You are on page 1of 29

Universidad Autónoma de Santo Domingo

(Facultad de Ciencias Agronómicas y Veterinarias)

Estudio genético poblacional de Bemisia tabaci Genn, en la República
Dominicana usando marcadores RADP y gen Citocromo Oxidasa I

Andreina Cuello1
Luis Matos 2, 3

Santo Domingo
Republica Dominicana
Noviembre, 2018
CONTENIDO

Introducción
Las infecciones virales han sido una de las causas de
Justificacion mayores pérdidas económicas en los últimos anos.

Objetivos Los vectores mas comunes en la transmisión de virus son
áfidos trips y moscas blancas de estas ultimas Bemisia
Materiales y tabaci y Trialeurodes vaporariorum son las especies que
Métodos
se encuentran mas distribuidas y las responsables de
Resultados y cuantiosas perdidas económicas.
discusión
Las moscas blancas representan uno de los mas eficientes
Conclusión transmisores de virus a nivel mundial
CONTENIDO

Introducción
Uno de los grandes problemas causados por moscas
Justificacion blancas es la transmisión de virus, transmite virus
pertenecientes a siete grupos que incluyen Begomovirus,
Objetivos Carlavirus, Ipomovirus, Crinitivirus (Jones, 2003 citado
por Moreales 2006 ) siendo los mas importantes por los
Materiales y danos causados Begomovirus y los Crinivirus.
Métodos

Resultados y Bean golden mosaic virus- BGMV
discusión Tomato chlorosis Virus(ToCV)
Tomato infectious chlorosis virus (TICV)
Conclusión Tomato yellow leaf curl virusTYLCV
Squash leaf curl virus (SLCV)
CONTENIDO

Introducción

Justificacion
General:
Objetivos

Materiales y Estudiar la diferencia poblacional de Bemisia tabaci Genn, en
Métodos la Republica Dominicana usando marcadores RADP y otros
genes conservados.
Resultados y
discusión

Conclusión
CONTENIDO

Introducción

Justificacion Especifico:
Objetivos

Materiales y
Identificar los posibles biotipos de Mosca
Métodos blanca usando RADP, COI, ITS y 16S rRNA
Resultados y
discusión
Determinar poblaciones mixtas por regiones

Conclusión
CONTENIDO

Introducción
Ubicacion del estudio
Justificacion
Las muestras fueron tomadas en las provincias Constanza, Jarabacoa,
Rancho Arriba y Azua tanto a campo abierto como bajo invernaderos
Objetivos
y fueron analizadas en el laboratorio de Biología Molecular de la
Facultad de Ciencias Agronómicas y Veterinaria de la Universidad
Materiales y
Autonomía de Santo Domingo.
Métodos

Resultados y
discusión

Conclusión
CONTENIDO

Introducción  Identificar los posibles biotipos de Mosca blanca
Justificacion
usando RADP, COI, ITS y 16S rRNA
• Colección y preservación de muestras, los hospederos
Objetivos fueron tomate, melón, pepino, berenjena, auyama, y
malezas.
Materiales y
Métodos

Resultados y
discusión

Conclusión
CONTENIDO
 Identificar los posibles biotipos de Mosca blanca
Introducción
usando RADP, COI, ITS y 16S rRNA
Justificacion • Extracción del ADN genómico
Objetivos
El ADN genómico fue extraído de 5 individuos utilizando
Materiales y el kit de extracción de Invitrogen bajo las instrucciones del
Métodos fabricante.

Resultados y • Reacción en cadena de la polimerasa PCR (Kary
discusión
Mullis,1983), utilizando primer específicos para MB y
Conclusión primers RADP.
CONTENIDO
 Determinar poblaciones mixtas por regiones
Introducción geográficas

Justificacion Algunas muestras fueron clonadas con E.coli
Objetivos

Materiales y
Métodos

Resultados y
discusión

Conclusión
CONTENIDO

Introducción  Identificar los posibles biotipos de Mosca blanca
Justificacion
usando Citocromo Oxidasa I (COI)

Objetivos

Materiales y Se amplificó por PCR el gen Citocromo Oxidasa I
Métodos usando los primers 2195F y 3014R.
(Frohlich et al., 1999; khasdan et al., 2005; Cifuentes et al., 2011).

