You are on page 1of 77

Gentica

Mnica Mara Saldarriaga

Gentica

Enfoque clsico

Enfoque molecular

GENETICA MENDELIANA
La gentica solo comenz en la dcada de 1860 Gregor Mendel (1822-1884)
Monje agustino catlico y naturalista, nacido en Austria

Dise experimentos que apuntaban hacia la existencia de unos elementos biolgicos que hoy llamamos genes

Herencia mezclada
Exista el concepto de herencia mezclada: la descendencia muestra normalmente caractersticas similares a las de ambos progenitores.pero, la descendencia no siempre es una mezcla intermedia entre las caractersticas de sus parentales

GENETICA MENDELIANA
CONCEPTO DE HERENCIA PARTICULADA
Los factores hereditarios no se mezclan al pasar a la descendencia (Pangnesis), son transmitidos intactos de una generacin a otra y as dirigen la expresin del fenotipo.

Los experimentos de Mendel

Programa de experimentacin sobre la hibridacin de plantas que lo llev pstumamente a ser el fundador de la ciencia de la gentica

Los experimentos de Mendel


Constituyen un ejemplo de la correcta utilizacin del mtodo cientfico Material de investigacin adecuado Dise sus experimentos cuidadosamente Datos abundantes Anlisis matemtico para demostrar que sus resultados eran coherentes con sus hiptesis Las predicciones de las hiptesis se comprobaron otra vez en una serie de experimentos

Pisum sativum

Disponibilidad de guisantes de diversas formas y colores Los guisantes pueden auto-polinizarse Baratos y fciles de obtener Tiempo de generacin corto y produccin de muchos descendientes

Plantas que difieren en un solo carcter


Carcter: propiedad especfica de un organismo; caracterstica o rasgo.

Lnea pura: poblacin que produce descendencia homognea para el carcter particular en estudio; todos los descendientes producidos por autopolinizacin o fecundacin cruzada, dentro de la poblacin, muestran el carcter de la misma forma.

Fenotipo: formas o variantes de un carcter. Deriv. griego: lo que se muestra


Ej: Carcter: color de la flor, Fenotipo: prpura o blanco 1er Exto:

Generacin parental (P) Cruzamiento recpocro fenotipo A fenotipo B 1era Generacin filial (F1) x fenotipo B x fenotitpo A

Todas prpuras!! Primera ley de Mendel: A esta ley se le llama tambin Ley de la uniformidad de los hbridos de la primera generacin (F1), y dice que cuando se cruzan dos variedades individuos de raza pura, ambos homocigotos, para un determinado carcter, todos los hbridos de la primera generacin son iguales.

Fenotipo parental Lisa Amarilla Prpura Hinchada Verde Axial Largo

Cruza Semilla lisa x rugosa Semilla amarilla x verde Ptalos ppuras x blancos Vaina hinchada x hendida Vaina verde x amarilla Flores axiales x terminales Tallo largo x corto

F1 Todas lisas Todas amarillas Todos prpuras Todas hinchadas Todas verdes Todas axiales Todos largos

F2 5474 lisas;1850 rugosas 6022 amarillas;2001 verdes 705 prpuras;224 blancos 882 hinchadas;299 hendidas 428 verdes;152 amarillas 651 axiales;207 terminales 787 largos;277 cortos

Relacin en F2 2,96:1 3,01:1 3,15:1 2,95:1 2,82: 1 3,14: 1 2,84: 1

Resultados de todos los cruzamientos de Mendel en los que los parentales difieren en un solo carcter
(autofecundacin de F1)

Mendel era conciente de la importancia de la proporcin 3:1


El fenotipo blanco est completamente ausente en la F1, pero reaparece (en su forma original) en la cuarta parte de las plantas F2 difcil de explicar por herencia mezclada.

