UNIVERSITY NATIONAL OF HUANCAVELICA

FACULTY OF SCIENCE OF ENGINEERING
SCHOOL ACADEMIC PROFESSIONAL OF ZOOLOGY

CLASS : BIOLOGY CELULAE AND MOLECULE
PROFESSOR : M.Sc. CHÁVEZ ARAUJO, Elmer Rene
INTEGRANTS: CONDOR QUINTE, Jolwin Rudy
CONTRERAS RAMOS, Abel Cristhian
LAURENTE DE LA CRUZ, Eduardo
CYCLE : IV “A”

HUANCAVELICA – PERÚ
2013
MOLECULAR EVOLUTION OF THE FAMILY CAMELIDAE:
A MITOCONDRIAL DNA STUDY
LA EVOLUCIÓN MOLECULAR DE LA
FAMILIA CAMELIDAE: UN ESTUDIO DE ADN
MITOCONDRIAL

Helen F. Stanley
1
, Miranda Kadwell
1
y Jane C. Wheeler
2


Resumen

Se presenta el primer análisis molecular evolutiva de la familia de los
camélidos mediante el análisis de la secuencia completa de ADN del gen
mitocondrial citocromo b. Las estimaciones para el tiempo de divergencia
del Viejo Mundo (Camelini) y del Nuevo Mundo (lamini) tribus obtenidos
a partir de datos de la secuencia están de acuerdo con los obtenidos por el
registro fósil. Los datos de la secuencia de ADN también se utilizaron para
probar las hipótesis actuales relativas a los antepasados de la llama y la
alpaca domesticada. Los resultados muestran que la hibridación ha
ocurrido en el linaje de los dos camélidos domesticados, ocultando el
origen de las especies domésticas.
Introducción

La familia del camélido que originó en norte América durante la
eocena, comprende dos viejos mundos (tribus del camelini) y
cuatro nuevos mundos (tribus de lamine); especies con la división
entre el lamine y el cameline citado aproximadamente el 11,
mayo-agosto (Webb 1974, Harrison 1979) estos fueron migrando
a América del sur y Asia occidental. Y ambos el camelini y
lamini, llega a extinguirse en norte América. Representivos del
extenso nuevo mundo genera llama y vicuña aparecen (López
Aranguren 1930)
Los cariotipos (2n=74) de todos de los camélidos de las seis
especies son similares (Hsu. Benirschke 1967)
Especies
En el desierto del viejo mundo (África) hoy en día existen dos especies de
camelini:
Camelus dromedarius
Camelus bactrianus
En América del sur existen cuatro especies de lamini:
 Silvestres: guanaco y vicuña, se diferencia por la morfología dental.
 Domesticados: llama y alpaca.

En el Perú aproximadamente se domestican alrededor de 6000 – 7000
años (Wheeler 1986; Wing 1986).
El presente estudio se realiza :
Primero investigación de relación de una evolución de los camélidos
por la variación del análisis de la secuencia del gen mitocondrial de
citocromo b.
Segundo el uso de la secuencia para el test de hipótesis con respecto a
los ancestros de la domesticación de llama y alpaca.
MATERIALES Y MÉTODOS:

(a) Muestra
Se tomaron muestras de sangre de todas de las especies, la investigación
se realizo en institutos de animales del Perú, Chile; hábitat (reserva
nacional pampas galeras, Perú y Chubut; Argentina).
• Un total de 2 arabian y 2 bactrian camels
• 14 guanacos, 11 vicuñas, 13 llamas y 14 alpacas
Utilizados para el análisis, se incluye 2 muestras de piel.

