Screening for

CONNEXIN 26 MUTATION
in hearing impaired families

External guide: Internal guide: Dr. C.R. SRIKUMARI SRISAILATHY Mr. R.Balachander M.Phil UGC Research Scientist – B Dept. of biotechnology Dept of Genetics Prathyusha Engg. College. Institute of Basic Medical Sciences (IBM Balaji. A Chennai

▪ Objective
Introduction Literature terials & Methods sult & Discussion Conclusion

Introduction

Hearing loss is a common sensory disorder in the human population. The incidence of congenital hearing loss is estimated at 1 in 1000 To births. for W24X, W77X, Q124X and 35delG mutations in screen connexin26 ( GJB2 gene) in hearing impaired families of Thiruvallur Dist. which appropriately equal numbers of case are attributed to Of environmental and genetic factors To compare with the general agrees these mutation with the trend in India. hearing disorder attributed to genetic causes, approximately The 70% are classified as nonsyndromic and remaining 30% as To syndromic. results for genetic counseling. analyze the Mutations in Connexin26 (encoded by GJB2 gene) have been established as a major cause(50%) of inherited non syndromic deafness in different populations.

Introduction

In India population, W24X is the major mutation(87% ) found in the GJB2 gene.


Introduction Literature terials & Methods connexin26 sult & Discussion Deafness Conclusion

Literature
Structure , location & function

»

Molecular Models for Connexin26 Topology

1. Gap junctions contain channels that connect neighboring cells.

Literature

2. They are relatively nonspecific, and the molecular movement through the channels occurs by passive diffusion. 3. 26 in connexin26 represents its molecular weight.


Introduction Literature

Literature
Mechanism of Hearing & Role Structure , location & function of Cx26 in it

»

connexin26 Deafness

terials & Methods sult & Discussion Conclusion

Expression of Cx26 in the epithelial network of cochlear cells involved in recycling of K+ ions between the fluids of inner ear (organ of corit). Any mutation in GJB2 gene (location 13q11) will interfere the recycling of K+ ions, which results in deafness.


Introduction Literature

Literature
Hair Cells Mechanism of Hearing & Role of Cx26 in it

»

connexin26 Deafness

terials & Methods sult & Discussion Conclusion

The most likely model for hair cell function proposes that deflection of the sterocilia pulls on fine links that join adjacent sterocilia at their tips. The tips link acts as a gating spring to open one or more transduction channels, allowing cations ( k+, Ca 2+ ) to flood into the cell and depolarize it.


Introduction Literature connexin26

Literature
Classification of Etiologies Recycling of k+ ions
Environmental
Ototoxic drugs Acoustic trauma Bacterial infections Viral infections

~50%

»

Deafness
Syndromic Alport Norrie Pendred Usher Waardenburg Branchio-Oto- Renal Jervell and Lange-Nielsen ~50%
30%

terials & Methods sult & Discussion Conclusion

Hearing Loss

Non-syndromic Genetic
~22% Autosomal Dominant

(DFNA1-DFNA54)
70% ~77% Autosomal Recessive

(DFNB1-DFNA67)
<1%

X-Linked (DFN1-DFN8) Mitochondrial

~1%


Introduction Literature connexin26

Literature
Non-syndromic Etiologies Classification ofhearing loss

»

Deafness

terials & Methods sult & Discussion Conclusion

Connexin26 ( GJB2 gene ) contribute to both autosomal dominant (Locus: DFNA3) and recessive ( Locus: DFNB1) nonsyndromic hearing loss.

