You are on page 1of 58

Chapter 9 Proteins and Their Synthesis

Green Fluorescent Protein drawn in cartoon style with fluorophore highlighted as ball-andstick; one wholly-reproduced protein, and cutaway version to show the fluorophore.

Review
Central Dogma
5 ATG GAC CAG TCG GTT TAA GCT 3
DNA
3 TAC CTG GTC AGC CAA ATT CGT 5
transcription

RNA

5 AUG GAC CAG UCG GUU UAA GCU 3


translation

Protein

aa - aa - aa - aa - aa - aa - aa

Protein Structure

via condensation

Protein Structure
Primary Structure

Protein folding is dependent on


the amino acid R groups
R

General Structure

H2N

COOH

There are 20 amino acids.


Their properties are determined by the R group.

There are 20 amino acids.


Nonpolar or hydrophobic (9)
Polar (hydrophillic), but uncharged (6)
Polar (hydrophillic), but charged (5)

Nonpolar
ring

(Hydrophobic)

sulfur

Protein Structure
Primary Structure

Protein Structure
Two major types
of Secondary
Structure
Helix

Sheet

Protein Structure

How do we get from DNA to Primary


protein structure ?

DNA

5 ATG GAC CAG TCG GTT TAA GCT 3


3 TAC CTG GTC AGC CAA ATT CGT 5
transcription

RNA

5 AUG GAC CAG UCG GUU UAA GCU 3


translation

Protein

aa - aa - aa - aa - aa - aa - aa

DNA (mRNA) is read in Triplets


-Codon Group of 3 DNA bases codes for a specific
amino acid
Ex. ATG = methionine
-This means the code is degenerate more than one
codon can specify one amino acid

The Genetic Code - Nonoverlapping

Key To The Genetic Code


Groups of 3 mRNA
bases (codons) code for
specific amino acids
5 CCAACCGGG 3
CCA-ACC-GGG
Pro-Thr-Gly

The Genetic Code Stop Codons

UGA
UAA
UAG

Proteins and Genes are Colinear


Mutations in DNA show specific corresponding changes
in the protein

Genes are converted to proteins in a linear fashion

Key To The Genetic Code


CCG UGG AGA GAC UAA
Pro Trp Arg Asp - Stop
CCG UCG AGA GAC UAA
Pro Ser Arg Asp - Stop
CCG UGG CGA GAC UAA
Pro Trp Arg Asp - Stop
CCG UGG AGA GAC UAA
Pro Stop
CCG UGG AGA CGA CUA
Pro Trp Arg Arg - Leu

The Genetic Code - Mutations


4 Types of Mutations
1. Silent mutations
2. Missense mutations
3. Nonsense mutations
4. Frameshift mutations

The Genetic Code


mRNA has 3 potential reading frames
5 CUUACAGUUUAUUGAUACGGAGAAGG 3
3 GAAUGUCAAAUAACUAUGCCUCUUCC 5
5 CUU ACA GUU UAU UGA UAC GGA GAA GG 3
3 GAA UGU CAA AUA ACU AUG CCU CUU CC 5
5 C UUA CAG UUU AUU GAU ACG GAG AAG G 3
3 G AAU GUC AAA UAA CUA UGC CUC UUC C 5
5 CU UAC AGU UUA UUG AUA CGG AGA AGG 3
3 GA AUG UCA AAU AAC UAU GCC UCU UCC 5

Stop
UAA
UGA
UAG

The Genetic Code


mRNA has 3 potential reading frames
5 CUUACAGUUUAUUGAUACGGAGAAGG 3
3 GAAUGUCAAAUAACUAUGCCUCUUCC 5
5 CUU ACA GUU UAU UGA UAC GGA GAA GG 3
3 GAA UGU CAA AUA ACU AUG CCU CUU CC 5
5 C UUA CAG UUU AUU GAU ACG GAG AAG G 3
3 G AAU GUC AAA UAA CUA UGC CUC UUC C 5
5 CU UAC AGU UUA UUG AUA CGG AGA AGG 3
3 GA AUG UCA AAU AAC UAU GCC UCU UCC 5

Stop
UAA
UGA
UAG

Review - RNA
mRNA- messenger RNA
tRNA- transfer RNA
rRNA- Ribosomal RNA

tRNA-The adapter

tRNA-The adapter
-tRNA functions as the adapter
between amino acids and the
RNA template
-tRNAs are structurally similar
except in two regions
Amino acid attachment site
Anticodon

tRNA-The anticodon
The tRNA anticodon
3 base sequence
Complementary to the codon
Base pairing between the mRNA and the tRNA
Oriented and written in the 3 to 5 direction
tRNA
Aspartic Acid

3 CUG 5
5 GAC 3

mRNA

Aminoacyl-tRNA
synthetase
The enzyme responsible
for joining an amino
acid to its
corresponding tRNA
20 tRNA synthetases
1 for each amino acid

Wobble
Allows one tRNA to recognize multiple codons
Occurs in the 3rd nucleotide
of a codon

Wobble A new set pairing of rules

I = Inosine: A rare base found in tRNA

Wobble A new set pairing of rules

Isoaccepting tRNAs: tRNAs that accept the same


amino acid but are transcribed from different genes

Wobble Problem
What anticodon would you predict for a tRNA species carrying
isoleucine?

