You are on page 1of 98

Improving life through genome engineering

November
2010
Disclaimer
This communication expressly or implicitly contains certain forward-looking statements concerning
Cellectis and its business. Such statements involve certain known and unknown risks,
uncertainties and other factors, which could cause the actual results, financial condition,
performance or achievements of Cellectis to be materially different from any future results,
performance or achievements expressed or implied by such forward-looking statements. Cellectis
is providing this communication as of this date and does not undertake to update any forward-
looking statements contained herein as a result of new information, future events or otherwise.

November 2010 2
November 30, 2010

Welcome to Cellectis first R&D Day

3
Program

13:30 Cellectis – An Overview – André Choulika, CEO


13:40 Update on the Science of Meganucleases – Philippe
Duchateau
14:00 Research Tools – Christophe Delenda
14:20 Genome Engineering in Plants – Dan Voytas
14:50 Therapeutic Programs – Carole Desseaux
15:10 An Example of Collaboration in Therapeutics – Serge Braun AFM
15:45 Perspectives: potential applications of iPS cell technologies –
David Sourdive
16:00 Q&A

November 2010 4
The post-genomic era challenge

A genome is like a recipe


...CTCTGGTTAGACCAGATTTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTG
AACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACT
AGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTGGCGCCCGAACAGGGACTTGAAAGCGAAAGGGAAACCAGAGGA
GCTCTCTCGACGCAGGACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGGGGAGGCGACTGGTGAGTACGCTTTGACAGCCGCCTAG
CATTTCATCACGTGGCCCGAGAGCTGCATCCGGAGTACTTCAAGAACTGCTGACATAGAGCTTGCTACAAGGGACTTTCCGCTGGGGACT
TTCCAGGGAGGCGTGGCCTGGGCGGGACTGGGGAGTGCGAGCCCTCAGATGCTGCATATAAGCAGCTGCTTTTTGCCTGTACTGGGTCTC
TCTGGTTAGACCAGATTTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTC
AGGTCTCTCTGGTTAGACCAGATTTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGA
GCAAGAGGCGAGGGGAGGCGACTGGTGAGTACGCTTTGACAGCCGCCTAGCATTTCAAAGGGAAACCAGAGGAGCTCTCTCGACGCA...

Modifying it matters
...CTCTGGTTAGACCAGATTTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTG
AACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACT
AGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTGGCGCCCGAACAGGGACTTGAAAGCGAAAGGGAAACCAGAGGA
GCTCTCTCGACGCAGGACTCGAGTCAGTGTGGAAAATCTCTAGCAGTGGCGCCCGAACAGGGACTTGAATACGCTTTGACAGCCGCCTAG
CATTTCATCACGTGGCCCGAGAGCTGCATCCGGAGTACTTCAAGAACTGCTGACATAGAGCTTGCTACAAGGGACTTTCCGCTGGGGACT
TTCCAGGGAGGCGTGGCCTGGGCGGGACTGGGGAGTGCGAGCCCTCAGATGCTGCATATAAGCAGCTGCTTTTTGCCTGTACTGGGTCTC
TCTGGTTAGACCAGATTTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTC
AGGTCTCTCTGGTTAGACCAGATTTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGA
GCAAGAGGCGAGGGGAGGCGACTGGTGAGTACGCTTTGACAGCCGCCTAGCATTTCAAAGGGAAACCAGAGGAGCTCTCTCGACGCA...

So why not use it to improve life?

November 2010 5
A very short history of sequencing

• The number of complete genomes sequenced is increasing more


rapidly than expected
• 1995: First sequence of a living organism (Haemophilus influenzae, 1.8M
bp)
• 2002: Sequence of the mouse genome (2.2 billion bp)
• 2003: First precise human genome sequence (2.9 billion bp)
• 2005: Sequence of the rice genome (400M bp)

Ø• The cost of sequencing a complete genome is dropping rapidly


• First human genome: 2.7 billion $
• 2010: 10,000$
• 2012: 1,000$
• 2015: 300$?

November 2010 6
Genome engineering today

• Research and production


• Analysis of gene functions
• Production of bioproteins

Ø
• Agrobiotech
• New traits that are herbicide resistant, pesticide resistant, or have
better yields of production

Ø
• Healthcare
• First gene therapies for well characterized monogenic diseases

November 2010 7
Genome engineering tomorrow

• Agrobiotech
• New traits with improved nutritional properties or adapted to new
climate conditions, containing little to no foreign DNA sequences

Ø
• Healthcare
• Custom medicine, able to cure a patient of a disease even before the
appearance of the first symptoms
• Gene therapy 2.0 with complete control of the inserted or modified
gene
• Energy
Ø
• Production of petrol substitutes from algae

Ø• White biotech
• Plastics, fibers… produced from living organisms
• …

Ø
November 2010 8
Cellectis - a leader in genome engineering

André Choulika
CEO of Cellectis

9
Cellectis in brief

Company World pioneer in targeted genome engineering; established in Dec 1999


Listed on Paris Stock Exchange since 2007: Alternext : ALCLS

Organization HQ in Romainville, Paris - France; > 120 employees (45 PhDs)


