Primer Design

By Dr/ Dalia Shaalan Lecturer of Medical Biochemistry and Molecular Biology Mansoura University

Why Are Primers Important?

Primers are what gives PCR its SPECIFICITY!!!
Good primer design: PCR work is great. Bad primer design: PCR work is terrible.

Very-Brief PCR Reminder

PCR is a method to amplify large quantities of a DNA covering a specific sequence.

PCR

General notes on primer design in PCR Perhaps the most critical parameter for successful PCR is the design of primers
Primer selection

Critical variables that affect priming are: - primer length - specificity - melting temperature (Tm)

- G/C content
- 3-end sequence - complementary primer sequences

Primer length
Specificity and the temperature of annealing are dependent on primer length Oligonucleotides between 20 and 30 bases are highly sequence specific Primer length is inversly proportional to annealing efficiency: in general, the longer the primer, the more inefficient the annealing The primers should not be too short as specificity decreases Primer Size: Too small, may bind to more than one site in the genome Too Large (Long primers), takes a longer time to hybridize and would slow down the PCR cycle.

Melting temperature (Tm)

Not all primers will work the same; primers perform differently at different temperatures. Melting temperature (Tm) is temperature at which the primer will dissociate.

Factors affecting Tm: PRIMER LENGTH

Longer primers stick better = melt at a higher temperature.

GC CONTENT

More G-C content = more triple bonds = primers stick better = melt at higher temperature.
http://www.alkami.com/primers/refprmr.htm

Melting temperature (Tm)

Annealing temperature (Ta): Optimal temperature for primers to attach to the template DNA If you use too high Ta: Bonds dont work Primer doesnt anneal If you use too low Ta: Primer may attach anywhere Non-specific amplification Depends on strength of bonds Remember: G-C three hydrogen bonds A-T two hydrogen bonds Annealing temperature depends on GC content

Melting temperature (Tm)

the goal should be to design a primer with an annealing temperature of at least 50C. the relationship between annealing temperature and melting temperature is one of the Black Boxes of PCR. a general rule is to use an annealing temperature that is 5C lower than the melting temperature.

PCR Annealing Temp = Melt T - 5C

Melting temperature (Tm)

both of the primers should be designed such that they have nearly similar melting temperatures. If primers are mismatched in terms of Tm, amplification will be less efficient or may not even work:

One primer with the higher Tm will misprime at lower temperatures; Other primer with the lower Tm may not work at higher temperatures.

Melting temperature (Tm)

-The melting temperatures of oligos are most accurately calculated using nearest neighbor thermodynamic calculations with the formula:

Tm= H [S+ R (c/4)] 273.15 C + 16.6 log 10 [K+]

(H is the enthalpy, S is the entropy for helix formation, R is the molar gas constant and c is the concentration of primer)
-A good working approximation of this value can be calculated using the Wallace formula:

Tm = 4x (C+G) + 2x (A+T) C

G/C content Ideally a primer should have a random mix of nucleotides and about 50% GC content. There should be no PolyG or PolyC stretches that can promote non-specific annealing.

3-end sequence The 3' terminal position in PCR primers is essential for the control of mis-priming.

Inclusion of a G or C residue at the 3' end of primers helps to ensure correct binding (stronger hydrogen bonding = 3 bonds of G/C residues).

Complementary primer sequences Primers need to be designed with absolutely no intra-primer homology beyond 3 base pairs. If a primer has such a region of selfhomology, snap back can occur. Another related danger is inter-primer homology: partial homology in the middle regions of two primers can interfere with hybridization. If the homology should occur at the 3' end of either primer, primer dimer formation will occur

Complementarity
PRIMER-PRIMER (BAD)

atcggactatcga gctatacttatggcca

Excessive similarity between primers, especially at the 3 ends, leads to the formation of : primer dimers

PRIMER-TARGET (GOOD)
atcggactatcga

tagcctgatagctatacttatggcca

Ideally should be 100% for maximal specificity.

What is a Primer-Dimer
An unwanted extension product Results from primers annealing to themselves, or each other, at 3 ends Extended primers are no longer available to prime target for PCR

atcggactatcga gctatacttatggcca

atcggactatcgatatgaataccgga tagcctgatagctatacttatggcca

Two Strategies for Primer Design

Fixed Primers, Vary Conditions : Pick a primer pair and optimize PCR conditions for it.
If an exact sequence site needs to be amplified.

Optimizing Primers for Set Conditions:

Optimize the primer design to work in a specific set of PCR conditions.

If youve got flexibility around the amplified site.

If youre working with someone elses primers.

Allows more standardized PCR conditions.

Strategy 1 for Primer Design: Fixed Primers, Vary Conditions

With a given primer pair, the Tm can be calculated. Run multiple PCR reactions, each using a different annealing temperature (= Tm - 5). Ta: 3C, -2C, -1C, 0C, +1C, +2C, +3C Temp too low: Smearing due to non-specific priming Temp too high: No amplification due to no priming Choose conditions which give the best results.