Ribosomes General characteristics


Come together with tRNA and mRNA to create protein
Ribosome consist of one small and one large subunit
In prokaryotes, 30S and 50S subunits form a 70S
particle
In Eukaryotes, 40S and 60S subunits form an 80S
particle
Each subunit is composed of 1 to 3 types of rRNA and
up to 49 proteins

Ribosomes General characteristics

Ribosomes General characteristics


rRNA folds up by
intramolecular base
pairing

Ribosomes General characteristics

Translation
Synthesizing Protein

An overview

Translation Initiation - Prokaryotes


Translation begins at an AUG codon Methionine
Requires a special initiator tRNA charged with
Met tRNAMeti
This involves the addition of a formyl group to
methionine while it is attached to the
initiator

Shine-Dalgarno Sequence

mRNA only associates with unbound 30S subunit

Translation Initiation Prokaryotes


Initiation Factors
3 initiation factor proteins are required for the start of
translation in prokaryotes
IF1 Binds to 30S subunit as part of the complete initiation
complex. Could be involved in stability
IF2 Binds to charged initiator tRNA and insures that other
tRNAS do not enter initiation complex
IF3 Keeps the 30S subunit disassociated from the 50S subunit
and allows binding of mRNA

Figure2121
Figure 9-15-1

Figure2121
Figure 9-15-2

Figure2121
Figure 9-15-3

Translation Initiation Eukaryotes


1. mRNA is produced in the nucleus and
transported to the cytoplasm
2. 5 end of the mRNA is capped to prevent
degradation
3. Eukaryotic Initiation Factors (eIF4A, eIF4B,
and eIF4G) associate with the 5 cap, the 40S
subunit, and initiator tRNA
4. Complex moves 5 to 3 unwinding the mRNA
until an initiation site (AUG) is discovered
5. Initiation factors are released and 60S
subunit binds

Figure2121
Figure 9-16-1

1. mRNA is produced in the


nucleus and transported to
the cytoplasm
2. mRNA is covered with
proteins and often folds on
itself
3. 5 end of the mRNA is
capped to prevent
degradation

Figure2121
Figure 9-16-2

4.Eukaryotic Initiation
Factors (eIF4A,
eIF4B, and eIF4G)
associate with the 5
cap, the 40S subunit,
and initiator tRNA

Figure 9-16-3

5. Complex moves 5 to
3 unwinding the
mRNA until an
initiation site (AUG)
is discovered

Figure 9-16-4

6. Initiation factors
are released and 60S
subunit binds

Elongation
Requires two protein Elongation Factors:
EF-Tu and EF-G
Amino acids are added to the growing peptide chain
at the rate of 2-15 amino acids per second

Elongation

Termination
Release Factors RF1, RF2 and RF3
RF1 recognizes UAA or UAG
RF2 recognizes UAA or UGA
RF3 assists both RF1 and RF2
Stop codon also called a nonsense codon

A water molecule in the


peptidyltransferase center leads to
the release of the peptide chain

Translation differences between


Eukaryotes and Prokaryotes
Prokaryotes

Eukaryotes

NO nuclear membrane
Translation coupled to
transcription

Presence of a nuclear membrane

Ribosomes bind the Shine


Dalgarno sequence
mRNA can contain multiple
genes

Ribosome binds to the 5 cap


mRNA has information for
only one gene

Formylmethionine bound to
initiator tRNA

mRNA exported from


nucleus

Methionine bound to initiator


tRNA

Posttranslational Folding
Proteins must fold correctly to be functional
Correct folding is not always energetically favorable in the
cytoplasm
Chaperones (including GroE chaperonins) bind to nascent
peptides and facilitate correct folding

Posttranslational modifications
Phosphorylation
Many proteins require some
type of modification to become
functional

Posttranslational modifications
Glycosylation adding sugars
Signaling molecules
Cell wall proteins
Glycoproteins

Posttranslational modifications

Ubiquitination marks a protein


for degradation
-Short lived proteins
(functional in cell cycle)
- Damaged or mutated proteins

Summary
Translation
Prokaryote
Eukaryote

Post translational modifications


Phosphorylation
Glycosylation
Ubiquitination