Mendel: la capacidad para producir tanto el fenotipo prpura como el blanco se mantiene y transmite a travs de las generaciones sin modificaciones.
Entoncespor qu no se expresa el fenotipo blanco en la F1? Fenotipo dominante: aquel que aparece en la F1, tras el cruzamiento de 2 lneas puras. Fenotipo prpura es dominante sobre el blanco Fenotipo blanco es recesivo sobre el prpura

Semillas

Exto autofecundacin de F2

F1

Todas Autofecundacin

F2 Autofecundacin F3 3/4 y

3/4

;1/4 (3:1)

; 1/4

Todas

(= al parental verde)

(3:1, amarillas:verdes)

Entonces:

de F2

1/3 = al parental amarillo 2/3 = F1

F2

Proporciones fenotpicas
3/4 amarillos

Proporciones genotpicas
1/4 amarillos puros 2/4 amarillos impuros 1/4 verdes puros

1/4 verdes

Proporcin aparente 3:1 de F2 es 1:2:1

Postulado de Mendel para explicar proporcin 1:2:1


1- Existen determinantes hereditarios de naturaleza particulada genes.

2- Cada planta adulta tiene 2 genes, una pareja gnica. Las plantas de la F1 tienen genes dominantes (A) y recesivos (a).
3- Los miembros de cada pareja gnica se distribuyen de manera igualitaria entre los gametos o clulas sexuales. 4- Cada gameto es portador de un solo miembro de la pareja gnica. 5- La unin de un gameto de cada parental para formar un nuevo descendiente se produce al azar.
Esquema de la generaciones P, F1 y F2 en el sistema de Mendel que implica la diferencia en un carcter determinado por la diferencia de un gen.

CRUZAMIENTO DE PRUEBA PARA DETERMINAR EL GENOTIPO DE UN INDIVIDUO BASADO EN EL FENOTIPO DE LA PROGENIE RETROCRUZA A x aa

PARENTALES

GAMETOS F 1
Todos dominantes Dominante Recesivo

Corroboracin del modelo por Cruzamiento prueba (cruzamiento con un homocigota recesivo)

Obtiene: 58 amarillas (Yy) 52 verdes (yy)

Se confirma la segregacin igualitaria de Y e y en el individuo de la F1

Segunda Ley de Mendel (separacin o disyuncin de los alelos. Los dos miembros de una pareja gnica se distribuyen separadamente entre los gametos (segregan), de forma que la mitad de los gametos llevan un miembro de la pareja y la otra mitad lleva el otro miembro de la pareja gnica.

BASE CROMOSOMICA DE LA 2 LEY DE MENDEL

TRANSMISIN INDEPENDIENTE DE GENES NO ALLICOS


EL ALINEAMIENTO DE CADA PAR CROMOSOMICO ES INDEPENDIENTE Y ALEATORIO: SE PRODUCEN 4 TIPOS DE GAMETOS CON LA MISMA FRECUENCIA MEIOSIS I

MEIOSIS II

MODELO MENDELIANO BASICO


RELACION ENTRE GENES Y RAZGOS HEREDITARIOS
GEN Y SUS FORMAS ALELICAS: UNIDAD BASICA DE LA HERENCIA ALELOS: GENES QUE CONTROLAN UN PAR DE CARACTERES ALTERNATIVOS

TRANSMISIN DE GENES DE UNA GENERACIN A OTRA SOLO UN MIEMBRO DE CADA PAR ALELO, INCLUIDO EN UN
GAMETO ES TRANSFERIDO A LA GENERACION SIGUIENTE

Carcter

Fenotipos

Genotipos

Alelos

Gen

Prpura (dominante) Color de la flor Blanco (recesivo)

CC (homocigota dominante Cc (heterocigota)

C (dominante)

Gen del color de la flor c (recesivo)

cc (homocigota recesivo)

Individuos de una lnea pura son homocigotas. Genotipo: constitucin gentica (o allica) respecto de uno o varios caracteres en estudio.

Alelos: distintas variantes de un gen

Glosario de trminos

Heterocigotos - Hbridos Homocigotos

Homocigoto dominante
Homocigoto recesivo Genotipo Alelo Locus

Cruzamiento dihbrido: las lneas puras parentales difieren en dos genes que controlan dos diferencias de caracteres distintos.

Las proporciones lisas:rugosas y amarillas:verdes son ambas 3:1!!

