You are on page 1of 60

Estructura y Función del

Material Genético
Conceptos generales. Definiciones…

Genotipo:
Patrimonio genético característico de un organismo,
especie o individuo…

Propiedad inherente a los genes


presentes en un organismo

Fenotipo:
Conjunto de características observables o medibles
de un organismo, especie o individuo…

Manifestación externa del


genotipo de un organismo
¿Qué es un gen?
 Es una secuencia de nucleótidos en la
molécula de ADN, equivalente a una unidad
de transcripción.
 Contiene la información, a partir de la cual se
sintetiza un polipéptido, un ácido
ribonucleico: mensajero, de transferencia o
ribosomal.
 En el genoma de los animales la mayoría de
los genes son únicos y se expresan en forma
independiente. Los genes segregan cuando
ocurre la meiosis.
Naturaleza
Naturaleza del
del material
material hereditario.
hereditario.
Los
Los ácidos
ácidos nucleicos
nucleicos yy sus
sus componentes
componentes
ADENINA
ADENINA(A)
(A) GUANINA
GUANINA(G)
(G)

Los
Losácidos
ácidosnucleicos
nucleicosson
sonmacromoléculas
macromoléculasconcon
estructura
estructurade
de polímero
polímerolineal,
lineal,donde
dondeloslosmonómeros
monómerosson
son
nucleótidos.
nucleótidos.Cada
Cadanucleótido
nucleótidoestá
estáformado
formadopor
porun
unazúcar
azúcar
pentosa,
pentosa,ununfosfato
fosfatoyyuna
unabase
basenitrogenada.
nitrogenada.
Naturaleza
Naturaleza del
del material
material hereditario.
hereditario.
Los
Los ácidos
ácidos nucleicos
nucleicos yy sus
sus componentes
componentes
ADENINA
ADENINA(A)
(A) GUANINA
GUANINA(G)
(G)

Las
Lasbases
basespueden
puedenser
serpurinas
purinas(de
(dedoble
dobleanillo),
anillo),como
comola
la
Adenina
Adeninayyla
laGuanina...
Guanina...
3 4
5
6
2
1

TIMINA
TIMINA(T)
(T) URACILO
URACILO(U
(U) ) CITOSINA
CITOSINA(C)
(C)

También
Tambiénpueden
pueden serser pirimidinas,
pirimidinas, de
deanillo
anillo
sencillo,
sencillo,como
comola la timina
timinayyla
lacitosina,
citosina, en
enelel
ADN;
ADN; yyla
lacitosina
citosinayyel eluracilo
uracilo en
en el
elARN
ARN
5’

3’

ATENCIÒN:
ATENCIÒN:Un Un
hidrógeno
hidrógenoenenla
la
posición
posición2’
2’

Pentosa
Pentosa del
del ADN:
ADN: Desoxirribosa
Desoxirribosa
La
Lamolécula
moléculade
deADN
ADNesesuna
unadoble
doblehélice
hélice
antiparalela
antiparalela
Fosfatos
Fosfatos van
van Hebras
Hebras
unidos
unidosalalazúcar
azúcar antiparalelas
antiparalelas
en
en el C-5’ yelelC-3’
el C-5’ y C-3’

Punta
Punta3’3’libre
libre
Punta
Punta5’5’libre
libre

ACIDOS
ACIDOSNUCLEICOS
NUCLEICOS
Watson se dio cuenta de que
los patrones formados en cruz
en la fotografía tenían que estar
formados como una hélice. Así,
conjuntamente con Crick,
construyó un modelo de metal
de dos hélices unidas entre sí
por pares de cuatro moléculas.
El reporte sobre el modelo en la
publicación Nature, en 1953,
dio a ambos, Watson y Crick,
conjuntamente con Wilkins, el
premio Nóbel de Medicina en
1962. Franklin, olvidada, murió
de cáncer en 1958

Dibujo original
Watson y Crick, 1953
Del DNA al Cromosoma
"Cuentas de Una vuelta de
rosario" de la Un rosetón espiral
cromatina (6 bucles) (30 rosetones)

Fibra de 30 nm
DNA Un bucle Dos cromátidas
(50 X 1066 pb) (de 2 X 10 vueltas
de espiral)
EL
ELADN
ADNes
esla
lamolécula
moléculaque
quepermite
permiteperpetuar
perpetuarla
lavida:
vida:
REPLICACIÓN
REPLICACIÓNDEL
DELADN
ADN
Hebra
Hebramolde
molde

Hebra
Hebralíder
líder

Hebra
Hebraretardada
retardada

La elongación de la replicación es siempre 5’ DNA POL.MOV 3’.


