Curso: Biología Celular y Molecular

Oscar Nolasco Cárdenas MSc.
oscarnol@hotmail.com
Noviembre 2008

EL DOGMA CENTRAL DE LA BIOLOGIA MOLECULAR
ADN CCTGAGCCAACTATTGATGAA transcripción

ARN CCUGAGCCAACUAUUGAUGAA
traducción Proteína

PEPTIDE

ARN -historia
• - 1800s mitos sobre el origen de la vida. Generación espontánea. • 1824 Luis Pasteur pone fin a la hipótesis de generación espontánea. • 1924 Alexander Oparin propuso que las formas de vida tienen moléculas simples orgánicas presentes en la atmosfera de la tierra.1929 Haldane complemento la idea • 1953 Stanley Miller realizo el experimento con “atmosfera primitiva” o de Miller-Urey. Otro importante descubrimiento también se publicaba sobre la estructura del ADN

ARN -historia
• 1954 Severo Ochoa descubrió la polinucleótido fosforilasa, capaz de sintetizar in vitro RNA a partir de ribonucleotidotrifosfatos: RNA polimerasa. Ese mismo año George Gamow funda el “RNA tie club”Se reunían 2 veces al año para discutir sobre la estructura del RNA y como esta contribuye a la formación de proteínas

Reunión del “RNA tie club”, Cambridge, Inglaterra. Francis Crick (fondo, izquierda), Leslie Orgel (fondo, derecha), Alexander Rich (frente, izquierda), y James Watson (frente, derecha).1955

ARN -historia
• • 1955 F Crick propuso su "Adapter Hypothesis“ referida a la falta de una molécula que porte el aminoácido 1956 Alexander Rich y David Davies publicaron en the journal of the American Chemical Society que las hebras de ARN podían hibridizarse 1961 Marshall Nirenberg inicia sus trabajos para descifrar el código genetico (1961-1962 The coding race: entre el laboratorio de Ochoa y Nirenberg, el primero desistió al ver que tan avanzado estaban los trabajos de Nirenberg)
Marshall Nirenberg y Heinrich Matthaei.

Severo Ochoa

ARN -historia
• 1965 Robert Holley descubre el ARNt la molécula faltante de Crick • 1968 Francis Crick y Leslie Orgel propusieron al ARN como la primera molécula informativa • 1972 Harry Noller propone el rol del ARNr en la traducción del ARNm • 1986 Thomas Cech y Sidney Altman descubrieron el ARN catalitico (self-splicing) primera evidencia sólida de primera molécula informativa • 1993 el laboratorio de Harry Noller evidencio la participación del ARNr en la síntesis de proteínas

Figure 1 Schematic (A) and ribbon (B) diagrams depicting the crystal structure of the full-length hammerhead ribozyme. The sequence and secondary structure in Figure A is color-coded to match the structural features shown in Figure B. The cleavage site nucleotide, C-17, is shown in green, and various helical stems and loops are denoted using several other colors. Tertiary hydrogen bonding contacts are denoted as thin black lines, and tertiary stacking interactions as thin green lines. See Figure 2 for a detailed schematic representation of the active site.

ARN estructura
O
-

O C HN H2N-C N 5’ CH2 C C N CH N

G

ARN es un polimero de ribonucleotidos
NH2 C

5’ end

-

O - P –O

o

4’ 3’ O

O 2’ OH

1’ O CH2

N C N

CH CH

C

pGCUA
O C

O P O O

O HN

CH CH NH2 C N C

U

 Azucar ribosa  Enlace fosfodiester  Cadenas Direccionales (5’ to 3’)  4 Bases purines: adenina & guanina pirimidines: citosina & uracilo

O O P O O

OH

O CH2

C

N

O

N CH

A

O O P O O

HC C N OH N CH2 3’ O

3’ end

OH

OH

Las moléculas de ARN consisten de una hebra que se pliega sobre si misma adquiriendo una estructura secundaria
Horquilla (hairpin) Hebra en simple cadena Bucle interno A C (single strands) (loop) Bolsa A AG A A CU A CA A CUACC U G UC UG A CCU CGU A G AG GAUG G GGAAC U GCA G G C A G A Doble AU helice
A

CC G

CG

GC

A A G

T

En ARN, G se aparea con C y A se aparea con U.