Tercera Ley de Mendel (herencia independiente de caracteres). La segregacin de una pareja gnica durante la formacin de las gametas se produce de manera independiente de las otras parejas gnicas.

CONFIRMACIN DE LA ASOCIACION INDEPENDIENTE DE GENES NO ALELOS


ANALISIS DE F 2 CRUZAMIENTO DIHIBRIDO

RrYy x RrYy

9:3:3:1 es el producto matemtico de la proporcin obtenida para cada uno de los dos caracteres por separado
(3lisas+1rugosa) x (3amarillas +1verde)

Confirmando que segregan independientemente


TOTAL 556 315 108 101 32

Leyes de Mendel
1

Interfase

Profase

Teora cromosmica de la herencia (Sutton-Boveri): el paralelismo entre el comportamiento de los genes (Mendel) y los cromosomas llev a pensar que los genes estn situados en cromosomas. (luego se corrobora por herencia sexual)

Metafase I

Anafase I

Explica la distribucin igualitaria y la segregacin independiente

Telofase I

Anafase II

Telofase II

Meiosis de una clula diploide con genotipo A/a:B/b

Smbolos utilizados en anlisis de pedrigr humanos

HERENCIA AUTOSOMICA RECESIVA


Aa Aa

AA
Fenotipo

Aa

Heterocigotos

Aa

aa

75% Sanos 25 % Afectados

Afectados son hijos de padres sanos Cada hijo tiene un riesgo de (25%) de ser afectado La probabilidad es mayor en matrimonios consanguneos
Ej. Fenilcetonuria, fibrosis qustica, albinismo

Fenilcetonuria
Enfermedad hereditaria recesiva provocada por un trastorno en el metabolismo de la fenilalanina que se transforma en cido fenilpirvico en lugar de tirosina. El cido fenilpirvico no se libera totalmente por la orina y una parte de l se acumula en el organismo provocando retraso mental, alteraciones neurolgicas (hipertona muscular y epilepsia) y alteraciones del comportamiento

Carencia de la enzima Fenilalanina hidroxilasa o tiroxina hidrosilasa

Fibrosis Qustica
La Fibrosis Qustica (FQ) es la enfermedad hereditaria letal ms frecuente en raza blanca. Se transmite de manera autosmica recesiva, de tal modo que una pareja de portadores tiene la probabilidad de un 25% de un hijo con FQ en cada embarazo y que cada hijo sano tiene 2/3 de probabilidades de ser portador. La enfermedad se produce por una mutacin en el gen que codifica la protena reguladora de la conductancia transmembrana de la FQ (CFTR)1, ubicado en el brazo largo del cromosoma 7. El defecto de la protena provoca un trastorno del transporte de cloro y sodio por las clulas de los epitelios, generndose un gran espesamiento de las secreciones, que determina daos en los epitelios secretores, siendo los principales rganos afectados el pulmn, pncreas, hgado, la piel, el aparato reproductor masculino y otros

HERENCIA AUTOSOMICA DOMINANTE


aa Aa

Aa
Fenotipo

aa

Aa

aa

50% Afectados 50% Sanos

Una persona afectada tiene por lo menos un padre afectado Padres sanos slo tienen hijos sanos

Enfermedad de Huntington
La enfermedad de Huntington es causada por un defecto gentico en el cromosoma No 4. El defecto hace que una parte del ADN, llamada repeticin CAG, ocurra muchas ms veces de lo que se supone que debe ser. Normalmente, esta seccin del ADN se repite de 10 a 35 veces, pero en una persona con la enfermedad de Huntington, se repite de 36 a 120 veces.

Es un trastorno que se transmite de padres a hijos, en el cual ciertas neuronas en el cerebro se desgastan o se degeneran

Bases moleculares de la gentica mendeliana


Alelos: variantes de un mismo gen. Difieren en solo uno o unos pocos nucletidos entre s. Alelo wild-type: forma en la que cualquier gen particular es hallado en la naturaleza. Ej. Color del ptalo de la planta de guisante. Alelo A es wild-type

Genotipo
A/A A/a a/a enzima activa enzima activa enzima inactiva pigmento prpura pigmento prpura no hay pigmento ptalos prpura ptalos prpura ptalos blancos

Imp! El fenotipo blanco puede darse por la inactivacin de cualquiera de los genes involucrados en la sntesis del pigmento.