ü
4 subsidiaries, including one located in Saint Paul, Minnesota, USA
ü
Diversified business model ; key segments in tools, agrobiotech and therapeutics
ü
ü
Technology Proprietary platform based on meganucleases (DNA scissors)
ü
Extensive and valuable intellectual property estate
ü
ü
Partners More than 50 agreements since inception (€40M generated so far)
ü
Strategically positioned
ü in core interest areas
ü
Financials Over €25m cash and ü growing revenue base
ü
ü
ü
ü
November 2010 ü 10
Meganucleases – The basics

• Naturally occurring DNA scissors found in single-celled organisms


• First discovered in baking yeast in the 1980’s
• Cut DNA at a unique target site (motif of 12-30 base pairs)
• Create an opening in DNA to allow sequence insertion, deletion and/or
repair
• Stimulate homologous recombination
The first in vivo DNA “cut & paste”
Ø

Chromosome Meganuclease

DNA cut with


incredible target
specificity
“Cut”

DNA repair/insertion
Human genome size:
(Paste)
6.4 billion bases
(G, A, T, C).

November 2010 11
Genome engineering – 3 principles of action

November 2010 12
Multiple partnerships strongly supporting the technology

Upstrea Research Production


m Tools Tools Agrobiotech Therapeutics
Researc
h

Harvard Institute
of Medicine

November 2010 13
A market-based organization

Research
tools

Production
tools

Agrobiotech

Therapeutics

Stem cells

November 2010 14
Update on the science of meganucleases

Philippe Duchateau
Head of Meganuclease Research Department

15
The meganuclease research department

Meganuclease Research is a core corporate function driving


innovation

It is composed of 3 groups: Protein engineering, Cell biology


and Computational biology

Its key objective is to keep the meganuclease technology at


its very best and continue improving it

We are developing new tools to improve meganuclease-


induced HR or mutagenesis.

November 2010 16
1 – Targeted approaches induced
by meganucleases

November 2010
Different endonucleases used for targeted recombination
Meganucleases (homing endonucleases)
•Natural proteins
•1st endonucleasesused for genome engineering
•Low apparent modularity (2 separable domains)
-
Zinc-Finger Nucleases
•Artificial protein : zinc finger protein (DNA binding
domain) fused with a catalytic domain (FokI)
•1st engineered endonuclease used to edit a human gene
•High modularity (6-8 separable domains “polydactyls”)

Chemical endonucleases
•Chemical DNA binding domain (TFO, polyamine) fused to
effector (chemical or restriction enzyme)
•High modularity

TALE Nucleases •DNA binding domain from Transcription Activator Like


Effectors from Xanthomonas
•Very high modularity (potential code)
•Early stage technology
-
November 2010 18
The four major families of nuclease-mediated genome engineering methods

x x

Targeted insertion Targeted deletion Gene Gene


(knock-in) (knock-out) correction inactivation

Gene conversion

Homologous Recombination Non-Homologous


End Joining
(NHEJ)

November 2010 19
2 - Engineered meganucleases

November 2010
The combinatorial approach
Omegabase (proprietary database)
Evolution over time

Ø
Targetable DNA sequence •Hit frequency: 1/350 bp; success rate ≥ 40%
= •Hit frequency: 1/100 bp; success rate ≥ 25%
patchwork of cleavable sequence •Timeline: 10 weeks-9 month depending on
difficulty (deliverable: meganuclease
characterized in a cell-based assay), possible
Arnould et al. (2006) J. Mol. Biol. further refinement for therapeutic grade
Smith et al. (2006) Nucleic Acids Res.
Arnould et al. (2007) J. Mol. Biol. •Production capacity: 100 last year (100
Grizot et al. (2009) Nucleic Acids Res. different targets)

November 2010 21
Improving meganuclease features: expanding number of potential targets

Definition of a new DNA region for which the I-CreI specificity can be modified

Such a meganuclease could hit


virtually any 22bp DNA sequence

-11 -10 -9 -8 -7 -6 -5 -4 -3 -2 -1

5’ C A A A A C G T C G T A C G A C G T T T T G 3’
3’ G T T T T G C A G C A T G C T G C A A A A C 5’
Target DNA sequence diversity up to 18/22bp

I-CreI CAAAACGTCGTACGACGTTTTG

Examples of
CTTGGACTCATAAGAGTCCAAG
14 / 22 mismatches
new cleaved targets CTGGCACCCGTACGGGTGCCAG

November 2010 22
Improving meganuclease specificity

Example of the SH4 meganuclease


 presents an intermediate toxicity profile
Ø
Based on specificity profiles, replacement of individual modules

Toxicity in cell survival assay Activity at the endogenous locus


0,6

0,5
Cell survival (%)

160
% In / Del
140 0,4
120 SH4 0,3
100 SH4new
80 I - SceI 0,2
60 I - CreI
0,1
40
20 0
0 SH4 SH4new SH4 SH4new
0 5 10 15 20 25 toxic non toxic toxic non toxic
Transfected DNA ( ng )
3 days 7 days