ARN tipos:
Principales ARN involucrados en los procesos de transcripción y traducción: -ARNm -ARNt -ARNr

ARNs en E. coli
Tipo Sed. Coef. Mol. Wt. Residuos % del total ARN

mRNA tRNA rRNA

6 - 25 ~4 5 16 23

25,000 - 1,000,000 23,000 - 30,000 35,000 550,000 1,100,000

75 -3000 73 - 94 120 1,542 2,904

~2 16

82

Células eucariotas contienen otros tipos de ARN como ARN pequeño nuclear (snRNA).

rRNA es el principal componente de los ribosomas

Representación de las estructuras secundarias de rRNA

mRNA eucariote

tRNA
 tRNA estructura primaria Secuencia lineal de 60 a 95 nucleotidos de longitud ( Comunmente 76).  tRNA estructura secundaria La estructura de hoja de trebol muestra los brazos y los bucles o loops.  tRNA estructura terciaria Nueve enlaces de hidrogeno entre las bases en los bucles de simple cadena y el plegamkiento de la estructura secundaria en una estructura en forma de L con el anticodon y el brazo aceptor del aminoacido en los extremos opuestos de la molecula.

Estructura de tRNA . (a) Cloverleaf structure mostrando los nucleotidos invariantes y los semivariantes, donde I = inosina, Ψ = pseudouridina, R = purina, Y = pirimidina y * indica una modificacion. (b) Enlaces de hidrogeno entre las bases. (c) Estructura en forma de L del tRNATyr de levadura.

2. Brazo aceptor o tallo aceptor compuesto de 7-bp apareadas del 5'-terminal con 3'terminal. Puede contener apareamiento no tipo Watson-Crick. 3. CCA cola Secuencia en el 3' terminal, en la adenina final se une el aminoacido. En procariotes el CCA es transcrita, y en eucariotes la secuenia CCA es adicionada post transcripcional. 4. El brazo D Tiene un tallo de 4 bp que termina en un bucle o loop que contiene dihidrouridina. 5. El Brazo del anticodon Tiene un tallo de 5 bp y contiene el loop del anticodon. 6. El Brazo T Tiene un tallo de 5 bp que contiene la secuencia TΨC donde Ψ es una pseudouridina. 7. Un brazo variable que divide a los tRNAs en dos clases dependiendo de su tamano, la clase 1 contiene 3 a 5 bases y la clase 2 contiene 13 a 21 bases formando un tallo de 5 bases apareadas 8. Las bases que han sido modificadas por metilacion se encuentran fuera del anticodon. La primera base del anticodon algunas veces es modificada a Inosina

Aminoacil-tRNA sintetasas
• Nomenclatura de tRNA-sintetasas and charged tRNAs

Catalizan la unión aminoácido - tRNA.
Aminoacido: serine tRNA : tRNAser aminoacyl-tRNA sintetasa: seryl-tRNA sintetasa Aminoacyl-tRNA: seryl-tRNAser • Tipos de tRNA-sintetasas Existen dos tipos de Aminoacil tRNA sintetasas clasificadas en la forma inicial de la unión del aminoacido a la adenina del CCA terminal del tRNA: CLASE I. Aminoacila inicialmente el 2OH de la adenina, luego por una transesterificacion esta unión se traslada al 3OH. Comprende las sintetasas para los tRNA de los aminoacidos: Leu,Ile,Val,Cys,Met,Glu,Gln,Arg,Tyr,Trp. CLASE II. Aminoacila el 3OH de la adenina. Comprende las sintetasas para los tRNA de los aminoacidos: His,Pro,Ser,Thr,Asp,Asn,Lys,Gly,Ala,Phe