Recesividad de un alelo mutante de un gen haplosuficiente

Cdigo gentico

Molcula de ADN:

ATG CAT TCA CAT TCA TAC AAA ACT ATG

Protena sintetizada:

Met His

Ser His

Ser Tir Lys

Thr Met

Si ocurre una mutacin y la T es cambiada por una C (una sustitucin) entonces: Molcula de ADN: Protena sintetizada: ATG CAT CCA CAT TCA TAC AAA ACT Met His Pro His Ser Tir Lys Thr

Alelo nulo: aquel que lleva a la desaparicin fenotpica de la funcin normal (ej m2 y m3).

Los alelos nuevos formados por mutacin pueden resultar en la prdida total o parcial de la funcin, o de la ganancia de ms funcin o incluso adquisicin de una nueva funcin a nivel proteico.

Bases moleculares del albinismo (enfermedad autosmica recesiva)

Resumen de los trabajos de Mendel


Los caracteres son heredados a travs de partculas los genes Hay dos copias de cada gen en cada clula germinal Hay una sola copia de cada gen en cada gameto Los alelos segregan al azar Los alelos tienen formas dominantes y recesivas

=> genotipo fenotipo


Los alelos de diferentes genes combinan de manera independiente

EXTENSIONES A LAS LEYES DE MENDEL


RELACIONES DE DOMINANCIA DOMINANCIA INCOMPLETA

CODOMINANCIA
ALELOS MULTIPLES INTERACCIONES GENICAS NO ALELICAS

EPISTASIS
PENETRANCIA Y EXPRESIVIDAD VARIABLE HERENCIA LIGADA AL SEXO

RELACIONES DE DOMINANCIA
- DOMINANCIA INCOMPLETA

- CODOMINANCIA

Comparten: fenotpicamente es posible distinguir a los heterocigotos

DOMINANCIA INCOMPLETA
Uno de los alelos no es completamente dominante sobre el otro. El heterocigoto presenta un fenotipo intermedio

Frecuencia fenotpica F2:

1: 2:1

Extensiones del anlisis mendeliano


Dominancia completa: el homocigota dominante no puede distinguirse fenotpicamente del heterocigota.

Dominancia incompleta: el heterocigota muestra un fenotipo cuantitativamente (aunque no exactamente) intermedio entre los fenotipos homocigotas correspondientes. Ej. Planta Dondiego de noche P F1 ptalos rojos x ptalos blancos ptalos rosas

F2

1/4 ptalos rojos 1/2 ptalos rosas 1/4 ptalos blancos

CODOMINANCIA
AMBOS ALELOS SON COMPLETAMENTE FUNCIONALES Y SE EXPRESAN AL ESTADO HETEROCIGOTO

SISTEMA ABO GRUPO SANGUINEO


LOCUS 9q34 GEN MULTIALELICO QUE CODIFICA PARA ANTIGENOS DE SUPERFICIE GL ROJOS, DEPENDIENDO DEL ALELO PRESENTE

ALELOS: IA I B I0

A=B, A>O, B>O 4 FENOTIPOS

Codominancia: el heterocigota expresa el fenotipo de ambos homocigotas por igual.

Ej. Grupos sanguneos humanos ABO


Antgeno A

Glbulos rojos de una persona tipo A Antgeno B

Anticuerpos Anti-A

Aglutinacin de gl. rojos tipo A

No hay aglutinacin de gl. rojos tipo B

Glbulos rojos de una persona tipo B

Anticuerpos Anti-A

Glbulos rojos de una persona tipo AB

Anticuerpos Anti-A

Aglutinacin de gl. rojos tipo AB

Base bioqumica de los grupos ABO


N-acetilgalactosamina adicionada al precursor Antgeno A; reacciona con anticuerpos anti-A

alelo A (

IA)

alelo O (i) Antgeno H; no reacciona con anticuerpos anti-A ni anti-B alelo B ( IB)

Carbohidrato precursor

Los alelos A y B producen transferasas distintas (que modifican de distinta manera la galactosa terminal del compuesto precursor) y el alelo O no produce ninguna.

