You are on page 1of 30

Polymerase Chain Reaction

(PCR) For Diagnosis malaria

In vitro amplification of certain part of DNA


sequence with the help of polymerse enzyme
Genome and DNA sequence of the cell
Plasmodium Genomes
caatttcagttaacgtttaaattgaatgagcctaagtac
tgaattcaattaaagtttaattcgaaatttgatttaacgc
aagtttcgcatgccaaatgcacgaacaagcaatttcg
aaccaattaaaattggaatttaaaagaccattaccga
actttaaccgaaattctatatacaagct

PCR Diagnosis : identification


of species unique sequence on
its DNA
PCR
Material needed:
-Taq Polymerase
-DNTP: nucleic
acid ( a, t, g, c)
-Primer : forward
& reverse
-Buffer
-MgCL2
-DNA target
Bahan yang dipakai
PCR buffer (10x)
MgCl2 (1.5 mM)
dNTP (dATP, dCTP, dTTP, dGTP)
Primer
Forwards
Reverse
DNA templete
Enzyme Polymerase (1 u/50 ul reaction
Primer
Design

CTGAATTGTTCCGGCTTAACCGCTT

ATTATTAGCTATACCTTTAACCGTG

GCCAAATTATTATTAGTTAATTGGC

CTACCGTATAGCTGTGATATAGTAT

AGTATAGCGTAGTAGTAATTGTGCT

CTYTTAATAATGGCTTTCCAATAAT

GCCGTTATTAAATAGTACTATAAT
Length
Primer length has effects on uniqueness and melting/annealing
temperature. Roughly speaking, the longer the primer, the more chance
that its unique; the longer the primer, the higher melting/annealing
temperature.
Generally speaking, the length of primer has to be at least 15 bases to
ensure uniqueness. Usually, we pick primers of 17-28 bases long. This
range varies based on if you can find unique primers with appropriate
annealing temperature within this range.
PCR Principle
PCR
50 A. Double
strand DNA

96 B. Denature

50 C. Anneal
primers

Taq
72 D. Polymerase
binds
Taq
Taq Taq
72
E. Copy
strands
Taq Taq

96
2
F.
Denature
3
First round
of cDNA
synthesis (4
strands) 4
1

G. Anneal
50
primers

4
1
Taq

72

Taq 2

H.
Polymerase
3 binds
Taq

Taq
4
1
Taq

72

Taq 2

I. Copy
strands

3
Second Taq
round of
cDNA
synthesis
(8 strands)
Taq
4
1

J.
Denature at 96
Anneal primers
at 50

4
1

72

K. Bind polymerase
(not shown) and copy
strands

3
Third
round of
cDNA
synthesis
(16
strands)

4
1

L.
Denature at 96
Anneal primers
at 50

2
3

4
1

M.
Copy strands at
72
72

2
3

Fourth
round of
cDNA
synthesis
(32
strands)

4
1

cDNA
strands
(32) are
now
shown as
lines 2

4
1

After 5 rounds
there are 32
double strands of
which 24 (75%)
are are same size

2
3

4
DNA Isolation
from blood for
Plasmodium
diagnosis
Isolated DNA
DNA Isolation Kit
DNA Isolation
using special Kit
Primer for species identiification of Plasmodium
PCR Mixture
Nest I Nest II
PCR Buffer 5 ul 5 ul
dNTP 2 ul 2 ul
dATP
dTTP
dCTP
dGTP
Primer
Forward 1 ul 1 ul
Reverse 1 ul 1 ul
DNA Templete 5 ul 2 ul(PCR product Nest I)
Taq-Polymerase 0.5 ul 0,5 ul
ddH2O 35,5 ul 38,5 ul.......
Total Vol 50 ul 50 ul
PCR Condition
Denaturation 95oC 1
Anealing 58oC 2
Extention 72oC 2
Nest I : 25 cycle
Nest II : 30 cycle
Agarose Electrophoresis

Gel Agarose (1-2%)

Agarose 4 gr
TBE buffer 40 ml
microwafe 1
cooled down 5
Ethidium bromide
poured in gel tray

Sample loading:
5 ul PCR product +
5 ul loading buffer
P. ovale

P. falciparum
P. malariae
P. vivax