La ADN polimerasa
Replicación
 Las ADN polimerasas requieren como
sustrato la punta 3’ hidroxilo libre de
una base apareada para catalizar la
unión de otro nucleótido.
 El OH libre se une al 5’-fosfórico del
deoxinucleósido 5’ trifosfato,
liberándose un pirofosfato inorgánico
ADN polimerasas……
 ADN polimerasas de alta fidelidad dirigidas
por ADN: dos de ellas replican los
cromosomas, () específica para la hebra
retardada porque tiene una subunidad primasa,
() líder y elongación de la hebra retardada,
otras dos reparan el ADN ( y ), y una de ellas
replica y repara el ADN mitocondrial ().
ADN-polimerasas…..

 ADN polimerasas propensas a errores dirigidas


por ADN: un grupo grande que replica con muy baja
fidelidad. La tasa de error de la polimerasa (iota) es
20.000 veces mayor que la de . Se expresan en
cantidades altas en el sistema inmune, implicadas en
la hipermutabilidad en linfocitos B y T..
Otras proteínas necesarias para
replicación

 Helicasas: desenrrollamiento
 Topoisomerasas: rompen una hebra y la tensión del
enrrollamiento de la hélice se relaja
 Primasas: sintetizan los iniciadores de ARN que se
necesitan para iniciar la replicación
 Ligasas: sellan los espacios dejadas por las
ribonucleasas cuando remueven los primers, catalizan
la unión fosfodiester entre nucleótidos adyacentes.
 Proteinas de unión a la hebra sencilla del ADN:
estabilizan la horquilla de replicación.
OKASAKI II.MOV

Horquilla de replicación en los mamíferos: Dos polimerasas


diferentes en la hebra retardada, primero empieza la pol 
sintetizando el primer de ARN algo del ADN porque tiene una
subunidad primasa, luego sigue trabajando la pol en la
elongación del fragmento
Reacción en Cadena de la Polimerasa o
PCR

• Desarrollado por el Dr. Kary Mullis en 1983


(Recibió el Premio Nobel en 1993)

• Es un método que permite amplificar selectivamente


una región elegida dentro de una molécula de DNA

• Se basa en los procesos de replicación del DNA


Permite copiar in vitro DNA
En el PCR hay una amplificación exponencial
Aplicaciones de la Técnica de PCR
•Diagnóstico de agentes infecciosos

•Diagnóstico de enfermedades genéticas prenatales

•Clonamiento directo desde ADN genómico

•Cuantificación de ADN por PCR

•Amplificación de RNA por PCR (RT-PCR)

•Mutagénesis in vitro

•“Fingerprinting”Genético de muestras forenses

•Análisis de variaciones de secuencias


Capitulo 2: del ADN a las proteínas
Transmisión de la información
 La transmisión se lleva a cabo
principalmente gracias a la existencia de los
ácidos ribonucleicos o ARNs
 ARN mensajero (lineal de hebra simple)
 ARN de transferencia
 ARN ribosomal
 Y a las ARNs polimerasas
ATENCION:
ATENCION:
Grupo
Grupohidroxilo
hidroxilo
en
enla
laposición
posición2’2’
Ribonucleótido
Ribonucleótido
URACILO
URACILO sustituye
sustituyeaalalaTIMINA
TIMINA

La
Lasecuencia
secuenciacorrespondiente
correspondienteaauna unaunidad
unidaddede
transcripción
transcripción en
enelelADN
ADNse se transcribe
transcribeen
enuna
unahebra
hebra
complementaria
complementariade deARN,
ARN,llamada
llamadatranscrito
transcrito
primario,
primario, aapartir
partir del
del cual,
cual, por
por modificaciones
modificacionespost-
post-
transcripcionales
transcripcionales,, se
seorigina
originael elARN
ARN mensajero
mensajero
TRANSCRIPCIÒN
TRANSCRIPCIÒN

