Hope in the Pipeline: New Molecular Tools for Recognizing TB

Evolution of TB diagnostics in the public sector

Fundamental diagnostic: 1882

Fundamental diagnostic: 2007

3 - 9 months

DOTS EXPANSION HAS NOT RESULTED IN BETTER CASE DETECTION RATES
No of countries implementing DOTS
250 100 90 200

Total number of countries

80 70

Global case notification rate (All forms of TB)

150

60 50

100

40 30

50

20 10

0 1990 1991 1992 1993 1994 1995 1996 1997 1998 1999 2000

0

Global CNR Countries

Year

Source: WHO Report 2003: Global Tuberculosis Control: surveillance, planning, financing. WHO, 2003.

1 40 0 0 00 1 20 0 0 00 1 00 0 0 00 80 0 0 00 60 0 0 00 40 0 0 00 20 0 0 00 0

Microscopy and case detection in Peru

1 9 91 19 9 2 1 99 3 1 9 9 4 1 99 5 1 9 9 6 19 9 9
S m e a rs e xa m ine d S m e a r-po s itive c a s e s

WHO/TDR 2001

The slow road to microscopy diagnosis of TB
Implement molecular test with sensitivity similar to culture

AFB/ml

Abbreviating delay through better sensitivity or better access

Implement dipstick with sensitivity equal to microscopy
10,000,000 AFB/ml

Implement molecular test with sensitivity similar to culture

AFB/ml

Where delay contributes greatest to morbidity, mortality, transmission

Smear-positive patients are those most contagious
Amerindian Sputum Status of source case Intimate Positive Smear 44.7 Pos. Cx only Negative Cx 27.7 25.7 Casual 37.4 15.6 18.7 Causasian Intimate Casual 34.7 8.9 7.2 10.1 2.4 3.3

Grzybowski, et al. Bull Int Un Tuberc 1975;50:90

Cumulative TB mortality in Sanitorium patients

s ar-po Sme

ie e p at itiv

nts

atients negative p Smear-

yil a r o M t t

1

2

3 Years

4

5

6

7

Annual TB Deaths
5 4 3

Current tools inadequate to avert this.

Deaths in millions

2 1 0 1850

1900 “First” Epidemic 2000 The 1950

2050

Europe and Americas

The “Second” Epidemic Asia + Africa

Discovery of TB Bacillus 1882

Sanatoria Movement Starts 1900

Discovery of First TB Drug 1945

WHO Declares Global Emergency 1993

Adapred from: Pilheu Int J Tuberc Lung Dis 2:696

Windows of opportunity in public health

Smallpox vaccinated HIV-infected individual. Eradication of virus just prior to HIV pandemic.

TB notification in Zambia, 1974 - 1999
50000 45000 40000 35000 30000 25000 20000 15000 10000 5000 0 1974 1976 1978 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998

•incidence in Lusaka >900/100,000 •Disproportionate increase in smear-negative disease •<20% notified pulmonary TB pts are smear-pos

US MDR outbreaks in 1990-1992 in Florida, New York, and New Jersey

T B case fatality rates: Africa HIV+ = 3.5 x HIV45 40 35 30 CFR (%) 25 20 15 10 5 0 ZAM BFA TAN KEN MAL MAL DRC DRC CAR CDI SAF SAF SAF a ll form s sm e a r-positive HIV+ HIV-

source: Ya Diul 2000

country

Tugela Ferry DST Survey: 1/05-3-06

1539 specimens 995 (65%) Cx 323 (59%) DS

544 (35%) Cx+ 221(41%) MDRTB

53 XDR-TB

FIND board Feb 2004
Tests that revolutionize patient care or disease control
• POC smear replacement • POC culture replacement • 2-day high-TP sensitive lab test for case detection +/DST for urban centers

Tests that are significant incremental improvements over existing tools
• Improved microscopy • Simplified or speeded culture
POSITIVE

• 2-day lab-free culture replacement • Specific predictor of progression from LTBI

• Simplified or speeded DST

NEGATIVE

2004

2005

2006

2007

2008

2009

Level of technology

District Laboratory
“faster than culture”
Current diagnostic service Solid culture – 30d

Portion of population served

Peripheral Lab
Increased access, earlier detection
“more sensitive than smear” Current diagnostic service Microscopy – 60% sensitive

Clinic (true POC)
Reaching new patients “simpler than microscopy” Current diagnostic service None

Increased delay, morbidity, cost

30%

Referral for 3.8b people in 22 HBC 325

1500 Reference center District hospital 27,000 Microscopy center Health post

270,000

1,52m?