Mutations in the Connexin 26 gene. Highlighted mutations are focused in this present study
Mutation name -3170G M1V 31del14 31del38 G12V Nucleotide change -3170G>A 1A→G del of 14 nt at 31 del of 38 nt at 31 35G→T Codon ---1 11-15 11-23 12 Amino acid change Splice site Met→Val Frameshift Frameshift Gly→Val Domain None IC1 IC1 IC1 IC1

35delG
35insG 51del 12insA S19T

del of G at 30-35
ins of G at 30-35 del of 12 nt at 52 56G→C

10-12
10-12 17-21 19

Frameshift
Frameshift Frameshift Ser→Thr

IC1
IC1 IC1 IC1

W24X
M34Ta V37Ib W44C W44X G45E E47X 167del T Q57X G59A 176-191del 16 Y65X D66H R75W W77R

71G→A
101T→C 109G→A 132G→C 132G→A 134G→A 139G→T del of T at 167 169C→T 176→G del of 16 nt at 176 195C→G 196G→C 223T→G 229T→C

24
34 37 44 44 45 47 56 57 59 59-64 65 66 75 77

Trp→Stop
Met→Thr Val→Ile Trp→Cys Trp→Stop Gly→Glu Glu→Stop Frameshift Gln→Stop Gly→Ala Frameshift Tyr→Stop Asp→His Arg→Trp Trp→Arg

TM1
TM1 TM1 EC1 EC1 EC1 EC1 EC1 EC1 EC1 EC1 EC1 EC1 EC1 TM2

W77X
235del C

231G→A
del of C at 233-235

77
78-79

Trp→Stop
Frameshift

TM2
TM2

Mutation name V84L L90P 269ins T V95M R98Q H100Yc 299-300del AT 314del 14d 333-334del AA S113R 358-360del GAGe K122I

Nucleotide change 250G→C 269T→C Ins of T at 269 283G→A 293G→A 298C→T del of AT at 299 del of 14 nt at 314 del of AA at 333-335 339→G del of GAG at 358 339T→G

Codon 84 90 90 95 98 100 100 104-110 111-112 113 120 122

Amino acid change Val→Leu Leu→Pro Frameshift Val→Met Arg→Gln His→Tyr Frameshift Frameshift Frameshift Ser→Arg Del of Glu 120 Lys→Ile

Domain TM2 TM2 TM2 IC2 IC2 IC2 IC2 IC2 IC2 IC2 IC2 IC2]

Q124X
R127H Y136X R143W 509insA P175T R184P S199F 631-632del GT

370C→T
380G→A 408C→A 427C→T ins of A at 509 523C→T 551G→C 596→T del of GT at 631-632

124
127 136 143 170 175 184 199 210

Gln→Stop
Arg→His Tyr→Stop Arg→Trp Frameshift Pro→Thr Arg→Pro Ser→Phe Frameshift

IC2
IC2 IC2 IC2 TM3 EC2 EC2 EC2 IC3

Diagrammatic representation of the Connexin 26 protein traversing the membrane. Mutations of Cx26 are also showed. Mutations in Red Colour are focused in this study


Introduction Literature terials & Methods connexin26 sult & Discussion Samples

Materials & Methods
Pedigrees
FAMILY CODE: ZTVR 139 FAMILY CODE: ZTVR 134 FAMILY CODE: ZTVR 136 FAMILY CODE: ZTVR 137
(50) (38) 136-1 (36) (83) 2 134-1 Total137-1 of families : 7 no. 5 (22) 139-1 (28) 136-2 (30) 134-2 2

»

Conclusion Isolation of DNA Samples Dissolving of DNA Screening W24X Screening W77X, Q124X & 35delG

(27) (20) (25) (23) 139- (5) 139139Total no. individuals : 30 139(10) (12) (8) 2 3 134-3 4 5 136-4 136-5 (blood collected) 3 136-3 3 2

2

Total no. of affected: 16
137-2 (32) (52) 135-1 (42) 84-1

FAMILY CODE: ZTVR FAMILY CODE: ZPON 84 135
137(27) 3 (40) 135-2 84-2 (38)

(57) (44) FAMILY CODE: ZTVR 138

1381 (22) (24) (20) (17) 137137137(17) (20) (15) 4 (8) 5 (6) (6) 6 84-4 84-5 (1/2) (8) 84-3 135-3 135-5 138-2 138-3

