You are on page 1of 19

Screening for

CONNEXIN 26
MUTATION
in hearing impaired
families
External
Internalguide:
guide:
Dr.
Mr.
C.R.
R.Balachander
SRIKUMARI SRISAILATHY
M.Phil
UGC
Dept.
Research
of biotechnology
Scientist – B
Dept
Prathyusha
of Genetics
Engg. College.
Institute of Basic Medical Sciences (IBM
Balaji. A
Chennai
Introduction
▪ Objective
Introduction

Literature
Hearing loss is a common sensory disorder in the human population.
The incidence of congenital hearing loss is estimated at 1 in 1000
aterials & Methods To births.
screen for W24X, W77X, Q124X and 35delG mutations in
esult & Discussion connexin26 ( GJB2 gene) in hearing impaired families of Thiruvallur
Dist.
Of which appropriately equal numbers of case are attributed to
Conclusion
environmental and genetic factors
To compare with the general agrees these mutation with the trend in
India.
The hearing disorder attributed to genetic causes, approximately
70% are classified as nonsyndromic and remaining 30% as
To syndromic.
analyze the results for genetic counseling.

Mutations in Connexin26 (encoded by GJB2 gene) have been


established as a major cause(50%) of inherited non syndromic
deafness in different populations.
Introduction
In India population, W24X is the major mutation(87% ) found in the
GJB2 gene.
Literature
▪ Structure , location & function
Introduction

Literature

aterials & Methods


» connexin26
esult & Discussion
Deafness
Conclusion

Molecular Models for Connexin26


Topology

1. Gap junctions contain channels that connect neighboring


cells. Literature
2. They are relatively nonspecific, and the molecular
movement through the channels occurs by passive diffusion.
3. 26 in connexin26 represents its molecular weight.
Literature
▪ Structure , location
Mechanism of Hearing
& function
& Role of Cx26 in it
Introduction

Literature

» connexin26

Deafness

aterials & Methods

esult & Discussion

Conclusion Expression of Cx26 in the epithelial network of cochlear cells involved in


recycling of K+ ions between the fluids of inner ear (organ of corit).

Any mutation in GJB2 gene (location 13q11) will interfere the recycling of
K+ ions, which results in deafness.
Literature
▪ Mechanism
Hair Cells of Hearing & Role of Cx26 in it
Introduction

Literature

» connexin26

Deafness

aterials & Methods

esult & Discussion

Conclusion

The most likely model for hair cell function proposes


that deflection of the sterocilia pulls on fine links that
join adjacent sterocilia at their tips.

The tips link acts as a gating spring to open one or


more transduction channels, allowing cations ( k+, Ca
2+
) to flood into the cell and depolarize it.
Literature
▪ Recycling of k+
Classification of ions
Etiologies
Introduction
Environmental
Literature
Ototoxic drugs
Acoustic trauma
connexin26 ~50% Bacterial infections
Viral infections

» Deafness

Syndromic
Hearing Loss
aterials & Methods Alport Norrie
Pendred Usher
esult & Discussion Waardenburg
Branchio-Oto- Renal
Conclusion Jervell and Lange-Nielsen
~50% 30%

Non-syndromic
Genetic ~22% Autosomal Dominant
(DFNA1-DFNA54)

70% ~77% Autosomal Recessive


(DFNB1-DFNA67)
<1%
X-Linked
(DFN1-DFN8)
~1%
Mitochondrial
Literature
▪ Classification ofhearing
Non-syndromic Etiologies
loss
Introduction

Literature

connexin26

» Deafness

Connexin26 ( GJB2 gene ) contribute to both autosomal dominant


aterials & Methods (Locus: DFNA3) and recessive ( Locus: DFNB1) nonsyndromic
esult & Discussion hearing loss.
Conclusion
Mutations in the Connexin 26 gene. Highlighted mutations are focused in this present study
Mutation name Nucleotide change Codon Amino acid change Domain

-3170G -3170G>A ---- Splice site None


M1V 1A→G 1 Met→Val IC1
31del14 del of 14 nt at 31 11-15 Frameshift IC1
31del38 del of 38 nt at 31 11-23 Frameshift IC1
G12V 35G→T 12 Gly→Val IC1