Resultados y
discusión

Conclusión La amplificacion por PCR del gen COI se obtuvieron dos
fragmentos aproximadamente de 350pb, muestras de Rancho Arriba.
CONTENIDO

Introducción  Identificar los posibles biotipos de Mosca blanca
Justificacion
usando 16S rRNA

Objetivos
• Se amplificó el gen mitochondrial 16S
Materiales y rRNA usando los primers
Métodos WF-F y WF-R.
(Frohlich et al., 1999).
Resultados y
discusión
La amplificación por PCR del 16S rRNA se obtuvo un fragmento
Conclusión aproximadamente de 350pb las muestras de Constanza y Jarabacoa, las
muestras de Azua se obtuvieron fragmentos aproximadamente de
250pb.
CONTENIDO

Introducción  Identificar los posibles biotipos de Mosca blanca
Justificacion
usando 16S rRNA

Objetivos
WF Constanza 100% de similitud con
Materiales y T. Vaporariorun con AY521265.2 (California)
Métodos
Nnnnnnnnnnnnnnnacgactcattttcatcatttttctnnttgcattg
tcctaatccaacatcgaggtcgcattacattttngttaatatgatctttt
Resultados y gaaaagttgtgcgctgttatcccttaggtaacttgttcttttttcttatt
discusión gtaggttattttattttcactaattggtgttgggttttaatataagttgt
ttgtgttttattgtctccccaaccaaataaaaggcgtttttgttataatt
tgctttttataaagttctaaagggtctttttgtcttttttatttatttaa
Conclusión gctttttaacttaaagtttaatttttatcttttaaacaaaaaaagttaaa
CONTENIDO

Introducción  Identificar los posibles biotipos de Mosca blanca
Justificacion
usando ITS (Espaciador interno transcrito)

Objetivos
• Se amplificó el gen mitochondrial ITS
Materiales y usando los primers TW-81-F y TW-81-
Métodos R.(Frohlich et al., 1999).

Resultados y
discusión

Conclusión La amplificación por PCR del gen ITS se obtuvo un fragmento
aproximadamente de 250pb las muestras de Constanza, Azua y
jarabacoa.
Sri Lanka

CONTENIDO

Introducción  Identificar los posibles biotipos de Mosca blanca
usando ITS
Justificacion

Objetivos

Materiales y
TW-81- Jarabacoa Tomate MF161995 (Sri Lanka)
Métodos 99% de similitud con B. tabaci.
nnnnnnnnnngnncnnanngcgaagnnnnnnannnccgaagccgtcccgn
gnagaancngngccngccgcttgaaagcgccgggcggtcgacggcttcac
Resultados y ccccacccggtctcggggaatcggagccggtccgtccgccctccgaggcg
discusión ggcgagcgccggcgattcccgaccgcacactcgacgtgcccgacgtgccc
ccgccgtcccactcgctctcgcggcggttgggagctccggcgagcggcga
cggcaccgacggtgattctgacgaagacgccgctcgccctccggggtcgc
Conclusión gcgagacccgacgccgcccgcacctgttgtgccgccgcgccctctccttc
CONTENIDO

Introducción  Identificar los posibles biotipos de Mosca blanca
usando ITS
Justificacion