No impact of toxicity Toxicity has a long term impact

November 2010 23
Creating new scaffolds
Domains shuffling

I-CreI
I-MsoI
I-DmoI
I-AniI
…bI3
PI -SceI
I-SceI
I-CeuI
I-ChuI

Hybrid meganuclease

-Active hybrid meganucleases can be obtained


Example: DmoCre
Chevalier et al. (2002) Mol. Cell
Epinat et al. (2003) Nucleic Acids Res.
November 2010 24
3 - Characterizing the activity of
engineered meganucleases

November 2010
EXTRA-CHROMOSOMAL MUTAGENESIS GENE INSERTION TOXICITY
2kb 1.2kb
ACTIVITY Cell survival assay
No DNA matrix
1.7 Kb

SSA , CHO - K1 PCR amplification 10cells/well FACS analysis


β-Gal activity rescue on 293H cell population (293H w/o selection) (GFP+ CHO-K1 cells)

PCR Screen

- + 1 2 3 4 5 6

454 sequencing technology 140

120

Cell survival %age


100

80

60

40

20

0
0 10 20 30 40
DNA qty (ng)

November 2010 26
Meganuclease-induced HR at endogenous locus
Example of the RAG1 gene
•involved in immunoglobulin and T-cell receptor RAG1
recombination
•mutations cause Omenn syndrome, an autosomal 5’ 3’

recessice form of SCID HindIII

In vitro cleavage 5’ 3’
10 - 1700bp

Cloning into
96 well
plates
or 10
cells/well
PCR analysis
6 - 8 % of gene targeting
observed
Amplification and Southern Blot
(> 550 clones analyzed )
HEK293
analysis
PCR + clones MW

WT
5kb
4kb
3kb Targeted

November 2010 27
The NHEJ and HR at a same locus have correlated frequencies

MN InDel % RH Freq.
Transfection
293H cells WAS5 1.0 11.4

DMD21 1.4 ² 8.7¹

RAG1 1.5² 8.1

SH1 1.1 5

SH2 0.6 1.2

IL2RG3 0.2 1.08


I
gDNA extraction (day 5-7) MN11 0.2 0.9

DMD31 0.2 0.6

PCR MN5 0.5 0.6


Gene MN6 0.4 0.5
mutation
(NHEJ) Deep sequencing DMD33 0.1 0.09
(individual molecules )
KI frequencies normalized to plating efficiency (30%)

¹ Up to 20 % with other experimental


design
² 6 % in clonal analysis
November 2010 28
Improvement of MNs efficacy in vivo (I)
Mutations within this gene cause Xeroderma pigmentosa characterized by increased
sensitivity to ultraviolet (UV) irradiation and risk of skin cancer, resulting from a defect in
DNA repair
met met
XPC target T C G A G A T G T C A C A C A G A G G T A C G A
Two CpGs 100% methylated in 293 cells

XPC4 target: CAPNS1 target:


(2 methylated CpG) (3 unmethylated CpGs)
8 7
7 6
6
5

InDel (%)
5
4
4
3 3

2 2
1 1
0 0
- - XPC4 XPC4 XPC4 Meganuclease CAPNS1 CAPNS1

0 1 0 0,2 1 5azadC (µM) 0 0,2


100 ~40 100 ~60 ~60 Methylation (%) NA NA
November 2010 29
Improvement of MN-induced HR in vivo
Two approaches:
siRNA Small compounds
gene identification target unknown
difficult to deliver easy to deliver

•19000 genes screened with 2 siRNA per gene •18000 compounds screened
•290 genes identified whose down regulation led •100 compounds identified which stimulate
to gene targeting stimulation gene targeting
•66 genes validated with secondary screening •2 compounds confirmed on secondary screening

Impact of siRNA on the GT efficiency Recognition EGFP


at 6the endogenous RAG1 locus . site
of KI frequency vs control

5
EGFP EGFP
4 meganuclease
Fold increase

3 FACS analysis
2 4.3% 8%
1

0
AS EP300 ATF7IP No compound Active compound
siRNA 33nM
November 2010 30
Improvement of MN-induced mutagenesis in vivo

Strategy: selected siRNA targeting genes involved in DNA repair

Meganuclease - induced mutagenesis at RAG endogenous locus


with selected siRNA

2,5
% age of mutagenesis at RAG1 locus

1,5

0,5

0
control Gene 1 Gene 2 Gene 3 Gene 4 Gene 5 Gene 6
siRNA 1nM

November 2010 31
Conclusions

Using a combinatorial approach, it is possible to engineer


meganucleases with tailored specificities

Based on the growth of the Omegabase, it is possible today


to engineer meganucleases for virtually any gene

The activity of a meganuclease is not the sole factor


governing efficacy at the endogenous locus

We are developing new tools to improve meganuclease-


induced HR or mutagenesis.