Galactosa adicionada al precursor

Antgeno B; reacciona con anticuerpos anti-B

N-acetilglucosamina

Galactosa

N-acetilgalactosamina

Fucosa

Tipo sanguneo A B AB

Genotipo IAIA o IAi IBIB o IBi IAIB

El alelo i es nulo, es incapaz de producir cualquier forma del antgeno. Alelos A y B son dominantes sobre el alelo i. Alelos A y B son codominantes entre s.

ii

Grupo O es donante universal (no contiene antgenos ni A ni B). Grupo AB es receptor universal (no produce anticuerpos contra el antgeno A ni el antgeno B).

Ej. Anemia falciforme humana


Origen Tipo de Hb presente Genotipo Fenotipo Portador Anemia falciforme Normal

SyA S A
Migracin

HbSHbA HbSHbS HbAHbA

Respecto a la anemia: alelo HbA es dominante.


HbAHbA: Normal. Los gl. rojos no se deforman nunca. HbSHbS: Anemia grave, a menudo mortal. La Hb anormal causa que los gl. rojos adquieran forma de hoz. HbSHbA: No se produce anemia. Los gl. rojos se deforman slo a concentraciones de O2 anormalmente bajas.

Respecto a la forma de los glbulos rojos: existe dominancia incompleta de HbA Respecto a la sntesis de Hb: hay codominancia.

Mutacin: cambio de cido glutmico por valina

MUTACION = VARIABILIDAD
MUTACIN: PRINCIPAL FUENTE DE VARIABILIDAD GENETICA Y GENERACION DE ALELOS POLIMORFICOS GEN A
AGCATCCAAGGT TCGTAGGTTCCA
MUTACIN 1 MUTACIN 2

AGCATTCAAGGT TCGTAAGTTCCA

AGCATCCGAGGT TCGTAGGCTCCA

ALELO A

ALELO A

Variabilidad de la secuencia de ADN

ATTCGCTATCGAACGCTACGCTGCGAACGGG
ATTCGTTATCGAACGCTACGCTGCGAACGGG ATTCGCTATCGAA- - -TACGCTGCGAACGGG Sustitucin Delecin

ATTCGCTATCGAACGCCGCTACGCTGCGAACGGG Repeticin ATTCG - - - CGAACGCTACGCTGCTATCGAACGGG Transposicin

Ademas: Errores de appareamiento de cromosomas Ruptura / fusion de cromosomas (o partes).

ALELOS MULTIPLES
SERIES ALELICAS MULTIPLES

Ms de 2 formas allicas de un gen participan en la formacin de un carcter.


Color del pelaje de los conejos = 4 alelos
Himalayo (ch ) Albino (c)

AGUTI (c+) Chinchilla (cch )

ALEL0S MULTIPLES
Jerarqua de dominancia simple: C+ Cch Ch

>

>

>

c Albino

Agut

Chinchilla Himalayo

Alelos letales: alelos mutantes que pueden causarle la muerte a un organismo. Los genes en los cuales ciertas mutaciones pueden ser letales son claramente genes esenciales.

Alelos letales recesivos: en organismos diploides se mantienen en heterocigosis.

Ej. Alelo (A) del color de la piel del ratn Color normal (marrn) es lnea pura.

P F1

amarillo x wild type amarillos:normales 1:1


Ratones amarillos son heterocigotas y el amarillo es dominante

amarillo x amarillo 2/3 amarillo: 1/3 color normal 2:1


El alelo amarillo es letal en homocigosis Alelo amarillo es dominante segn el color de pelo y adems letal recesivo (mueren antes de nacer)

P F1

AyA x AyA 1/4 AA wild type

1/2 AyA amarillo


1/4 AyAy letal

Genes pleiotrpicos: genes de los que se sabe que tienen ms de un efecto fenotpico distinto

Ejercicios
1. Qu proporciones fenotpicas y genotpicas se esperan en una F2 cuando se cruzan individuos cuyo carcter estudiado est determinado por un locus diallico, en las situaciones .

a. b.