Materials & Methods


Introduction

Materials & Methods
Reagents Pedigrees Protocol

1. 5-10 ml of peripheral blood was collected in a vacutainer tube containing 1 liquidlysis buffer wasAmmonium Chloridemin at ,3000 rpm. RBC EDTA and : centrifuged for 25 7 g/l Ammonium Literature 2. The supernatant was bicarbonate 70 mg/l buffy coat was transferred into a discarded and the terials & Methods 2 sterile 50 ml conical 1M Tris, 0.5M EDTA, and 10% SDS, pH Cell Lysis buffer : centrifuge tube. Final volume was brought to 50 ml 8.2. using RBC lysis buffer. Samples 5M Ammonium : 19. 27 mg/50 ml. 3.3 Blood with RBC lysis buffer was placed on ice (4°C) for 30 mins and was acetate inverted for every 10min. » Isolation of DNA TE buffer : 10 at 3500 and mM EDTA, pH 8.0. 4.4 This was spinned down mM Tris rpm1for 10 min at 4°C and the supernatant Dissolving of DNA was discarded. The step was repeated until WBC’s pelleted without RBC’s. 5. The WBC pellet was then suspended in 5 ml of cell lysis buffer and was Screening W24X mechanically sheared to break the clumps. This was done until the DNA Screening W77X, released from WBC which was indicated by viscosity of the solution. Q124X & 35delG 6. 2.5 ml of 5M ammonium acetate was added to the solution and the tube was inverted for 5 min to precipitate proteins out of the solution. sult & Discussion 7. This was centrifuged at 3500 rpm for 10 min at 4°C and the supernatant was carefully transferred to 15 ml conical tube containing 5 ml of isopropanol. Conclusion 8. The tube was gently inverted, until the solution losses its high viscosity, to precipitate DNA. The pellet was then transferred to a 1.5 ml micro centrifuge tube containing 70% ethanol, spinned down and dissolved in TE


Introduction

Materials & Methods
Protocol

Cottony mass of DNA stored in 70 % EtOH at the end of DNA isolation ↓ ↓ Literature Vortex Vortex terials & Methods ↓ ↓ Cf. at 13000 rpm for min Centrifuged at 13000 rpm2for 2 min Samples ↓ ↓ Discard the supernatant Supernatant discarded Isolation of DNA ↓ ↓ Dry the pellet To the pellet 70% of alcohol ( 200 µl) added » Dissolving of DNA ↓ ↓ Add TE* Vortex Screening W24X ↓ ↓o Incubate 1 hr at 65 C for 2 min Screening W77X, Cf. at 13000 rpm ( water bath) Q124X & 35delG ↓ ↓o Incubate at 37supernatanthrs Discard the C2 for 2-3 sult & Discussion ↓ To the pellet, add 200 µl of 100% EtOH Conclusion ↓


Introduction Literature terials & Methods Samples Isolation of DNA Dissolving of DNA

Materials & Methods
Overview PCR conditions Protocol
: 2.0 µl : 2 mM : 200 µM :2.5 pmol : 2.5 pmol Amplification of Exon2 of GJB2 gene ( chr. 13q11 ) using PCR : 0.5 U : 50-100 ng

10X PCR buffer MgCl2 dNTPs Primer Genomic DNA forward Reverse Taq polymerase Template DNA
Primer sequences: bp) Exon2 (286 Primer type Primer Sequence

»

Screening W24X Screening W77X, Q124X & 35delG

Alu I restriction enzyme

Amplico n length

PCR Cycles
AG CT TC GA

GG CT Forward Wild type 5’-TCT CC GA

Reverse sult & Discussion Conclusion

TTT CCA GAG CAA ACC GC-3’ 5’-GAC ACG AAG ATC AGC TGC AGG-3’

W24X 286 mutant 30

( 286 bp) Mutation W24X Initial Denaturation 95°C-5min Denaturation 95°C-40 sec Annealing 65°C-40sec Extension ( 184 & 102bp) 72°C-30sec Final Extension 72°C-2min

▪ PCR conditions ▪ RFLP
Introduction Literature terials & Methods Samples Isolation of DNA Dissolving of DNA

Materials & Methods

The PCR product was digested in a 10µl reaction volume which consist of 2.0µl of 10X buffer, 2.5 U of Alu I restriction enzyme. The reaction volume was incubated at 37oC for 16 hours.