November 2010 32
Research Tools

Christophe Delenda
CSO of Cellectis bioresearch

33
Different Types of Research Tools

§
§CBR research tools and products for in cellulo
applications :
•Products already commercialized in secondary cell
lines
•Next demonstrations to come (2011) with primary
cells


•A CBR parallel objective would be to design in vitro
research tools :
•Meganucleases as restriction enzymes (2012?)

November 2010 34
Different Types of Genome Modifications

Different types of genome customization via meganuclease-driven expression

§ Applications
§Gene targeted integration (knock- Over -
in) expression
Drug discovery
•shRNA targeted integration (knock- Modulation of Gene function
down) expression
Protein

•Gene deletion or disruption (knock- production
out) Absence of
expression

November 2010 35
Meganuclease-Driven Gene Knock-In

Meganucleases for DNA


target site cutters

Double-strand DNA break


induction

A DNA repair matrix


containing the GOI to be
integrated is used as
template for homologous
recombination
GOI : gene of
interest
November 2010 36
Two Approaches for Site-Directed Gene Knock-In

cGPS ® : cellular Two lines of kits


Genome
Positioning
System

2 3 2 3

Pre - engineered cell lines Any cells from a same species


Pre-insertion of a landing pad containing Endogenous site recognized by a
a natural meganuclease site meganuclease with modified specificity

November 2010 37
Example of a cGPS®-Related Product – cGPS® CHO-K1 (1)

1
2
cGPS® CHO-K1 Cell Line LacZ Control Integration Matrix
200 000 cells / 10cm dish

Co-transfection
2 3

D+1 Selection 1
G418 (Neo)

Selection 2 1 + 3 1 + 2 1 + 2 + 3
D+8 G418 + Puro
Without Integration Without Meganuclease
Matrix Expression Vector

D+13 Picking
(96-well plate)

üFast and effortless protocol


D+24 üHigh selection frequency (~1x10-3 )

NeoR PuroR cell clones


~ 200 generated

November 2010 38
Example of a cGPS®-Related Product – cGPS® CHO-K1 (2)

Genetic pattern of targeted ( vs untargeted ) cell clones


Determined by using a dedicated radioactive probe (Southern blotting
analysis)
x
tri
Ma

1
n

-K
io

HO
Targeted LacZ+ cell clones at
gr

C
1
.1

-K
10 e

PS
t

O
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 π In

cG
CH
> 10 kb
Random insertions
Targeted integration

üVery efficient site-directed gene knock-in (> 95%)


üWith minor associated random integrations (<10%)

November 2010 39
Example of a cGPS®-Related Product – cGPS® CHO-K1 (3)
Transgene expression pattern of targeted cell clones
Determined by reporter protein expression (LacZ, luciferase)

With selection Without selection


10000 10000

1000 1000

n
u
gene model

n
u

it
it

100 100

L
c
a
z
L
c
a
LacZ

10 10

R
R

tiv
la
e
tiv
la
e

1
0 10 20 30 40 50 0 10 20 30
Passages Passages

10000 10000

1000 1000
gene model
Luciferase

100 100

10 10

n
u
L
c
tivR
la
e
n
u
L
c
tivR
la
e

1 1
0 10 20 30 40 50 0 10 20 30
Passages Passages

Homegeneity and stability of expression over time


(with and without selection drugs)

November 2010 40
Knock-In Systems (kits)
cGPS ® systems
cGPS ® CHO - K1 Hamster cell lines
cGPS ® CHO - S Cemax
cGPS ® HEK - 293 Human cell line

cGPS ® Custom systems


cGPS ® Custom CHO - K1 (HPRT locus)
cGPS ® Custom HEK - 293 (RAG1 locus)
cGPS ® Custom Human (RAG1 locus)
cGPS® Custom HCT116 (RAG1 locus)
cGPS® Custom Jurkat (RAG1 locus)
cGPS® Custom U2OS (RAG1 locus)
cGPS® Custom K562 (RAG1 locus) New human cell lines
cGPS Custom MRC5 (RAG1 locus)
®
cGPS® Custom HEK-293 (DMD locus)
cGPS® Custom HCT116 (DMD locus)
cGPS® Custom Jurkat (DMD locus) New meganuclease target site
for human cell lines

cGPS ® Duo systems Each system is sold with a


dedicated and adequate
cGPS ® CHO - K1 Duo (cGPS® & HPRT & loci) protocol (i.e. User Manual)
cGPS ® HEK - 293 Duo (cGPS® & RAG1 loci)
cGPS® HEK-293 Custom Duo (RAG1 & DMD loci)
November 2010 41
pIM and Mega Stores

üIntegration matrices also sold separately with adequate “goodies”


for various applications (i.e. markets);
pIM STORE ü
Integration üTwo integration matrices per cGPS® knock-in system , i.e. one for the
matrices cloning of the gene of interest and the other encoding a reporter
gene (for control of integration);

üNecessary reload products for cGPS®-related kits;