Strength of health system

Addressing equity: Making EME standard accessible in DEC

•Price negotiations on MGIT •Licensing agreement for MPT64 •Development for lower cost version •Large demonstration projects (>100,000 pts) •Customer support plan

Rifampin resistance

Mutations map to a single “core region” of the rpoB gene Accounts for ~ 95% of clinical rifampin-resistance.

rpoB

Deletion Deletion Deletion AATTCATGG GACCAG GAACAA Deletion CCATTC Deletion GGCACC Deletion CAGAAC Del AAC

Insertion Insertion TTCATG TTC

GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTG TCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCTG

507

* ** ** *** * *** * ** *

* *

81 base pair core region

*** *** **

*** * * 533 *

Adapted from: Musser. 1995. Clin. Microbiol. Rev. 8:496.

Steps in Hain test for molecular MDR screening with PCR and line probe hybridization
Process specimen, extract DNA, amplify DNA targets with PCR Hybridize amplified DNA to oligonucleotide probes on strips

Addressing MDR crisis: Proving PCR and line-probe hybridization in HBCs
May 2004 Peru study of 5 methods

Addressing MDR crisis: Proving PCR and line-probe hybridization in HBCs

Automated solution: Cepheid

rpoB Molecular Beacon Assay

Molecular Beacon

Target Hybrid

Inactivation procedure

Overall performance: per patient analysis

UPCH, Peru %

Sensitivity & specificity of a single, direct Xpert; 1462 patients

36

Decentralization of molecular diagnostics
1st generation MDR

Le s

sc

om p

lex ity ,

2nd generation automated MDR

mo

ob us 1st generation tne manual detection ss
2nd generation manual detection

re r

LPA 2008

Xpert 2010

LAMP 2011

POC test 2015
37

• Closed system • Isothermal • Rapid • Multiprimer • Visible readout

Basic principle of the LAMP method
- Starting structure producing step F3c F2c F1c Target DNA F3 F2 F1 B1c B2c B3c B1 B2 B3 5’ 3’

(4)
3’ 5’

3’ 5’

F3c F2c F1c F3 F2 F1

B1

B2

B3

5’ 3’

B1c B2c B3c

65℃ (1)
3’ F3c F1c 5’ F2c F1c F2 FIP 3’ B1 B2 B3 5’

(5)
5’ F1c F2 F1 B1c B2c B3c 3’

DNA polymerase with strand displacement activity

(6)
B3 5’ 3’

F2

F1 F1c 5’ F2 F1

B1c B2c B3c

3’

(2) 3’
5’

F3c F2c F1c F1c F2 F1

B1 B1c B1

B2

(7) F1c
5’

B3 Primer 3’ B2 B1c 5’ BIP B1c B2c B3c 3’ B1 B2 B1 5’ B2 B1c B3 5’

B2c B3c B2 B3

3’ F1 F2c F1c

(3) 3’

F3c

F2c F1c F1

5’ 3’

(8)

F1c F2c F1 3’

F2 F3 Primer F1c 5’

B1c B2c B3c

Annealing position of Loop Primers
BIP Loop Primer B Loop Primer F

F
FIP

2F c 1 2 F 31 ’ 1 c

c 5

B B ’

1 1B c 2
Loop Primer B

B2c F2 B2 BIP

F F

Loop Primer F

F F 2F 5 1

1 ’ c

B 3 B’

1B B 1 B

c2 1

c 2BIP c
Loop Primer B Loop Primer B B2 B2 F2 B2c

Loop Primer F F2 FIP F2c

Loop Primer F

Improved analytic sensitivity of LAMP with new primers  
Old
60

New
60

50

50

40 Tt (min) Tt (min) 100cps 10cps 5cps 1cps

40

30

30

20

20

10

10

0

0 100cps 10cps 5cps 1cps

MTB gDNA /Tube

MTB gDNA /Tube

Detection using the real-time turbidimeter
SARS CoV RNA
Turbidity

Time (min)

Spiked sputum samples

Approved

MGIT

2007-8

Capilia Hain iLED

2009-11 2012-15

XpertTB LAMP Ag ? Ab ?