»

Screening W24X Screening W77X, Q124X & 35delG

sult & Discussion Conclusion

▪ Primer sequences ▪ PCR conditions ▪ Overview RFLP
Introduction Literature terials & Methods Samples Isolation of DNA Dissolving of DNA Screening W24X

Materials & Methods

10X PCR buffer Allele Specific Oligonucleotide : Polymerase Chain Reaction [ASO-PCR] - 2.0 µl MgCl2 : 2.5 mM dNTPs : 200 µM Primer Genomic Effect Mutation DNA Primer Sequence forward :0.4 µmol Reverse Nor 5’- TACTTCCCCATCTCCCACATCCGGCTATTG-3’ : 0.4 µmol G-to-A W77X bp 231 polymerase Mut 5’-TACTTCCCCATCTCCCACATCCGGCTATTA-3’ Taq : 0.5 U Com 5’- GATGACCCGGAAGAAGATGCTGCTTGTGTA- 3’ Amplification of Exon1 Template DNA : 50-100 ng of GJB2 gene ( chr. 13q12 ) using ASO-PCR
G deletion bp 35 35delG

Amplicon length 234 bp

PCR Cycles 30

Nor 5’-TTGGGGCACGCTGCAGACGATCCTGGGGAG-3’ Mut 5’- TTGGGGCACGCTGCAGACGATCCTGGGGAT -3’ Com 5’- GAAGTAGTGATCGTAGCACACGTTCTTGCA-3’

202 bp

30

»

Screening W77X, Q124X & 35delG

Normal + common primer

C-to-T Q124X Nor Mutation Initial 5’-GAATTTAAGGACATCGAGGAGATCAAAACAC-3’ Denaturation Annealing Extension bp 370 Mut 5’-GAATTTAAGGACATCGAGGAGATCAAAACAT-3’ Mutant + common Denaturation Com 5’ GACACAAAGCAGTCCACAGTGTTGGGACAA–3’ primer

210 bp

30 Final Extension

W77X

95°C-5min 95°C-5min
Amplification for wild type only

95°C-40sec 95°C-40sec
the mutation is present

66°C-30sec 66°C-30sec

72°C-30sec 72°C-30sec 72°C-30sec

72°C-3min 72°C-3min 72°C-3min

Q124X sult & Discussion Conclusion 35delG

95°C-5min

95°C-40sec if 66°C-30sec Amplification


Introduction Literature terials & Methods sult & Discussion Conclusion

Result & Discussion
Gel Photos

Gel photograph showing mutational status of individuals belonging to family ZPON84.

ZPON84-1

ZPON84-2

ZPON84-3

ZPON84-4

ZPON84-5

286 bp 184 bp 102 bp

HET

HET

Result & Discussion
L HOMO HOMO NOR

L HET NOR

- 100 bp LADDER -HETEROZYGOUS - NORMAL

HOMO -HOMOZYGOUS

Conclusion
Introduction Literature terials & Methods sult & Discussion Conclusion

Phenotype – Genotype Correlation of ZPON84 Family
S .No. 1 2 3 4 5 Genotype Family ID ZPON84-1 ZPON84-2 ZPON84-3 ZPON84-4 ZPON84-5 Age/gender 52/M 40/F 20/M 17/M 15/F Phenotype W24X Normal Normal Bilateral profound Bilateral Profound Normal Heterozygous Heterozygous Homozygous Mutant Homozygous Mutant Normal W77X 35delG Q124X -

Among the remaining six families (ZTVR134, ZTVR135, ZTVR136, ZTVR137, ZTVR138 and ZTVR139) all the affected screened in the first phase tested negative for all the four common mutations screened. Figure 4.5 shows absence of W24X in these families. Hence the family members were not further tested. Screening for other known mutations would explain their etiology.

Conclusion

THANK
I Profusely Thank All The Probands And Family Members Who Participated In This Study And Made This Work A Reality

YOU