ü
üMeganuclease vectors also sold separately for specific gene knock-
MEGA STORE out applications, such as GS (Lonza’s service project)
Meganuclease ü
vectors üOther engineered meganucleases for enlarging their usage to other
model organisms, such as mouse, rat, fishes (medaka, zebrafish),
xenopus, worm, drosophila…

November 2010 42
Current Clients

Kits and sub - products ( pIM & Service


MEGA )
Industrial Knock - out
Servier, Galapagos, Novartis, New England Lonza
Biolabs, Actelion, Biogen Idec, Boehringer
Ingelheim, Abbott, KTH, Euromedex, Oncomed, Knock - in
CSIR Biosciences, SuperGen, GSK Canada, Servier, Xention Pharmaceuticals,
Xention Pharmaceuticals Cytoo
Academic
Mount Sinai School of Medecine, University
of Minnesota, Memorial Sloan-Kettering
Cancer Center

Others via distributors


Tebu Bio (Europe), Wako Chemicals (Japan),
Cedarlane (Canada)

November 2010 43
Genome Engineering in Plants

Dan Voytas
CSO of Cellectis plant sciences

44
The challenge of feeding the world population

Arable land required to sustain a Western diet for one year

November 2010 45
The challenge of feeding the world population

Arable land currently available per person globally

November 2010 46
The challenge of feeding the world population

Arable land available per person globally in the year 2050

November 2010 47
The challenge of feeding the world population

Source: Nature 2010. 466:546


November 2010 48
Important Contributors to Modern Agricultural Productivity

Use of Plant Hybrids

Green Revolution

Transgenesis

November 2010 49
Important Contributors to Modern Agricultural Productivity

Use of Plant Hybrids

Green Revolution

Transgenesis

Genome Engineering

Genetic variability enables crop improvement


November 2010 50
Historical Corn Yields in the United States

Transgenics
Single-Cross
Hybrids

Double-Cross
Open- Hybrids
Pollinated

Source: USDA

November 2010 51
Genome Engineering is now possible in plants

§
•Cellectis’ technology enables precise modification of plant
genomes at high efficiency
•Genomic information is now available for numerous plant
species providing many target genes for modification
•New crop varieties can be developed by first selecting the
desired trait and then implementing the trait through
genome engineering

November 2010 52
Mission of Cellectis plant sciences

§
•Optimize methods for genome engineering of plant cells
•Provide technical support to Cellectis’ licensees to
expedite implementation of the technology
•Establish commercial relationships as outsourced R&D or
risk-shared collaboration
•Develop proprietary traits

November 2010 53
Proof of activity of QMAPs in Arabidopsis

16 29 23
34 4 18 22
Chr. I
29205 kb
7
1 20
10 9 24
Chr. II
17463 kb
31 39 36
15
28 25 13 12

Chr. III
23560 kb
27
14 33 6 3
Chr. IV
22140 kb
11
32 38 19 2
40 26 30 8 35 37 21 5 17
Chr. V
26170 kb

Hits in exons of known coding regions Hits in introns of known coding regions Hits within non-coding regions
Hits in exons of undefined coding regions Hits in introns of undefined coding regions Centromere

November 2010 54
Testing meganucleases in Arabidopsis
Generating Germinal mutations

Introduce
meganuclease
into plant Analyze
genomic DNA
for
meganuclease
activity

Induce expression of
meganuclease in
seedlings

November 2010 55
Mutations induced by Arabidopsis QMAPs
Transformation of Mnase

1% mutagenesis frequency has been


MNase induction achieved by Arabidopsis QMAPs.

Genomic DNA prep on


Pooled samples

PCR

Deep sequencing to
estimate frequency

November 2010 56
Mission of Cellectis plant sciences

§
•Optimize methods for genome engineering of plant cells
•Provide technical support to Cellectis’ licensees to
expedite implementation of the technology
•Establish commercial relationships as outsourced R&D or
risk-shared collaboration
•Develop proprietary traits

November 2010 57
Principal Partnerships

Upstrea Research Production


m Tools Tools Agrobiotech Therapeutics
Researc
h

Harvard Institute
of Medicine

November 2010 58
Mission of Cellectis plant sciences

§
•Optimize methods for genome engineering of plant cells
•Provide technical support to Cellectis’ licensees to
expedite implementation of the technology
•Establish commercial relationships as outsourced R&D or
risk-shared collaboration
•Develop proprietary traits

November 2010 59
What’s new?

Genome engineering can create crops with valuable traits without


adding foreign DNA
Herbicide Tolerance

Addition of
Traditional bacterial gene
Transgenesis

Targeted
Genome modification of
Engineerin native plant gene
g

November 2010 60
Herbicide tolerance created through genome engineering

Plants with
Unmodified Plants Engineered Genomes

Both groups of plants exposed to herbicide

November 2010 61
Meganucleases for Therapeutic Programs

Carole Desseaux
Head of Preclinical and Clinical Programs

62
Cellectis genome surgery - Overview

Gene therapy recently marked successful milestones:


§
§Gene therapy trials have dramatically improved the vision of patients who
suffer from Leber congenital amaurosis, an hereditary blindness.