35delG del of G at 30-35 10-12 Frameshift IC1


35insG ins of G at 30-35 10-12 Frameshift IC1
51del 12insA del of 12 nt at 52 17-21 Frameshift IC1
S19T 56G→C 19 Ser→Thr IC1

W24X 71G→A 24 Trp→Stop TM1


M34Ta 101T→C 34 Met→Thr TM1
V37Ib 109G→A 37 Val→Ile TM1
W44C 132G→C 44 Trp→Cys EC1
W44X 132G→A 44 Trp→Stop EC1
G45E 134G→A 45 Gly→Glu EC1
E47X 139G→T 47 Glu→Stop EC1
167del T del of T at 167 56 Frameshift EC1
Q57X 169C→T 57 Gln→Stop EC1
G59A 176→G 59 Gly→Ala EC1

176-191del 16 del of 16 nt at 176 59-64 Frameshift EC1


Y65X 195C→G 65 Tyr→Stop EC1
D66H 196G→C 66 Asp→His EC1
R75W 223T→G 75 Arg→Trp EC1
W77R 229T→C 77 Trp→Arg TM2

W77X 231G→A 77 Trp→Stop TM2


235del C del of C at 233-235 78-79 Frameshift TM2
Mutation name Nucleotide change Codon Amino acid change Domain
V84L 250G→C 84 Val→Leu TM2
L90P 269T→C 90 Leu→Pro TM2
269ins T Ins of T at 269 90 Frameshift TM2
V95M 283G→A 95 Val→Met IC2
R98Q 293G→A 98 Arg→Gln IC2
H100Yc 298C→T 100 His→Tyr IC2
299-300del AT del of AT at 299 100 Frameshift IC2
314del 14d del of 14 nt at 314 104-110 Frameshift IC2
333-334del AA del of AA at 333-335 111-112 Frameshift IC2
S113R 339→G 113 Ser→Arg IC2
358-360del GAGe del of GAG at 358 120 Del of Glu 120 IC2
K122I 339T→G 122 Lys→Ile IC2]

Q124X 370C→T 124 Gln→Stop IC2


R127H 380G→A 127 Arg→His IC2
Y136X 408C→A 136 Tyr→Stop IC2
R143W 427C→T 143 Arg→Trp IC2
509insA ins of A at 509 170 Frameshift TM3
P175T 523C→T 175 Pro→Thr EC2
R184P 551G→C 184 Arg→Pro EC2
S199F 596→T 199 Ser→Phe EC2
631-632del GT del of GT at 631-632 210 Frameshift IC3
Diagrammatic representation of the Connexin 26 protein traversing the membrane. Mutations of
Cx26 are also showed. Mutations in Red Colour are focused in this study
Materials & Methods
▪ Pedigrees
FAMILY CODE:
FAMILY ZTVR
CODE: 139134
ZTVR
Introduction
FAMILY CODE: ZTVR 136
FAMILY CODE: ZTVR 137
Literature (50)

aterials & Methods 139-1


(38)
connexin26 (28)

»
esult & Discussion
Samples 5 (83) (36)
136-1
2
136-2 (30)
2
134-1 134-2
Conclusion Total137-1
no. of families : 7
Isolation of DNA
(22) (27) (23) (20) (25)
Samples Total no.(12)
individuals
139- (5) : 30 139-
139-
(10) 139-
(8)
Dissolving of DNA 2 3 134-3 4 5
(blood
2
collected)
3 136-3 136-4 136-53 2
FAMILY
FAMILY CODE:
CODE: ZTVR
ZPON 84 135
Screening W24X
Total no. of affected: 16
FAMILY
(57) CODE: ZTVR 138
(44)
Screening W77X, 137-2 137-
Q124X & 35delG (32) 3 (27)
(52) 135-1 (40)
135-2

Materials & Methods


(42) 84-1
138-
84-2 (38)