Situation in 2004
• No new TB tests in public sector for many years • No WHO approval mechanism • No dedicated laboratory strengthening initiative • No mechanism to link policy change to scaledup implementation • No DEC pricing mechanism for existing tools • No public sector platform for discovery and development of new TB tests

Situation in 2008
• Multiple new TB tests in public sector use • WHO approval mechanism established • Global laboratory initiative established/Maputo declaration • UNITAID, PEPFAR, GFATM funding scale-up • Negotiated pricing in place • Multiple discovery and development activities led or partnered with the public sector

Thank you

What action would primary care TB testing sponsor?
Immediate referral for initiation of treatment (high NPV)

Referral for further testing, syndromic management of negatives (high PPV)

Point of care testing
• Antigen detection
− Feasibility studies of Ag detection in sputum − Evaluations of commercial LAM − Development of new LAM reagents − MS characterization of LAM species in urine − Proteomic discovery from urine, sputum, blood − Feasibility studies of more sensitive POC platforms

• Antibody detection
− Screening entire proteome − Alternate expression systems − Peptide profiling

• Molecular testing
− Feasibility assessment of POC molecular − Feasibility studies of trans-renal DNA

• New approaches
− FIND RFA for POC 2008

• Volatiles detection
− Feasibility studies of eNose − VOC discovery projects

Detection options for POC testing

RNA signatures Protein signatures VOCs

Metabolites DNA in urine TB antigens Antibodies to TB

ks R i

Whole organism

DNA in sputum

Reward Reward

Sensitivity of selected antigens at >95% specificity level compared to healthy controls
Antigen TB9.7 CFP10:ESAT6* TB10.2 TB15.3 TB16.3 TB 51 TB51.7 aCry:MPT83 38 kDa Europe, HIV– (n=71) 35% 25% 21% 41% 55% 31% 57% 26% 19% Africa, HIV– (n=79) 79 % 64% 45% 75% 81% 76% 83% 83% 29% Africa, HIV+ (n=77) 91% 49% 48% 65% 88 % 48% 78% 58% 15%

Whole proteome screening of M. tuberculosis for diagnostic antigens

Down-selection of antigens for a TB serologic test
High density array with crude expression product 4000 proteins

1200 pts

Moderate density bead array with purified antigens 60 antigens 2500 pts Low-density quantitative glass slide array and ELISA 15-50 antigens 5000 pts Lateral flow qualitative assay <5 antigens

mBio Diagnostics (division of Precision Photonics): low-cost, multiplexed serodiagnostic

Antigen detection

Targets, Matrices

Detection platforms

Detection options for POC testing

Antigen detection: LAM in urine
Initial clinical data in Swedish and Ethiopian patients

P-of-P in experimentally infected mice
Densitogram

8000

6000

R = 0.85 P < 0.0001

4000

Sample 1
2000

0 0.1

1

10

100

LAM concentration (ng/ml)

FIND’s approach to AG/AB Rapid Detection

Do existing reagents work?
Suboptimal reagents

Improved reagents?

Better platform?

Novel antigens?

Suboptimal detection system Suboptimal antigen/antibody Partners A Partner B Partner C Partner D

LAM in urine

New AG/AB sets & cocktails LFI ± reader

AG/AB discovery

Proteins in urine

Proteins in blood

Proteins in sputum Small molecules in urine

Platform evaluations

TOAD ESE reader

Matrix sensor

Dual Path Platform

RAMP

Detection options for POC testing

POC molecular

Technology obstacles
•Xpert development •LAMP POC feasibility

Matrix obstacles
•Tr-DNA •Sputum processing research

Detection options for POC testing

zNose eNose DIMS

MS Cricetomys gambianus

Detection options for POC testing

Whole cell detection

Urease

β lactamase

NMR

Fluorescent detection of Mtb β -lactamase activity

Sign up to vote on this title
UsefulNot useful