•Marked clinical improvements in young children with Wiskott-Aldrich
syndrome, a very rare but severe immunodeficiency disorder

•Gene therapy could remedy Parkinson's disease: significant improvements in
motor behaviour of monkeys after two weeks, without any visible adverse
effects

•Gene therapy corrects adrenoleucodystrophy in two children


Our mission is to establish genome surgery as
a standard in the therapeutic field

November 2010 63
Cellectis genome surgery’s Mission Statement

Cellectis genome surgery is dedicated to the development of


new approaches using meganucleases
Gene correction Gene insertion « safe harbor » Virus clipping

target site

degradation

« cleanest » approach Versatile


Limited by the length of Properties of locus to be sequence removal
conversion tracts assessed
Ø Ø

November 2010 64
Gene Correction and Safe Harbor Approach

November 2010 65
The antiviral approach

HIV HSV HBV


Latent
infection
RT (circular viral
DNA)

In
t

Viral genomic RNA is Viral DNA enters the


reverse transcribed in nucleous and
the cytoplasm and the Productive infection transcription starts
resulting dsDNA is (linear viral DNA) after circularization of
integrated into the host the DNA genome
DNA

November 2010 66
Therapeutics R&D

November 2010 67
The Therapeutic Development Group

Founded in 2008
20 employees including 10PhDs

•Cell Proof of Concept


•Animal Proof of Concept
•Vectorization studies
•Validation of optimised leads and final vectors
•Validation of model/methods •Non clinical studies
(pharmacology, toxicology, …)
•Clinical studies
•Drug Manufacturing
•Regulatory strategy

November 2010 68
Strategy

§
§Develop new treatment approaches for current unmet clinical needs
§
•Establish key partnerships with « best-in-class » academic labs and industry

•Identify unsuitable therapeutic candidates and stop expensive development
programmes

•Strongly evaluate and share the risks associated with development (ie
regulatory strategy, clinical and manufacturing feasibility, therapy cost, …)

November 2010 69
Research Field
In-house Collaboration
•Safe harbor •Gene correction

Homologous recombination in T cell Pr Notarangelo (Rag1)


Homologous recombination in Hematopietic Stem Cell Pr Fischer (IL2RG, Artemis)
•Vectorisation Dr Sadelain (HBB)
Protein manufacturing set up Dr Tremblay, Dickson, Voit (DMD)
Cell penetrating peptides (DPV, Vectocell technology) Dr Sarasin (XPC)
Electroporation (Cytopulse technology) Pr Thrasher (WAS)
Mouse and cell lines testing models Pr Scharenberg (CCR5, canine XSCID)
•Safe harbor

Pr VandenDriessche (Haemophilia A et B)
Pr Naldini (SH)
Pr Bueren/Segovia (Fanconi Anemia / PKLR)
Pr Danos (SH + vectorisation)

•Antiviral
HSV & HIV : Projet ACTIVE (Pr Labetoule et Dr Gabison, Pr Wain-Hobson)
HBV : Pr Zoulim

November 2010 70
Research Field
In-house Collaboration
•Safe harbor •Gene correction

Homologous recombination in T cell Pr Notarangelo (Rag1)


Homologous recombination in Hematopietic Stem Cell Pr Fischer (IL2RG, Artemis)
•Vectorisation Dr Sadelain (HBB)
Protein manufacturing set up Dr Tremblay, Dickson, Voit (DMD)
Cell penetrating peptides (DPV, Vectocell technology) Dr Sarasin (XPC)
Electroporation (Cytopulse technology) Pr Thrasher (WAS)
Mouse and cell lines testing models Pr Scharenberg (CCR5, canine XSCID)
•Safe harbor

Pr VandenDriessche (Haemophilia A et B)
Pr Naldini (SH)
Pr Bueren/Segovia (Fanconi Anemia / PKLR)
Pr Danos (SH + vectorisation)

•Antiviral
HSV & HIV : Projet ACTIVE (Pr Labetoule et Dr Gabison, Pr Wain-Hobson)
HBV : Pr Zoulim

November 2010 71
Safe Harbor Meganucleases and
Blood Cells: ex vivo Approach

November 2010 72
The Safe Harbor Approach

1 - Identify a meganuclease that targets a locus defined as safe with a


high specificity and activity

EXTRA - CHROMOSOMAL TOXICITY MUTAGENESIS GENE INSERTION


2kb 1.2kb
ACTIVITY Cell survival assay No DNA matrix 1.7 Kb
CHO - K1
293H
SSA , CHO - K1 PCR amplification
β-Gal activity rescue 140 on 293H cell population
Cell survival %age

120 PCR Screen


100

80

60

40

20

0
0 10 20 30 40 50 60
DNA qty (ng)

hADCY9 hCTSZ hSMC5 454 sequencing


SC_Rag I-Cre D75 technology contro
ls

- +
-

November 2010 73
The Safe Harbor Approach

2 – Vectorize the meganuclease to the cell of interest via prorpietary


electroporation system

The pulsed electric fields


transiently permeabilizes
living cells for delivery of
material into cells

Need to establish the


conditions necessary to have
a good transfection efficiency,
expression level and viability
of electroporated cells
(ongoing).