1
(24) (22) (20) (17)
137- 137- 137-
(20) (17) (15)
(6) 4 (8) 5 (6) 6
(8) 84-3 84-4 84-5 (1/2)
135-3 135-5
138-2 138-3
Materials & Methods
▪ Protocol
Pedigrees
Reagents
Introduction 1. 5-10 ml of peripheral blood was collected in a vacutainer tube containing
Literature 1 liquid EDTA
RBC lysis and was
buffer centrifugedChloride
: Ammonium for 25 min
7 g/lat ,3000 rpm.
Ammonium
2. The supernatant was bicarbonate
discarded 70 andmg/l
the buffy coat was transferred into a
aterials & Methods
2 sterile 50 ml
Cell Lysis conical
buffer : 1M centrifuge tube.
Tris, 0.5M Finalandvolume
EDTA, waspH
10% SDS, brought to 50 ml
Samples using RBC lysis buffer. 8.2.
3.3 Blood with RBC lysis
5M Ammonium : 19.buffer was placed
27 mg/50 ml. on ice (4°C) for 30 mins and was
» Isolation of DNA acetate for every 10min.
inverted
4.4 This
TE buffer : 10 mM
was spinned down Tris rpm
at 3500 and 1for
mM 10EDTA,
min atpH4°C8.0.and the supernatant
Dissolving of DNA
was discarded. The step was repeated until WBC’s pelleted without RBC’s.
5. The WBC pellet was then suspended in 5 ml of cell lysis buffer and was
Screening W24X
mechanically sheared to break the clumps. This was done until the DNA
Screening W77X, released from WBC which was indicated by viscosity of the solution.
Q124X & 35delG 6. 2.5 ml of 5M ammonium acetate was added to the solution and the tube was
inverted for 5 min to precipitate proteins out of the solution.
esult & Discussion 7. This was centrifuged at 3500 rpm for 10 min at 4°C and the supernatant was

Conclusion carefully transferred to 15 ml conical tube containing 5 ml of isopropanol.


8. The tube was gently inverted, until the solution losses its high viscosity, to
precipitate DNA. The pellet was then transferred to a 1.5 ml micro
centrifuge tube containing 70% ethanol, spinned down and dissolved in TE
Materials & Methods
▪ Protocol
Introduction Cottony mass of DNA stored in 70 % EtOH at the end of DNA isolation
Literature ↓↓
Vortex
Vortex
aterials & Methods
↓↓
Cf. at 13000
Centrifuged at 13000rpm rpm
for 2for
min2 min
Samples
↓↓
Discard the supernatant
Supernatant discarded
Isolation of DNA
↓↓
Dryofthe pellet( 200 µl) added
» Dissolving of DNA To the pellet 70% alcohol
↓↓
Screening W24X
Add
VortexTE*
↓↓ o
Screening W77X, Incubate
Cf. at113000
hr at 65
rpmC for
( water
2 minbath)
↓↓o
Q124X & 35delG
Incubate
Discardatthe
37supernatant
C2 for 2-3 hrs
esult & Discussion ↓
Conclusion To the pellet, add 200 µl of 100% EtOH

Materials & Methods
▪ Protocol
PCR
Overview
conditions
Introduction 10X PCR buffer : 2.0 µl
MgCl2 : 2 mM
Literature
dNTPs : 200 µM
aterials & Methods Primer
Genomic DNA
forward :2.5 pmol
Samples
Reverse : 2.5 pmol
Taq polymerase : 0.5 U Amplification of Exon2 of GJB2 gene ( chr. 13q11 ) using PCR
Isolation of DNA
Template DNA : 50-100 ng
Dissolving of DNA
Primer sequences:
Exon2 (286 bp)

» Screening W24X
Primer Primer Sequence
Alu I restriction
Amplico PCR
type enzyme n length Cycles
Screening W77X,
Q124X & 35delG GG CT AG CT
Wild type W24X mutant
Forward
CC GA 5’-TCTTTT CCA GAG CAA ACC GC-3’ 286 30 TC GA
Reverse 5’-GAC ACG AAG ATC AGC TGC AGG-3’
esult & Discussion
( 286 bp)
Conclusion
Mutation Initial Denaturation Annealing Extension Final Extension
Denaturation
( 184 & 102bp)
W24X 95°C-5min 95°C-40 sec 65°C-40sec 72°C-30sec 72°C-2min
Materials & Methods
▪▪ PCR
RFLPconditions
Introduction

Literature

aterials & Methods The PCR product was digested in a 10µl reaction volume which
Samples consist of 2.0µl of 10X buffer, 2.5 U of Alu I restriction enzyme.

