You are on page 1of 30

Polymerase Chain Reaction

(PCR) For Diagnosis malaria

In vitro amplification of certain part of DNA
sequence with the help of polymerse enzyme

Genome and DNA sequence of the cell

Plasmodium Genomes
caatttcagttaacgtttaaattgaatgagcctaagtac
tgaattcaattaaagtttaattcgaaatttgatttaacgc
aagtttcgcatgccaaatgcacgaacaagcaatttcg
aaccaattaaaattggaatttaaaagaccattaccga
actttaaccgaaattctatatacaagct

PCR Diagnosis : identification
of species unique sequence on
its DNA

PCR Material needed: -Taq Polymerase -DNTP: nucleic acid ( a. c) -Primer : forward & reverse -Buffer -MgCL2 -DNA target . t. g.

5 mM) • dNTP (dATP. dGTP) • Primer – Forwards – Reverse • DNA templete • Enzyme Polymerase (1 u/50 ul reaction . Bahan yang dipakai • PCR buffer (10x) • MgCl2 (1. dTTP. dCTP.

Primer Design CTGAATTGTTCCGGCTTAACCGCTT ATTATTAGCTATACCTTTAACCGTG GCCAAATTATTATTAGTTAATTGGC CTACCGTATAGCTGTGATATAGTAT AGTATAGCGTAGTAGTAATTGTGCT CTYTTAATAATGGCTTTCCAATAAT GCCGTTATTAAATAGTACTATAAT .

Length Primer length has effects on uniqueness and melting/annealing temperature. Usually. we pick primers of 17-28 bases long. the length of primer has to be at least 15 bases to ensure uniqueness. Generally speaking. Roughly speaking. the higher melting/annealing temperature. This range varies based on if you can find unique primers with appropriate annealing temperature within this range. the longer the primer. the more chance that it’s unique. the longer the primer. .

PCR Principle .

PCR .

Double strand DNA 96º B. Denature 50º C. Anneal primers Taq 72º D. Polymerase binds Taq .50º A.

Denature 3 First round of cDNA synthesis (4 strands) 4 . Copy strands Taq Taq 1 96º 2 F. Taq Taq 72º E.

1 2 G. Anneal 50º primers 3 4 .

Polymerase 3 binds Taq Taq 4 . 1 Taq 72º Taq 2 H.

Copy strands 3 Second Taq round of cDNA synthesis (8 strands) Taq 4 . 1 Taq 72º Taq 2 I.

1 J. Denature at 96º Anneal primers at 50º 2 3 4 .

1 72º K. Bind polymerase (not shown) and copy strands 2 3 Third round of cDNA synthesis (16 strands) 4 .

1 L. Denature at 96º Anneal primers at 50º 2 3 4 .

1 M. Copy strands at 72º 72º 2 3 Fourth round of cDNA synthesis (32 strands) 4 .

1 cDNA strands (32) are now shown as lines 2 3 4 .

1 After 5 rounds there are 32 double strands of which 24 (75%) are are same size 2 3 4 .

DNA Isolation from blood for Plasmodium diagnosis .

Isolated DNA .

DNA Isolation Kit .

• DNA Isolation using special Kit .

Primer for species identiification of Plasmodium .

5 ul • ddH2O 35. PCR Mixture Nest I Nest II • PCR Buffer 5 ul 5 ul • dNTP 2 ul 2 ul – dATP – dTTP – dCTP – dGTP • Primer – Forward 1 ul 1 ul – Reverse 1 ul 1 ul • DNA Templete 5 ul 2 ul(PCR product Nest I) • Taq-Polymerase 0..5 ul 0.5 ul.. Total Vol 50 ul 50 ul ....5 ul 38..

PCR Condition • Denaturation 95oC 1’ • Anealing 58oC 2’ • Extention 72oC 2’ • Nest I : 25 cycle • Nest II : 30 cycle .

Agarose Electrophoresis Gel Agarose (1-2%) Agarose 4 gr TBE buffer 40 ml  microwafe 1’  cooled down 5”  Ethidium bromide poured in gel tray Sample loading: 5 ul PCR product + 5 ul loading buffer .

P. malariae P. vivax . ovale P. falciparum P.