November 2010 74
The Safe Harbor Approach

3 – Confirm expression of « gene of interest » at the locus and


establish the proof of concept of efficacy and safety in partnership
with worldwide experts: example of hemophilia

Advantages of Hemophilia:

Meganuclease SH •The protein is secreted (several


+ tissues can be targeted)
FIX •1% of normal level of expression
Matrix with Gene of Interest
+ is sufficient to obtain a therapeutic
F
I
gain
X
S
H
FIX
Cell of Interest (CD34+)
FIX
FIX

November 2010 75
The Safe Harbor Approach

MN mutagenesis Recombination

WAS5 0,9 11,4


DMD21** 1,4 8,7 To date, acceptable percentage of mutagenesis
RAG1 * 1,5 8,1
SH 0,6 1,2 Good transfection efficiency with acceptable viability
IL2RG3 0,2 1,08 in electroporation assay. Expression of the marker
MN20 0,1 0,99 gene.
MN11 0,2 0,9
DMD31 0,2 0,6 Preliminary results of recombination in CD34+
MN5 0,5 0,6
MN6 0,4 0,5
DMD33 0,1 0,09
frequencies normalized to plating efficiency (30%)

The strategy will be used for different pathologies by changing

•Matrix of interest (ie Fanconi or sickle cell anemia)


•Cell of interest (ie T cell for adaptative cancer therapy)
•Meganuclease (antiviral meganuclease for preventing infection)

November 2010 76
Meganucleases and Antiviral ex
vivo Approach: Example of HSV

November 2010 77
The Antiviral Approach

The ultimate goal of our project is to prevent graft failure due to reinfection by
HSV1 (herpetic keratitis) by ex vivo treatment of donor cornea graft

Current antiviral agents do not


destroy viruses but only prevent
population growth

üNo effect on latent viruses


ü
üNeed of chronic antiviral therapy

November 2010 78
Anti-HSV Approach
24h 48 / 120h
Transfection COS-7 cells Infection rHSV
with meganuclease plasmid ( MOI 10-3 ) X - gal staining (0,5%)
(Approx. 0.2 x 106 cells) T0 after 1h infection at (Blue plaque number)
37°C
 Fresh medium
Empty vector HSV1m2 HSV1m4

T48 I-SceI Rag1m I-CreI

Empty vector HSV1m2 HSV1m4

T120 I-SceI Rag1m I-CreI


Prevention of replication by HSV2
and HSV4

November 2010 79
Anti-HSV Approach

§
§ex-vivo PoC (rabbit cornea)
Up to 50% of protection against HSV (number and size
lysis) versus infected cornea without meganuclease pre-
treatment
§
•ex-vivo PoC (human cornea) – next steps

•The ex vivo antiviral meganuclease pre-treatment approach
could be developed for any organ/cells to be grafted in
order to reduce deleterious effects of viral reactivation
after transplantation

• Whole cornea transduced by a rAAV-GFP coding
vector.
Observation in confocal microscopy

November 2010 80
Conclusion
§
§Meganucleases engineering allows the development of new potential therapeutic
approaches by genome surgery
§
•Innovative approaches in gene therapy field

•2 types of indications are developed by Cellectis genome surgery
•Antiviral : A new class of antiviral agents, viral genome cleavage (ex: HIV)
•Inherited monogenic diseases : Gene correction by HR, insertion in a safe locus (ex:
sickle cell anemia)


• Many research programs are conducted in collaboration with
•academic teams and biotechnology companies in Europe and in the US

November 2010 81
An Example of Collaboration

Serge Braun
Chief Scientific Officer
Association Française contre les Myopathies

82
Perspectives - Potential Applications of iPS
Cell Technologies

David Sourdive
Executive VP, Corporate Development

83
Pluripotent stem cells

Potency and indefinite replication

ES EG EC

November 2010 84
Embryonic stem cells were the first source of pluripotent stem cells

Advantages:
üindefinite self-replication
ücan give rise to any cell type (whole organism)
ü
ü
Drawbacks:
ürequires embryonic cells
üvery limited choice of genotype
ügenotype not from a whole organism with known features and
phenotype
üdifferentiation may be difficult, irreproducible, incomplete, etc.
ünot industrial

November 2010 85
Induced pluripotent stem cells
Making pluripotent stem cells directly from adult cells
ü Sox2

Oct4 yc
C-m
Klf
4

Skin (or other


adult) cell
Shinya Yamanaka :
Pluripotent cells 2006; 2007
Can be differentiated into any
cell type

ES EG EC iPS

November 2010 86
Induced pluripotent stem cells: breakthrough

Advantages:
üindefinite self-replication
ücan give rise to any cell type (whole organism)
übroad choice of genotypes
ücan be derived from a whole organism with known phenotype

Drawbacks:
üuses random viral transgenesis of oncogenes
ürecent technology with many features remaining to establish
üdifferentiation may be difficult, irreproducible, incomplete, subject
to epigenetic memory etc.
ünot (yet) industrial
ü
ü
ü