Etapa de activación

Etapa de transferencia

La aminoacil tRNA sintetasa une una adenosina monofosfato AMP, al grupo –COOH para crear un aminoacil adenilato intermediario. Luego el apropiado tRNA desplaza el AMP. La aminoacil tRNA sintetasa puede realizar el proceso de relectura o proofreading valiendose de los determinantes de identidad del tRNA

Las sintetasas tienen que distinguir entre cerca de 40 formas de tRNAs y para ello usa elementos denominados determinantes de identidad que son especificos, ubicados en su mayoría en la region de la minihelice y en la region del anticodon

Transcripción
Para que la información genética almacenada en el DNA sea utilizada por los organismos generar una copia en RNA complementaria a la hebra de DNA que ha servido como molde por medio de un proceso conocido como transcripción ( de una escritura a otra). La hebra de ADN que ha servido como molde se denomina hebra antisentido y la otra hebra de ADN es denominada hebra codante o con sentido y la secuencia es identica a la del RNA sintetizado ( Excepto en las posicion de T que son cambiadas por U)

(5')ATGCGCTATAGCTGTTT(3') Hebra de DNA no molde (+)
codante

(3')TACGCGATATCGACAAA(5') Hebra de DNA molde (-)
antisentido

(5')AUGCGCUAUAGCUGUUU(3') Transcrito de RNA

Transcripción
• El resultado de la transcripción es una
molécula de RNA llamada transcrito. • El transcripto puede ser :
– RNA mensajero o mRNA; – RNA ribosomal o rRNA; – RNA de transferencia o tRNA; o

– Otras como ribozimas (act. Enzimatica),RNA de interferencia o iRNA (actividades de regulación de la expresión genética), o participar en actividades postranscripcionales de edición de mRNA (gRNA).

Inicio

Transcripción y Superenrollamiento
RNA polimerasa Burbuja de Transcripción Burbuja de Transcripción
Enrollamiento Desenrollamiento

(a)

5' 3' 5' Híbrido RNA-DNA

3'

5' 3'

RNA Dirección de la trancripción Dirección de la trancripción

Superhélices negativas

(b)

Superhélices positivas

5'

Dirección de la trancripción Dirección de la trancripción

Localización de transcritos
Transcritos de RNA

DNA

36 x 103 pb 36 x 103 pb

• Genoma de adenovirus, ambas hebras contienen codificación de proteínas. Muchos de los mensajeros se sintetizan inicialmente en forma de un transcrito largo que proviene de dos tercios de la longitud del DNA. Este transcrito es modificado posteriormente.

RNA polimerasa de E. coli

Núcleo de la enzima
RNA polymerase of E. coli is a multisubunit protein Subunit α 2 β β ’ σ Number uncertain 1 1 1 Role

Subunidad

forms phosphodiester bonds binds DNA template recognizes promoter and facilitates initiation

α 2 β β ’σ holoenzyme

α 2β β ’ core polymerase

+

σ

sigma factor

Sintesis de RNA
RNA RNA

A=T

A = T

U=A

U=A

• La sintesis de RNA generalmente se inicia en una purina ATP or GTP

(el primer nucleotido) • La cadena es sintetizada en dirección 5’ a 3’ • La Terminación de algunos transcriptos depende de Rho protein, que se une a una secuencia pobre en G y Rho separa el DNA del RNA, Otras terminaciones se dan por secuencias palindromes que generan factores intrinsecos

La transcripción puede ser dividida en tres etapas: 1. Iniciación 2. Elongación 3. Terminación

Gene (DNA)
Transcription Start Site 5’ Untranslated Region 3’ Untranslated Region

5’
Promoter/ Control Region

Protein Coding Region RNA Transcript
Terminator Sequence

3’

Inicio de la transcripción
• Los factores de transcripción se unen al promotor • Si los factores de transcripción estan presentes, la RNA polimerasa se une al complejo de iniciación • RNA polimerasa denatura el DNA e inicia la transcripción

Iniciación:
T. F.
Promoter

T. F.
. .F T

RNA Pol.