Dominancia? Codominancia?

c.

Herencia intermedia?

2. En cual de las situaciones anteriormente descritas se puede distinguir el heterocigoto?

2. Los pollos con alas y patas recortadas reciben el nombre de trepadores. El apareamiento de este tipo de pollos con aves normales da lugar a una descendencia equilibrada entre pollos normales y trepadores. El apareamiento de pollos trepadores entre s produce una descendencia formada por dos pollos trepadores y uno normal. El cruzamiento entre pollos normales da lugar a una progenie uniforme formada exclusivamente por aves normales. Explicar el fenmeno de forma razonada.

INTERACCIONES GENICAS NO ALELICAS


INTERACCION DE DOS O MAS GENES PARA DETERMINAR UN RASGO Productos de genes no alelos actan en conjunto para producir un mismo carcter.

En F2 aparecen fenotipos en un nmero mayor a lo esperado por la accin de un par de alelos.

INTERACCIONES GENICAS NO ALELICAS


EPISTASIS: La expresin de un gen es encubierta por la expresin de otro gen no alelo pero que afecta el mismo rasgo. En este caso se modifican las proporciones mendelianas en el fenotipo.

Epstasis: tipo de interaccin gnica en la cual un gen enmascara la expresin de otro y expresa su propio fenotipo. Generalmente ambos genes se encuentran en una misma ruta metablica.

Ej. Color de pelo del ratn

BBcc (albino) x bbCC (marrn) o BBCC (negro) x bbcc (albino) Todos BbCc (negro)
9 B-C3 bbC3 B-cc 1 bbcc (negro) (marrn) (albino) (albino)

Gen B. alelo B: negro alelo b: marrn Gen C. alelo C: color alelo c: ausencia de color

F1
F2

9 3
4

Ej. Epstasis recesiva en ruta metablica

Complementacin: dos alelos dominantes wild-type se unen para producir un fenotipo especfico, revirtiendo el fenotipo dado por dos alelos mutantes recesivos.

Ej. Color de ptalos

Flor wild type: azul (pigmento antocianina) Lnea mutante 1: flor blanca Lnea mutante 2: flor blanca Lnea blanca 1 x Lnea blanca 2 AAbb x aaBB todas AaBb (azules)

F1

F2

9 3 3 1

A-BA-bb aaBaabb

(azul) (blanca) (blanca) (blanca)

9 7

Supresin: alelo de un gen que anula la expresin de otro gen. El gen supresor puede llevar asociado su propio fenotipo o no tener otro efecto detectable mas que el de la supresin (ej maldivina).

Ej. Produccin de malvidina en plantas: antocianina que da el color al vino tinto


P F1 F2 9 3 1 3 KKdd (malvidina)

Gen K: dominante, produccin de malvidina. Gen D: supresor no allico dominante

x kkDD (no malvidina)

todas KkDd (no malvidina)

K-DkkDkkdd K-dd

(no malvidina) (no malvidina) (no malvidina) (malvidina)

13 3

Genes duplicados: la presencia de al menos un alelo dominante de cualquiera de los dos genes es suficiente para que se exprese el mismo fenotipo dominante.

Ej. Forma del fruto en la planta bolsa del pastor

Gen A1: dominante, frutos redondeados Gen A2: dominante, frutos redondeados

A1A1A2A2 (redondeados) x a1a1a2a2 (estrechos)

F1
F2 9 3 3 1

todos A1a1A2a2 (redondeados)


A1-A2- (redondeados) A1-a2a2 (redondeados) a1a1A2- (redondeados) a1a1a2a2 (estrechos)

15 1

En complementacin (9:7) son necesarios ambos genes dominantes para producir el fenotipo

Varios genes afectan al mismo carcter Ej. Color de la piel de las vboras

camuflado

negro

naranja

albino Albino parece rosa por el color de la Hb de la sangre

PENETRANCIA
UN GENOTIPO DETERMINADO PUEDE NO EXPRESAR EL FENOTIPO ESPERADO, DEPENDIENDO DE CONDICIONES AMBIENTALES E INFLUENCIA DE OTROS GENES PENETRANCIA DE UN GEN Est determinada por el porcentaje de individuos con un cierto genotipo que muestran el fenotipo esperado.