November 2010 87
Meganucleases induce high levels of recombination in iPS cells

Lt Homology SV40 NEO IRES MYC Rt Homology

RAG1
2.6 kb

Lt Homology Rt Homology

4.4 kb

Lt Homology SV40 NEO IRES MYC Rt Homology

3.3 kb

RAG1

Actin B
Repair RHE + RHE + Repair RHE + RHE +
Matrix Matrix
Repair Empty Repair Empty
Matrix Vector Matrix Vector

November 2010
Meganucleases induce high levels of recombination in iPS cells

RAG1

Relative expression (fold increase)


Actin B
Repair RHE + RHE +
Matrix
Repair Empty
Matrix Vector

RT-PCR

Repair RHE + RHE +


Matrix
Repair Empty
Matrix Vector

November 2010 89
Bringing robustness to industrialize induced pluripotent stem cells

Sox2

Oct4 yc
C-m
Klf
4

Skin (or other


adult) cell

Pluripotent cells
Can be differentiated into any
Cell type

ES EG EC iPS

November 2010 90
Rationale

•Focus on industrialization of iPS (reprogrammation, culture,


differentiation, etc.)
• Goals :

• Making iPS safe (targeting dangerous genes, putting safety “devices”, etc.)

• Making iPS robust (reproducible differentiation, more “adult” phenotypes,
highly enriched (pure) cell populations, etc.)

Turning cells into assay devices

•Use genome engineering (like was successfully used to industrialize cell lines)

Targeted Medicine Regenerative Medicine

iPS used as tools for research and iPS used as sources of grafts
industry
November 2010
Strategy: robust combination of genotype and phenotype

Subjects/patients
Choice of genotypes
Samples

Somatic
cells

iPS
Genome engineering
Reproducible and robust
processing
Differentiation
Choice of phenotypes

Single cell type with


many genotypes

in vitro models Source of grafts

November 2010
CellMill: a large iPS cells biobank

5 Collecti
5
5 on
5 center

5 Collecti
5
5 on
5
center

5 Collecti
5
5 on
5
center

5 Collecti
5
5 on
5 iPS cell bank with Differentiated
center
104 to 105 entries engineered
(i.e. iPS + phenotype) cells/tissues from
Patients and multiple donors
siblings cohorts

November 2010 93
Reduce attrition and allow targeted medicine
Develop industrial in vitro tools predicting human physiology, pathology and genetic diversity
Meet a strong industrial demand : better cell-based assays
-
Reduce attrition and development costs
- Allow targeting drugs towards responders
ü Today, 10% to 20% of drugs entering clinical development reach the market
ü The most expensive failures come late, when the drug is confronted to human genetic diversity.

10
000
molecules

250 1
5
Commercialization
IND Filing for market
Preclinical Phase I Phase II Phase III Phase IV
n500 to thousands
n20-100 patients n100-500 patients
nCell culture animal patients nPharmacovigilance
nFailure: 80-90% nFailure: 60% …
nCost: 30% nFailure: 80-90% nCost: 10-15%
nCost: 10% nCost: 10-15%
nCost: 30-35%

~2 years 1-2 years 2-3 years 3-5 years


10-12 years

SSRIs ( anti - depress .)


statins
( cholesterol ) Inhib . ACE
( Hypertension )
ß - blockers
ß2 - agonists ( cardio )
( asthae ) Responders
0% 20% 40% 60% 80% 100%
November 2010 94
Haplobank: a GMP biobank of haplotypically homozygous iPS cell lines
Differentiated engineered
cells/tissues of chosen
5
55 types and origins
5

5
55
5 5
55

5
55
5 5
5
5
5
55
5 Known sub-population GMP iPS bank with
of triple HLA-A B and DR (i.e. iPS + phenotype)
homozygotes
(1015 people)

Existing French
registry of volunteers
for bone marrow donation
( 1 . 7 x 10 5 people )

November 2010 95
Conclusion

§Induced pluripotent stem cells unleash the potential of stem cells


§
§Meganucleases to leverage the opportunity lying in iPS cells:
üProviding control over their behavior
üMaking them robust
üMaking them safe

§Focus on industrialization
§
§Target two main fields
üTools for research and industry, representative of human physiology,
pathology and genetic diversity
üTools for regenerative medicine: source of cells compatible with clinical
applications

November 2010
Structure and partnerships

Dedicated subsidiary for the project

Key partners and collaborations


§Expertise in iPS and stem cells
§
§

§Strategic intellectual property


§Commercial license to iPS technology for tools
§Commercial license to iPS technology for therapeutic applications
(first world wide)

§Other key players to come …


§
November 2010
§
Thank you

Parc Biocitech
102, Avenue Gaston Roussel
93230 Romainville
France

http://www.cellectis.com
Alternext : ALCLS . PA investors@cellectis.com

Tel: +33 (0) 1 41 83 99 00


Fax: + 33 (0) 1 41 83 99 03

November 2010