RNA Pol. RNA
5’

Factor sigma factor
• La subunidad de la RNA polimerasa es un Factor de iniciación • Existen diferentes factores sigma en E. coli y son especificos para diferentes grupos de genes • Factor sigma mantiene estable la unión de la RNA polimerasa al promotor en el DNA

Ka (M-1 )
Cualquier región DNA (no especifico) Core Holo 2 X 1011 1 X 107 1013 to 1015 Promotor DNA (especifico)

Promotores de E. coli. 1

Secuencias concenso en promotores (control de transcripción)

Un tipico promotor tiene tres componentes, dos secuecias consenso -35 y -10 y el inicio de la transcripción

Terminación de la transcripción
• Una vez que el proceso de transcripción ha comenzado la burbuja de transcripción avanza a medida que el RNA es transcrito y se continúa hasta que la polimerasa encuentra una secuencia que induce la disociación del complejo DNA-RNA y la separación de la enzima. • En eucariontes esta secuencia no ha sido bien estudiada, mientras que para los procariontes como E. coli se han reconocido dos tipos de señales de terminación que se diferencian por la ausencia o presencia de un factor proteico que parece reconocer dicha señal.

Terminación de la transcripción Rho independiente

• La primera de ellas, conocida como terminación independiente de rho (ρ ), contiene una secuencia que induce a la formación de una horquilla en el transcrito de RNA de 10 a 15 nucleótidos antes del final, seguida por un tramo de poliA en la cadena molde que facilita la disociación de los elementos de la transcripción.

Terminación Rho dependiente
• En la terminación dependiente de ρ no se presenta el tramo de poliA, aunque sí se forma una horquilla en la que la RNA polimerasa hace una pausa y si se encuentra la proteína ρ presente se detiene la transcripción. • No se conoce a detalle el mecanismo de disociación, pero en este se produce la hidrólisis de ATP por efecto de ρ .

• Transcripción en eucariotes
3 RNA Polimerasas en Eucariotes

RNA polymerase I transcribes most rRNA genes RNA polymerase II transcribes all protein-coding genes RNA polymerase III transcribes tRNA genes and 5S rRNA genes

Reconocimiento del promotor

Formación del complejo de iniciación

Iniciación

Compuestos que inhiben el proceso de transcripción

Se une al surco menor del DNA

Se une al surco a G yC

El transcripto de mRNA en eucariote sufre diversos procesos postranscripcionales

Splicing

Mecanismo de splicing mediado por el splicesoma

Mecanismo 5 Capping

Proceso de Poliadenilación

Proceso de expresión en eucariotes

Regulación de la expresión por splicing alternativo según el tejido

Traducción

Shine-Delgarno (SD) es una secuenca que se presenta en transcriptos de procariotes que consta de 3-9 bases del mRNA que se complementan con el 3’terminal del 16S rRNA

Unión de la subunidad pequeña y de los factores de iniciación

Elongación

Elongación

Terminación

Factores de iniciación en eucariotes
name subunits function

eIF1 eIF1A eIF2 eIF2B eIF3 eIF4A eIF4B eIF4E eIF4F eIF4G eIF4H eIF5 eIF5B

1 1 3 5 11 1 1 1 3 1 1 1 1

fidelity of AUG codon recognition, destabilizes aberrant initiation complexes catalytically promotes Met-tRNAi binding to 40S; required for strong binding of 40S subunit to mRNA GTPase, escorts Met-tRNAi onto 40S subunit guanine nucleotide exchange factor for eIF2 scaffold for the cap binding complex, binds 40S subunit; stabilizing Met-tRNAi and preventing association with 60S subunit RNA dependent ATPase; essential for binding of ribosomes to mRNA RNA binding protein; promotes eIF4A activity binds directly to the m7G cap cap binding complex of eIFs 4A, 4E, and 4G binds mRNA, PABP, eIF4E, eIF4A, and eIF3 similar to eIF4B AUG recognition and promote eIF2 GTPase activity GTPase, mediates assembly of 80S from 40S and 60S

