Panax ginseng C. A.

Meyer
E EMetabolic Engineering of Ginsenoside Biosynthetic Pathway for the Enhanced Production of Oleanane-type Ginsenoside [Ro] in Panax ginseng C. A. Meyer

Metabolic Engineering of Ginsenoside Biosynthetic Pathway for the Enhanced Production of Oleanane-type Ginsenoside [Ro] in Panax ginseng C. With the exception of Ginsenoside Ro. all ginsenosides are the dammarane-type separated into panaxadiol and panaxatriol classes. Medicinal properties of Oleanane-type ginsenosides [Ro] Anti-platelet aggregation Fibrinolytic action Stimulation of phagocytic action Anti-hepatic activity Anti-inflammatory activity Anti-tumor activity Anti-oxidant activity . These ginsenosides are synthesized via Isoprenoid pathway. Meyer The main biologically active constituents in P. -amyrin synthase [AS] is the key enzyme involved in oleanane-type ginsenoside [Ro] biosynthesis. which is an oleanane-type triterpenoid. These are found only in the four-year-old roots. ginseng are the complex mixture of triterpene saponins known as Ginsenosides (Rx). A.

Isoprenoid Pathway .

Heterologous expression studies of  -amyrin synthase cDNA in E. coli BL21 DE3 pLys S vCloning of -amyrin synthase cDNA into pRSET A expression vector and subsequent transformation into E. coli BL21 DE3 pLys S vIPTG-induced expression of -amyrin synthase cDNA v vRecombinant -amyrin synthase purification using Ni-NTA columns vPolyclonal antibodies in rabbits vIn vitro -amyrin synthase assay vCrystallographic studies of recombinant -amyrin synthase .

5 .Standardisation of expression conditions UI 25oC 37oC M 1 2 3 4 5 6 7 8 9 10 1112 13 14 15 16 17 18 19 r 1h r 2h r r N 3h O/ 1h r 2h r 3h O/ N IPTG: 0.5mM O.D of Induction: 0.

5 IPTG: 0. coli BL21 [pRSET A ::  AS] – membrane fraction Ni-NTA purified  AS Marker o.0 mM Incubation: 1.25. coli BL21 [pRSET A ::  AS] – Soluble fraction IPTG induced E. Parameters Culture OD600 : 0.5. 2. 0.IPTG induced expression and Ni-NTA column purification of  AS SDS-PAGE 1 AS 87 kDa 2 3 4 5 6 kDa 116 66 45 35 25 2 Coomasie 3 4 5 6 kDa 116 66 45 35 25 Silver 6 5 AS 87 kDa Sample IPTG induced E. 0. coli BL21 [pRSET A] Uninduced E. 3 h or overnight Recovery of Ni-NTA eluted  AS – 850  g/ml Temperature: 25 or 37 oC .75 or 1. coli BL21 [pRSET A ::  AS] IPTG induced E.

coli BL21 DE3 pLys S (pRSET A-AS). the purified recombinant AS fusion protein.5 % SDS-PAGE and stained with coomassie brilliant blue R-250. Ten micrograms of protein extracts prepared from IPTG-induced or uninduced E. . total protein of uninduced E. total protein (insoluble fraction) of IPTG-induced E. Lanes contain protein extracts as follows. The Ni-NTA-purified lysate containing the recombinant AS fusion protein stained with silver nitrate. coli BL21 DE3 pLys S (pRSET A-AS). B. lane 7. lane 6. total protein of IPTG-induced E. total protein (soluble fraction) of IPTG-induced E. lane 2. Lane 1. coli BL21 DE3 pLys S (pRSET A-AS). coli BL21 DE3 pLys S. coli BL21 DE3 pLys S (pRSET A).A 1 2 3 4 5 6 7 kDa 116 66 45 35 AS 87 kDa B 25 Fig. coli BL21 DE3 pLys S (pRSET A). SDS-PAGE of the over-expressed  AS recombinant protein. 1. Expression of recombinant His-tagged AS protein in E. A. lane 3. lane 5. coli BL21 DE3 pLys S cells containing pRSET A or pRSET A-AS were fractionated on 12. lane 4. Total protein of uninduced E. Protein marker.

Immuno blot analysis of r-bAS with α-bAS antibody from rabbit α-His α-bAS 0 0 40 :80 1: 1 0 60 :200 1 1 1: .

6 kb 1: uncut pET32b 2: pET32b/SalI-NotI 3: uncut bAS3-TA 4: bAS3TA/SalI-NotI 5: 1 kb Ladder .To amplify BAS1 from pRSETA and clone into pET32b vector (with thioredoxin tag) BAS3F: Sal I site CCGTCGACGCATGTGGAAGCTTAAGATAGCGG BAS3R:Not I site TTGCGGCCGCTTAGGTGCCTAGGGACGG 1 2 3 4 5 6 kb 2.4 kb 2.

Clone confirmation of bAS-pET32b 1 2 3 4 5 6 7 8 1 2 3 4 5 ~4.6kb+6.6 kb 1 2 3 4 5 6 7 8 9 10 11 1: uncut pET-bAS 2: pET-bAS/SacI 3: uncut pET32b 4: pET32b-SacI 5: 1 kb Ladder Expected SacI1.5 kb 1.8kb .

ginseng A.4-D (1 mg/l) +Kn (0.4-D (1 mg/l) +Kn (0. tumefaciens LBA 4404 [pBIN AR :: AS] for three days in dark Selection medium [MS semisolid + Cefotaxime (250 mg/l) + Kanamycin (100 mg/l)] thrice of 15 days incubation Transgenic calli [MS+2. tumefaciens LBA 4404 [pBIN AR ::  AS] construct RB 35 PRO AS NOS TER NOS PRO npt II NOS TER LB P.Agrobacterium-mediated transformation of  AS gene in P.1 mg/l)] In vitro shoot regeneration Somatic embryogenesis Transgenic plant .5 O. ginseng seeds In vitro plantlets Nodal explants Callus induced [MS+2.1 mg/l)] Kanamycin sensitivity test MS + Kan [25 – 200 mg/l] – 100 mg/l Co-cultivated with 0. culture of A.D.

ginsengplants to confirm the stable integration and the constitutive expression of β-AS gene. In vitro  -amyrin synthase assay and HPLC profiling.subcloning into pMAL vector (MBP fusions are generally cytosolic) .To be done… Molecular analysis of transformed P.subcloning into pBAD vector for tightly controlled expression b. To get bAS in the soluble fraction in E. coli a.

Matsushima et al .5) Column: Glass-ODS (4 rnm I.D. acetonitrile-water (27. B. acetonitrile-water (16.5 : 83.5). Flow-rate: 1. X 150 ram). Detection at 203 nm. Eluent: A.HPLC-chromatograms of a mixture of ginsenosides.0 ml/min.5 : 72. Y.

Detection at 203 nm. Y. X 150 mm).D. Flow-rate: 1.HPLC-chromatograms of a ginseng extract.5 : 72. acetonitrile-water (16 : 84) Column: Glass-ODS (4 mm I.5). B. Eluent: A. Matsushima et al .0 ml/min. acetonitrile-water (27.

Sign up to vote on this title
UsefulNot useful