Objetivos TW-81 Constanza Pepino MF161995.1 (Sri Lanka)
98% de similitud con B. tabaci
Materiales y nnnnnnntnnnnnnngganngggggggngnngccgatnccagaggannng
gannngtcnaccagaggcgtcgacgctcgcgccgaggcgagcgtcgtccc
Métodos gtgaaccgctgtgggtctgcatccctagagtcacgccgtcgggtcgagcg
tccgacggttcagggcgtgctcctgccgcggcgacgctctctgaaggaga
Resultados y gggcgcggcggcacaacaggtgcgggcggcgtcgggtctcgcgcgacccc
ggagggcgagcggcgtcttcgtcagaatcaccgtcggtgccttccccgct
discusión cgcccgagctccccactggcactagcgttagaggtcccgggctggtcgct
gggttctttggatccccctttgcgctcgttgcggganttaacccctcttt
Conclusión tcggnncacgagatgacgacagtcatgnntcat
CONTENIDO
 Identificar los posibles biotipos de Mosca blanca
Introducción usando RADP
OPA-04
Justificacion

Objetivos El primer utilizados en las distintas
reacciones fueron oligonucleotidos de
Materiales y 10 bases de longitud y secuencia
Métodos arbitraria RAPD por su alto grado de
polimorfismo OPA-04.
(Quintero et al.1998)
Resultados y
discusión Se logro distinguir patrones de bandas
caracteristicos de los diferentes biotipos
Conclusión A, B de B.tabaci y T.vaporariorum
CONTENIDO
 Identificar los posibles biotipos de Mosca blanca
Introducción usando RADP
Justificacion
• Constanza,
Objetivos
T. Vaporatiorum y
biotipo B de B. tabaci
Materiales y
Métodos
• Azua,
B.tabaci biotipo B
Resultados y
discusión
• Rancho Arriba,
B. tabaci biotipo B
Conclusión
CONTENIDO
 Identificar los posibles biotipos de Mosca blanca
Introducción usando RADP
Justificacion
• Jarabacoa,
Objetivos B. Tabaci y
T. vaporariorum
Materiales y
Métodos • San juan
biotipo A de B. tabaci
Resultados y
discusión
• Santo Domigo
Conclusión biotipo A de B. tabaci
CONTENIDO
 Identificar los posibles biotipos de Mosca blanca
Introducción usando RADP, COI, ITS y 16S rRNA
Justificacion

Objetivos

Materiales y Resultados obtenidos por
Métodos
Quintero et al 2001,
Resultados y Colombia
discusión mediante la tecnica
RADP, primer OPA-04
Conclusión
CONTENIDO
 Identificar los posibles biotipos de Mosca blanca
Introducción usando RADP, COI, ITS y 16S rRNA
Justificacion

Objetivos

Materiales y Resultados obtenidos por
Métodos
Rodríguez et al. 2005,
Resultados y Colombia
discusión mediante la tecnica
RADP, primer OPA-04
Conclusión
CONTENIDO
 Identificar los posibles biotipos de Mosca blanca
Introducción usando RADP, COI, ITS y 16S rRNA
Justificacion
Segun Caballero (1992), T. vaporariorum tradicionalmente se habia
Objetivos
encontrado por encima de los 800 msnm, sin embargo se hallo tambien
a partir de los 600 msnm, aunque B.tabaci y T. vaporariorum se
Materiales y
desarrollan en habitat distintos se hallaron compartiendo nicho
Métodos
ecologico estando presente ambos en Constanza en pepino y maleza, lo
que puede corroborar lo dicho por Byrne et al. (1990), que el hombre
Resultados y
ha transportado las moscas blancas a nuevos habitad y tambien ha
discusión
alterado los ambientes favoreciendo la supervivencia de especies de las
mismas en areas donde usualmete no de desarrollaban. Ademas
Conclusión
CONTENIDO
 Identificar los posibles biotipos de Mosca blanca
Introducción usando RADP, COI, ITS y 16S rRNA
Justificacion
Segun Lima et al. (2002) estudios filogenéticos recientemente
Objetivos realizados utilizando marcadores más efectivos como el ADN
mitocondrial (Frohlich et al., 1999;Kirk et al., 2000) y marcadores de
Materiales y ADN ribosomal (De Barro et al., 2000) sugieren que los mejor forma
Métodos de ver B. tabaci es como un complejo que contiene geográficamente
distintas poblaciones que exhiben variación a través de una
Resultados y número de rasgos.
discusión
Más estudios son necesarios sobre secuencias moleculares, fenotipos
Conclusión de rango de hospedadores y compatibilidad de apareamiento entre los
biotipos y subgrupos de B. tabaci por que el cambio de nombre del
biotipo B a B.argentifolii es prematuro.
CONTENIDO
 Identificar los posibles biotipos de Mosca blanca
Introducción usando RADP, COI, ITS y 16S rRNA
Justificacion
Según Guirao et al. (1994) es posible distinguir con facilidad el grupo
Objetivos de poblaciones de B. tabaci y T. vaporariorum con esta técnica RAPD.