Transcripción y traducción ocurren simultaneamente en procariotes

5’

3’

3’

5’

RNA Pol.
Ribosome

mRNA
5’

Ribosome

En Eucariotes los procesos de transcripcion y traducción ocurren en diversos compartimientos

Nuclear pores
DNA

Cytoplasm

Transcription
RNA

RNA Processing
mRNA G
AAAAAA

G

AAAAAA

Nucleus

Export

Un gen de eucariote
Transcription Start Site 5’ Untranslated Region Introns 3’ Untranslated Region

5’
Promoter/ Control Region

Exon 1 Int. 1

Exon 2 Int. 2 Exon 3

3’
Terminator Sequence

Exons
Un transcripto de eucariote RNA Transcript

5’

Exon 1 Int. 1

Exon 2 Int. 2 Exon 3

3’

Código genético.

El código génetico: Como los nucleotidos son especificos para 20 aminoacidos? 1. 4 diferentes nucleotidos (A, G, C, U/T) 2. Posibles codones: • 1 letra codigo ⇒ • 2 letra codigo ⇒ <20 • 3 letra codigo ⇒ 4 AAs 4 x 4 = 16 AAs <20

4 x 4 x 4 = 64 AAs >>20

1. Codigo de tres letras generan 64 posibilidades para 20 aminoacido, esto sugiere que el codigo genetico es degenerado (e., mas de un codon es especifico para un aminoacido).

Caracteristicas del código genético (escrito en 5’ to 3’): 1. Codigo es un triplet. Un codon 3 nucleotidos consecutivos de mRNA especifico para 1 aminoacido. 2. El codigo no se sobrelapa cada nucleotido es leido una sola vez. 3. El codigo es casi universal. La mayoria de codones tiene el mismo significado en distintos organismos. (Diferencia del codigo de mitocondria en animales) 4. El codigo es degenerado. Muchos aminoacidos tiene mas de un codon a excepcion de Met y Trp. 5. Presenta un codon de inicio y otro de termino. ATG para Met como codon de inicio. TAA, TAG, y TGA como codones stop de la traduccion del polipeptido. 6. La tercera posicion del codon es menos especifica y ocurre el bamboleo o alternacion del nucleotido sin alterar la secuencia del polipeptido.

Numero de codones por aminoacido

Unin codon anticodon

Descifrando el codigo
• Marshall Nirenberg y Heinrich Matthaei mostraron que una poly-U produce polifenilalanine en un extracto celular libre de celulas (E. coli) • Poly-A da polilisina • Poly-C da poliprolina • Poly-G da poliglicina

Degeneracion de la tercera base
Y la hipotesis del bamboleo • El apareamiento es crucial en la lectura del codigo genetico • La hipotesis de Crick esta referida a la tercera posicion del codon, primera posicion del anticodon que se denomina posicion de bamboleo

• En la tercera posicion del codon pueden ocurrir apareamientos no canonicos • En el anticodon como regla en la primera posicion para un U este puede reconocer una A o G, La primera posicion en G puede reconocer U o C y la primera posicion del anticodon en I puede reconocer U, C o A • Ventaja del bamboleo: disociación del tRNA del mRNA mas rapida

1.

Mutaciones por cambios de lectura (frameshift: adicion or delecion) resulted in a different sequence of amino acids.

Inserciones de tres nucleotidos genera una region incorrecta en la secuencia polipeptidica