DNA FINGER PRINT

PROF. ALEXANDRE S. OSÓRIO

GENOMA NUCLEAR

MICROSSATÉLITES
• Seqüências hipervariáveis (também chamadas polimórficas) repetitivas de 1 a 4 pb com distribuição ao longo do genoma. • O polimorfismo destas seqüências é resultado de diferentes rearranjos envolvendo segmentos de DNA de tamanhos diferentes. • Herança Mendeliana (os filhos sempre recebem metade dos alelos de origem materna e metade de origem paterna).

MICROSSATÉLITES
Exemplos de seqüências de microssatélites: • Repetição de 1 base: GTAAAAAAAAAAAAAAAGGAT • Repetição de 2 bases: GTCACACACACACACACAGGAT (dinucleotídeo) • •Repetição de 3 bases: GTCACCACCACCACCACCACGGAT (trinucleotídeo) • •Repetição de 4 bases: GTCAGACAGACAGACAGAGGAT (tetranucleotídeo) - Polimorfismos são devidos às diferenças no número de repetições - São também conhecidos como “short tandem repeat” (STR). - O número de repetições em seqüência pode variar, sendo chamadas de VNTRs (Variable Number of Tandem Repeats = número variável de repetições em seqüência) .

IMPRESSÕES DIGITAIS DO DNA (DNA FINGERPRINTS)
O QUE SIGNIFICA?
Com base no estudo de uma bateria de 12-20 microssatélites, é possível obter perfis genéticos praticamente indivíduo-específicos, muito úteis na investigação de paternidade, identificação de vítimas e criminosos.

TÉCNICAS
• • RFLP (Restriction Fragment Lenght Polymorphism). PCR (Polymerase Chain Reaction).

Polimorfismo de Comprimento de Fragmento de Restrição
1) Coleta de amostras biológicas que podem ser saliva, sangue, esperma e cabelo com raiz, entre outros. 2) Extração e purificação do DNA. 3) Corte com enzimas de restrição (tesouras moleculares que reconhecem e cortam seqüências específicas do DNA). 4) Eletroforese: onde, através de uma corrente elétrica, são separados os fragmentos de DNA por tamanho. A partir daí, é formada uma espécie de código de barras que é a identificação individual e intransferível de cada indivíduo.

As enzimas de restrição
Fazem parte de um sistema da célula bacteriana denominado sistema de modificação-restrição. Este sistema consiste numa endonuclease de restrição.

O nome dado a enzima refere-se ao organismo de onde foi isolado. A primeira letra representa o gênero e as outras duas a espécie, seguido de um algarismo romano (ou outra letra) que indica a ordem da descoberta ou a linhagem da qual foi isolado.

Sítios de reconhecimento, modificação e clivagem por alguns enzimas de restrição

Enzima

Local de restrição

Organismo de origem

EcoRI

Escherichia coli

Haemophilus influenza HindIII

Serratia marcescens Smal

Enzimas de restrição Uma enzima de restrição ou endonuclease de restrição é um tipo de nuclease que cliva uma cadeia dupla de DNA sempre que identificar uma sequência específica de 4 a 8 pares de bases que seja o local de restrição da enzima (Smith & Wilcox, 1970). As seqüências reconhecidas apresentam nas duas cadeias complementares seqüências idênticas mas invertidas – palíndromo.

PCR – REAÇÃO EM CADEIA DE POLIMERASE
• Aquecimento do DNA a ser amplificado a temperatura de 94°C por 1 minuto, o que provoca separação da dupla hélice. Depois, com a temperatura mais baixa, são empregadas as polimerases, que atuam em cada uma das cadeias do DNA, complementando os pares de bases. A cada ciclo, a quantidade de DNA-alvo é duplicada, de modo que em 10 ciclos obtêm-se 1024 vezes mais DNA-alvo; em 20 ciclos, cerca de 1 milhão de vezes mais DNA-alvo. Propicia um aumento na eficiência da análise de material genético Polimerases são enzimas que ocorrem nas células e catalisam reações de polimerização (formação de moléculas de cadeias longas) Pela técnica PCR promove-se a duplicação de trechos do DNA in vitro.

• • • •

PCR

VISUALIZAÇÃO DO DNA
Uso de sondas: pequenos segmentos de DNA radioativados, cuja seqüência de bases é conhecida. Acoplam-se às seqüências de DNA das quais são complementares, ligando-se às mesmas.
SLP: detecta um único segmento de DNA repetitivo em um único cromossomo. Seu uso resulta em um padrão que contém no máximo duas bandas: uma para cada segmento de DNA reconhecido em cada membro do par de cromossomos homólogos. Para a obtenção de padrões mais característicos de cada pessoa, são necessárias várias sondas. Devido à sua sensibilidade, são empregadas nas investigações criminais.

SLP (single-locus probe)

VISUALIZAÇÃO DO DNA
MLP: detecta vários segmentos de DNA repetitivo localizados em muitos cromossomos. O padrão obtido consiste em aproximadamente 20 a 30 bandas. Por isso, a probabilidade de duas pessoas tomadas ao acaso apresentarem todas as bandas exatamente com a mesma posição é extremamente baixa (1:10 trilhões).

MLP (multi-locus-probe)

RESULTADOS DE TESTES
Mary Higgins foi violentada no Central Park em Nova York. Três suspeitos foram presos. O DNA revelou o verdadeiro agressor.

RESULTADOS DE TESTES
O assassinato de Jon Bennet Ramsey: um crime sem solução?

Tristeza ou remorso ?

RESULTADOS DE TESTES
Em 1987: casal de noivos – Matthew Brock e Kelly Lynn Perry (também estuprada) – é achado baleado na cabeça (bala de rifle calibre 30) em Rodman Dam, área de recreação na Flórida. Principais suspeitos: os adolescentes Randall Scott Jones e Chris Reesh.