La ARN polimerasa
se activa cuando
forma un complejo
con los factores de
transcripción o
elementos
trans. La interacción
de estos entre sí, y con
las secuencias
reguladoras del ADN
(los factores cis) es la
que determina donde,
cuando y con qué
rapidez ocurre la
transcripción
¿Qué es una unidad transcripcional ?…

atcatcctgccccatgcccatcgccacgcgttttggcgtgccaaaaaggttgcacagc
accggcatggcgtaacctttaggattttcaaacagcaacgccggtccaccggcacgca
gcgtgcggtcagcgatttccgtgatttccagatgaggatccacaggtagcgtgatgcg
ttttagttccccctgctgctcaagtagcgtcaggaagtcgcgtaaatcgtgatatttc
atggcgtccattgtagcctcttggtaagcgcatcattatacggcgttcatcatcggga
tgctgtatttttgttaaattagcgtgaactctggcaaccaacgctaatccagatacgg
cttaaaggatgaagtgtataattaacttcgcgcatggcttttgctatgcttgcgcccc
gaacaagcggataagagtcattatgcaatcctggtatttactgtactgcaaacgcggg
caacttcagcgtgctcaggaacacctcgaaagacaagcggtaagttgcctgacaccga
tgatcaccctggaaaaaatggtacgcggaaaacgtaccttcgtcagcgaaccgctctt
tcctaattatctgttcgttgaatttgatccggaagtgatacataccactacaatcaac
gccacgcgcggcgtcagccattttgtgcgctttggcgcgcatcctgcgatcgtgcctt
ccagcgttattcatcagctttctatctacaagcccgaaggcgttgtcgatcctgaaac
cccctatcccggcgatagcgtcatcatcacggaaggcgcatttgaagggctgaaagcg
atttttaccgaaccggatggcgaaacgcgttcgatgttactgcttaatttactcaata
aagaagtgaagcagagcgtaaaaaacaccggttttcgcaagatttagcgatcgttcag
aatacgacctcaaataaggttctggcattggcatctgtcatcgccgctaaccattgcg
gatcttcaccacgccatagcgctatgcgctccag
Secuencia de DNA…

atcatcctgccccatgcccatcgccacgcgttttggcgtgccaaaaaggttgcacagc
accggcatggcgtaacctttaggattttcaaacagcaacgccggtccaccggcacgca
gcgtgcggtcagcgatttccgtgatttccagatgaggatccacaggtagcgtgatgcg
ttttagttccccctgctgctcaagtagcgtcaggaagtcgcgtaaatcgtgatatttc
atggcgtccattgtagcctcttggtaagcgcatcattatacggcgttcatcatcggga
tgctgtatttttgttaaattagcgtgaactctggcaaccaacgctaatccagatacgg
cttaaaggatgaagtgtataattaacttcgcgcatggcttttgctatgcttgcgCccc
gaacaagcggataagagtcattatgcaatcctggtatttactgtactgcaaacgcggg
caacttcagcgtgctcaggaacacctcgaaagacaagcggtaagttgcctgacaccga
tgatcaccctggaaaaaatggtacgcggaaaacgtaccttcgtcagcgaaccgctctt
tcctaattatctgttcgttgaatttgatccggaagtgatacataccactacaatcaac
gccacgcgcggcgtcagccattttgtgcgctttggcgcgcatcctgcgatcgtgcctt
ccagcgttattcatcagctttctatctacaagcccgaaggcgttgtcgatcctgaaac
cccctatcccggcgatagcgtcatcatcacggaaggcgcatttgaagggctgaaagcg
atttttaccgaaccggatggcgaaacgcgttcgatgttactgcttaatttactcaata
aagaagtgaagcagagcgtaaaaaacaccggttttcgcaagatttagcgatcgttcag
aatacgacctcaaataaggttctggcattggcatctgtcatcgccgctaaccattgcg
gatcttcaccacgccatagcgctatgcgctccag
Estructura de un gen…

Inicio
(transcripción)
+1
Fin traducción
Promotor TAA
(Región -35 y -10) Inicio traducción TGA
ATG TAG