(b) Extracción de ADN
El genoma de ADN esta extraído usando procedimientos estándares: toda
sangre ha sido recopilado en una solución comprensible (milimols por
litro): 50 Tris - HCl, pH 8.0, 5 EDTA, 100 NaCl, 2% SDS y 0.5 mg ml
-1
,
proteinasa k a 55°C por 18-24 h. los resultados estan extraidos con fenol
(pH 8.0), fenol cloroformo (1:1), finalmente con cloroformo isoamil
alcohol (24:1)
(c) Amplificación y secuenciamiento del gen mitocondrial del
citocromo b
La completa amplificación y secuenciamiento de citocromo b , en las seis
especies se usa los primers H15149 (Kocher et. Al 1989) y L14724,
L15408, L155113,H15915 (Irwin et. Al 1991); los primers son designados
por los autores usados y secueciados (5
l
- 3
l
): H14900, CTCGGCA -
GATGTGTGCGAC; H15075, CCAATGTTTCATGTTT - CTG; H15263,
GAATCGTGTTAGGGTGGC; H15355,
CCTTGGTTGGGTTATTAGAACC; H15392, GGAATTGGAA -
TGGGATTTTATC; H15494, GTAGTTGTCAGGGTCT -CCTTAA;
H15598, ACGCCTCCTAGTTTGTTGGGG y H15756,
TACTGGTTGTCCTCCGATTC.
Para la variación de la investigación intraespecifica en los Camélidos de
América del sur, se obtuvieron 200 pb y 950 pb, secuenciados de 2
guanacos, 2 vicuñas, 3 llamas y 4 alpacas; para examinar los largos
genotipos del lamini se llevara a cabo la amplificacion y secuenciamiento a
176 pb fragmentados. las condiciones usados para la amplificacion por
reacción en cadena de polimerasa.
(d) Análisis de secuencia
La completa amplificación y secuencamiento de
citocromo b se realizo utilizando el programa
CRUSTAL V (Higgins y Sharp 1989), se determina la
relación de genotipos determinando al máximo de un
análisis usando el programa PAUP versión 3.0 por el
Apple Macintosh (swofford 1990). Deja para las bases
de las frecuencias de las mutaciones, obtenido cuando
también se realiza al máximo este método in PHYLIP.
La determinación de frecuencias y el promedio de
transición y transversion de radio. La secuencia tiene
un deposito en el banco de genes con accesibilidad de
números U06425, U06430.
Resultados
(a) Composición de secuencia y código usado
El producto de la traducción del gen mitocondrial de citocromo b,
contiene 379 aminoácidos tomados en la muestra de otros
mamíferos estudiados a la fecha. El camélido Africanos tienen el
ADN diferentes a la actualidad. Las tres posiciones, esto contiene
nucleótidos 15635, 15652 y 15653. referente esto al de humano.
El primer de estos esta en la tercera posición del codón valina
(295 aminoácidos) y representados una sustitución similar. En el
inicio, en la tercera posición, sin embargo estos datos están en la
histidina (301 aminoácidos) mejor que la leucina. Cuando la
distribución de variable de aminoacidos residuales alargados de
proteína están asignados, entre un 63% y 75% de cambio se
establece ocurrido en la transmembrana dominado de la
proteína, cambiando, envuelto de los residuos hidrofobico
(leucina, isoleucina, y valina) predominante.
Los patrones variados de nucleótidos en el gen del mitocondrial
de citocromo b, son similares de estos en los mamíferos. La
excelente variabilidad de nucleótidos compuestos entre especies
(s.d. 0.88- 1.55) ocurridos en la primera posición, mas la cadena
que esta aquí apagado, con mínima variabilidad en la segunda
posición (s.d. 0.11-0.43) los números de transición están a 4.6
horas grandes en la primera posición de codones que en una
segunda posición. La transversion y la transición están en razón
en la primera posición 28.3 (arabian también bactrian camel) 3.2
0 3.4 para todos los camelini, lamini comparados, y el lamine
esta dentro del valor 4.3, 10.8, 16 y 17.3. usando todas
posiciones, evaluados de 26, 3.5-3.8, y 3,11, 9 y 12 son obtenidos
respectivamente. La proporción divergente de 0.22% y 0.25-0.27
% fueron obtenidos para tres posiciones transversales usando
datos fósiles para la división entre llama y vicugna y camelini-
lamini respectivamente.
(b) Evolución molecular del camelini
Evaluados en la tabla N°1. el arabian y bactrian camel diferentes por 10.3%,
mientras que la divergencia entre el viejo mundo y el america del sur, las
especies estan en 17.3 – 19.6%. El ultimo par de genotipos ambos
divergentes por 1.8%, mientras genotipos de la vicuña y guanaco estan 6.7%
divergentes. La máxima probabilidad por la misma topología, todos son
significativos (p<0.01). Basados en 200-950 pb secuenciados de 2-4
individuos de especies de camélidos de America del Sur, la mayor parte
intraespecificos divergente con un rango de valor: 1.2-1.7%, pero genotipos
B3 y B5 divergente por 2.5%.
Un reconocimiento de genotipos largos, en camélidos de América del Sur,
nosotros amplificamos y secuenciamos un corto (176 pb) fragmentos en el
extremo 5´ del gen. 12 sitios de variables dentro de esta región definida 2
grupos distintos de genotipos, A y B, dentro están 6.8% divergentes (tabla
2). El grupo A contiene 2 genotipos dentro diferentes por una sola
sustitución. Mientras 4 sustituidos, separado el 5 genotipo del grupo B. todas
las especies salvajes tienen genotipos mas visibles, uno de estos grupos; el
tipo A en vicuñas y el tipo B en guanacos.
Discusión
Los datos secuenciados estan demostrados a 17.3-19.6% divergente
entre los camelinis y laminis. Nuestros datos sugiere un promedio de
nucleótidos sustituidos de 1.6-1.8% por millones de años.
Estimamos para transversion de proporción de 0.22-0.27% por millones
de años también aproximados valores establece en tardíos por rDNA
(Miyamoto y boyle 1989) y citocromo b (Irwin et al. 1991) secuenciados.
Dos genotipos predominantes son establecidos en el lamini en todas las
vicuñas y todos los guanacos. El genotipo A1 y B3, los cuales son usados
en construcciones cadenas, diverge por 6.7%.
En conclusión, las moléculas obtenidos a la fecha de nuestros análisis
del lamini provee de la primera genética evidente que hibridizamos
ocurridos en la historia de los camélidos de America del Sur, soportando
observaciones hechos en llama y alpaca criados a base o fenotipo
característico solitario.