Materiales y Sin embargo, no se puede llegar a establecer por el momento una clave
Métodos taxonómica con los datos obtenidos, seria necesario examinar mas
poblaciones y caracterizar su variabilidad.
Resultados y
discusión Por el momento esta técnica es útil para determinar la mayor o menor
similitudes entre una población y otras pero es necesario disponer de
Conclusión poblaciones de referencia correctamente clasificadas.
CONTENIDO
 Determiner poblaciones mixtas por regiones
Introducción

Justificacion Se realizaron clonaciones con
E. coli
Objetivos
Luego de analizar 16 secuencias
Materiales y no obtuvimos presencia de
Métodos poblaciones mixtas basados en el
patron de bandas determinados
Resultados y por los primers RADP
discusión

Conclusión
CONTENIDO
 Identificar los posibles biotipos de Mosca blanca
Introducción usando RADP, COI, ITS y 16S rRNA
Justificacion

Objetivos WF Constanza GQ867761.1 (Taiwan)
100% desimilitud con
Materiales y
Métodos
T.Vaporariorum

nnnnnnnntnnantgnagcaatttctgctcaatgagcaattaaatagccg
Resultados y cagtatattaactgtgctaaggtagcataataattagttttttaattaaa
discusión aactagaatgaatgaaaaaatgaaggtttaactttttttgtttaaaagat
aaaaattaaactttaagttaaaaagcttaaataaataaaaaagacaaaaa
gaccctttagaactttataaaaagcaaattataacaaaaacgccttttat
Conclusión ttggttggggagacaataaaa
CONTENIDO
 Identificar los posibles biotipos de Mosca blanca
Introducción usando RADP, COI, ITS y 16S rRNA
Justificacion

Objetivos WF Jarabacoa AY521265.2 (California, USA)
99% de similitud con
Materiales y
T.Vaporariorum
Métodos
nnnnnnntnnantgnagcaatttctgctcaatgagcaattaaatagccg
Resultados y cagtatattaactgtgctaaggtagcataataattagttttttaattaaa
discusión aactagaatgaatgaaaaaatgaaggtttaactttttttgtttaaaagat
aaaaattaaactttaagttaaaaagcttaaataaataaaaaagacaaaaa
gaccctttagaactttataaaaagcaaattataacaaaaacgccttttat
Conclusión ttggttggggagacaataaaacacaaacaacttatattaaaacccaacac
caattagtgaaaataaaataacctacaataagaaaaaagaacaagttacc
CONTENIDO
 Los datos mostrados representan información preliminar de
Introducción un estudio poblacional sobre MB que esta en proceso
Justificación
 La población de B tabaci parece ser muy heterogénea a nivel
Objetivos nacional

Materiales y  Los genes conservados usados para la diferenciación
Métodos genética representan una buena fuente para tales fines
Resultados y
 Igualmente se trabaja en la determinar la infectividad los
discusión
virus transmitidos
Conclusión
 No fueron encontradas poblaciones mixtas
Gracias por su atención