GEN DE PENETRANCIA INCOMPLETA es todo gen que expresa el fenotipo esperado en menos del 100% de los casos.

PENETRANCIA

EXPRESIVIDAD VARIABLE
Describe el grado o la intensidad con que se expresa un genotipo determinado. Un gen 100% penetrante su expresividad vara entre los individuos
Las causas de tal variacin pueden ser genticas, ambientales o ambos

EXPRESIVIDAD VARIABLE

Herencia Materna

- Las mitocondrias y los cloroplastos contienen pequeos cromosomas circulares que codifican para un definido nmero de genes del genoma total de la clula. -Las organelas no son genticamente independientes, algunas funciones estn a cargo de genes nucleares. -Cada organela est presente en varias copias por clula y cada una presenta una gran cantidad de copias de sus cromosomas. - Los genes de las organelas muestran herencia uniparental: sus genes son heredados exclusivamente por uno de los progenitores las organelas residen en el citoplasma

y el vulo contribuye con la mayora del citoplasma (y sus organelas) a la clula cigota.

Mitocondria

Genoma mitocondrial humano

EL ORIGEN ENDOSIMBINTICO DE LAS MITOCONDRIAS

Ejemplos de endosimbiontes actuales


Las algas fotosintticas verdes del tipo de Chlorella que viven en las clulas del protista ciliado Paramecium viride. Los dinoflagelados que viven dentro de las clulas de muchos corales.

Patrn de herencia citoplsmica:


Mutante Wild-type x wild-type x mutante toda la progenie es mutante toda la progenie es wild-type

Excepcin:
Heteroplasmonte: clula que posee dos tipos genticos de organelas (normales y mutantes). En estas clulas generalmente ocurre una segregacin citoplsmica de cada tipo de organela en las diferentes clulas hijas.
Ej. Mutacin en alelo que controla la produccin de clorofila en los cloroplastos hojas blancas

Rama toda blanca Rama toda verde

Tallo principal variegado

REGLAS BASICAS PARA EL CALCULO DE PROBABILIDAD

SUMA: Eventos mutuamente excluyentes: la ocurrencia de uno establece la no ocurrencia del otro
P(E1 E2 )= P(E1) + P(E2 ) APLICACIN EN GENETICA:
Cruzamiento monohibrido:
3/4 progenie fenotipo dominante A- = AA+2/4 Aa

Cruzamiento dihibrido: AaBb x AaBb


Cual es la probabilidad de gametos con genotipo homocigoto recesivo? P(A-bb aaB- aabb)=P(A-bb)+P(aaB-)+P(aabb)= 3/16+3/16+1/16= 7/16

REGLAS BASICAS PARA EL CALCULO DE PROBABILIDAD

MULTIPLICACION: Eventos independientes, la ocurrencia de uno no afecta la probabilidad de ocurrencia del otro. P(E1 y E2) = P(E1 )x P(E2)

APLICACIN EN GENETICA:
De un individuo AaBbCcDd que proporcin de gametos portaran el genotipo ABCd?

Segregacion independiente, probabilidad c/u=


P(ABCd)= P(A)P(B)P(C)P(d)= ()4 =1/16

EXCEPCION A LOS PRINCIPIOS DE MENDEL

GENES LIGADOS:

GENES NO ALELOS UBICADOS EN EL MISMO CROMOSOMA EN DISTINTO LOCUS

Crossing over Meiosis I

- NO SE DISTRIBUYEN INDEPENDIENTE UNO DEL OTRO


Meiosis II

- PRODUCTO DEL CROSSING OVER SE OBTIENEN NUEVAS COMBINACIONES ENTRE GENES LIGADOS
Recombinantes

Parentales

SITIOS

http://www.biologi a.arizona.edu/men del/mendel.html http://www.arrakis.e s/~lluengo/genemen de.html#GlossPrime ra


LIBRO

WALKER, L Problemas de gentica