Región codificante
Región (Marco de lectura abierto)
Secuencia de unión al Terminador
regulatoria (“Open reading frame” ORF) (transcripción)
(transcripción) ribosoma
(Shine-Delgagno en
bacterias y Kosak en
eucariontes)
Modelo simplificado de un gen eucarionte

PROMOTOR
Secuencia que no se traduce Secuencia que no se traduce

Intrón 1 Intrón 2 Intrón 3

5` 3`

Región reguladora EXON 1 EXON 2 EXON 3 EXON 4 EXON n Región reguladora

Unidad de transcripción

Después
Despuésdel
delprocesamiento
procesamientopostranscripcional
postranscripcionaldel
delARN
ARN
transcrito
transcritoprimario,
primario,la
lasecuencia
secuenciade
deARNm
ARNmcorresponde
correspondeaalas
las
secuencias
secuenciasde
delos
losexones.
exones.
DOGMA
DOGMACENTRAL
CENTRALDE
DELA
LABIOLOGÌA
BIOLOGÌAMOLECULAR
MOLECULAR

Hebra
Hebramolde
molde
Transcripción
Transcripción

Traducción
Traducción
ARN
ARNdedetransferencia
transferenciaactivado:
activado:
cargado
cargadocon
conelelaminoácido
aminoácido
correspondiente
correspondiente
CODIGO
CODIGO
GENETICO
GENETICO
ARNm
ARNm
TRADUCCIÓN
TRADUCCIÓN
ARN
ARN---
---Proteína
Proteína
Cuatro monómeros de aminoácidos

Reacción de
condensación

Polipéptido

Enlace peptídico catalizado por el complejo enzimático localizado en el ribosoma


Estructura primaria Residuos de los distintos aminoácidos
(Secuencia lineal)

Estructura secundaria Estructura terciaria


(forma adoptada espontáneamente) (Forma tridimensional: globular,
tubular, como una rueda, etc.)

Las proteínas sufren transformaciones post-traduccionales


Estructura cuaternaria: combinación de monómeros
CAPITULO III: MUTACIONES
Mutaciones
 Germinales o constitucionales:

 El individuo las adquiere por herencia de sus padres, puede


ocurrir de novo en una célula germinal de alguno de los
padres.
 Todas las células del cuerpo llevan la misma mutación
 Ejemplo: enfermedades hereditarias

 Somáticas:

 Se adquiere en el transcurso de la vida


 Es portada únicamente por la célula afectada y sus células
hijas. El individuo es un mosaico.
 Ejemplo: cáncer
Clases de Mutaciones

Mutaciones Puntuales:

• Sustitución de bases
• Adiciones de bases
• Supresiones de bases
Otros tipos de mutaciones:

Mutaciones cromosómicas

•delecciones
•duplicaciones
•Inversiones
•Inserciones
•translocaciones
Qué Causa las Mutaciones?
Mecanismos endógenos:
1. Pérdida de bases tipo purinas por ruptura
espontánea del enlace con el azúcar
5000/día/célula humana
2. Deaminación espontánea de citosinas y
adeninas produce uracilo e hipoxantina
3. Moléculas con oxígenos reactivos atacan los
anillos de las bases nitrogenadas
4. La ADN polimerasa puede incorporar bases
equivocadas en la replicación
5. Errores en la replicación o recombinación
provocan fracturas en el ADN
Agentes extracelulares

1. Radiaciones ionizantes: rayos gamma y


rayos X causan rupturas en la doble hélice
2. Luz UV causa la formación de los dímeros
de timina
3. Químicos ambientales como agentes
alquilantes y otras sust químicas forman
aductos con las bases del ADN:
hidrocarburos, productos naturales como las
aflatoxinas.
Reparación del ADN
Mecanismos de detección y reparación
de daños al ADN
• Sistemas enzimáticos para reconocer,
eliminar y reparar daños inducidos al
ADN .

• El estudio de los síndromes


hereditarios de predisposición al cáncer
ha permitido ampliar el conocimiento
en el ser humano y animales
Xeroderma Pigmentoso
 Individuos con esta
enfermedad genética
tienen defectos en las
enzimas de reparación.
 can’t remove thymine
dimers caused by UV
light
 very sensitive to
sunlight and often get
skin cancers From: Concepts of Genetics, 6th edition,
Klug and Cummings, Prentice Hall
11_21.jpg
11_21_2.jpg