Strategy 2 for Primer Design: Optimizing Primers for Set Conditions

PCR conditions (esp. annealing temp) are kept constant. Select primers for a theoretical Tm. Best to select multiple primers, then experiment to see which combination works best.
F1: atcgatcgatcgatcagtcatcg F2: gtactgagctagctgcagctc

R1: atgactgagctgctagcttg R2: atgcatgctcgtgactgtg

R1 R2

F1 F1/R1 F1/R2

F2 F2/R1 F2/R2

95C 65C 72C

Where do we get primer sequences from?

Somebody may have isolated them Check databases Freely available on internet (GenBank) Results not publishable without primer information Heterologous primers (from related species) Primer design from published sequences. Primer isolation Very lengthy and expensive procedure several months work

Primer design
Sequence should be reverse compliments (i.e. 3 ends point toward one another).

Primer design Primer 1 5-CATACGATGCTAGCT-3 CATACGATGCTAGCTAGCTGCTAGTGCTG 5 ATCGTAGTCGTAGCTAGTCGTACGTACGT CGATGTAATTCGCATCGATATGCGCTAGC GATATGCGCATCGATCGATATCGATATGC 3 Primer 2 3-GCTATAGCTATACG-5
Primer 1: 5-CATACGATGCTAGCT-3 Primer 2: 5-GCATATCGATATCG-3

Primer design Primer 1 5-CTGCTAGTGC-3 5 CATACGATGCTAGCTAGCTGCTAGTGCTG ATCGTAGTCGTAGCTAGTCGTACGTACGT CGATGTAATTCGCATCGATATGCGCTAGC GATATGCGCATCGATCGATATCGATATGC 3 Primer 2 3-TACGCGTAGCTA-5

Primer 1: 5-CTGCTAGTGC-3

Primer 2: 5-ATCGATGCGCAT-3

PCR

Designing Primers
Primer Design on the Web

Example: Primer3
http://frodo.wi.mit.edu/

Example gene: GFP5 Green Fluorescent Protein

GFP5, Genebank 1848286

301 aggagaggac catcttcttc aaggacgacg ggaactacaa gacacgtgct gaagtcaagt 361 ttgagggaga caccctcgtc aacaggatcg agcttaaggg aatcgatttc 1 ggatccaagg agatataaca atgagtaaag gagaagaact tttcactgga gttgtcccaa 61 ttcttgttga attagatggt gatgttaatg ggcacaaatt ttctgtcagt ggagagggtg 121 aaggtgatgc aacatacgga aaacttaccc ttaaatttat ttgcactact ggaaaactac 181 ctgttccatg gccaacactt gtcactactt tctcttatgg tgttcaatgc ttttcaagat 241 acccagatca tatgaagcgg cacgacttct tcaagagcgc catgcctgag ggatacgtgc aaggaggacg 421 gaaacatcct cggccacaag ttggaataca actacaactc ccacaacgta tacatcatgg 481 ccgacaagca aaagaacggc atcaaagcca acttcaagac ccgccacaac atcgaagacg 541 gcggcgtgca actcgctgat cattatcaac aaaatactcc aattggcgat ggccctgtcc 601 ttttaccaga caaccattac ctgtccacac aatctgccct ttcgaaagat cccaacgaaa 661 agagagacca catggtcctt cttgagtttg taacagctgc tgggattaca catggcatgg 721 atgaactata caaataagag ctc

Designing Primers
Primer Design on the Web Using Primer3

Enter sequence

Pick Primers

Designing Primers
Primer3 Output
Details: -Start -Length -Tm -GC -Sequence

Where they bind:

Designing Primers
Primer 3 Output (continued)

Primer Evaluation
Lets assume we selected the first primer pair (for + rev) Website for online primer evaluation:
Enter Sequence
TCATTGTTTGCCTCCCTGC TAGAAACCCCAACCCGTGAAA

Primer Evaluation
Website displays potential problems with primer self-annealing TCATTGTTTGCCTCCCTGC TAGAAACCCCAACCCGTGAAA More advanced software can examine interactions between primers
Graphical Output

Primer Evaluation
Just for fun, lets assume we selected a really BAD primer...
GGGCCCCTCACCAACCCGTGCCCGGG

Live Example Primer Design

Primer Design Workflow: 1. Pick a gene. ie. BRCA1 2. Pull up sequence for the gene. a. http://www.ncbi.nlm.nih.gov/ b. search Nucleotide Database for brca1 c. scroll through accessions for desired one 3. Copy sequence to text editor.

4. Pull up a primer design website. a. http://frodo.wi.mit.edu/ b. copy sequence c. select options and choose Pick Primers
5. Analyse and double-check the primers a.http://www.idtdna.com/analyzer/Applications/OligoAnalyzer/Default.a spx b. enter sequence, view 6. Order oligos. a. http://www.operon.com

Conclusion on Primer design

Primer pairs should have similar annealing temp
length, %GC content Tm = 4(G + C) + 2(A + T) oC.

Primers should have no self complementarity

ATA GGC GCC

5-ACTGT

AGAT-3

Minimal (<3bp) between-primer-complementarity

5-ACTGTGCCATAGATGCAG-3 |||| 3-CAACTGCACCGTATGCAT-5

Programs on the web to design primers

Links on webpage