Isolation of DNA
The reaction volume was incubated at 37oC for 16 hours.

Dissolving of DNA

» Screening W24X

Screening W77X,
Q124X & 35delG

esult & Discussion

Conclusion
Materials & Methods
▪▪▪PCR
Primer
Overview
RFLP sequences
conditions
Introduction

Literature
10X PCR
Allele buffer
Specific Oligonucleotide :- Polymerase
2.0 µl Chain Reaction [ASO-PCR]
MgCl2 : 2.5 mM
aterials & Methods dNTPs : 200 µM
Primer
Samples Genomic DNA
Mutation Effect Primer Sequence Amplicon PCR
forward :0.4 µmol length Cycles

Isolation of DNA
Reverse
G-to-A W77X Nor : 0.4 µmol
5’- TACTTCCCCATCTCCCACATCCGGCTATTG-3’ 234 bp 30
Taq
bp 231 polymerase Mut : 0.5 U
5’-TACTTCCCCATCTCCCACATCCGGCTATTA-3’
Com 5’- GATGACCCGGAAGAAGATGCTGCTTGTGTA- 3’
Dissolving of DNA
Template DNA : 50-100
Amplificationng
of Exon1 of GJB2 gene ( chr. 13q12 )
G 35delG Nor 5’-TTGGGGCACGCTGCAGACGATCCTGGGGAG-3’
using ASO-PCR 202 bp 30
deletion Mut 5’- TTGGGGCACGCTGCAGACGATCCTGGGGAT -3’
bp 35 Com 5’- GAAGTAGTGATCGTAGCACACGTTCTTGCA-3’
Screening W24X
C-to-T
MutationQ124X
bp 370
InitialNor 5’-GAATTTAAGGACATCGAGGAGATCAAAACAC-3’
Denaturation Annealing Extension
Mut 5’-GAATTTAAGGACATCGAGGAGATCAAAACAT-3’
210 bp
Final 30

»
Mutant + common
Screening W77X, Denaturation
Com 5’ GACACAAAGCAGTCCACAGTGTTGGGACAA–3’
primer
Extension
Normal + common
Q124X & 35delG W77X
primer
95°C-5min 95°C-40sec 66°C-30sec 72°C-30sec 72°C-3min

Q124X 95°C-5min 95°C-40sec 66°C-30sec 72°C-30sec 72°C-3min


esult & Discussion 35delG 95°C-5min 95°C-40sec 66°C-30sec 72°C-30sec 72°C-3min
Amplification for Amplification if
wild type only the mutation is
Conclusion present
Result & Discussion
▪ Gel Photos
Gel photograph showing mutational status of individuals belonging to family ZPON84.
Introduction

Literature

aterials & Methods


ZPON84-1 ZPON84-2

esult & Discussion

Conclusion
ZPON84-3 ZPON84-4 ZPON84-5

286 bp
184 bp
102 bp

HET HET
Result & Discussion
L HOMO HOMO NOR

L - 100 bp LADDER
HET -HETEROZYGOUS
HOMO -HOMOZYGOUS
NOR - NORMAL
Conclusion

Introduction
Phenotype – Genotype Correlation of ZPON84 Family
Literature
Genotype
aterials & Methods S
Family ID Age/gender Phenotype
.No.
esult & Discussion W24X W77X 35delG Q124X
1 ZPON84-1 52/M Normal Heterozygous - - -
Conclusion
2 ZPON84-2 40/F Normal Heterozygous - - -
Bilateral Homozygous
3 ZPON84-3 20/M - - -
profound Mutant
Bilateral Homozygous
4 ZPON84-4 17/M - - -
Profound Mutant
5 ZPON84-5 15/F Normal Normal - - -

Among the remaining six families (ZTVR134, ZTVR135, ZTVR136,


Conclusion
ZTVR137, ZTVR138 and ZTVR139) all the affected screened in the first
phase tested negative for all the four common mutations screened. Figure
4.5 shows absence of W24X in these families. Hence the family
members were not further tested. Screening for other known mutations
would explain their etiology.
THANK
YOU
I Profusely Thank All The Probands And Family Members
Who Participated In This Study And Made This Work A Reality