blue = low mRNA abundance

YN = young nurse YF = young forager ON = old nurse OF = old forager Gene expression was primarily associated with behavior, not age!

Genes

Bee brains

YN

OF

YN YF ON OF

Yellow = high mRNA abundance Blue = low mRNA abundance

YN = young nurse YF = young forager ON = old nurse OF = old forager

Genes

Bee brains

Although 1/3 genes show differences, only ~50 genes are needed to predict whether a bee is a nurse or a forager
(Whitfield, Cziko & Robinson. Science 2003, 302: 296)

mRNA level

Single-cohort Typical colony (age-matched) bees bees

Y = young (7 2 days) O = old (30 2 days) N = Nurse F = Forager

>2 1.5 1.25 1 0.8 0.67 <0.5

Is gene expression in the brain a cause or consequence of behavior? Brain gene expression
Upstream regulation of behavior
?

Behavior

-- or -?

Behavior

Brain gene expression


Consequence of behavioral activity, experience or environmental differences

Is gene expression in the brain a cause or consequence of behavior? Direct test of causation: Manipulate gene expression in brain Effects on behavior?

Is gene expression in the brain a cause or consequence of behavior? Direct test of causation: Manipulate gene expression in brain Effects on behavior?

Is gene expression in the brain a cause or consequence of behavior? Brain gene expression
Upstream regulation of behavior
?

Behavior

-- or -?

Behavior

Brain gene expression


Consequence of behavioral activity, experience or environmental differences

Brain gene expression in the absence of task-related experience

Caged bees (no task-related experiences)

Brain gene expression in the absence of task-related experience

Social cue or treatment that accelerates the onset of foraging


Caged bees (no task-related experiences)

Forager-like changes in brain gene expression?

Brain gene expression in the absence of task-related experience

Social cue or treatment that accelerates the onset of foraging

Forager-like changes in brain gene expression?

Social cue or treatment that delays the onset of foraging

Nurse-like changes in brain gene expression?

Caged bees (no task-related experiences)

Juvenile hormone analog (methoprene) accelerates the onset of foraging and causes forager-like changes in brain gene expression (in the absence of experience)
marker genes High in foragers (32) Treat with methoprene (JH analog) Caged bees (no task-related experiences) Induced by methoprene (249) Repressed by methoprene (222) High in nurses (18)

13

11

Whitfield CW et al. PNAS. 2006. Oct 31; 103(44):16068-75.

Queen mandibular pheromone (QMP) delays the onset of foraging and causes nurse-like changes in brain gene expression (in the absence of experience)

marker genes High in foragers (32) Treat with QMP High in nurses (18) 4 2

Induced by QMP (602)


Caged bees (no task-related experiences) Repressed by QMP (704)

0 18

Grozinger CM, Sharabash NM, Whitfield CW, Robinson GE. PNAS. 2003. Nov 25; 100:14519

Is behavior caused by genes or environment?

Can the environment influence the function of genes?

Many behaviors but how many involve gene expression differences?

Gene clusters (expression level in brain)

>2 1.5 1.25 1 0.8 0.67 < 0.5

Are gene expression changes robust at the level of individual?


Can gene expression profile in an individual bees brain be used to correctly predict behavioral group?

Leave-one-out cross-validated class prediction


Training set 59 bees (computer knows behavior) Test set 1 bee (computer attempts to classify) Method: 1. Computer identifies a set of predictor genes for behavior using expression data from the 59 bees in the training set. 2. Computer attempts to classify the single test bee based on its expression of the predictor genes. 3. Repeat iteratively for all 60 individual bees. Result: Computer can correctly assign behavior group for 57 out of the 60 bees.

nurse or forager?